Production of RNA polynucleotide encoding picornavirus

JP2025516241A5Pending Publication Date: 2026-06-05ELEVATEBIO MANAGEMENT INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
ELEVATEBIO MANAGEMENT INC
Filing Date
2023-04-28
Publication Date
2026-06-05

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure relates to the use of ribozymes to produce recombinant RNA molecules encoding oncolytic viral genomes, such as picornaviruses, in conjunction with the native 5' end of the viral genome. The disclosure further relates to the design of corresponding DNA templates and the use of the recombinant RNA molecules and / or corresponding particles for the treatment and prevention of cancer. In one aspect, the present disclosure provides a recombinant DNA molecule comprising, from 5' to 3', a promoter sequence, a 5' junction cleavage sequence, and a polynucleotide sequence encoding an RNA molecule comprising a synthetic RNA viral genome, wherein the 5' junction cleavage sequence comprises or consists of an ENV27 ribozyme coding sequence.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 336,601, filed April 29, 2022, the contents of which are incorporated by reference in their entirety herein.

[0002] Incorporating electronically submitted text files The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety. A computer-readable copy of the sequence listing (Filename: ONCR_031_01WO_SeqList_ST26.xml, Created: April 28, 2023, File Size: 510,929 bytes).

[0003] The present disclosure generally relates to the fields of immunology, inflammation, and cancer therapy. More specifically, the present disclosure relates to the production of RNA polynucleotides encoding viral genomes of oncolytic viruses, such as picornaviruses (e.g., coxsackieviruses), and the design of recombinant DNA molecules for the expression of such viral genomes. The present disclosure further relates to the treatment and prevention of proliferative disorders, such as cancer. [Background technology]

[0004] Oncolytic viruses are replicable viruses with a lytic life cycle that can infect and lyse tumor cells. Direct tumor cell lysis not only leads to cell death, but also to the development of innate and adaptive immune responses against tumor antigens that are taken up and presented by local antigen-presenting cells. Thus, oncolytic viruses combat tumor cell growth by both direct cell lysis and by promoting antigen-specific adaptive responses that can sustain antitumor responses after viral clearance.

[0005] However, the clinical use of replication-competent viruses poses several challenges. In general, viral exposure activates innate immune pathways, resulting in a widespread non-specific inflammatory response. If the patient has not been previously exposed to the virus, this initial innate immune response may lead to the development of an adaptive antiviral response and the production of neutralizing antibodies. If the patient has been previously exposed to the virus, pre-existing neutralizing antiviral antibodies may prevent the desired lytic effect. In either case, the presence of neutralizing antibodies not only prevents viral lysis of target cells, but also renders re-administration of the viral therapeutic ineffective. These factors limit the use of viral therapeutics in the treatment of metastatic cancers, because the effectiveness of the repeated systemic administration required to treat such cancers is hindered by the naturally occurring antiviral response.

[0006] One strategy to overcome such challenges is to use artificial particles (e.g., lipid nanoparticles) rather than natural viral particles to deliver polynucleotides encoding viral genomes to target cells. The production of these artificial particles typically requires in vitro production and packaging of recombinant polynucleotides encoding viral genomes, which must be capable of efficiently producing viral RNA upon introduction into cells. However, many viral genomes (e.g., genomes of various picornaviruses) require the native 5' and / or 3' ends of the viral genome to replicate efficiently. Moreover, there remains a long-standing unmet need in the art for compositions and methods related to in vitro production of recombinant polynucleotides containing the native 5' and / or 3' ends of the corresponding viral genome. The present disclosure provides such compositions and methods, and others. Summary of the Invention

[0007] In one aspect, the disclosure provides a recombinant DNA molecule comprising, from 5' to 3', a promoter sequence, a 5' junction cleavage sequence, and a polynucleotide sequence encoding an RNA molecule comprising a synthetic RNA viral genome, wherein the 5' junction cleavage sequence comprises or consists of an ENV27 ribozyme coding sequence.

[0008] In one aspect, the disclosure provides a recombinant DNA molecule comprising, from 5' to 3', a promoter sequence, a 5' junction cleavage sequence, a polynucleotide sequence encoding an RNA molecule comprising a synthetic RNA viral genome, a polyA tail, and a 3' junction cleavage sequence, wherein the 5' junction cleavage sequence comprises or consists of an ENV27 ribozyme coding sequence.

[0009] In some embodiments, the ENV27 ribozyme coding sequence comprises or consists of a polynucleotide sequence (excluding the P3 stem insert) having at least 80% identity to SEQ ID NO:132 (excluding its P3 stem insert corresponding to nucleotides 49-54 of SEQ ID NO:132). In some embodiments, the polynucleotide sequence (excluding the P3 stem insert) is 100% identical or has at most 1, at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, or at most 11 mutations (insertions, deletions, or substitutions) compared to SEQ ID NO:132 (excluding its P3 stem insert corresponding to nucleotides 49-54 of SEQ ID NO:132). In some embodiments, the mutation(s) are substitution(s). In some embodiments, the ENV27 ribozyme coding sequence comprises the polynucleotide "TTTATT" or "TTTGTT" at a position corresponding to nucleotides 25-30 of SEQ ID NO:132. In some embodiments, the ENV27 ribozyme coding sequence comprises the polynucleotide "TTTATT" at a position corresponding to nucleotides 25-30 of SEQ ID NO:132. In some embodiments, the ENV27 ribozyme coding sequence comprises a P3 stem insert that is about 1-30, about 1-20, about 6-20, or about 6-10 polynucleotides in length. In some embodiments, the P3 stem insert is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 polynucleotides in length. In some embodiments, the P3 stem insert is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 polynucleotides in length. In some embodiments, the P3 stem insert comprises or consists of the polynucleotide "AGATCT" in the region corresponding to nucleotides 49-54 of SEQ ID NO: 132. In some embodiments, the P3 stem insert comprises or consists of the polynucleotide "AGAGAAATCT" (SEQ ID NO: 137) in the region corresponding to nucleotides 49-54 of SEQ ID NO: 132.In some embodiments, the P3 stem insert comprises or consists of the polynucleotide "AGAACGAGAAATCGTTCT" (SEQ ID NO:138) in the region corresponding to nucleotides 49-54 of SEQ ID NO:132.

[0010] In some embodiments, the recombinant DNA molecule comprises, from 5' to 3', a promoter sequence, a 5' junction cleavage sequence, a polynucleotide sequence encoding an RNA molecule comprising a synthetic RNA viral genome, and a poly A tail.

[0011] In some embodiments, the recombinant DNA molecule comprises, from 5' to 3', a promoter sequence, a 5' junction cleavage sequence, a polynucleotide sequence encoding an RNA molecule comprising a synthetic RNA viral genome, and a 3' junction cleavage sequence.

[0012] In some embodiments, the recombinant DNA molecule comprises, from 5' to 3', a promoter sequence, a 5' junction cleavage sequence, a polynucleotide sequence encoding an RNA molecule comprising a synthetic RNA viral genome, a polyA tail, and a 3' junction cleavage sequence.

[0013] In some embodiments, the synthetic RNA virus genome encodes a picornavirus. In some embodiments, the picornavirus is a Coxsackievirus. In some embodiments, the 5' end of the RNA virus genome begins with "UUAAA". In some embodiments, the Coxsackievirus is a CVA21 strain. In some embodiments, the CVA21 strain is selected from a Kuykendall strain, an EF strain, and a KY strain. In some embodiments, the 5' end of the RNA virus genome comprises or consists of a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to nucleotides 1-260 of any one of SEQ ID NOs: 1, 5, or 9.

[0014] In some embodiments, the recombinant DNA molecule does not contain additional nucleic acid between the 5' junction cleavage sequence and the polynucleotide sequence encoding the RNA molecule. In some embodiments, cleavage of the 5' junction cleavage sequence and / or the 3' junction cleavage sequence generates the natural 5' and / or 3' end of the synthetic RNA viral genome after transcription.

[0015] In some embodiments, the recombinant DNA molecule of the present disclosure further comprises a leader sequence between the promoter sequence and the 5' junction cleavage sequence. In some embodiments, the leader sequence is less than 100 bp, less than 90 bp, less than 80 bp, less than 70 bp, less than 60 bp, less than 50 bp, or less than 40 bp in length. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 135 or 136. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence having at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 135.

[0016] In some embodiments, the recombinant DNA molecule does not comprise any additional nucleic acid between the promoter sequence and the leader sequence. In some embodiments, the recombinant DNA molecule does not comprise any additional nucleic acid between the leader sequence and the 5' junction cleavage sequence.

[0017] In some embodiments, the promoter sequence is a T7 promoter sequence. In some embodiments, the T7 promoter sequence comprises or consists of SEQ ID NO:91.

[0018] In some embodiments, the polyA tail is about 50-90 bp in length, or about 65-75 bp in length. In some embodiments, the polyA tail is about 70 bp in length. In some embodiments, the polyA tail is about 10-50 bp, or about 25-35 bp in length.

[0019] In some embodiments, the 3' junction cleavage sequence comprises or consists of a ribozyme sequence. In some embodiments, the 3' ribozyme sequence is a Hepatitis Delta virus ribozyme sequence.

[0020] In some embodiments, the 3' junction cleavage sequence comprises or consists of a restriction enzyme recognition sequence. In some embodiments, the 3' junction cleavage sequence comprises or consists of a type IIS restriction enzyme recognition sequence. In some embodiments, the 3' junction cleavage sequence comprises or consists of a BsmBI recognition sequence. In some embodiments, the 3' junction cleavage sequence comprises or consists of a BsaI recognition sequence.

[0021] In some embodiments, the promoter sequence is a T7 promoter sequence, the leader sequence consists of a polynucleotide sequence according to SEQ ID NO: 135, the 5' junction cleavage sequence comprises or consists of an ENV27 ribozyme sequence according to any one of SEQ ID NOs: 132-134, the polyA tail is about 70 bp in length, and the 3' junction cleavage sequence comprises or consists of a BsmBI recognition sequence.

[0022] In some embodiments, the promoter sequence is a T7 promoter sequence, the leader sequence consists of a polynucleotide sequence according to SEQ ID NO: 135, the 5' junction cleavage sequence comprises or consists of an ENV27 ribozyme sequence according to any one of SEQ ID NOs: 132-134, the polyA tail is about 70 bp in length, and the 3' junction cleavage sequence comprises or consists of a BsaI recognition sequence.

[0023] In some embodiments, the recombinant DNA molecule does not contain additional nucleic acid in the region spanning the promoter sequence and the 3' junction cleavage sequence.

[0024] In one aspect, the disclosure provides a method for producing a recombinant RNA molecule, the method comprising in vitro transcription of a recombinant DNA molecule of the disclosure, and purification of the resulting recombinant RNA molecule, in some embodiments, the recombinant RNA molecule comprises the 5' and 3' ends that are naturally present in the viral genome encoded by the recombinant RNA molecule.

[0025] In one aspect, the disclosure provides recombinant RNA molecules transcribed from a recombinant DNA molecule of the disclosure. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% of the recombinant RNA molecules comprise 5' and 3' ends that are originally present in the viral genome encoded by the recombinant RNA molecule. In some embodiments, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5%, or no more than 0.1% of the recombinant RNA molecules comprise an RNA sequence encoded by an ENV27 ribozyme coding sequence. In some embodiments, at least one of the recombinant RNA molecules comprises an RNA sequence encoded by an ENV27 ribozyme coding sequence. In some embodiments, at least 0.0001%, at least 0.001%, at least 0.01%, at least 0.1%, or at least 1% of the recombinant RNA molecules comprise an RNA sequence encoded by an ENV27 ribozyme coding sequence.

[0026] In one aspect, the disclosure provides a composition comprising an effective amount of a recombinant RNA molecule of the disclosure and a carrier suitable for administration to a mammalian subject.

[0027] In one aspect, the present disclosure provides a particle comprising a recombinant RNA molecule of the present disclosure. In some embodiments, the particle is selected from the group consisting of a nanoparticle, an exosome, a liposome, and a lipoplex. In some embodiments, the particle is a lipid nanoparticle.

[0028] In one aspect, the present disclosure provides a pharmaceutical composition comprising a plurality of particles of the present disclosure. In some embodiments, delivery of the composition to a subject delivers the encapsulated recombinant RNA molecule to a target cell, and the encapsulated recombinant RNA molecule produces an infectious virus capable of lysing the target cell.

[0029] In one aspect, the present disclosure provides a method of killing cancerous cells, comprising exposing cancerous cells to a particle of the present disclosure, or a composition thereof, under conditions sufficient for intracellular delivery of the particle to the cancerous cells, where the replication-competent virus produced by the encapsulated polynucleotide results in the killing of the cancerous cells. In one aspect, the present disclosure provides a method of treating cancer in a subject, comprising administering to a subject suffering from cancer an effective amount of a particle of the present disclosure, or a composition thereof. In some embodiments, the method is performed in vivo, in vitro, or ex vivo. In some embodiments, the cancer is lung cancer, breast cancer, colon cancer, or pancreatic cancer, and the synthetic RNA virus genome comprises a polynucleotide sequence derived from the KY strain. In some embodiments, the cancer is bladder cancer, renal cell carcinoma, ovarian cancer, gastric cancer, or liver cancer, and the synthetic RNA virus genome comprises a polynucleotide sequence derived from the EF strain. In some embodiments, the cancer is selected from lung cancer, breast cancer, ovarian cancer, cervical cancer, prostate cancer, testicular cancer, colorectal cancer, colon cancer, pancreatic cancer, liver cancer, renal cell carcinoma, gastric cancer, head and neck cancer, thyroid cancer, malignant glioma, glioblastoma, melanoma, B-cell chronic lymphocytic leukemia, multiple myeloma, monoclonal gammopathy of undetermined significance (MGUS), Merkel cell carcinoma, diffuse large B-cell lymphoma (DLBCL), sarcoma, neuroblastoma, neuroendocrine carcinoma, rhabdomyosarcoma, medulloblastoma, bladder cancer, and marginal zone lymphoma (MZL). In some embodiments, the cancer is selected from the group consisting of lung cancer, breast cancer, colon cancer, pancreatic cancer, bladder cancer, renal cell carcinoma, ovarian cancer, gastric cancer, and liver cancer. In some embodiments, the cancer is renal cell carcinoma, lung cancer, or liver cancer. In some embodiments, the cancer is small cell lung cancer or non-small cell lung cancer (e.g., lung squamous cell carcinoma or lung adenocarcinoma). In some embodiments, the cancer is hepatocellular carcinoma (HCC) (e.g., Hepatitis B virus-associated HCC). In some embodiments, the cancer is neuroendocrine prostate cancer that develops under treatment.In some embodiments, the cancer is lung cancer, liver cancer, prostate cancer (e.g., CRPC-NE), bladder cancer, pancreatic cancer, colon cancer, gastric cancer, breast cancer, neuroblastoma, renal cell carcinoma, ovarian cancer, rhabdomyosarcoma, medulloblastoma, neuroendocrine carcinoma, Merkel cell carcinoma, or melanoma. In some embodiments, the cancer is neuroblastoma. [Brief description of the drawings]

[0030] [Figure 1] 1 shows tumor volumes in SK-MEL-28 tumor-bearing mice following intratumoral administration of CVA21-RNA molecules formulated with PBS or Lipofectamine, or intravenous administration of LNPs containing CVA21-Kuykendall strain RNA molecules (Formulation ID: 70032-6C).

[0031] [Figure 2A] We outline an in vitro transcription method for generating picornavirus true 3' ends using 3' type IIS restriction enzyme recognition sites. [Figure 2B] Electrophoresis of DNA digested with BsmBI or BsaI restriction enzymes is shown.

[0032] [Diagram 3] 1 shows the RNase H approach to generate true 5' ends of picornaviruses using a 5' DNA primer and RNase H enzyme.

[0033] [Figure 4] 1 shows a ribozyme approach to generating authentic 5' ends of picornaviruses.

[0034] [Diagram 5] A to B show hammerhead ribozymes for generating individual 5' ends. A shows a structural model of a minimal hammerhead ribozyme (HHR) that anneals and cleaves at the 5' end at the arrow (SEQ ID NO: 75). B shows a structural model of a ribozyme (STBL) with stabilized stem I for cleaving the 5' end at the arrow (SEQ ID NO: 76).

[0035] [Figure 6] A-B show pistol ribozymes for generating distinct 5' ends. A shows a diagram of the wild-type pistol ribozyme features (SEQ ID NO: 77). B shows a pistol ribozyme from P. Polymyxa with a tetraloop added to fuse the P3 strand, modeled by mFOLD. The dashed boxes are regions that were mutagenized to keep the ribozyme folding in the context of the viral sequence. The "GUC" sequence shown in the dashed box was mutated to "UCA" to generate pistol 1, and the "GUC" sequence was mutated to "TTA" to generate pistol 2. (SEQ ID NO: 78)

[0036] [Figure 7] A sequence alignment of several pistol-type ribozyme variants and the location of the P2 motif are shown.

[0037] [Figure 8] The in vitro transcription process of CVA21-RNA and Neg-RNA is shown. Autocatalytic cleavage of CVA21-RNA by 5' and 3' ribozymes (Rib) generated CVA21-RNA with distinct 5' and 3' ends required for replication. In contrast, the Neg-RNA construct lacked the ribozyme sequence and was incapable of replication and virion production.

[0038] [Figure 9A] 1 shows a schematic diagram of the removal of non-viral RNA polynucleotides from genomic transcripts using a junction cleavage sequence to maintain distinct 5' and 3' native ends of the virus. [Figure 9B] 1 shows an illustration of the removal of non-viral RNA polynucleotides from a genomic transcript using a junction cleavage sequence to maintain distinct 5' and 3' native ends of the virus, where the 3' junction cleavage sequence contains a restriction enzyme recognition site.

[0039] [Figure 10A]FIG. 1 shows a non-limiting diagram of the CVA21 expression construct design and the corresponding in vitro transcription process to generate a synthetic RNA viral genome with precise 5′ and 3′ ends. [Figure 10B] 1 shows the design of a DNA construct to test the cleavage efficiency of a ribozyme as a 5' junction cleavage sequence. [Figure 10C] 1 is a gel electrophoresis image showing the cleavage efficiency of initial candidate ribozymes against either the shorter, approximately 60 nt, viral start or the longer, approximately 260 nt, viral start.

[0040] [Figure 11] A shows the DNA sequences encoding the various ENV27 ribozymes. B shows a representation of the secondary structure of the ribozyme (left) and the base pairing of the ribozyme P2 motif with the 5' end of the viral genome (right).

[0041] [Figure 12A] 1 is a gel electrophoresis image showing the cleavage efficiency of the indicated ribozyme constructs. [Figure 12B] 1 is a gel electrophoresis image showing the cleavage efficiency of the indicated ribozyme constructs. [Figure 12C] 1 is a table summarizing the cleavage efficiency of each indicated ribozyme incorporated into a viral genome expression construct.

[0042] [Figure 13] 1 is a chart showing viral titers produced by cells transfected with viral genomic RNA generated by the indicated DNA templates.

[0043] [Figure 14A] 1 is a chart showing tumor growth in animals treated with LNPs containing viral genomic RNA generated by the indicated DNA templates. [Figure 14B] 1 is a chart showing weight change in animals treated with LNPs containing viral genomic RNA produced by the indicated DNA templates. [Figure 14C]1 shows tumor growth charts in NCI-H1299 animal tumor models treated with LNPs containing viral genomic RNA generated by the indicated DNA templates.

[0044] [Figure 15A] FIG. 1 shows the UV A280 absorbance profiles of CVA21 viral genomes with various polyA tail lengths using oligo-dT chromatography. [Figure 15B] 1 shows the UV A280 absorbance profiles of SVV viral genomes with various polyA tail lengths using oligo-dT chromatography.

[0045] [Figure 16A] FIG. 13 plots the change in tumor size over time in animals treated with LNPs containing RNA viral genomes derived from in vitro transcription of DNA templates with different designs as indicated (e.g., various polyA tail lengths and 5′ ribozyme sequences) using the NCI-H1299 xenograft model. [Figure 16B] FIG. 13 is a plot of tumor size over time in animals treated with the indicated LNPs. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0046] The present disclosure provides recombinant polynucleotides encoding viral genomes and template vector designs for in vitro viral expression. In particular, recombinant polynucleotides may be required to expose the natural 5' and 3' ends of viral genomes to allow efficient viral replication in cells. To produce such recombinant polynucleotides, it is necessary to optimize the design of vector templates and the production process (e.g., expression, purification, encapsulation and storage).

[0047] In some embodiments, the viral genome is replicable. The present disclosure also provides viral genomes that can be encapsulated in non-immunogenic particles, such as lipid nanoparticles, polymer nanoparticles, or exosomes, that can be repeatedly administered to a subject. In some embodiments, the particles further encapsulate polynucleotides that encode payload molecules. Thus, the present disclosure allows for safe and effective systemic delivery of recombinant polynucleotide vectors, providing methods for the treatment and prevention of a variety of proliferative disorders (e.g., cancer).

[0048] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited herein, including but not limited to patents, patent applications, papers, books, and articles, are expressly incorporated herein by reference in their entirety for all purposes. In the event that one or more of the incorporated documents or portions of documents defines a term in conflict with the definition of that term in this application, the definition appearing in this application shall prevail. However, the mention of any references, papers, publications, patents, patent publications, and patent applications cited herein is not, and should not be construed as, an admission or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.

[0049] definition As used herein, any concentration range, percentage range, ratio range, or integer range should be understood to include every integer value within the stated range, and fractions thereof, where appropriate (such as tenths and hundredths of integers), unless otherwise indicated. The terms "a" and "an" as used herein should be understood to refer to "one or more" of the listed components, unless otherwise indicated. The use of alternatives (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the terms "include" and "comprise" are used synonymously. As used herein, "plurality" can refer to one or more components (e.g., one or more miRNA target sequences). In this application, the use of "or" means "and / or" unless otherwise indicated.

[0050] As used in this application, the terms "about" and "approximately" are used as equivalent terms. Any numbers used in this application, whether about or not, are intended to encompass any normal deviations recognized by those of ordinary skill in the relevant art. In certain embodiments, the term "about" or "about" refers to a range of values ​​within 10% in either direction (above or below) from the stated reference value (except when such number exceeds 100% of the possible values), unless otherwise stated or otherwise clear from the context. In some embodiments, the term "about" or "about" refers to a range of values ​​within 10% in either direction (above or below) from the stated reference value (except when such number exceeds 100% of the possible values), unless otherwise stated or otherwise clear from the context.

[0051] "Reduce" or "reducing" refers to a decrease or reduction of at least 5%, e.g., 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, or 100% of a particular value compared to a reference value. A decrease or reduction of a particular value can also be expressed as a fold change in the value compared to the reference value, e.g., a decrease of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000 or more times compared to the reference value.

[0052] "Increase" refers to an increase of at least 5%, e.g., 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 99, 100, 200, 300, 400, 500% or more of a particular value compared to a reference value. An increase in a particular value can also be expressed as a fold change in the value compared to the reference value, e.g., an increase of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000 or more times compared to the reference level.

[0053] The term "sequence identity" refers to the percentage of bases or amino acids between two polynucleotide or polypeptide sequences that are the same and in the same relative position. Thus, one polynucleotide or polypeptide sequence has a certain percentage of sequence identity compared to another polynucleotide or polypeptide sequence. For sequence comparison, typically one sequence serves as a reference sequence to which a test sequence is compared. The term "reference sequence" refers to the molecule to which a test sequence is compared. Unless otherwise specified, the term "sequence identity" in the claims refers to the sequence identity calculated by Clustal Omega® version 1.2.4 using default parameters.

[0054] The term "derived from" refers to a polypeptide or polynucleotide sequence that comprises all or a portion of a reference polypeptide or polynucleotide sequence. For example, an RNA polynucleotide encoding an SVV or CVA genome described herein can comprise a polynucleotide sequence that is derived from all or a portion of a reference SVV or CVA genome (e.g., a naturally occurring or modified SVV or CVA genome). A polypeptide or polynucleotide sequence "derived from" a reference polypeptide or polynucleotide sequence also includes a polypeptide and / or polynucleotide sequence that contains one or more amino acid or nucleic acid mutations (e.g., substitutions, deletions, and / or insertions) relative to the reference polypeptide or polynucleotide sequence.

[0055] "Complementary" refers to the ability to pair through base stacking and specific hydrogen bonding between two sequences containing naturally occurring or non-naturally occurring (e.g., modified as described above) bases (nucleotides) or their analogs. For example, if a base at a position of a nucleic acid can hydrogen bond with a base at a corresponding position of a target, these bases are considered to be complementary to each other at that position. Nucleic acids can contain universal bases or inert abasic spacers that do not provide a positive or negative contribution to hydrogen bonding. Base pairs can include both standard Watson-Crick base pairs and non-Watson-Crick base pairs (e.g., wobble base pairs and Hoogsteen base pairs). For complementary base pairs, it is understood that adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), cytosine-type bases (C) are complementary to guanosine-type bases (G), and universal bases such as 3-nitropyrrole or 5-nitroindole will hybridize with and be considered complementary to any A, C, U, or T. Nichols et al., Nature, 1994; 369: 492-493, and Loakes et al., Nucleic Acids Res., 1994; 22: 4039-4043. Inosine (I) is also considered to be a universal base in the art and is considered to be complementary to any A, C, U, or T. See Watkins and SantaLucia, Nucl. Acids Research, 2005;33(19):6258-6267.

[0056] "Expression cassette" or "expression construct" refers to a polynucleotide sequence operably linked to a promoter. "Operably linked" refers to a juxtaposition in which the components so described are in a relationship that allows them to function in their intended manner. For example, a promoter is operably linked to a polynucleotide sequence if the promoter affects the transcription or expression of the polynucleotide sequence.

[0057] The term "subject" includes animals, such as mammals. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, the subject is a livestock animal, such as cattle, sheep, goats, dairy cows, pigs, or domesticated animals, such as dogs and cats. In some embodiments (e.g., particularly in research contexts), the subject is a rodent (e.g., mouse, rat, hamster), rabbit, primate, or pig, such as an inbred pig. The terms "subject" and "patient" are used interchangeably herein.

[0058] "Administering," as used herein, refers to introducing an agent or composition into a subject or contacting a composition with cells and / or tissues.

[0059] As used herein, "treating" refers to delivering an agent or composition to a subject to affect a physiological outcome. In some embodiments, treating refers to the treatment of disease in a mammal, e.g., a human, including (a) inhibiting disease, i.e., arresting the onset of disease or preventing disease progression; (b) relieving disease, i.e., causing regression of the disease state; and (c) curing disease.

[0060] The term "effective amount" refers to the amount of an agent or composition required to produce a particular physiological effect (e.g., the amount required to increase, activate, and / or enhance a particular physiological effect). The effective amount of a particular agent can be expressed in a variety of ways based on the nature of the agent, such as mass / volume, number of cells / volume, particles / volume, (mass of agent) / (mass of subject), number of cells / (mass of subject), or particles / (mass of subject). The effective amount of a particular agent is expressed as the half maximal effective concentration (EC 50 ), which refers to the concentration of a drug that produces a particular physiological response whose magnitude is midway between a basal level and a maximum response level.

[0061] A "population" of cells refers to any number of cells greater than one, but preferably at least 1×103 cells, at least 1 x 10 4 cells, at least 1 x 10 5 cells, at least 1 x 10 6 cells, at least 1 x 10 7 cells, at least 1 x 10 8 cells, at least 1 x 10 9 cells, at least 1 x 10 10 A population of cells can refer to an in vitro population (e.g., a population of cells in culture) or an in vivo population (e.g., a population of cells present in a particular tissue).

[0062] "Effector function" refers to the functions of an immune cell involved in generating, maintaining, and / or enhancing an immune response against a target cell or target antigen.

[0063] The terms "microRNA," "miRNA," and "miR" are used interchangeably herein to refer to small, non-coding endogenous RNAs, approximately 21-25 nucleotides in length, that control gene expression by directing their target messenger RNAs (mRNAs) for degradation or translational repression.

[0064] As used herein, the term "composition" refers to a formulation of a recombinant RNA molecule or particle-encapsulated recombinant RNA molecule described herein that can be administered or delivered to a subject or a cell.

[0065] The phrase "pharmacologically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are, within the scope of safe medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0066] As used herein, a "pharmaceutically acceptable carrier, diluent, or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, surface active agent, and / or emulsifier approved by the U.S. Food and Drug Administration as acceptable for use in humans and / or domestic animals.

[0067] The term "replicative viral genome" refers to a viral genome that encodes all of the viral genes necessary for viral replication and the production of infectious viral particles.

[0068] The term "oncolytic virus" refers to a virus that has been modified or that naturally preferentially infects cancer cells.

[0069] The term "vector" is used herein to refer to a nucleic acid molecule capable of transporting, encoding, or carrying another nucleic acid molecule.

[0070] The term "corresponding to" or "corresponding to" as used herein with respect to an amino acid or nucleic acid position(s) refers to a position(s) in a first polypeptide / polynucleotide sequence that aligns with a given amino acid / nucleic acid in a reference polypeptide / polynucleotide sequence when the first and reference polypeptide / polynucleotide sequences are aligned. Alignments are performed by one of skill in the art using software designed for this purpose, e.g., Clustal Omega version 1.2.4, using the default parameters in that version.

[0071] The term "encapsulation efficiency" or "EE%" refers to the percentage of target molecules (e.g., synthetic RNA virus genomes) that are successfully encapsulated into LNPs. Encapsulation efficiency is calculated by the following formula: (EE%)=(Wt / Wi)×100% where Wt is the total amount of drug in the LNP suspension and Wi is the total amount of drug initially added during preparation. As an illustrative example, if 97 mg of target molecule are encapsulated in the LNPs out of a total of 100 mg of target molecule initially provided in the composition, the encapsulation efficiency can be given as 97%.

[0072] The term "lipid nitrogen to phosphate ratio" or "(N:P)" refers to the ratio of positively chargeable lipid amine groups to nucleic acid phosphate groups in a lipid nanoparticle.

[0073] The term "half-life" refers to a pharmacokinetic property of a molecule (e.g., a molecule encapsulated in a lipid nanoparticle). Half-life can be expressed as the time required for fifty percent (50%) of a known amount of a molecule to be eliminated from a subject's body (e.g., a human patient or other mammal) or a particular compartment thereof by biological processes (e.g., metabolism, excretion, accelerated blood clearance, etc.) following its administration in vivo, as measured, for example, in serum (i.e., circulating half-life) or other tissues. In general, an increase in half-life results in an increase in the mean residence time (MRT) of an administered molecule in the circulation.

[0074] The term "accelerated blood clearance" or "ABC" refers to the phenomenon in which certain pharmaceutical agents (e.g., PEG-containing LNPs) are rapidly cleared from the blood shortly after second and subsequent administrations. ABC has been observed for many lipid delivery vehicles, including liposomes and LNPs.

[0075] As used herein, the term "ratio" when used in relation to lipid composition (e.g., as a percentage of total lipid content) refers to molar ratio, unless otherwise clearly indicated. Molar ratio as a percentage of total lipid content can also be expressed by "mol%". For example, "49:22:28.5:0.5mol%" means the molar ratio of 49:22:28.5:0.5.

[0076] As used herein, the term "aliphatic" or "aliphatic group" refers to a linear (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more units of unsaturation, or a non-aromatic monocyclic or bicyclic hydrocarbon (also referred to herein as "carbocycle", "alicyclic", or "cycloalkyl") that is fully saturated or contains one or more units of unsaturation, but has a single point of attachment to the remainder of the molecule. Unless otherwise specified, an aliphatic group contains 1-6 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-5 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-4 aliphatic carbon atoms. In still other embodiments, an aliphatic group contains 1-3 aliphatic carbon atoms, and in still other embodiments, an aliphatic group contains 1-2 aliphatic carbon atoms. In some embodiments, an "alicyclic" (or "carbocycle" or "cycloalkyl") refers to a non-aromatic monocyclic C ring that is fully saturated or contains one or more units of unsaturation, but has a single point of attachment to the remainder of the molecule. 3 -C 6 Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups, and hybrids thereof, such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0077] As used herein, the term "alkyl" refers to a branched or unbranched saturated hydrocarbon group having a specified number of carbon atoms. In some embodiments, an alkyl group is a group having three carbon atoms (C 3 ) . In some embodiments, alkyl refers to a branched or unbranched saturated hydrocarbon group having 6 carbon atoms (C 6 In some embodiments, the term "alkyl" includes, but is not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, s-butyl, t-butyl, n-pentyl, isopentyl, s-pentyl, neopentyl, and hexyl.

[0078] As used herein, the term "alkylene" refers to a divalent alkyl group. An "alkylene chain" is a polymethylene group, i.e., -(CH 2 ) n -, where n is a positive integer, preferably 1 to 6, 1 to 4, 1 to 3, 1 to 2, or 2 to 3. A substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for substituted aliphatic groups.

[0079] The term "aryl" used alone or as part of a larger moiety, such as in "aralkyl", "aralkoxy" or "aryloxyalkyl", refers to monocyclic and bicyclic ring systems having a total of 5 to 14 ring members, in which at least one ring in the system is aromatic and each ring in the system contains 3 to 7 ring members. The term "aryl" may be used interchangeably with the term "aryl ring". In certain embodiments of the present disclosure, "aryl" refers to aromatic ring systems, including but not limited to phenyl, biphenyl, naphthyl, anthracyl, and the like, which may bear one or more substituents. As the term "aryl" is used herein, its scope also includes groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthymidyl, phenanthridinyl, or tetrahydronaphthyl.

[0080] The terms "heteroaryl" and "heteroar-" used alone or as part of a larger moiety, such as "heteroaralkyl" or "heteroaralkoxy", refer to groups having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms, having 6, 10, or 14 pi-electrons shared in a cyclic arrangement, and having 1 to 5 heteroatoms in addition to the carbon atoms. The term "heteroatom" refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen. Heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. The terms "heteroaryl" and "heteroar-" as used herein also include groups in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocyclyl rings, and the radical or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzothiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. Heteroaryl groups can be monocyclic or bicyclic. The term "heteroaryl" may be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroaromatic," all of which include rings that are optionally substituted. The term "heteroaralkyl" refers to an alkyl group substituted by a heteroaryl, where the alkyl and heteroaryl portions independently are optionally substituted.

[0081] The term "haloaliphatic" refers to an aliphatic group that is substituted with one or more halogen atoms.

[0082] The term "haloalkyl" refers to a straight or branched chain alkyl group that is substituted with one or more halogen atoms.

[0083] The term "halogen" means F, Cl, Br, or I.

[0084] As used herein, the terms "heterocycle", "heterocyclyl", "heterocyclic radical", and "heterocyclic ring" are used interchangeably and refer to a stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is saturated or partially unsaturated and has, in addition to carbon atoms, one or more, preferably one to four, heteroatoms as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen can be N (such as in 3,4-dihydro-2H-pyrrolyl), NH (such as in pyrrolidinyl), or . +It may be NR (such as in the case of TV-substituted pyrrolidinyl). The heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure, and any of the ring atoms may be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothiophenylpyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocycle", "heterocyclyl", "heterocyclyl ring", "heterocyclic group", "heterocyclic moiety", and "heterocyclic radical" are used interchangeably herein and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or alicyclic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl, where the radical or point of attachment is on the heterocyclyl ring. Heterocyclyl groups can be monocyclic or bicyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted by heterocyclyl, where the alkyl and heterocyclyl moieties, independently, are optionally substituted.

[0085] A heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure, and any ring atom may be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothiophenylpyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocycle", "heterocyclyl", "heterocyclyl ring", "heterocyclic group", "heterocyclic moiety", and "heterocyclic radical" are used interchangeably herein and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or alicyclic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl, where the radical or point of attachment is on the heterocyclyl ring. Heterocyclyl groups can be monocyclic or bicyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted by heterocyclyl, where the alkyl and heterocyclyl moieties, independently, are optionally substituted.

[0086] As described herein, the compounds of the present disclosure may contain "optionally substituted" moieties. In general, the term "substituted", whether preceded by the term "optionally" or not, means that one or more hydrogens of the specified moiety are replaced with a suitable substituent. Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each of the substitutable positions of the group, and when multiple positions in any given structure may be substituted with multiple substituents selected from a specified group, the substituents may be the same or different at each position. The combinations of substituents envisioned by the present disclosure are preferably those that result in the formation of stable or chemically feasible compounds. As used herein, the term "stable" refers to a compound that is substantially unchanged when subjected to conditions that allow for the production, detection, and, in certain embodiments, the recovery, purification, and use of the compounds for one or more of the purposes disclosed herein.

[0087] Suitable monovalent substituents on a substitutable carbon atom of an "optionally substituted" group are, independently, halogen; -(CH 2 ) 0-4 R ° ;-(CH 2 ) 0-4 OR ° ;-O(CH 2 ) 0-4 R ° , -O-(CH 2 ) 0-4 C(O)OR ° ;-(CH 2 ) 0-4 CH(OR ° ) 2 ;-(CH 2 ) 0-4 S.R. ° ;R ° may be substituted with -(CH 2 ) 0-4 Ph;R ° may be substituted with -(CH 2 ) 0-4 O(CH 2 ) 0-1 Ph;R °-CH=CHPh; R ° may be substituted with -(CH 2 ) 0-4 O(CH 2 ) 0-1 -Pyridyl; -NO 2 ;-CN;-N 3 ;-(CH 2 ) 0-4 N(R ° ) 2 ;-(CH 2 ) 0-4 N(R ° )C(O)R ° ;-N(R ° )C(S)R ° ;-(CH 2 ) 0-4 N(R ° )C(O)NR ° 2 ;-N(R ° )C(S)NR ° 2 ;-(CH 2 ) 0-4 N(R ° )C(O)OR ° ;-N(R ° )N(R ° )C(O)R ° ;-N(R ° )N(R ° )C(O)NR ° 2 ;-N(R ° )N(R ° )C(O)OR ° ;-(CH 2 ) 0-4 C(O)R ° ;-C(S)R ° ;-(CH 2 ) 0-4 C(O)OR ° ;-(CH 2 ) 0-4 C(O)SR ° ;-(CH 2 ) 0-4 C(O)OSiR ° 3 ;-(CH 2 ) 0-4 O.C.(O)R ° ;-OC(O)(CH2 ) 0-4 SR ° 、SC(S)SR ° ;-(CH 2 ) 0-4 SC(O)R ° ;-(CH 2 ) 0-4 C(O)NR ° 2 ;-C(S)NR ° 2 ;-C(S)SR ° ;-SC(S)SR ° 、-(CH 2 ) 0-4 OC(O)NR ° 2 ;-C(O)N(OR ° )R ° ;-C(O)C(O)R ° ;-C(O)CH 2 C(O)R ° ;-C(NOR ° )R ° ;-(CH 2 ) 0-4 SSR ° ;-(CH 2 ) 0-4 S(O) 2 R ° ;-(CH 2 ) 0-4 S(O) 2 OR ° ;-(CH 2 ) 0-4 OS(O) 2 R ° ;-S(O) 2 NR ° 2 ;-(CH 2 ) 0-4 S(O)R ° ;-N(R ° )S(O) 2 NR ° 2 ;-N(R ° )S(O) 2 R ° ;-N(OR ° )R ° ;-C(NH)NR ° 2 ;-P(O) 2 R° ;-P(O)R ° 2 ;-OP(O)R ° 2 ;-OP(O)(OR ° ) 2 ;SiR ° 3 ;-(C 1-4 Linear or branched alkylene)ON(R ° ) 2 ; or -(C 1-4 Linear or branched alkylene)C(O)ON(R ° ) 2 where each R ° are optionally substituted as defined below and independently represent hydrogen, C 1-6 Aliphatic, -CH 2 Ph, -O(CH 2 ) 0-1 Ph, -CH 2 -(5- to 6-membered heteroaryl ring), or a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; or, regardless of the above definitions, R ° two independent occurrences of together with their intervening atom(s) form a 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be optionally substituted as defined below.

[0088] R ° (or R ° Suitable monovalent substituents on the ring formed by combining two independent occurrences of -(CH 2 ) 0-2 R ● , -(Halo R ● ), -(CH 2 ) 0-2 OH, -(CH 2 ) 0-2 OR ● , -(CH 2 ) 0-2 CH(OR ● )2 ;-O(Halo R ● ), -CN, -N 3 , -(CH 2 ) 0-2 C(O)R ● , -(CH 2 ) 0-2 C(O)OH, -(CH 2 ) 0-2 C(O)OR ● , -(CH 2 ) 0-2 S.R. ● , -(CH 2 ) 0-2 SH, -(CH 2 ) 0-2 NH 2 , -(CH 2 ) 0-2 NHR ● , -(CH 2 ) 0-2 NR ● 2 , -NO 2 , -SiR ● 3 , -OSiR ● 3 , -C(O)SR ● , -(C 1-4 Linear or branched alkylene)C(O)OR ● , or -SSR ● where each R ● is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and C 1-4 Aliphatic, -CH 2 Ph, -O(CH 2 ) 0-1 R is independently selected from Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. ° Suitable divalent substituents on a saturated carbon atom of include ═O and ═S.

[0089] Preferred divalent substituents on a saturated carbon atom of an "optionally substituted" group are ═O, ═S, ═NNR * 2 , =NNHC(O)R *, =NNHC(O)OR * , =NNHS(O) 2 R * , =NR * , =NOR * , -O(C(R * 2 )) 2-3 O-, or -S(C(R * 2 )) 2-3 S-, where R * Each independent occurrence of is hydrogen, optionally substituted as defined below, C 1-6 Aliphatic or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. A preferred divalent substituent attached to the adjacent substitutable carbon of an "optionally substituted" group is -O(CR* 2 ) 2-3 O-, where each independent occurrence of R* is hydrogen, C, which may be substituted as defined below. 1-6 It is selected from aliphatic or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0090] R * Preferred substituents on the aliphatic groups are halogen, -R ● , -(Halo R ● ), -OH, -OR ● , -O(HaloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH 2 , -NHR ● , -NR ● 2 , or -NO 2 where each R ● is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and independently, C 1-4 Aliphatic, -CH 2 Ph, -O(CH 2 ) 0-1Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0091] A suitable substituent on a substitutable nitrogen of an "optionally substituted" group is -R † , -NR † 2 , -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CH 2 C(O)R † , -S(O) 2 R † , -S(O) 2 NR † 2 , -C(S)NR † 2 , -C(NH)NR † 2 , or -N(R † )S(O) 2 R † where each R † are independently hydrogen, C which may be substituted as defined below 1-6 aliphatic, unsubstituted -OPh, or an unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; or, notwithstanding the above definitions, R † two independent occurrences of together with their intervening atom(s) form an unsubstituted 3-12 membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0092] R † Suitable substituents on the aliphatic groups are, independently, halogen, -R ● , -(Halo R ● ), -OH, -OR ● , -O(HaloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH 2 , -NHR● , -NR ● 2 , or -NO 2 where each R ● is unsubstituted or, if preceded by "halo", is substituted only with one or more halogens, and independently, C 1-4 Aliphatic, -CH 2 Ph, -O(CH 2 ) 0-1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0093] As used herein, the term "partially unsaturated" refers to a ring moiety that contains at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings with multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as defined herein.

[0094] As used herein, the term "pharmaceutically acceptable salt" refers to a salt that is suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic reactions, etc., within the bounds of safe medical judgment, and commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S.M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, which is incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of the present disclosure include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods used in the art, such as ion exchange. Other pharma- ceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, and 2-hydroxy-ethanesulfonate. Examples of the salts include phonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, and valerate.

[0095] Salts derived from appropriate bases include alkali metal salts, alkaline earth metal salts, ammonium salts, and N(C1-4 Alkyl) 4 Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Further pharma- ceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkylsulfonates, and arylsulfonates.

[0096] "Pharmaceutically acceptable derivative" means any non-toxic salt, ester, salt of an ester, or other derivative of a compound of the present disclosure which, upon administration to a recipient, is capable of providing, directly or indirectly, a compound of the present disclosure, or an active metabolite or residue thereof.

[0097] The term "tertiary amine" is used to describe an amine (nitrogen atom) bound to three carbon-containing groups, each of which is covalently bonded to an amine group through a carbon atom of the group. Tertiary amines may be protonated or may form a complex with a Lewis acid.

[0098] The recitation of a list of chemical groups in any definition of a variable herein includes a definition of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable herein includes that embodiment as any single embodiment or in combination with any other embodiment or portion thereof. Unless otherwise indicated, the structures depicted herein are also intended to include all enantiomeric, diastereomeric, and geometric (or conformational) forms of the structure, such as the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Thus, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the compounds of the present disclosure are within the scope of the present disclosure. Unless otherwise indicated, all tautomeric forms of the compounds of the present disclosure are within the scope of the present disclosure.

[0099] General methods in molecular and cellular biochemistry are described in Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001), Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999), Protein Methods (Bollag et al., John Wiley & Sons 1996), Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999), Viral Vectors (Kaplift & Loewy eds., Academic Press 1995), Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997), and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1999). 1998), the disclosures of which are incorporated herein by reference.

[0100] Synthetic RNA virus genome In some embodiments, the present disclosure provides a recombinant RNA molecule encoding an oncolytic virus (e.g., an RNA genome). Such a recombinant RNA molecule is referred to herein as a "synthetic viral genome" or "synthetic RNA viral genome." In such embodiments, the synthetic RNA viral genome can produce an infectious and lytic virus when introduced into a cell by a non-viral delivery vehicle, and does not require the presence of additional exogenous genes or proteins in the cell to replicate and produce an infectious virus. Rather, endogenous translation mechanisms within the host cell mediate the expression of viral proteins from the synthetic RNA viral genome. The expressed viral proteins then mediate viral replication and assembly into infectious viral particles (which may include capsid proteins, envelope proteins, and / or membrane proteins) that include the RNA viral genome. Thus, the RNA polynucleotides described herein (i.e., synthetic RNA viral genomes), when introduced into a host cell, generate a virus that can infect another host cell. In some embodiments, the oncolytic virus is a picornavirus. In some embodiments, the picornavirus is CVA21. In some embodiments, the picornavirus is SVV.

[0101] In some embodiments, the synthetic viral genome is provided as a recombinant ribonucleic acid (RNA) (i.e., a synthetic RNA viral genome). In some embodiments, the synthetic RNA viral genome comprises one or more nucleic acid analogs. Examples of nucleic acid analogs include 2'-O-methyl substituted RNA, 2'-O-methoxy-ethyl bases, 2'fluoro bases, locked nucleic acid (LNA), unlocked nucleic acid (UNA), bridged nucleic acid (BNA), morpholino, and peptide nucleic acid (PNA). In some embodiments, the synthetic RNA viral genome is a replicon, an RNA viral genome encoding a transgene, an mRNA molecule, or a circular RNA molecule (circRNA). In some embodiments, the synthetic RNA viral genome comprises a single-stranded RNA (ssRNA) viral genome. In some embodiments, the single-stranded genome can be a positive-sense or negative-sense genome.

[0102] In some embodiments, the recombinant RNA molecule is a circular RNA molecule (circRNA). CircRNA molecules lack the free ends required for exonuclease-mediated degradation, thus extending the half-life of the RNA molecule and allowing for more stable protein production over time (see, e.g., Wesselhoeft et al., Engineering circular RNA for potent and stable translation in eukaryotic cells. Nature Communications. (2018) 9:2629). To produce a functional RNA virus from a circRNA molecule, the circular construct needs to be "pried open" once it enters the cell so that a linear RNA genome with the appropriate 3' and 5' natural ends can be produced. Thus, in some embodiments, the recombinant RNA molecule encoding an oncolytic virus is provided as a circRNA molecule and further comprises one or more additional RNA sequences that facilitate linearization of the circRNA molecule inside the cell. Examples of such additional RNA sequences include siRNA target sites, miRNA target sites, and guide RNA target sites. The corresponding siRNA, miRNA, or gRNA can be combined with the circRNA molecule. Alternatively, miRNA target sites may be selected based on the expression of cognate miRNAs in target cells, such that cleavage of the circRNA molecule and initial expression of the encoded oncolytic virus is restricted to target cells expressing the particular miRNA.

[0103] The synthetic RNA viral genomes described herein encode oncolytic viruses, examples of which are known in the art and include, but are not limited to, picornaviruses (e.g., coxsackieviruses), polioviruses, measles viruses, vesicular stomatitis viruses, orthomyxoviruses, and maraba viruses. In some embodiments, the oncolytic virus encoded by the synthetic RNA viral genome is a Picornaviridae virus, such as a Coxsackievirus, a Poliovirus (including chimeric polioviruses such as PVS-RIPO and other chimeric picornaviruses), or a Seneca Valley virus, or any virus of chimeric origin from any of the numerous picornaviruses, a Arenaviridae virus, such as Lassa virus, a Retroviridae virus, such as a Murine Leukemia Virus, a Orthomyxoviridae virus, such as Influenza A virus, a Paramyxoviridae virus, such as Newcastle Disease Virus or Measles Virus, a Reoviridae virus, such as a mammalian Orthoreovirus, a Togaviridae virus, such as Sindbis virus, or a Rhabdoviridae virus, such as Vesicular Stomatitis Virus (VSV) or Maraba virus.

[0104] Positive-sense single-stranded RNA viruses In some embodiments, the synthetic RNA virus genome described herein encodes a single-stranded RNA (ssRNA) virus genome. In some embodiments, the ssRNA virus is a positive-sense ssRNA (+sense ssRNA) virus. Exemplary +sense ssRNA viruses include members of the Picornaviridae family (e.g., including Coxsackievirus, Poliovirus, and Seneca Valley Virus (SVV), SVV-A), Coronaviridae family (e.g., Alphacoronaviruses such as HCoV-229E and HCoV-NL63, Betacoronaviruses such as HCoV-HKU1, HCoV-OC3, and MERS-CoV), Retroviridae family (e.g., Murine Leukemia Virus), and Togaviridae family (e.g., Alphaviruses such as Semliki Forest Virus, Sindbis Virus, Ross River Virus, or Chikungunya Virus). Additional exemplary genera and species of positive-sense ssRNA viruses are listed in Table 1 below. [Table 1]

[0105] In some embodiments, the recombinant RNA molecules described herein encode a picornavirus selected from a coxsackievirus, a poliovirus, and a Seneca Valley virus (SVV). In some embodiments, the recombinant RNA molecules described herein encode a coxsackievirus. In some aspects of this embodiment, the recombinant RNA molecule encodes a coxsackievirus and comprises the 5'UTR sequence of SEQ ID NO:2 (see, e.g., Brown et al., Complete Genomic Sequencing Shows that Polioviruses and Members of Human Enterovirus Species C Are Closely Related in the Noncapsid Coding Region. Journal of Virology, (2003) 77:16, p. 8973-8984. GenBank Accession No. AF546702). In such embodiments, the 5'UTR sequence of SEQ ID NO:2 unexpectedly increases the production of functional Coxsackievirus compared to other previously reported 5'UTR sequences (see, e.g., Newcombe et al., Cellular receptor interactions of C-cluster human group A coxsackieviruses Journal of General Virology (2003), 84, 3041-3050. GenBank Accession No. AF465515). In some aspects of this embodiment, the recombinant RNA molecule encodes a Coxsackievirus and comprises the sequence of SEQ ID NO:1.

[0106] In some embodiments, the synthetic RNA virus genome described herein encodes a Coxsackievirus. In some embodiments, the Coxsackievirus is selected from CVB3, CVA21, and CVA9. Exemplary Coxsackievirus nucleic acid sequences are provided under GenBank Reference No. M33854.1 (CVB3), GenBank Reference No. KT161266.1 (CVA21), and GenBank Reference No. D00627.1 (CVA9). In some embodiments, the synthetic RNA virus genome described herein encodes a modified CVA21 virus comprising SEQ ID NO:1, which virus is a Kuykendall (Kuyk) strain. In some embodiments, the sequence of the Kuykendall strain viral genome is according to GenBank Accession No. AF465515.1 or AF546702.1. In some embodiments, the synthetic RNA virus genome described herein encodes a chimeric Coxsackievirus. In some embodiments, the synthetic RNA viral genome described herein encodes a CVA21 strain selected from the CVA21-EF and CVA21-KY strains. In some embodiments, the synthetic RNA viral genome described herein encodes a CVA21-EF strain. An exemplary sequence of the EF strain viral genome is according to GenBank Accession No. EF015029.1. In some embodiments, the synthetic RNA viral genome described herein encodes a CVA21-KY strain. An exemplary sequence of the KY strain viral genome is according to GenBank Accession No. KY284011.1. As shown in Figures 11-26, the EF and KY strains provide therapeutic benefits over the Kuykendall laboratory strains and previously reported synthetic picornavirus compositions.

[0107] The domain organization of the three CVA21 strains (EF, KY, and Kuykendall) is shown in FIG. 32 and the sequence identity between various regions of these three strains is shown in Table 2 below. [Table 2]

[0108] One or more specific regions within the viral genome of the CVA21 EF or KY strain may contribute to the beneficial therapeutic effects observed for the EF and KY strains over the Kuykendall laboratory strain. In some embodiments, the one or more specific regions are selected from the group consisting of the 5'UTR (IRES) region, the P1 region, and the 3D region. The nucleic acid location of each of these specific regions in the viral strains described herein is as follows: (a) The 5'UTR (IRES) region of CVA21-Kuykendall encompasses nucleic acids 1 to 713 of SEQ ID NO: 1. The 5'UTR (IRES) region of CVA21-KY encompasses nucleic acids 1 to 713 of SEQ ID NO: 5. The 5'UTR (IRES) region of CVA21-EF encompasses nucleic acids 1 to 748 of SEQ ID NO: 9. (b) The P1 region of CVA21-Kuykendall encompasses nucleic acids 714 to 3350 of SEQ ID NO: 1. The P1 region of CVA21-KY encompasses nucleic acids 714 to 3350 of SEQ ID NO: 5. The P1 region of CVA21-EF encompasses nucleic acids 749 to 3385 of SEQ ID NO: 9. (c) The 3D region of CVA21-Kuykendall encompasses nucleic acids 5952-7340 of SEQ ID NO: 1. The 3D region of CVA21-KY encompasses nucleic acids 5952-7340 of SEQ ID NO: 5. The 3D region of CVA21-EF encompasses nucleic acids 5987-7375 of SEQ ID NO: 9.

[0109] In some embodiments, the synthetic RNA viral genome described herein encodes the CVA21-KY strain. In some embodiments, the synthetic RNA viral genome encoding the CVA21-KY strain comprises a polynucleotide sequence according to SEQ ID NO:5. In some embodiments, the synthetic RNA viral genome encoding the CVA21-KY strain comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity to SEQ ID NO:5 (including all ranges and subranges therebetween). In some embodiments, the synthetic RNA viral genome encoding the CVA21-KY strain comprises a polynucleotide sequence that is less than 95%, less than 90%, less than 85%, or less than 80% identical to SEQ ID NO:1 (including all ranges and subranges therebetween).

[0110] In some embodiments, a synthetic RNA virus genome described herein encodes a CVA21-KY strain and comprises a 5'UTR (IRES) sequence according to SEQ ID NO:6 (corresponding to nucleic acids 1-713 of SEQ ID NO:5). In some embodiments, a synthetic RNA virus genome described herein encodes a CVA21-KY strain and comprises a 5'UTR (IRES) sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity to SEQ ID NO:6 (including all ranges and subranges therebetween). In some embodiments, the synthetic RNA viral genome encoding the CVA21-KY strain comprises a 5'UTR (IRES) sequence that is less than 95%, less than 90%, less than 85%, or less than 80% identical to SEQ ID NO:2 (including all ranges and subranges therebetween).

[0111] In some embodiments, a synthetic RNA viral genome described herein encodes a CVA21-KY strain and comprises a P1 sequence according to SEQ ID NO:7 (corresponding to nucleic acids 714-3350 of SEQ ID NO:5). In some embodiments, a synthetic RNA viral genome described herein encodes a CVA21-KY strain and comprises a P1 sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity to SEQ ID NO:7 (including all ranges and subranges therebetween). In some embodiments, a synthetic RNA viral genome encoding a CVA21-KY strain comprises a P1 sequence that is less than 95%, less than 90%, less than 85%, or less than 80% identical to SEQ ID NO:3 (including all ranges and subranges therebetween).

[0112] In some embodiments, a synthetic RNA viral genome described herein encodes a CVA21-KY strain and comprises a 3D sequence according to SEQ ID NO:8 (corresponding to nucleic acids 5952-7340 of SEQ ID NO:5). In some embodiments, a synthetic RNA viral genome described herein encodes a CVA21-KY strain and comprises a 3D sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity to SEQ ID NO:8 (including all ranges and subranges therebetween). In some embodiments, a synthetic RNA viral genome encoding a CVA21-KY strain comprises a 3D sequence that is less than 95%, less than 90%, less than 85%, or less than 80% identical to SEQ ID NO:4 (including all ranges and subranges therebetween).

[0113] In some embodiments, the synthetic RNA viral genome described herein encodes the CVA21-EF strain. In some embodiments, the synthetic RNA viral genome encoding the CVA21-EF strain comprises a polynucleotide sequence according to SEQ ID NO:9. In some embodiments, the synthetic RNA viral genome encoding the CVA21-EF strain comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity to SEQ ID NO:9 (including all ranges and subranges therebetween). In some embodiments, the synthetic RNA viral genome encoding the CVA21-EF strain comprises a polynucleotide sequence that is less than 95%, less than 90%, less than 85%, or less than 80% identical to SEQ ID NO:1 (including all ranges and subranges therebetween).

[0114] In some embodiments, a synthetic RNA viral genome described herein encodes a CVA21-EF strain and comprises a 5'UTR (IRES) sequence according to SEQ ID NO: 10 (corresponding to nucleic acids 1-748 of SEQ ID NO: 9). In some embodiments, a synthetic RNA viral genome described herein encodes a CVA21-EF strain and comprises a 5'UTR (IRES) sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity to SEQ ID NO: 10 (including all ranges and subranges therebetween). In some embodiments, the synthetic RNA viral genome encoding the CVA21-EF strain comprises a 5'UTR (IRES) sequence that is less than 95%, less than 90%, less than 85%, or less than 80% identical to SEQ ID NO:2 (including all ranges and subranges therebetween).

[0115] In some embodiments, a synthetic RNA viral genome described herein encodes a CVA21-EF strain and comprises a P1 sequence according to SEQ ID NO:11 (corresponding to nucleic acids 749-3385 ​​of SEQ ID NO:9). In some embodiments, a synthetic RNA viral genome described herein encodes a CVA21-EF strain and comprises a P1 sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity to SEQ ID NO:11 (including all ranges and subranges therebetween). In some embodiments, a synthetic RNA viral genome encoding a CVA21-EF strain comprises a P1 sequence that is less than 95%, less than 90%, less than 85%, or less than 80% identical to SEQ ID NO:3 (including all ranges and subranges therebetween).

[0116] In some embodiments, a synthetic RNA viral genome described herein encodes a CVA21-EF strain and comprises a 3D sequence according to SEQ ID NO: 12 (corresponding to nucleic acids 5987-7375 of SEQ ID NO: 9). In some embodiments, a synthetic RNA viral genome described herein encodes a CVA21-EF strain and comprises a 3D sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity to SEQ ID NO: 12 (including all ranges and subranges therebetween). In some embodiments, a synthetic RNA viral genome encoding a CVA21-EF strain comprises a 3D sequence that is less than 95%, less than 90%, less than 85%, or less than 80% identical to SEQ ID NO: 4 (including all ranges and subranges therebetween).

[0117] In some embodiments, the CVA21 RNA virus genome described herein does not contain the nucleotide sequence CGUCUC (SEQ ID NO: 83) or GAGACG (SEQ ID NO: 84). The corresponding complementary DNA sequences, CGTCTC (SEQ ID NO: 85) and GAGACG (SEQ ID NO: 86), are BsmBI restriction enzyme recognition sites.

[0118] In some embodiments, the CVA21 RNA virus genome described herein does not contain the nucleotide sequence GGUCUC (SEQ ID NO: 87) or GAGACC (SEQ ID NO: 88). The corresponding complementary DNA sequences GGTCTC (SEQ ID NO: 89) and GAGACC (SEQ ID NO: 90) are BsaI restriction enzyme recognition sites.

[0119] In some embodiments, the synthetic RNA virus genome described herein encodes a Seneca Valley Virus (SVV). In some embodiments, the SVV is selected from wild-type SVV (such as SVV-001, SEQ ID NO: 25), or a mutant or chimeric SVV (such as SVV-001-S177A encoded by SEQ ID NO: 26, or SVV-IRES-2-S177A encoded by SEQ ID NO: 68 or SEQ ID NO: 73).

[0120] In some embodiments, the SVV is an SVV-S177 mutant. In some embodiments, the SVV is an SVV-S177A mutant. As used herein with respect to the SVV viral genome, the term "S177 mutant" refers to an SVV viral genome encoding a VP2 protein that includes a mutation at amino acid S177 (amino acid numbering according to the VP2 protein encoded by SEQ ID NO:25) of the wild-type protein. Thus, the term "S177A mutant" refers to an SVV mutant having an amino acid substitution of S177A of the VP2 protein. In SEQ ID NO:25, the VP2 S177 residue is encoded by the codon "UCU" at nucleic acid positions 1645-1647. Thus, the SVV-S177 mutant includes a nucleic acid mutation in the region corresponding to nucleic acid positions 1645-1647 of SEQ ID NO:25. In some embodiments, the SVV-S177A mutant includes the codon sequence "GCU", "GCC", "GCA", or "GCG" in the region corresponding to nucleic acid positions 1645-1647 of SEQ ID NO:25. In some embodiments, the SVV-S177A mutant comprises the codon sequence "GCG" in the region corresponding to nucleic acid positions 1645 to 1647 of SEQ ID NO:25.

[0121] In some embodiments, the SVV RNA viral genome described herein does not comprise the nucleotide sequence GCUCUUC (SEQ ID NO: 79) or GAAGAGC (SEQ ID NO: 80). The corresponding complementary DNA sequences GCTCTTC (SEQ ID NO: 81) and GAAGAGC (SEQ ID NO: 82) are SapI restriction enzyme recognition sites. In some embodiments, the wild-type SVV RNA viral genome comprises SEQ ID NO: 79 at a position corresponding to nucleic acids 1504-1510 and / or nucleic acids 5293-5299 of SEQ ID NO: 25. In some embodiments, the SVV RNA viral genome of the present disclosure comprises at least one nucleotide substitution compared to SEQ ID NO: 79 within the region corresponding to nucleic acids 1504-1510 and / or nucleic acids 5293-5299 of SEQ ID NO: 25. In some embodiments, the at least one nucleotide substitution is a silent mutation that does not change the amino acid encoded by the corresponding region of DNA. In some embodiments, the SVV RNA viral genome of the present disclosure comprises a cytidine ("C") at a position corresponding to nucleic acids 1509 and / or 5298 of SEQ ID NO: 25.

[0122] In some embodiments, the SVV RNA viral genome described herein does not contain the nucleotide sequence GGUCUC (SEQ ID NO: 87) or GAGACC (SEQ ID NO: 88). The corresponding complementary DNA sequences GGTCTC (SEQ ID NO: 89) and GAGACC (SEQ ID NO: 90) are BsaI restriction enzyme recognition sites.

[0123] In some embodiments, the synthetic RNA virus genomes described herein encode chimeric picornaviruses (e.g., encode a virus that includes one portion, such as a capsid protein or IRES, from a first picornavirus and another portion, such as a nonstructural gene, such as a protease or polymerase, from a second picornavirus). In some embodiments, the synthetic RNA virus genomes described herein encode chimeric SVVs.

[0124] In some embodiments, the synthetic RNA virus genome described herein encodes an SVV that includes one or more specific regions derived from an SVV strain selected from the group consisting of SVV-001 (SEQ ID NO:25 or SEQ ID NO:72 (Genbank Identification No. DQ641257.1)), SVA / BRA / MG2 / 2015 (SEQ ID NO:69; GenBank Identification No. KR063108.1), SVA / Canada / MB / NCFAD-104 / 2015 (SEQ ID NO:70; GenBank Identification No. KY486156.1), and SVV-MN15-308 (SEQ ID NO:71; GenBank Identification No. KU359214.1). In some embodiments, the one or more specific regions are selected from the group consisting of the 5'UTR (IRES) region, the P1 region, and the P3 region. The nucleic acid location of each of these specific regions in the virus strains described herein is as follows: (a) The 5'UTR (IRES) region of SVV-001 includes nucleic acids 1 to 668 of SEQ ID NO: 25. The 5'UTR (IRES) region of SVA / BRA / MG2 / 2015 includes nucleic acids 1 to 656 of SEQ ID NO: 69. The 5'UTR (IRES) region of SVA / Canada / MB / NCFAD-104 / 2015 includes nucleic acids 1 to 612 of SEQ ID NO: 70. The 5'UTR (IRES) region of SVV-MN15-308 includes nucleic acids 1 to 610 of SEQ ID NO: 71. (b) The P1 region of SVV-001 encompasses nucleic acids 669-3477 of SEQ ID NO: 25. The P1 region of SVA / BRA / MG2 / 2015 encompasses nucleic acids 657-3465 of SEQ ID NO: 69. The P1 region of SVA / Canada / MB / NCFAD-104 / 2015 encompasses nucleic acids 613-3421 of SEQ ID NO: 70. The P1 region of SVV-MN15-308 encompasses nucleic acids 611-3419 of SEQ ID NO: 71. (c) The P3 region of SVV-001 encompasses nucleic acids 4855-7212 of SEQ ID NO: 25. The P3 region of SVA / BRA / MG2 / 2015 encompasses nucleic acids 4843-7200 of SEQ ID NO: 69. The P3 region of SVA / Canada / MB / NCFAD-104 / 2015 encompasses nucleic acids 4799-7156 of SEQ ID NO: 70. The P3 region of SVV-MN15-308 encompasses nucleic acids 4797-7154 of SEQ ID NO: 71.

[0125] In some embodiments, the synthetic RNA viral genome described herein encodes an SVV that includes a 5'UTR (IRES) region (nucleic acids 1-656 of SEQ ID NO:69) derived from SVA / BRA / MG2 / 2015. In some embodiments, the synthetic RNA viral genome encodes an SVV that includes a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to nucleic acids 1-656 of SEQ ID NO:69. In some embodiments, the remainder of the SVV viral genome, other than one or more regions derived from SVA / BRA / MG2 / 2015, is derived from SVV-001 and comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to the corresponding region of SEQ ID NO: 25. In some embodiments, the SVV is an SVV-S177 mutant (e.g., an S177A mutant).

[0126] In some embodiments, the synthetic RNA viral genome described herein encodes an SVV that includes a 5'UTR (IRES) region (nucleic acids 1-612 of SEQ ID NO:70) from SVA / Canada / MB / NCFAD-104 / 2015. In some embodiments, the synthetic RNA viral genome encodes an SVV that includes a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to nucleic acids 1-612 of SEQ ID NO:70. In some embodiments, the remainder of the SVV viral genome, other than one or more regions derived from SVA / Canada / MB / NCFAD-104 / 2015, is derived from SVV-001 and comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to the corresponding region of SEQ ID NO: 25. In some embodiments, the SVV is an SVV-S177 mutant (e.g., an S177A mutant).

[0127] In some embodiments, the synthetic RNA viral genome described herein encodes an SVV that includes a 5'UTR (IRES) region from SVV-MN15-308 (nucleic acids 1-610 of SEQ ID NO:71). In some embodiments, the synthetic RNA viral genome encodes an SVV that includes a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to nucleic acids 1-610 of SEQ ID NO:71. In some embodiments, the remainder of the SVV viral genome, other than one or more regions derived from SVV-MN15-308, is derived from SVV-001 and comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to the corresponding region of SEQ ID NO: 25. In some embodiments, the SVV is an SVV-S177 mutant (e.g., an S177A mutant).

[0128] In some embodiments, the synthetic RNA viral genome described herein encodes an SVV that includes a P1 region (nucleic acids 657-3465 of SEQ ID NO:69) from SVA / BRA / MG2 / 2015. In some embodiments, the synthetic RNA viral genome encodes an SVV that includes a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to nucleic acids 657-3465 of SEQ ID NO:69. In some embodiments, the remainder of the SVV viral genome, other than one or more regions derived from SVA / BRA / MG2 / 2015, is derived from SVV-001 and comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to the corresponding region of SEQ ID NO: 25. In some embodiments, the SVV is an SVV-S177 mutant (e.g., an S177A mutant).

[0129] In some embodiments, the synthetic RNA viral genome described herein encodes an SVV that includes a P1 region (nucleic acids 613-3421 of SEQ ID NO:70) from SVA / Canada / MB / NCFAD-104 / 2015. In some embodiments, the synthetic RNA viral genome encodes an SVV that includes a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to nucleic acids 613-3421 of SEQ ID NO:70. In some embodiments, the remainder of the SVV viral genome, other than one or more regions derived from SVA / Canada / MB / NCFAD-104 / 2015, is derived from SVV-001 and comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to the corresponding region of SEQ ID NO: 25. In some embodiments, the SVV is an SVV-S177 mutant (e.g., an S177A mutant).

[0130] In some embodiments, the synthetic RNA viral genome described herein encodes an SVV that includes a P1 region (nucleic acids 611-3419 of SEQ ID NO:71) from SVV-MN15-308. In some embodiments, the synthetic RNA viral genome encodes an SVV that includes a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to nucleic acids 611-3419 of SEQ ID NO:71. In some embodiments, the remainder of the SVV viral genome, other than one or more regions derived from SVV-MN15-308, is derived from SVV-001 and comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to the corresponding region of SEQ ID NO: 25. In some embodiments, the SVV is an SVV-S177 mutant (e.g., an S177A mutant).

[0131] In some embodiments, the synthetic RNA viral genome described herein encodes an SVV that includes a P3 region (nucleic acids 4843-7200 of SEQ ID NO:69) from SVA / BRA / MG2 / 2015. In some embodiments, the synthetic RNA viral genome encodes an SVV that includes a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to nucleic acids 4843-7200 of SEQ ID NO:69. In some embodiments, the remainder of the SVV viral genome, other than one or more regions derived from SVA / BRA / MG2 / 2015, is derived from SVV-001 and comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to the corresponding region of SEQ ID NO: 25. In some embodiments, the SVV is an SVV-S177 mutant (e.g., an S177A mutant).

[0132] In some embodiments, the synthetic RNA viral genome described herein encodes an SVV that includes a P3 region (nucleic acids 4799-7156 of SEQ ID NO:70) from SVA / Canada / MB / NCFAD-104 / 2015. In some embodiments, the synthetic RNA viral genome encodes an SVV that includes a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to nucleic acids 4799-7156 of SEQ ID NO:70. In some embodiments, the remainder of the SVV viral genome, other than one or more regions derived from SVA / Canada / MB / NCFAD-104 / 2015, is derived from SVV-001 and comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to the corresponding region of SEQ ID NO: 25. In some embodiments, the SVV is an SVV-S177 mutant (e.g., an S177A mutant).

[0133] In some embodiments, the synthetic RNA viral genome described herein encodes an SVV that includes a P3 region from SVV-MN15-308 (nucleic acids 4797-7154 of SEQ ID NO:71). In some embodiments, the synthetic RNA viral genome encodes an SVV that includes a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to nucleic acids 4797-7154 of SEQ ID NO:71. In some embodiments, the remainder of the SVV viral genome, other than one or more regions derived from SVV-MN15-308, is derived from SVV-001 and comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) to the corresponding region of SEQ ID NO: 25. In some embodiments, the SVV is an SVV-S177 mutant (e.g., an S177A mutant).

[0134] In some embodiments, the synthetic RNA viral genome described herein encodes a chimeric SVV comprising a 5'UTR (IRES) region from SVA / Canada / MB / NCFAD-104 / 2015 (SEQ ID NO: 70) and the remainder of the viral genome from SVV-001 (SEQ ID NO: 25). In some embodiments, the SVV is an SVV-S177 mutant (e.g., an S177A mutant). In some embodiments, the synthetic RNA viral genome has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, at least 99.9%, or 100% sequence identity (including all ranges and subranges therebetween) with SEQ ID NO: 68.

[0135] In some embodiments, the synthetic RNA virus genome is engineered to contain less than 100% sequence identity with that of a wild-type virus (e.g., wild-type CVA21 or wild-type SVV). In some embodiments, the synthetic RNA virus genome contains less than 99.9%, less than 99.8%, less than 99.7%, less than 99.6%, less than 99.5%, less than 99%, less than 98%, less than 97%, less than 96%, less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, or less than 90% sequence identity with that of the corresponding wild-type virus.

[0136] In some embodiments, the synthetic RNA virus genome comprises a microRNA (miRNA) target sequence (miR-TS) cassette, the miR-TS cassette comprises one or more miRNA target sequences, and the expression of one or more of the corresponding miRNAs in the cell inhibits the replication of the encoded oncolytic virus in the cell. In some embodiments, the one or more miRNAs are selected from miR-124, miR-1, miR-143, miR-128, miR-219, miR-219a, miR-122, miR-204, miR-217, miR-137, miR-142, and miR-126. In some embodiments, the miR-TS cassette comprises one or more copies of the miR-124 target sequence, one or more copies of the miR-1 target sequence, and one or more copies of the miR-143 target sequence. In some embodiments, the miR-TS cassette comprises one or more copies of a miR-128 target sequence, one or more copies of a miR-219a target sequence, and one or more copies of a miR-122 target sequence. In some embodiments, the miR-TS cassette comprises one or more copies of a miR-128 target sequence, one or more copies of a miR-204 target sequence, and one or more copies of a miR-219 target sequence. In some embodiments, the miR-TS cassette comprises one or more copies of a miR-217 target sequence, one or more copies of a miR-137 target sequence, and one or more copies of a miR-126 target sequence.

[0137] In some embodiments, the synthetic RNA viral genome comprises one or more miR-TS cassettes integrated into the 5' untranslated region (UTR) or 3' UTR of one or more essential viral genes. In some embodiments, the synthetic RNA viral genome comprises one or more miR-TS cassettes integrated into the 5' untranslated region (UTR) or 3' UTR of one or more non-essential genes. In some embodiments, the synthetic RNA viral genome comprises one or more miR-TS cassettes integrated into the 5' or 3' of one or more essential viral genes.

[0138] In some embodiments, the synthetic RNA viral genome comprises a heterologous polynucleotide encoding a payload molecule. In such embodiments, the synthetic RNA viral genome drives the production of infectious oncolytic virus and expression of the payload molecule. In some embodiments, expression of the payload molecule can increase the therapeutic efficacy of the oncolytic virus. In some embodiments, the payload molecule is selected from IL-12, GM-CSF, CXCL10, IL-36γ, CCL21, IL-18, IL-2, CCL4, CCL5, anti-CD3-anti-FAP BiTE, an antigen binding molecule that binds DLL3, or an antigen binding molecule that binds EpCAM. In some embodiments, the payload molecule comprises or consists of an MLKL 4HB domain. In some embodiments, the payload molecule comprises or consists of a GAS-DERMIN DN-terminal fragment. In some embodiments, the payload molecule comprises or consists of a GAS-DERMIN EN-terminal fragment. In some embodiments, the payload molecule comprises or consists of an HMGB1 Box B domain. In some embodiments, the payload molecule comprises or consists of SMAC / Diablo. In some embodiments, the payload molecule comprises or consists of melittin. In some embodiments, the payload molecule comprises or consists of L-amino acid oxidase (LAAO). In some embodiments, the payload molecule comprises or consists of a disintegrin. In some embodiments, the payload molecule comprises or consists of TRAIL (TNFSF10). In some embodiments, the payload molecule comprises or consists of a nitroreductase (e.g., NfsB or NfsA of E. coli). In some embodiments, the payload molecule comprises or consists of a reovirus FAST protein (e.g., ARV p14, BRV p15, or a p14-p15 hybrid). In some embodiments, the payload molecule comprises or consists of leptin / FOSL2. In some embodiments, the payload molecule comprises or consists of an α-1,3-galactosyltransferase.In some embodiments, the payload molecule comprises or consists of adenosine deaminase 2 (ADA2). In some embodiments, the payload molecule comprises or consists of a cytokine selected from IL-IL-36γ, IL-7, IL-12, IL-18, IL-21, IL2, or IFNγ. Further description of the types of payload molecules suitable for use in these embodiments is provided below.

[0139] Methods for generating recombinant RNA viral genomes In some embodiments, the present disclosure provides a recombinant DNA molecule that encodes a synthetic RNA virus genome as described herein. Such a recombinant DNA molecule is referred to herein as a "DNA template" or a "recombinant DNA template." In some embodiments, the recombinant DNA molecule is used as a template for in vitro transcription of the encoded synthetic RNA virus genome. In some embodiments, the recombinant DNA molecule (e.g., the DNA template) comprises, from 5' to 3', one or more of the following elements: (i) a promoter, (ii) a 5' leader sequence, (iii) a 5' junction cleavage sequence, (iv) a DNA polynucleotide sequence encoding a synthetic RNA genome, (v) a polyA tail, and / or (vi) a 3' junction cleavage sequence. In some embodiments, the recombinant DNA molecule (e.g., the DNA template) that encodes a recombinant RNA molecule comprises each of the following elements: (i) a promoter, (ii) a 5' leader sequence, (iii) a 5' junction cleavage sequence, (iv) a DNA polynucleotide sequence encoding a synthetic RNA genome, (v) a polyA tail, and (vi) a 3' junction cleavage sequence. Each of these elements is described in detail below. The description provided for each individual element is such that a particular embodiment of each element may be incorporated into a final recombinant DNA molecule (e.g., a DNA template), for example, a particular leader sequence disclosure may be combined with a particular 5' junction cleavage sequence disclosure, etc.

[0140] In some embodiments, the recombinant DNA molecule (e.g., DNA template) does not contain additional nucleic acid between the two adjacent elements, but may contain additional nucleic acid upstream of the promoter sequence or downstream of the 3' junction cleavage sequence. In some embodiments, the promoter sequence is a T7 promoter sequence. In some embodiments, the T7 promoter sequence comprises or consists of SEQ ID NO:91.

[0141] In some embodiments, the promoter is suitable for in vitro transcription, hi some embodiments, the promoter is a T7 promoter.

[0142] In some embodiments, the synthetic RNA virus genome described herein is generated in vitro using one or more recombinant DNA templates that contain a polynucleotide encoding the synthetic RNA virus genome. In other words, the recombinant DNA template is a vector that contains a polynucleotide encoding the synthetic RNA virus genome. The term "vector" is used herein to refer to a nucleic acid molecule that can transport, encode or carry another nucleic acid molecule. The nucleic acid to be transported is usually inserted into a vector nucleic acid molecule. The vector may contain sequences that direct autonomous replication in a cell and / or may contain sufficient sequences to allow integration into host cell DNA. In some embodiments, the recombinant RNA molecule encoding the oncolytic virus described herein is generated using one or more DNA vectors.

[0143] In some embodiments, the synthetic RNA viral genomes described herein are produced by introducing a recombinant DNA molecule (e.g., a DNA template) containing a polynucleotide encoding the recombinant RNA molecule into a suitable host cell in vitro (e.g., by means of transfection, transduction, electroporation, etc.). Suitable host cells include insect and mammalian cell lines. The host cell is cultured for an appropriate time to allow expression of the polynucleotide and production of the synthetic RNA viral genome. The synthetic RNA viral genome is then isolated from the host cell and formulated (e.g., encapsulated into particles) for therapeutic use. A schematic of the in vitro synthesis of CVA21 RNA viral genome with 3' and 5' ribozymes is shown in Figure 8. The same schematic applies to the synthesis of RNA viral genomes (e.g., CVA21 or SVV viral genomes) using other combinations of junction cleavage sequences (see, e.g., Figure 9A). If the 3' junction cleavage sequence comprises or consists of a restriction enzyme recognition site, the recombinant DNA molecule (e.g., the DNA template) can be digested with the corresponding restriction enzyme prior to the in vitro transcription process, as shown in Figure 9B.

[0144] T7 promoter In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises a T7 promoter. In some embodiments, the T7 promoter comprises or consists of the polynucleotide sequence of SEQ ID NO: 91. In some embodiments, the T7 promoter comprises or consists of the polynucleotide sequence of SEQ ID NO: 91 including up to 1, 2, 3, or 4 mutations.

[0145] In some embodiments, the T7 promoter is located immediately before the leader sequence, with no additional nucleotides in between. In some embodiments, the T7 promoter is located immediately before the 5' junction cleavage sequence, with no additional nucleotides in between. In some embodiments, the viral genome encodes CVA21 or SVV.

[0146] Junction cleavage sequence In some embodiments, recombinant RNA molecules comprising the synthetic RNA virus genomes described herein require distinct 5' and 3' ends that are naturally present in the virus. RNA transcripts produced in vitro by T7 RNA polymerase or by mammalian RNA Pol II contain mammalian 5' and 3' UTRs and do not contain distinct native ends required for the production of infectious RNA viruses. For example, T7 RNA polymerase requires a guanosine residue at the 5' end of the template polynucleotide to initiate transcription. However, SVV begins with a uridine residue at its 5' end. Thus, the T7 leader sequence, which is required for in vitro transcription of SVV transcripts, must be removed to generate the native 5'SVV ends required for the production of functional infectious SVV. Therefore, in some embodiments, recombinant DNA molecules (e.g., DNA templates) suitable for use in the production of synthetic RNA virus genomes described herein require additional non-viral 5' and 3' sequences that allow for the generation of distinct 5' and 3' ends that are naturally present in the virus. Such sequences are referred to herein as junction cleavage sequences (JCS). In some embodiments, the junction cleavage sequence acts to cleave a T7 RNA polymerase or Pol II encoded RNA transcript at the junction of the viral RNA and mammalian mRNA sequences, resulting in removal of non-viral RNA polynucleotides from the transcript to maintain the native 5' and 3' distinct ends of the virus (see diagram in Figure 9A). In some embodiments, the junction cleavage sequence acts to generate proper ends during linearization of a DNA plasmid encoding a synthetic viral genome (e.g., use of a 3' restriction enzyme recognition sequence to generate proper 3' ends immediately after linearization of the plasmid template and prior to in vitro transcription of the synthetic RNA genome).

[0147] In some embodiments, a recombinant DNA molecule (e.g., a DNA template) suitable for use in producing a synthetic RNA viral genome described herein comprises at least one 5' junction cleavage sequence and at least one 3' junction cleavage sequence. In some embodiments, a recombinant DNA molecule (e.g., a DNA template) suitable for use in producing a synthetic RNA viral genome described herein comprises one or more 5' junction cleavage sequences and at least one 3' junction cleavage sequence. In some embodiments, a recombinant DNA molecule (e.g., a DNA template) suitable for use in producing a synthetic RNA viral genome described herein comprises at least one 5' junction cleavage sequence and one or more 3' junction cleavage sequences. In some embodiments, a recombinant DNA molecule (e.g., a DNA template) suitable for use in producing a synthetic RNA viral genome described herein comprises one or more 5' junction cleavage sequences and one or more 3' junction cleavage sequences. In some embodiments, a recombinant DNA molecule (e.g., a DNA template) suitable for use in producing a synthetic RNA viral genome described herein comprises two 5' junction cleavage sequences and at least one 3' junction cleavage sequence. In some embodiments, a recombinant DNA molecule (e.g., a DNA template) suitable for use in producing a synthetic RNA viral genome described herein comprises at least one 5' junction cleavage sequence and two 3' junction cleavage sequences.

[0148] The nature of the junction cleavage sequence and the removal of non-viral RNA from the viral genome transcript can be achieved by various methods. For example, in some embodiments, the junction cleavage sequence is the target of an RNA interference (RNAi) molecule. As used herein, "RNA interference molecule" refers to an RNA polynucleotide that mediates the degradation of a target mRNA sequence via an endogenous gene silencing pathway (e.g., Dicer and RNA-induced silencing complex (RISC)). Exemplary RNA interference agents include microRNA (miRNA), artificial miRNA (amiRNA), short hairpin RNA (shRNA), and small interfering RNA (siRNA). In addition, any system for cleaving an RNA transcript at a specific site that is currently known in the art or will be defined in the future can be used to generate the individual ends that are naturally present in the virus.

[0149] In some embodiments, the RNAi molecule is a miRNA. miRNA refers to a naturally occurring small non-coding RNA molecule of about 18-25 nucleotides in length that is at least partially complementary to a target mRNA sequence. In animals, genes for miRNAs are transcribed into primary miRNAs (pri-miRNAs), which are double-stranded and form a stem-loop structure. Pri-miRNAs are then cleaved in the nucleus by the microprocessor complex, which includes class 2 RNase III, Drosha, and the microprocessor subunit, DCGR8, to form 70-100 nucleotide precursor miRNAs (pre-miRNAs). The pre-miRNAs form hairpin structures and are transported to the cytoplasm, where they are processed by the RNase III enzyme, Dicer, into miRNA duplexes of about 18-25 nucleotides. Although either strand of the duplex can function as a functional miRNA, typically one strand of the miRNA is degraded and only one strand is loaded onto Argonaute (AGO) nuclease to generate an effector RNA-induced silencing complex (RISC) in which the miRNA and its mRNA target interact (Wahid et al., 1803:11, 2010, 1231-1243). In some embodiments, the 5' and / or 3' junction cleavage sequence is a miRNA target sequence.

[0150] In some embodiments, the RNAi molecule is an artificial miRNA (amiRNA) derived from a Pol II transcript with an embedded synthetic miRNA (see, e.g., Liu et al., Nucleic Acids Res (2008) 36:9; 2811-2834; Zeng et al., Molecular Cell (2002), 9; 1327-1333; Fellman et al., Cell Reports (2013) 5; 1704-1713). In some embodiments, the 5' and / or 3' junction cleavage sequence is an amiRNA target sequence.

[0151] In some embodiments, the RNAi molecule is an siRNA molecule. siRNA refers to a double-stranded RNA molecule, typically about 21-23 nucleotides in length. Double-stranded siRNA molecules are processed in the cytoplasm by association with a multiprotein complex called the RNA-induced silencing complex (RISC), during which the "passenger" sense strand is enzymatically cleaved from the double strand. The antisense "guide" strand contained in the activated RISC then guides the RISC to the corresponding mRNA by sequence complementarity, and AGO nucleases cleave the target mRNA, causing specific gene silencing. In some embodiments, the siRNA molecule is derived from an shRNA molecule. shRNAs are single-stranded artificial RNA molecules about 50-70 nucleotides in length that form a stem-loop structure. Expression of the shRNA in cells is achieved by introducing a DNA polynucleotide encoding the shRNA by a plasmid or viral vector. The shRNA is then transcribed into a product that mimics the stem-loop structure of the pre-miRNA, and after nuclear export, the hairpin is processed by Dicer to form a double-stranded siRNA molecule, which is then further processed by RISC to mediate target gene silencing. In some embodiments, the 5' and / or 3' junction cleavage sequence is an siRNA target sequence.

[0152] In some embodiments, the junction cleavage sequence is a guide RNA (gRNA) target sequence. In such embodiments, the gRNA can be designed and introduced using a Cas endonuclease (e.g., Cas13) with RNase activity to mediate cleavage of the viral genome transcript at a precise junction site. In some embodiments, the 5' and / or 3' junction cleavage sequence is a gRNA target sequence.

[0153] In some embodiments, the junction cleavage sequence is a sequence encoding a pri-miRNA. When a polynucleotide (e.g., a recombinant RNA molecule) encoding a viral genome is transcribed, these sequences form a pri-miRNA stem-loop structure that is cleaved in the nucleus by Drosha, cleaving the transcript at the precise junction site. In some embodiments, the 5' and / or 3' junction cleavage sequence is a pri-mRNA target sequence.

[0154] In some embodiments, the junction cleavage sequence is a primer binding sequence that promotes cleavage by the endoribonuclease RNAseH. In such embodiments, primers that anneal to the 5' and / or 3' junction cleavage sequence are added to the in vitro reaction along with the RNAseH enzyme. RNAseH specifically hydrolyzes the phosphodiester bonds of RNA hybridized to DNA, thus allowing the synthetic RNA genome intermediate to be cleaved at the precise junction cleavage sequence to generate the required 5' and 3' natural ends.

[0155] In some embodiments, the junction cleavage sequence comprises or consists of a restriction enzyme recognition site, resulting in the generation of distinct ends of the viral transcript during linearization of the plasmid-templated run-off RNA synthesis with T7 RNA polymerase. In some embodiments, the junction cleavage sequence is a type IIS restriction enzyme recognition site. Type IIS restriction enzymes constitute a specific group of enzymes that recognize asymmetric DNA sequences and cleave at a defined distance outside their recognition sequence, usually within 1-20 nucleotides. Exemplary type IIS restriction enzymes include AcuI, AlwI, BaeI, BbsI, BbvI, BccI, BceAI, BcgI, BciVI, BcoDI, BfuAI, BmrI, BpmI, BpuEI, BsaI, BsaXI, BseRI, BsgI, BsmAI, BsmBi, BsmFI, BsmI, BspCNI, BspMI, BspQI, BsrDI, BsrI, BtgZI, BtsCI, BstI, CaspCI, EarI, EciI, Esp3I, FauI, FokI, HgaI, HphI, HpyAV, MbolI, MlyI, MmeI, MnlL, NmeAIII, PleI, SapI, and SfaNI. The recognition sequences of these type IIS restriction enzymes are known in the art. See the New England Biolabs website at neb.com / tools-and-resources / selection-charts / type-iis-restriction-enzymes. In some embodiments, the junction cleavage sequence comprises a SapI restriction enzyme recognition site. In some embodiments, the junction cleavage sequence comprises a BsmBI restriction enzyme recognition site. In some embodiments, the junction cleavage sequence comprises a BsaI restriction enzyme recognition site. One of skill in the art will appreciate that because the cleavage sites for type IIS restriction enzymes are typically outside of (e.g., offset by 1-5 nucleotides) the enzyme recognition site, the corresponding junction cleavage sequence may also include additional nucleotide(s) required by the corresponding restriction enzyme to generate distinct ends of the viral transcript (e.g., a polyA tail at the 3' end).

[0156] In some embodiments, the junction cleavage sequence is a sequence that codes for a ligand-induced self-cleaving ribozyme, referred to as an "aptazyme." An aptazyme is a ribozyme sequence that contains an incorporated aptamer domain that is specific for a ligand. Binding of the aptamer domain to the ligand triggers activation of the enzymatic activity of the ribozyme, thereby resulting in cleavage of the RNA transcript. Exemplary aptazymes include theophylline-dependent aptazymes (e.g., the hammerhead ribozyme linked to a theophylline-dependent aptamer described in Auslander et al., Mol BioSyst. (2010) 6, 807-814), tetracycline-dependent aptazymes (e.g., the hammerhead ribozyme linked to a theophylline-dependent aptamer described in Zhong et al., eLife 2016;5:e18858 DOI:10.7554 / eLife.18858, Win and Smolke, PNAS (2007) 104;14283-14288, Whittmann and Suess, Mol Biosyt (2011) 7;2419-2427, Xiao et al., Chem&Biol (2008) 15;125-1137, and Beilstein et al., ACS Syn Biol (2015) 4; 526-534), and guanine-dependent aptazymes (e.g., hammerhead ribozymes linked to guanine-dependent aptamers as described in Nomura et al., Chem Commun., (2012) 48(57); 7215-7217). In some embodiments, the 5' and / or 3' junction cleavage sequences are sequences encoding an aptazyme.

[0157] In some embodiments, the junction cleavage sequence is a target sequence of an RNAi molecule (e.g., an siRNA molecule, an shRNA molecule, an miRNA molecule, or an amiRNA molecule), a gRNA molecule, or an RNAseH primer. In such embodiments, the junction cleavage sequence is at least partially complementary to the sequence of the RNAi molecule, the gRNA molecule, or the primer molecule. Methods of sequence alignment for comparison and determination of percent sequence identity and percent complementarity are well known in the art. Optimal alignment of sequences for comparison can be determined, for example, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443, by the similarity search method of Pearson and Lipman, (1988) Proc. Nat'l. Acad. Sci. USA 85:2444, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), by manual alignment and visual inspection (see, for example, Brent et al., (2003) Current Protocols in Molecular Biology), by the method of Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402 and Altschul et al. This can be done by using algorithms known in the art, including the BLAST and BLAST 2.0 algorithms described in, respectively, U.S. Patent No. 6,319,962 and U.S. Patent No. 6,319,962. Software for performing BLAST analyses is publicly available from the National Center for Biotechnology Information.

[0158] In some embodiments, the 5' junction cleavage sequence and the 3' junction cleavage sequence are from the same group (e.g., both are RNAi target sequences, both are ribozyme coding sequences, etc.). For example, in some embodiments, the junction cleavage sequence is an RNAi target sequence (e.g., an siRNA, shRNA, amiRNA, or miRNA target sequence) and is incorporated into the 5' and 3' ends of a polynucleotide (e.g., a recombinant RNA molecule) encoding a viral genome. In such embodiments, the 5' and 3' RNAi target sequences can be the same (i.e., the same siRNA, amiRNA, or miRNA target) or different (i.e., the 5' sequence is the target of one siRNA, shmiRNA, or miRNA and the 3' sequence is the target of another siRNA, amiRNA, or miRNA). In some embodiments, the junction cleavage sequence is a guide RNA target sequence and is incorporated into the 5' and 3' ends of a polynucleotide (e.g., a recombinant RNA molecule) encoding a viral genome. In such embodiments, the 5' and 3' gRNA target sequences can be the same (i.e., targets of the same gRNA) or different (i.e., the 5' sequence is a target of one gRNA and the 3' sequence is a target of another gRNA). In some embodiments, the junction cleavage sequence is a sequence encoding a pri-mRNA and is incorporated at the 5' and 3' ends of a polynucleotide sequence encoding a viral genome (e.g., a recombinant RNA molecule). In some embodiments, the junction cleavage sequence is a sequence encoding a ribozyme and is incorporated immediately 5' and 3' to a polynucleotide sequence encoding a viral genome (e.g., a recombinant RNA molecule).

[0159] In some embodiments, the 5' junction cleavage sequence and the 3' junction cleavage sequence are from the same group but are different variants or types. For example, in some embodiments, the 5' and 3' junction cleavage sequence can be the target sequence of an RNAi molecule, the 5' junction cleavage sequence is a siRNA target sequence, and the 3' junction cleavage sequence is a miRNA target sequence (or vice versa). In some embodiments, the 5' and 3' junction cleavage sequence can be a sequence encoding a ribozyme, the 5' junction cleavage sequence is a sequence encoding a hammerhead ribozyme, and the 3' junction cleavage sequence is a sequence encoding a hepatitis delta virus ribozyme.

[0160] In some embodiments, the 5' junction cleavage sequence and the 3' junction cleavage sequence are different types. For example, in some embodiments, the 5' junction cleavage sequence is an RNAi target sequence (e.g., an siRNA, an amiRNA, or an miRNA target sequence), and the 3' junction cleavage sequence is a ribozyme sequence, an aptazyme sequence, a pri-miRNA sequence, or a gRNA target sequence. In some embodiments, the 5' junction cleavage sequence is a ribozyme sequence, and the 3' junction cleavage sequence is an RNAi target sequence (e.g., an siRNA, an amiRNA, or an miRNA target sequence), an aptazyme sequence, a sequence encoding a pri-miRNA, or a gRNA target sequence. In some embodiments, the 5' junction cleavage sequence is an aptazyme sequence, and the 3' junction cleavage sequence is an RNAi target sequence (e.g., an siRNA, an amiRNA, or an miRNA target sequence), a ribozyme sequence, a pri-miRNA sequence, or a gRNA target sequence. In some embodiments, the 5' junction cleavage sequence is a pri-miRNA sequence and the 3' junction cleavage sequence is an RNAi target sequence (e.g., an siRNA, amiRNA, or miRNA target sequence), a ribozyme sequence, an aptazyme sequence, or a gRNA target sequence. In some embodiments, the 5' junction cleavage sequence is a gRNA target sequence and the 3' junction cleavage sequence is an RNAi target sequence (e.g., an siRNA, amiRNA, or miRNA target sequence), a ribozyme sequence, a pri-miRNA sequence, or an aptazyme sequence.

[0161] Exemplary locations of the junction cleavage sequences relative to the polynucleotide encoding the synthetic viral genome are shown in Tables 3 and 4 below. [Table 3] [Table 4-1] [Table 4-2]

[0162] In some embodiments, the junction cleavage sequence is a ribozyme coding sequence that mediates self-cleavage of the synthetic RNA genome intermediate to generate the native individual 5' and / or 3' ends required for the production of the final synthetic viral RNA genome and subsequent infectious RNA virus. Exemplary ribozymes include hammerhead ribozymes (e.g., the hammerhead ribozyme shown in FIG. 5A), Varkud satellite (VS) ribozyme, hairpin ribozyme, GIR1 branched ribozyme, glmS ribozyme, twister ribozyme, twister sister ribozyme (e.g., twister sister 1 or twister sister 2), pistol ribozyme (e.g., the pistol ribozyme shown in FIG. 6A-B and FIG. 7, Env25 pistol ribozyme, or Alistipes Putredinis pistol ribozyme), hatchet ribozyme, and hepatitis delta virus ribozyme. In some embodiments, the 5' and / or 3' junction cleavage sequence is a ribozyme coding sequence.

[0163] In some embodiments, the 5' junction cleavage sequence comprises or consists of a ribozyme sequence. In some embodiments, the 5' ribozyme sequence is selected from a hammerhead ribozyme sequence, a pistol ribozyme sequence, or a twister sister ribozyme sequence.

[0164] In some embodiments, the 5' junction cleavage sequence comprises or consists of a 5' pistol-type ribozyme sequence. In some embodiments, the 5' pistol-type ribozyme sequence is derived from P. polymyxa. In some embodiments, the 5' pistol-type ribozyme sequence derived from P. polymyxa comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) with any one of SEQ ID NOs: 16-19 and 23-24. In some embodiments, the 5' pistol-type ribozyme sequence comprises a P2 motif as shown in Figures 6A and 6C, which is 4 nucleotides in length and located in a region corresponding to nucleic acid positions 27-30 of SEQ ID NOs: 16-19 and 23-24. In some embodiments, the 5' pistol ribozyme sequence from P. polymyxa comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to SEQ ID NO: 17, and the polynucleotide sequence of the P2 motif is "TTTA". In some embodiments, the 5' pistol ribozyme sequence from P. polymyxa comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to SEQ ID NO: 18, and the polynucleotide sequence of the P2 motif is "TTTT".In some embodiments, the 5' pistol-style ribozyme sequence from P. polymyxa comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 19 (including all ranges and subranges therebetween), and the polynucleotide sequence of the P2 motif is "TTGT". In some embodiments, the 5' pistol-style ribozyme sequence is incorporated into a recombinant DNA molecule for in vitro transcription of a Coxsackievirus (e.g., CVA21) RNA virus genome.

[0165] In some embodiments, the 5' junction cleavage sequence comprises or consists of a 5' pistol-type ribozyme sequence. In some embodiments, the 5' pistol-type ribozyme sequence is derived from P. polymyxa. In some embodiments, the 5' pistol-type ribozyme sequence derived from P. polymyxa comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:64 or 65 (including all ranges and subranges therebetween). In some embodiments, the 5' pistol-type ribozyme sequence includes a P2 motif that is 4 nucleotides in length and is located in a region corresponding to nucleic acid positions 27-30 of SEQ ID NO:64 or 65. In some embodiments, the 5' pistol ribozyme sequence from P. polymyxa comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to SEQ ID NO:64, and the polynucleotide sequence of the P2 motif is "TCAA". In some embodiments, the 5' pistol ribozyme sequence from P. polymyxa comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to SEQ ID NO:65, and the polynucleotide sequence of the P2 motif is "TTAA". In some embodiments, a 5' pistol-type ribozyme sequence is incorporated into a recombinant DNA molecule for in vitro transcription of the SVV (eg, SVV-IRES-2) RNA viral genome.

[0166] In some embodiments, the 5' junction cleavage sequence comprises or consists of an ENV27 ribozyme coding sequence. In some embodiments, the Env27 ribozyme coding sequence comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to any one of SEQ ID NOs: 130-134. In some embodiments, the Env27 ribozyme coding sequence comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to SEQ ID NO: 132.

[0167] In some embodiments, the ENV27 ribozyme coding sequence contains a modification (e.g., an insertion) in the P3 stem insert region, which is the region corresponding to nucleotides 49-54 of SEQ ID NO: 132. Without wishing to be bound by any particular theory, it is hypothesized that extending the P3 stem insert region may aid in the folding and / or cleavage efficiency of the ENV27 ribozyme. In some embodiments, the ENV27 ribozyme coding sequence includes a P3 stem insert that is about 1-30, about 1-25, about 1-20, about 1-15, about 1-10, about 5-30, about 5-25, about 5-20, about 5-15, about 5-10, about 6-30, about 6-25, about 6-20, about 6-15, or about 6-10 polynucleotides in length. In some embodiments, the ENV27 ribozyme coding sequence comprises a P3 stem insert of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 polynucleotides in length. In some embodiments, the P3 stem insert comprises or consists of the polynucleotide "AGATCT" in the region corresponding to nucleotides 49-54 of SEQ ID NO:132. In some embodiments, the P3 stem insert comprises or consists of the polynucleotide "AGAGAAATCT" (SEQ ID NO:137) in the region corresponding to nucleotides 49-54 of SEQ ID NO:132. In some embodiments, the P3 stem insert comprises or consists of the polynucleotide "AGAACGAGAAATCGTTCT" (SEQ ID NO:138) in the region corresponding to nucleotides 49-54 of SEQ ID NO:132.

[0168] In some embodiments, the Env27 ribozyme coding sequence comprises or consists of a sequence (excluding the P3 stem insert region) that has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to SEQ ID NO:132 (excluding its P3 stem insert corresponding to nucleotides 49-54 of SEQ ID NO:132). In some embodiments, the ENV27 ribozyme coding sequence comprises or consists of a sequence (excluding the P3 stem insert region) that is 100% identical to SEQ ID NO:132 (excluding its P3 stem insert corresponding to nucleotides 49-54 of SEQ ID NO:132). In some embodiments, the ENV27 ribozyme coding sequence comprises or consists of a sequence (excluding the P3 stem insert region) that has at most 1, at most 2, at most 3, at most 5, at most 5, at most 6, at most 7, at most 8, at most 8, at most 10, or at most 11 mutations (insertions, deletions, or substitutions) compared to SEQ ID NO: 132 (excluding the P3 stem insert corresponding to nucleotides 49-54 of SEQ ID NO: 132). In some embodiments, such mutation(s) are substitution(s).

[0169] In some embodiments, the ENV27 ribozyme coding sequence comprises the polynucleotide "TTTATT" at positions corresponding to nucleotides 25-30 of SEQ ID NO:132.

[0170] In some embodiments, the ENV27 ribozyme coding sequence comprises the polynucleotide "TTTGTT" at positions corresponding to nucleotides 25-30 of SEQ ID NO:132.

[0171] In some embodiments, the ENV27 sequence is incorporated into a recombinant DNA molecule for in vitro transcription of a Coxsackievirus (eg, CVA21) RNA virus genome.

[0172] In some embodiments, the disclosure provides a plurality of recombinant RNA molecules transcribed from a recombinant DNA molecule of the disclosure. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% of the recombinant RNA molecules comprise 5' and 3' ends that are originally present in the viral genome encoded by the recombinant RNA molecule. In some embodiments, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5%, or no more than 0.1% of the recombinant RNA molecules comprise an RNA sequence encoded by an ENV27 ribozyme coding sequence. In some embodiments, at least one of the recombinant RNA molecules comprises an RNA sequence encoded by an ENV27 ribozyme coding sequence. In some embodiments, at least 0.0001%, at least 0.001%, at least 0.01%, at least 0.1%, or at least 1% of the recombinant RNA molecules comprise an ENV27 ribozyme (encoded by an ENV27 ribozyme coding sequence).

[0173] In some embodiments, the 5' junction cleavage sequence comprises or consists of the Env25 pistol ribozyme. In some embodiments, the DNA sequence encoding the Env25 pistol ribozyme comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:96 (including all ranges and subranges therebetween). In some embodiments, the Env25 pistol ribozyme RNA sequence comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:100 (including all ranges and subranges therebetween).

[0174] In some embodiments, the 5' junction cleavage sequence comprises or consists of the Alistipes Putredinis pistol ribozyme. In some embodiments, the DNA sequence encoding the Alistipes Putredinis pistol ribozyme comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 97 (including all ranges and subranges therebetween). In some embodiments, the Alistipes Putredinis pistol ribozyme RNA sequence comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 101 (including all ranges and subranges therebetween).

[0175] In some embodiments, the 5' junction cleavage sequence comprises or consists of a twister sister 1 ribozyme. In some embodiments, the DNA sequence encoding the twister sister 1 ribozyme comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:98 (including all ranges and subranges therebetween). In some embodiments, the twister sister 1 ribozyme RNA sequence comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:102 (including all ranges and subranges therebetween).

[0176] In some embodiments, the 5' junction cleavage sequence comprises or consists of a twister sister 2 ribozyme. In some embodiments, the DNA sequence encoding the twister sister 2 ribozyme comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 99 (including all ranges and subranges therebetween). In some embodiments, the twister sister 2 ribozyme RNA sequence comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 103 (including all ranges and subranges therebetween).

[0177] Leader sequence In some embodiments, the recombinant DNA molecule (e.g., the DNA template) comprises a leader sequence between the promoter sequence and the 5' junction cleavage sequence. In some embodiments, the presence of the leader sequence facilitates or ensures proper folding of a downstream 5' junction cleavage sequence (e.g., a 5' ribozyme sequence).

[0178] In some embodiments, the leader sequence is about 5 bp, about 10 bp, about 15 bp, about 20 bp, about 25 bp, about 30 bp, about 35 bp, about 40 bp, about 45 bp, about 50 bp, about 55 bp, about 60 bp, about 65 bp, about 70 bp, about 75 bp, about 80 bp, about 85 bp, about 90 bp, about 95 bp, or about 100 bp in length, including all ranges and subranges therebetween. In some embodiments, the leader sequence is at least 5 bp, at least 10 bp, at least 15 bp, at least 20 bp, at least 25 bp, at least 30 bp, at least 35 bp, at least 40 bp, at least 45 bp, at least 50 bp, at least 55 bp, at least 60 bp, at least 65 bp, at least 70 bp, at least 75 bp, at least 80 bp, at least 85 bp, at least 90 bp, at least 95 bp, or at least 100 bp in length, including all ranges and subranges therebetween. In some embodiments, the leader sequence is less than 5 bp, less than 10 bp, less than 15 bp, less than 20 bp, less than 25 bp, less than 30 bp, less than 35 bp, less than 40 bp, less than 45 bp, less than 50 bp, less than 55 bp, less than 60 bp, less than 65 bp, less than 70 bp, less than 75 bp, less than 80 bp, less than 85 bp, less than 90 bp, less than 95 bp, or less than 100 bp in length, including all ranges and subranges therebetween. In some embodiments, the leader sequence is about 50-70 bp, about 40-60 bp, about 60-80 bp, about 40-80 bp, about 30-70 bp, about 50-90 bp, about 30-90 bp, about 20-60 bp, or about 60-100 bp in length, including all ranges and subranges therebetween. In some embodiments, the leader sequence is about 57 bp or about 55-60 bp in length.

[0179] In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to any one of SEQ ID NOs: 13-15. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence according to any one of SEQ ID NOs: 13-15. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to SEQ ID NO: 15. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence according to SEQ ID NO: 15. In some embodiments, the leader sequence is followed or immediately followed by a 5' pistol-type ribozyme sequence (e.g., a pistol-type ribozyme from P. Polymyxa or a variant thereof). In some embodiments, the leader sequence is incorporated into a recombinant DNA molecule (e.g., a DNA template) for in vitro transcription of the CVA21 RNA viral genome.

[0180] In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to any one of SEQ ID NOs: 135-136. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence according to any one of SEQ ID NOs: 135-136. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to SEQ ID NO: 135. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence according to SEQ ID NO: 135. In some embodiments, the leader sequence is followed or immediately followed by an ENV27 ribozyme sequence (e.g., any one of SEQ ID NOs: 130-134 or a variant thereof). In some embodiments, the leader sequence is incorporated into a recombinant DNA molecule (e.g., a DNA template) for in vitro transcription of the CVA21 RNA viral genome.

[0181] In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to any one of SEQ ID NOs: 53-63. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to any one of SEQ ID NOs: 53-60 and 62-63. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence according to any one of SEQ ID NOs: 53-60 and 62-63.

[0182] In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to SEQ ID NO: 53. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence according to SEQ ID NO:53.

[0183] In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity (including all ranges and subranges therebetween) to SEQ ID NO: 58. In some embodiments, the leader sequence comprises or consists of a polynucleotide sequence according to SEQ ID NO:58.

[0184] In some embodiments, the leader sequence is followed or immediately followed by a 5' pistol ribozyme sequence (e.g., a pistol ribozyme according to SEQ ID NO: 64 or 65 or a variant thereof). In some embodiments, the leader sequence is incorporated into a recombinant DNA molecule (e.g., a DNA template) for in vitro transcription of the SVV RNA viral genome.

[0185] Poly A tail In some embodiments, the recombinant DNA molecule (e.g., the DNA template) includes a sequence encoding a polyA tail. In some embodiments, the polyA tail is added to the 3' end of the synthetic RNA viral genome. In some embodiments, the polyA tail is 2-500 bp in length (i.e., 2-500 pA). In some embodiments, the polyA tail is 2-100, 2-150, 2-200, 2-250, 2-300, 2-400, or 2-500 bp in length, including all ranges and subranges therebetween. In some embodiments, the polyA tail is about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 bp in length, including all ranges and subranges therebetween. In some embodiments, the polyA tail is about 10-30, 20-40, 30-50, 40-60, 50-70, 60-80, 70-90, 80-100, 90-110, 100-120, 110-130, 120-140, 130-150, 140-160, 150-170, 160-180, 170-190, or 180-200 bp in length, including all ranges and subranges therebetween. In some embodiments, the polyA tail is about 65-75, 60-80, 55-85, 50-90, 45-95, or 40-100 bp in length, including all ranges and subranges therebetween. In some embodiments, the polyA tail is about 70 bp in length. In some embodiments, a longer polyA tail (e.g., about 70 bp in length) improves the loading capacity of a synthetic RNA viral genome in oligo-dT chromatography compared to a corresponding synthetic RNA viral genome having a shorter polyA tail (e.g., about 30 bp in length).In some embodiments, the loading capacity is improved by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 7-fold, or at least 10-fold compared to a synthetic RNA viral genome with a polyA tail of about 30 bp in length.

[0186] Non-Limiting Examples of Recombinant DNA Molecule Design In some embodiments, the synthetic RNA viral genomes described herein are produced in vitro by in vitro RNA transcription (see, e.g., diagrams in Figures 8, 9A, 9B, and 10A). The synthetic RNA viral genomes are then purified and formulated for therapeutic use (e.g., encapsulated in lipid nanoparticles).

[0187] In some embodiments, a recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' junction cleavage sequence that comprises or consists of a ribozyme sequence, (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises or consists of a ribozyme sequence. In some embodiments, a recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' hammerhead ribozyme sequence (e.g., a wild-type HHR or a modified HHR, e.g., those provided in Figures 5A and 5B), (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' hepatitis delta virus ribozyme sequence.

[0188] In some embodiments, a recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' junction cleavage sequence that comprises or consists of a ribozyme sequence, (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises a restriction enzyme recognition site. In some embodiments, a recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' hammerhead ribozyme sequence (e.g., a wild-type HHR or a modified HHR, such as those provided in Figures 5A and 5B), (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises or consists of a SapI restriction enzyme recognition site.

[0189] In some embodiments, a recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' junction cleavage sequence that comprises or consists of a ribozyme sequence, (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises or consists of a restriction enzyme recognition site. In some embodiments, a DNA template comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' hammerhead ribozyme sequence (e.g., a wild-type HHR or a modified HHR, e.g., those provided in Figures 5A and 5B), (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises or consists of a BsaI restriction enzyme recognition site.

[0190] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' junction cleavage sequence that comprises or consists of an ENV27 ribozyme sequence, (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises or consists of a SapI restriction enzyme recognition site.

[0191] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' junction cleavage sequence that comprises or consists of an ENVY27 ribozyme sequence, (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises or consists of a BsaI restriction enzyme recognition site.

[0192] In some embodiments, a recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' junction cleavage sequence that comprises or consists of a 5' RNAseH primer binding site, (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises a restriction enzyme recognition site. In some embodiments, a recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', a polynucleotide comprising: (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' junction cleavage sequence that comprises or consists of a 5' RNAseH primer binding site, (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises or consists of a SapI restriction enzyme recognition site.

[0193] In some embodiments, a recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' junction cleavage sequence that comprises or consists of a 5' RNAseH primer binding site, (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises a restriction enzyme recognition site. In some embodiments, a recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', a polynucleotide comprising: (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a 5' junction cleavage sequence that comprises or consists of a 5' RNAseH primer binding site, (iii) a polynucleotide encoding a synthetic RNA viral genome, and (iv) a 3' junction cleavage sequence that comprises or consists of a BsaI restriction enzyme recognition site.

[0194] In some embodiments, the synthetic RNA virus genome is a Coxsackievirus (CVA) genome. In some embodiments, the Coxsackievirus is a CVA21 strain. In some embodiments, the CVA21 strain is an EF strain. In some embodiments, the CVA21 strain is a KY strain.

[0195] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) an optional leader sequence, (iii) a 5' junction cleavage sequence that comprises or consists of an ENV27 ribozyme sequence, (iv) a polynucleotide encoding a synthetic RNA viral genome, (v) a polyA tail (e.g., about 20-80 bp in length, or about 30-70 bp in length), and (vi) a 3' junction cleavage sequence that comprises or consists of a restriction enzyme recognition site (e.g., for BsmBI or BsaI restriction enzymes).

[0196] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a leader sequence (e.g., SEQ ID NO: 135 or 136), (iii) a 5' junction cleavage sequence comprising or consisting of a 5' pistol-type ribozyme sequence (e.g., a pistol-type ribozyme from P. Polymyxa or a variant thereof), (iv) a polynucleotide encoding the CVA21 synthetic RNA viral genome, (v) a polyA tail (e.g., about 20-80 bp in length, or about 30-70 bp in length), and (vi) a 3' junction cleavage sequence comprising or consisting of a BsmBI restriction enzyme recognition site.

[0197] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a leader sequence (e.g., SEQ ID NO: 135 or 136), (iii) a 5' junction cleavage sequence comprising or consisting of a 5' pistol-type ribozyme sequence (e.g., a pistol-type ribozyme from P. Polymyxa or a variant thereof), (iv) a polynucleotide encoding the CVA21 synthetic RNA viral genome, (v) a polyA tail (e.g., about 20-80 bp in length, or about 30-70 bp in length), and (vi) a 3' junction cleavage sequence comprising or consisting of a BsaI restriction enzyme recognition site.

[0198] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a leader sequence according to SEQ ID NO: 135, (iii) a 5' junction cleavage sequence comprising or consisting of an ENV27 ribozyme sequence, (iv) a polynucleotide encoding a CVA21 synthetic RNA viral genome, (v) a polyA tail, and (vi) a 3' junction cleavage sequence comprising or consisting of a BsmBI restriction enzyme recognition site, wherein the combination of the 5' ENV27 ribozyme sequence and polyA tail is selected from one of embodiments E1 to E68 provided in Table 5 below.

[0199] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a leader sequence according to SEQ ID NO: 135, (iii) a 5' junction cleavage sequence comprising or consisting of an ENV27 ribozyme sequence, (iv) a polynucleotide encoding a CVA21 synthetic RNA viral genome, (v) a polyA tail, and (vi) a 3' junction cleavage sequence comprising or consisting of a BsaI restriction enzyme recognition site, wherein the combination of the 5' ENV27 ribozyme sequence and polyA tail is selected from one of embodiments E1 to E68 provided in Table 5 below.

[0200] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a leader sequence according to SEQ ID NO: 136, (iii) a 5' junction cleavage sequence comprising or consisting of an ENV27 ribozyme sequence, (iv) a polynucleotide encoding a CVA21 synthetic RNA viral genome, (v) a polyA tail, and (vi) a 3' junction cleavage sequence comprising or consisting of a BsmBI restriction enzyme recognition site, wherein the combination of the 5' ENV27 ribozyme sequence and polyA tail is selected from one of embodiments E1 to E68 provided in Table 5 below.

[0201] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a promoter sequence (e.g., a T7 polymerase promoter), (ii) a leader sequence according to SEQ ID NO: 136, (iii) a 5' junction cleavage sequence that comprises or consists of an ENV27 ribozyme sequence, (iv) a polynucleotide encoding a CVA21 synthetic RNA viral genome, (v) a polyA tail, and (vi) a 3' junction cleavage sequence that comprises or consists of a BsaI restriction enzyme recognition site, wherein the combination of the 5' ENV27 ribozyme sequence and the polyA tail is selected from one of embodiments E1 to E68 provided in Table 5 below. [Table 5-1] [Table 5-2] [Table 5-3]

[0202] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a T7 polymerase promoter sequence, (ii) a leader sequence according to SEQ ID NO: 135, (iii) a 5' junction cleavage sequence comprising or consisting of a 5' ENV27 ribozyme sequence according to SEQ ID NO: 132, (iv) a polynucleotide encoding a CVA21 synthetic RNA viral genome, (v) a polyA tail (e.g., a polyA tail of about 70 bp, about 60-80 bp, or about 50-90 bp in length), and (vi) a 3' junction cleavage sequence comprising or consisting of a BsmBI restriction enzyme recognition site.

[0203] In some embodiments, the recombinant DNA molecule (e.g., a DNA template) comprises, from 5' to 3', (i) a T7 polymerase promoter sequence, (ii) a leader sequence according to SEQ ID NO: 135, (iii) a 5' junction cleavage sequence comprising or consisting of a 5' ENV27 ribozyme sequence according to SEQ ID NO: 132, (iv) a polynucleotide encoding a CVA21 synthetic RNA viral genome, (v) a polyA tail (e.g., a polyA tail of about 70 bp, about 60-80 bp, or about 50-90 bp in length), and (vi) a 3' junction cleavage sequence comprising or consisting of a BsaI restriction enzyme recognition site.

[0204] Exemplary embodiments of DNA templates encoding the CVA viral genome are provided in Table 18 below. [Table 18]

[0205] Particles containing synthetic RNA genomes In some embodiments, the synthetic RNA genomes described herein are encapsulated in a "particle." As used herein, a particle refers to a non-tissue derived composition of matter such as a liposome, lipoplex, nanoparticle, nanocapsule, microparticle, microsphere, lipid particle, exosome, vesicle, etc. In certain embodiments, the particle is non-proteinaceous and non-immunogenic. In such embodiments, the encapsulation of the synthetic RNA genomes described herein allows for the delivery of viral genomes without inducing a systemic anti-viral immune response, mitigating the effects of neutralizing anti-viral antibodies. Additionally, the encapsulation of the synthetic RNA genomes described herein protects the genome from degradation, facilitating introduction into target host cells. In some embodiments, the present disclosure provides a nanoparticle comprising the synthetic RNA genomes described herein. In some embodiments, the nanoparticle is a lipid nanoparticle. In some embodiments, the nanoparticle further comprises a second RNA molecule encoding a payload molecule.

[0206] In some embodiments, the particle is biodegradable in the subject.In such embodiments, multiple doses of the particle can be administered to the subject without the particle accumulating in the subject.Examples of suitable particles include polystyrene particles, poly(lactic-co-glycolic acid) PLGA particles, polypeptide-based cationic polymer particles, cyclodextrin particles, chitosan, N,N,N-trimethylchitosan particles, lipid-based particles, poly(β-amino ester) particles, low molecular weight polyethyleneimine particles, polyphosphoester particles, disulfide cross-linked polymer particles, polyamidoamine particles, polyethyleneimine (PEI) particles, and PLURIONICS stabilized polypropylene sulfide particles.

[0207] In some embodiments, the polynucleotides described herein are encapsulated in inorganic particles. In some embodiments, the inorganic particles are gold nanoparticles (GNPs), gold nanorods (GNRs), magnetic nanoparticles (MNPs), magnetic nanotubes (MNTs), carbon nanohorns (CNHs), carbon fullerenes, carbon nanotubes (CNTs), calcium phosphate nanoparticles (CPNPs), mesoporous silica nanoparticles (MSNs), silica nanotubes (SNTs), or star-shaped hollow silica nanoparticles (SHNPs).

[0208] Preferably, the particles described herein are nanoscopic in size to enhance solubility, avoid potential complications caused by phagocytic clearance and aggregation in vivo, and promote pinocytosis. In some embodiments, the particles have an average diameter of less than about 1000 nm. In some embodiments, the particles have an average diameter of less than about 500 nm. In some embodiments, the particles have an average diameter of about 30 to about 100 nm, about 50 to about 100 nm, or about 75 to about 100 nm. In some embodiments, the particles have an average diameter of about 30 to about 75 nm, or about 30 to about 50 nm. In some embodiments, the particles have an average diameter of about 100 to about 500 nm. In some embodiments, the particles have an average diameter of about 200 to 400 nm. In some embodiments, the particles have an average diameter of about 350 nm.

[0209] Exosomes In some embodiments, the synthetic RNA genomes described herein are encapsulated in exosomes. Exosomes are small membrane vesicles of endocytic origin that are released into the extracellular environment after multivesicular bodies fuse with the plasma membrane of a parent cell (e.g., the cell from which the exosomes are released, also referred to herein as a donor cell). The surface of the exosome comprises a lipid bilayer derived from the plasma membrane of the parent cell and may further comprise membrane proteins expressed on the parent cell surface. In some embodiments, the exosome may also comprise cytosol from the parent cell. Exosomes are produced by many different cell types, including epithelial cells, B and T lymphocytes, mast cells (MCs), and dendritic cells (DCs), and have been identified in plasma, urine, bronchoalveolar lavage fluid, intestinal epithelial cells, and tumor tissue. The composition of exosomes depends on the parent cell type from which they are derived, so there are no "exosome-specific" proteins. However, many exosomes contain proteins associated with the intracellular vesicles from which they arose in the parent cell (e.g., proteins associated with and / or expressed by endosomes and lysosomes). For example, exosomes can be enriched in antigen-presenting molecules such as major histocompatibility complexes I and II (MHC-I and MHC-II), tetraspanins (e.g., CD63), several heat shock proteins, cytoskeletal components such as actin and tubulin, proteins involved in intracellular membrane fusion, cell-cell interaction molecules (e.g., CD54), signaling proteins, and cytosolic enzymes.

[0210] Exosomes can mediate the transfer of cellular proteins from one cell (e.g., a parent cell) to a target or recipient cell by fusing the exosome membrane with the plasma membrane of the target cell. Thus, modifying the material encapsulated by exosomes provides a mechanism by which exogenous agents, such as the polynucleotides described herein, can be introduced into target cells. Exosomes that have been modified to contain one or more exogenous agents (e.g., the polynucleotides described herein) are referred to herein as "modified exosomes." In some embodiments, modified exosomes are produced by introducing an exogenous agent (e.g., the polynucleotides described herein) into a parent cell. In such embodiments, the exogenous nucleic acid is introduced into a parent exosome-producing cell such that the exogenous nucleic acid itself, or a transcript of the exogenous nucleic acid, is incorporated into modified exosomes produced from the parent cell. Exogenous nucleic acid can be introduced into the parent cell by means known in the art, such as by transduction, transfection, transformation, electroporation, and / or microinjection of the exogenous nucleic acid.

[0211] In some embodiments, modified exosomes are generated by directly introducing a synthetic RNA genome described herein into an exosome. In some embodiments, a synthetic RNA genome described herein is introduced into an intact exosome. "Intact exosomes" refers to exosomes that contain proteins and / or genetic material derived from the parent cell that produces them. Methods for obtaining intact exosomes are known in the art (see, for example, Alvarez-Erviti L.et al., Nat Biotechnol. 2011 Apr;29(4):34-5; Ohno S,et al., Mol Ther 2013 Jan;21(l):185-91; and European Patent Publication No. 2010663).

[0212] In certain embodiments, the synthetic RNA genome is introduced into empty exosomes. "Empty exosomes" refers to exosomes that lack proteins and / or genetic material (e.g., DNA or RNA) derived from a parent cell. Methods for producing empty exosomes (e.g., lacking genetic material from a parent cell) are known in the art and include UV exposure, mutation / deletion of endogenous proteins that mediate the loading of nucleic acids into exosomes, and electroporation and chemical treatments to open pores in the exosome membrane so that endogenous genetic material exits the exosome through the opened pores. In some embodiments, empty exosomes are produced by opening exosomes by treatment with an aqueous solution having a pH of about 9 to about 14 to obtain exosome membranes, removing intravesicular components (e.g., intravesicular proteins and / or nucleic acids), and reassembling the exosome membranes to form empty exosomes. In some embodiments, intravesicular components (e.g., intravesicular proteins and / or nucleic acids) are removed by ultracentrifugation or density gradient ultracentrifugation. In some embodiments, the membrane is reassembled by sonication, mechanical vibration, extrusion through a porous membrane, electric current, or a combination of one or more of these techniques. In certain embodiments, the membrane is reassembled by sonication.

[0213] In some embodiments, loading intact or empty exosomes with the synthetic RNA genomes described herein to generate modified exosomes can be accomplished using conventional molecular biology techniques, such as in vitro transformation, transfection, and / or microinjection. In some embodiments, an exogenous agent (e.g., a polynucleotide described herein) is directly introduced into intact or empty exosomes by electroporation. In some embodiments, an exogenous agent (e.g., a polynucleotide described herein) is directly introduced into intact or empty exosomes by lipofection (e.g., transfection). Lipofection kits suitable for use in generating exosomes according to the present disclosure are known in the art and are commercially available (e.g., FuGENE® HD Transfection Reagent from Roche and LIPOFECTAMINE™ 2000 from Invitrogen). In some embodiments, an exogenous agent (e.g., a polynucleotide described herein) is directly introduced into intact or empty exosomes by transformation using heat shock. In such an embodiment, exosomes isolated from parent cells may be treated with Ca to permeabilize the exosome membrane. 2+ (CaCl 2 The exosomes are cooled in the presence of divalent cations such as 1,2-dichlorophenyl ether (DMSO) in 1000° C. The exosomes can then be incubated with exogenous nucleic acid and briefly heat shocked (e.g., incubated at 42° C. for 30-120 seconds). In certain embodiments, loading of the empty exosomes with an exogenous agent (e.g., a polynucleotide described herein) can be accomplished by mixing or co-incubating the agent with the exosome membrane following removal of intravesicular components. Thus, modified exosomes reassembled from the exosome membrane will incorporate the exogenous agent in the intravesicular space. Additional methods for producing exosome-encapsulated nucleic acids are known in the art (see, e.g., U.S. Pat. Nos. 9,889,210, 9,629,929, and 9,085,778; International PCT Publication Nos. WO2017 / 161010 and WO2018 / 039119).

[0214] Exosomes can be obtained from a number of different parental cells, including cell lines, bone marrow-derived cells, and cells derived from primary patient samples. Exosomes released from parental cells can be isolated from the supernatant of parental cell cultures by means known in the art. For example, physical properties of exosomes can be exploited to separate exosomes from culture media or other source materials, including separation based on charge (e.g., electrophoretic separation), size (e.g., filtration, molecular sieving, etc.), density (e.g., conventional or gradient centrifugation), and Svedberg constant (e.g., sedimentation with or without external forces, etc.). Alternatively, or in addition, isolation can be based on one or more biological properties, which can include methods that utilize surface markers (e.g., for precipitation, reversible binding to solid phases, FACS separation, specific ligand binding, nonspecific ligand binding, etc.). Analysis of exosome surface proteins can be determined by flow cytometry using fluorescently labeled antibodies against exosome-associated proteins, such as CD63. Additional markers for characterizing exosomes are described in International PCT Publication No. WO2017 / 161010. In still further contemplated methods, exosomes can also be fused using chemical and / or physical methods, including PEG-induced fusion and / or ultrasonic fusion.

[0215] In some embodiments, size exclusion chromatography can be utilized to isolate exosomes. In some embodiments, exosomes can be further isolated after chromatographic separation (in one or more chromatographic fractions) by centrifugation techniques, as is widely known in the art. In some embodiments, isolation of exosomes can involve a combination of methods, including, but not limited to, differential centrifugation as previously described (see, e.g., Raposo, G. et al., J. Exp. Med. 183, 1161-1172 (1996)), ultracentrifugation, size-based membrane filtration, concentration, and / or rate zonal centrifugation.

[0216] In some embodiments, the exosome membrane comprises one or more of phospholipids, glycolipids, fatty acids, sphingolipids, phosphoglycerides, sterols, cholesterol, and phosphatidylserine.Furthermore, the membrane can comprise one or more polypeptides and one or more polysaccharides, such as glycans.Exemplary exosome membrane compositions and methods for modifying the relative amounts of one or more membrane components are described in International PCT Publication No. WO2018 / 039119.

[0217] In some embodiments, the particles are exosomes and have a diameter of about 30 to about 100 nm, about 30 to about 200 nm, or about 30 to about 500 nm. In some embodiments, the particles are exosomes and have a diameter of about 10 nm to about 100 nm, about 20 nm to about 100 nm, about 30 nm to about 100 nm, about 40 nm to about 100 nm, about 50 nm to about 100 nm, about 60 nm to about 100 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 100 nm to about 200 nm, about 100 nm to about 150 nm, about 150 nm to about 200 nm, about 100 nm to about 250 nm, about 250 nm to about 500 nm, or about 10 nm to about 1000 nm. In some embodiments, the particles are exosomes and have a diameter of about 20 nm to 300 nm, about 40 nm to 200 nm, about 20 nm to 250 nm, about 30 nm to 150 nm, or about 30 nm to 100 nm.

[0218] compound Compounds of formula (I) In various embodiments, provided herein is a compound of formula (I): [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein A is -N(CH 2 R N1 )(CH 2 R N2 ), or a 4- to 7-membered heterocyclyl ring containing at least one N, the 4- to 7-membered heterocyclyl ring being3 and optionally substituted with Each X is independently -O-, -N(R 1 )- or -N(R 2 )-and R 1 is optionally substituted C 1 -C 31 Selected from the group consisting of aliphatic and steroidal; R 2 is optionally substituted C 1 -C 31 Selected from the group consisting of aliphatic and steroidal; R 3 is optionally substituted C 1 -C 6 It is aliphatic, R N1 and R N2 are each independently hydrogen, hydroxy-C 1 -C 6 Alkyl, C 2 -C 6 Alkenyl, or C 3 -C 7 is cycloalkyl, L 1 is optionally substituted C 1 -C 20 Alkylene chain and divalent optionally substituted C 2 -C 20 alkenylene chains, L 2 is optionally substituted C 1 -C 20 Alkylene chain and divalent optionally substituted C 2 -C 20 alkenylene chains, L 3 is a bond, optionally substituted C 1 -C 6 Alkylene chain or divalent optionally substituted C 3 -C 7 It is a cycloalkylene.

[0219] In some embodiments, A is -N(CH 3 )(CH 3 ) and when X is O, L 3 is C 1 -C 6 It is not an alkylene chain.

[0220] In some embodiments, the present disclosure provides a compound of formula (Ia): [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein m is 0, 1, 2, 3, 4, 5, or 6.

[0221] In some embodiments, the present disclosure provides a compound of formula (Ib): [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein n is 0, 1, 2, or 3; and m is 0, 1, 2, 3, 4, 5, or 6.

[0222] In some embodiments, the present disclosure provides a compound of formula (I-bi): [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0223] In some embodiments, the present disclosure provides a compound of formula (I-bii): [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein m is 0, 1, 2, or 3; p and q are each 0, 1, 2, or 3; and q+p is 3 or less.

[0224] In some embodiments, the present disclosure provides a compound of formula (I-biii): [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0225] In some embodiments, the present disclosure provides a compound of formula (Ic): [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0226] In some embodiments, A is -N(CH 2 R N1 )(CH 2 R N2 ) or an optionally substituted 4- to 7-membered heterocyclyl ring containing at least one N.

[0227] In some embodiments, A is -N(CH 2 R N1 )(CH 2 R N2 In some embodiments, R N1 and R N2 are each independently hydrogen, hydroxy-C 1 -C 3 Alkylene, C 2 -C 4 Alkenyl, or C 3 -C 4 cycloalkyl.

[0228] In some embodiments, R N1 and R N2 are each independently hydrogen, -CH 2 CH=CH 2 , -CH 2 CH 2 OH, [ka] ,or [ka] In some embodiments, R N1 and R N2 is the same. In some embodiments, R N1 and R N2 Each is hydrogen. In some embodiments, R N1 and R N2 are respectively, C 2 -C 4 Alkenyl, for example, -CH 2 CH=CH 2 In some embodiments, R N1 and R N2 are hydroxy-C 1 -C 3 Alkylene, for example, -CH 2 CH 2 In some embodiments, R N1 and R N2 In some embodiments, R N1 and R N2 One of them is hydrogen and the other is C 3 -C 4 In some embodiments, R N1 and R N2 One of them is hydrogen and the other is [ka] It is.

[0229] In some embodiments, A is an optionally substituted 4- to 7-membered heterocyclyl ring containing at least one N. In some embodiments, A is an optionally substituted 4- to 7-membered heterocyclyl ring containing only one N. In some embodiments, A is an unsubstituted 4- to 7-membered heterocyclyl ring containing at least one N. In some embodiments, A is an unsubstituted 4- to 7-membered heterocyclyl ring containing only one N. In some embodiments, A is an optionally substituted 5- to 6-membered heterocyclyl ring containing at least one N. In some embodiments, A is an unsubstituted 5- to 6-membered heterocyclyl ring containing at least one N.

[0230] In some embodiments, A is an optionally substituted 4-7 membered heterocyclyl ring containing at least one N, and the N atom of A is a tertiary amine.

[0231] In some embodiments, A is an optionally substituted 4-7 membered heterocyclyl ring containing at least one N and further containing one or more S. In some embodiments, A is an optionally substituted 4-7 membered heterocyclyl ring containing at least one N and further containing only one S.

[0232] In some embodiments, A is selected from the group consisting of azetidine, pyrrolidine, piperidine, azepane, and thiomorpholine. In some embodiments, A is selected from the group consisting of pyrrolidine and piperidine.

[0233] In some embodiments, L 1 is optionally substituted C 1 -C 20 Alkylene chain and divalent optionally substituted C 1 -C 20 In some embodiments, L is selected from the group consisting of alkenylene chains. 2 is optionally substituted C 1 -C 20 Alkylene chain and divalent optionally substituted C 1 -C 20 In some embodiments, L is selected from the group consisting of alkenylene chains. 1 is optionally substituted C 1 -C 20 In some embodiments, L 2 is optionally substituted C 1 -C 20 It is an alkylene chain.

[0234] In some embodiments, L 1 and L 2 In some embodiments, L 1 and L2 is different.

[0235] In some embodiments, L 1 is optionally substituted C 1 -C 10 In some embodiments, L 2 is optionally substituted C 1 -C 10 In some embodiments, L 1 is optionally substituted C 1 -C 5 In some embodiments, L 2 is optionally substituted C 1 -C 5 It is an alkylene chain.

[0236] In some embodiments, L 1 and L 2 are -CH 2 CH 2 CH 2 CH 2 In some embodiments, L 1 and L 2 are -CH 2 CH 2 CH 2 In some embodiments, L 1 and L 2 are -CH 2 CH 2 -It is.

[0237] In some embodiments, L 3 is a bond, optionally substituted C 1 -C 6 Alkylene chain or divalent optionally substituted C 3 -C 6 In some embodiments, L is cycloalkylene. 3 is a bond. In some embodiments, L 3 is optionally substituted C 1 -C 6In some embodiments, L 3 is optionally substituted C 1 -C 3 In some embodiments, L 3 is the unsubstituted C 1 -C 3 In some embodiments, L 3 -CH 2 In some embodiments, L 3 -CH 2 CH 2 In some embodiments, L 3 -CH 2 CH 2 CH 2 In some embodiments, L 3 is a divalent C 3 -C 6 In some embodiments, L is cycloalkylene. 3 teeth [ka] It is.

[0238] In some embodiments, the number of carbon atoms between S and N of A of the thiolate of formula (I) is 2 to 10. In some embodiments, the number of carbon atoms between S and N of A of the thiolate of formula (I) is 2 to 8. In some embodiments, the number of carbon atoms between S and N of A of the thiolate of formula (I) is 2 to 5. In some embodiments, the number of carbon atoms between S and N of A of the thiolate of formula (I) is 2 to 4. In some embodiments, the number of carbon atoms between S and N of A of the thiolate of formula (I) is 2. In some embodiments, the number of carbon atoms between S and N of A of the thiolate of formula (I) is 3. In some embodiments, the number of carbon atoms between S and N of A of the thiolate of formula (I) is 4.

[0239] In some embodiments, R 1 is optionally substituted C 1 -C 31In some embodiments, R is selected from the group consisting of aliphatic and optionally substituted steroidyl. 2 is optionally substituted C 1 -C 31 In some embodiments, R is selected from the group consisting of aliphatic and optionally substituted steroidyl. 1 is optionally substituted C 1 -C 31 In some embodiments, R 2 is optionally substituted C 1 -C 31 In some embodiments, R 1 is optionally substituted C 5 -C 25 In some embodiments, R 2 is optionally substituted C 5 -C 25 In some embodiments, R 1 is optionally substituted C 10 -C 20 In some embodiments, R 2 is optionally substituted C 10 -C 20 In some embodiments, R 1 is optionally substituted C 10 -C 20 In some embodiments, R 2 is optionally substituted C 10 -C 20 In some embodiments, R 1 is the unsubstituted C 10 -C 20 In some embodiments, R 2 is the unsubstituted C 10 -C 20 It is an alkyl.

[0240] In some embodiments, R 1 is optionally substituted C 14 -C 16In some embodiments, R 2 is optionally substituted C 14 -C 16 In some embodiments, R 1 is the unsubstituted C 14 -C 16 In some embodiments, R 2 is the unsubstituted C 14 -C 16 It is an alkyl.

[0241] In some embodiments, R 1 is an optionally substituted branched C 3 -C 31 In some embodiments, R 2 is an optionally substituted branched C 3 -C 31 In some embodiments, R 1 is an optionally substituted branched C 10 -C 20 In some embodiments, R 2 is an optionally substituted branched C 10 -C 20 In some embodiments, R 1 is an optionally substituted branched C 14 -C 16 In some embodiments, R 2 is an optionally substituted branched C 14 -C 16 In some embodiments, R 1 is a substituted branched C 3 -C 31 In some embodiments, R 2 is a substituted branched C 3 -C 31 In some embodiments, R 1 is a substituted branched C 10 -C 20 In some embodiments, R 2 is a substituted branched C10 -C 20 In some embodiments, R 1 is a substituted branched C 14 -C 16 In some embodiments, R 2 is a substituted branched C 14 -C 16 It is an alkyl.

[0242] In some embodiments, R 1 and R 2 is the same.

[0243] In some embodiments, R 1 and R 2 In some embodiments, R 1 is optionally substituted C 6 -C 20 alkenyl, R 2 is optionally substituted C 10 -C 20 In some embodiments, R 1 is C 6 -C 20 alkenyl, R 2 is a branched C 10 -C 20 It is an alkyl.

[0244] In some embodiments, A contains at least one N and 0 to 6 R 3 In some embodiments, R is a 4-7 membered heterocyclyl ring optionally substituted with 3 is optionally substituted C 1 -C 6 In some embodiments, R 3 is optionally substituted C 1 -C 3 In some embodiments, R 3 is optionally substituted C 1 -C 6 In some embodiments, R 3is optionally substituted C 1 -C 3 In some embodiments, R 3 is the unsubstituted C 1 -C 6 In some embodiments, R 3 is the unsubstituted C 1 -C 3 In some embodiments, R 3 is optionally substituted C 1 -C 6 In some embodiments, R is alkenyl. 3 is optionally substituted C 1 -C 3 In some embodiments, R is alkenyl. 3 is the unsubstituted C 1 -C 6 In some embodiments, R is alkenyl. 3 is the unsubstituted C 1 -C 3 It is alkenyl.

[0245] In some embodiments, R 3 1 to 3 C 3 -C 6 In some embodiments, R 3 is one C 3 -C 6 In some embodiments, R 3 is substituted with cyclopropanyl. In some embodiments, R 3 is substituted with 1 to 3 -OH. In some embodiments, R 3 is substituted with one -OH.

[0246] In some embodiments, m is 0, 1, 2, 3, 4, 5, or 6. In some embodiments, m is 0 or 1. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5. In some embodiments, m is 6.

[0247] In some embodiments, n is 0, 1, 2, or 3. In some embodiments, n is 1 or 2. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3.

[0248] In some embodiments, the compound of formula (I) is a compound selected from Table 21, or a pharma- ceutically acceptable salt or solvate thereof. [Table 21-1] [Table 21-2] [Table 21-3] [Table 21-4] [Table 21-5] [Table 21-6]

[0249] Compound of formula (A) In various embodiments, provided herein is a compound of formula (A): [ka] or a pharma- ceutically acceptable salt thereof, wherein n is an integer between 10 and 200, inclusive; L P1 is -[(CH 2 ) 0-3 -C(O)O] 1-3 -, -(CH 2 ) 0-3 -C(O)O-(CH 2 ) 1-3 -OC(O)- or -C(O)N(H)-; R P1 is C 5 -C 25 Alkyl or C 5 -C 25 alkenyl, R P2 is hydrogen or -CH 3 It is.

[0250] In some embodiments, formula (A) is HO-(CH 2 CH 2 O) n -C(O)N(H)-(CH 2 ) 17 CH 3 isn't it.

[0251] In some embodiments, L P1 -CH 2 C(O)O-, -CH 2 CH 2 C(O)O-, -CH 2 C(O)OCH 2 C(O)O-, -CH 2 C(O)OCH 2 CH 2 It is -OC(O)- or -C(O)N(H)-.

[0252] In some embodiments, the PEG lipid is a compound of Formula (Aa), Formula (Ab), Formula (Ac), Formula (Ad), or Formula (Ae): [ka] or a pharma- ceutically acceptable salt thereof.

[0253] In some embodiments, R P1 is C 6 -C 24 , C 10 -C 20 , C 10 -C 18 , C 10 -C 16 , C 10 -C 14 , C 10 -C 12 , C 12 -C 20 , C 12 -C 18 , C 12 -C 16 , C 12 -C 14 , C 14 -C 20 , C 14 -C 18 , C 14 -C 16 , C 16 -C 20 , C 16 -C 18 , or C 18 -C 20 In some embodiments, R P1 is C 14 -C 18 In some embodiments, R P1 is C 14 -C 16 In some embodiments, R P1 is C 15 -C 17 In some embodiments, R P1 is C 16 -C 18 In some embodiments, R P1 is C 6 , C 7 , C 8 , C 9 , C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , or C 24 In some embodiments, R P1 is C 6 -C 24 , C 10 -C 20 , C 10 -C 18 , C 10 -C 16 , C 10 -C 14 , C 10 -C 12 , C 12 -C 20 , C 12 -C 18 , C 12 -C 16 , C 12 -C 14 , C 14 -C 20 , C 14 -C 18 , C 14 -C 16 , C 16 -C 20 , C 16 -C 18 , or C 18 -C 20 In some embodiments, R is alkenyl. P1 is C 14 -C 18 In some embodiments, R is alkenyl. P1 is C 14 - 16 In some embodiments, R is alkenyl. P1 is C 15 -C 17 In some embodiments, R is alkenyl. P1 is C 16 - 18 In some embodiments, R is alkenyl. P1 is C 6 , C 7 , C 8 , C9 , C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , or C 24 It is alkenyl.

[0254] In some embodiments, R P2 is hydrogen. In some embodiments, R P2 is -CH 3 It is.

[0255] In some embodiments, n is, on average, 10 to 200, 10 to 180, 10 to 160, 10 to 140, 10 to 120, 10 to 100, 10 to 80, 10 to 60, 10 to 40, 10 to 20, 20 to 200, 20 to 180, 20 to 160, 20 to 140, 20 to 120, 20 to 100, 20 to 80, 20 to 60, 20 to 40, 40 to 200, 40 to 180, 40 to 160, 40 to 140, 40 to 120, 40 to 100, 40 to 80, 40 to 60, 60 to 200, 6 0-180, 60-160, 60-140, 60-120, 60-100, 60-80, 80-200, 80-180, 80-160, 80-140, 80-120, 80-100, 100-200, 100-180, 100-160, 100-140, 100-120, 120-200, 120-180, 120-160, 120-140, 140-200, 140-180, 140-160, 160-200, 160-180, or 180-200. In some embodiments, n is, on average, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200. In some embodiments, n is, on average, about 20. In some embodiments, n is, on average, about 40. In some embodiments, n is, on average, about 45. In some embodiments, n is, on average, about 50. In some embodiments, n is, on average, about 68. In some embodiments, n is, on average, about 75. In some embodiments, n is, on average, about 100.

[0256] In some embodiments, the compound of formula (A) is HO-(CH 2 CH 2 O) n -CH 2 C(O)O-(CH 2 ) 17 CH 3 [n is about 45 on average], H 3 CO-(CH 2 CH 2 O) n -CH 2 C(O)O-(CH2 ) 17 CH 3 [n is about 45 on average], HO-(CH 2 CH 2 O) n -CH 2 C(O)O-(CH 2 ) 15 CH 3 [n is about 45 on average], HO-(CH 2 CH 2 O) n -CH 2 C(O)O-(CH 2 ) 13 CH 3 [n is about 45 on average], and HO-(CH 2 CH 2 O) n -C(O)N(H)-(CH 2 ) 17 CH 3 [n is about 45 on average] or a pharma- ceutically acceptable salt thereof.

[0257] Alternative Embodiments In alternative embodiments, the compounds described herein may contain one or more isotopic substitutions. For example, hydrogen is 2 H (D or deuterium) or 3 H (T or tritium), and carbon can be, for example, 13 C or 14 C, and oxygen may be, for example, 18 O, and the nitrogen may be, for example, 15 In other embodiments, a particular isotope (e.g., 3 H, 13 C. 14 C. 18 O, or 15N) may represent at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 99.9% of the total isotopic abundance of the element occupying a particular site on the compound.

[0258] Lipid Nanoparticles In certain embodiments, the synthetic RNA virus genome described herein is encapsulated in a lipid nanoparticle (LNP). In certain embodiments, the LNP comprises one or more lipids, such as triglycerides (e.g., tristearin), diglycerides (e.g., glycerol bahenate), monoglycerides (e.g., glycerol monostearate), fatty acids (e.g., stearic acid), steroids (e.g., cholesterol), and waxes (e.g., cetyl palmitate). In some embodiments, the LNP comprises one or more cationic lipids, one or more structural lipids, and one or more helper lipids. In some embodiments, the LNP comprises one or more cationic lipids, cholesterol, and one or more neutral lipids.

[0259] In some embodiments, the compounds of the present disclosure are used to form nanoparticles. In some embodiments, the nanoparticles are lipid nanoparticles (LNPs). In some embodiments, the LNPs include PEG lipids, ionizable lipids, helper lipids, and structural lipids. In some embodiments, the LNPs described herein are formulated to deliver a therapeutic agent to a subject in need thereof. In some embodiments, the LNPs described herein are formulated to deliver a nucleic acid molecule to a subject in need thereof.

[0260] The lipid composition in an LNP significantly affects the therapeutic use and efficacy of a particular LNP. For example, LNP formulations such as SS-OC / cholesterol / DSPC / PEG2k-DPG typically exhibit increased clearance rates upon repeated intravenous (IV) administration in, for example, mice, non-human primates (NHPs) and / or humans, and much shorter circulation times in vivo after a second dose compared to after a first dose. The shortened circulation time may adversely affect the delivery efficiency of the LNP, possibly by reducing the exposure of the LNP to the target. Thus, while such formulations may be useful for delivering drugs that do not require multiple administrations, their use for delivery of drugs that require subsequent administrations may be limited by this shortened circulation time.

[0261] There remains a need for LNP formulations that exhibit tunable circulation and exposure to target cells, for example, sustained circulation and consistent exposure, upon repeated dosing in vivo. The present disclosure provides such LNP formulations by incorporating ionizable lipids and / or PEG lipids of the present disclosure into the lipid formulation of the LNP. The sustained circulation of the LNPs of the present disclosure upon repeated dosing results in a sustained therapeutic effect of the synthetic RNA virus genome encapsulated therein.

[0262] In some embodiments, without the ionizable lipids and / or PEG lipids of the present disclosure, the rapid clearance of the LNP and its components upon repeated dosing reduces the efficiency of delivery of the encapsulated synthetic RNA viral genome upon subsequent dosing, as the body may eliminate the LNP before the release of the synthetic RNA viral genome. In some embodiments, the ionizable lipids and / or PEG lipids of the present disclosure, when incorporated into the LNP, slow the clearance of the LNP upon repeated dosing, allowing for the release of the encapsulated synthetic RNA viral genome and sustained therapeutic effect.

[0263] Polyethylene glycol (PEG) lipids In some embodiments, the PEG lipids of the present disclosure comprise a hydrophilic head group and a hydrophobic lipid tail. In some embodiments, the hydrophilic head group is a PEG moiety. In some embodiments, the PEG lipids of the present disclosure comprise a mono-lipid tail. In some embodiments, the PEG lipids of the present disclosure comprise a mono-alkyl lipid tail, a mono-alkenyl lipid tail, a mono-alkynyl lipid tail, or a mono-acyl lipid tail. In some embodiments, the mono-lipid tail comprises an ether group, a carbonyl group, or an ester group. In some embodiments, the PEG lipids of the present disclosure may comprise a polyoxyethylene alkyl ether, a polyoxyethylene alkenyl ether, or a polyoxyethylene alkynyl ether (such molecules are also known as BRIJ® or Brij® molecules). In some embodiments, the PEG lipids of the present disclosure may comprise a polyoxyethylene alkyl ester, a polyoxyethylene alkenyl ester, or a polyoxyethylene alkynyl ester (such molecules are also known as MYRJ® molecules).

[0264] In some embodiments, the PEG lipid may comprise a di-acyl lipid tail.

[0265] In some embodiments, the PEG lipid is a compound of formula (A) [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein the variables are defined herein.

[0266] In some embodiments, the PEG lipid is a compound of formula (A'): [ka] or a pharma- ceutically acceptable salt thereof, wherein n is an integer between 10 and 200, inclusive; L P1’ is a bond, -C(O)-, -[(CH 2 ) 0-3 -C(O)O]1-3 -, -(CH 2 ) 0-3 -C(O)O-(CH 2 ) 1-3 -OC(O)- or -C(O)N(H)-; R P1’ is C 5 -C 25 Alkyl or C 5 -C 25 alkenyl, R P2’ is hydrogen or -CH 3 It is.

[0267] In some embodiments, L P1’ is a bond, -C(O)-, -CH 2 C(O)O-, -CH 2 CH 2 C(O)O-, -CH 2 C(O)OCH 2 C(O)O-, -CH 2 C(O)OCH 2 CH 2 In some embodiments, R P1’ is R P1 In some embodiments, R P2’ is R P2 It is.

[0268] In some embodiments, the PEG lipid is a compound of formula (A″): [ka] or a pharma- ceutically acceptable salt thereof, wherein n is an integer between 10 and 200, inclusive; L P1” is a bond, -[(CH 2 ) 0-3 -C(O)O] 1-3 -, -(CH 2 ) 0-3 -C(O)O-(CH 2 ) 1-3 -OC(O)- or -C(O)N(H)-; RP1” is C 5 -C 25 Alkyl or C 5 -C 25 alkenyl, R P2” is hydrogen or -CH 3 It is.

[0269] In some embodiments, L P1” is a bond, -CH 2 C(O)O-, -CH 2 CH 2 C(O)O-, -CH 2 C(O)OCH 2 C(O)O-, -CH 2 C(O)OCH 2 CH 2 It is -OC(O)- or -C(O)N(H)-.

[0270] In some embodiments, the PEG lipid is a compound of formula (A"-a), formula (A"-b), formula (A"-c), formula (A"-cd), formula (A"-e), or formula (A"-f): [ka] or a pharma- ceutically acceptable salt thereof.

[0271] In some embodiments, R P1” is R P1 In some embodiments, R P2” is R P2 It is.

[0272] In some embodiments, the PEG lipid has the formula (A″-f1): [ka] or a pharma- ceutically acceptable salt thereof.

[0273] In some embodiments, the PEG lipid has the formula (A″-f2): [ka] or a pharma- ceutically acceptable salt thereof.

[0274] In some embodiments, the PEG lipid has the formula (A″-f3): [ka] or a pharma- ceutically acceptable salt thereof.

[0275] In some embodiments, the PEG lipid of the present disclosure comprises a compound of formula (B): [ka] or a pharma- ceutically acceptable salt thereof, wherein n is an integer between 10 and 200, inclusive; R B1 is C 5 -C 25 Alkyl or C 5 -C 25 It is alkenyl.

[0276] In some embodiments, R B1 is R P1 It is.

[0277] In some embodiments, the PEG lipid is a compound of formula (Ba): [ka] or a pharma- ceutically acceptable salt thereof.

[0278] In some embodiments, the PEG lipid is a compound of formula (Bb): [ka] or a pharma- ceutically acceptable salt thereof.

[0279] In some embodiments, n is, on average, 10 to 200, 10 to 180, 10 to 160, 10 to 140, 10 to 120, 10 to 100, 10 to 80, 10 to 60, 10 to 40, 10 to 20, 20 to 200, 20 to 180, 20 to 160, 20 to 140, 20 to 120, 20 to 100, 20 to 80, 20 to 60, 20 to 40, 40 to 200, 40 to 180, 40 to 160, 40 to 140, 40 to 120, 40 to 100, 40 to 80, 40 to 60, 60 to 200, 6 0-180, 60-160, 60-140, 60-120, 60-100, 60-80, 80-200, 80-180, 80-160, 80-140, 80-120, 80-100, 100-200, 100-180, 100-160, 100-140, 100-120, 120-200, 120-180, 120-160, 120-140, 140-200, 140-180, 140-160, 160-200, 160-180, or 180-200. In some embodiments, n is, on average, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200. In some embodiments, n is, on average, about 20. In some embodiments, n is, on average, about 40. In some embodiments, n is, on average, about 45. In some embodiments, n is, on average, about 50. In some embodiments, n is, on average, about 68. In some embodiments, n is, on average, about 75. In some embodiments, n is, on average, about 100.

[0280] In some embodiments, the PEG lipid comprises a PEG moiety having an average molecular weight of about 500 to about 10,000 daltons. In some embodiments, the PEG lipid is about 500 to about 5,000 daltons, about 500 to about 4,000 daltons, about 500 to about 3,000 daltons, about 500 to about 2,000 daltons, about 500 to about 1,000 daltons, about 500 to about 800 daltons, about 500 to about 600 daltons, about 600 to about 5,000 daltons, about 600 to about 4,000 daltons, about 600 to about 3,000 daltons, about 600 to about 2,000 daltons, about 600 to about 1,000 daltons, about 600 to about 800 daltons, about 800 to about 5,000 daltons, about 800 to about 4,000 daltons, about 800 to about 3,000 daltons, about The PEG moiety has an average molecular weight of 800 to about 2,000 daltons, about 800 to about 1,000 daltons, about 1,000 to about 5,000 daltons, about 1,000 to about 4,000 daltons, about 1,000 to about 3,000 daltons, about 1,000 to about 2,000 daltons, about 2,000 to about 5,000 daltons, about 2,000 to about 4,000 daltons, about 2,000 to about 3,000 daltons, about 3,000 to about 5,000 daltons, about 3,000 to about 4,000 daltons, about 5,000 to about 10,000 daltons, about 5,000 to about 7,500 daltons, or about 7,500 to about 10,000 daltons. In some embodiments, the PEG portion of the PEG lipid has an average molecular weight of about 1,500 to about 2,500 daltons. In some embodiments, the PEG portion of the PEG lipid has an average molecular weight of about 1,000 to about 5,000 daltons. In some embodiments, the PEG lipid comprises a PEG portion having an average molecular weight of about 500, about 600, about 800, about 1,000, about 1,500, about 2,000, about 2,500, about 3,000, about 3,500, about 4,000, about 4,500, about 5,000, about 6,000, about 7,000, about 8,000, about 9,000, or about 10,000 daltons.In some embodiments, the PEG lipid comprises a PEG moiety having an average molecular weight of at least 500, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 3,500, at least 4,000, at least 4,500, at least 5,000, at least 6,000, at least 7,000, at least 8,000, at least 9,000, or at least 10,000 daltons. In some embodiments, the PEG lipid comprises a PEG moiety having an average molecular weight of 500 daltons or less, 1,000 daltons or less, 1,500 daltons or less, 2,000 daltons or less, 2,500 daltons or less, 3,000 daltons or less, 3,500 daltons or less, 4,000 daltons or less, 4,500 daltons or less, 5,000 daltons or less, 6,000 daltons or less, 7,000 daltons or less, 8,000 daltons or less, 9,000 daltons or less, or 10,000 daltons or less. All values ​​include all endpoints.

[0281] In some embodiments, the PEG lipid is polyoxyethylene (100) stearyl ether, polyoxyethylene (20) cetyl ether, polyoxyethylene (20) oleyl ether, polyoxyethylene (20) stearyl ether, or mixtures thereof. In some embodiments, the PEG lipid is polyoxyethylene (100) stearate, polyoxyethylene (50) stearate, polyoxyethylene (40) stearate, polyoxyethylene palmitate, or mixtures thereof.

[0282] In some embodiments of the present disclosure, the PEG lipid is [ka] The CAS number is 9005-00 and the rational formula is C 18 H 37 (OCH 2 CH 2 ) nOH, where n is 100. BRIJ® S100 is also known colloquially as polyoxyethylene (100) stearyl ether. Thus, in some embodiments, the PEG lipid is HO-PEG100-CH 2 (CH 2 ) 16 CH 3 It is.

[0283] In some embodiments of the present disclosure, the PEG lipid is [ka] The CAS number is 9004-95-9 and the rational formula is C 16 H 33 (OCH 2 CH 2 ) n OH, where n is 20. BRIJ® C20 is also known as BRIJ® 58, commonly known as polyethylene glycol hexadecyl ether, polyoxyethylene (20) cetyl ether. Thus, in some embodiments, the PEG lipid is HO-PEG20-CH 2 (CH 2 ) 14 CH 3 It is.

[0284] In some embodiments of the present disclosure, the PEG lipid is [ka] The CAS number is 9004-98-2 and the rational formula is C 18 H 35 (OCH 2 CH 2 ) n OH, where n is 20. BRIJ® O20 is also known colloquially as polyoxyethylene (20) oleyl ether. Thus, in some embodiments, the PEG lipid is HO-PEG20-C 18 H 35 It is.

[0285] In some embodiments of the present disclosure, the PEG lipid is [ka] The CAS number is 9005-00-9 and the rational formula is C 18 H 37 (OCH 2 CH 2 ) n OH, where n is 20. BRIJ® S20 is also known colloquially as polyethylene glycol octadecyl ether or polyoxyethylene (20) stearyl ether. Thus, in some embodiments, the PEG lipid is HO-PEG20-CH 2 (CH 2 ) 16 CH 3 It is.

[0286] In some embodiments of the present disclosure, the PEG lipid is [ka] The CAS number is 9004-99-3 and the rational formula is C 17 H 35 C(O)(OCH 2 CH 2 ) n OH, where n is 100. MYRJ™ S100 is also known colloquially as polyoxyethylene (100) stearate. Thus, in some embodiments, the PEG lipid is HO-PEG100-CH 2 (CH 2 ) 15 CH 3 It is.

[0287] In some embodiments of the present disclosure, the PEG lipid is [ka] The CAS number is 9004-99-3 and the rational formula is C 17 H 35 C(O)(OCH 2 CH2 ) n OH, where n is 50. MYRJ™ S50 is also known colloquially as polyoxyethylene (50) stearate. Thus, in some embodiments, the PEG lipid is HO-PEG50-CH 2 (CH 2 ) 15 CH 3 It is.

[0288] In some embodiments of the present disclosure, the PEG lipid is [ka] The CAS number is 9004-99-3 and the rational formula is C 17 H 35 C(O)(OCH 2 CH 2 ) n OH, where n is 40. MYRJ™ S40 is also known colloquially as polyoxyethylene (40) stearate. Thus, in some embodiments, the PEG lipid is HO-PEG40-CH 2 (CH 2 ) 15 CH 3 It is.

[0289] In some embodiments of the present disclosure, the PEG lipid is [ka] Its CAS number is 1607430-62-04 and its molecular formula is C122H242O50. PEG2k-DMG is also known as 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000.

[0290] In some embodiments of the present disclosure, the PEG lipid is [ka] In the alkyl composition R 1 COO=C16:0, R 2It is the one with COO = C16:0 (PEG2k-DPG). PEG2k-DPG is generally also known as 1,2-dipalmitoyl-rac-glycero-3-methylpolyoxyethylene.

[0291] In some embodiments of the present disclosure, the PEG lipid is PEG-dilaurylglycerol, PEG-dimyristoylglycerol (PEG-DMG), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE), PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-distearoylglycamide, PEG-cholesterol (1-[8'-(cholest-5-ene-3[beta]-oxy)carboxamido-3',6'-dioxaoctadecylglycerol), ... nyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB (3,4-ditetradecoxylbenzyl-[omega]-methyl-poly(ethylene glycol) ether), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSPE), 1,2-di The PEG lipid may be stearoyl-sn glycerol, methoxypolyethylene glycol (PEG2k-DSG), poly(ethylene glycol)-2000-dimethacrylate (PEG2k-DMA), or 1,2-distearyloxypropyl-3-amine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSA). In some embodiments, the PEG lipid may be PEG2k-DMG. In some embodiments, the PEG lipid may be PEG2k-DSG. In other embodiments, the PEG lipid may be PEG2k-DSPE. In some embodiments, the PEG lipid may be PEG2k-DMA. In yet other embodiments, the PEG lipid may be PEG2k-C-DMA. In some embodiments, the PEG lipid may be PEG2k-DSA. In other embodiments, the PEG lipid may be PEG2k-C11. In some embodiments, the PEG lipid may be PEG2k-C14. In some embodiments, the PEG lipid may be PEG2k-C16. In some embodiments, the PEG lipid may be PEG2k-C18.

[0292] In some embodiments, PEG lipids with a single lipid tail of the present disclosure (e.g., PEG lipids of formula (A), (A'), (A"), or (B)) may mitigate accelerated blood clearance (ABC) upon administration and / or repeated administration of an LNP composition of the present disclosure. In some embodiments, PEG lipids with a single lipid tail of the present disclosure may reduce or deplete PEG-specific antibodies (e.g., anti-PEG IgM) produced by a subject's immune system upon administration and / or repeated administration of an LNP composition of the present disclosure.

[0293] In some embodiments, the PEG lipid comprises a poly(ethylene)glycol chain of up to 5 kDa in length covalently attached to one or more C6-C20 alkyl-containing lipids. In some embodiments, the PEG lipid is 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG) or 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (DSPE-PEG-amine). In some embodiments, the PEG lipid is selected from 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-5000] (DSPE-PEG5K), 1,2-dipalmitoyl-rac-glycerol methoxypolyethylene glycol-2000 (DPG-PEG2K), 1,2-distearoyl-rac-glycero-3-methylpolyoxyethylene-5000 (DSG-PEG5K), 1,2-distearoyl-rac-glycero-3-methylpolyoxyethylene-2000 (DSG-PEG2K), 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene-5000 (DMG-PEG5K), and 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene-2000 (DMG-PEG2K). In some embodiments, the PEG lipid is DSPE-PEG5K. In some embodiments, the PEG lipid is DPG-PEG2K. In some embodiments, the PEG lipid is DSG-PEG2K. In some embodiments, the PEG lipid is DMG-PEG2K. In some embodiments, the PEG lipid is DSG-PEG5K. In some embodiments, the PEG lipid is DMG-PEG5K.

[0294] In some embodiments, the PEG lipid is a cleavable PEG lipid. Examples of PEG derivatives with cleavable bonds include those modified with peptide bonds (Kulkarni et al.(2014).Mmp-9 responsive PEG cleavable nanovesicles for efficient delivery of chemotherapeutics to pancreatic cancer.Mol Pharmaceutics 11:2390-9;Lin et al.(2015).Drug / dye-loaded, multifunctional PEG-chitosan-iron oxide nanocomposites for methotraxate synergistically self-targeted cancer therapy and dual model imaging.ACS Appl Mater Interfaces 7:11908-20.), those modified with disulfide bonds (Yan et al.(2014).A method to accelerate the gelation of disulfide-crosslinked hydrogels.Chin J Polym Sci 33:118-27;Wu & Yan(2015).Copper nanopowder catalyzed cross-coupling of diaryl disulfides with aryl iodides in PEG-400. Synlett 26:537-42), vinyl ether bonds, hydrazone bonds (Kelly et al.(2016).Polymeric prodrug combination to exploit the therapeutic potential of antimicrobial peptides against cancer cells. Org Biomol Chem 14:9278-86.), and ester bonds (Xu et al.(2008).Esterase-catalyzed dePEGylation of pH-sensitive vesicles modified with cleavable PEG-lipid derivatives. J Control Release 130:238-45). Also see Fang et al., (2017) Cleaveable PEGylation: a strategy for overcoming the “PEG dilemma” in efficient drug delivery. Drug Delivery 24:2,22-32.

[0295] In some embodiments, the PEG lipid is an activated PEG lipid. Exemplary activated PEG lipids include PEG-NH2, PEG-MAL, PEG-NHS, and PEG-ALD. Such functionalized PEG lipids are useful for attaching targeting moieties to lipid nanoparticles to direct the particles to specific target cells or tissues (e.g., by binding antigen-binding molecules, peptides, glycans, etc.). In some embodiments, functionalized moieties (e.g., -NH2, _MAL, -NHS, -ALD) are added to the free end of the PEG moiety of the PEG lipids of the present disclosure (e.g., BRIJ® or MYRJ™ family of PEG lipids).

[0296] Cationic lipids In some embodiments, the LNPs provided herein comprise one or more cationic lipids. "Cationic lipid" and "ionizable lipid" are used interchangeably herein.

[0297] Cationic lipids refer to any of several lipid species that carry a net positive charge at a selected pH, such as physiological pH. Such lipids include 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), dioctadecyldimethylammonium (DODMA), distearyldimethylammonium (DSDMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOT). Cationic lipids that are positively charged at less than physiological pH include, but are not limited to, N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), 3-(N-(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), and N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE). For example, cationic lipids that are positively charged at less than physiological pH include, but are not limited to, DODAP, DODMA, and DMDMA. In some embodiments, the cationic lipid is C 18 They contain an alkyl chain, an ether bond between the head group and the alkyl chain, and 0 to 3 double bonds. Such lipids include, for example, DSDMA, DLinDMA, DLenDMA, and DODMA.

[0298] In some embodiments, the cationic lipid comprises a protonizable tertiary amine head group. Such lipids are referred to herein as ionizable lipids. Ionizable lipids refer to lipid species that comprise an ionizable amine head group and typically comprise a pKa less than about 7. Thus, in an acidic pH environment, the ionizable amine head group is protonated such that the ionizable lipid preferentially interacts with negatively charged molecules (e.g., nucleic acids such as recombinant polynucleotides described herein), thus facilitating nanoparticle assembly and encapsulation. Thus, in some embodiments, the ionizable lipid can increase the loading of nucleic acids into lipid nanoparticles. In an environment with a pH greater than about 7 (e.g., physiological pH of about 7.4), the ionizable lipid comprises a neutral charge. When a particle containing the ionizable lipid is taken up into the low pH environment of an endosome (e.g., pH<7), the ionizable lipid is again protonated and associates with the anionic endosomal membrane, facilitating the release of the contents encapsulated by the particle. In some embodiments, the LNPs comprise an ionizable lipid, for example, a 7.SS cleavable pH-responsive lipid mimic (such as the COATSOME® SS series).

[0299] In some embodiments, the cationic lipid of the LNP is DLinDMA, DLin-KC2-DMA, DLin-MC3-DMA (MC3), COATSOME® SS-LC (formerly SS-18 / 4PE-13), COATSOME® SS-EC (formerly SS-33 / 4PE-15), COATSOME® SS-OC, COATSOME® SS-OP, di((Z)-non-2-en-1-yl) 9-((4-dimethylamino)butanoyl)oxy)heptadecanedioate (L-319), N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), or a mixture thereof.

[0300] In some embodiments, the cationic lipid of the LNP is a compound of formula (I): [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein the variables are defined herein.

[0301] In some embodiments, the cationic lipid of the present disclosure is a compound selected from Table 21, or a pharma- ceutically acceptable salt thereof.

[0302] In some embodiments, the cationic lipid of the LNP is a compound of formula (II-1): [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein R la and R 1b are each independently 1 -C 8 Aliphatic or -O(C 1 -C 8 aliphatic)-, where the O atom, if present, is attached to the piperidine ring; X a and X b each independently represents -C(O)O- * , -OC(O)- * , -C(O)N(R x 1 )- * , -N(R x 1 )C(O)- * , -O(C=O)N(R x 1 )- * , -N(R x 1 )(C=O)O- * or -O-, where - * are R 2a or R 2b indicates the point of attachment to R x 1 Each occurrence of is selected from hydrogen and optionally substituted C 1 -C 4 alkyl, R2a and R 2b are each independently a sterol residue, a fat-soluble vitamin residue, or C 13 -C 23 It is aliphatic.

[0303] In some embodiments, the cationic lipid of the LNP is a compound of formula (II-2): [ka] or a pharma- ceutically acceptable salt or solvate thereof, wherein R 1a’ and R 1b’ are each independently 1 -C 8 Alkylene or -O(C 1 -C 8 alkylene), where the O atom, if present, is attached to the piperidine ring; Y a’ and Y b’ each independently represents -C(O)O- * , -OC(O)- * , -C(O)N(R x 1 )- * , -N(R x 1 )C(O)- * , -O(C=O)N(R x 1 )- * , -N(R x 1 )(C=O)O- * , -N(R x 1 )C(O)N(R x 1 )-, or -O-, where - * is R 2a or R 2b indicates the point of attachment to R x 1 Each occurrence of is selected from hydrogen and optionally substituted C 1 -C 4 alkyl, Z a’ and Z b’each independently represents an optionally substituted arylene-C 0 -C 8 Alkylene or optionally substituted arylene-C 0 -C 8 heteroalkylene, where the alkylene or heteroalkylene group is Y a’ and Y b’ is bound to R 2a’ and R 2b’ are each independently a sterol residue, a fat-soluble vitamin residue, or C 12 -C 22 It is aliphatic.

[0304] In some embodiments, the cationic lipid of the LNP is a compound of formula (II-1a) (COATSOME® SS-OC) or a compound of formula (II-2a) (COATSOME® SS-OP): [ka] It is.

[0305] In some embodiments, the cationic lipid of the LNP is a compound of formula (II-1a) (COATSOME® SS-OC). COATSOME® SS-OC is also known as SS-18 / 4PE-16.

[0306] In some embodiments, the cationic lipid of the LNP is a compound of formula (II-2a) (COATSOME® SS-OP).

[0307] In some embodiments, the cationic lipid of the LNP is 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP).

[0308] Helper lipids In some embodiments, the LNPs described herein include one or more helper lipids. The term "helper lipid" refers to a lipid that can increase the delivery of the LNP to a target, e.g., to a cell. Without wishing to be bound by any particular theory, it is contemplated that the helper lipid can enhance the stability and / or fusogenicity of the lipid nanoparticle. In some embodiments, the helper lipid is a phospholipid. In some embodiments, the helper lipid is a phospholipid substitute or replacement. In some embodiments, the helper lipid is an alkylresorcinol.

[0309] In some embodiments, the helper lipid is phosphatidylcholine (PC). In some embodiments, the helper lipid is not phosphatidylcholine (PC). In some embodiments, the helper lipid is a phospholipid or phospholipid substitute. In some embodiments, the phospholipid or phospholipid substitute can be, for example, one or more saturated or (poly)unsaturated phospholipids, or phospholipid substitutes, or combinations thereof. Generally, a phospholipid comprises a phosphate head group and one or more fatty acid tails. In some embodiments, a phospholipid can comprise one or more multiple (e.g., double or triple) bonds (i.e., one or more unsaturations). In some embodiments, the helper lipid is non-cationic.

[0310] The phosphate head group can be selected from the non-limiting group consisting of, for example, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

[0311] The fatty acid tail may be selected from the non-limiting group consisting of, for example, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0312] Phospholipids include, but are not limited to, glycerophospholipids, such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidiglycerol, and phosphatidic acid. Phospholipids also include phosphosphingolipids, such as sphingomyelin.

[0313] In some embodiments, the non-cationic helper lipid is a DSPC analog, a DSPC substitute, oleic acid, or an oleic acid analog.

[0314] In some embodiments, the non-cationic helper lipid is a non-phosphatidylcholine (PC) zwitterionic lipid, a DSPC analog, oleic acid, an oleic acid analog, or a 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) substitute.

[0315] In some embodiments, phospholipids can facilitate fusion to membrane.For example, cationic phospholipids can interact with one or more negatively charged phospholipids of membrane (e.g., cell membrane or intracellular membrane).Fusion of phospholipids to membrane can allow one or more components of lipid-containing composition to pass through membrane, for example, to deliver one or more components to cell.

[0316] In some embodiments, the phosphate head group may be selected from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin. The fatty acid tail may be selected from the non-limiting group consisting of, for example, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0317] In some embodiments, the phospholipid is a compound according to formula (III): [ka] where R p represents a phosphate head group, R 1 and R 2 represents fatty acid tails with or without unsaturation that may be the same or different. The phosphate head group may be selected from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin. The fatty acid tail may be selected from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Non-natural species are also contemplated, including naturally occurring species with modifications and substitutions such as branching, oxidation, cyclization, and alkynes. For example, phospholipids may be functionalized or crosslinked with one or more alkynes (e.g., alkenyl groups in which one or more double bonds have been replaced with triple bonds). Under appropriate reaction conditions, the alkyne groups can undergo copper-catalyzed cycloaddition when exposed to azides. Such reactions can be useful in functionalizing the lipid bilayer of LNPs to facilitate membrane permeation or cell recognition, or in linking LNPs to useful components such as targeting or imaging moieties (e.g., dyes).

[0318] In some embodiments, the LNPs include one or more non-cationic helper lipids (e.g., neutral lipids). Exemplary neutral helper lipids include (1,2-dilauroyl-sn-glycero-3-phosphoethanolamine) (DLPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DiPPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleyl-sn-glycero-3-phosphoethanolamine (DOPE ... Palmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), (1,2-dioleoyl-sn-glycero-3-phospho-(l'-rac-glycerol) (DOPG), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), ceramide, and sphingomyelin. In some embodiments, the one or more helper lipids are selected from 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). In some embodiments, the helper lipid of the LNP comprises, consists essentially of, or consists of 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE) or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE). In some embodiments, the LNP comprises DSPC. In some embodiments, the LNP comprises DOPC. In some embodiments, the LNP comprises DLPE. In some embodiments, the LNP comprises DOPE.

[0319] In some embodiments, the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (18:3(cis)PC), 1,2-diarachidonoyl-sn-glycero-3-phosphocholine (DAPC), 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine (22:6(cis)PC) 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (4ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine (PE(18:2 / 18:2), 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine (PE 18:3 (9Z, 12Z, 15Z), 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE 18:3 (9Z, 12Z, 15Z), 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine (22:6 (cis)PE), 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin.

[0320] In some embodiments, the helper lipid is distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylcholine (DPPC), palmitoyloleoylphosphatidylcholine (DPPG), palmitoyloleoyl ... Toyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanolamine, dimethylphosphatidylethanolamine, 18-1-trans PE, l-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), hydrogenated soy phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), distearoylphosphatidylglycerol (DSPG), diercoylphosphatidylcholine (DEPC), palmitoyloleoylphosphatidylcholine (PMP), The phosphatidylglycerol (POPG), dielaidoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetyl phosphate, lysophosphatidylcholine, and dilinoleoylphosphatidylcholine.

[0321] In some embodiments, the helper lipid of the present disclosure is DSPC.

[0322] In some embodiments, the LNPs comprise DSPC. In some embodiments, the LNPs comprise DOPE. In some embodiments, the LNPs comprise DMPE. In some embodiments, the LNPs comprise both DSPC and DOPE.

[0323] In some embodiments, the helper lipid is selected from the group consisting of DSPC, DMPE, and DOPC or a combination thereof.

[0324] In some embodiments of the present disclosure, the helper lipid is [ka] It has a CAS number of 816-94-4 and the molecular formula is C44H88NO8P. DSPC is also known as 1,2-distearoyl-sn-glycero-3-phosphocholine.

[0325] In some embodiments, the phospholipid of the present disclosure comprises modified tail.In some embodiments, the phospholipid is DSPC (1,2-dioctadecanoyl-sn-glycero-3-phosphocholine) or its analogue, comprising modified tail.As described herein, "modified tail" can be a tail that comprises a shorter or longer aliphatic chain, a branched aliphatic chain, a substituted aliphatic chain, an aliphatic chain in which one or more methylenes are replaced with cyclic or heteroatomic groups, or any combination thereof.

[0326] In some embodiments, the helper lipids of the present disclosure are alternative lipids that are not phospholipids.

[0327] In some embodiments, the phospholipids useful in the present disclosure comprise modified tails.In some embodiments, the phospholipids useful in the present disclosure are DSPCs or their analogs that comprise modified tails.As described herein, "modified tails" can be tails that comprise shorter or longer aliphatic chains, aliphatic chains that are branched, aliphatic chains that are substituted, aliphatic chains that have one or more methylenes replaced with cyclic or heteroatomic groups, or any combination thereof.

[0328] In some embodiments, phospholipids useful in the present disclosure comprise a modified phosphocholine moiety in which the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (eg, n is not 2).

[0329] In some embodiments, the LNPs of the present disclosure include oleic acid or an oleic acid analog as a helper lipid. In some embodiments, the oleic acid analog includes a modified oleic acid tail, a modified carboxylic acid moiety, or both. In some embodiments, the oleic acid analog is a compound in which the carboxylic acid moiety of oleic acid is replaced with a different group.

[0330] In some embodiments, the LNPs of the present disclosure include different zwitterionic groups instead of phospholipids as helper lipids.

[0331] In some embodiments, the helper lipid of the present disclosure is a naturally occurring membrane lipid. In some embodiments, the helper lipid of the present disclosure is 1,2-dipalmitoyl-sn-glycero-3-O-4'-(N,N,N-trimethyl)-homoserine (DGTS), monogalactosyl diacylglycerol (MGDG), digalactosyl diacylglycerol (DGDG), sulfoquinovosyl diacylglycerol (SQDG), 1-palmitoyl-2-cis-9,10-methylenehexadecanoyl-sn-glycero-3-phosphocholine (cycloPC), or a combination thereof. In some embodiments, the LNP of the present disclosure comprises a combination of helper lipids. In some embodiments, the combination of helper lipids does not include DSPC. In some embodiments, the combination of helper lipids includes DSPC. In some embodiments, LNPs comprising one or more naturally occurring membrane lipids (e.g., DGTPS) have improved hepatic transfection / delivery of target molecules encapsulated in the LNPs compared to LNPs comprising DSPC as the only helper lipid.

[0332] In some embodiments, the helper lipid of the present disclosure is 5-heptadecylresorcinol or a derivative thereof.

[0333] structured lipids In some embodiments, the LNP of the present disclosure comprises one or more structured lipids.The incorporation of structured lipids into lipid nanoparticles can help reduce the aggregation of other lipids in the particle.The structured lipid can be, but is not limited to, sterol or lipids that contain sterol moieties.

[0334] In some embodiments, the structural lipid of the LNP is a sterol (e.g., a plant sterol or an animal sterol). In some embodiments, the sterol is cholesterol, or an analog or derivative thereof. In some embodiments, the sterol is cholesterol. In some embodiments, the sterol is cholesterol, beta-sitosterol, fecosterol, ergosterol, sitosterol, campesterol, stigmasterol, brassicasterol, ergosterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, alone or in combination, including analogs, salts, or esters thereof.

[0335] In some embodiments, the structural lipid of the LNP is cholesterol, a corticosteroid (eg, prednisolone, dexamethasone, prednisone, hydrocortisone, etc.), or a combination thereof.

[0336] In some embodiments, the structural lipid of the LNP is a plant sterol. In some embodiments, the plant sterol is sitosterol, stigmasterol, campesterol, sitostanol, campestanol, brassicasterol, fucosterol, beta-sitosterol, stigmastanol, beta-sitostanol, ergosterol, lupeol, cycloartenol, A5-avenacerol, A7-avenacerol, or A7-stigmasterol, alone or in combination, including analogs, salts, or esters thereof.

[0337] In some embodiments, the LNPs include one or more plant sterols. In some embodiments, the plant sterol component of the LNPs is a single plant sterol. In some embodiments, the plant sterol component of the LNPs of the disclosure is a mixture of different plant sterols (e.g., 2, 3, 4, 5, or 6 different plant sterols). In some embodiments, the plant sterol component of the LNPs of the disclosure is a blend of one or more plant sterols with one or more animal sterols, for example, a blend of a plant sterol (e.g., a sitosterol, such as beta-sitosterol) and cholesterol.

[0338] In some embodiments of the present disclosure, the structural lipid of the LNP is cholesterol: [ka] It is.

[0339] In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the cationic lipid is DOTAP. In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the cationic lipid is DLin-MC3-DMA (MC3). In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the cationic lipid is COATSOME® SS-EC. In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the cationic lipid is COATSOME® SS-LC. In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the cationic lipid is COATSOME® SS-OC. In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the cationic lipid is COATSOME® SS-OP. In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the cationic lipid is L-319. In some embodiments, the LNPs further comprise a structured lipid. In some embodiments, the structural lipid is cholesterol.

[0340] In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids. In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the one or more helper lipids comprise DLPE. In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the one or more helper lipids comprise DSPC. In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the one or more helper lipids comprise DOPE. In some embodiments, the LNPs comprise a cationic lipid and one or more helper lipids, where the one or more helper lipids comprise DOPC. In some embodiments, the LNPs further comprise a structured lipid. In some embodiments, the structured lipid is cholesterol.

[0341] In some embodiments, the LNPs comprise a cationic lipid, a helper lipid, and a structural lipid. In some embodiments, the structural lipid is cholesterol. In some embodiments, the cationic lipid is DOTAP and the helper lipid is DLPE. In some embodiments, the cationic lipid is MC3 and the helper lipid is DSPC. In some embodiments, the helper lipid is DOPE. In some embodiments, the helper lipid is DSPC. In some embodiments, the LNPs comprise a cationic lipid, a structural lipid, and at least two helper lipids, where the cationic lipid is DOTAP and the at least two helper lipids comprise DLPE and DSPE. In some embodiments, the LNPs comprise a cationic lipid, a structural lipid, and at least two helper lipids, where the cationic lipid is MC3 and the at least two helper lipids comprise DSPC and DMG. In some embodiments, the at least two helper lipids comprise DOPE and DSPE. In some embodiments, the at least two helper lipids comprise DSPC and DMG. In some embodiments, the structured lipid is cholesterol. In some embodiments, the LNPs include DOTAP, cholesterol, and DLPE. In some embodiments, the LNPs include MC3, cholesterol, and DSPC. In some embodiments, the LNPs include DOTAP, cholesterol, and DOPE. In some embodiments, the LNPs include DOTAP, cholesterol, DLPE, and DSPE. In some embodiments, the LNPs include MC3, cholesterol, DSPC, and DMG. In some embodiments, the LNPs include DOTAP, cholesterol, DLPE, and DSPE-PEG. In some embodiments, the LNPs include MC3, cholesterol, DSPC, and DMG-PEG. In some embodiments, the LNPs include DOTAP, cholesterol, DOPE, and DSPE. In some embodiments, the LNPs include DOTAP, cholesterol, DOPE, and DSPE-PEG. In some embodiments, the LNPs include SS-OC, DSPC, cholesterol, and DPG-PEG (e.g., DPG-PEG2K).In some embodiments, the LNP comprises SS-OC, DSPC, cholesterol, and a PEG lipid of formula (I) (e.g., BRIJ® S100).

[0342] Molar ratio of lipids in the LNP composition In some embodiments, the LNPs of the disclosure comprise 40 mol%-70 mol% cationic lipids, up to 50 mol% helper lipids, 10 mol%-50 mol% structural lipids, and 0.001 mol%-5 mol% PEG lipids (all endpoints included). In some embodiments, the total mol% of cationic lipids, helper lipids, structural lipids, and PEG lipids is 100%.

[0343] In some embodiments, the mol% of the cationic lipid in the LNP is 40-70 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 44-54 mol%, 45-60 mol%, 45-55 mol%, 45-50 mol%, 50-60 mol%, 49-64 mol%, 50-55 mol%, or 55-60 mol%. In some embodiments, the mol% of the cationic lipid in the LNP is 44-54 mol%. In some embodiments, the mol% of the cationic lipid in the LNP is 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 mol%. In some embodiments, the mol% of cationic lipid in the LNP is about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54, about 55, about 56, about 57, about 58, about 59, or about 60 mol%. All values ​​include all endpoints.

[0344] In some embodiments, the mol% of the structured lipid in the LNP is 10-60 mol%, 10-30 mol%, 15-35 mol%, 20-40 mol%, 20-45 mol%, 25-33 mol%, 24-32 mol%, 25-45 mol%, 30-50 mol%, 35-43 mol%, 35-55 mol%, or 40-60 mol%. In some embodiments, the mol% of the structured lipid in the LNP is 20-45 mol%. In some embodiments, the mol% of the structured lipid in the LNP is 24-32 mol%. In some embodiments, the mol% of the structured lipid in the LNP is 25-33 mol%. In some embodiments, the mol% of the structured lipid in the LNP is 22-28 mol%. In some embodiments, the mol% of the structured lipid in the LNP is 35-45 mol%. In some embodiments, the mol% of the structured lipid in the LNP is 35-43 mol%. In some embodiments, the mol% of structural lipids in the LNP is 10-60 mol%. In some embodiments, the mol% of structural lipids in the LNP is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 mol%. In some embodiments, the mol% of the structural lipid in the LNP is about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 51, about 52, about 53, about 54, about 55, about 56, about 57, about 58, about 59, or about 60 mol%. In some embodiments, the structural lipid is cholesterol. All values ​​include all endpoints.

[0345] In some embodiments, the mol% of the helper lipid in the LNP is 1-50 mol%. In some embodiments, the mol% of the helper lipid in the LNP is up to 29 mol%. In some embodiments, the mol% of the helper lipid in the LNP is 1-10 mol%, 5-9 mol%, 5-15 mol%, 8-14 mol%, 18-22%, 19-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 20-30 mol%, 25-35 mol%, 30-40 mol%, or 35-50 mol%. In some embodiments, the mol% of the helper lipid in the LNP is 10-25 mol%. In some embodiments, the mol% of the helper lipid in the LNP is 5-9 mol%. In some embodiments, the mol% of the helper lipid in the LNP is 8-14 mol%. In some embodiments, the mol% of the helper lipid in the LNP is 18-22 mol%. In some embodiments, the mol% of helper lipid in the LNP is 19-25 mol%. In some embodiments, the mol% of helper lipid in the LNP is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 mol%. In some embodiments, the mol% of helper lipid in LNP is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, or about 40 mol%. In some embodiments, the helper lipid is DSPC. All values ​​include all endpoints.

[0346] In some embodiments, the mol% of PEG lipid in the LNP is greater than 0 mol% and up to 5 mol% of the total lipid present in the LNP. In some embodiments, the mol% of PEG lipid is 0.1 mol%, 0.2 mol%, 0.25 mol%, 0.3 mol%, 0.4 mol%, 0.5 mol%, 0.6 mol%, 0.7 mol%, 0.8 mol%, 0.9 mol%, 1.0 mol%, 1.1 mol%, 1.2 mol%, 1.3 mol%, 1.4 mol%, 1.5 mol%, 1.6 mol%, 1.7 mol%, 1.8 mol%, 1.9 mol%, 2.0 mol%, 2.1 mol%, 2.2 mol%, 2.3 mol%, 2.4 mol%, 2.5 mol%, 2.6 mol%, 2.7 mol%, 2.8 mol%, 2.9 ...9 mol%, 2.1 mol%, mol%, 1.8mol%, 1.9mol%, 2.0mol%, 2.1mol%, 2.2mol%, 2.3mol%, 2.4mol%, 2.5mol%, 2.6mol%, 2.7mol%, 2.8 mol%, 2.9mol%, 3.0mol%, 3.1mol%, 3.2mol%, 3.3mol%, 3.4mol%, 3.5mol%, 4.0mol%, 4.5mol%, or 5mol%. In some embodiments, the mol% of PEG lipid is about 0.1 mol%, about 0.2 mol%, about 0.25 mol%, about 0.3 mol%, about 0.4 mol%, about 0.5 mol%, about 0.6 mol%, about 0.7 mol%, about 0.8 mol%, about 0.9 mol%, about 1.0 mol%, about 1.1 mol%, about 1.2 mol%, about 1.3 mol%, about 1.4 mol%, about 1.5 mol%, about 1.6 mol%, about 1.7 mol% of the total lipid present in the LNP. ol%, about 1.8 mol%, about 1.9 mol%, about 2.0 mol%, about 2.1 mol%, about 2.2 mol%, about 2.3 mol%, about 2.4 mol%, about 2.5 mol%, about 2.6 mol%, about 2.7 mol%, about 2.8 mol%, about 2.9 mol%, about 3.0 mol%, about 3.1 mol%, about 3.2 mol%, about 3.3 mol%, about 3.4 mol%, about 3.5 mol%, about 4.0 mol%, about 4.5 mol%, or about 5 mol%.In some embodiments, the mol% of PEG lipid is at least 0.1 mol%, at least 0.2 mol%, at least 0.25 mol%, at least 0.3 mol%, at least 0.4 mol%, at least 0.5 mol%, at least 0.6 mol%, at least 0.7 mol%, at least 0.8 mol%, at least 0.9 mol%, at least 1.0 mol%, at least 1.1 mol%, at least 1.2 mol%, at least 1.3 mol%, at least 1.4 mol%, at least 1.5 mol%, at least 1.6 mol%, at least 1.7 mol%, or less of the total lipid present in the LNP. at least 1.8 mol%, at least 1.9 mol%, at least 2.0 mol%, at least 2.1 mol%, at least 2.2 mol%, at least 2.3 mol%, at least 2.4 mol%, at least 2.5 mol%, at least 2.6 mol%, at least 2.7 mol%, at least 2.8 mol%, at least 2.9 mol%, at least 3.0 mol%, at least 3.1 mol%, at least 3.2 mol%, at least 3.3 mol%, at least 3.4 mol%, at least 3.5 mol%, at least 4.0 mol%, at least 4.5 mol%, or at least 5 mol%. In some embodiments, the mol% of PEG lipid is up to 0.1 mol%, up to 0.2 mol%, up to 0.25 mol%, up to 0.3 mol%, up to 0.4 mol%, up to 0.5 mol%, up to 0.6 mol%, up to 0.7 mol%, up to 0.8 mol%, up to 0.9 mol%, up to 1.0 mol%, up to 1.1 mol%, up to 1.2 mol%, up to 1.3 mol%, up to 1.4 mol%, up to 1.5 mol%, up to 1.6 mol%, up to 1.7 mol %, maximum 1.8mol%, maximum 1.9mol%, maximum 2.0mol%, maximum 2.1mol%, maximum 2.2mol%, maximum 2.3mol%, maximum 2.4mol%, maximum 2.5mol%, maximum 2.6mol%, maximum 2.7mol%, maximum 2.8m ol%, up to 2.9 mol%, up to 3.0 mol%, up to 3.1 mol%, up to 3.2 mol%, up to 3.3 mol%, up to 3.4 mol%, up to 3.5 mol%, up to 4.0 mol%, up to 4.5 mol%, or up to 5 mol%.In some embodiments, the mol% of the PEG lipid is 0.1-4 mol% of the total lipid present in the LNP. In some embodiments, the mol% of the PEG lipid is 0.1-2 mol% of the total lipid present in the LNP. In some embodiments, the mol% of the PEG lipid is 0.2-0.8 mol%, 0.4-0.6 mol%, 0.7-1.3 mol%, 1.2-1.8 mol%, or 1-3.5 mol% of the total lipid present in the LNP. In some embodiments, the mol% of the PEG lipid is 0.1-0.7 mol%, 0.2-0.8 mol%, 0.3-0.9 mol%, 0.4-0.8 mol%, 0.4-0.6 mol%, 0.4-1 mol%, 0.5-1.1 mol%, 0.6-1.2 mol%, 0.7-1.3 mol%, 0.8-1.4 mol%, or 0.9-1.5 mol% of the total lipid present in the LNP. , 1-3.5 mol%, 1-1.6 mol%, 1.1-1.7 mol%, 1.2-1.8 mol%, 1.3-1.9 mol%, 1.4-2 mol%, 1.5-2.1 mol%, 1.6-2.2 mol%, 1.7-2.3 mol%, 1.8-2.4 mol%, 1.9-2.5 mol%, 2-2.6 mol%, 2.4-3.8 mol%, or 2.6-3.4 mol%. All values ​​are inclusive.

[0347] In some embodiments, the LNPs of the present disclosure comprise 44-60 mol% cationic lipid, 19-25 mol% helper lipid, 25-33 mol% structural lipid, and 0.2-0.8 mol% PEG lipid (inclusive). In some embodiments, the LNPs of the present disclosure comprise 44-54 mol% cationic lipid, 19-25 mol% helper lipid, 24-32 mol% structural lipid, and 1.2-1.8 mol% PEG lipid (inclusive). In some embodiments, the LNPs of the present disclosure comprise 44-54 mol% cationic lipid, 8-14 mol% helper lipid, 35-43 mol% structural lipid, and 1.2-1.8 mol% PEG lipid (inclusive). In some embodiments, the LNPs of the present disclosure comprise 45-55 mol% cationic lipid, 5-9 mol% helper lipid, 36-44 mol% structural lipid, and 2.5-3.5 mol% PEG lipid (inclusive).

[0348] In some embodiments, the LNPs of this disclosure comprise one or more cationic lipids of this disclosure, one or more helper lipids of this disclosure, one or more structured lipids of this disclosure, and one or more PEG lipids of this disclosure, in a mol % of total lipids (or mol % range of total lipids) in the LNP according to Table 6 below. In some embodiments, the total mol % of these four lipid components equals 100%. In some embodiments, the total mol % of these four lipid components is less than 100%. In some embodiments, the cationic lipid is a compound of Formula (I) or a compound selected from Table 21. In some embodiments, the structured lipid is cholesterol. In some embodiments, the helper lipid is DSPC. In some embodiments, the PEG lipid is of Formula (A), Formula (A'), or Formula (A"). [Table 6-1] [Table 6-2]

[0349] In some embodiments, the LNPs of the disclosure comprise 44-54 mol% cationic lipid, 19-25 mol% helper lipid, 25-33 mol% structural lipid, and 0.2-0.8 mol% PEG lipid (inclusive). In some embodiments, the LNPs of the disclosure comprise 44-54 mol% compound of formula (II-1a), 19-25 mol% DSPC, 25-33 mol% cholesterol, and HO-PEG100-CH 2 (CH 2 ) 16 CH 3 , HO-PEG20-CH 2 (CH 2 ) 16 CH 3 , HO-PEG20-CH 2 (CH 2 ) 14 CH 3 , HO-PEG20-C 18 H 35HO-PEG100-C(O)-CH 2 (CH 2 ) 13 CH 3 HO-PEG50-C(O)-CH 2 (CH 2 ) 13 CH 3 HO-PEG40-C(O)-CH 2 (CH 2 ) 13 CH 3 HO-PEG100-C(O)-CH 2 (CH 2 ) 15 CH 3 HO-PEG50-C(O)-CH 2 (CH 2 ) 15 CH 3 HO-PEG40-C(O)-CH 2 (CH 2 ) 15 CH 3 The compound contains 0.2 to 0.8 mol % PEG lipid selected from the group consisting of (end points included).

[0350] In some embodiments, the LNPs of the disclosure comprise 44-54 mol% cationic lipid, 19-25 mol% helper lipid, 24-32 mol% structural lipid, and 1.2-1.8 mol% PEG lipid (inclusive). In some embodiments, the LNPs of the disclosure comprise 44-54 mol% compound of formula (II-1a), 19-25 mol% DSPC, 24-32 mol% cholesterol, and HO-PEG100-CH 2 (CH 2 ) 16 CH 3 , HO-PEG20-CH 2 (CH 2 ) 16 CH 3 , HO-PEG20-CH 2 (CH 2 ) 14 CH 3 , HO-PEG20-C 18 H 35 HO-PEG100-C(O)-CH 2 (CH2 ) 13 CH 3 HO-PEG50-C(O)-CH 2 (CH 2 ) 13 CH 3 HO-PEG40-C(O)-CH 2 (CH 2 ) 13 CH 3 HO-PEG100-C(O)-CH 2 (CH 2 ) 15 CH 3 HO-PEG50-C(O)-CH 2 (CH 2 ) 15 CH 3 HO-PEG40-C(O)-CH 2 (CH 2 ) 15 CH 3 The composition comprises 1.2 to 1.8 mol % PEG lipid selected from the group consisting of (end points included).

[0351] In some embodiments, the LNPs of the disclosure comprise 44-54 mol% cationic lipid, 8-14 mol% helper lipid, 35-43 mol% structural lipid, and 1.2-1.8 mol% PEG lipid (inclusive). In some embodiments, the LNPs of the disclosure comprise 44-54 mol% compound of formula (II-1a), 8-14 mol% DSPC, 35-43 mol% cholesterol, and HO-PEG100-CH 2 (CH 2 ) 16 CH 3 , HO-PEG20-CH 2 (CH 2 ) 16 CH 3 , HO-PEG20-CH 2 (CH 2 ) 14 CH 3 , HO-PEG20-C 18 H 35 HO-PEG100-C(O)-CH 2 (CH 2 ) 13 CH 3HO-PEG50-C(O)-CH 2 (CH 2 ) 13 CH 3 HO-PEG40-C(O)-CH 2 (CH 2 ) 13 CH 3 HO-PEG100-C(O)-CH 2 (CH 2 ) 15 CH 3 HO-PEG50-C(O)-CH 2 (CH 2 ) 15 CH 3 HO-PEG40-C(O)-CH 2 (CH 2 ) 15 CH 3 The composition comprises 1.2 to 1.8 mol % PEG lipid selected from the group consisting of (end points included).

[0352] In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and PEG lipids, and the ratio of SS-OC:DSPC:Chol:PEG lipids (as a percentage of the total lipid content) is about A:B:C:D, where A=40 mol%-60 mol%, B=10 mol%-25 mol%, C=20 mol%-30 mol%, and D=0 mol%-3 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and PEG lipids, and the ratio of SS-OC:DSPC:Chol:PEG lipids (as a percentage of the total lipid content) is about A:B:C:D, where A=45 mol%-50 mol%, B=20 mol%-25 mol%, C=25 mol%-30 mol%, and D=0 mol%-1 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and PEG lipids, and the ratio of SS-OC:DSPC:Chol:PEG lipids (as a percentage of the total lipid content) is about 49:22:28.5:0.5. In some embodiments, the PEG lipid is a compound of Formula (A), Formula (A'), or Formula (A"). In some embodiments, the PEG lipid is selected from the group consisting of BRIJ® S100, BRIJ® S20, BRIJ® O20, and BRIJ® C20. In some embodiments, the PEG lipid is BRIJ® S100.

[0353] In some embodiments, the LNPs comprise DOTAP, cholesterol (Chol), and DLPE, and the ratio of DOTAP:Chol:DLPE (as a percentage of total lipid content) is about 50:35:15. In some embodiments, the LNPs comprise DOTAP, cholesterol (Chol), and DLPE, and the ratio of DOTAP:Chol:DOPE (as a percentage of total lipid content) is about 50:35:15. In some embodiments, the LNPs comprise DOTAP, cholesterol (Chol), DLPE, DSPE-PEG, and the ratio of DOTP:Chol:DLPE (as a percentage of total lipid content) is about 50:35:15, and the particles comprise about 0.2 mol% DSPE-PEG. In some embodiments, the LNPs comprise MC3, cholesterol (Chol), DSPC, and DMG-PEG, wherein the ratio of MC3:Chol:DSPC:DMG-PEG (as a percentage of the total lipid content) is about 49:38.5:11:1.5.

[0354] In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, where the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about A:B:C:D, where A=40 mol%-60 mol%, B=10 mol%-25 mol%, C=20 mol%-30 mol%, and D=0 mol%-3 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, and the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about A:B:C:D, where A=45 mol%-50 mol%, B=20 mol%-25 mol%, C=25 mol%-30 mol%, and D=0 mol%-1 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, and the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about 49:22:28.5:0.5.

[0355] In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, where the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about A:B:C:D, where A=40 mol%-60 mol%, B=10 mol%-30 mol%, C=20 mol%-45 mol%, and D=0 mol%-3 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, where the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about A:B:C:D, where A=40 mol%-60 mol%, B=10 mol%-30 mol%, C=25 mol%-45 mol%, and D=0 mol%-3 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, where the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about A:B:C:D, where A=45 mol%-55 mol%, B=10 mol%-20 mol%, C=30 mol%-40 mol%, and D=1 mol%-2 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, and the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about A:B:C:D, where A=45 mol%-50 mol%, B=10 mol%-15 mol%, C=35 mol%-40 mol%, and D=1 mol%-2 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, and the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about 49:11:38.5:1.5.

[0356] In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, where the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about A:B:C:D, where A=45 mol%-65 mol%, B=5 mol%-20 mol%, C=20 mol%-45 mol%, and D=0 mol%-3 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, where the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about A:B:C:D, where A=50 mol%-60 mol%, B=5 mol%-15 mol%, C=30 mol%-45 mol%, and D=0 mol%-3 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, and the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about A:B:C:D, where A=55 mol%-60 mol%, B=5 mol%-15 mol%, C=30 mol%-40 mol%, and D=1 mol%-2 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, and the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is about A:B:C:D, where A=55 mol%-60 mol%, B=5 mol%-10 mol%, C=30 mol%-35 mol%, and D=1 mol%-2 mol%, and A+B+C+D=100 mol%. In some embodiments, the LNPs comprise SS-OC, DSPC, cholesterol (Chol), and DPG-PEG2K, and the ratio of SS-OC:DSPC:Chol:DPG-PEG2K (as a percentage of the total lipid content) is 58:7:33.5:1.5.

[0357] In some embodiments, the nanoparticles are coated with glycosaminoglycans (GAGs) to modulate or promote uptake of the nanoparticles by target cells. GAGs can be heparin / heparin sulfate, chondroitin sulfate / dermatan sulfate, keratin sulfate, or hyaluronic acid (HA). In certain embodiments, the surface of the nanoparticles is coated with HA to target the particles for uptake by tumor cells. In some embodiments, the lipid nanoparticles are coated with arginine-glycine-aspartic acid tripeptide (RGD peptide) (see Ruoslahti, Advanced Materials, 24, 2012, 3747-3756, and Bellis et al., Biomaterials, 32(18), 2011, 4205-4210).

[0358] Characterization of LNP Composition The present disclosure provides compositions (e.g., pharmaceutical compositions) comprising a plurality of the LNPs described herein. Also provided herein are compositions comprising the LNPs described herein and encapsulated molecules.

[0359] In some embodiments, the LNPs of the present disclosure may reduce immune responses in vivo compared to control LNPs. In some embodiments, the control LNPs are LNPs that include a PEG lipid that is not of Formula (A), Formula (A'), or Formula (A"). In some embodiments, the PEG lipid of the control LNPs is PEG2k-DPG. In some embodiments, the PEG lipid of the control LNPs is PEG2k-DMG. In some embodiments, the control LNPs have the same molar ratio of PEG lipids as the LNPs of the present disclosure. In some embodiments, the control LNPs are identical to the LNPs of the present disclosure except that the control LNPs include a PEG lipid that is not of Formula (A), Formula (A'), or Formula (A") (e.g., the control LNPs may include PEG2k-DPG or PEG2k-DMG as the PEG lipid).

[0360] In some embodiments, the control LNP is an LNP that includes a cationic lipid that is not of formula (I). In some embodiments, the cationic lipid of the control LNP is SS-OC. In some embodiments, the control LNP has the same molar ratio of cationic lipids as the LNPs of the present disclosure. In some embodiments, the control LNP is identical to the LNPs of the present disclosure, except that the control LNP includes a cationic lipid that is not of formula (I) (e.g., the control LNP can include SS-OC as the cationic lipid).

[0361] In some embodiments, the reduction in immune response can be a reduction in accelerated blood clearance (ABC). In some embodiments, ABC is associated with the secretion of natural IgM and / or anti-PEG IgM. As used herein, the term "native IgM" refers to circulating IgM in serum that exists independent of known immune exposure (e.g., exposure to the LNPs of the present disclosure). The term "reduction in ABC" refers to any reduction in ABC compared to a control LNP. In some embodiments, the reduction in ABC can be a reduction in clearance of the LNPs relative to a control LNP upon a second or subsequent dose. In some embodiments, the reduction can be at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100%. In some embodiments, the reduction is about 10% to about 100%, about 10 to about 50%, about 20 to about 100%, about 20 to about 50%, about 30 to about 100%, about 30 to about 50%, about 40% to about 100%, about 40 to about 80%, about 50 to about 90%, or about 50 to about 100%. In some embodiments, the reduction in ABC can be measured by an increase in encapsulated synthetic RNA viral genomes after a second or subsequent administration, or a sustained detectable level thereof. In some embodiments, the reduction in ABC can result in an increase in the level of encapsulated synthetic RNA viral genomes (e.g., a 2-fold, 3-fold, 4-fold, 5-fold, or greater fold increase) relative to the level of encapsulated synthetic RNA viral genomes after administration of a control LNP. In some embodiments, the reduced ABC is associated with lower serum levels of anti-PEG IgM.

[0362] In some embodiments, the LNPs of the present disclosure may delay clearance of the LNP and its components upon repeated dosing, as compared to control LNPs that may be cleared prior to release of the encapsulated molecule. Thus, the LNPs of the present disclosure may improve the delivery efficiency of the encapsulated molecule (e.g., a synthetic RNA viral genome) upon subsequent dosing.

[0363] In some embodiments, the LNP has an average diameter (i.e., average outer diameter) of about 50 nm to about 500 nm. In some embodiments, the LNP has an average diameter of about 50 nm to about 200 nm, about 100 nm to about 200 nm, about 150 nm to about 200 nm, about 50 nm to about 100 nm, about 50 nm to about 150 nm, about 100 nm to about 150 nm, about 200 nm to about 250 nm, about 250 nm to about 300 nm, about 300 nm to about 400 nm, about 150 nm to about 500 nm, about 200 nm to about 500 nm, about 300 nm to about 500 nm, about 350 nm to about 500 nm, about 400 nm to about 500 nm, about 425 nm to about 500 nm, about 450 nm to about 500 nm, or about 475 nm to about 500 nm. In some embodiments, the LNPs have an average diameter of about 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, about 120, or about 125 nm. In some embodiments, the LNPs have an average diameter of about 100 nm. In some embodiments, the LNPs have an average diameter of 50 nm to 150 nm. In some embodiments, the LNPs have an average diameter (average outer diameter) of 50 nm to 150 nm, 50 nm to 125 nm, 50 nm to 100 nm, 50 nm to 75 nm, 75 nm to 150 nm, 75 nm to 125 nm, 75 nm to 100 nm, 100 nm to 150 nm, 100 nm to 125 nm, or 125 nm to 150 nm. In some embodiments, the LNPs have an average diameter between 70 nm and 90 nm, between 80 nm and 100 nm, between 90 nm and 110 nm, between 100 nm and 120 nm, between 110 nm and 130 nm, between 120 nm and 140 nm, or between 130 nm and 150 nm. In some embodiments, the LNPs have an average diameter between 90 nm and 110 nm. All values ​​include endpoints.

[0364] In some embodiments, the LNPs have an average diameter (i.e., average outer diameter) of about 50 nm to about 150 nm. In some embodiments, the disclosure provides a therapeutic composition comprising a plurality of lipid nanoparticles, wherein the plurality of LNPs has an average diameter of about 60 nm to about 130 nm. In some embodiments, the disclosure provides a therapeutic composition comprising a plurality of lipid nanoparticles, wherein the plurality of LNPs has an average diameter of about 70 nm to about 120 nm. In some embodiments, the disclosure provides a therapeutic composition comprising a plurality of lipid nanoparticles, wherein the plurality of LNPs has an average diameter of about 70 nm. In some embodiments, the disclosure provides a therapeutic composition comprising a plurality of lipid nanoparticles, wherein the plurality of LNPs has an average diameter of about 80 nm. In some embodiments, the disclosure provides a therapeutic composition comprising a plurality of lipid nanoparticles, wherein the plurality of LNPs has an average diameter of about 90 nm. In some embodiments, the disclosure provides a therapeutic composition comprising a plurality of lipid nanoparticles, wherein the plurality of LNPs has an average diameter of about 100 nm. In some embodiments, the disclosure provides a therapeutic composition comprising a plurality of lipid nanoparticles, wherein the plurality of LNPs have an average diameter of about 110 nm. All values ​​include endpoints.

[0365] In some embodiments, the efficiency of encapsulation of synthetic RNA virus genome by LNP is about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100%. In some embodiments, about 70%, about 75%, about 80%, about 90%, about 95%, about 97%, about 98%, or about 99% of the plurality of LNPs contain encapsulated synthetic RNA virus genome. In some embodiments, the efficiency of encapsulation of synthetic RNA virus genome by LNP is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%. In some embodiments, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of the LNPs comprise an encapsulated synthetic RNA virus genome. In some embodiments, about 70%-100%, about 75%-100%, about 80%-100%, about 85%-100%, about 90%-100%, about 91%-100%, about 92%-100%, about 93%-100%, about 94%-100%, about 95%-100%, about 96%-100%, about 97%-100%, about 98%-100%, or about 99%-100% of the LNPs comprise an encapsulated synthetic RNA virus genome.

[0366] In some embodiments, the LNPs have a neutral charge (e.g., an average zeta potential of about 0 mV to about 1 mV). In some embodiments, the LNPs have an average zeta potential of about 40 mV to about -40 mV. In some embodiments, the LNPs have an average zeta potential of about 40 mV to about 0 mV. In some embodiments, the LNPs have an average zeta potential of about 35 mV to about 0 mV, about 30 mV to about 0 mV, about 25 mV to about 0 mV, about 20 mV to about 0 mV, about 15 mV to about 0 mV, about 10 mV to about 0 mV, or about 5 mV to about 0 mV. In some embodiments, the LNPs have an average zeta potential of about 20 mV to about -40 mV. In some embodiments, the LNPs have an average zeta potential of about 20 mV to about -20 mV. In some embodiments, the LNPs have an average zeta potential of about 10 mV to about -20 mV. In some embodiments, the LNPs have an average zeta potential of about 10 mV to about -10 mV. In some embodiments, the LNPs have an average zeta potential of about 10 mV, about 9 mV, about 8 mV, about 7 mV, about 6 mV, about 5 mV, about 4 mV, about 3 mV, about 2 mV, about 1 mV, about 0 mV, about -1 mV, about -2 mV, about -3 mV, about -4 mV, about -5 mV, about -6 mV, about -7 mV, about -8 mV, about -9 mV, about -9 mV, or about -10 mV.

[0367] In some embodiments, the LNPs have an average zeta potential of about 0 mV to about -20 mV. In some embodiments, the LNPs have an average zeta potential of less than about -20 mV. For example, in some embodiments, the LNPs have an average zeta potential of less than about -30 mV, less than about 35 mV, or less than about -40 mV. In some embodiments, the LNPs have an average zeta potential of about -50 mV to about -20 mV, about -40 mV to about -20 mV, or about -30 mV to about -20 mV. In some embodiments, the LNP is at about 0 mV, about -1 mV, about -2 mV, about -3 mV, about -4 mV, about -5 mV, about -6 mV, about -7 mV, about -8 mV, about -9 mV, about -10 mV, about -11 mV, about -12 mV, about -13 mV, about -14 mV, about -15 mV, about -16 mV, about -17 mV, about -18 mV, about -19 mV, about -20 mV, about The LNPs have an average zeta potential of about -21 mV, about -22 mV, about -23 mV, about -24 mV, about -25 mV, about -26 mV, about -27 mV, about -28 mV, about -29 mV, about -30 mV, about -31 mV, about -32 mV, about -33 mV, about -34 mV, about -35 mV, about -36 mV, about -37 mV, about -38 mV, about -39 mV, or about -40 mV. In some embodiments, the LNPs have an average zeta potential of less than about -20 mV, less than about -30 mV, less than about 35 mV, or less than about -40 mV.

[0368] In some embodiments, the LNPs comprise a recombinant nucleic acid molecule described herein and have a lipid (L) to nucleic acid (N) mass ratio of about 10:1 to about 60:1. In some embodiments, the LNPs comprise a recombinant nucleic acid molecule described herein and have a lipid (L) to nucleic acid (N) mass ratio of about 20:1. In some embodiments, the LNPs comprise a recombinant nucleic acid molecule described herein and have a lipid (L) to nucleic acid (N) mass ratio of about 30:1. In some embodiments, the LNPs comprise a recombinant nucleic acid molecule described herein and have a lipid (L) to nucleic acid (N) mass ratio of about 40:1. In some embodiments, the LNPs comprise a recombinant nucleic acid molecule described herein and have an L:N mass ratio of about 15:1, about 16:1, about 17:1, about 18:1, about 19:1, about 20:1, about 21:1, about 22:1, about 23:1, about 24:1, about 25:1, about 26:1, about 27:1, about 28:1, about 29:1, about 30:1, about 31:1, about 32:1, about 33:1, about 34:1, about 35:1, about 36:1, about 237:1, about 28:1, about 39:1, about 40:1, about 41:1, about 42:1, about 43:1, about 44:1, or about 45:1.

[0369] In some embodiments, the LNPs have a lipid (L) to nucleic acid molecule (N) mass ratio of 10:1 to 60:1, 20:1 to 60:1, 30:1 to 60:1, 40:1 to 60:1, 50:1 to 60:1, 10:1 to 50:1, 20:1 to 50:1, 30:1 to 50:1, 40:1 to 50:1, 10:1 to 40:1, 20:1 to 40:1, 30:1 to 40:1, 10:1 to 30:1, 20:1 to 30:1, or 10:1 to 20:1 (all endpoints included). In some embodiments, the LNPs have a lipid:nucleic acid molecule mass ratio of 30:1 to 40:1. In some embodiments, the LNPs have a lipid:nucleic acid molecule mass ratio of 30:1 to 36:1.

[0370] In some embodiments, the LNPs comprise a recombinant nucleic acid molecule described herein and have a lipid (L) to nucleic acid (N) mass ratio of about 10:1 to about 60:1. In some embodiments, the LNPs comprise a recombinant nucleic acid molecule described herein and have a lipid (L) to nucleic acid (N) mass ratio of about 20:1. In some embodiments, the LNPs comprise a recombinant nucleic acid molecule described herein and have a lipid (L) to nucleic acid (N) mass ratio of about 30:1 (L:N). In some embodiments, the LNPs comprise a recombinant nucleic acid molecule described herein and have a lipid (L) to nucleic acid (N) mass ratio of about 40:1 (L:N). In some embodiments, the LNPs comprise a recombinant nucleic acid molecule described herein and have an L:N mass ratio of about 15:1, about 16:1, about 17:1, about 18:1, about 19:1, about 20:1, about 21:1, about 22:1, about 23:1, about 24:1, about 25:1, about 26:1, about 27:1, about 28:1, about 29:1, about 30:1, about 31:1, about 32:1, about 33:1, about 34:1, about 35:1, about 36:1, about 237:1, about 28:1, about 39:1, about 40:1, about 41:1, about 42:1, about 43:1, about 44:1, or about 45:1.

[0371] In some embodiments, the LNPs comprise a nucleic acid molecule and have a lipid nitrogen to phosphate ratio (N:P) of 1 to 25. In some embodiments, N:P is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, N:P is 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 10 to 25, 10 to 20, 10 to 15, 15 to 25, 15 to 20, or 20 to 25. In some embodiments, the LNPs comprise a nucleic acid molecule and have a lipid nitrogen to phosphate ratio (N:P) of 14.

[0372] In some embodiments, the LNPs comprise a synthetic RNA virus genome encoding an oncolytic virus, and the encoded oncolytic virus can reduce the size of a tumor at a distance from the site of LNP administration to a subject. For example, as demonstrated in the examples provided herein, intravenous administration of the LNPs described herein results in viral replication in tumor tissue and a reduction in tumor size. These data indicate that the LNPs of the present disclosure can localize to tumors or cancerous tissues at a distance from the site of LNP administration. Such an effect allows the LNP-encapsulated oncolytic viruses described herein to be used to treat tumors that are not easily accessible and therefore not suitable for intratumoral therapeutic delivery.

[0373] LNP preparation method In some embodiments, the present disclosure provides a method for preparing a composition of lipid nanoparticles (LNPs) comprising a nucleic acid molecule, the method comprising: (a) diluting the nucleic acid molecule to a desired concentration in an aqueous solution; (b) using microfluidic flow to mix an organic lipid phase containing all the lipid components of the LNP with an aqueous phase containing the nucleic acid molecules to form the LNP; (c) dialysing the LNPs against a buffer to remove the organic solvent; (d) concentrating the LNPs to a target volume; (e) optionally filtering through a sterile filter.

[0374] In some embodiments, the organic lipid phase and the aqueous phase are mixed in a ratio of 1:1 (v:v) to 1:10 (v:v). In some embodiments, the organic lipid phase and the aqueous phase are mixed in a ratio of 1:1 (v:v), 1:2 (v:v), 1:3 (v:v), 1:4 (v:v), 1:5 (v:v), 1:6 (v:v), 1:7 (v:v), 1:8 (v:v), 1:9 (v:v), or 1:10 (v:v). In some embodiments, the organic lipid phase and the aqueous phase are mixed in a ratio of 1:1 (v:v) to 1:3 (v:v), 1:2 (v:v) to 1:4 (v:v), 1:3 (v:v) to 1:5 (v:v), 1:4 (v:v) to 1:6 (v:v), 1:5 (v:v) to 1:7 (v:v), 1:6 (v:v) to 1:8 (v:v), 1:7 (v:v) to 1:9 (v:v), or 1:8 (v:v) to 1:10 (v:v). In some embodiments, the organic lipid phase and the aqueous phase are mixed in a ratio of 1:3 (v:v) to 1:5 (v:v). In some embodiments, the organic lipid phase and the aqueous phase are mixed in a ratio of 1:3 (v:v). In some embodiments, the organic lipid phase and the aqueous phase are mixed in a ratio of 1:5 (v:v).

[0375] In some embodiments, the total flow rate of the microfluidic streams is between 5 and 20 mL / min. In some embodiments, the total flow rate of the microfluidic streams is between 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mL / min. In some embodiments, the total flow rate of the microfluidic streams is between 9 and 20 mL / min. In some embodiments, the total flow rate of the microfluidic streams is between 11 and 13 mL / min.

[0376] In some embodiments, the solvent in the organic lipid phase in step (b) is ethanol. In some embodiments, heat is applied to the organic lipid phase in step (b). In some embodiments, about 40, 45, 50, 55, 60, 65, 70, 75, or 80° C. is applied to the organic lipid phase in step (b). In some embodiments, heat of 60° C. is applied to the organic lipid phase in step (b). In some embodiments, no heat is applied to the organic lipid phase in step (b).

[0377] In some embodiments, the aqueous solution of step (a) has a pH of 1 to 7. In some embodiments, the aqueous solution of step (a) has a pH of 1 to 3, 2 to 4, 3 to 5, 4 to 6, or 5 to 7. In some embodiments, the aqueous solution of step (a) has a pH of 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, or 7. In some embodiments, the aqueous solution of step (a) has a pH of 3. In some embodiments, the aqueous solution of step (a) has a pH of 5.

[0378] In some embodiments, the total lipid concentration is 5 mM to 80 mM. In some embodiments, the total lipid concentration is about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, or 80 mM. In some embodiments, the total lipid concentration is about 20 mM. In some embodiments, the total lipid concentration is about 40 mM.

[0379] In some embodiments, the LNPs produced by this method have a lipid nitrogen to phosphate ratio (N:P) of 1 to 25. In some embodiments, N:P is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, N:P is 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 10 to 25, 10 to 20, 10 to 15, 15 to 25, 15 to 20, or 20 to 25. In some embodiments, the LNPs comprise a nucleic acid molecule and have a lipid nitrogen to phosphate ratio (N:P) of 14.

[0380] In some embodiments, the buffer in step (c) has a neutral pH (e.g., 1×PBS, pH 7.2). In some embodiments, step (d) uses centrifugal filtration for concentration.

[0381] In some embodiments, the encapsulation efficiency of the disclosed method is at least 70%, at least 75%, at least 75%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%. In some embodiments, the encapsulation efficiency of the disclosed method is at least 90%. In some embodiments, the encapsulation efficiency of the disclosed method is at least 95%. In some embodiments, the encapsulation efficiency is determined by RiboGreen.

[0382] In some embodiments, the LNPs produced by the methods of the present disclosure have an average diameter (ie, average outer diameter) of about 50 nm to about 500 nm. In some embodiments, the LNPs have an average diameter of about 50 nm to about 200 nm, about 100 nm to about 200 nm, about 150 nm to about 200 nm, about 50 nm to about 100 nm, about 50 nm to about 150 nm, about 100 nm to about 150 nm, about 200 nm to about 250 nm, about 250 nm to about 300 nm, about 300 nm to about 400 nm, about 150 nm to about 500 nm, about 200 nm to about 500 nm, about 300 nm to about 500 nm, about 350 nm to about 500 nm, about 400 nm to about 500 nm, about 425 nm to about 500 nm, about 450 nm to about 500 nm, or about 475 nm to about 500 nm. In some embodiments, the LNPs have an average diameter of about 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, about 120, or about 125 nm. In some embodiments, the LNPs have an average diameter of about 100 nm. In some embodiments, the LNPs have an average diameter of 50 nm to 150 nm. In some embodiments, the LNPs have an average diameter (average outer diameter) of 50 nm to 150 nm, 50 nm to 125 nm, 50 nm to 100 nm, 50 nm to 75 nm, 75 nm to 150 nm, 75 nm to 125 nm, 75 nm to 100 nm, 100 nm to 150 nm, 100 nm to 125 nm, or 125 nm to 150 nm. In some embodiments, the LNPs have an average diameter between 70 nm and 90 nm, 80 nm and 100 nm, 90 nm and 110 nm, 100 nm and 120 nm, 110 nm and 130 nm, 120 nm and 140 nm, or 130 nm and 150 nm. In some embodiments, the LNPs have an average diameter between 90 nm and 110 nm.

[0383] In some embodiments, the polydispersity index of the LNPs is between 0.01 and 0.3. In some embodiments, the polydispersity index of the LNPs is between 0.1 and 0.15. In some embodiments, the polydispersity index of the LNPs is about 0.01, about 0.02, about 0.03, about 0.04, about 0.05, about 0.06, about 0.07, about 0.08, about 0.09, about 0.10, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 016, about 0.17, about 0.18, about 0.19, about 0.20, about 0.21, about 0.22, about 0.23, about 0.24, about 0.25, about 0.26, about 0.27, about 0.28, about 0.29, or about 0.30. In some embodiments, the polydispersity index of the LNPs is about 0.10, about 0.11, about 0.12, about 0.13, about 0.14, or about 0.15. In some embodiments, the average diameter and / or polydispersity is determined by dynamic light scattering.

[0384] Payload molecules In some embodiments, the particle comprises a synthetic RNA viral genome and further comprises a recombinant RNA polynucleotide encoding a payload molecule. In some embodiments, the particle is a lipid nanoparticle and comprises a synthetic RNA viral genome and further comprises a recombinant RNA polynucleotide encoding a payload molecule. In some embodiments, the synthetic RNA viral genome in the particle (e.g., LNP) comprises a recombinant RNA polynucleotide encoding a payload molecule. In some embodiments, the particle (e.g., LNP) comprises 1) a synthetic RNA viral genome (which may or may not encode a payload molecule), and 2) a second recombinant RNA polynucleotide encoding a payload molecule. In some embodiments, the synthetic RNA viral genome and the second recombinant RNA polynucleotide encoding the payload molecule are not linked in the particle (e.g., LNP). In some embodiments, the synthetic RNA viral genome and the second recombinant RNA polynucleotide encoding the payload molecule are non-covalently linked. In some embodiments, the synthetic RNA viral genome and the second recombinant RNA polynucleotide encoding the payload molecule are covalently linked via a covalent bond other than a regular 3',5' phosphodiester bond. In some embodiments, one or more miRNA target sequences are incorporated into the 3' or 5' UTR of the RNA polynucleotide encoding the payload molecule. In some embodiments, one or more miRNA target sequences are inserted into the polynucleotide encoding the payload molecule. In such embodiments, translation and subsequent expression of the payload is not present or is substantially reduced in cells in which the corresponding miRNA is expressed. In some embodiments, the recombinant RNA polynucleotide encoding the payload molecule is a replicon.

[0385] In some embodiments, the payload is a cytotoxic peptide. As used herein, "cytotoxic peptide" refers to a protein that can induce cell death when expressed in a host cell and / or cell death of neighboring cells when secreted by a host cell. In some embodiments, the cytotoxic peptide is a caspase, p53, diphtheria toxin (DT), Pseudomonas exotoxin A (PEA), type I ribozyme inactivating protein (RIP) (e.g., saporin and gelonin), type II RIP (e.g., ricin), Shiga-like toxin 1 (Slt1), photosensitive reactive oxygen species (e.g., killer red). In certain embodiments, the cytotoxic peptide is encoded by a suicide gene that causes cell death via apoptosis, such as a caspase gene.

[0386] In some embodiments, the payload is an immunomodulatory peptide. As used herein, an "immunomodulatory peptide" is a peptide that can modulate (e.g., activate or inhibit) a particular immune receptor and / or pathway. In some embodiments, the immunomodulatory peptide can act on any mammalian cell, including immune cells, tissue cells, and stromal cells. In preferred embodiments, the immunomodulatory peptide acts on immune cells such as T cells, NK cells, NKT T cells, B cells, dendritic cells, macrophages, basophils, mast cells, or eosinophils. Exemplary immunomodulatory peptides include antigen-binding molecules such as antibodies or antigen-binding fragments thereof, cytokines, chemokines, soluble receptors, cell surface receptor ligands, bipartite peptides, and enzymes.

[0387] In some embodiments, the payload is a cytokine, such as IL-1, IL-12, IL-15, IL-18, IL-36γ, TNFα, IFNα, IFNβ, IFNγ, or TNFSF14. In some embodiments, the payload is a chemokine, such as CXCL10, CXCL9, CCL21, CCL4, or CCL5. In some embodiments, the payload is a ligand of a cell surface receptor, such as an NKG2D ligand, a neuropilin ligand, an Flt3 ligand, a CD47 ligand (e.g., SIRP1α). In some embodiments, the payload is a soluble receptor, such as a soluble cytokine receptor (e.g., IL-13R, TGFβR1, TGFβR2, IL-35R, IL-15R, IL-2R, IL-12R, and an interferon receptor) or a soluble innate immune receptor (e.g., Toll-like receptor, complement receptor, etc.). In some embodiments, the payload is a dominant agonist mutant of a protein involved in intracellular RNA and / or DNA sensing (e.g., a dominant agonist mutant of STING, RIG-1, or MDA-5).

[0388] In some embodiments, the payload is an antigen-binding molecule, such as an antibody or an antigen-binding fragment thereof (e.g., single chain variable fragment (scFv), F(ab), etc.). In some embodiments, the antigen-binding molecule specifically binds to a cell surface receptor, such as an immune checkpoint receptor (e.g., PD-1, PD-L1, and CTLA4) or additional cell surface receptors involved in cell growth and activation (e.g., OX40, CD200R, CD47, CSF1R, TREM2, 4-1BB, CD40, and NKG2D).

[0389] In some embodiments, the payload molecule is a scorpion polypeptide, such as chlorotoxin, BmKn-2, neopragin 1, neopragin 2, and mauriporin. In some embodiments, the payload molecule is a snake polypeptide, such as contortrostatin, apoxin I, bothropstoxin I, BJcuL, OHAP-1, rhodostomin, drCT-I, CTX-III, B1L, and ACTX-6. In some embodiments, the payload molecule is a spider polypeptide, such as latarcin and hyaluronidase. In some embodiments, the payload molecule is a bee polypeptide, such as melittin and apamin. In some embodiments, the payload molecule is a frog polypeptide, such as PsT-1, PdT-1, and PdT-2.

[0390] In some embodiments, the payload molecule is an enzyme. In some embodiments, the enzyme can modulate the tumor microenvironment by modifying the extracellular matrix. In such embodiments, the enzyme can include, but is not limited to, matrix metalloproteases (e.g., MMP9), collagenase, hyaluronidase, gelatinase, or elastase. In some embodiments, the enzyme is part of the gene-dependent enzyme prodrug therapy (GDEPT) system, such as thymidine kinase, cytosine deaminase, nitroreductase, carboxypeptidase G2, purine nucleoside phosphorylase, or cytochrome P450 of herpes simplex virus. In some embodiments, the enzyme can induce or activate a cell death pathway in the target cell (e.g., caspase). In some embodiments, the enzyme can degrade an extracellular metabolite or message (e.g., adenosine deaminase, or arginase, or 15-hydroxyprostaglandin dehydrogenase).

[0391] In some embodiments, the payload molecule is MLKL. In some embodiments, the MLKL polypeptide comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 104. In some embodiments, the payload molecule comprises or consists of an MLKL 4HB domain. In some embodiments, the MLKL 4HB domain comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to amino acids 1-120 of SEQ ID NO: 104.

[0392] In some embodiments, the payload molecule is Gasdermin D (GSDMD). In some embodiments, Gasdermin D (GSDMD) comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 105. In some embodiments, the payload molecule comprises or consists of a Gasdermin DN terminal fragment. In some embodiments, the Gasdermin DN terminal fragment comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to amino acids 1-233 of SEQ ID NO: 105. In some embodiments, the payload molecule comprises a mutation corresponding to L192A of SEQ ID NO: 105.

[0393] In some embodiments, the payload molecule is Gasdermin E (GSDME). In some embodiments, Gasdermin E (GSDME) comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 106. In some embodiments, the payload molecule comprises or consists of a Gasdermin EN-terminal fragment. In some embodiments, the Gasdermin EN-terminal fragment comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to amino acids 1-237 of SEQ ID NO: 106.

[0394] In some embodiments, the payload molecule is HMGB1. In some embodiments, the HMGB1 polypeptide comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 107. In some embodiments, the payload molecule comprises or consists of an HMGB1 Box B domain. In some embodiments, the HMGB1 Box B domain comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to amino acids 96-162 of SEQ ID NO: 107.

[0395] In some embodiments, the payload molecule is SMAC / Diablo. In some embodiments, SMAC / Diablo comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 108. In some embodiments, the payload molecule comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to amino acids 56-239 of SEQ ID NO: 108.

[0396] In some embodiments, the payload molecule is melittin, which in some embodiments comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 109.

[0397] In some embodiments, the payload molecule is an L-amino acid oxidase (LAAO). In some embodiments, the L-amino acid oxidase (LAAO) comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:110.

[0398] In some embodiments, the payload molecule is a disintegrin. In some embodiments, the disintegrin comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:111.

[0399] In some embodiments, the payload molecule is TRAIL (TNFSF10). In some embodiments, TRAIL (TNFSF10) comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:112.

[0400] In some embodiments, the payload molecule is a nitroreductase. In some embodiments, the nitroreductase is NfsB (e.g., from E. coli). In some embodiments, NfsB comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:113. In some embodiments, the nitroreductase is NfsA (e.g., from E. coli). In some embodiments, NfsA comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:114.

[0401] In some embodiments, the payload molecule is a reovirus FAST protein. In some embodiments, the reovirus FAST protein is ARV p14, BRV p15, or a p14-p15 hybrid. In some embodiments, the payload molecule is ARV p14. In some embodiments, the ARV p14 comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:115. In some embodiments, the payload molecule is BRV p15. In some embodiments, the BRV p15 comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:116. In some embodiments, the payload molecule is a p14-p15 hybrid. In some embodiments, the p14-p15 hybrid comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:117.

[0402] In some embodiments, the payload molecule is leptin / FOSL2. In some embodiments, leptin / FOSL2 comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:118.

[0403] In some embodiments, the payload molecule is adenosine deaminase 2 (ADA2). In some embodiments, the adenosine deaminase (ADA2) comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:119.

[0404] In some embodiments, the payload molecule is an alpha-1,3-galactosyltransferase. In some embodiments, the alpha-1,3-galactosyltransferase comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:120.

[0405] In some embodiments, the payload molecule is IL-2. In some embodiments, the IL-2 comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:121.

[0406] In some embodiments, the payload molecule is IL-7. In some embodiments, the IL-7 comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 122.

[0407] In some embodiments, the payload molecule is IL12. In some embodiments, the payload molecule comprises an IL-12 beta subunit comprising or consisting of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 123. In some embodiments, the payload molecule comprises an IL-12 alpha subunit comprising or consisting of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 124.

[0408] In some embodiments, the payload molecule is IL18. In some embodiments, IL18 comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 125.

[0409] In some embodiments, the payload molecule is IL-21. In some embodiments, the IL-21 comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 126.

[0410] In some embodiments, the payload molecule is IL-36γ. In some embodiments, the IL-36γ comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:127.

[0411] In some embodiments, the payload molecule is IFNγ. In some embodiments, the IFNγ comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:128.

[0412] In some embodiments, the payload molecule is CCL21. In some embodiments, CCL21 comprises or consists of an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 129.

[0413] In some embodiments, the payload molecule is encoded by a polynucleotide molecule according to one of the embodiments provided in Table 20 below. [Table 20-1] [Table 20-2]

[0414] In some embodiments, the payload molecule is a bipartite peptide. As used herein, a "bipartite peptide" refers to a multimeric protein composed of a first domain capable of binding to a cell surface antigen expressed on a non-cancerous effector cell and a second domain capable of binding to a cell surface antigen expressed by a target cell (e.g., a cancerous cell, a tumor cell, or a different type of effector cell). In some embodiments, the individual polypeptide domains of the bipartite polypeptide may comprise an antibody or a binding fragment thereof (e.g., a single chain variable fragment (scFv) or F(ab)), a nanobody, a diabody, a flexibody, a DOCK-AND-LOCK™ antibody, or a monoclonal anti-idiotypic antibody (mAb2). In some embodiments, the structure of the bipartite polypeptide may be a dual variable domain antibody (DVD-Ig™), a Tandab™, a bispecific T cell engager (BiTE™), a DuoBody™, or a dual affinity retargeting (DART) polypeptide. In some embodiments, the bipartite polypeptide is a BiTE and comprises a domain that specifically binds to an antigen shown in Table 8 and / or Table 9. Exemplary BiTEs are shown in Table 7 below. [Table 7]

[0415] In some embodiments, the cell surface antigen expressed on the effector cell is selected from Table 8 below. In some embodiments, the cell surface antigen expressed on the tumor cell or effector cell is selected from Table 9 below. In some embodiments, the cell surface antigen expressed on the tumor cell is a tumor antigen. In some embodiments, the tumor antigen is selected from CD19, EpCAM, CEA, PSMA, CD33, EGFR, Her2, EphA2, MCSP, ADAM17, PSCA, 17-A1, NKGD2 ligand, CSF1R, FAP, GD2, DLL3, TROP2, Nectin4, or Neuropilin. In other embodiments, the antigen is a viral antigen associated with cancer development. In some embodiments, the viral antigen associated with cancer development is HBV-core (Hepatitis B core antigen), HBV-pol, HbS-Ag, HPV E6, HPV E7, Merkel cell polyoma large T antigen, or Epstein-Barr virus antigen EBNA2 or BZLF1. In some embodiments, the tumor antigen is selected from those listed in Table 9. [Table 8] [Table 9-1] [Table 9-2]

[0416] Pharmaceutical Compositions and Methods of Use One aspect of the present disclosure relates to pharmaceutical compositions comprising recombinant RNA molecules described herein or particles comprising recombinant RNA molecules described herein, and methods of treating cancer. In some embodiments, the present disclosure provides a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of CVA21-EF, CVA21-KY, or SVV virus, or a corresponding RNA virus genome. The compositions described herein can be formulated in any manner suitable for the desired delivery route. Typically, the formulation comprises any physiologically acceptable composition, such as a derivative or prodrug, solvate, stereoisomer, racemate, or tautomer thereof, together with any pharma- ceutically acceptable carrier, diluent, and / or excipient.

[0417] As used herein, a "pharmaceutically acceptable carrier, diluent, or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, surface active agent, or emulsifier approved by the U.S. Food and Drug Administration as acceptable for use in humans or domestic animals. Exemplary pharma- ceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; tragacanth; malt; gelatin; talc; cocoa butter, waxes, animal and vegetable fats, paraffin, silicones, bentonite, silicic acid, zinc oxide; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffers; and any other compatible substances utilized in pharmaceutical formulations.

[0418] "Pharmaceutically acceptable salts" include both acid addition salts and base addition salts. Pharmaceutically acceptable salts include inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc., and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxo-glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid, etc. formed from (formed by the free amino groups of proteins) acid addition salts. Salts formed by free carboxyl groups can also be derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, etc.Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, substituted amines such as naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.

[0419] The present disclosure provides a method of killing cancerous or target cells, comprising exposing the cells to an RNA polynucleotide or particle, or composition thereof, described herein, under conditions sufficient for intracellular delivery of the composition to the cancerous cells. As used herein, "cancerous cell" or "target cell" refers to a mammalian cell selected for treatment or administration with a polynucleotide or particle, or composition thereof, described herein. As used herein, "killing a cancerous cell" refers to the death of a cancerous cell, particularly by apoptosis or necrosis. The killing of a cancerous cell can be determined by methods known in the art, including, but not limited to, tumor size measurement, cell count, and flow cytometry for detection of cell death markers such as Annexin V and incorporation of propidium iodide.

[0420] The present disclosure further provides a method of treating or preventing cancer in a subject in need thereof, wherein an effective amount of a pharmaceutical composition described herein is administered to the subject. The route of administration will of course vary depending on the location and nature of the disease being treated, and may include, for example, intradermal, transdermal, subdermal, parenteral, intranasal, intravenous, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intratumoral, perfusion, lavage, direct injection, and oral administration. The encapsulated polynucleotide compositions described herein are particularly useful in the treatment of metastatic cancers, where systemic administration may be required to deliver the composition to multiple organs and / or cell types. Thus, in certain embodiments, the compositions described herein are administered systemically.

[0421] "Effective amount" or "effective dose", as used interchangeably herein, refers to the amount and / or dose of the composition described herein that results in an improvement or alleviation of symptoms of a disease or condition. An improvement is any improvement or alleviation of a disease or condition, or symptoms of a disease or condition. An improvement can be an observable or measurable improvement, or an improvement in the subject's overall sense of well-being. Thus, those skilled in the art recognize that a treatment may improve a disease condition, but may not be a complete cure of the disease. Improvements in a subject may include, but are not limited to, a reduction in tumor burden, a reduction in tumor cell proliferation, an increase in tumor cell death, activation of immune pathways, an increase in time to tumor progression, a reduction in cancer pain, an increase in survival rate, or an improvement in quality of life.

[0422] In some embodiments, administration of an effective dose can be accomplished by administration of a single dose of the compositions described herein. As used herein, "dose" refers to the amount of composition delivered at one time. In some embodiments, the dose of the recombinant RNA molecule is greater than or equal to 50% tissue culture infectious dose (TCID 50 In some embodiments, the TCID 50 is at least about 10 3 ~10 9 TCID 50 / mL, e.g., at least about 103 TCID 50 / mL, about 10 4 TCID 50 / mL, about 10 5 TCID 50 / mL, about 10 6 TCID 50 / mL, about 10 7 TCID 50 / mL, about 10 8 TCID 50 / mL, or about 10 9 TCID 50 In some embodiments, the dose may be measured by the number of particles contained in a given volume (e.g., particles / mL). In some embodiments, the dose may be more precisely expressed by the number of genomic copies of the RNA polynucleotides described herein present in each particle (e.g., number of particles / mL, each particle containing at least one genomic copy of the polynucleotide). In some embodiments, delivery of an effective dose may require administration of multiple doses of the compositions described herein. Thus, administration of an effective dose may require administration of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50 or more doses of the compositions described herein.

[0423] In embodiments in which multiple doses of the compositions described herein are administered, each dose need not be administered by the same person and / or in the same geographic location. Furthermore, the dosing can be administered according to a predetermined schedule. For example, the predetermined dosing schedule can include administering a dose of the compositions described herein daily, every other day, weekly, biweekly, monthly, bimonthly, annually, semi-annually, etc. The predetermined dosing schedule can be adjusted as needed for a given patient (e.g., the amount of the composition administered can be increased or decreased, and / or the frequency of the doses can be increased or decreased, and / or the total number of doses administered can be increased or decreased).

[0424] As used herein, "prevention" or "prophylaxis" can mean preventing a disease symptom altogether, delaying the onset of a disease symptom, or reducing the severity of a disease symptom that subsequently occurs.

[0425] The term "subject" or "patient" as used herein is taken to mean any mammalian subject to which the compositions described herein are administered according to the methods described herein. In certain embodiments, the methods of the present disclosure are utilized to treat human subjects. The methods of the present disclosure can also be utilized to treat non-human primates (e.g., monkeys, baboons, and chimpanzees), mice, rats, cows, horses, cats, dogs, pigs, rabbits, goats, deer, sheep, ferrets, gerbils, guinea pigs, hamsters, bats, birds (e.g., chickens, turkeys, and ducks), fish, and reptiles.

[0426] In some embodiments, the disclosure provides a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an oncolytic Coxsackievirus, the Coxsackievirus being a CVA21 strain, or a polynucleotide encoding CVA21, wherein the cancer is classified as susceptible to CVA21 infection based on the expression level of ICAM-1 in the cancer and / or the percentage of ICAM-1 positive cancer cells. In some embodiments, the CVA21 strain is CVA21-KY.

[0427] Intercellular adhesion molecule 1 (ICAM-1, also known as BB2, CD54, P3.58) is a protein (UniProt Ref: P03562) encoded by the ICAM1 gene (NCBI Gene ID: 3383) that is important in stabilizing cell-cell interactions and promoting leukocyte endothelial transmigration. In some embodiments, treatment decisions for a particular cancer are made based on ICAM-1 expression, and expression of ICAM-1 is determined in the cancer, and the cancer is identified as sensitive or resistant to CVA21 expression based on the level of ICAM-1 expression. Generally, higher expression of ICAM-1 (% of positive tumor cells, or intensity, or both) indicates higher susceptibility to CVA21 infection (see Example 8). ICAM-1 expression can be determined by means known in the art for mRNA and / or protein expression. mRNA...

Claims

1. A recombinant DNA molecule, wherein from 5' to 3', Promoter sequence, 5' junction cutting arrangement, and Polynucleotide sequences encoding RNA molecules, including synthetic RNA virus genomes. The recombinant DNA molecule comprising, wherein the 5' junction cleavage sequence comprises or consists of the ENV27 ribozyme coding sequence.

2. The ENV27 ribozyme coding sequence is A polynucleotide sequence (excluding the P3 stem insert) having at least 80% identity with Sequence ID No. 132 (excluding its P3 stem insert corresponding to nucleotides 49-54 of Sequence ID No. 132). A recombinant DNA molecule according to claim 1, comprising or consisting of the following.

3. The recombinant DNA molecule according to claim 1, wherein the ENV27 ribozyme coding sequence includes a polynucleotide "TTTATT" or "TTTGTT" at positions corresponding to nucleotides 25-30 of sequence number 132.

4. The recombinant DNA molecule according to claim 2, wherein the ENV27 ribozyme coding sequence comprises the P3 stem insert having a length of about 1 to 30, about 1 to 20, about 6 to 20, or about 6 to 10 polynucleotides.

5. The P3 stem insert is i) In the region corresponding to nucleotides 49-54 of SEQ ID NO: 132, the polynucleotide "AGATCT"; i) In the region corresponding to nucleotides 49-54 of SEQ ID NO: 132, the polynucleotide "AGAGAAATCT" (SEQ ID NO: 137); or iii) In the region corresponding to nucleotides 49-54 of SEQ ID NO: 132, the polynucleotide "AGAACGAGAAAAATCGTTCT" (SEQ ID NO: 138) A recombinant DNA molecule according to claim 4, comprising or consisting of the following.

6. The recombinant DNA molecule according to claim 1, wherein the synthetic RNA virus genome encodes a picornavirus.

7. The recombinant DNA molecule according to claim 1, wherein the 5' end of the RNA virus genome comprises a polynucleotide sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with nucleotides 1 to 260 of any one of SEQ ID NOs: 1, 5, or 9.

8. The recombinant DNA molecule according to claim 1, wherein the recombinant DNA molecule further comprises a 3' junction cleavage sequence, the 3' junction cleavage sequence comprising or consisting of a ribozyme sequence, a restriction enzyme recognition sequence, an IIS-type restriction enzyme recognition sequence, a BsmBI recognition sequence, or a BsaI recognition sequence.

9. A method for producing recombinant RNA molecules, In vitro transcription of a recombinant DNA molecule according to any one of claims 1 to 8, and Purification of the obtained recombinant RNA molecule The method, including the method described above.

10. One recombinant RNA molecule or a plurality of recombinant RNA molecules transcribed from a recombinant DNA molecule according to any one of claims 1 to 8.

11. An effective amount of the recombinant RNA molecule according to claim 10, and Carriers suitable for administration to mammals A composition containing the following:

12. A particle comprising the recombinant RNA molecule described in Claim 10.

13. A pharmaceutical composition comprising a plurality of particles as described in Claim 12.

14. A composition for use in a method for killing cancer cells, comprising the particles described in claim 12, wherein the method is Exposing the cancer cells to the particles is performed under conditions that satisfy intracellular delivery of the particles to the cancer cells. The composition comprising, wherein a replicable virus generated by the encapsulated polynucleotide results in the killing of the cancer cells.

15. A composition for treating cancer in a subject, comprising the particles described in claim 12.