Double-stranded DNA compositions and related methods

Abstract

The present disclosure provides, for example, a therapeutic double-stranded construct (TDSC). In some embodiments, the TDSC includes a double-stranded DNA region, an upstream closed end, and a downstream closed end. In some embodiments, the TDSC includes chemically modified nucleotides. In some embodiments, the TDSC is resistant to endonuclease digestion and / or resistant to immunosensor recognition and aids in the expression of a heterologous payload encoded by the TDSC.

Description

Technical Field

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 341,960, filed May 13, 2022, the entire content of which is incorporated herein by reference.

[0002] Sequence Listing This application includes a sequence listing submitted electronically in XML format, which is incorporated herein by reference in its entirety. The XML copy created on May 10, 2023, is named F2128 - 7002WO_SL.xml and is 183,436 bytes in size.

Background Art

[0003] There is a need for novel therapies to address unmet medical needs.

Summary of the Invention

Means for Solving the Problems

[0004] Pharmaceutical DNA compositions, constructs, formulations, methods of using such compositions, constructs and formulations, and methods of making the same are described herein.

[0005] In one aspect, the invention features a therapeutic double - stranded construct (“TDSC”).

[0006] Enumerated Embodiments 1. a) Upstream exonuclease - resistant DNA end form; b) Double - stranded region; and c) Downstream exonuclease - resistant DNA end form A TDSC comprising A TDSC comprising one or more chemically modified nucleotides.

[0007] 2. a) Upstream DNA end form that is a closed - type end; b) Double - stranded region; c) Downstream DNA end form with a closed end A TDSC comprising A TDSC containing one or more chemically modified nucleotides.

[0008] 3. The TDSC according to Embodiment 1, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form is an open end.

[0009] 4. a) An upstream DNA end form (e.g., an upstream exonuclease-resistant DNA end form) containing a Y-shaped adapter structure; b) A double-stranded region; and c) A downstream DNA end form (e.g., a downstream exonuclease-resistant DNA end form) containing a Y-shaped adapter structure A TDSC comprising A TDSC containing one or more chemically modified nucleotides.

[0010] 5. The TDSC according to Embodiment 1 or 3, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form is a blunt end or a sticky end.

[0011] 6. a) An upstream double-stranded blunt-ended DNA end form (e.g., an upstream exonuclease-resistant DNA end form that is double-stranded and blunt-ended) containing phosphorothioate modifications on each strand; b) A double-stranded region; and c) A downstream double-stranded blunt-ended DNA end form (e.g., a downstream exonuclease-resistant DNA end form that is double-stranded and blunt-ended) containing phosphorothioate modifications on each strand A TDSC comprising A TDSC optionally further containing one or more chemically modified nucleotides.

[0012] 7. The TDSC according to Embodiment 1, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form is a closed end.

[0013] 8. The TDSC according to any one of Embodiments 1 to 3, 5 or 7, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form contain a loop.

[0014] 9. a) An upstream DNA end form that is a closed end (e.g., an upstream exonuclease-resistant DNA end form); b) A double-stranded region; c) A downstream DNA end form that is a closed end (e.g., a downstream exonuclease-resistant DNA end form) The TDSC comprising: A TDSC containing one or more chemically modified nucleotides.

[0015] 10. The TDSC according to any one of Embodiments 1 to 9, wherein the upstream DNA end form (e.g., the upstream exonuclease-resistant DNA end form) contains one or more chemically modified nucleotides.

[0016] 11. The TDSC according to any one of Embodiments 1 to 10, wherein the downstream DNA end form (e.g., the downstream exonuclease-resistant DNA end form) contains one or more chemically modified nucleotides.

[0017] 12. The TDSC according to any one of Embodiments 1 to 11, wherein one or more of the chemically modified nucleotides contain modifications to the backbone, sugar, or base.

[0018] 13. The TDSC according to any one of Embodiments 1 to 12, wherein one or more of the chemically modified nucleotides are conjugated to a peptide or protein.

[0019] 14. The TDSC according to any one of Embodiments 1 to 13, wherein one or more of the chemically modified nucleotides contain chemically modified cytosine nucleotides and / or phosphorothioate bonds.

[0020] 15. The TDSC according to any one of Embodiments 1 to 14, wherein one or more of the chemically modified nucleotides contain chemically modified cytosine nucleotides.

[0021] 16. The TDSC according to embodiment 15, wherein the chemically modified cytosine nucleotide has a substitution other than hydrogen at the 5-position carbon of cytosine.

[0022] 17. The TDSC according to any one of embodiments 1 to 16, wherein one or more of the chemically modified nucleotides contain phosphorothioate bonds.

[0023] 18. The TDSC according to any one of embodiments 1 to 17, wherein each of the first strand and the second strand of the TDSC contains one or more chemically modified nucleotides.

[0024] 19. The TDSC according to any one of embodiments 1 to 18, wherein each of the first strand and the second strand of the TDSC contains one or more phosphorothioate bonds.

[0025] 20. The TDSC according to any one of embodiments 1 to 19, wherein the upstream exonuclease-resistant DNA terminal form contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphorothioate bonds (e.g., in the first strand, the second strand, or both the first strand and the second strand, e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal-side nucleotides of the upstream exonuclease-resistant DNA terminal form).

[0026] 21. The TDSC according to any one of embodiments 1 to 20, wherein the upstream exonuclease-resistant DNA terminal form contains at least 3 phosphorothioate bonds (e.g., in the first strand, the second strand, or both the first strand and the second strand, e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal-side nucleotides of the upstream exonuclease-resistant DNA terminal form).

[0027] 22. The TDSC according to any one of embodiments 1 to 20, wherein the upstream exonuclease-resistant DNA end form contains at least 6 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream exonuclease-resistant DNA end form, in the first strand, the second strand, or both the first and second strands).

[0028] 23. The TDSC according to any one of embodiments 1 to 22, wherein the downstream exonuclease-resistant DNA end form contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA end form, in the first strand, the second strand, or both the first and second strands).

[0029] 24. The TDSC according to any one of embodiments 1 to 23, wherein the downstream exonuclease-resistant DNA end form contains at least 3 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA end form, in the first strand, the second strand, or both the first and second strands).

[0030] 25. The TDSC according to any one of embodiments 1 to 23, wherein the downstream exonuclease-resistant DNA end form contains at least 6 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA end form, in the first strand, the second strand, or both the first and second strands).

[0031] 26. The TDSC according to any one of Embodiments 1 to 20 or 23, wherein the upstream and downstream exonuclease-resistant DNA terminal forms each contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphorothioate linkages (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA terminal forms, in, for example, the first strand, the second strand, or both the first strand and the second strand).

[0032] 27. The TDSC according to any one of Embodiments 1 to 21, 23, 24, or 26, wherein the upstream and downstream exonuclease-resistant DNA terminal forms each contain at least 3 phosphorothioate linkages (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA terminal forms, in, for example, the first strand, the second strand, or both the first strand and the second strand).

[0033] 28. The TDSC according to any one of Embodiments 1 to 20, 22, 23, 25, or 26, wherein the upstream and downstream exonuclease-resistant DNA terminal forms each contain at least 6 phosphorothioate linkages (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA terminal forms, in, for example, the first strand, the second strand, or both the first strand and the second strand).

[0034] 29. The TDSC according to any one of Embodiments 1 to 28, wherein one or more of the chemically modified nucleotides contain a methyl group.

[0035] 30. a) An upstream exonuclease-resistant DNA terminal form; b) A double-stranded region; c) A downstream exonuclease-resistant DNA terminal form A TDSC comprising A TDSC, wherein one or both of the upstream exonuclease-resistant DNA terminal form and the downstream exonuclease-resistant DNA terminal form contain a Y-shaped adapter structure.

[0036] 31. The TDSC according to embodiment 30, wherein the Y-shaped adapter is formed by cleavage with uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII (e.g., USER enzyme mixture).

[0037] 32. The TDSC according to embodiment 30 or 31, wherein the Y-shaped adapter comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0038] 33. The TDSC according to any one of embodiments 30 to 32, wherein every nucleotide in the Y-shaped adapter is a chemically modified nucleotide (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0039] 34. a) An upstream exonuclease-resistant DNA end form; b) A double-stranded region; c) A downstream exonuclease-resistant DNA end form The TDSC comprising: The TDSC, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise one or more of a nuclear targeting sequence, a maintenance sequence, or a sequence that binds to an endogenous polypeptide in a target cell.

[0040] 35. a) An upstream exonuclease-resistant DNA end form; b) A double-stranded region; c) A downstream exonuclease-resistant DNA end form The TDSC comprising: The TDSC, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have the following characteristics: i) The nucleic acid sequences TATCAGCACACAATTGCCCATTATACGC (SEQ ID NO: 55) and GCGTATAATGGGCAATTGTGTGCTGATA (SEQ ID NO: 56), or nucleic acid sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto; and / or not containing the nucleic acid sequences TATCAGCACACAATAGTCCATTATACGC (SEQ ID NO: 57) and GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO: 58); ii) Any nucleotide in the TDSC binds to another nucleotide in the TDSC; iii) The upstream exonuclease-resistant DNA end form has a loop size of less than about 28 or 56 nucleotides in length or greater than about 28 or 56 nucleotides in length; or iv) The downstream exonuclease-resistant DNA end form has a loop size of less than about 28 or 56 nucleotides in length or greater than about 28 or 56 nucleotides in length A TDSC having one or more of the above.

[0041] 36. i) A promoter sequence (where optionally the promoter sequence is in a double-stranded region); ii) A payload sequence (e.g., a therapeutic payload sequence) operably linked to the promoter sequence (where optionally the payload sequence is in a double-stranded region); iii) A heterologous functional sequence, e.g., a nuclear targeting sequence or a regulatory sequence; iv) A maintenance sequence; and / or v) An origin of replication The TDSC according to any one of Embodiments 1 to 35, comprising one or more of the above.

[0042] 37. i, ii, and iii; i, ii, and iv; i, ii, and v; i, ii, iii, and iv; i, ii, iii, and v; i, ii, iv, and v; or i, ii, iii, iv, and v The TDSC according to Embodiment 36, comprising

[0043] 38. The TDSC according to Embodiment 36 or 37, wherein the nuclear targeting sequence comprises the CT3 sequence (for example, the sequence of AATTCTCCTCCCCACCTTCCCCACCCTCCCCA (SEQ ID NO: 59)), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0044] 39. The TDSC according to any one of Embodiments 36 to 38, wherein the nuclear targeting sequence binds to the hnRNPK protein (for example, human hnRNPK protein).

[0045] 40. The TDSC according to any one of Embodiments 2, 7 to 29, or 36 to 39, wherein one or both of the closed ends contain a loop, and one or both of the loops contain the nuclear targeting sequence as listed in Table 3, or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0046] 41. The TDSC according to any one of Embodiments 2, 7 to 29, or 36 to 40, wherein one or both of the closed ends contain a loop, and one or both of the loops contain a nuclear targeting sequence that binds to a nuclear translocation protein as listed in Table 3.

[0047] 42. The TDSC according to any one of Embodiments 36 to 41, wherein the payload sequence encodes a polypeptide (for example, a protein).

[0048] 43. The TDSC according to any one of Embodiments 36 to 42, wherein the payload sequence encodes a functional RNA (for example, miRNA, siRNA, or tRNA).

[0049] 44. The TDSC according to any one of Embodiments 36 to 43, wherein the payload sequence is heterologous to the target cell.

[0050] 45. The TDSC according to any one of Embodiments 1 to 44, wherein the double-stranded region includes a sense strand and an antisense strand.

[0051] 46. The TDSC according to Embodiment 45, wherein the antisense strand includes one or more chemically modified nucleotides.

[0052] 47. The TDSC according to Embodiment 45 or 46, wherein the sense strand does not include any chemically modified nucleotides.

[0053] 48. The TDSC according to Embodiment 45 or 46, wherein the sense strand includes one or more chemically modified nucleotides.

[0054] 49. The TDSC according to any one of Embodiments 1 to 48, wherein the TDSC shows resistance to endonuclease digestion and / or shows resistance to immunosensor recognition.

[0055] 50. The TDSC according to any one of Embodiments 1 to 49, wherein the upstream exonuclease-resistant DNA terminal form shows resistance to endonuclease digestion.

[0056] 51. The TDSC according to any one of Embodiments 1 to 50, wherein the upstream exonuclease-resistant DNA terminal form shows resistance to immunosensor recognition.

[0057] 52. The TDSC according to any one of Embodiments 1 to 51, wherein the downstream exonuclease-resistant DNA terminal form shows resistance to endonuclease digestion.

[0058] 53. The TDSC according to any one of Embodiments 1 to 52, wherein the downstream exonuclease-resistant DNA terminal form shows resistance to immunosensor recognition.

[0059] 54. The TDSC according to any one of Embodiments 1 to 53, wherein the double-stranded region shows resistance to endonuclease digestion.

[0060] 55. The TDSC according to any one of Embodiments 1 to 54, wherein the double-stranded region exhibits resistance to immunosensor recognition.

[0061] 56. The TDSC according to any one of Embodiments 1 to 55, wherein the upstream DNA terminal form and the downstream DNA terminal form have the same nucleotide sequence.

[0062] 57. The TDSC according to any one of Embodiments 1 to 55, wherein the upstream DNA terminal form and the downstream DNA terminal form have different nucleotide sequences.

[0063] 58. The TDSC according to any one of Embodiments 1 to 57, wherein the upstream exonuclease-resistant DNA terminal form and the downstream exonuclease-resistant DNA terminal form have the same structure.

[0064] 59. The TDSC according to any one of Embodiments 1 to 57, wherein the upstream exonuclease-resistant DNA terminal form and the downstream exonuclease-resistant DNA terminal form have different structures.

[0065] 60. The TDSC according to any one of Embodiments 1, 7, 8, or 10 to 59, wherein one or both of the upstream exonuclease-resistant DNA terminal form and the downstream exonuclease-resistant DNA terminal form are open ends (for example, blunt ends, sticky ends, or Y-shaped adapters).

[0066] 61. The TDSC according to any one of Embodiments 1 to 3, 5, or 7 to 60, wherein one or both of the upstream exonuclease-resistant DNA terminal form and the downstream exonuclease-resistant DNA terminal form are closed ends (for example, hairpins).

[0067] 62. The TDSC according to Embodiment 61, wherein the closed end contains one or more (for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50) nucleotides that do not hybridize (for example, are not part of the double-stranded region).

[0068] 63. The TDSC according to embodiment 61, wherein the closed ends do not contain any nucleotides that do not hybridize (e.g., all nucleotides at the closed ends are hybridized to another nucleotide).

[0069] 64. The TDSC according to any one of embodiments 30 to 63, wherein the upstream DNA end form, the downstream DNA end form, or both contain at least one chemically modified nucleotide.

[0070] 65. The TDSC according to any one of embodiments 30 to 64, wherein both the upstream DNA end form and the downstream DNA end form contain at least one chemically modified nucleotide in the sense strand and at least one chemically modified nucleotide in the antisense strand.

[0071] 66. The TDSC according to any one of embodiments 30 to 65, wherein both the upstream DNA end form and the downstream DNA end form contain chemically modified nucleotides at every sense strand position and every antisense strand position.

[0072] 67. The TDSC according to any one of embodiments 30, 31, 34 to 45, 47, or 49 to 63, wherein the upstream DNA end form, the downstream DNA end form, or both contain inverted terminal repeats (ITRs), and optionally the dsDNA does not contain chemically modified nucleotides.

[0073] 68. The TDSC according to any one of embodiments 1 to 67, wherein the upstream DNA end form, the downstream DNA end form, or both do not contain telomerase sequences.

[0074] 69. The TDSC according to any one of embodiments 30, 31, 34 to 45, 47, 49 to 63, or 67, wherein the upstream DNA end form, the downstream DNA end form, or both contain telomerase sequences, and optionally the dsDNA does not contain chemically modified nucleotides.

[0075] 70. One or more of the telomerase sequences comprise a nucleic acid sequence TATCAGCACACAATTGCCCATTATACGC (SEQ ID NO: 55) and GCGTATAATGGGCAATTGTGTGCTGATA (SEQ ID NO: 56), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, (e.g., in the order of 5' to 3'), the TDSC according to embodiment 69.

[0076] 71. One or more of the telomerase sequences comprise a nucleic acid sequence TATCAGCACACAATAGTCCATTATACGC (SEQ ID NO: 57) and GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO: 58), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, (e.g., in the order of 5' to 3'), the TDSC according to embodiment 69 or 70.

[0077] 72. One or more of the telomerase sequences comprise a nucleic acid sequence ACCTATTTCAGCATACTACGC (SEQ ID NO: 60) and GCGTAGTATGCTGAAATAGGT (SEQ ID NO: 61), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, (e.g., in the order of 5' to 3'), the TDSC according to any one of embodiments 69 to 71.

[0078] 73. One or more of the telomerase sequences comprise a nucleic acid sequence CACACAATTGCCCATTATACGCGCGTATAATGGGCAATTGTGTG (SEQ ID NO: 62), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto, (e.g., in the order of 5' to 3'), the TDSC according to any one of embodiments 69 to 72.

[0079] 74. One or more of the telomerase sequences comprise a nucleic acid sequence: (i) TAAATATAATTTAA (SEQ ID NO: 63) and TTAAATTATATTTA (SEQ ID NO: 64), (ii) AATATATAATCTAA (SEQ ID NO: 65) and TTAGATTATATATT (SEQ ID NO: 66), (iii) TATTTATTATCTTT (SEQ ID NO: 67) and AAAGATAATAAATA (SEQ ID NO: 68), (iv) ATATAATTTTTAATTAGTATAGAATATGTTAA (SEQ ID NO: 69) and TTAACATACTCTATACTAATTAAAAATTATAT (SEQ ID NO: 70), (v) TATAATTTGATATTAGTACAAATCCC (SEQ ID NO: 71) and GGGATTTGTACTAATATCAAATTATA (SEQ ID NO: 72), (vi) ATATAATATTTATTTAGTACAAAGTTC (SEQ ID NO: 73) and GAACTTTGTACTAAATAAATATTATAT (SEQ ID NO: 74), (vii) ATATAATTTTTTATTAGTATAGAGTAT (SEQ ID NO: 75) and ATACTCTATACTAATAAAAAATTATAT (SEQ ID NO: 76), (viii) TAAATATAATTTAA (SEQ ID NO: 63) and TTAAATTATATTTA (SEQ ID NO: 64); or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity therewith, the TDSC according to any one of Embodiments 69 to 73.

[0080] 75. One or more of the telomerase sequences further (e.g., in the order from 5' to 3') the nucleic acid sequence: (i) TAGTATAAAAAACTGT (SEQ ID NO: 77) and ACAGTTTTTTATACTA (SEQ ID NO: 78), (ii) TAGTATACAAAAGATT (SEQ ID NO: 79) and AATCTTTTGTATACTA (SEQ ID NO: 80), (iii) TAGTATATATATCTCT (SEQ ID NO: 81) and AGAGATATATATACTA (SEQ ID NO: 82), or (viii) TAGTATAAAAAAAATT (SEQ ID NO: 83) and AATTTTTTTTATACTA (SEQ ID NO: 84); or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity therewith, the TDSC according to any one of Embodiments 69 to 74.

[0081] 76. The TDSC according to any one of Embodiments 69 to 75, wherein the telomerase sequence is generated by digestion with TelN telomerase, ResT telomerase, Tel PY54 telomerase, or TelK telomerase.

[0082] 77. The TDSC according to any one of Embodiments 69 to 75, wherein the telomerase sequence is not generated by digestion with TelN telomerase.

[0083] 78. The TDSC according to any one of Embodiments 69 to 75 or 77, wherein the telomerase sequence is not generated by digestion with Tel PY54 telomerase.

[0084] 79. The TDSC according to any one of Embodiments 69 to 75, 77, or 78, wherein the telomerase sequence is not generated by digestion with TelK telomerase.

[0085] 80. The TDSC according to any one of Embodiments 69 to 75 or 77 to 79, wherein the telomerase sequence is not generated by digestion with ResT telomerase.

[0086] 81. The TDSC according to any one of Embodiments 69 to 80, wherein the telomerase sequence is about 28 or 56 nucleotides in length.

[0087] 82. The TDSC according to any one of Embodiments 69 to 81, wherein the telomerase sequence is less than 28 nucleotides in length (for example, less than 15, 20, 25, 26, 27, or 28 nucleotides in length).

[0088] 83. The TDSC according to any one of Embodiments 69 to 82, wherein the telomerase sequence is from about 28 nucleotides in length (e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides in length) to about 56 nucleotides in length (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides in length).

[0089] 84. The TDSC according to any one of Embodiments 69 to 83, wherein the telomerase sequence is greater than about 56 nucleotides in length (e.g., greater than 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 90, or 100 nucleotides in length).

[0090] 85. The TDSC according to any one of Embodiments 30 to 94, wherein the upstream DNA end form, the downstream DNA end form, or both contain a Y-shaped adapter.

[0091] 86. Optionally, the dsDNA of the TDSC according to Embodiment 85 does not contain chemically modified nucleotides.

[0092] 87. The TDSC according to Embodiment 69, wherein the telomerase sequence is generated from a first telomerase recognition sequence (PRS) and a second PRS recognized by TelN telomerase or ResT telomerase.

[0093] 88. The TDSC according to Embodiment 69, wherein the telomerase sequence is generated from a first telomerase recognition sequence (PRS) and a second PRS recognized by Tel PY54 telomerase or TelK telomerase.

[0094] 89. The TDSC according to any one of Embodiments 1 to 85, 87, or 88, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form contain at least one chemically modified nucleotide (e.g., including chemical modifications to any sense strand nucleotide and any antisense strand nucleotide).

[0095] 90. The TDSC according to any one of Embodiments 1 to 85 or 87 to 89, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form contain one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0096] 91. The TDSC according to any one of Embodiments 1 to 85 or 87 to 90, wherein the double-stranded region contains one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0097] 92. The TDSC according to any one of Embodiments 1 to 85 or 87 to 91, wherein the double-stranded region encodes a payload sequence, and the antisense strand of the payload sequence contains one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0098] 93. The TDSC according to any one of Embodiments 1 to 92, wherein the double-stranded region encodes a payload sequence, and the sense strand of the payload sequence contains one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0099] 94. The TDSC according to any one of Embodiments 1 to 93, wherein 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the sugars of the TDSC are deoxyribose sugars.

[0100] 95. The TDSC according to any one of Embodiments 1 to 94, wherein the TDSC contains a sequence encoding RNA (e.g., mRNA, siRNA, or miRNA).

[0101] 96. The TDSC according to any one of Embodiments 1 to 94, wherein the TDSC does not contain a sequence encoding RNA.

[0102] 97. The TDSC according to any one of Embodiments 1 to 96, wherein the TDSC is replicable (e.g., by a DNA polymerase natural to cells containing the TDSC).

[0103] 98. The TDSC according to any one of Embodiments 1 to 96, wherein the TDSC is not replicable.

[0104] 99. The TDSC according to any one of Embodiments 1 to 98, wherein the TDSC is linear and can be circularized.

[0105] 100. The TDSC according to any one of Embodiments 1 to 98, wherein the TDSC is linear and cannot be circularized.

[0106] 101. The TDSC according to any one of Embodiments 1 to 100, wherein the TDSC or a part thereof can be integrated into the genome.

[0107] 102. The TDSC according to any one of Embodiments 1 to 100, wherein the 102.TDSC or a part thereof is not integratable into the genome.

[0108] 103. The TDSC according to any one of Embodiments 1 to 102, wherein the 103.TDSC is concatemerizable.

[0109] 104. The TDSC according to any one of Embodiments 1 to 102, wherein the 104.TDSC is not concatemerizable.

[0110] 105. A pharmaceutical composition comprising double-stranded DNA (dsDNA) containing an effector sequence, a. the dsDNA lacks a vector backbone, or lacks a substantial part of the vector backbone, or does not contain an origin of replication of a non-human (e.g., bacterial) organism; b. the dsDNA is not encapsulated in a capsid, or does not essentially have viral proteins, or does not contain a viral packaging signal, or does not contain a viral ITR; c. the dsDNA contains an exonuclease-resistant end; and d. the dsDNA contains at least one chemically modified nucleotide, a pharmaceutical composition.

[0111] 106. A pharmaceutical composition comprising the TDSC according to any one of Embodiments 1 to 105.

[0112] 107. The pharmaceutical composition according to Embodiment 105 or 106, wherein the dsDNA or TDSC is contained in a lipid nanoparticle (LNP).

[0113] 108. The pharmaceutical composition according to any one of Embodiments 105 to 107, further comprising an electroporation buffer.

[0114] 109. The pharmaceutical composition according to any one of Embodiments 105 to 108, further comprising a transfection reagent.

[0115] 110. a) an upstream exonuclease-resistant DNA end form; b) Double-stranded region; c) Downstream exonuclease-resistant DNA end form A proto-TDSC comprising: A proto-TDSC, wherein the proto-TDSC contains one or more (e.g., 1 or 2) uracil nucleotides.

[0116] 111. The proto-TDSC according to embodiment 110, wherein the upstream exonuclease-resistant DNA end form contains one or more (e.g., 1 or 2) uracil nucleotides.

[0117] 112. The proto-TDSC according to embodiment 110 or 111, wherein the downstream exonuclease-resistant DNA end form contains one or more (e.g., 1 or 2) uracil nucleotides.

[0118] 113. The proto-TDSC according to any one of embodiments 110 to 112, wherein the upstream exonuclease-resistant DNA end form contains a loop structure.

[0119] 114. The proto-TDSC according to any one of embodiments 110 to 113, wherein the downstream exonuclease-resistant DNA end form contains a loop structure.

[0120] 115. The proto-TDSC according to any one of embodiments 110 to 114, wherein the upstream exonuclease-resistant DNA end form contains one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0121] 116. The proto-TDSC according to any one of embodiments 110 to 115, wherein all nucleotides in the upstream exonuclease-resistant DNA end form are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0122] 117. The protTDSC according to any one of embodiments 110 to 116, wherein the downstream exonuclease-resistant DNA end form contains one or more chemically modified nucleotides (for example, phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0123] 118. The protTDSC according to any one of embodiments 110 to 117, wherein all nucleotides in the downstream exonuclease-resistant DNA end form are chemically modified nucleotides (for example, phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0124] 119. a) An upstream exonuclease-resistant DNA end form; b) A double-stranded region; c) A downstream exonuclease-resistant DNA end form A protTDSC comprising: The protTDSC, wherein the upstream exonuclease-resistant DNA end form contains a sticky end and / or the downstream exonuclease-resistant DNA end form contains a sticky end.

[0125] 120. A method for expressing a heterologous payload in a target cell, comprising: (i) Introducing the TDSC or composition according to any one of embodiments 1 to 119 into the target cell, wherein the double-stranded region of the TDSC contains a sequence encoding the heterologous payload; and (ii) Maintaining (for example, incubating) the cells under conditions suitable for expressing the heterologous payload from the TDSC Thereby expressing the heterologous payload in the target cell. A method for expressing a heterologous payload in a target cell.

[0126] 121. A method for expressing a heterologous payload in a target cell, comprising: (i) providing a target cell comprising the TDSC or composition according to any one of Embodiments 1 to 119, wherein the double-stranded region of the TDSC comprises a sequence encoding the heterologous payload; and (ii) maintaining (e.g., incubating) the cell under conditions suitable for expressing the heterologous payload from the TDSC ; thereby providing a method for expressing a heterologous payload in a target cell.

[0127] 122. The method according to Embodiment 120 or 121, which is carried out ex vivo or in vivo.

[0128] 123. A method for delivering a heterologous payload to a target cell, comprising introducing into the target cell the TDSC or composition according to any one of Embodiments 1 to 119, wherein the double-stranded region of the TDSC comprises a sequence encoding the heterologous payload ; thereby providing a method for delivering a heterologous payload to a target cell.

[0129] 124. A method for modulating (e.g., increasing or decreasing) the biological activity of a target cell, comprising: (i) introducing into the target cell the TDSC or composition according to any one of Embodiments 1 to 119, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous payload for modulating the biological activity of the target cell; and (ii) maintaining (e.g., incubating) the cell under conditions suitable for expressing the heterologous payload from the TDSC ; thereby providing a method for modulating the biological activity of a target cell.

[0130] 125. A method for modulating (e.g., increasing or decreasing) the biological activity of a target cell, comprising: ​(i) To provide a target cell comprising the TDSC or composition according to any one of Embodiments 1 to 119, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous payload that regulates the biological activity of the target cell; and (ii) Maintaining the cells (e.g., incubating) under conditions suitable for expressing the heterologous payload from the TDSC comprising; A method for regulating the biological activity of a target cell thereby.

[0131] 126. The method according to Embodiment 124 or 125, wherein the biological activity of the target cell is increased by the heterologous payload.

[0132] 127. The method according to Embodiment 124 or 125, wherein the biological activity of the target cell is decreased by the heterologous payload.

[0133] 128. The method according to any one of Embodiments 124 to 127, wherein the biological activity includes cell growth, cell metabolism, cell signaling, cell motility, specialization, interaction, division, transport, homeostasis, osmosis, or diffusion.

[0134] 129. The method according to any one of Embodiments 120 to 128, wherein the cell is an animal cell, such as a mammalian cell, such as a human cell.

[0135] 130. A method for treating a cell, tissue, or subject in need of treatment, administering to the cell, tissue, or subject the TDSC or composition according to any one of Embodiments 1 to 119, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous payload comprising; A method for treating a cell, tissue, or subject thereby.

[0136] 131. A method for producing a TDSC, (i) A double-stranded DNA molecule A hairpin DNA molecule comprising a loop region and a double-stranded region containing one or more chemically modified nucleotides Ligating thereto; Thereby generating ligated dsDNA; and (ii) Incubating the ligated dsDNA with an enzyme that cleaves the loop region from the ligated dsDNA Comprising; A method for producing TDSC thereby.

[0137] 132. The method according to embodiment 131, further comprising incubating the dsDNA with a blunt-end generating enzyme (such as mung bean nuclease) (for example, after step (ii)).

[0138] 133. The method according to embodiment 131 or 132, wherein the enzyme that cleaves the loop region from the ligated dsDNA is uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII (for example, USER enzyme mixture).

[0139] 134. A method for producing TDSC, comprising: (i) A double-stranded DNA molecule A hairpin DNA molecule, comprising: A loop region, and A double-stranded region Including, A hairpin DNA molecule containing one or more chemically modified nucleotides, for example, in the loop region Ligating thereto; Thereby generating ligated dsDNA; and (ii) Incubating the ligated dsDNA with an enzyme that opens or cleaves the loop region Including; A method for producing TDSC thereby.

[0140] 135. The method according to embodiment 134, wherein the loop region contains uracil nucleotides.

[0141] 136. The method according to embodiment 134 or 135, wherein the enzyme that opens or cleaves the loop region is uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII (e.g., USER enzyme mixture).

[0142] 137. A method for producing a TDSC, comprising: ligating a double-stranded DNA molecule to a self-annealing DNA molecule comprising a first region and a second region, wherein the first region hybridizes to the second region; thereby generating a TDSC. The method for generating a TDSC thereby.

[0143] 138. The method according to embodiment 137, wherein the self-annealing DNA molecule further comprises a loop between the first region and the second region.

[0144] 139. The method according to embodiment 138, wherein the loop comprises a heterologous functional sequence, such as a nuclear targeting sequence (e.g., CT3 sequence); or a regulatory sequence.

[0145] 140. The method according to embodiment 138 or 139, wherein the loop comprises a nuclear targeting sequence as listed in Table 3, or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0146] 141. The method according to any one of embodiments 138 to 140, wherein the loop comprises a nuclear targeting sequence that binds to a nuclear translocation protein as listed in Table 3.

[0147] 142. The method according to any one of embodiments 137 to 141, wherein the self-annealing DNA molecule does not contain any non-hybridizing nucleotides (e.g., all nucleotides of the self-annealing DNA molecule are hybridized to another nucleotide).

[0148] The method according to any one of embodiments 131 to 142, further comprising ligating a second hairpin DNA molecule to a double-stranded DNA molecule, wherein the second hairpin DNA molecule comprises a loop region and a double-stranded region, and optionally the second hairpin DNA molecule comprises one or more chemically modified nucleotides in one or both of the loop region or the double-stranded region.

[0149] A method of making or manufacturing a TDSC, comprising: a) providing a TDSC comprising a closed end, such as the TDSC described herein; b) incubating the TDSC with a double-stranded DNA exonuclease, such as exonuclease III, for example, 1 μL of exonuclease III per 5 μg of DNA in 50 μL, at 37° C. for 1 hour, as described in Example 10; c) optionally purifying the TDSC treated in step b) by, for example, a silica membrane column, as described in Example 10 thereby making or manufacturing a TDSC.

[0150] A method of making or manufacturing a TDSC, comprising: a) providing a proto-TDSC, such as a proto-TDSC treated with exonuclease III, wherein the proto-TDSC comprises a closed DNA end form each containing uracil; b) incubating the proto-TDSC with a uracil removal enzyme, such as USER enzyme, for example, 3 μL of USER enzyme per 5 μg of DNA in 100 μL, at 37° C. for 1 hour, as described in Example 12; c) optionally incubating the TDSC with a single-stranded DNA nuclease, such as mung bean nuclease, for example, 10 U of mung bean nuclease per 5 μg of DNA in about 100 μL, at 30° C. for 30 minutes, as described in Example 12; d) Optionally, for example, as described in Example 12, purify the TDSC processed in step c) using, for example, a silica membrane column. comprising a method for preparing or manufacturing TDSC thereby.

[0151] 146. The method according to embodiment 144 or 145, further comprising assaying the TDSC for degradation, for example, by an agarose gel as described in Example 10.

[0152] 147. The method according to embodiment 146, further comprising performing one of releasing the TDSC, placing the TDSC in a container, formulating the TDSC, or adding one or more excipients to the TDSC, depending on the assay for degradation (e.g., in response to a determination that the degradation is below a predetermined value).

[0153] 148. A method for preparing or manufacturing TDSC, comprising: a) providing a TDSC, for example, the TDSC described in any one of embodiments 1 to 119; b) determining whether the structure of the TDSC matches a reference structure comprising; a method for preparing or manufacturing TDSC thereby.

[0154] 149. The method according to embodiment 148, wherein the determining in (b) comprises sequencing the TDSC.

[0155] 150. The method according to embodiment 148 or 149, wherein the determining in (b) comprises digesting the TDSC with a restriction enzyme.

[0156] 151. The method according to any one of embodiments 148 to 150, wherein the structure of the TDSC that matches the reference structure is identical to the reference structure.

[0157] 152. The method according to any one of embodiments 148 to 151, wherein the structure of the TDSC that matches the reference structure has the same array as the reference structure.

[0158] 153. The method according to any one of embodiments 148 to 152, wherein the structure of the TDSC that matches the reference structure has the same length as the reference structure.

[0159] In certain embodiments, the TDSC has at least 15 nucleotides, at least 30 nucleotides, at least 50 nucleotides, at least 75 nucleotides, 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 750 nucleotides, at least 1,000 nucleotides, at least 2,000 nucleotides, at least 3,000 nucleotides, at least 4,000 nucleotides, at least 5,000 nucleotides, at least 10,000 nucleotides, at least 15,000 nucleotides, at least 20,000 nucleotides, at least 25,000 nucleotides, at least 30,000 nucleotides, at least 35,000 nucleotides, at least 40,000 nucleotides, at least 45,000 nucleotides, at least 50,000 nucleotides, at least 60,000 nucleotides, or more.

[0160] In certain embodiments, the TDSC has 20 - 1000 nucleotides, 20 - 50 nucleotides, 100 - 500 nucleotides, 500 - 50,000 nucleotides, 1,000 - 50,000 nucleotides, 2,000 - 40,000 nucleotides, 5,000 - 50,000 nucleotides, 500 - 50,000 nucleotides, 500 - 25,000 nucleotides, 1,000 - 20,000 nucleotides, 1,000 - 10,000 nucleotides, 10,000 - 60,000 nucleotides, 1,000 - 20,000 nucleotides, 1,000 - 40,000 nucleotides.

[0161] In certain embodiments, the TDSC includes at least one nucleotide modification selected from, for example, N6-methyladenosine (m6A, 6mA); 5-formylcytosine (5-formyl-2'-deoxycytosine, 5fC, f5C); 5-carboxylcytosine (5-carboxyl-2'-deoxycytosine, 5-carboxycytosine, ca5C, 5caC); 5-hydroxymethylcytosine (5-hydroxymethyl-2'-deoxycytosine, 5hmC, hm5C); 5-methyldeoxycytosine (5-methylcytosine; 5-methyl-2'-deoxycytosine; m5dC; 5mC, m5C); 5'-methylcytosine; 3-methylcytosine (m3C); 5-methylpyrimidine; 8-oxoguanine (8-oxoG); phosphorothioate; S and R phosphorothioate bonds; methylthymine; N3'-P5' phosphoramidate (NP), for example, a covalent nucleotide modification. In some embodiments, the nucleotide modification is a base modification. In some embodiments, the nucleotide modification is a backbone modification. In some embodiments, the nucleotide modification is a sugar modification. In some embodiments, the nucleotide modification includes a peptide conjugate. In some embodiments, the nucleotide modification includes a protein conjugate.

[0162] In certain embodiments, the effector sequence is a DNA sequence encoding a therapeutic RNA (e.g., mRNA or regulatory RNA) operably linked to a promoter. In certain embodiments, the RNA can be, for example, mRNA, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, or hnRNA.

[0163] In certain embodiments, the effector array is a DNA sequence encoding a therapeutic peptide or polypeptide that is operably linked to a promoter. The therapeutic peptide or polypeptide can be, for example, a DNA-binding protein; an RNA-binding protein; a transporter; a transcription factor; a translation factor; a ribosomal protein; a chromatin remodeling factor; an epigenetic modification factor; an antigen; a hormone; an enzyme (nuclease, e.g., endonuclease, e.g., nuclease element of the CRISPR system, e.g., Cas9, dCas9, Cas9-nickase, Cpf / Cas12a, etc.); a Crispr-linked enzyme, e.g., a base editor or a prime editor; a mobile genetic factor protein (e.g., transposase, retrotransposase, recombinase, integrase); a gene writer polypeptide; a polymerase; a methylase; a demethylase; an acetylase; a deacetylase; a kinase; a phosphatase; a ligase; a deubiquitinase; a protease; an integrase; a recombinase; a topoisomerase; a gyrase; a helicase; a lysosomal acid hydrolase; an antibody (e.g., an intact antibody, a fragment thereof, or a nanobody); a signal transduction peptide; a receptor ligand; a receptor; a clotting factor; a coagulation factor; a structural protein; a caspase; a membrane protein; a mitochondrial protein; a nuclear protein; or a modified binder, e.g., centyrin, darpin, or adnectin. In certain embodiments, the effector array is a DNA sequence encoding a reporter protein.

[0164] In embodiments, the TDSC may include a plurality of effector sequences. The plurality may be of the same or different types. For example, the TDSC may include an effector sequence that is structured DNA and a second effector sequence that is a DNA sequence encoding a functional RNA or polypeptide. The TDSC may include an effector sequence that is a DNA sequence encoding a functional RNA and a second effector sequence that is a DNA sequence encoding a functional polypeptide. The plurality of effector sequences may be the same or different sequences of the same type.

[0165] In embodiments, the TDSC is not placed in a carrier. For example, it is formulated for administration naked.

[0166] In embodiments, the TDSC is formulated with a carrier, such as a lipid-based carrier, such as an LNP.

[0167] In embodiments, the TDSC is formulated with a pharmaceutical excipient.

[0168] In embodiments, the TDSC is formulated for parenteral administration.

[0169] In embodiments, the pharmaceutical composition is formulated for topical administration.

[0170] In embodiments, the pharmaceutical composition is substantially free of impurities or process by-products selected from the group consisting of, for example, endotoxin, mononucleotide, chemically modified mononucleotide, DNA fragment or truncation, and protein (e.g., enzyme, e.g., ligase, restriction enzyme). In some embodiments, the pharmaceutical composition is substantially free of circular DNA.

[0171] In another aspect, the present invention includes a method of delivering an effector to a subject, such as a subject in need thereof. The method includes administering to the subject a composition described herein, such as a composition described in any of the above embodiments. In certain embodiments, the subject has or is diagnosed with a condition that can be treated with the effector.

[0172] In another aspect, the present invention includes a method of modulating (e.g., increasing or decreasing) a biological parameter in a cell, tissue, or subject. The method includes administering to the subject a composition described herein, such as a composition described in any of the above embodiments. In embodiments, the biological parameter is an increase or decrease in gene expression of a gene of interest in a target cell, tissue, or subject, and the increase or decrease is effected by an effector sequence described herein. In certain embodiments, the subject has or is diagnosed with a condition that can be treated with the effector.

[0173] In another aspect, the present invention includes a method of treating a cell, tissue, or subject. The method includes administering to the cell, tissue, or subject in need thereof a TDSC or construct described herein, such as a TDSC or construct described in any of the above embodiments. In certain embodiments, the subject has or is diagnosed with a condition that can be treated with the effector.

[0174] The present disclosure also provides a method of making the TDSC and dsDNA compositions described herein. In certain embodiments, the method includes performing a Golden Gate assembly.

[0175] In certain embodiments, the method further includes concentrating or purifying the TDSC.

[0176] In certain embodiments, concentrating or purifying involves substantially removing from the TDSC one or more impurities selected from endotoxin, mononucleotide, chemically modified mononucleotide, single-stranded DNA, DNA fragment or truncation, and protein (e.g., enzyme, e.g., ligase, restriction enzyme).

[0177] In certain embodiments, the method further includes formulating the concentrated or purified TDSC for pharmaceutical use, e.g., formulating the TDSC with a pharmaceutically acceptable excipient and / or a carrier, e.g., LNP.

[0178] Definitions As used herein, the term “antibody” refers to a molecule that specifically binds to or is immunologically reactive with a particular antigen and that includes at least the variable domain of the heavy chain and usually includes at least the variable domains of the heavy and light chains of an immunoglobulin. Antibodies and antigen-binding fragments, variants, or derivatives thereof include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primatized, or chimeric antibodies, heteroconjugate antibodies (e.g., bispecific, trispecific, and tetravalent antibodies, diabodies, tribodies, and tetrabodies), single domain antibodies (sdAb), epitope-binding fragments, e.g., Fab, Fab’, and F(ab’) 2, Fd, Fvs, single-chain Fvs (scFv), rlgG, single-chain antibodies, disulfide-bonded Fvs (sdFv), nanobodies, fragments containing either a VL or VH domain, fragments generated by a Fab expression library, and anti-idiotype (anti-Id) antibodies. The antibodies described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2), or subclass of immunoglobulin molecule. Further, unless otherwise specified, the term "monoclonal antibody" (mAb) means both intact molecules capable of specifically binding to a target protein and antibody fragments (e.g., Fab and F(ab’)2 fragments, etc.). Fab and F(ab’)2 fragments lack the Fc fragment of an intact antibody.

[0179] As used herein, the term "carrier" means a compound, composition, reagent, or molecule that facilitates or promotes the transport or delivery of a composition (e.g., a TDSC described herein, or a nucleic acid encoding dsDNA) into a cell. For example, a carrier can be a partial or complete encapsulant.

[0180] As used herein, the term "chemically modified nucleotide" refers to a nucleotide that contains one or more structural differences compared to standard deoxyribonucleotides (i.e., G, T, C, and A) when used in the context of DNA herein. Chemically modified nucleotides can have a chemically modified nucleobase, a chemically modified sugar, a chemically modified phosphodiester bond, or combinations thereof (compared to standard nucleotides). No particular method of preparation is implied; for example, chemically modified nucleotides can be generated directly by chemical synthesis or by covalently modifying standard nucleotides.

[0181] As used herein, the term "chemically modified cytosine nucleotide", when used in connection with DNA herein, refers to a chemically modified nucleotide in which the nucleobase contains a monocyclic six-membered ring such that carbon 4 is covalently bonded to a nitrogen that is not one of the six members of the ring, where the nucleobase of the chemically modified cytosine nucleotide contains one or more structural differences compared to the standard cytosine nucleobase. In some embodiments, the C-5 position of the nucleobase may have a substitution other than H. No particular method of preparation is implied.

[0182] As used herein, the term "closed end" refers to a portion of a DNA molecule located at one end of a double-stranded region, wherein all nucleotides within that portion of the DNA molecule are covalently linked to adjacent nucleotides on either side. In some embodiments, the closed end may include a loop containing one or more nucleotides that do not hybridize to another nucleotide. In some embodiments, every nucleotide of the closed end is hybridized to another nucleotide. In some embodiments, the TDSC includes a first closed end (e.g., upstream of the heterologous target sequence) and a second closed end (e.g., downstream of the heterologous target sequence).

[0183] As used herein, the term "open end" refers to a portion of a DNA molecule located at one end of a double-stranded region, wherein at least one nucleotide (the "terminal-side nucleotide") is covalently linked to exactly one other nucleotide. In some embodiments, the terminal-side nucleotide includes a free 5' phosphate. In some embodiments, the terminal-side nucleotide includes a free 3' OH. In some embodiments, in a TDSC comprising a first DNA strand and a second DNA strand, the open end includes a first terminal-side nucleotide on the first DNA strand and a second terminal nucleotide on the second DNA strand. In some embodiments, the TDSC includes a first open end (e.g., upstream of the heterologous target sequence) and a second open end (e.g., downstream of the heterologous target sequence). In some embodiments, the open end includes a blunt end, a sticky end, or a Y-shaped adapter.

[0184] As used herein, the term "DNA" refers to any compound and / or substance that includes at least two (e.g., at least 10, at least 20, at least 50, at least 100) covalently linked deoxyribonucleotides. In some embodiments, the DNA is a single oligonucleotide strand, while in other embodiments, the DNA includes multiple oligonucleotide strands, and in still other embodiments, the DNA is a portion of an oligonucleotide strand. In some embodiments, the DNA is a compound and / or substance that is incorporated or can be incorporated into an oligonucleotide strand by a phosphodiester bond. In some embodiments, the DNA includes only standard nucleotides. In some embodiments, the DNA includes one or more chemically modified nucleotides. In some embodiments, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the sugars of the DNA are deoxyribose sugars. In some embodiments, the DNA is prepared by one or more of isolation from a natural source, enzymatic synthesis (in vivo or in vitro) by polymerization based on a complementary template, replication in a recombinant cell or system, and chemical synthesis.

[0185] As used herein, the term "DNA end form" refers to a structure that includes DNA located at one end of a TDSC. In some embodiments, the DNA end form includes a closed end. In other embodiments, the DNA end form includes an open end. In some embodiments, the DNA end form includes a hairpin, a loop, a Y-shaped adapter, a blunt end, or a sticky end. The DNA end form may include one or both of a single-stranded region and a double-stranded region. The DNA end form may include standard nucleotides, chemically modified nucleotides, or combinations thereof. In some embodiments, the DNA end form includes 3 to 100 nucleotides. In some embodiments, a TDSC includes a first DNA end form at a first end and a second DNA end form at a second end. In some embodiments, the first DNA end form and the second DNA end form of the TDSC are of the same type. In some embodiments, the first DNA end form and the second DNA end form of the TDSC are of different types.

[0186] As used herein, the term "exonuclease resistance" when used in reference to DNA means that the DNA exhibits resistance in the exonuclease assay described in Example 10 when it includes a closed end and exhibits resistance in the exonuclease assay described in Example 11 when it includes open ends (e.g., two open ends).

[0187] As used herein, the term "heterologous" means that when used to describe a first element in relation to a second element, the first and second elements are not found in nature in the arrangement as described. For example, a heterologous polypeptide, nucleic acid molecule, construct or sequence is (a) a polypeptide, nucleic acid molecule or portion of a polypeptide or nucleic acid molecule sequence that is not native to the cell in which it is expressed, (b) a polypeptide or nucleic acid molecule or portion of a polypeptide or nucleic acid molecule that has been modified or mutated compared to its native state, or (c) a polypeptide or nucleic acid molecule having an altered expression compared to the native expression level under similar conditions. For example, a heterologous regulatory sequence (e.g., a promoter, enhancer) can be used to regulate a gene or nucleic acid molecule in a manner different from the way the gene or nucleic acid molecule is normally expressed in nature. In another example, a heterologous domain of a polypeptide or nucleic acid sequence (e.g., the DNA-binding domain of a polypeptide or the nucleic acid encoding the DNA-binding domain of a polypeptide) can be arranged relative to another domain, or can have a different sequence or be derived from a different source compared to another domain or portion of the polypeptide or its encoding nucleic acid. In certain embodiments, a heterologous nucleic acid molecule can be present in the native host cell genome, but can have an altered expression level or a different sequence or both. In other embodiments, a heterologous nucleic acid molecule may not be endogenous to the host cell or host genome, but instead may be introduced into the host cell by transformation (e.g., transfection, electroporation), where the added molecule may integrate into the host genome or exist as extrachromosomal genetic material, either transiently (e.g., mRNA) or semi-stably over two or more generations (e.g., episomal viral vector, plasmid or other self-replicating vector).

[0188] As used herein, the term "heterologous functional array" refers to a nucleic acid sequence that is heterologous to an adjacent (e.g., directly adjacent) nucleic acid sequence and has one or more biological functions. In some embodiments, the biological function includes targeting to an organelle, e.g., nuclear targeting. In some embodiments, the heterologous functional array includes a nuclear targeting sequence or a regulatory sequence.

[0189] As used herein, the terms "increasing" and "decreasing" each refer to a modulation that results in an increase or decrease in the amount of an indicator of function, expression, or activity as compared to a reference. For example, after administration of TDSC in the methods described herein, the amount of an indicator described herein (e.g., the level of gene expression, or a marker of innate immunity) is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more increased or decreased in a subject as compared to the amount of the marker before administration, such as TDSC comprising a chemically modified nucleic acid as compared to unmodified TDSC, or as compared to administration of a control TDSC. Generally, the indicator is measured after administration, at the time when the administration has had the recited effect, e.g., at least 1 day, 1 week, 1 month, 3 months, or 6 months after the start of a treatment regimen.

[0190] As used herein, the term "linear" with respect to a TDSC or nucleic acid comprising dsDNA described herein means a nucleic acid comprising two DNA strands or portions of strands that hybridize to each other (thereby forming a double-stranded region), where this structure includes two ends. The ends may be closed or open. The two strands that hybridize to each other may be partially or fully complementary. In some embodiments, the linear TDSC consists of a single strand of DNA that is circular under denaturing conditions, where under physiological conditions, a first portion of the strand hybridizes to a second portion of the strand (thereby forming a double-stranded region), and the linear TDSC includes a first closed end that includes a first loop and a second closed end that includes a second loop.

[0191] As used herein, the term "loop" refers to a nucleic acid sequence that is single-stranded. The loop is connected at both ends by double-stranded regions referred to as "stems", forming a "stem-loop".

[0192] As used herein, the term "maintenance sequence" is a DNA sequence or motif that enables or facilitates the retention of DNA molecules in the nucleus during cell division. Maintenance sequences typically enable the replication and / or transcription of DNA in the nucleus by interacting with proteins that facilitate chromatin looping. An example of a maintenance sequence is a scaffold / matrix attachment region (S / MAR element).

[0193] As used herein, a "nuclear targeting sequence" is a DNA sequence that enables or facilitates the entry of DNA into the target cell nucleus. In some embodiments, the nuclear targeting sequence is the DNA sequence of Table 3.

[0194] As used herein, a "pharmaceutical composition" or "pharmaceutical formulation" is a composition or formulation adapted for use as a medicine for animals, such as humans or livestock, for example, for prophylactic, diagnostic or therapeutic use in non-human animals or humans. A pharmaceutical formulation, in combination with a pharmaceutically acceptable excipient or diluent, contains an active agent having a biological effect on the cells or tissues of a subject, for example, having a pharmacological activity or effect in the alleviation, treatment, or prevention of a disease. A pharmaceutical composition also means a finished dosage form or formulation of a prophylactic, diagnostic or therapeutic composition.

[0195] As used herein, the terms "peptide", "polypeptide", and "protein" are used interchangeably and refer to a compound comprising amino acid residues covalently linked by peptide bonds or by means other than peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit on the maximum number of amino acids that can comprise the sequence of a protein or peptide. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or by means other than peptide bonds. As used herein, the term refers to both short chains, which are also generally referred to in the art as peptides, oligopeptides, and oligomers for example, and longer chains, which are generally referred to in the art as proteins, of which there are many types. In some embodiments, the polypeptide comprises non-standard amino acid residues. As used herein, the term "telomerase sequence" refers to a nucleotide sequence capable of being generated by telomerase that joins a first telomerase recognition sequence (PRS) to a second PRS. In some embodiments, the telomerase sequence is generated by a process involving telomerase, and in other embodiments, the telomerase sequence is generated by a process not involving telomerase (e.g., by solid-phase synthesis).

[0196] As used herein, the "sense strand" of dsDNA is the strand that has the same sequence as the mRNA or pre-mRNA encoding a functional protein but does not serve as a template for transcription. The "antisense strand" of dsDNA is the strand that has a sequence complementary to the mRNA or pre-mRNA encoding a functional protein and / or can serve as a template for transcription.

[0197] As used herein, the term "double-stranded DNA" or "dsDNA" means a DNA composition comprising two complementary strands of deoxyribonucleotides that base pair with each other. These two complementary strands may have perfect complementarity or may have one or more mismatches, for example, to form a bulge. In some embodiments, either of the two strands may have self-complementary regions that pair to form an intramolecular / intrastrand double-stranded motif in a folded structure, for example, forming a hairpin loop, junction, bulge, or internal loop. In some embodiments, dsDNA includes one or two closed ends. In some embodiments, the dsDNA molecule is circular or linear. In some embodiments (e.g., in a dsDNA molecule having a closed end), the two complementary strands of deoxyribonucleotides are covalently linked.

[0198] As used herein, the term "therapeutic double-stranded construct" ("TDSC") refers to a linear construct that contains DNA and is at least partially double-stranded. The TDSC does not include a plasmid backbone sequence (e.g., does not include an origin of bacterial replication). The TDSC does not include a viral capsid or viral envelope. In some embodiments, the TDSC includes a closed end or an open end (e.g., a blunt end or a sticky end). In some embodiments, the TDSC is suitable for administration to a human subject.

[0199] As used herein, the term "proto-TDSC" refers to a construct that can be converted into a TDSC. In some embodiments, the proto-TDSC is a manufacturing intermediate that can be subjected to one or more steps (e.g., a cleavage step) to be converted into a TDSC. In some embodiments, the proto-TDSC falls within the definition of a TDSC, for example, the proto-TDSC is a first TDSC and can be subjected to one or more steps to be converted into a second TDSC.

[0200] As used herein, the term "terminal nucleotide" refers to a nucleotide that is covalently linked to exactly one other nucleotide. In some embodiments, the terminal nucleotide includes a free 5' phosphate. In some embodiments, the terminal nucleotide includes a free 3' OH.

[0201] As used herein, "treating" and "treatment" refer to the medical treatment of a subject, which is intended to improve, ameliorate, stabilize (i.e., not exacerbate), prevent, or cure a disease, condition, or disorder. This term includes active treatment (treatment aimed at improving a disease, condition, or disorder), causal treatment (treatment directed at the cause of the associated disease, condition, or disorder), palliative treatment (treatment aimed at alleviating symptoms), prophylactic treatment (treatment aimed at minimizing or partially or completely suppressing the occurrence of the associated disease, condition, or disorder); and supportive treatment (treatment used to complement another therapy). Treatment includes, whether detectable or undetectable, a reduction in the degree of a disease or condition; prevention of the expansion of a disease or condition; delay or deceleration of the progression of a disease or condition; improvement or alleviation of a disease or condition; and remission (whether partial or complete). "Improving" or "alleviating" a disease or condition means that the degree and / or undesirable clinical symptoms of the disease, disorder, or condition are reduced and / or the time course of progression is delayed or extended, compared to the degree or time course without treatment. "Treatment" can also mean extending survival compared to the predicted survival without treatment. Those in need of treatment include those who are already suffering from a condition or disorder, as well as those who are susceptible to a condition or disorder or who seek to prevent a condition or disorder.

[0202] As used herein, the term "Y-shaped adapter" refers to a nucleic acid structure comprising a first nucleic acid region and a second nucleic acid region that are complementary to each other (e.g., fully complementary); the first and second regions can hybridize to form a double-stranded region. The first nucleic acid region is covalently linked to a third nucleic acid region, and the second nucleic acid region is covalently linked to a nucleic acid region, and the third and fourth nucleic acid regions are not substantially complementary to each other; the third and fourth regions may be single-stranded. The first nucleic acid region is on the 3' side of the third nucleic acid region, and the second nucleic acid region is on the 5' side of the fourth nucleic acid region. As a result, the third and fourth regions can be located on the same side of the double-stranded region. The Y-shaped adapter can be part of a TDSC.

Brief Description of the Drawings

[0203]

Figure 1A

Figure 1B

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7A

Figure 7B

Figure 7C

Figure 7D

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14A - 14B

Figure 15A - 15C

Figure 16A - 16C

Figure 17

Mode for Carrying Out the Invention

[0204] The present disclosure relates to compositions and methods for providing an effector, e.g., a therapeutic effector, to a cell, tissue, or subject, e.g., in vivo or in vitro. The effector can be a DNA sequence, a polypeptide, e.g., a therapeutic protein; or an RNA, e.g., a regulatory RNA or an mRNA.

[0205] Elements of the DNA construct The nucleic acids encoding the TDSC or dsDNA described herein contain elements sufficient to deliver an effector sequence to a target cell, tissue, or subject. In some embodiments, the effector sequence is a DNA sequence. In some embodiments, the TDSC drives the expression of an effector and includes, for example, a promoter and a sequence encoding an RNA or a polypeptide, e.g., a therapeutic RNA or polypeptide. In some embodiments, the DNA constructs described herein further contain one or both of a nuclear targeting sequence and a maintenance sequence. Although many of the embodiments herein refer to TDSC, it is understood that the embodiments referring to TDSC can be applied, as appropriate, to nucleic acids containing dsDNA as well.

[0206] Exonuclease-resistant DNA end forms The TDSC or nucleic acid containing dsDNA described herein includes DNA end forms at each end of the double-stranded DNA molecule. The DNA end forms described herein may, in some examples, include closed ends, where every nucleotide of the DNA end form is covalently linked to two other nucleotides of the DNA end form. In other cases, the DNA end forms described herein include open ends that include at least one nucleotide that is covalently linked to only one other nucleotide of the DNA end form. DNA end forms generally exhibit exonuclease resistance. In some examples, DNA end forms that include closed ends (e.g., covalently closed ends) exhibit resistance in the exonuclease assay described in Example 10. In some examples, DNA end forms that include open ends (e.g., Y-shaped adapters, blunt ends, or sticky ends as described herein) exhibit resistance in the exonuclease assay described in Example 11.

[0207] Closed ends, such as hairpins In some embodiments, the exonuclease-resistant DNA end form includes a DNA hairpin. A hairpin generally includes a single-stranded loop region covalently linked at both the 5' and 3' ends to a double-stranded stalk region. In certain embodiments, the single-stranded loop region includes one or more nucleotides (e.g., 1-2, 2-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, or 35-40 nucleotides) that do not hybridize to another nucleotide. Exemplary hairpin structures and exemplary TDSCs that include hairpins are shown in FIG. 1A.

[0208] In certain embodiments, the single-stranded loop region comprises one or more functional elements (e.g., a nuclear localization sequence (e.g., a CT3 ssDNA sequence), or a regulatory sequence). In embodiments, the functional elements included in the single-stranded loop region are heterologous to the DNA end form and / or one or more other elements of the TDSC that include the DNA end form. In certain embodiments, the single-stranded loop region of the hairpin loop is less than about 5, 10, 15, 20, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0209] In embodiments, the hairpin is included in a TDSC having a doggybone structure. In embodiments, the hairpin comprises a telomerase sequence (e.g., as described herein). In embodiments, the telomerase sequence is generated by TelN telomerase, ResT telomerase, Tel PY54 telomerase, or TelK telomerase digestion. In embodiments, the telomerase sequence is less than about 15, 20, 25, 26, 27, 28, 29, or 30 nucleotides in length. In embodiments, the telomerase sequence is from about 28 (e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) nucleotides in length to about 56 (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60) nucleotides in length. In embodiments, the telomerase sequence is greater than about 56 nucleotides in length (e.g., greater than 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 90, or 100 nucleotides in length).

[0210] The hairpin can be attached to one or both ends of a double-stranded DNA molecule (e.g., a proto-TDSC as described herein), for example, by ligation (e.g., as described herein). In some embodiments, a TDSC as described herein includes a DNA hairpin loop at one or both ends. In some embodiments, the upstream exonuclease-resistant DNA end form of a TDSC as described herein includes a DNA hairpin loop. In some embodiments, the downstream exonuclease-resistant DNA end form of a TDSC as described herein includes a DNA hairpin loop.

[0211] In certain embodiments, the DNA hairpin loop includes one or more unmodified nucleotides. In embodiments, the DNA hairpin loop consists entirely of unmodified nucleotides. In certain embodiments, the DNA hairpin loop includes one or more chemically modified nucleotides (e.g., as described herein, e.g., phosphorothioate-modified nucleotides). In embodiments, the DNA hairpin loop consists entirely of chemically modified nucleotides (e.g., as described herein, e.g., phosphorothioate-modified nucleotides).

[0212] In certain embodiments, the single-stranded loop region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the single-stranded loop region are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the single-stranded loop region of the DNA hairpin loop consists entirely of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In certain embodiments, the single-stranded loop region of the DNA hairpin loop comprises one or more unmodified nucleotides. In embodiments, the single-stranded loop region of the DNA hairpin loop consists entirely of unmodified nucleotides.

[0213] In certain embodiments, the double-stranded stem region of the DNA hairpin loop comprises one or more unmodified nucleotides. In embodiments, the double-stranded stem region of the DNA hairpin loop consists entirely of unmodified nucleotides. In certain embodiments, the double-stranded stem region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the double-stranded stem region are modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the double-stranded stem region of the DNA hairpin loop consists entirely of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein).

[0214] In embodiments, the single-stranded loop region of the DNA hairpin loop contains one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein), and the double-stranded stalk region contains one or more unmodified nucleotides. In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the single-stranded loop region are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the single-stranded loop region of the DNA hairpin loop consists entirely of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein), and the double-stranded stalk region consists entirely of unmodified nucleotides.

[0215] Y-shaped adapter In some embodiments, the exonuclease-resistant DNA end form as described herein includes a Y-shaped adapter. As described herein, a Y-shaped adapter generally includes a pair of single-stranded DNA regions, each attached at one end to a strand of a double-stranded DNA region, thereby forming a "Y" shape (where the base of the "Y" corresponds to the double-stranded DNA region and each of the branched upper portions of the "Y" corresponds to the two single-stranded DNA regions). An exemplary Y-shaped adapter structure and an exemplary TDSC including the Y-shaped adapter are shown in FIG. 2.

[0216] In some embodiments, generation of the Y-shaped adapter is by attaching a hairpin loop containing a single-stranded region that includes a cleavable moiety (e.g., a uracil nucleotide) to the end of a double-stranded DNA region (e.g., by ligation). The two single-stranded DNA regions of the Y-shaped adapter can then be generated by cleaving the cleavable moiety (e.g., by treating with an enzyme having the ability to cleave the cleavable moiety, such as USER enzyme).

[0217] In certain embodiments, the single-stranded DNA region of the Y-shaped adapter (e.g., one or both single-stranded DNA regions) comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the single-stranded DNA region are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the single-stranded DNA region of the Y-shaped adapter (e.g., one or both single-stranded DNA regions) consists entirely of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In certain embodiments, the single-stranded DNA region of the Y-shaped adapter (e.g., one or both single-stranded DNA regions) comprises one or more unmodified nucleotides.

[0218] In embodiments, the single-stranded DNA region of the Y-shaped adapter (e.g., one or both single-stranded DNA regions) comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein), and the double-stranded DNA region of the Y-shaped adapter comprises one or more unmodified nucleotides. In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in one or more single-stranded DNA regions are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the single-stranded DNA region of the Y-shaped adapter (e.g., one or both single-stranded DNA regions) consists entirely of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein), and the double-stranded DNA region of the Y-shaped adapter consists entirely of unmodified nucleotides.

[0219] Closed DNA end form without loop In some embodiments, the TDSC as described herein includes an exonuclease-resistant DNA end form that is covalently closed and does not include a hairpin loop. For example, in certain embodiments, every nucleotide of the covalently closed DNA end form is hybridized to another nucleotide (e.g., as shown in the exemplary "adapter without loop" of FIG. 6). In certain embodiments, the covalently closed DNA end form includes a first region and a second region, where the first region is entirely capable of hybridizing to the second region (e.g., where the first region is complementary to the second region), and where the 3' end of the first region is covalently linked to the 5' end of the second region. In embodiments, the covalently closed DNA end form as described herein can be linked, for example, by ligation to one end of a proto-TDSC as described herein.

[0220] Open DNA end form In some embodiments, the TDSC as described herein includes an exonuclease-resistant DNA end form that is not covalently closed. In certain embodiments, the DNA end form includes blunt ends (e.g., blunt ends that include one or more chemical modifications as described herein) or sticky ends (e.g., sticky ends that include one or more chemical modifications as described herein).

[0221] In certain embodiments, the open DNA end form is generated by nuclease digestion of a covalently closed DNA end form, such as a DNA hairpin. In embodiments, the DNA hairpin includes a double-stranded stalk region that includes a cleavable moiety (e.g., uracil nucleotide) on each strand, and then the DNA hairpin is contacted with an enzyme (e.g., USER enzyme) that has the ability to cleave the cleavable moiety. In embodiments, as a result, sticky ends that include overhangs are formed. In embodiments, when the overhangs are digested with an enzyme (e.g., a single-strand specific nuclease, e.g., mung bean nuclease), blunt ends are formed.

[0222] In certain embodiments, DNA end forms comprising blunt ends include one or more chemically modified nucleotides (e.g., phosphorothioate modified nucleotides as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the DNA end form comprising blunt ends are chemically modified nucleotides (e.g., phosphorothioate modified nucleotides as described herein). In embodiments, the DNA end form comprising blunt ends consists entirely of chemically modified nucleotides (e.g., phosphorothioate modified nucleotides as described herein). In embodiments, the base pairs at the termini of the DNA end form comprising blunt ends include chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), e.g., phosphorothioate modified nucleotides as described herein. In embodiments, a plurality of base pairs (e.g., 2, 3, 4, 5, or 6 base pairs) at the terminal side termini of the DNA end form include chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), e.g., phosphorothioate modified nucleotides as described herein. In certain embodiments, the 3 base pairs at the terminal side termini of the DNA end form include chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), e.g., phosphorothioate modified nucleotides as described herein. In certain embodiments, the 6 base pairs at the terminal side termini of the DNA end form include chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), e.g., phosphorothioate modified nucleotides as described herein.

[0223] In certain embodiments, a DNA end form comprising a sticky end comprises one or more chemically modified nucleotides (e.g., phosphorothioate modified nucleotides as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the DNA end form comprising a sticky end are chemically modified nucleotides (e.g., phosphorothioate modified nucleotides as described herein). In embodiments, the DNA end form comprising a sticky end consists entirely of chemically modified nucleotides (e.g., phosphorothioate modified nucleotides as described herein). In embodiments, the terminal nucleotides of the DNA end form comprising a sticky end are chemically modified nucleotides (e.g., nucleotides of one or both base pairs are chemically modified), e.g., phosphorothioate modified nucleotides as described herein. In embodiments, the overhang region of the sticky end of the DNA end form comprises one or more chemically modified nucleotides, e.g., phosphorothioate modified nucleotides as described herein.

[0224] Inverted terminal repeat (ITR) In some embodiments, a TDSC as described herein comprises an exonuclease-resistant DNA end form comprising an inverted terminal repeat (ITR). In some embodiments, the ITR is an ITR from a virus, such as an adenovirus or an adeno-associated virus (AAV). In some embodiments, the ITR comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an ITR sequence from a virus, such as an adenovirus or an adeno-associated virus (AAV). In certain embodiments, the ITR comprises an origin of replication (e.g., a viral origin of replication). In embodiments, a TDSC as described herein comprises an exonuclease-resistant DNA end form comprising an ITR (e.g., as described herein) at each end. In some embodiments, the TDSC does not comprise an ITR.

[0225] Promoters and other regulatory sequences The TDSC described herein, or a nucleic acid encoding dsDNA, may contain a promoter (a DNA sequence to which an RNA polymerase and transcription factors bind directly or indirectly to initiate transcription) operably linked to an effector sequence. The promoter may be operably linked to the effector sequence and be found naturally, or be heterologous to the effector sequence. The promoters described herein may be specific to the target cell or tissue, or be heterologous to the target cell or tissue. The promoter may be constitutive, inducible and / or tissue-specific.

[0226] Examples of constitutive promoters include the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally, together with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally, together with the CMV enhancer) (see, for example, Boshart et al, Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerate kinase (PGK) promoter, and the EF1α promoter.

[0227] Inducible promoters allow for the regulation of expression and can be regulated by externally supplied compounds, environmental factors such as temperature, or the presence of specific physiological states, such as the acute phase, a specific differentiation state of a cell, or only within replicating cells. Inducible promoters and inducible systems are available from a variety of sources. Examples of inducible promoters regulated by externally supplied promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdyson insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline repression system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al, Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)) and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)).

[0228] In some embodiments, the native promoter of the sequence encoding the effector can be used.

[0229] In some embodiments, the regulatory sequences confer tissue-specific gene expression capabilities. In some cases, tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: liver-specific thyroxine-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synapsin-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, α-myosin heavy chain (a-MHC) promoter, or cardiac troponin T (cTnT) promoter. Other exemplary promoters include, among those known to those of skill in the art, the β-actin promoter, hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); α-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol., 161:1063-8 (1998); immunoglobulin heavy chain promoter; T cell receptor α-chain promoter, neurons, such as the neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)).

[0230] Examples of tissue / cell-specific promoters are listed in Table 1:

[0231] [Table 1-1]

[0232] [Table 1-2]

[0233] The constructs described herein may also contain other natural or heterologous expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences.

[0234] Effector sequence The effector sequence of the TDSC described herein, or of the nucleic acid encoding dsDNA, can be, for example, a functional DNA sequence, such as a therapeutically functional DNA sequence; a DNA sequence encoding a therapeutic peptide, polypeptide or protein; or a DNA sequence encoding a therapeutic RNA (e.g., non-coding RNA).

[0235] DNA effector: A therapeutically functional DNA sequence can be a DNA sequence that forms a functional structure, such as a DNA aptamer, DNAzyme or allele-specific oligonucleotide (DNA ASO). A therapeutically functional DNA sequence may not have a promoter operably linked thereto. In embodiments, the TDSC described herein, or the nucleic acid encoding dsDNA, may contain one or more functional DNA sequences, such as 2, 3, 4, 5, 6, or more sequences, which may be the same or different.

[0236] Polypeptide effector: The DNA sequence encoding the therapeutic polypeptide can be a DNA sequence encoding one or more effectors that are peptides, proteins, or combinations thereof. For example, the DNA sequence encodes mRNA. The peptide or protein can be a DNA-binding protein; an RNA-binding protein; a transporter; a transcription factor; a translation factor; a ribosomal protein; a chromatin remodeling factor; an epigenetic modification factor; an antigen; a hormone; an enzyme (nuclease, e.g., endonuclease, e.g., nuclease element of the CRISPR system, e.g., Cas9, dCas9, aCas9-nickase, Cpf / Cas12a, etc.); a Crispr-linked enzyme, e.g., a base editor or a prime editor; a mobile genetic element protein (e.g., transposase, retrotransposase, recombinase, integrase); a gene writer; a polymerase; a methylase; a demethylase; an acetylase; a deacetylase; a kinase; a phosphatase; a ligase; a deubiquitinase; a protease; an integrase; a recombinase; a topoisomerase; a gyrase; a helicase; a lysosomal acid hydrolase); an antibody (e.g., an intact antibody, a fragment thereof, or a nanobody); a signal transduction peptide; a receptor ligand; a receptor; a clotting factor; a coagulation factor; a structural protein; a caspase; a membrane protein; a mitochondrial protein; a nuclear protein; an engineered conjugate such as centyrin, DARPin, or adnectin. See, e.g., Gebauer & Skerra. 2020. Annual Review of Pharmacology and Toxicology 60:1,391-415.

[0237] In embodiments, the TDSC described herein, or the nucleic acid encoding dsDNA, may include one or more sequences encoding a polypeptide, e.g., 2, 3, 4, 5, 6, or more sequences encoding a polypeptide. Each of the plurality may encode the same or different proteins. For example, the TDSC or sequences described herein may include a plurality of sequences encoding a plurality of proteins, e.g., a plurality of proteins in a biological pathway.

[0238] In some embodiments, the TDSC or sequences described herein may include a plurality of sequences encoding a polypeptide separated by a self-cleaving peptide, e.g., P2A, T2A, E2A, or F2A, e.g., 2, 3, 4, 5, 6, or more sequences encoding a polypeptide. The self-cleaving peptide is 18-22 amino acids in length and can induce ribosome skipping during protein translation so that two polypeptides can be encoded in the same transcript. Each of the polypeptides may encode the same or different proteins. In one embodiment, the TDSC or sequences described herein may include a promoter, followed by a sequence encoding a first polypeptide of interest, a sequence encoding a 2A self-cleaving peptide, a sequence encoding a second polypeptide of interest, and a polyA portion. In another embodiment, the TDSC or sequences described herein may include a promoter, followed by a sequence encoding a first polypeptide of interest, a first 2A self-cleaving peptide, a second polypeptide of interest, a sequence encoding a second 2A self-cleaving peptide, a sequence encoding a third polypeptide of interest, and a polyA portion.

[0239] In some embodiments, the effector includes a cell-permeable polypeptide. In some embodiments, the effector is a fusion protein comprising a cell-permeable polypeptide and a second amino acid sequence.

[0240] RNA effector: The effector array can be a DNA sequence encoding one or more of non-coding RNAs, such as small interfering RNA (siRNA), microRNA (miRNA), long non-coding RNA, piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), Cajal body small specific RNA (scaRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), RNA aptamer, and small nuclear RNA (snRNA).

[0241] In some embodiments, the TDSC disclosed herein, or the nucleic acid encoding dsDNA, comprises one or more expression sequences encoding regulatory RNAs, such as RNAs that modify the expression of endogenous and / or foreign genes. In some embodiments, the TDSC or sequence disclosed herein can comprise sequences that are antisense to regulatory nucleic acids such as, but not limited to, non-coding RNAs such as tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and hnRNA. In one embodiment, the regulatory nucleic acid targets a host gene. The regulatory nucleic acid can include, but is not limited to, nucleic acids that hybridize to endogenous genes, such as antisense RNAs, nucleic acids that hybridize to guide RNAs, nucleic acids that hybridize to exogenous nucleic acids such as viral DNA or RNA, nucleic acids that hybridize to RNA, nucleic acids that interfere with gene transcription, nucleic acids that interfere with RNA translation, nucleic acids that stabilize or destabilize RNA by, for example, targeting for degradation, and nucleic acids that regulate DNA or RNA binding factors. In one embodiment, the sequence is a miRNA. In some embodiments, the regulatory nucleic acid targets the sense strand of the host gene. In some embodiments, the regulatory nucleic acid targets the antisense strand of the host gene.

[0242] In some embodiments, the TDSC or sequences disclosed herein encode a guide RNA. Guide RNA sequences generally have a length of 15 to 30 nucleotides (e.g., 17, 19, 20, 21, 24 nucleotides) complementary to the nucleic acid sequence being targeted, and are designed to have a region that promotes complex formation (e.g., with tracrRNA or a nuclease). Custom gRNA generators and algorithms are commercially available for use in the design of effective guide RNAs. Gene editing also mimics the naturally occurring crRNA-tracrRNA complex and uses a chimeric "single guide RNA" ("sgRNA"), an engineered (synthetic) single RNA molecule that contains both a tracrRNA (for binding to the nuclease) and at least one crRNA (for directing the nuclease to the sequence being edited). Chemically modified sgRNAs have also been demonstrated to be effective for genome editing; see, e.g., Hendel et al. (2015) Nature Biotechnol., 985-991. A gRNA can recognize a specific DNA sequence (e.g., a sequence adjacent to or within a gene's promoter, enhancer, silencer, or repressor). In one embodiment, the gRNA is used as part of a CRISPR system for gene editing. For gene editing, the TDSC or sequences disclosed herein can be designed to include one or more sequences that encode a guide RNA sequence corresponding to the desired target DNA sequence; see, e.g., Cong et al. (2013) Science, 339:819-823; Ran et al. (2013) Nature Protocols, 8:2281-2308.

[0243] The disclosed TDSC or sequences may encode specific regulatory nucleic acids that can inhibit gene expression through the biological process of RNA interference (RNAi). RNAi molecules typically contain 15 to 50 base pairs (such as about 18 to 25 base pairs) and include an RNA or RNA-like structure having a nucleobase sequence that is identical (complementary) or nearly identical (substantially complementary) to the coding sequence in the target gene expressed intracellularly. Such RNAi molecules include, but are not limited to: small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), meroduplex, and dicer substrates (U.S. Patent Nos. 8,084,599, 8,349,809, and 8,513,207), and RNA antisense oligonucleotides (RNA ASO).

[0244] In one embodiment, the TDSC or sequences disclosed herein include a sequence comprising the sense strand of an lncRNA. In one embodiment, the TDSC or sequences disclosed herein include a sequence encoding the antisense strand of an lncRNA.

[0245] The TDSC or sequences disclosed herein may encode regulatory nucleic acids that are substantially complementary or completely complementary to a fragment of an endogenous gene or gene product (e.g., mRNA). The regulatory nucleic acid may complement the sequence at the boundary between introns and exons, between exons, or adjacent to an exon to prevent the maturation of a newly generated nuclear RNA transcript of a particular gene into mRNA for transcription. A regulatory nucleic acid complementary to a particular gene can hybridize to the mRNA for that gene and prevent its translation. Antisense regulatory nucleic acids can be DNA, RNA, or derivatives or hybrids thereof. In some embodiments, the regulatory nucleic acid includes a protein-binding site that can bind to a protein involved in the regulation of the expression of an endogenous or foreign gene.

[0246] The TDSC or array disclosed herein may encode a regulatory nucleic acid that hybridizes to a transcript of interest and can be, for example, about 5 to 30 nucleotides, about 10 to 30 nucleotides, or about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The degree of identity of the regulatory nucleic acid to the targeted transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0247] The TDSC or sequences disclosed herein may encode a microRNA (miRNA) molecule that is identical to about 5 to about 30 contiguous nucleotides of a target gene. In some embodiments, the miRNA sequence targets an mRNA, starts with the dinucleotide AA, contains a GC content of about 30-70% (about 30-60%, about 40-60%, or about 45%-55%), and has, for example, a high percentage identity to any nucleotide sequence other than the target in the mammalian genome into which it is introduced, as determined by a standard BLAST search. In some embodiments, the TDSC or sequences disclosed herein encode at least one miRNA, such as 2, 3, 4, 5, 6, or more. In some embodiments, the TDSC or sequences disclosed herein include a sequence encoding a miRNA having at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity to any one of the nucleotide sequences or a sequence complementary to the target sequence. Lists of known miRNA sequences can be found, inter alia, in databases maintained by research institutions such as the Wellcome Trust Sanger Institute, the Penn Center for Bioinformatics, Memorial Sloan Kettering Cancer Center, and the European Molecule Biology Laboratory. Known effective siRNA sequences and cognate binding sites are also well represented in the relevant literature. RNAi molecules are readily designed by techniques known in the art. Furthermore, there are computational tools that increase the opportunity to discover effective and specific sequence motifs (see, for example, Lagana et al., Methods Mol. Bio., 2015, 1269:393-412).

[0248] The TDSC or sequences disclosed herein can regulate the expression of RNA encoded by genes. Since multiple genes can share a certain degree of sequence homology with each other, in some embodiments, the TDSC or sequences disclosed herein can be designed to target classes of genes having sufficient sequence homology. In some embodiments, the TDSC or sequences disclosed herein can contain sequences having complementarity to sequences shared among different gene targets or specific to a particular gene target. In some embodiments, the TDSC or sequences disclosed herein target conserved regions of RNA sequences having homology among several genes, thereby being designed to target some genes in a gene family (e.g., different gene isoforms, splice variants, mutant genes, etc.). In some embodiments, the TDSC or sequences disclosed herein can be designed to target sequences specific to a particular RNA sequence of a single gene.

[0249] In embodiments, the effector sequence encoding the regulatory RNA has a length of less than 5000 bps (e.g., about 5000 bps, 4000 bps, 3000 bps, 2000 bps, 1000 bps, 900 bps, 800 bps, 700 bps, 600 bps, 500 bps, 400 bps, 300 bps, 200 bps, 100 bps, 50 bps, 40 bps, 30 bps, 20 bps, 10 bps or less, or less than that). In some embodiments, the effector sequence, independently or in addition thereto, has a length of more than 10 bps (e.g., at least about 10 bps, 20 bps, 30 bps, 40 bps, 50 bps, 60 bps, 70 bps, 80 bps, 90 bps, 100 bps, 200 bps, 300 bps, 400 bps, 500 bps, 600 bps, 700 bps, 800 bps, 900 bps, 1000 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, 1.7 kb, 1.8 kb, 1.9 kb, 2 kb, 2.1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3 kb, 3.1 kb, 3.2 kb, 3.3 kb, 3.4 kb, 3.5 kb, 3.6 kb, 3.7 kb, 3.8 kb, 3.9 kb, 4 kb, 4.1 kb, 4.2 kb, 4.3 kb, 4.4 kb, 4.5 kb, 4.6 kb, 4.7 kb, 4.8 kb, 4.9 kb, 5 kb or more).

[0250] In some embodiments, the TDSC or sequence disclosed herein comprises one or more of the features described herein, such as one or more structural DNA sequences, one or more sequences encoding a peptide or protein, one or more sequences encoding a regulatory element, one or more sequences encoding a regulatory nucleic acid, such as one or more non-coding RNAs, other expression sequences, and any combination of the foregoing. The constructs described herein may have one or more effector sequences, e.g., 2, 3, 4, 5 or more effector sequences. In the case of multiple effector sequences in a single construct, the effector sequences may be the same or different.

[0251] In one embodiment, the TDSC comprises a therapeutically functional structural DNA sequence. In one embodiment, the TDSC comprises a promoter and a sequence encoding a therapeutic peptide, polypeptide, or protein described herein. In one embodiment, the TDSC comprises a promoter and a sequence encoding a regulatory RNA described herein.

[0252] In certain embodiments, an effector sequence encoding a polypeptide or protein is codon-optimized, e.g., optimized for expression in a mammal, e.g., a human. Generally, codon optimization means modifying a nucleic acid sequence for enhanced expression in a target host cell by replacing at least one codon of a native sequence (e.g., one or more, e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons; e.g., at least 1%, 5%, 10%, 20%, 25%, 50%, 60%, 70%, 80%, 90% or 100%) with a codon that is used more frequently or most frequently in the genes of that host cell while maintaining the native amino acid sequence. Codon usage tables are available, for example, in the "Codon Usage Database" available at http: / / www.kazusa.or.jp / codon / . These tables can be adapted in many ways, see, e.g., Nakamura et al., 2000, Nucl. Acids Res. 28:292. Computer algorithms for codon-optimizing a particular sequence for expression in a particular host cell, e.g., Gene Forge, are also available.

[0253] Nuclear targeting sequence (NTS) The TDSC disclosed herein, or the nucleic acid encoding dsDNA, may include a nuclear targeting sequence (NTS) that facilitates the transport of DNA from the cytoplasm of a cell into the nucleus. The NTS includes a binding site for a protein (such as a transcription factor, chaperone, etc.) that binds to an importin that transports cargo into the nucleus through the nuclear pore complex. In embodiments, the NTS may generally function (such as the SV40 enhancer NTS). In other embodiments, the NTS contains, for example, a binding site for a transcription factor expressed in a particular cell type and can target the TDSC described herein to the nucleus in a cell-specific manner (such as SRF, Nkx3), and may be cell- or tissue-specific. The NTS may be functional at multiple positions in the TDSC described herein, such as before the promoter and / or after the effector sequence.

[0254] The NTS can be of viral or non-viral origin. The NTS is described, for example, in Le Guen et al. 2021. Nucleic Acids Vol. 24: 477-486. Examples of NTS are disclosed in Table 2:

[0255] [Table 2]

[0256] In some embodiments, the NTS has a sequence according to Table 2, or a functional sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0257] Nuclear translocation protein In some embodiments, a TDSC or nucleic acid comprising dsDNA (e.g., as described herein) is capable of nuclear translocation, for example, by a nuclear translocation protein (e.g., as listed in Table 3). In some embodiments, a TDSC or nucleic acid comprising dsDNA (e.g., as described herein) can be bound by a nuclear translocation protein (e.g., as listed in Table 3). In some embodiments, a TDSC or nucleic acid comprising dsDNA (e.g., as described herein) comprises a recognition sequence for a nuclear translocation protein (e.g., as listed in any single row of Table 3). In some embodiments, a TDSC or nucleic acid comprising dsDNA (e.g., as described herein) comprises a recognition sequence as listed in Table 3, or a nucleic acid sequence having at least 75%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto. In some embodiments, an exonuclease-resistant DNA end form (e.g., as described herein, e.g., contained in a TDSC or nucleic acid comprising dsDNA) comprises a recognition sequence as listed in Table 3, or a nucleic acid sequence having at least 75%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0258] Exemplary transport proteins include, for example, basic helix-loop-helix (bHLH) proteins, heterogeneous nuclear ribonucleoprotein (hnRNP) isoforms, nuclear factor I (NFI) proteins, such as those listed in Table 3. In some embodiments, the bHLH protein includes an acetylcholine receptor subunit, such as the α subunit, such as CHRNA1, CHRNA2, CHRNA3, CHRNA4, CHRNA5, or CHRNA7. In some embodiments, the acetylcholine receptor subunit includes the γ or ε subunit. In some embodiments, the transport protein includes desmin. In some embodiments, the transport protein includes hnRNP, such as hnRNP A1, hnRNP C, hnRNP K, hnRNP U. In some embodiments, the transport protein includes importin. In some embodiments, the transport protein includes myosin light chain. In some embodiments, the transport protein includes NFI. In some embodiments, the transport protein includes NFKB. In some embodiments, the transport protein includes nucleoside diphosphate kinase, such as NM23-H2. In some embodiments, the transport protein includes Oct1. In some embodiments, the transport protein includes Oct2.

[0259] In some embodiments, the transport protein includes SRF. In some embodiments, the transport protein includes TEF-1. In some embodiments, the transport protein includes AP2. In some embodiments, the transport protein includes troponin, such as troponin I, such as troponin I 2. In some embodiments, the transport protein includes TTF-1. In some embodiments, the transport protein includes Ran binding protein, such as RanBP3 or RanBP1. In some embodiments, the transport protein includes a homeobox transcription factor, such as Chx10.

[0260] In some embodiments, the transport factor specifically binds to an E-box, a DTS (e.g., SV40 DTS or SMGA DTS), a promoter (e.g., SP-C promoter or htk promoter), a telomere, an ATTT motif, a cell cycle regulatory unit (CCRU), a CT3 sequence, an S / MAR, a topoisomerase II consensus sequence, an ARS consensus sequence, 3NF, an origin of virus replication (ori) (e.g., EBV oriP site).

[0261]

Table 3-1

[0262]

Table 3-2

[0263]

Table 3-3

[0264]

Table 3-4

[0265]

Table 3-5

[0266]

Table 3-6

[0267]

Table 3-7

[0268]

Table 3-8

[0269]

Table 3-9

[0270]

Table 3-10

[0271]

Table 3-11

[0272]

Table 3-12

[0273]

Table 3-13

[0274]

Table 3-14

[0275]

Table 3-15

[0276]

Table 3-16

[0277]

Table 3-17

[0278]

Table 3-18

[0279]

Table 3-19

[0280]

Table 3-20

[0281]

Table 3-21

[0282] Maintaining array The TDSC disclosed herein, or the nucleic acid encoding dsDNA, may include a maintenance sequence for the TDSC of the invention that supports or enables persistent gene expression by a continuous series of cell divisions and / or progenitor cell differentiations within a host cell. In embodiments, the maintenance sequence is a nuclear matrix / matrix attachment region (S / MAR). S / MAR elements are diverse AT-rich sequences in the range of 60 to 500 bp that are conserved among species and are thought to anchor chromatin to nuclear matrix proteins during interphase (Bode et al. 2003. Chromosome Res 11, 435-445). S / MARs can be incorporated into the TDSC described herein to promote long-term transgene expression and extrachromosomal maintenance. In one embodiment, the maintenance sequence is the human interferon-β MAR (5’tataattcactggaatttttttgtgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata-3’ (SEQ ID NO: 39)), or a functional sequence having at least 80%, 90%, 95%, or 98% identity thereto. In embodiments, S / MARs useful in the constructs described herein can be found by searching the MARome at http: / / bioinfo.net.in / MARome and are also described by Narwade et al. 2019. Nucleic Acids Research. Volume 47, Issue 14:7247-7261.

[0283] In embodiments, the TDSCs described herein are capable of replicating within mammalian cells, such as human cells. In some embodiments, the TDSCs described herein are maintained within a host cell, tissue, or subject by at least one cell division. For example, the TDSCs described herein are maintained within a host cell, tissue, or subject by at least 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 40, 50 cell divisions or more. In vitro cell division can be tracked by flow cytometry or microscopy. In vivo cell division can be tracked by intravital microscopy.

[0284] Other elements The TDSCs, or nucleic acids encoding dsDNA, disclosed herein may also include other regulatory elements operably linked to an effector sequence, such as a sequence encoding an effector, in a manner that enables its transport, localization, transcription, translation, and / or expression within a target cell, or promotes its degradation or suppression of expression within a non-target cell. As used herein, an "operably linked" sequence includes both an expression control sequence adjacent to the sequence encoding an effector and an expression control sequence that acts at a distance to control the sequence encoding the effector, either in cis or trans. The exact nature of the regulatory sequences required for gene expression within a host cell can vary between species, tissues, or cell types, but generally includes 5' non-transcribed and 5' untranslated sequences that are each involved in the initiation of transcription and translation, such as a TATA box, capping sequence, CAAT sequence, enhancer elements, etc., as needed. The regulatory sequences may optionally also include enhancer sequences or upstream activator sequences. The constructs described herein may optionally include a 5' leader or signal sequence.

[0285] Chemically modified nucleotides The TDSC or nucleic acid encoding dsDNA described herein may have chemical modifications of the nucleobases, sugars, and / or phosphate backbone (such as those shown in FIGS. 1A - 2, for example). Without wishing to be bound by theory, such modifications may be useful for protecting the DNA from degradation (e.g., from exonucleases) or from the immune system of the host tissue or subject. Generally, chemically modified modified nucleotides have the same base pairing specificity as unmodified nucleotides, i.e., modified adenine "A" can base pair with thymine "T". One or more atoms of the pyrimidine nucleobases can be replaced or substituted with an optionally substituted amino, an optionally substituted thiol, an optionally substituted alkyl (e.g., methyl or ethyl), or a halo (e.g., chloro or fluoro). In certain embodiments, the chemical modification (e.g., one or more modifications) is present in each of the sugar and the internucleoside linkage.

[0286] In some embodiments, the TDSC comprises at least one chemical modification. Suitable modifications are described by Sood et al. 2019. DNAmod: the DNA modification database. J Cheminform 11, 30. DNAmod is an open-source database (https: / / dnamod.hoffmanlab.org) that catalogs chemically modified nucleotides and provides a single source of information for learning about their properties. DNAmod provides a web interface for easily browsing and searching for these modifications. In this database, annotations are made for the chemical properties and structures of all curated chemically modified DNA bases, as well as a much larger list of chemical entity candidates. DNAmod includes manual annotations regarding available sequencing methods and explanations of their occurrence in nature, and provides existing and proposed nomenclatures. Examples of chemical modifications to DNA useful in the methods described herein include, for example, N6-methyladenosine (m6A, 6mA); 5-formylcytosine (5-formyl-2'-deoxycytosine, 5fC, f5C); 5-carboxylcytosine (5-carboxyl-2'-deoxycytosine, 5-carboxycytosine, ca5C, 5caC); 5-hydroxymethylcytosine (5-hydroxymethyl-2'-deoxycytosine, 5hmC, hm5C); 5-methyldeoxycytosine (5-methylcytosine; 5-methyl-2'-deoxycytosine; m5dC; 5mC, m5C); 5'-methylcytosine; 3-methylcytosine (m3C); 2'-fluoro-2'-deoxynucleoside; 5-glucosylmethylcytosine; 5-methylpyrimidine; 8-oxoguanine (8-oxoG); phosphorothioate; S and R phosphorothioate bonds; methylthymine; N3'-P5' phosphoramidate (NP); cyclohexane nucleic acid (CeNA); tricyclo-DNA (tcDNA).For example, see Pu et al. 2020. An in-vitro DNA phosphorothioate modification reaction. Mol Microbiol. 113:452-463; Zheng & Sheng. 2021. Synthesis of N4-methylcytidine (m4C) and N4,N4-dimethylcytidine (m42C) modified RNA. Current Protocols, 1, e248; Ohkubo et al. 2021. Chemical synthesis of modified oligonucleotides containing 5’-amino-5’-deoxy-5’-hydroxymethylthymidine residues. Current Protocols, 1, e70; Bao & Xu. 2021. Observation of Z-DNA structure via the synthesis of oligonucleotide DNA containing 8-trifluoromethyl-2-deoxyguanosine. Current Protocols, 1, e28; Skakuj et al. 2020. Automated synthesis and purification of guanidine-backbone oligonucleotides. Current Protocols in Nucleic Acid Chemistry, 81, e110.

[0287] In some embodiments, a TDSC as described herein may contain phosphorothioate-modified nucleotides. In some embodiments, a DNA end form as described herein (e.g., an exonuclease-resistant DNA end form) may contain phosphorothioate-modified nucleotides. In some embodiments, a TDSC as described herein may contain S and R phosphorothioate-modified nucleotide linkages. In one embodiment, the phosphorothioate linkages are made according to Iwamoto et al, 2017, Nature Biotechnology, Volume 35:845-851. Briefly, monomers of nucleoside 3'-oxaazaphospholidine derivatives undergo stereocontrolled oligonucleotide synthesis with iterative capping and sulfurization to form stereocontrolled phosphorothioate linkages. The final sample is analyzed by reverse-phase high-performance liquid chromatography (RP-HPLC) and ultra-high-performance liquid chromatography mass spectrometry (UPLC / MS) to determine the stereochemistry of the modification. Nucleic acids containing phosphorothioate linkages are also commercially available.

[0288] In some embodiments, a TDSC as described herein may contain borano-phosphate-modified nucleotides, for example, according to the method in Sergueev and Shaw, 1998, J Am Chem Soc, Volume 120, Issue 37:9417-9427. Briefly, after H-phosphonate chain elongation, boronylation follows to replace the non-bridging oxygen in the phosphate backbone with a borano group. The final sample is purified and analyzed by RP-HPLC to determine the stereochemistry of the modification. Borano-phosphate-modified nucleotides are also commercially available.

[0289] In some embodiments, the TDSC described herein may contain 5-methylcytosine modified nucleotides, prepared, for example, according to the method in Lin et al, 2002, Mol Cell Biol, Volume 22, Issue 3: 704-723. Briefly, cytosine or a sequence containing cytosine is incubated with unlabeled S-adenosylmethionine (AdoMet) together with the glutathione S-transferase fusion of wild-type Dnmt3a (GST-3a) protein. The nucleotides are purified and analyzed by HPLC to determine that the nucleotides are methylated at the appropriate positions. 5-Methylcytosine modified nucleotides are also commercially available.

[0290] In some embodiments, the TDSC described herein may contain 7-methylguanine modified nucleotides. In one embodiment, the 7-methylguanine modified nucleotides are prepared according to the method in Jones and Robins, 1963, Purine nucleosides. III. Methylation studies of certain naturally occurring purine nucleosides, J Am Chem Soc, Volume 85: 193. Briefly, 2'-deoxyguanosine in dimethyl sulfoxide is treated with methyl iodide. The nucleotides are purified and analyzed by HPLC to determine that the nucleotides are methylated at the appropriate positions. In another embodiment, the 7-methylguanine modified nucleotides are prepared according to the methods described in Hendler et al, 1970, Volume 9, Issue 21: 4141:4153, and Kore and Parmar, 2006, Biochemistry, Volume 25, Issue 3: 337-340. Briefly, instead of guanosine 5'-diphosphate, guanosine 5'-diphosphate in water is added with dimethyl sulfate to obtain 7-methyl GDP. The nucleotides are purified and analyzed by HPLC to determine that the nucleotides are methylated at the appropriate positions. 7-Methylguanine modified nucleotides are also commercially available.

[0291] In some embodiments, the TDSC described herein includes methylation in one or more CpG or GpC dinucleotides. In some embodiments, the TDSC described herein includes methylation introduced by AluI methyltransferase. In some embodiments, the TDSC described herein includes methylation introduced by BamHI methyltransferase. In some embodiments, the TDSC described herein includes methylation introduced by CpG methyltransferase (M.Sssl). In some embodiments, the TDSC described herein includes methylation introduced by dam methyltransferase. In some embodiments, the TDSC described herein includes methylation introduced by EcoGII methyltransferase. In some embodiments, the TDSC described herein includes methylation introduced by EcoRI methyltransferase. In some embodiments, the TDSC described herein includes methylation introduced by GpC methyltransferase (M.CviPI). In some embodiments, the TDSC described herein includes methylation introduced by HaeIII methyltransferase. In some embodiments, the TDSC described herein includes methylation introduced by HhaI methyltransferase. In some embodiments, the TDSC described herein includes methylation introduced by HpaII methyltransferase. In some embodiments, the TDSC described herein includes methylation introduced by MspI methyltransferase. In some embodiments, the TDSC described herein includes methylation introduced by TaqI methyltransferase.In some embodiments, the methods described herein include contacting dsDNA with AluI methyltransferase, BamHI methyltransferase, M.Sssl, dam methyltransferase, EcoGII methyltransferase, EcoRI methyltransferase, M.CviPI, HaeIII methyltransferase, HhaI methyltransferase, HpaII methyltransferase, MspI methyltransferase, or TaqI methyltransferase.

[0292] In some embodiments, the TDSC described herein includes a carboxyl modification or a formyl modification.

[0293] In an embodiment, the TDSC described herein, or one strand of the TDSC (e.g., the sense strand or the antisense strand), contains 1 to 100% chemically modified nucleotides, 1% to 90% chemically modified nucleotides, 1% to 80% chemically modified nucleotides, 1% to 70% chemically modified nucleotides, 1% to 60% chemically modified nucleotides, 1% to 50% chemically modified nucleotides, 1% to 40% chemically modified nucleotides, 1% to 30% chemically modified nucleotides, 1% to 20% chemically modified nucleotides, 1% to 15% chemically modified nucleotides, 1% to 10% chemically modified nucleotides, 20% to 90% chemically modified nucleotides, 20% to 80% chemically modified nucleotides. In an embodiment, the TDSC described herein, or one strand of the TDSC (e.g., the sense strand or the antisense strand), contains at least 1% chemically modified nucleotides, at least 5% chemically modified nucleotides; at least 10% chemically modified nucleotides; at least 15% chemically modified nucleotides; at least 20% chemically modified nucleotides; at least 25% chemically modified nucleotides; at least 30% chemically modified nucleotides; at least 40% chemically modified nucleotides; at least 50% chemically modified nucleotides; at least 60% chemically modified nucleotides; at least 70% chemically modified nucleotides; at least 80% chemically modified nucleotides; at least 85% chemically modified nucleotides; at least 90% chemically modified nucleotides; at least 92% chemically modified nucleotides; at least 95% chemically modified nucleotides; at least 97% chemically modified nucleotides. In an embodiment, the TDSC described herein, or one strand of the TDSC (e.g., the sense strand or the antisense strand), contains chemically modified nucleotides in 0% to 100% of each different nucleotide, e.g., 0% to 100% chemically modified T nucleotides, 0% to 100% chemically modified A nucleotides, 0% to 100% chemically modified C nucleotides, and 0% to 100% chemically modified G nucleotides for each construct.In an embodiment, the TDSC described herein, or one strand of the TDSC (e.g., the sense strand or the antisense strand), contains chemically modified nucleotides at 0 to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, or 10% to 50% of the different nucleotides, for example, chemically modified T nucleotides at 0 to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, or 10% to 50%; chemically modified A nucleotides at 0 to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, or 10% to 50%; chemically modified C nucleotides at 0 to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, or 10% to 50%; or chemically modified G nucleotides at 0 to 100%, 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, or 10% to 50%. For example, the TDSC may contain 100% chemically modified T nucleotides, 50% chemically modified A nucleotides, 0% chemically modified C nucleotides, and 25% chemically modified G nucleotides.

[0294] In an embodiment, the chemically modified nucleotides, such as the modifications described herein, can be introduced throughout the sequence, within the scope of an element of the sequence, such as an element described herein, at the 5'-end or 3'-end, and / or between the last 10, 8, 6, 5, 4, 3, or 2 nucleotides at the 5'-end or 3'-end in the TDSC described herein.

[0295] In some embodiments, the TDSC as described herein contains chemically modified nucleotides only in one strand (e.g., as shown in FIG. 1A). In some embodiments, the TDSC as described herein contains chemically modified nucleotides in the antisense strand. In some embodiments, the TDSC as described herein contains chemically modified nucleotides in the sense strand.

[0296] In some embodiments, a TDSC as described herein includes chemically modified nucleotides on both strands (e.g., as shown in FIGS. 1A and 2). In certain embodiments, both strands include chemical modifications at the same positions (e.g., the chemically modified nucleotides of one strand base pair with the chemically modified nucleotides of the reverse strand, and / or the unchemically modified nucleotides of one strand base pair with the unchemically modified nucleotides of the reverse strand). In embodiments, both entire strands are composed of chemically modified nucleotides. In other embodiments, the two strands of a TDSC as described herein include different chemical modification patterns (e.g., one or more chemically modified nucleotides of one strand base pair with unchemically modified nucleotides of the other strand). In embodiments, a TDSC as described herein includes one or more double-stranded regions in which both strands are chemically modified and / or one or more double-stranded regions in which neither strand is chemically modified. In embodiments, a TDSC as described herein includes one or more double-stranded regions in which one strand is chemically modified and the other is unchemically modified.

[0297] In embodiments, a TDSC as described herein includes one or more DNA end forms (e.g., exonuclease-resistant DNA end forms as described herein, e.g., covalently closed DNA end forms or non-covalently closed DNA end forms) each including one or more chemically modified nucleotides (e.g., on one or both strands in the form of DNA ends). In embodiments, the TDSC includes a double-stranded region adjacent to a non-covalently closed exonuclease-resistant DNA end form including chemically modified nucleotides as described herein (e.g., as described herein (e.g., in FIG. 2)).

[0298] In embodiments, the TDSCs described herein have one or more chemical modifications that impede some of the ability of the TDSCs to form double-stranded structures. For example, the TDSCs described herein have one or more chemical modifications on nucleotides present in regions having intramolecular complementarity. In embodiments, the TDSCs described herein have one or more chemical modifications that impede base pairing of regions of intramolecular complementarity as compared to the unmodified sequences of the TDSCs. In some embodiments, the chemically modified nucleotides used herein have a decreased tendency to base pair with chemically modified nucleotides as compared to the tendency of unmodified nucleotides to base pair with unmodified nucleotides. In some embodiments, the chemically modified nucleotides used herein have an increased tendency to base pair with unmodified nucleotides as compared to modified nucleotides.

[0299] Other modifications are also contemplated. For example, the ends of the linear DNA described herein can be chemically modified, for example, to protect them from exonucleases. For example, one or more dideoxynucleotide residues can be added to the 3' end of the linear molecule and / or self-complementary oligonucleotides can be ligated to one or both ends. See, for example, Chang, et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls, et at (1996) Science 272:886-889.

[0300] In some embodiments, the chemically modified TDSCs described herein exhibit reduced recognition by DNA sensors in a host tissue or subject, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more reduced recognition by DNA sensors in a host tissue or subject as compared to unmodified TDSCs of the same sequence. In some embodiments, the chemically modified TDSCs described herein exhibit reduced degradation by DNA nucleases as compared to unmodified TDSCs of the same sequence, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more reduced degradation by DNA nucleases in a host tissue or subject as compared to unmodified TDSCs. In some embodiments, the chemically modified TDSCs described herein exhibit reduced activation of the innate immune system in a target / host tissue or subject as compared to unmodified TDSCs of the same sequence, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more reduced activation of the innate immune system in a target / host tissue or subject as compared to unmodified TDSCs of the same sequence.

[0301] In some embodiments, TDSCs comprising the chemically modified nucleotides described herein exhibit any of the following properties in a target / host tissue or subject as compared to dsDNA of the same sequence that does not comprise the chemically modified nucleotide (unmodified dsDNA): increased integration of exogenous constructs into the genome of target cells; increased retention in target cells through replication; decreased secondary or tertiary structure formation; decreased interaction with innate immune sensors; decreased interaction with nucleases; enhanced stability; enhanced longevity; decreased toxicity; enhanced delivery; increased expression; increased transport across membranes; increased binding to DNA-binding moieties such as nuclear DNA-binding proteins, transcription factors, chaperones, DNA polymerases. In embodiments, any of the properties listed above are modulated by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more in a target / host tissue or subject as compared to unmodified dsDNA of the same sequence.

[0302] Structure of the DNA construct In some embodiments, the TDSC disclosed herein, or the nucleic acid encoding dsDNA, is at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 500 nucleotides, at least about 1000 nucleotides, at least about 2000 nucleotides, at least about 3000 nucleotides, at least about 4000 nucleotides, at least about 5000 nucleotides, at least about 6000 nucleotides, at least about 7000 nucleotides, at least about 8000 nucleotides, at least about 9000 nucleotides, at least about 10,000 nucleotides, at least about 20,000 nucleotides, at least about 30,000 nucleotides, at least about 40,000 nucleotides, or at least about 50,000 nucleotides in length. In some embodiments, the TDSC or nucleic acid comprising dsDNA disclosed herein is 20 - 30, 30 - 40, 40 - 50, 50 - 75, 75 - 100, 100 - 200, 200 - 300, 300 - 500, 500 - 1000, 1000 - 2000, 2000 - 3000, 3000 - 4000, 4000 - 5000, 5000 - 6000, 6000 - 7000, 7000 - 8000, 8000 - 9000, 9000 - 10,000, 10,000 - 20,000, 20,000 - 30,000, 30,000 - 40,000, or 40,000 - 50,000 nucleotides in length. In some embodiments, the size of the TDSC disclosed herein is of sufficient length to encode a useful polypeptide or RNA.

[0303] In some embodiments, the TDSC or nucleic acid comprising dsDNA comprises an exonuclease-resistant DNA end form (e.g., as described herein). In some embodiments, the DNA end form is at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides in length. In some embodiments, the DNA end form is less than 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides in length. In some embodiments, the DNA end form is 2-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-70, 70-80, 80-90, or 90-100 nucleotides in length.

[0304] In some embodiments, a TDSC or nucleic acid comprising dsDNA comprises a double-stranded region encoding an effector (e.g., a polypeptide or RNA as described herein) located, for example, between two exonuclease-resistant DNA end forms. In some embodiments, the double-stranded region is at least 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 20,000, 30,000, 40,000, or 50,000 nucleotides in length. In some embodiments, the double-stranded region form is less than 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 20,000, 30,000, 40,000, or 50,000 nucleotides in length. In some embodiments, the double-stranded region is 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-70, 70-80, 80-90, 90-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, 9000-10,000, 10,000-20,000, 20,000-30,000, 30,000-40,000, or 40,000-50,000 nucleotides in length.

[0305] The TDSC described herein may have a single-stranded structure that is less than the threshold level. In one embodiment, the TDSC does not contain more than 20, 18, 16, 14, 12, 10, 8, 7, 5, 4, 3, 2, or 1 single-stranded region longer than 100, 80, 70, 60, 50, 40, 30, 20, or 10 bases. For example, it does not contain a single-stranded region longer than 100, 80, 70, 60, 50, 40, 30, 20, or 10 bases. In one embodiment, the double-stranded region formed by the TDSC described herein is determined as described by Xayaphoummine et al. 2005. Kinefold web server for RNA / DNA folding path and structure prediction including pseudoknots and knots. Nucleic Acids Research, Volume 33: W605-610. In one embodiment, the Kinefold website (http: / / kinefold.curie.fr / cgi-bin / form.pl) is used to predict the double-stranded region of the constructs described herein using the following parameters: · Sequence to fold: Enter and select "DNA sequence" · Stochastic simulation: Cotranscriptional folding, 3 milliseconds · Molecular time to simulate: Default · Pseudoknots: Not allowed · Entanglement: No crossing · Random number seed: 11453

[0306] Generate In some embodiments, the TDSC or nucleic acid comprising dsDNA as described herein is generated from a plasmid assembled to contain the desired elements as described herein. The plasmid template can be assembled, for example, using the Golden Gate cloning method for assembling a plurality of DNA fragments in a defined linear order into a recipient vector using a one-pot assembly technique. The Golden Gate cloning method is described in Marillonnet & Gruetzner, 2020, Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline, Current Protocols in Molecular Biology, 130:e115. In some embodiments, the plasmid template is linearized, for example, by digestion with a nuclease (e.g., a restriction endonuclease) or by PCR amplification of a linear nucleic acid sequence from the plasmid template (e.g., as described in Example 2). In certain embodiments, when the plasmid template is linearized, a proto-TDSC as described herein (e.g., a linear nucleic acid containing dsDNA that does not contain exonuclease-resistant DNA end forms at one or both ends) is generated.

[0307] In some embodiments, a TDSC or proto-TDSC comprising a chemical modification on one strand is generated by amplification of one strand (e.g., from a plasmid template) using a dNTP mixture containing one or more chemically modified nucleotides and a primer capable of amplifying one strand of the TDSC or proto-TDSC sequence (e.g., as described in Example 3). In certain embodiments, the reverse strand (e.g., an unmodified strand or a strand having a different chemical modification as described herein, e.g., as described in FIGS. 1A-2) is generated in a separate amplification reaction using, for example, a dNTP mixture containing unmodified nucleotides or a different set of chemically modified nucleotides and a primer capable of amplifying the reverse strand of the TDSC or proto-TDSC sequence (e.g., as described in Example 3).

[0308] In some embodiments, a TDSC or proto-TDSC comprising one or more identical chemical modifications on both strands is generated by amplification of a TDSC strand or proto-TDSC strand (e.g., from a plasmid template) using a dNTP mixture comprising one or more chemically modified nucleotides and a primer capable of amplifying both strands of the TDSC or proto-TDSC sequence (e.g., as described in Example 4).

[0309] In some embodiments, an exonuclease-resistant DNA end form (e.g., as described herein) is introduced (e.g., ligated) to one or both ends of the proto-TDSC. In certain embodiments, the DNA end form is ligated (e.g., as described in Example 5 or 6) to the ends of the proto-TDSC. In embodiments, ligating a DNA end form (e.g., a covalently closed circular DNA end form) to the proto-TDSC generates the final TDSC. In certain embodiments, the exonuclease resistance of the ligated DNA end form is confirmed, for example, as described in Examples 10 and 11, by incubating the TDSC in the presence of an exonuclease (e.g., exonuclease III, USER enzyme, and / or mung bean nuclease). In embodiments, the exonuclease resistance of the ligated DNA end form is confirmed by incubating the TDSC in the presence of exonuclease III. In embodiments, the DNA end form comprises blunt ends, sticky ends, or a Y-type adapter (e.g., as described herein), and the exonuclease resistance of the ligated DNA end form is confirmed by incubating the TDSC in the presence of exonuclease III and (e.g., subsequently, previously, or simultaneously) mung bean nuclease and / or USER enzyme.

[0310] In certain embodiments, the DNA end form is linked to the end of the proto-TDSC in a nascent form (e.g., as described in Example 5 and FIGS. 3-4, for example, a non-covalently closed DNA end form may be linked to the proto-TDSC as a hairpin). In a subsequent step, the nascent DNA end form may be further modified (e.g., cleaved) to generate the final DNA end form. For example, the non-covalently closed DNA end form may be generated, for example, by cleavage of the nascent form by a nuclease. In an embodiment, the nascent form contains one or more uracil nucleotides. In an embodiment, the nascent form is cleaved using a USER enzyme with one or more uracil nucleotides. In some embodiments, a nascent form containing an overhang or sticky end (e.g., a nascent form generated by USER enzyme cleavage as shown in FIGS. 3-4) can be converted to a blunt end by digestion with a single-strand specific nuclease, such as mung bean nuclease (e.g., as described in Example 5). In some embodiments, a nascent form containing a hairpin with a cleavable moiety (e.g., a uracil nucleotide) in its single-stranded loop region is converted to a Y-shaped adapter, for example, by cleavage of the cleavable moiety (e.g., by a USER enzyme) as described in Example 7. T

[0311] TDSC may be concentrated or purified from impurities or by-products selected from the group consisting of endotoxins, mononucleotides, chemically modified mononucleotides, single-stranded DNA, circular DNA, proteins (e.g., enzymes, e.g., ligases, restriction enzymes), DNA fragments or truncations. In some embodiments, the purified TDSC is substantially free of process by-products and impurities, such as the process by-products or impurities described herein.

[0312] In some embodiments, TDSC is formulated with a lipid-based carrier, such as lipid nanoparticles (LNP), as described in Example 8, for example.

[0313] By sequencing the TDSC, a desired designed array can be confirmed. In embodiments, other structural analyses of the TDSC (e.g., restriction enzyme analysis) may be performed to confirm or verify its sequence.

[0314] Pharmaceutical composition The present disclosure includes a TDSC, or a nucleic acid encoding dsDNA and related compositions, in combination with one or more pharmaceutically acceptable excipients and / or carriers.

[0315] The pharmaceutical composition may optionally include one or more additional active substances, e.g., therapeutically and / or prophylactically active substances. The pharmaceutical compositions of the present invention are generally sterile and / or pyrogen-free.

[0316] The TDSC described herein can be formulated without a carrier; for example, the TDSC described herein can be administered "naked" to a host cell, tissue, or subject. Naked formulations can contain pharmaceutical excipients or diluents but lack a carrier.

[0317] Pharmaceutically acceptable excipients or diluents can include inert substances that act as vehicles or media for the compositions described herein, such as any one of the active ingredients listed in the Inactive Ingredients Database approved by the United States Food and Drug Administration (FDA) and incorporated herein by reference. Non-limiting examples of pharmaceutically acceptable excipients or diluents include solvents, aqueous solvents, non-aqueous solvents, tonicity agents, dispersion media, cryoprotectants, diluents, suspending aids, surfactants, isotonic agents, thickening agents, emulsifying agents, preservatives, hyaluronidase, dispersing agents, preservatives, lubricants, granulating agents, disintegrating agents, binding agents, antioxidants, buffers (e.g., phosphate buffered saline (PBS)), lubricants, oils, and mixtures thereof.

[0318] General considerations in the formulation and / or manufacture of pharmaceuticals can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference).

[0319] Carrier The TDSC described herein, or the nucleic acid encoding dsDNA, can also be formulated with or included in a carrier. General considerations for carriers and pharmaceutical delivery can be found, for example, in Delivery Technologies for Biopharmaceuticals: Peptides, Proteins, Nucleic Acids and Vaccines (Lene Jorgensen and Hanne Morck Nielson, Eds.) Wiley; 1st edition (December 21, 2009); and Vargason et al. 2021. Nat Biomed Eng 5, 951 - 967.

[0320] Non - limiting examples of carriers include carbohydrate carriers (e.g., anhydro - modified phyto - glycogen or glycogen - type materials, GalNAc), nanoparticles (e.g., nanoparticles encapsulating or covalently linked to TDSC, gold nanoparticles, silica nanoparticles), lipid particles (e.g., liposomes, lipid nanoparticles), cationic carriers (e.g., cationic lipopolymers or transfection reagents), fusosomes, enucleated cells (e.g., reticulocytes differentiated ex vivo), nucleated cells, exosomes, protein carriers (e.g., proteins covalently linked to TDSC), peptides (e.g., cell - penetrating peptides), materials (e.g., graphene oxide), single pure lipids (e.g., cholesterol), DNA origami (e.g., DNA tetrahedron).

[0321] In one embodiment, the TDSC compositions, constructs, and systems described herein can be formulated in liposomes or other similar vesicles. Liposomes are spherical vesicular structures composed of a monolayer or multilayer lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral, or cationic. Liposomes are biocompatible, non-toxic, can deliver both hydrophilic and lipophilic drug molecules, protect their payloads from degradation by plasma enzymes, and can transport the payload across biological membranes and the blood-brain barrier (BBB) (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, page 12, 2011. doi:10.1155 / 2011 / 469679 for a review).

[0322] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Methods for the preparation of multilamellar vesicle lipids are known in the art (see, for example, U.S. Patent No. 6,693,086, the teachings of which are incorporated herein by reference, for teachings regarding the preparation of multilamellar vesicle lipids). Vesicle formation can occur spontaneously when a lipid film is mixed with an aqueous solution, but it can also be facilitated by applying force in the form of agitation by using a homogenizer, sonicator, or extrusion device (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, page 12, 2011. doi:10.1155 / 2011 / 469679 for a review). Extruded lipids can be prepared by passing them through a filter that reduces the size, as described in Templeton et al., Nature Biotech, 15:647-652, 1997, the teachings of which are incorporated herein by reference regarding the preparation of extruded lipids).

[0323] Exosomes can also be used as a drug delivery vehicle for the compositions and systems described herein. For an overview, see Ha et al. July 2016. Acta Pharmaceutica Sinica B. Volume 6, Issue 4, Pages 287-296; https: / / doi.org / 10.1016 / j.apsb.2016.02.001.

[0324] Erythrocytes differentiated ex vivo can also be used as a carrier for the agents (e.g., TDSC) described herein. See, for example, WO 2015073587; WO 2017123646; WO 2017123644; WO 2018102740; WO 2016183482; WO 2015153102; WO 2018151829; WO 2018009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136; US Patent No. 9,644,180; Huang et al. 2017. Nature Communications 8:423; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136.

[0325] For example, fusosome compositions as described in WO 2018208728 can also be used as a carrier for delivering the TDSC described herein.

[0326] Lipid nanoparticles: Lipid nanoparticles (LNPs) are carriers made of ionizable lipids. LNPs are taken up by cells via endocytosis, and their properties enable endosomal escape, which allows for the release of cargo into the cytoplasm of target cells. In addition to ionizable lipids, LNPs may contain helper lipids that promote cell binding, cholesterol that fills the gaps between lipids, and / or polyethylene glycol (PEG) that reduces opsonization by serum proteins and reticuloendothelial clearance. Lipid nanoparticles, in some embodiments, comprise one or more ionizable lipids, such as non-cationic lipids (e.g., neutral or anionic, or zwitterionic lipids); one or more conjugate lipids (such as PEG-conjugated lipids or lipids conjugated to polymers described in Table 5 of WO 2019217941, which is hereby incorporated by reference in its entirety); one or more sterols (e.g., cholesterol); and optionally, one or more targeting molecules (e.g., conjugate receptors, receptor ligands, antibodies); or combinations of the foregoing.

[0327] Lipids that can be used in nanoparticle formulations (e.g., lipid nanoparticles) include, for example, those described in Table 4 of WO 2019217941 (incorporated by reference), e.g., lipid-containing nanoparticles may comprise one or more of the lipids in Table 4 of WO 2019217941. Lipid nanoparticles may contain additional elements, such as polymers, such as those described in Table 5 of WO 2019217941 (incorporated by reference).

[0328] In some embodiments, the conjugate lipid, if present, may include PEG-diacylglycerol (DAG) (such as l-(monomethoxy-polyethylene glycol)-2,3-dimyristoyl glycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), pegylated phosphatidylethanolamine (PEG-PE), PEG succinic acid diacylglycerol (PEGS-DAG) (such as 4-0-(2’,3’-di(tetradecanoyloxy)propyl-l-0-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG)), PEG dialkoxypropylcarbam, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, and those described in Table 2 of WO 2019 / 051289, dx.doi.org / 10.1021 / acs.nanolett.0c01386 (incorporated by reference), and may include one or more of the above combinations.

[0329] In some embodiments, the sterol that can be incorporated into the lipid nanoparticles includes one or more of cholesterol or cholesterol derivatives such as those described in WO 2009 / 127060 or US Patent Application Publication No. 2010 / 0130588 (incorporated by reference). Additional exemplary sterols include plant sterols including those described in Eygeris et al (2020) (incorporated herein by reference).

[0330] In some embodiments, the lipid particles comprise an ionizable lipid, a non-cationic lipid, a conjugate lipid that inhibits particle aggregation, and a sterol. The amounts of these components can be varied independently and to achieve the desired properties. For example, in some embodiments, the lipid nanoparticles comprise an ionizable lipid in an amount of about 20 mol% to about 90 mol% of the total lipid (in other embodiments, it can be 20 - 70% (mol), 30 - 60% (mol) or 40 - 50% (mol); it can be in an amount of about 50 mol% to about 90 mol% of the total lipid present in the lipid nanoparticles), a non-cationic lipid in an amount of about 5 mol% to about 30 mol% of the total lipid, a conjugate lipid in an amount of about 0.5 mol% to about 20 mol% of the total lipid, and a sterol in an amount of about 20 mol% to about 50 mol% of the total lipid. The ratio of total lipid to nucleic acid can be varied as needed. For example, the total lipid to nucleic acid (mass or weight) ratio can be about 10:1 to about 30:1.

[0331] In some embodiments, the lipid to nucleic acid ratio (mass / mass ratio; w / w ratio) can be in the range of about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipid and nucleic acid can be adjusted to obtain a desired N / P ratio, for example, an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10 or more. Generally, the total lipid content of the lipid nanoparticle formulation can be in the range of about 5 mg / ml to about 30 mg / mL.

[0332] Some non-limiting examples of lipid compounds that can be used in the compositions described herein, for example, to form the lipid nanoparticles for delivery of the nucleic acids described herein (e.g., in combination with other lipid components) include

Chemical formula

[0333] In some embodiments, the LNP comprising formula (i) is used to deliver the DNA composition described herein to the liver and / or hepatocytes. [Chemistry]

[0334] In some embodiments, the LNPs comprising formula (ii) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes. [Chemistry]

[0335] In some embodiments, the LNPs comprising formula (iii) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes. [Chemistry]

[0336] In some embodiments, the LNPs comprising formula (v) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes. [Chemistry]

[0337] In some embodiments, the LNPs comprising formula (vi) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes. [Chemistry]

[0338] In some embodiments, the LNPs comprising formula vii or (viii) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes. [Chemistry]

[0339] In some embodiments, the LNPs comprising formula (ix) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0340] In some embodiments, the LNPs comprising formula (x) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes:

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

[0341] In some embodiments, the LNP comprising formula (xi) is used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0342] In some embodiments, the LNP comprising formula (xii) is used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

Chemical formula

[0343] In some embodiments, the LNP comprises a compound of formula (xiii) and a compound of formula (xiv).

Chem.

[0344] In some embodiments, an LNP comprising formula (xv) is used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

Chem.

[0345] In some embodiments, an LNP comprising a formulation of formula (xvi) is used to deliver the DNA compositions described herein to lung endothelial cells.

[0346] In some embodiments, an LNP comprising a formulation of formula (xvii), (xviii) or (xix) is used to deliver the DNA compositions described herein to lung endothelial cells.

Chem.

[0347] In some embodiments, the lipid compounds used to form lipid nanoparticles for delivery of the compositions described herein, e.g., nucleic acids described herein, are made by one of the following reactions:

Chem.

[0348] In some embodiments, the compositions described herein (e.g., nucleic acids or proteins) are provided in LNPs comprising ionizable lipids. In some embodiments, the ionizable lipid is, for example, heptadec-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102) as described in Example 1 of U.S. Patent No. 9,867,888, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is, for example, (9Z,12Z)-3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate (LP01) as synthesized in Example 13 of International Publication No. WO 2015 / 095340, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is, for example, di((Z)-nona-2-en-1-yl) 9-((4-dimethylamino)butanoyl)oxy)heptadecane dioate (L319) as synthesized in Examples 7, 8, or 9 of U.S. Patent Application Publication No. 2012 / 0027803, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is, for example, 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200) as synthesized in Examples 14 and 16 of International Publication No. WO 2010 / 053572, which is incorporated herein by reference in its entirety.In some embodiments, the ionizable lipid is an imidazole cholesterol ester (ICE) lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, for example, Structure (I) from WO 2020 / 106946 pamphlet (incorporated herein by reference in its entirety).

[0349] In some embodiments, the ionizable lipid can be a cationic lipid, an ionizable cationic lipid, e.g., a cationic lipid that can exist in a positively charged or neutral form depending on the pH, or an amine-containing lipid that can be readily protonated. In some embodiments, the cationic lipid is, for example, a lipid that can be positively charged under physiological conditions. Exemplary cationic lipids contain one or more amine groups having a positive charge. In some embodiments, the lipid particles contain a cationic lipid in a formulation with one or more of a neutral lipid, an ionizable amine-containing lipid, a biodegradable alkyne lipid, a steroid, a phospholipid containing a polyunsaturated lipid, a structural lipid (e.g., a sterol), PEG, cholesterol, and a polymer-conjugated lipid. In some embodiments, the cationic lipid can be an ionizable cationic lipid. Exemplary cationic lipids disclosed herein can have an effective pKa greater than 6.0. In embodiments, the lipid nanoparticles can contain a second cationic lipid having an effective pKa different from (e.g., higher than) the first effective pKa of the first cationic lipid. The lipid nanoparticles can contain 40 to 60 mole percent of a cationic lipid, a neutral lipid, a steroid, a polymer-conjugated lipid, and a therapeutic agent, e.g., a nucleic acid described herein encapsulated within or bound to the lipid nanoparticles. In some embodiments, the nucleic acid is formulated simultaneously with the cationic lipid. The nucleic acid can be adsorbed on the surface of an LNP, e.g., an LNP containing a cationic lipid. In some embodiments, the nucleic acid can be encapsulated within an LNP, e.g., an LNP containing a cationic lipid. In some embodiments, the lipid nanoparticles can contain, for example, a targeting moiety coated with a targeting agent. In embodiments, the LNP formulation is biodegradable. In some embodiments, one or more of the lipids described herein, e.g., lipid nanoparticles containing formulas (i), (ii), (ii), (vii), and / or (ix), encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, or 100% of the molecular TDSC.

[0350] Exemplary ionizable lipids that can be used in lipid nanoparticle formulations include, but are not limited to, those listed in Table 1 of WO 2019 / 051289 pamphlet (incorporated herein by reference). Additional exemplary lipids include, but are not limited to, one or more of the following formulas: X of US Patent Application Publication No. 2016 / 0311759; I of US Patent Application Publication No. 20150376115 or US Patent Application Publication No. 2016 / 0376224; I, II, or III of US Patent Application Publication No. 20160151284; I, IA, II, or IIA of US Patent Application Publication No. 20170210967; I-c of US Patent Application Publication No. 20150140070; A of US Patent Application Publication No. 2013 / 0178541; I of US Patent Application Publication No. 2013 / 0303587 or US Patent Application Publication No. 2013 / 0123338; I of US Patent Application Publication No. 2015 / 0141678; II, III, IV, or V of US Patent Application Publication No. 2015 / 0239926; I of US Patent Application Publication No. 2017 / 0119904; I or II of WO 2017 / 117528 pamphlet; A of US Patent Application Publication No. 2012 / 0149894; A of US Patent Application Publication No. 2015 / 0057373; A of WO 2013 / 116126 pamphlet; A of US Patent Application Publication No. 2013 / 0090372; A of US Patent Application Publication No. 2013 / 0274523; A of US Patent Application Publication No. 2013 / 0274504; A of US Patent Application Publication No. 2013 / 0053572; A of WO 2013 / 016058 pamphlet; A of WO 2012 / 162210 pamphlet; I of US Patent Application Publication No. 2008 / 042973; I, II, III, or IV of US Patent Application Publication No. 2012 / 01287670; I or II of US Patent Application Publication No. 2014 / 0200257; I, II, or III of US Patent Application Publication No. 2015 / 0203446; I or III of US Patent Application Publication No. 2015 / 0005363;I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID, or III - XXIV of U.S. Patent Application Publication No. 2014 / 0308304; of U.S. Patent Application Publication No. 2013 / 0338210; I, II, III, or IV of International Publication No. 2009 / 132131 Pamphlet; A of U.S. Patent Application Publication No. 2012 / 01011478; I or XXXV of U.S. Patent Application Publication No. 2012 / 0027796; XIV or XVII of U.S. Patent Application Publication No. 2012 / 0058144; of U.S. Patent Application Publication No. 2013 / 0323269; I of U.S. Patent Application Publication No. 2011 / 0117125; I, II, or III of U.S. Patent Application Publication No. 2011 / 0256175; I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII of U.S. Patent Application Publication No. 2012 / 0202871; I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV, or XVI of U.S. Patent Application Publication No. 2011 / 0076335; I or II of U.S. Patent Application Publication No. 2006 / 008378; I of U.S. Patent Application Publication No. 2013 / 0123338; I or X - A - Y - Z of U.S. Patent Application Publication No. 2015 / 0064242; XVI, XVII, or XVIII of U.S. Patent Application Publication No. 2013 / 0022649; I, II, or III of U.S. Patent Application Publication No. 2013 / 0116307; I, II, or III of U.S. Patent Application Publication No. 2013 / 0116307; I or II of U.S. Patent Application Publication No. 2010 / 0062967; I - X of U.S. Patent Application Publication No. 2013 / 0189351; I of U.S. Patent Application Publication No. 2014 / 0039032; V of U.S. Patent Application Publication No. 2018 / 0028664; I of U.S. Patent Application Publication No. 2016 / 0317458; I of U.S. Patent Application Publication No. 2013 / 0195920; 5, 6, or 10 of U.S. Patent No. 10,221,127; III - 3 of International Publication No. 2018 / 081480 Pamphlet; I - 5 or I - 8 of International Publication No. 2020 / 081938 Pamphlet; 18 or 25 of U.S. Patent No. 9,867,888; A of U.S. Patent Application Publication No. 2019 / 0136231;II of WO 2020 / 219876 Pamphlet; 1 of US 2012 / 0027803 Patent Application Publication; OF-02 of US 2019 / 0240349 Patent Application Publication; 23 of US 10,086,013 Patent; cKK-E12 / A6 of Miao et al (2020); C12-200 of WO 2010 / 053572 Pamphlet; 7C1 of Dahlman et al (2017); 304-O13 or 503-O13 of Whitehead et al; TS-P4C2 of US 9,708,628 Patent; I of WO 2020 / 106946 Pamphlet; I of WO 2020 / 106946 Pamphlet are included.;

[0351] In some embodiments, the ionizable lipid is, for example, MC3(6Z,9Z,28Z,3lZ)-heptatriaconta-6,9,28,3l-tetraene-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA or MC3) as described in Example 9 of WO 2019051289A9 pamphlet (the whole is incorporated herein by reference). In some embodiments, the ionizable lipid is, for example, lipid ATX-002 as described in Example 10 of WO 2019051289A9 pamphlet (the whole is incorporated herein by reference). In some embodiments, the ionizable lipid is, for example, (l3Z,l6Z)-A,A-dimethyl-3-nonyldocosa-l3,l6-diene-1-amine (Compound 32) as described in Example 11 of WO 2019051289A9 pamphlet (the whole is incorporated herein by reference). In some embodiments, the ionizable lipid is, for example, Compound 6 or Compound 22 as described in Example 12 of WO 2019051289A9 pamphlet (the whole is incorporated herein by reference).

[0352] Exemplary non-cationic lipids include, but are not limited to, distearoyl-sn-glycero-phosphoethanolamine, distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylcholine (DOPC), dipalmitoyl phosphatidylcholine (DPPC), dioleoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyl oleoyl phosphatidylcholine (POPC), palmitoyl oleoyl phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanolamine (such as 16-O-monomethyl PE), dimethyl-phosphatidylethanolamine (such as 16-O-dimethyl PE), l8-l-trans PE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soy phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoyl phosphatidylserine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), distearoyl phosphatidylglycerol (DSPG), dieleoyl phosphatidylcholine (DEPC), palmitoyl oleoyl phosphatidylglycerol (POPG), dielaidoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysophosphatidylcholine, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetyl phosphate, lysophosphatidylcholine, dilinoleoyl phosphatidylcholine, or mixtures thereof.It is understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids can also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having a C10-C24 carbon chain, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Additional exemplary lipids include, but are not limited to, those described in Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386 (incorporated herein by reference) in certain embodiments. Such lipids include, in some embodiments, plant lipids that have been found to improve liver transfection with mRNA (e.g., DGTS).

[0353] Other examples of non-cationic lipids suitable for use in lipid nanoparticles include, but are not limited to, non-phospholipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine lauryl sulfate, alkyl-aryl sulfate polyethoxylated fatty acid amide, dioctadecyldimethylammonium bromide, ceramide, sphingomyelin, and the like. Other non-cationic lipids are described in WO 2017 / 099823 pamphlet or US Patent Application Publication No. 2018 / 0028664 (the entire contents of which are incorporated herein by reference).

[0354] In some embodiments, the non-cationic lipid is oleic acid or a compound of Formula I, II, or IV of US Patent Application Publication No. 2018 / 0028664 (incorporated herein by reference in its entirety). The non-cationic lipid can, for example, account for 0 to 30% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, the non-cationic lipid content is 5 to 20% (mol) or 10 to 15% (mol) of the total lipids present in the lipid nanoparticles. In embodiments, the molar ratio of ionizable lipid to neutral lipid is in the range of about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).

[0355] In some embodiments, the lipid nanoparticles do not contain any phospholipids.

[0356] In some aspects, the lipid nanoparticles can further comprise a component such as a sterol to provide membrane integrity. One exemplary sterol that can be used in the lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs such as 5a-cholestanol, 53-coprostanol, cholesteryl-(2 , -hydroxy)-ethyl ether, cholesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogs such as 5a-cholestane, cholestenone, 5a-cholestanone, 5p-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog such as cholesteryl-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT Publication No. WO 2009 / 127060 and US Patent Application Publication No. 2010 / 0130588, which are incorporated herein by reference in their entireties, respectively.

[0357] In some embodiments, components that provide membrane integrity, such as sterols, can account for 0 to 50% (mol) (e.g., 0 to 10%, 10 to 20%, 20 to 30%, 30 to 40%, or 40 to 50%) of the total lipids present in the lipid nanoparticles. In some embodiments, such components are 20 to 50% (mol) 30 to 40% (mol) of the total lipid content of the lipid nanoparticles.

[0358] In some embodiments, the lipid nanoparticles can include polyethylene glycol (PEG) or conjugated lipid molecules. Generally, these are used to inhibit aggregation of the lipid nanoparticles and / or to provide steric stabilization. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, e.g., a (methoxypolyethylene glycol) conjugated lipid.

[0359] Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (such as l-(monomethoxy-polyethylene glycol)-2,3-dimyristoyl glycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), pegylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (such as 4-O-(2’,3’-di(tetradecanoyloxy)propyl-l-O-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG)), PEG dialkoxypropyl carbam, N-(carbonyl-methoxypolyethylene glycol 2000)-l,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof. Additional exemplary PEG-lipid conjugates are described, for example, in U.S. Patent No. 5,885,613, U.S. Patent No. 6,287,591, U.S. Patent Application Publication No. 2003 / 0077829, U.S. Patent Application Publication No. 2003 / 0077829, U.S. Patent Application Publication No. 2005 / 0175682, U.S. Patent Application Publication No. 2008 / 0020058, U.S. Patent Application Publication No. 2011 / 0117125, U.S. Patent Application Publication No. 2010 / 0130588, U.S. Patent Application Publication No. 2016 / 0376224, U.S. Patent Application Publication No. 2017 / 0119904, and U.S. Patent Application No. 099823 (all of which are hereby incorporated by reference in their entirety). In some embodiments, the PEG-lipid is a compound of Formula III, III-a-I, III-a-2, III-b-1, III-b-2, or V of U.S. Patent Application Publication No. 2018 / 0028664 (incorporated herein by reference in its entirety). In some embodiments, the PEG-lipid is of Formula II of U.S. Patent Application Publication No. 20150376115 or U.S. Patent Application Publication No. 2016 / 0376224 (both of which are hereby incorporated by reference in their entirety).In some embodiments, the PEG-DAA conjugate can be, for example, PEG-dilauryl oxypropyl, PEG-dimyristyl oxypropyl, PEG-dipalmityl oxypropyl, or PEG-distearyl oxypropyl. The PEG-lipids can be PEG-DMG, PEG-dilauryl glycerol, PEG-dipalmitoyl glycerol, PEG-distearyl glycerol, PEG-dilauryl glycamide, PEG-dimyristyl glycamide, PEG-dipalmitoyl glycamide, PEG-distearyl glycamide, PEG-cholesterol (l-[8’-(cholesta-5-en-3[β]-oxy) carboxamide-3’,6’-dioxaoctanyl] carbamoyl-[ω]-methyl-poly(ethylene glycol)), PEG-DMB (3,4-ditetradecyloxybenzyl-[ω]-methyl-poly(ethylene glycol) ether), and one or more of 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipids include PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipids are.

Chemical Structure

[0360] In some embodiments, lipids conjugated with molecules other than PEG can also be used in place of PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipids (GPL) conjugates can be used in place of or in addition to PEG-lipids.

[0361] Exemplary conjugate lipids, namely, PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates and cationic polymer lipids, are described in the PCT and LIS patent applications listed in Table 2 of WO 2019 / 051289 A9 (all of which are hereby incorporated by reference in their entirety).

[0362] In some embodiments, the PEG or conjugated lipid may account for 0 to 20% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, the PEG or conjugated lipid content is 0.5 to 10% or 2 to 5% (mol) of the total lipids present in the lipid nanoparticles. The molar ratios of the ionizable lipid, non-cationic lipid, sterol, and PEG / conjugated lipid can be varied as needed. For example, the lipid particles can include 30 to 70% ionizable lipid per mole or total weight of the composition, 0 to 60% cholesterol per mole or total weight of the composition, 0 to 30% non-cationic lipid per mole or total weight of the composition, and 1 to 10% conjugated lipid per mole or total weight of the composition. Preferably, the composition includes 30 to 40% ionizable lipid per mole or total weight of the composition, 40 to 50% cholesterol per mole or total weight of the composition, and 10 to 20% non-cationic lipid per mole or total weight of the composition. In some other embodiments, the composition is 50 to 75% ionizable lipid per mole or total weight of the composition, 20 to 40% cholesterol per mole or total weight of the composition, and 5 to 10% non-cationic lipid per mole or total weight of the composition and 1 to 10% conjugated lipid per mole or total weight of the composition. The composition can contain 60 to 70% ionizable lipid per mole or total weight of the composition, 25 to 35% cholesterol per mole or total weight of the composition, and 5 to 10% non-cationic lipid per mole or total weight of the composition. The composition can also contain up to 90% ionizable lipid per mole or total weight of the composition and 2 to 15% non-cationic lipid per mole or total weight of the composition.The formulation may also be, for example, 8-30% ionizable lipid, 5-30% non-cationic lipid, and 0-20% cholesterol per mole or total weight of the composition; 4-25% ionizable lipid, 4-25% non-cationic lipid, 2-25% cholesterol, 10-35% conjugate lipid, and 5% cholesterol per mole or total weight of the composition; or 2-30% ionizable lipid, 2-30% non-cationic lipid, 1-15% cholesterol, 2-35% conjugate lipid, and 1-20% cholesterol per mole or total weight of the composition; or a lipid nanoparticle formulation comprising up to 90% ionizable lipid per mole or total weight of the composition and 2-10% non-cationic lipid, or 100% cationic lipid per mole or total weight of the composition. In some embodiments, the lipid particle formulation comprises an ionizable lipid, a phospholipid, cholesterol, and a PEGylated lipid in a molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation comprises an ionizable lipid, cholesterol, and a PEGylated lipid in a molar ratio of 60:38.5:1.5.

[0363] In some embodiments, the lipid particles comprise an ionizable lipid, a non-cationic lipid (e.g., a phospholipid), a sterol (e.g., cholesterol), and a PEGylated lipid, wherein the molar ratio of the lipids is in the range of 20-70 mole percent for the ionizable lipid, with a target of 40-60, in the range of 0-30 mole percent for the non-cationic lipid, with a target of 0-15, in the range of 20-70 mole percent for the sterol, with a target of 30-50, and in the range of 1-6 mole percent for the PEGylated lipid, with a target of 2-5.

[0364] In some embodiments, the lipid particles comprise ionizable lipid / non-cationic lipid / sterol / conjugate lipid in a molar ratio of 50:10:38.5:1.5.

[0365] In one aspect, the present disclosure provides a lipid nanoparticle formulation comprising phospholipids, lecithin, phosphatidylcholine, and phosphatidylethanolamine.

[0366] In some embodiments, one or more additional compounds may also be included. These compounds may be administered separately, or the additional compounds may be included in the lipid nanoparticles of the present invention. In other words, the lipid nanoparticles may contain other compounds in addition to the nucleic acid or at least a second nucleic acid different from the first nucleic acid. Without limitation, other additional compounds may be selected from the group consisting of small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogs and their derivatives, peptidomimetics, nucleic acids, nucleic acid analogs and their derivatives, extracts made from biological materials, or any combination thereof.

[0367] In some embodiments, the LNPs are targeted to specific tissues by the addition of targeting domains. For example, a biological ligand can be presented on the surface of the LNP to facilitate interaction with cells presenting the cognate receptor, thereby driving binding to the receptor and cargo delivery to the tissue where the cells express the receptor. In some embodiments, the biological ligand can be a ligand that drives delivery to the liver; for example, an LNP presenting GalNAc results in delivery of nucleic acid cargo to hepatocytes presenting the asialoglycoprotein receptor (ASGPR). The paper by Akinc et al., Mol Ther 18(7):1357-1364 (2010), teaches the conjugation of a trivalent GalNAc ligand to a PEG-lipid (GalNAc-PEG-DSG) to obtain ASGPR-dependent LNPs for observable LNP cargo effects (see, e.g., FIG. 6 of Akinc et al. 2010 above).For example, folate, transferrin, or other ligand-presenting LNP formulations incorporating antibodies are described in International Publication No. WO 2017 / 223135 (incorporated herein by reference in its entirety), and further in the references used therein, namely, Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197-206; Musacchio and Torchilin, Front Biosci. 2011 16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309-319; Akinc et al., Mol Ther. 2010 18:1357-1364; Srinivasan et al., Methods Mol Biol. 2012 820:105-116; Ben-Arie et al., Methods Mol Biol. 2012 757:497-507; Peer 2010 J Control Release. 20:63-68; Peer et al., Proc Natl Acad Sci U S A. 2007 104:4095-4100; Kim et al., Methods Mol Biol. 2011 721:339-353; Subramanya et al., Mol Ther. 2010 18:2028-2037; Song et al., Nat Biotechnol. 2005 23:709-717; Peer et al., Science. 2008 319:627-630; and Peer and Lieberman, Gene Ther. 2011 18:1127-1133.

[0368] In some embodiments, the LNP is selected for tissue-specific activity by the addition of a Selective ORgan Targeting (SORT) molecule to formulations containing conventional components such as ionizable cationic lipids, amphiphilic phospholipids, cholesterol, and poly(ethylene glycol) (PEG) lipids. The teachings of Cheng et al. Nat Nanotechnol 15(4):313-320 (2020) demonstrate that the addition of an auxiliary "SORT" component precisely modifies the in vivo RNA delivery profile and mediates tissue-specific (e.g., lung, liver, spleen) gene delivery and editing depending on the percentage and biophysical properties of the SORT molecule.

[0369] In some embodiments, the LNP comprises a biodegradable, ionizable lipid. In some embodiments, the LNP comprises (9Z,12Z)-3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate (also referred to as 3-(((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate)) or another ionizable lipid. See, for example, International Publication No. WO 2019 / 067992, International Publication No. WO 2017 / 173054, International Publication No. WO 2015 / 095340, and International Publication No. WO 2014 / 136086, and the lipids of the references provided therein. In some embodiments, the terms cationic and ionizable with respect to the LNP lipid are synonymous, e.g., an ionizable lipid is cationic depending on the pH.

[0370] In some embodiments, the average LNP diameter of the LNP formulation can be, for example, from several tens of nanometers to several hundreds of nanometers as measured by dynamic light scattering (DLS). In some embodiments, the average LNP diameter of the LNP formulation is from about 40 nm to about 150 nm, for example, about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average LNP diameter of the LNP formulation is from about 50 nm to about 100 nm, from about 50 nm to about 90 nm, from about 50 nm to about 80 nm, from about 50 nm to about 70 nm, from about 50 nm to about 60 nm, from about 60 nm to about 100 nm, from about 60 nm to about 90 nm, from about 60 nm to about 80 nm, from about 60 nm to about 70 nm, from about 70 nm to about 100 nm, from about 70 nm to about 90 nm, from about 70 nm to about 80 nm, from about 80 nm to about 100 nm, from about 80 nm to about 90 nm, or from about 90 nm to about 100 nm. In some embodiments, the average LNP diameter of the LNP formulation can be from about 70 nm to about 100 nm. In certain embodiments, the average LNP diameter of the LNP formulation can be about 80 nm. In some embodiments, the average LNP diameter of the LNP formulation can be about 100 nm. In some embodiments, the average LNP diameter of the LNP formulation is in the range of about 1 mm to about 500 mm, about 5 mm to about 200 mm, about 10 mm to about 100 mm, about 20 mm to about 80 mm, about 25 mm to about 60 mm, about 30 mm to about 55 mm, about 35 mm to about 50 mm, or about 38 mm to about 42 mm.

[0371] LNP can be relatively homogeneous in some cases. The polydispersity index can be used to indicate the homogeneity of the LNP, e.g., the particle size distribution of the lipid nanoparticles. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The LNP can have a polydispersity index of about 0 to about 0.25, e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the LNP can be about 0.10 to about 0.20.

[0372] The zeta potential of the LNP can be used to indicate the electrokinetic potential of the composition. In some embodiments, the zeta potential can represent the surface charge of the LNP. Lipid nanoparticles with a relatively low positive or negative charge are generally desirable because more highly charged species can interact unnecessarily with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the LNP can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0373] The efficiency of encapsulation of the protein and / or nucleic acid represents the amount of protein and / or nucleic acid encapsulated in the LNP or bound to the LNP in another form after preparation, compared to the initial amount provided. High (e.g., nearly 100%) encapsulation efficiency is desirable. Encapsulation efficiency can be measured, for example, by comparing the amount of protein and / or nucleic acid in a solution containing lipid nanoparticles before and after decomposing the lipid nanoparticles with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid in solution. Fluorescence can be used to measure the amount of free protein and / or nucleic acid in solution. For the lipid nanoparticles described herein, the encapsulation efficiency of the protein and / or nucleic acid can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In some embodiments, the encapsulation efficiency can be at least 90%. In some embodiments, the encapsulation efficiency can be at least 95%.

[0374] The LNP can optionally include one or more coatings. In some embodiments, the LNP can be formulated into a capsule, film, or tablet having a coating. The capsule, film, or tablet containing the composition described herein can have any useful size, tensile strength, hardness, or density.

[0375] Additional exemplary lipids, formulations, methods, and characterization of LNP are taught by International Publication No. WO 2020 / 061457 (incorporated herein by reference in its entirety). See also Hou et al. Lipid nanoparticles for mRNA delivery. Nat Rev Mater (2021). https: / / doi.org / 10.1038 / s41578-021-00358-0.

[0376] In some embodiments, in vitro or ex vivo cell lipofection is performed using Lipofectamine MessengerMax (Thermo Fisher) or TransIT-mRNA Transfection Reagent (Mirus Bio). In certain embodiments, the LNPs are formulated using the GenVoy_ILM ionizable lipid mixture (Precision NanoSystems). In certain embodiments, the LNPs are formulated using 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA) or dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA or MC3), and the formulation and in vivo use thereof are taught in Jayaraman et al. Angew Chem Int Ed Engl 51(34):8529-8533 (2012) (which is incorporated herein by reference in its entirety).

[0377] LNP formulations optimized for delivery of CRISPR-Cas systems, such as Cas9-gRNA RNPs, gRNAs, Cas9 mRNAs, are described in International Publication No. WO 2019 / 067992 and International Publication No. WO 2019 / 067910 (both incorporated by reference).

[0378] Additional specific LNP formulations useful for nucleic acid delivery are described in U.S. Patent No. 8,158,601 and U.S. Patent No. 8,168,775 (both incorporated by reference), which include the formulations used in patisiran, sold under the name ONPATTRO.

[0379] Exemplary dosages of DNA described herein with the LNPs can include about 0.1, 0.25, 0.3, 0.5, 1, 2, 3, 4, 5, 6, 8, 10, or 100 mg / kg (DNA).

[0380] The following embodiments are contemplated: A. Lipid nanoparticles (LNPs) comprising the TDSC constructs, sequences, or compositions described herein. B. The LNP according to embodiment A, comprising a cationic lipid. C. The cationic lipid is

Chemical formula

[0381] In embodiments, the LNP formulations comprising the TDSC described herein can be targeted to a desired cell type by surface decoration with a targeting effector. Such targeting effectors include, for example, cell-specific receptor ligands that bind to target cells; antibodies or other binding agents to target cells; centrin; cell-penetrating peptides; peptides that enable endosomal escape (e.g., GALA, KALA). For an overview, see, for example, Tables 1 and 2 of Tai & Gao. 2017. Adv Drug Deliv Rev. 110 - 111:157 - 168.

[0382] In embodiments, the LNP formulations comprising the TDSC described herein can be co-administered with an adjuvant, for example, co-delivered in the same formulation as the adjuvant.

[0383] Route of administration The TDSC described herein, or a nucleic acid encoding dsDNA, is introduced into cells, tissues or a subject by any suitable route.

[0384] Administration to target cells or tissues (e.g., ex vivo) can be performed by methods known in the art, such as transfection, e.g., transient or stable transfection using reagents (e.g., liposomes, calcium phosphate) or physical means (e.g., electroporation, gene gun, microinjection, microfluidic shearing, cell squeezing). Other methods are described, for example, in Rad et al. 2021. Adv. Mater. 33:2005363, which is incorporated herein by reference.

[0385] Administration to a subject, e.g., a mammalian subject, e.g., a human subject, can be by parenteral (e.g., intravenous, intramuscular, intraperitoneal, subcutaneous, or intracranial) routes; by topical administration, transdermal administration or transcutaneous administration. Other suitable routes include oral, rectal, transmucosal, intranasal, inhalation (e.g., via aerosol), oral (e.g., sublingual), intravaginal, intrathecal, intraocular, transdermal, intraendothelial, intrauterine (or intraovarian), intrapleural, intracerebral, intraarticular, topical, intralymphatic. Also included is direct tissue or organ injection (e.g., into the liver, eye, skeletal muscle, myocardium, diaphragm, muscle or brain).

[0386] Use The TDSC described herein, or the nucleic acid encoding dsDNA, can be used in therapeutic or medical applications for a subject, such as a human or non-human animal. The description of the pharmaceutical compositions provided herein mainly relates to pharmaceutical compositions suitable for administration to humans, but it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other animal. The subject can be any animal, such as a mammal, such as a human or non-human mammal. In embodiments, the subject is a vertebrate (e.g., a mammal, bird, fish, reptile, or amphibian). In embodiments, the subject is a human. In embodiments, the subject of the method is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., monkey, ape), ungulate (e.g., cow, buffalo, sheep, goat, pig, camel, llama, alpaca, deer, horse, donkey), carnivore (e.g., dog, cat), rodent (e.g., rat, mouse), or lagomorph (e.g., rabbit). In embodiments, the subject is a bird, such as a member of the order Galliformes (e.g., chicken, turkey, pheasant, quail) of the avian taxon, Anseriformes (e.g., duck, goose), Paleognathae (e.g., ostrich, emu), Columbiformes (e.g., pigeon, dove), or Psittaciformes (e.g., parrot). In embodiments, the subject is an invertebrate, such as an arthropod (e.g., insect, arachnid, crustacean), nematode, annelid, parasitic worm, or mollusk.

[0387] In some embodiments, the DNA described herein is provided at a dose of about 0.1 to 100 mg / kg of DNA.

[0388] In some embodiments, the TDSC described herein confers an effector biological effect, e.g., expression of a therapeutic polypeptide, on a host cell, tissue, or subject over a period of at least 2, 3, 4, 5, 6 days or 1 week; at least 8, 9, 10, 12, 14 days or 2 weeks; at least 16, 18, 20 days or 3 weeks; at least 22, 24, 25, 27, 28 days or 1 month; at least 2 months, 3 months, 4 months, 5 months, 6 months or more; 1 week to 6 months, 1 month to 6 months, 3 months to 6 months.

[0389] In some embodiments, the TDSC described herein confers an effector biological effect, e.g., expression of a therapeutic polypeptide, on a host cell, tissue, or subject over a period during which the host cell undergoes at least one cell division.

[0390] In embodiments, an effector, e.g., an effector described herein, can be delivered to a cell, tissue, or subject using the TDSC described herein.

[0391] In embodiments, the TDSC described herein can be used to modulate (e.g., increase or decrease) biological parameters in a cell, tissue, or subject. The biological parameter can be an increase or decrease in gene expression of a target gene in a target cell, tissue, or subject.

[0392] In embodiments, the TDSC described herein can be used to treat a cell, tissue, or subject in need thereof by administering the TDSC described herein to such a cell, tissue, or subject.

[0393] In embodiments, the TDSC delivers an effector to a cell selected from lymphocytes (e.g., T cells or monocytes), cancer cells (e.g., osteosarcoma cells), HEK293 cells, hepatocytes, or epidermal cells (e.g., keratinocytes).

Examples

[0394] Example 1: Design and Assembly of a Plasmid Template for Linear TDSC This example describes how to create a plasmid template for a chemically modified linear TDSC construct. In this example, the construct template is designed with the following specific sequence components: · Promoter Ef1a:

Chem.

Chem.

[0395] Optionally, this construct may also include one or both of an NTS or a maintenance sequence, such as · NTS: SV40 enhancer: 5’-cccaagaagaagaggaaagtc-3’ (SEQ ID NO: 1) · Maintenance sequence: human interferon-β MAR 5’tataattcactggaatttttttgtgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata3’ (SEQ ID NO: 121) One or both of these. · PolyA site:

Chem.

[0396] The plasmid template is designed with these elements using standard DNA design operation software. Assembly is performed by Golden Gate Assembly according to the published protocol and a commercially available kit (Marillonnet & Gruetzner. 2020. Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline. Current Protocols in Molecular Biology. 130: e115; Golden Gate Assembly Protocol for Using NEB Golden Gate Assembly Mix (E1600) (New England Biolabs)). The Golden Gate assembly of the designed construct is performed using a series of primers 120 bp in length that include the first 30 bp matching the relevant adjacent fragment, the next 60 bp encoding the new sequence, and the last 30 bp annealing to the target sequence. The fragments are assembled into the final construct design (NEB Golden Gate Assembly Kit), and the sequence is confirmed by Sanger Sequencing (Sigma Aldrich) according to the manufacturer's protocol.

[0397] Example 2: Conversion from Plasmid DNA to Unmodified TDSC This example describes the creation of TDSC containing linear dsDNA without chemically modified nucleotides. In this example, the linear dsDNA is made from the plasmid of Example 1 using PrimeSTAR® Max DNA Polymerase according to the manufacturer's protocol (Takara, R045Q). The dsDNA is purified using NucleoSpin® Gel and PCR Clean-up according to the manufacturer's protocol (Takara, 740609), and the concentration of the dsDNA is determined by Qubit™ 1× dsDNA Broad Range according to the manufacturer's protocol (Thermo Fisher, Q33265).

[0398] Example 3: Conversion from plasmid DNA to TDSC with only the sense strand or the antisense strand chemically modified This example describes the generation of TDSC containing linear dsDNA with only chemical modification to the sense strand or the antisense strand. The plasmid construct of Example 1 is converted to linear ssDNA according to the method of Minev et al., 2019, Rapid in vitro production of single stranded DNA, Nucleic Acids Research, Volume 47, Issue 22: 11956 - 11962 (which is incorporated herein by reference). Briefly, a dNTP mix for PCR to create a chemically modified strand is created by mixing the chemical modification nucleotide 5 - methylcytosine (5mC) with standard adenine (dATP), guanine (dGTP), and thymine (dTTP). PCR with a forward primer carrying a methanol - reactive polymer results in an amplicon tagged to allow selective precipitation of the chemically modified strand under denaturing conditions. The concentration of linear ssDNA, which is either the sense strand or the antisense strand, is determined using a Qubit™ ssDNA assay kit according to the manufacturer's protocol (Thermo Fisher, Q10212).

[0399] The complementary strand is created by incubating the ssDNA with a PCR mix containing the corresponding primer and unmodified nucleotides. This dsDNA is purified using NucleoSpin® Gel and PCR Clean - up according to the manufacturer's protocol (Takara, 740609), and the concentration of the dsDNA is determined using Qubit™ 1×dsDNA Broad Range according to the manufacturer's protocol (Thermo Fisher, Q33265).

[0400] Example 4: Conversion from plasmid DNA to TDSC with both the sense strand and the antisense strand chemically modified This example describes the creation of a TDSC containing linear dsDNA with chemically modified nucleotides in both the sense and antisense strands. The plasmid construct of Example 1 is converted into chemically modified linear dsDNA by mixing 5-methylcytosine (5mC) with dATP, dGTP, and dTTP to create a dNTP mix for PCR. The dNTP mix is used according to the manufacturer's protocol with PrimeSTAR® Max DNA Polymerase (Takara, R045Q). NucleoSpin® Gel and PCR Clean-up are used to purify the dsDNA according to the manufacturer's protocol (Takara, 740609), and the concentration of the dsDNA is determined according to the manufacturer's protocol using Qubit™ 1× dsDNA Broad Range (Thermo Fisher, Q33265).

[0401] Example 5: Addition of Exonuclease-Resistant DNA End Forms Containing Chemically Modified Nucleotides to the Ends of TDSCs This example describes the creation of a TDSC containing the linear dsDNA of Examples 2-4 with chemically modified nucleotides at both ends of the construct.

[0402] A custom adapter having the following sequence is designed to contain chemically modified nucleotides:

Chemical formula

[0403] Purify the dsDNA using NucleoSpin® Gel and PCR Clean-up according to the manufacturer's protocol (Takara, 740609), and determine the concentration of the dsDNA using Qubit® 1× dsDNA Broad Range according to the manufacturer's protocol (Thermo Fisher, Q33265).

[0404] Example 6: Addition of an Exonuclease-Resistant DNA End Form Containing a Loop Structure to the Ends of TDSCs This example describes the creation of a TDSC containing the linear dsDNA of Examples 2 to 4 with a loop structure at each end of the construct.

[0405] Design a custom adapter with the following sequence to contain chemically modified nucleotides:

Chemical formula

[0406] Purify the dsDNA using NucleoSpin® Gel and PCR Clean-up according to the manufacturer's protocol (Takara, 740609), and determine the concentration of the dsDNA using Qubit® 1× dsDNA Broad Range according to the manufacturer's protocol (Thermo Fisher, Q33265).

[0407] Example 7: Addition of an Exonuclease-Resistant DNA End Form Containing a Y-Type Adapter to the Ends of a TDSC This example describes the creation of a TDSC containing the linear dsDNA of any of Examples 2 to 4 with a Y-type adapter at each end of the construct.

[0408] Design a custom adapter with the following array to include chemically modified nucleotides:

Chemical formula

[0409] Purify the dsDNA using NucleoSpin® Gel and PCR Clean-up according to the manufacturer's protocol (Takara, 740609), and determine the concentration of the dsDNA using Qubit® 1× dsDNA Broad Range according to the manufacturer's protocol (Thermo Fisher, Q33265).

[0410] Example 8: Formulation of TDSC with LNP This example describes a method of formulating constructs prepared as described in the previous example using lipid nanoparticles (LNP).

[0411] The nucleic acid construct is combined with a lipid component by a microfluidic device according to the method of Chen et al. 2012. J Am Chem Soc. Volume 134, Issue 16: 6948 - 6951. Briefly, the microfluidic device is fabricated in polydimethylsiloxane (PDMS) according to standard lithography procedures (McDonald & Whitesides. 2002. Accounts Chem Res Volume 35, Issue 7: 491 - 499). Typically, a lipid component containing a cationic lipid, cholesterol, helper lipid, polyethylene glycol - modified lipid, and (optionally) a lipid that facilitates target - moiety conjugation is combined and solubilized in 90% ethanol. The nucleic acid construct is dissolved in buffer. The nucleic acid solution, lipid solution, and phosphate - buffered saline (PBS) are injected into the microfluidic device. The newly prepared LNP is dialyzed against PBS buffer using a membrane with a 3.5 kD MWCO to remove ethanol and exchange buffer.

[0412] The LNP is characterized in terms of effective diameter, polydispersity, and zeta potential using dynamic light scattering (DLS) (ZetaPALS, Brookhaven Instruments, NY, 15 mW laser, incident beam 676 nm); and the total nucleic acid concentration is determined by lysing the particles and using the Quant - iT™ 1×dsDNA assay kit, high - sensitivity (HS) and broad - range (BR) according to the manufacturer's protocol (ThermoFisher Scientific, Q33232).

[0413] Example 9: In Vitro Evaluation of Expression and Innate Immune Response in Cells This example describes how to test gene expression and how to determine the effect of TDSC on the innate immune response of cultured cells.

[0414] Prepare an experimental TDSC construct as in Examples 2-7 above. Administer the construct and the control at multiple concentrations by electroporation to cells selected from HEK, keratinocytes, macrophages, T cells, and epithelial cells. A run of untreated control samples may be performed in parallel. After electroporation, transfer the cells to the final culture vessel. Administer the construct formulated with LNP directly to the cells in the well plate.

[0415] To determine the expression of the construct encoding the fluorescent reporter mCherry, the cells are first washed with PBS before flow cytometry analysis. All flow cytometry is performed on a MACSQuant VYB from Miltenyi. For detection of the mCherry signal, a yellow laser (wavelength 561 nm) is used for excitation and an emission filter of 615 / 620 nm is used. 20,000 events are recorded for each sample and the data are analyzed using Flowjo V.9.0 software. The cells are first gated in the FSC-A and SSC-A plots to remove cell debris. The population is further plotted in the FSC-A and FSC-H plots to surround the single cell population. Finally, a bivariate plot between fluorescent signal-expressing cells and non-expressing cells is used to determine the percentage of expressing cells. The distribution of expressing cells is used to determine the level of expression within each cell. Expression analysis is performed at multiple time points.

[0416] As described in Jakobsen et al. 2013. Proc Natl Acad Sci USA Volume 110, Issue 48: E4571-80, qPCR is performed in cells to determine the RNA levels of IFN-β in test cells. Briefly, the probe-prime sets used in qPCR are human IFN-β (ThermoFisher, Hs01077958_s1) and β-actin (ThermoFisher, Hs00357333_g1). The analysis is performed using a pre-made Taqman assay and RNA-to-Ct one step kit (Applied Biosystems). qPCR is performed on an MX3005 system (Stratagene). RNA expression is normalized against β-actin and the relevant untreated controls. Data are presented as mean ± SEM from biological replicates.

[0417] ELISA is performed in cell supernatants according to the manufacturer's protocol to determine the secretion levels of IFN-β.

[0418] Example 10. Determination of exonuclease resistance for TDSCs containing closed ends This example describes how to test whether TDSCs containing closed ends (e.g., linear dsDNA constructs ligated with adapters) exhibit resistance to exonuclease III (M0206, New England Biolabs Inc.). The TDSCs are tested next to a non-nuclease control. The non-nuclease control contains DNA of the same sequence as the TDSC of interest, except that it has undergone an adapter ligation protocol used to add exonuclease-resistant DNA end forms to the TDSC, but without adding adapter oligonucleotides to the mixture. Add 1 μL of exonuclease III (starting concentration of 100 units / μL) per 5 μg of DNA in 50 μL. Mix the tubes well and spin down. Run a 1-hour run at 37 °C in a thermocycler for these tubes and heat inactivate at 70 °C for 30 minutes.

[0419] The sample is purified using a Nucleospin® gel and PCR clean-up kit (Catalog No. 740609, Macherey-Nagel) with a vacuum manifold according to the manufacturer's protocol. Briefly, the elution buffer is warmed to 70 °C. Two volumes of NTI binding buffer are added to one volume of Exo III-treated DNA. The sample is mixed until uniformly distributed and left at room temperature for 5 minutes. The column on the vacuum manifold is fixed, the valve is opened, and the vacuum is turned on. 375 μL of DNA-NTI mix is added to the 2× column and passed completely through each column. 700 μL of NTC wash buffer is added twice. The column is removed from the vacuum manifold and placed into a collection tube. The assembly is centrifuged at 11,000×g for 1 minute. The column is placed into a new low-binding microcentrifuge tube, 25 μL of pre-warmed buffer is added, and this assembly is incubated at 70 °C for 5 minutes. The assembly is centrifuged at 11,000×g for 1 minute. The second incubation and elution steps are repeated. The collected DNA is quantified using a dsDNA BR Qubit (Q32850, Thermo Fisher Scientific) with a Qubit 4 fluorometer (Q33226, Thermo Fisher Scientific) according to the manufacturer's protocol.

[0420] Load the sample into individual wells of an E-Gel EX, 1% agarose gel (G402021, Thermo Fisher Scientific) at a DNA amount of 16 ng per well. The ladder (10488090, Thermo Fisher Scientific) is loaded at 2 μl into the leftmost lane of the gel. The gel run is performed on an E-Gel Power Snap electrophoresis system according to the manufacturer's protocol (G8100, G8200, Thermo Fisher Scientific). After the gel run, exonuclease-resistant TDSC is visible at the molecular weight corresponding to the full-length DNA + closed adapter sequence. TDSC will be considered exonuclease-resistant in this assay if at least 95% of the products appearing in the lane on the gel correspond to full-length TDSC.

[0421] Example 11. Determination of exonuclease resistance for TDSC containing open ends (e.g., two open ends) This example describes how to test whether a TDSC containing open ends (e.g., a linear dsDNA construct ligated with an adapter) exhibits resistance to exonuclease III (M0206, New England Biolabs Inc.). The TDSC is tested next to a non-nuclease control. The non-nuclease control contains DNA of the same sequence as the TDSC of interest, except that it has undergone an adapter ligation protocol that is used to add an exonuclease-resistant DNA end form to the TDSC, but does not add adapter oligonucleotides to the mixture. Add 2 units of exonuclease III per 200 ng of DNA (10 ng / μl) in a 20 μl reaction. Mix the tubes well and spin down. Run these tubes in a thermocycler at 37 °C for 30 minutes.

[0422] Load the sample into individual wells of an E-Gel EX, 1% agarose gel (G402021, Thermo Fisher Scientific) at a DNA amount of 20 ng per well. The ladder (10488090, Thermo Fisher Scientific) is loaded at 2 μl into the leftmost lane of the gel. The gel run is performed using an E-Gel Power Snap electrophoresis system according to the manufacturer's protocol (G8100, G8200, Thermo Fisher Scientific). After the gel run, exonuclease-resistant TDSC can be seen at the molecular weight corresponding to the full-length DNA + closed adapter sequence. TDSC will be considered exonuclease-resistant in this assay if at least 95% of the products appearing in the lane in the gel correspond to full-length TDSC.

[0423] For four samples: a control (unmodified) TDSC designated "Ct"; a TDSC designated "6a" that contains six phosphorothioate bonds at each of the 5' and 3' termini of each strand (illustrated in Figure 7B); a TDSC designated "3a" that contains three phosphorothioate bonds at each of the 5' and 3' termini of each strand (illustrated in Figure 7C); and a TDSC designated "Ya" that contains the same Y-type adapter with six phosphorothioate bonds at each terminus at each end of each strand (illustrated in Figure 7D), the exonuclease III digestion protocol of this example was performed. As shown in Figure 7A, the control DNA "Ct" was digested, while the three TDSCs with phosphorothioate modifications showed resistance to exonuclease III digestion.

[0424] Example 12: Production of TDSC with Open Ends This example describes how to generate a TDSC containing an open-ended terminus (e.g., containing phosphorothioate bonds) using USER (M5505, New England BioLabs) and mung bean nuclease (M0250, New England BioLabs) treatment steps. This process starts with a proto-TDSC containing a closed-ended terminus. The proto-TDSC is then treated next with a non-nuclease control. The non-nuclease control contains DNA of the same sequence as the TDSC, except that it has undergone an adapter ligation protocol that is used to add exonuclease-resistant DNA termini to the TDSC, but does not add adapter oligonucleotides to the mixture.

[0425] These proto-TDSC samples are first processed through a step of confirming exonuclease III resistance as described in Example 10. 3 μL of USER enzyme is added to 5 μg of DNA from the purified sample from Example 10 in 100 μL. Removal of uracil located in the loop by USER treatment opens the closed-ended terminus and forms a Y-shaped adapter-like structure. The sample is incubated at 37 °C for 1 hour. 1 μL of mung bean nuclease (10 U / μL) is added to each tube. The sample is incubated at 30 °C for 30 minutes. The single-stranded DNA is degraded by the mung bean nuclease, resulting in blunt-ended TDSC.

[0426] The sample is purified using a Nucleospin® gel and PCR clean-up kit (740609, Macherey-Nagel) with a vacuum manifold according to the manufacturer's protocol. Briefly, the elution buffer is warmed to 70 °C. Two volumes of NTI binding buffer are added to one volume of DNA after USER / MBN treatment. The sample is mixed until uniformly distributed and left at room temperature for 5 minutes. The column on the vacuum manifold is fixed, the valve is opened, and the vacuum is turned on. The DNA-NTI mix is added to the column and allowed to pass completely through each column. 700 μL of NTC wash buffer is added twice. The column is removed from the vacuum manifold and placed in a collection tube. The assembly is centrifuged at 11,000 × g for 1 minute. The column is placed in a new low-binding tube, 25 μL of pre-warmed buffer is added, and the assembly is incubated at 70 °C for 5 minutes. The assembly is centrifuged at 11,000 × g for 1 minute. The second incubation and elution steps are repeated. The collected DNA is quantified using a dsDNA BR Qubit (Q32850, Thermo Fisher Scientific) with a Qubit 4 fluorometer (Q33226, Thermo Fisher Scientific) according to the manufacturer's protocol.

[0427] To confirm that the TDSC has been generated, the sample is loaded into individual wells of an E-Gel EX, 1% agarose gel (G402021, Thermo Fisher Scientific) at a DNA amount of 16 ng per well. The ladder (10488090, Thermo Fisher Scientific) is loaded at 2 μl into the leftmost lane of the gel. The gel run is performed using an E-Gel Power Snap electrophoresis system according to the manufacturer's protocol (G8100, G8200, Thermo Fisher Scientific). After the gel run, the TDSC can be seen at the molecular weight corresponding to the full-length DNA + adapter sequence.

[0428] Example 13: Production of TDSC Containing Y-Type Adapter This example describes how to generate a TDSC containing a Y - shaped adapter - terminated linear dsDNA construct using USER (M5505, New England BioLabs) to create an open - ended form. This process begins with a proto - TDSC containing closed ends. The proto - TDSC is next tested against a non - nuclease control. The non - nuclease control contains DNA of the same sequence as the TDSC, except that it has undergone an adapter ligation protocol that is used to add an exonuclease - resistant DNA end form to the TDSC, but does not have adapter oligonucleotides added to the mixture.

[0429] These proto - TDSC samples are first processed through a step to confirm exonuclease III resistance as described in Example 10. 3 μL of USER enzyme is added to 5 μg of DNA from the purified sample from Example 10 in 100 μL. The sample is incubated at 37 °C for 1 hour. Removal of uracil located in the loop by USER treatment opens the closed ends and forms a Y - shaped adapter, resulting in a TDSC containing a Y - shaped adapter end form.

[0430] The sample is purified using a Nucleospin® gel and PCR clean-up kit (740609, Macherey-Nagel) with a vacuum manifold according to the manufacturer's protocol. Briefly, the elution buffer is warmed to 70 °C. Two volumes of NTI binding buffer are added to one volume of DNA after USER / MBN treatment. The sample is mixed until uniformly distributed and left at room temperature for 5 minutes. The column on the vacuum manifold is fixed, the valve is opened, and the vacuum is turned on. The DNA-NTI mix is added to the column and allowed to pass completely through each column. 700 μL of NTC wash buffer is added twice. The column is removed from the vacuum manifold and placed in a collection tube. The assembly is centrifuged at 11,000 × g for 1 minute. The column is placed in a new low-binding tube, 25 μL of pre-warmed buffer is added, and this assembly is incubated at 70 °C for 5 minutes. The assembly is centrifuged at 11,000 × g for 1 minute. The second incubation and elution steps are repeated. The collected DNA is quantified using a dsDNA BR Qubit (Q32850, Thermo Fisher Scientific) with a Qubit 4 fluorometer (Q33226, Thermo Fisher Scientific) according to the manufacturer's protocol.

[0431] To verify that the final end form has been created, a small aliquot of USER-treated DNA is treated with 1 μL of exonuclease III per 5 μg of DNA in a 50 μL reaction. If the creation of the final end form is successful, the TDSC of the aliquot will be degraded by exonuclease III.

[0432] Load the sample into individual wells of an E-Gel EX, 1% agarose gel (G402021, Thermo Fisher Scientific) at a DNA amount of 16 ng per well. The ladder (10488090, Thermo Fisher Scientific) is loaded at 2 μl into the leftmost lane of the gel. The gel run is performed using an E-Gel Power Snap electrophoresis system according to the manufacturer's protocol (G8100, G8200, Thermo Fisher Scientific). After the gel run, the TDSC with the Y-type adapter added is at the molecular weight corresponding to the full-length DNA + adapter sequence, while the DNA form with the Y-type adapter added after exonuclease III treatment is not seen on the gel.

[0433] Example 14: Design and Assembly of Plasmid Templates for the Generation of Double-Stranded DNA (dsDNA) Molecules This example describes the generation of dsDNA molecules, for example, plasmid templates for TDSC. In this example, a construct template having the following specific sequence components was designed. · Promoter Ef1a:

Chemical formula

Chemical formula

[0434] Optional: · NTS: SV40 enhancer: 5’-cccaagaagaagaggaaagtc-3’ (SEQ ID NO: 1) · Maintenance sequence: human interferon-β MAR 5’tataattcactggaatttttttgtgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata3’(SEQ ID NO: 39) · Second strand motif: AAV2 wild-type ITR 5’aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg-3’(SEQ ID NO: 26)

[0435] Using standard DNA design operation software, plasmid templates were designed with these elements. After the design was completed, the plasmid was ordered from the supplier (GenScript) for use as a template in PCR amplification.

[0436] Example 15: Generation of TDSC with chemical modifications This example demonstrates the preparation of double-stranded DNA (dsDNA) molecules containing cytosine with chemical modifications, such as 5-formyl-2'-deoxycytosine (5-formylcytosine), for example, TDSC.

[0437] Plasmid DNA (10 ng / 50 ul PCR reaction) was used as a template for PCR amplification using KOD polymerase (710864, Sigma Aldrich) or KOD Xtreme (KODX) polymerase (719753, Sigma Aldrich). Other commercially available polymerases may also be used. The product version used was separated into its components rather than in master mix format to ensure an accurate ratio of modified nucleotides to standard dNTPs. The PCR reaction conditions for each enzyme included the following: a. For the KOD enzyme, MgSO at a final concentration of 2 mM 4 . b. 100 mM dNTP solution set (N0446, New England Biolabs), at a final concentration of 200 μM. c. Modified deoxynucleoside triphosphates (e.g., 5-formyl-dCTP, N-2064, Trilink Biotechnologies) were added at various ratios to their cognate dNTPs to a total of 200 μM (i.e., 200 μM dATP, 200 μM dCTP, 200 μM dTTP, and 200 μM dGTP). Thus, if the reaction is designed with a 25% incorporation rate, it can result in 50 μM modified nucleotides and 150 μM unmodified nucleotides. d. Forward and reverse primers at a final concentration of 300 μM.

[0438] For the synthesis of covalently closed TDSC, the primers contained either a phosphate group or a TelN recognition sequence for improving ligation efficiency.

[0439] For the synthesis of circular double-stranded DNA forms, in addition to containing sequences complementary to the plasmid, the primers contained additional sequences useful for downstream processing: a. Recognition sequences for one or more nicking enzymes; b. Restriction enzyme recognition sequences (e.g., BsaI, KpnI, or NheI) used for creating sticky ends of DNA after restriction enzyme digestion and promoting DNA circularization; and c. Additional bases (e.g., 5'-CCGTGGTCCTTC-3') (SEQ ID NO: 40) for increasing restriction enzyme digestion efficiency .

[0440] For any form, the PCR products were purified using a standard DNA purification column.

[0441] Figure 8 shows the generation of covalently closed TDSCs with terminal forms containing phosphorothioate modifications. For TDSCs with terminal forms containing phosphorothioate modifications (phosphorothioate terminal forms), up to 10 μg of PCR DNA in 50 μL per reaction was added to the NEBNext Ultra II end repair / dA tailing buffer (8 μL) and enzyme (3 μL) mix (E7546L), first at 20 °C for 30 minutes and then at 65 °C for 30 minutes. After brief cooling on ice, the NEBNext Ultra II ligation module components were added, including the ligation mix (30 μL), ligation enhancer (1 μL), and 3 μL of a 100 μM solution containing the DNA adapter to be ligated. This reaction mixture was incubated for over 1 hour, but typically overnight. Next, the post-ligation PCR-adapter solution was purified using a Nucleospin Midi column, quantified by Nanodrop, and any unligated PCR was cleaned up with ExoIII (NEB M0206) at 37 °C for 1 hour.

[0442] Figure 9 shows the generation of covalently closed TDSCs with TelN terminal forms. For TDSCs with TelN terminal forms, 1 μg of PCR DNA was incubated in a 40 μL reaction containing 4 μL of 10× ThermoPol buffer and 2 μL of TelN telomerase (M0651, New England Biolabs) at 30 °C for 1 hour. Next, the TelN-modified DNA was purified using a Zymo DCC-100 column, quantified by Nanodrop, and any unmodified PCR was cleaned up with ExoIII (NEB M0206) at 37 °C for 1 hour.

[0443] Figure 10 shows the generation of circular dsDNA molecules. For the synthesis of circular dsDNA molecules, DNA was digested overnight in a reaction solution using a restriction enzyme corresponding to the restriction enzyme recognition sequence, for example, KpnI-HF-V2 (R3142, New England Biolabs). Next, the DNA was purified using a DNA purification column. The digested DNA was circularized at 26 °C for 1 hour using T3 DNA ligase (M0317, New England Biolabs). The DNA that was not circularized was degraded by incubating the DNA with T5 exonuclease (M0663L, New England Biolabs) at 37 °C for 1 hour. T5 exonuclease was used to digest linear dsDNA rather than circular dsDNA. The DNA was purified using a DNA purification column. Other similar methods, such as agarose gel purification, may also be used.

[0444] Analysis of the composition and purity of the obtained double-stranded DNA form was performed using the CRISPR Discovery Kit (DNF-930-K1000CP) with an Agilent 5300 Fragment Analyzer. A gel for electrophoresis containing dsDNA inflow buffer and an intercalating dye was freshly prepared daily, while a marker tray containing mineral oil overlay and a capillary conditioning solution was freshly prepared monthly. These buffers were prepared according to the manufacturer's specifications. The circular double-stranded DNA sample was diluted with water to a final concentration of 100 pg / μL. For each sample well, 2 μL of the DNA sample was added to 22 μL of the dilution buffer (0.1×TE), and each sample run was performed with 2 to 4 replicates, with 1 well used for the MDK DNA ladder. The sample runs were performed using the default settings of the CRISPR Discovery Method (CRP-910-33) by the instrument control software.

[0445] Sample traces were analyzed using ProSize data analysis software v4.0.2.7. The peak analysis conditions for dsDNA were set to the standard conditions of "Peak Width (sec)" at 5, "Min. peak height (RFU)" at 50, # Extra Valley Points at 3, and "Valley to Valley Baseline?" enabled. The manual baseline was set from -2 minutes from the lower marker to +2 minutes to the higher marker. Peaks were automatically detected by the software under these conditions, and the peak width was selected by the software, except for examples where manual adjustment was required due to wide peaks, peak shoulders, or multiple peaks within a narrow size range.

[0446] Figures 11 - 13 show fragment analyzer traces of dsDNA forms with 5' cytosine modifications. Figure 11 shows a circular dsDNA construct generated in a reaction using 25% 5-formylcytosine and purified as described above. Figures 12 - 13 show linear covalently closed dsDNA constructs with phosphorothioate end forms (Figure 12) and TelN end forms (Figure 13), generated in a reaction using 25% 5-formylcytosine and purified as described above. In each trace, a single peak (indicated by the arrow) is clearly visible. These results indicate that multiple TDSC forms can be generated and purified, including those containing chemically modified nucleotides (e.g., 5-formylcytosine).

[0447] Example 16: In Vitro Evaluation of TDSC Gene Expression This example demonstrates the detection and quantification of gene expression using chemically modified TDSC in cultured cells.

[0448] The experimental constructs and controls were administered by lipid transfection (lipofection). Lipofection for DNA was performed in HEKa cells using Lipofectamine 3000 transfection reagent (#L3000001, ThermoFisher) according to the manufacturer's instructions. A DNA:P3000:Lipofectamine 3000 ratio of 1:2:3 was used for all DNA constructs and controls. 10,000 cells were seeded in advance into each well of a 96-well plate one day before transfection. Transfection was performed until the cells reached approximately 80 - 90% confluence. For each well of the 96-well plate, 3×Lipofectamine 3000 was first diluted in 5 μL of Opti-MEM™ I Reduced Serum Medium (#31985070, ThermoFisher). DNA was diluted in 5 μL of Opti-MEM™ I Reduced Serum Medium together with 2×P3000 reagent. Next, the DNA was added to Lipofectamine 3000 containing Opti-MEM™ I Reduced Serum Medium and gently mixed by pipetting. After incubation at room temperature for 15 minutes, the DNA-Lipofectamine 3000 complex was added to the target cells together with the complete culture medium in a dropwise manner to different regions of the well. The plate was gently rocked back and forth and from side to side to evenly distribute the DNA-Lipofectamine 3000 complex. After transfection, the cells were 2 incubated in a tissue culture incubator and the culture medium was changed 6 - 8 hours after transfection.

[0449] To determine the expression of the construct encoding the fluorescent reporter mCherry, cells were first washed with PBS before flow cytometry analysis. All flow cytometry was performed on a MACSQuant VYB from Miltenyi. For detection of the mCherry signal, a yellow laser (wavelength 561 nm) was used for excitation and an emission filter of 615 / 620 nm was used. 20,000 events were recorded for each sample and the data were analyzed using Flowjo V.9.0 software. Cells were first gated in the FSC-A and SSC-A plots to remove cell debris. The population was further plotted in the FSC-A and FSC-H plots to surround the single cell population. Finally, the percentage of expressing cells was determined using a bivariate plot between fluorescent signal-expressing and non-expressing cells. The level of expression within each cell was determined using the distribution of expressing cells. Expression analysis was performed at multiple time points.

[0450] Figures 14A - 14B show that multiple TDSC constructs generated with or without chemical modification enable the expression of a reporter gene. In HEKa cells, detectable expression of the reporter protein mCherry occurred with dsDNA comprising three different structures - circular double-stranded, covalently closed TDSC with phosphorothioate end form, and covalently closed TDSC with TelN end form. DNA molecules in which deoxycytosine was at least partially replaced with 5-formylcytosine as described in Example 15 also retained function as defined by a similar ratio of cells expressing mCherry. These results demonstrate that TDSC with various different end forms can be transcribed and yield a protein product even when chemically modified.

[0451] Example 17: In vitro evaluation of the effect of TDSC on the innate immune response of cells. This example describes the effect of chemically modified dsDNA constructs, such as TDSC, on the innate immune response of cultured cells.

[0452] An experimental construct was prepared as in Example 15 above and then administered to cells as in Example 16 above. qPCR was performed on the cells to determine the RNA levels of an inflammatory cytokine panel including human IFNL1, CXCL8, TNF, IL17B, IL6, IFNB1, CCL2, IL23, IL17E, CXCL10, CXCL1, CCL5, IL1B, IL5, IL33, IL1A, CXCL2, IL17C, and IL18. Human GAPDH was used as an endogenous control for the analysis. Refer to the attached Table 4 for the primer sequences. Briefly, mRNA was extracted from the cells using the PicoPure RNA Isolation Kit (ThermoFisher #KIT0204) according to the manufacturer's instructions. cDNA was synthesized using the RNA to cDNA EcoDry (TM) Premix (oligo dT) (Takara #639542) kit according to the manufacturer's instructions. Analysis was performed using the QuantStudio7 Flex real-time PCR system with the SYBR Select Master Mix from Life Technologies. RNA expression was normalized to GAPDH and represented as fold change relative to the method control (DNA-free lipofection reagent).

[0453]

Table 4-1

[0454]

Table 4-2

[0455] Figures 15A - 15C and 16A - 16C show the innate immune responses of HEKa (Figures 15A - 15C) and THP1 cells (Figures 16A - 16C) to TDSC generated with or without 5 - formylcytosine. In both HEKa cells and THP1 cells, a measurable innate immune response occurred as defined by the detectable expression of the cytokines IFNB, CXCL10, and IL6 with dsDNA comprising three different structures - circular double - stranded, linear TDSC with phosphorothioate - terminated form, and linear TDSC with TelN - terminated form. For covalently closed - circular TDSC, when cytosine was partially replaced with 5 - formylcytosine, the immune response decreased as defined by the decreased expression of IFNB, CXCL10, and IL6 in both HEKa cells and THP1 cells. These results demonstrate that both the terminal morphological structure and the presence of chemical modifications (e.g., 5 - formylcytosine) of TDSC can affect the innate immune response to double - stranded DNA while retaining the ability to encode functional protein products.

[0456] Figure 17 shows the innate immune response of HEKa cells to covalently closed - circular TDSC containing various modifications at the carbon 5 (C - 5) position of cytosine with phosphorothioated terminal adapters. The innate immune response is visualized as a scatter plot for each different chemically modified dsDNA molecule, where the X - axis represents the decrease in interferon signaling defined as the average fold - change decrease compared to TDSC containing unmodified cytosine for the markers IFNB and CXCL10, and the Y - axis represents the decrease in inflammatory cytokine signaling defined as the average fold - change decrease compared to TDSC containing unmodified cytosine for the markers IL6 and TNFa. These results demonstrate that incorporating specific chemical modifications at the C - 5 position of cytosine in TDSC can reduce the innate immune response to dsDNA in immunocompetent cell lines.

[0457] All publications, patents, and patent applications cited in this specification are hereby incorporated by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In the event of any conflict between the terms of this specification and those of the incorporated references, the terms of this specification shall control.

Claims

1. a) Upstream DNA end morphology with a closed end; b) Double-stranded regions; and c) Downstream DNA end morphology with closed ends A therapeutic double-stranded construct (TDSC) containing, The TDSC comprises one or more chemically modified nucleotides, A TDSC in which one or more chemically modified nucleotides contain a phosphorothioate linkage.

2. The TDSC according to claim 1, wherein one or both of the upstream DNA end morphology and the downstream DNA end morphology include a loop.

3. The TDSC according to claim 1, wherein the upstream DNA terminal morphology, the downstream DNA terminal morphology, and / or the double-stranded region comprises one or more chemically modified nucleotides.

4. The TDSC according to claim 1, wherein one or more of the chemically modified nucleotides are conjugated to a peptide or protein.

5. The TDSC according to claim 1, wherein each of the first and second chains of the TDSC contains one or more chemically modified nucleotides.

6. The TDSC according to claim 1, wherein each of the first and second chains of the TDSC contains one or more phosphorothioate bonds.

7. The TDSC according to claim 1, wherein each of the upstream and / or downstream DNA terminal forms comprises at least 1, 2, 3, 4, 5, or 6 phosphorothioate bonds (for example, between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides in the first strand, the second strand, or both the first and second strands).

8. The TDSC according to claim 1, wherein one or more chemically modified nucleotides include a chemically modified cytosine nucleotide.

9. The TDSC according to claim 8, wherein the chemically modified cytosine nucleotide has a substitution other than hydrogen at the carbon 5 position of the cytosine.

10. i) Promoter sequence (where the promoter sequence is optionally located in the double-stranded region); ii) A payload sequence (e.g., a therapeutic payload sequence) operably linked to the promoter sequence (where the payload sequence is optionally located in the double-stranded region); iii) Heterogeneous functional sequences, e.g., nuclear targeting sequences or regulatory sequences; iv) Maintenance sequence; and / or v) Origin of replication The TDSC according to claim 1, comprising one or more of the following.

11. The TDSC according to claim 10, wherein the payload sequence encodes a polypeptide (e.g., a protein) or a functional RNA (e.g., miRNA, siRNA, or tRNA), and optionally, the payload sequence is heterogeneous to the target cell.

12. The TDSC according to claim 1, wherein the TDSC is resistant to endonuclease digestion and / or immune sensor recognition.

13. i) The upstream DNA terminal morphology and the downstream DNA terminal morphology have the same nucleotide sequence; or ii) The TDSC according to claim 1, wherein the upstream DNA terminal morphology and the downstream DNA terminal morphology have different nucleotide sequences.

14. The TDSC according to claim 1, wherein one or both of the upstream exonuclease-resistant DNA end morphology and the downstream exonuclease-resistant DNA end morphology include a hairpin.

15. The TDSC according to claim 1, wherein the closed end comprises one or more nucleotides (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50) that do not hybridize (e.g., are not part of a double-stranded region).

16. The TDSC according to claim 1, wherein the closed terminus does not contain any non-hybridizing nucleotides (for example, all nucleotides of the closed terminus hybridize with other nucleotides).

17. i) the upstream DNA terminal morphology, the downstream DNA terminal morphology, or both include a protelomerase sequence; or ii) The TDSC according to claim 1, wherein the upstream DNA terminal morphology, the downstream DNA terminal morphology, or both do not contain a protelomerase sequence.

18. The TDSC according to claim 1, wherein at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the sugars in the TDSC are deoxyribose sugars.

19. i) The TDSC is replicable (for example, by a DNA polymerase native to the cell containing the TDSC); ii) The TDSC is not reproducible; iii) The TDSC is linear and can be made into an annular shape; iv) The TDSC is linear and cannot be annularized; v) The TDSC or a portion thereof can be incorporated into the genome; vi) The TDSC or any part thereof is not capable of being incorporated into the genome; vii) The TDSC is concatemizable; and / or viiii) The TDSC according to claim 1, wherein the TDSC is not concatemerizable.

20. a) The upstream exonuclease-resistant DNA terminal morphology and / or the downstream exonuclease-resistant DNA terminal morphology include one or more of the following: nuclear targeting sequences, maintenance sequences, or sequences that bind to endogenous polypeptides in target cells; or b) One or both of the upstream exonuclease-resistant DNA terminal morphology and the downstream exonuclease-resistant DNA terminal morphology have the following characteristics: i) nucleic acid sequences TATCAGCACACAATTGCCCATATATACGC (SEQ ID NO: 55) and GCGTATAATGGGGCAATTTGTGTGATA (SEQ ID NO: 56), or nucleic acid sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity therewith; and / or not containing nucleic acid sequences TATCAGCACACAATATAGTCCATATATACGC (SEQ ID NO: 57) and GCGTATAATGGGACTATTTGTGTGATA (SEQ ID NO: 58); ii) Any nucleotide in the TDSC binds to another nucleotide in the TDSC; iii) The upstream exonuclease-resistant DNA terminal morphology has a loop size of less than approximately 28 or 56 nucleotides or greater than approximately 28 or 56 nucleotides; or iv) The downstream exonuclease-resistant DNA terminal morphology has a loop size of less than approximately 28 or 56 nucleotides or greater than approximately 28 or 56 nucleotides. The TDSC according to claim 1, having one or more of the following.

21. A pharmaceutical composition comprising double-stranded DNA (dsDNA) containing an effector sequence, a) The dsDNA lacks a vector skeleton, or a substantial portion of a vector skeleton, or does not contain a non-human (e.g., bacterial) origin of replication; b) The dsDNA is not encapsulated in a capsid, essentially lacks viral proteins, does not contain a viral packaging signal, or does not contain a viral ITR; c) The dsDNA includes an exonuclease-resistant end; and d) The dsDNA comprises at least one chemically modified nucleotide, and the chemically modified nucleotide comprises a phosphorothioate bond. Pharmaceutical composition.

22. A pharmaceutical composition comprising a TDSC according to any one of claims 1 to 20, wherein the TDSC is optionally contained in lipid nanoparticles (LNPs).

23. An ex vivo method for expressing a heterologous payload in target cells, (i) Target cell Introducing a TDSC or composition according to any one of claims 1 to 20, wherein the double-stranded region of the TDSC includes a sequence encoding a heterogeneous payload; and (ii) Maintaining the cells under conditions suitable for expressing the heterologous payload from the TDSCs (e.g., incubation). Including; A method for expressing the heterologous payload in the target cells thereby.

24. A composition for use in a method for delivering a heterologous payload to target cells, comprising a TDSC according to any one of claims 1 to 20, wherein the method involves introducing the composition into target cells, the double-stranded region of the TDSC comprising a sequence encoding a heterologous payload. Including; A composition that thereby delivers the heterogeneous payload to the target cells.

25. A composition for use in a method for modulating (e.g., increasing or decreasing) the biological activity of target cells, comprising a TDSC according to any one of claims 1 to 20, wherein the method is (i) introducing the composition into target cells, wherein the double-stranded region of the TDSC contains a sequence encoding a heterologous payload that modulates the biological activity of the target cells; and (ii) Maintaining the cells under conditions suitable for expressing the heterologous payload from the TDSCs (e.g., incubation). Including; A composition that thereby modulates the biological activity of the target cells.

26. A pharmaceutical composition according to claim 22 for use in the treatment of cells, tissues, or subjects in need of treatment, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterogeneous payload.

27. ​​Use of the pharmaceutical composition according to claim 22 in the manufacture of a pharmaceutical for the treatment of cells, tissues, or subjects in need of treatment, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterogeneous payload.

28. A method for creating a TDSC, Double-stranded DNA molecules, A self-annealed DNA molecule comprising a first region and a second region, wherein the first region is hybridized with the second region. This includes ligating to; A method for generating TDSCs, A method wherein the self-annealed DNA molecule further includes a loop between the first region and the second region.

Images