Anti-WARS1 Antibody and Its Use

Abstract

The present invention relates to an anti-WARS1 antibody and a pharmaceutical composition containing the same as an active ingredient. The anti-WARS1 antibody according to the present invention specifically binds to WARS1 and can suppress the secretion of TNF-α induced by WARS1. Further, the anti-WARS1 antibody according to the present invention can be effectively used for the prevention or treatment of inflammatory diseases including sepsis, chronic obstructive pulmonary disease, inflammatory bowel disease, rheumatoid arthritis, atopic dermatitis, macrophage activation syndrome, and the like.

Description

Technical Field

[0001] The present invention relates to an antibody that specifically binds to the WARS1 protein and its uses.

Background Art

[0002] Aminoacyl-tRNA synthetase (ARS) is an enzyme that mediates the reaction of specifically binding an amino acid to tRNA and plays a central role in protein production. In recent years, it has been known that in addition to protein production, the ARS is involved in various biological phenomena such as apoptosis, angiogenesis, and inflammatory reactions. Among ARSs, human tryptophanyl-tRNA synthetase 1 (WARS1) is an aminoacyl-tRNA synthetase that recognizes tryptophan and ligates tryptophan to tRNA. Recently, there has been increasing interest in the role of WARS1 in the host defense mechanism against infection. The present inventors previously reported that monocytes secrete intracellular WARS1, which exists in cells without de novo synthesis within several minutes after bacterial infection, extracellularly (Young Ha Ahn.et al.Nature Microbiology (2016) 2:16191).

[0003] Secreted WARS1 functions as an endogenous ligand for TLR4 and TLR2, activates macrophages, and induces activation of innate immunity. In addition, WARS1 initiates the production of pro-inflammatory cytokines and chemokines including TNF-α, IL-6, MIP-1α, and IL-8, and induces neutrophil infiltration. Subsequently, the expression of the WARS1 gene is induced by IFN-γ to maintain continuous secretion of WARS1. Consistent with such findings, WARS1 was observed at high levels in the blood of sepsis patients.

[0004] In view of this, a strategy for developing anti-WARS1 antibodies for the treatment of infectious and / or inflammatory diseases caused by bacteria, viruses and / or fungi is considered. However, since ARSs including WARS1 have many structural similarities in proteins, antibodies obtained by immune responses often do not generate highly sensitive antibodies such as those showing cross-reactivity with other ARSs.

[0005] Therefore, there is an urgent need to develop antibodies that specifically bind only to WARS1 without cross-reactivity to other ARSs and can effectively neutralize WARS1.

Summary of the Invention

Problems to be Solved by the Invention

[0006] The present inventors made efforts to discover an antibody or a fragment thereof that specifically binds to WARS1, the expression level of which is significantly increased in patients with infectious diseases such as sepsis. As a result, the present invention was completed by producing a novel anti-WARS1 antibody that specifically binds to WARS1 and at the same time suppresses the inflammatory response in immune cells, and confirming its pharmacological activity.

Means for Solving the Problems

[0007] To achieve the above object, one aspect of the present invention provides an anti-WARS1 antibody or a fragment thereof, comprising a heavy chain variable region comprising H-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, H-CDR2 comprising the amino acid sequence of SEQ ID NO: 5, and H-CDR3 comprising the amino acid sequence of SEQ ID NO: 7, and a light chain variable region comprising L-CDR1 comprising the amino acid sequence of SEQ ID NO: 12, L-CDR2 comprising the amino acid sequence represented by SEQ ID NO: 95 below, and L-CDR3 comprising the amino acid sequence represented by SEQ ID NO: 96 below: N-terminal - Ala Asn Xaa1 Xaa2 His Arg Pro Ser - C-terminal (SEQ ID NO: 95), Here, Xaa1 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, Xaa2 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, when Xaa1 is Ser, Xaa2 is not His, N-terminal - Gly Ala Trp Asp Asp Ser Xaa3 Ser Ala Tyr Val - C-terminal (SEQ ID NO: 96), here, Xaa3 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro.

[0008] Another aspect of the present invention provides a polynucleotide encoding the antibody or its fragment, an expression vector containing the polynucleotide, and a transformed cell into which the expression vector has been introduced.

[0009] Another aspect of the present invention provides a method for producing an antibody or its fragment, which includes culturing the transformed cell and obtaining the antibody or its fragment.

[0010] Another aspect of the present invention provides a pharmaceutical composition for preventing or treating an inflammatory disease, which contains the antibody or its fragment as an active ingredient.

[0011] Another aspect of the present invention provides the use of the antibody or its fragment for preventing or treating an inflammatory disease.

[0012] Another aspect of the present invention provides a method for preventing or treating an inflammatory disease, which includes administering the antibody or its fragment to an individual.

Advantages of the Invention

[0013] The anti-WARS1 antibody according to the present invention specifically binds to WARS1 and suppresses the secretion of TNF-α induced by WARS1 in immune cells. In addition, as a result of administering the anti-WARS1 antibody in the present invention to a severe sepsis mouse model, a chronic obstructive pulmonary disease mouse model, an inflammatory bowel disease mouse model, a rheumatoid arthritis model, an atopic dermatitis mouse model, and a macrophage activation syndrome model, improvement effects for all diseases were shown in the mouse models of each disease. Therefore, the anti-WARS1 antibody according to the present invention can be effectively used for the therapeutic use of inflammatory diseases.

Brief Description of Drawings

[0014]

Figure 1

Figure 2

Figure 3a

Figure 3b

Figure 4a

Figure 4b

Figure 5

Figure 6a

Figure 6b

Figure 6c

Figure 7

Figure 8

Figure 9a

Figure 9b

Figure 9c

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16a

Figure 16b

Figure 17a

Figure 17b

Figure 17c

Figure 18a

Figure 18b

Figure 19

Figure 20

Figure 21

Figure 22a

Figure 22b

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31

Figure 32a

Figure 32b

Figure 33a

Figure 33b

Figure 33c

Figure 33d

Figure 34a

Figure 34b

Figure 34c

Figure 35

Figure 36

Figure 37

Figure 38

Figure 39

Figure 40a

Figure 40b

Figure 41a

Figure 41b

Mode for Carrying Out the Invention

[0015] Anti-WARS1 antibody The present invention provides an antibody or a fragment thereof that specifically binds to WARS1. At this time, the antibody or a fragment thereof that specifically binds to WARS1 may be an antibody or a fragment thereof that specifically binds to R20, R24, K27, I36, I43, and K47. The WARS1 may be a human WARS1 containing the amino acid sequence of SEQ ID NO: 94.

[0016] As used herein, the term "antibody" means an immunoglobulin molecule that immunologically reacts with a specific antigen and is a protein molecule that specifically recognizes the antigen. The heavy and light chains of an immunoglobulin can each contain a constant region (C) and a variable region (V). The light and heavy chain variable regions of an immunoglobulin contain three hypervariable regions called complementarity determining regions (CDRs) and four framework regions (FRs). The CDRs are antigen-binding sites that mainly bind to the epitope of an antigen.

[0017] As used herein, the term "WARS" refers to tryptophanyl-tRNA synthetase, also known as tryptophan-tRNA ligase, TrpRS, WRS, etc. WARS is an enzyme that mediates the aminoacylation reaction of the amino acid tryptophan and tRNA. In humans, WARS is encoded by the WARS gene, and the amino acid sequence and mRNA base sequence of the protein are known, such as Genbank accession number NP_004175.2 (protein), GenBank accession number NM_004184.3 (mRNA base sequence). WARS has two isoforms, a cytoplasmic form (WARS1 or tryptophanyl-tRNA synthetase 1, cytoplasmic) and a mitochondrial form (WARS2 or tryptophanyl-tRNA synthetase 2, mitochondrial). In the present invention, WARS may be WARS1. The WARS1 may be, but is not limited to, human WARS1 containing the amino acid sequence of SEQ ID NO: 94.

[0018] The anti-WARS1 antibody in the present invention may be an antibody or a fragment thereof that specifically binds to the WARS1. Further, the fragment of the antibody, the fragment of the antibody in the present invention, may be Fab, F(ab’) 2 , Fd, sdFv, Fv, dAb, scFv, sdAb, tetramer, etc., and any form can be included as long as it contains an antigen-binding site capable of specifically binding to WARS1.

[0019] One aspect of the present invention provides an anti-WARS1 antibody or a fragment thereof, comprising a heavy chain variable region comprising an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 3, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 5, and an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 7, and a light chain variable region comprising an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 12, an L-CDR2 comprising the amino acid sequence represented by SEQ ID NO: 95 below, and an L-CDR3 comprising the amino acid sequence represented by SEQ ID NO: 96 below: N-terminal - Ala Asn Xaa1 Xaa2 His Arg Pro Ser - C-terminal (SEQ ID NO: 95), wherein Xaa1 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, Xaa2 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, when Xaa1 is Ser, Xaa2 is not His, N-terminal - Gly Ala Trp Asp Asp Ser Xaa3 Ser Ala Tyr Val - C-terminal (SEQ ID NO: 96), wherein Xaa3 may be Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro.

[0020] Specifically, in the L-CDR2 of the light chain variable region, Xaa1 may be any one selected from the group consisting of Ile, Leu, Thr, Val and Gln, and at this time, Xaa2 may be His or Leu. Also, when Xaa1 is Ser, Xaa2 may be any one selected from the group consisting of Ile, Leu, Lys, Glu and Phe.

[0021] Specifically, in the L-CDR3 of the light chain variable region, Xaa3 may be Leu or Asn.

[0022] More specifically, the L-CDR1 of the light chain variable region includes the amino acid sequence of SEQ ID NO: 12, the L-CDR2 includes any amino acid sequence selected from the group consisting of SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, and 44, and the L-CDR3 can include the amino acid sequence of SEQ ID NO: 16 or SEQ ID NO: 46.

[0023] Preferably, the heavy chain variable region may include the amino acid sequence of SEQ ID NO: 9. Also, the light chain variable region can include any amino acid sequence selected from the group consisting of SEQ ID NOs: 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 48, and 49.

[0024] As a specific example of the present invention, the antibody or its fragment may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 21.

[0025] As a specific example, the antibody or its fragment may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 23.

[0026] As a specific example, the antibody or its fragment may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 25.

[0027] As a specific example, the antibody or its fragment may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 27.

[0028] As a specific example, the antibody or its fragment may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 29.

[0029] As a specific example, the antibody or a fragment thereof may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 31.

[0030] As a specific example, the antibody or a fragment thereof may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 33.

[0031] As a specific example, the antibody or a fragment thereof may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 35.

[0032] As a specific example, the antibody or a fragment thereof may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 37.

[0033] As a specific example, the antibody or a fragment thereof may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 39.

[0034] As a specific example, the antibody or a fragment thereof may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 41.

[0035] As a specific example, the antibody or a fragment thereof may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 43.

[0036] As a specific example, the antibody or a fragment thereof may include a heavy chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light chain variable region containing SEQ ID NO: 45.

[0037] As a specific example, the antibody or a fragment thereof may include a heavy-chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light-chain variable region containing SEQ ID NO: 47.

[0038] As a specific example, the antibody or a fragment thereof may include a heavy-chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light-chain variable region containing SEQ ID NO: 48.

[0039] As a specific example, the antibody or a fragment thereof may include a heavy-chain variable region containing the amino acid sequence of SEQ ID NO: 9 and a light-chain variable region containing SEQ ID NO: 49.

[0040] The antibody or a fragment thereof in the present invention may include an immunoglobulin Fc region. At this time, the Fc region of the immunoglobulin includes the heavy-chain constant region 2 (CH2) and the heavy-chain constant region 3 (CH3) of the immunoglobulin, and means a protein that does not include the variable regions of the heavy and light chains of the immunoglobulin and the light-chain constant region (CL). The immunoglobulin Fc region may be derived from IgG, IgA, IgE, IgD, or IgM.

[0041] In addition, the Fc region of the immunoglobulin may be not only a wild-type Fc region but also an Fc region variant. Also, the term "Fc region variant" as used herein can be in a form that is different from the glycosylation pattern of the wild-type Fc region, has an increased sugar chain compared to the wild-type Fc region, has a decreased sugar chain compared to the wild-type Fc region, or has the sugar chain removed (deglycosylated). Also included is an aglycosylated Fc region. The Fc region or variant may be made to have a certain number of sialic acids, fucosylations, or glycosylations adjusted through culture conditions or genetic manipulation of the host.

[0042] In addition, the sugar chains of the Fc region of immunoglobulins can be modified by ordinary methods such as chemical methods, enzymatic methods, and genetic engineering methods using microorganisms. Further, the Fc region variant may be in a form in which the Fc regions of immunoglobulins IgG, IgA, IgE, IgD, or IgM are mixed. Further, the Fc region variant may be in a form in which some amino acids in the Fc region are substituted with other amino acids.

[0043] In one specific example of the present invention, the Fc region can include the amino acid sequence of SEQ ID NO: 51.

[0044] The antibody in the present invention can include a fusion protein containing the variable light chain region (VL) and the constant light chain region (CL) of an anti-WARS1 antibody and a fusion protein containing the variable heavy chain region (VH), the constant heavy chain region 1 (CH1), and the Fc region of an anti-WARS1 antibody.

[0045] Specifically, the anti-WARS1 antibody may include (I) and (II). N’-X’-[Linker]o-Fc region fragment or its variant-C’ (I), and N’-X’’-C’ (II) At this time, in the structural formulas (I) and (II), the N’ is the N-terminus, the C’ is the C-terminus, the X is the antigen-binding site of an anti-WARS1 antibody or its fragment, and consists of X’ and X’’, the X’ includes the variable region (VH) and the CH1 region as the antigen-binding site of the heavy chain of an anti-WARS1 antibody or its fragment, the X’’ includes the variable region (VL) and the constant region (CL) as the antigen-binding site of the light chain of an anti-WARS1 antibody or its fragment, the linker is a peptide linker, the o is O or 1.

[0046] At this time, the anti-WARS1 antibody or its fragment, antigen-binding site, variable region, and constant region are as described above.

[0047] The peptide linker can consist of 1 to 50 consecutive amino acids or 3 to 30 consecutive amino acids. As a specific example, the peptide linker can consist of 23 amino acids. Further, the peptide linker can contain at least one cysteine. Specifically, it can contain one, two, or three cysteines. Also, the peptide linker may be derived from the hinge of an immunoglobulin. For example, the hinge can be selected from the hinge regions of various IgG subtype antibodies. Also, the hinge may be in a form in which some amino acids in the hinge region derived from an immunoglobulin are substituted with other amino acids, or in a sequence in which some amino acid sequences are added. In one specific example, the peptide linker may be a peptide linker consisting of the amino acid sequence of SEQ ID NO: 50.

[0048] Polynucleotide encoding anti-WARS1 antibody Another aspect of the present invention provides a polynucleotide encoding an anti-WARS1 antibody or its fragment. The anti-WARS1 antibody or its fragment is as described above.

[0049] The polynucleotide can contain the nucleotide sequence of SEQ ID NO: 52 encoding the heavy chain region of the anti-WARS1 antibody or its fragment. The polynucleotide can contain any nucleotide sequence selected from the group consisting of SEQ ID NO: 54 to SEQ ID NO: 69 encoding the light chain region of the anti-WARS1 antibody or its fragment.

[0050] In addition, when the polynucleotide encodes the same polypeptide, one or more bases may be mutated by substitution, deletion, insertion, or a combination thereof. When chemically synthesizing and manufacturing a polynucleotide sequence, synthesis methods widely known in the art can be used, for example, the methods described in the literature (Engels and Uhlmann, Angew Chem IntEd Engl., 37:73-127, 1988), including triester, phosphite, phosphoramidite, and H-phosphonate methods, PCR and other autoligation methods, oligonucleotide synthesis methods on solid supports, and the like.

[0051] According to one specific example, the polypeptide may include a nucleotide sequence having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identity with the nucleotide sequences of SEQ ID NO: 52 and SEQ ID NOs: 54 to 69.

[0052] The polynucleotide may additionally include a signal sequence or a leader sequence. As used herein, the term "signal sequence" means a nucleic acid encoding a signal peptide that directs the secretion of the target protein. The signal peptide is cleaved after translation in the host cell. Specifically, the signal sequence of the present invention is a nucleotide encoding an amino acid sequence that initiates the movement of a protein that penetrates the endoplasmic reticulum (ER) membrane.

[0053] Signal sequences are well-known in the art for their characteristics and typically contain 16 to 30 amino acid residues, but can contain more or fewer amino acid residues. A typical signal peptide consists of three regions: a basic N-terminal region, a central hydrophobic region, and a more polar C-terminal region. The central hydrophobic region contains 4 to 12 hydrophobic residues that anchor the signal sequence through the lipid bilayer of the membrane while the immature polypeptide migrates.

[0054] After initiation, the signal sequence is cleaved within the lumen of the ER by cellular enzymes often known as signal peptidases. At this time, the signal sequence may be the secretion signal sequence of tPa (tissue Plasminogen Activation), HSV gDs (signal sequence of Herpes simplex virus glycoprotein D), IgG signal sequence, or growth hormone. Preferably, a secretion signal sequence used in higher eukaryotic cells including mammals can be used. In the present invention, useful signal sequences include antibody light chain signal sequences, such as antibody 14.18 (Gillies et al., J. Immunol. Meth 1989.125:191-202), antibody heavy chain signal sequences, such as the MOPC141 antibody heavy chain signal sequence (Sakano et al., Nature, 1980.286:676-683), and other signal sequences known in the art (see, e.g., Watson et al., Nucleic Acid Research, 1984.12:5145-5164). As a specific example, the signal sequence can contain the amino acid sequence of SEQ ID NO: 1.

[0055] Vector carrying the polynucleotide Another aspect of the present invention provides a vector carrying a polynucleotide encoding the anti-WARS1 antibody or a fragment thereof. At this time, the polynucleotide may include a heavy chain region containing the nucleotide sequence of SEQ ID NO: 52 and a light chain region containing any nucleotide sequence selected from the group consisting of SEQ ID NOs: 54 to 69.

[0056] As used herein, the term "vector" can be introduced into a host cell and can be recombined and inserted into the host cell genome. Or the vector is understood as a nucleic acid means containing a nucleotide sequence that can replicate spontaneously as an episome. The vector includes linear nucleic acids, plasmids, phagemids, cosmids, RNA vectors, viral vectors, mini-chromosomes and the like. Examples of viral vectors include, but are not limited to, retroviruses, adenoviruses and adeno-associated viruses.

[0057] Specifically, the vector may be plasmid DNA, phage DNA, etc., commercially developed plasmids (such as pUC18, pBAD, pIDTSAMRT-AMP, etc.), Escherichia coli-derived plasmids (such as pYG601BR322, pBR325, pUC118, pUC119, etc.), Bacillus subtilis-derived plasmids (such as pUB110, pTP5, etc.), yeast-derived plasmids (such as YEp13, YEp24, YCp50, etc.), phage DNA (such as Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11, λZAP, etc.), animal viral vectors (such as retrovirus, adenovirus, vaccinia virus, etc.), insect viral vectors (such as baculovirus, etc.). Since the expression level and modification of proteins are different depending on the host cell for the vector, it is preferable to select and use the host cell most suitable for the purpose.

[0058] In addition, the plasmid can contain a selection marker such as an antibiotic resistance gene, and host cells carrying the plasmid can be cultured under selective conditions.

[0059] As used herein, the term "gene expression" or "expression" of the target protein is understood to mean transcription of the DNA sequence, translation of the mRNA transcript, and secretion of the antibody product or a fragment thereof. A useful expression vector may be RcCMV (Invitrogen, Carlsbad) or a variant thereof. The expression vector can contain a human CMV (cytomegalovirus) promoter for promoting continuous transcription of the target gene in mammalian cells and a bovine growth hormone polyadenylation signal sequence for enhancing the steady-state level of RNA after transcription.

[0060] Transformed cell Another aspect of the present invention provides a transformed cell into which an expression vector carrying a polynucleotide encoding the anti-WARS1 antibody or a fragment thereof has been introduced. At this time, the anti-WARS1 antibody or a fragment thereof is as described above.

[0061] As used herein, the term "transformed cell" refers to prokaryotic and eukaryotic cells into which a recombinant expression vector can be introduced. The transformed cell can be prepared by introducing the vector into a host cell and transforming it. In addition, the polynucleotide contained in the vector can be expressed to produce the antibody or a fragment thereof of the present invention.

[0062] The transformation can be carried out by various methods. As long as the antibody of the present invention can be produced, although not particularly limited thereto, specifically, the transformation method is CaCl 2 precipitation method, CaCl 2The Hanahan method with enhanced efficiency by using a reducing substance DMSO (dimethyl sulfoxide) in the Shen Dian method, electroporation, calcium phosphate precipitation method, protoplast fusion method, stirring method using silicon carbide fibers, Agrobacterium-mediated transformation method, transformation method using PEG, transformation methods of dextran sulfate, lipofectamine and dry / suppression medium, etc. can be used. Also, the target substance can be transferred into cells using virus particles by means of infection. Also, a vector can be introduced into a host cell by gene bombardment or the like.

[0063] Also, the host cell used for the preparation of the transformed cell is not particularly limited as long as it can produce the antibody of the present invention. Specifically, the host cell can include, but is not limited to, prokaryotic cells, eukaryotic cells, mammals, plants, insects, fungi or cells of cellular origin. As an example of the prokaryotic cell, Escherichia coli can be used. Also, as an example of the eukaryotic cell, yeast can be used. Also, as the mammalian cell, CHO cells, F2N cells, COS cells, BHK cells, Bowes melanoma cells, HeLa cells, 911 cells, AT1080 cells, A549 cells, SP2 / 0 cells, human lymphoblastoid, NSO cells, HT-1080 cells, PERC.6 cells, HEK293 cells or HEK293T cells, etc. can be used, but are not limited thereto, and all cells that can be used as mammalian host cells known to those skilled in the art are available.

[0064] Also, for optimizing the characteristics of the antibody as a therapeutic agent or for other purposes, glycosylation-related genes possessed by the host cell can be manipulated by methods known to those skilled in the art to adjust the sugar chain pattern of the antibody (for example, sialic acid, fucosylation, glycosylation).

[0065] Method for producing anti-WARS1 antibody or its fragment Another aspect of the present invention provides a method for producing the anti-WARS1 antibody or a fragment thereof.

[0066] The production method may include: i) culturing the transformed cell; and ii) obtaining the anti-WARS1 antibody or a fragment thereof.

[0067] As used herein, the term "culturing" means a method of growing microorganisms under appropriately artificially controlled environmental conditions.

[0068] The method of culturing the transformed cell can be carried out using methods widely known in the art. Specifically, the culturing is not particularly limited as long as the antibody of the present invention can be expressed and produced. Specifically, the culturing can be continuously carried out in a batch process or a fed batch or repeated fed batch process.

[0069] Also, the step of obtaining the antibody from the culture can be carried out by methods known in the art. Specifically, the obtaining method is not particularly limited as long as the produced antibody of the present invention or a fragment thereof can be obtained. Preferably, the obtaining method may be methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion).

[0070] Pharmaceutical composition containing anti-WARS1 antibody or its fragment Another aspect of the present invention provides a pharmaceutical composition for preventing or treating inflammatory diseases containing the anti-WARS1 antibody or a fragment thereof as an active ingredient. Here, the anti-WARS1 antibody or a fragment thereof is as described above.

[0071] As used herein, the term "inflammation" refers to a reaction for protecting a living body against harmful factors, which involves immune cells, blood vessels, and inflammatory mediators, and includes a series of processes for suppressing cell damage, removing damaged tissues and necrotic cells, and regenerating tissues. "Inflammatory disease" is a general term for diseases with inflammation as the main pathological change.

[0072] The inflammatory disease may be any selected from the group consisting of peritonitis, osteomyelitis, cellulitis, meningitis, encephalitis, pancreatitis, trauma-induced shock, cystic fibrosis, stroke, Lyme disease, polyarteritis nodosa, hypersensitivity vasculitis, Löfgren's granulomatosis, giant cell arteritis, synovitis, tenosynovitis, epicondylitis (tennis elbow), Henoch-Schönlein purpura, multicentric reticulohistiocytosis, sarcoidosis, hemochromatosis, sickle cell disease and other abnormal hemoglobinopathies, hyperlipoproteinemia, hypogammaglobulinemia, familial Mediterranean fever, recurrent fever, sepsis, septic shock, multiple organ dysfunction syndrome, bronchopulmonary dysplasia, inflammatory bowel disease, chronic obstructive pulmonary disease (COPD), macrophage activation syndrome (MAS), systemic lupus erythematosus, scleroderma, atopic dermatitis, psoriasis, anaphylaxis, dermatitis, diabetic retinopathy, retinitis, macular degeneration, uveitis, conjunctivitis, arthritis, rheumatoid arthritis, ankylosing spondylitis, osteoarthritis, osteoporosis, allergy, diabetes, diabetic nephropathy, pyelonephritis, nephritis, Sjögren's syndrome, autoimmune pancreatitis, periodontal disease, asthma, graft-versus-host disease, chronic pelvic inflammatory disease, endometritis, rhinitis, transplant rejection, and chronic prostatitis.

[0073] The preferred dosage of the pharmaceutical composition varies depending on the patient's condition and body weight, the degree of the disease, the drug form, the administration route, and the period, but can be appropriately selected by those skilled in the art. In the pharmaceutical composition for preventing or treating inflammatory diseases of the present invention, the antibody or its fragment can be included as an arbitrary amount (effective amount) according to the use, dosage form, compounding purpose, etc., as long as it exhibits anti-inflammatory activity or, in particular, can exhibit a therapeutic effect on inflammatory diseases. However, the normal effective amount is determined within the range of 0.001% by weight to 20.0% by weight based on the total weight of the composition. Here, the "effective amount" refers to the amount of the active ingredient that can induce an improvement or treatment effect of the disease state, particularly an improvement or treatment effect of the state of an inflammatory disease. Such an effective amount can be determined experimentally within the normal capabilities of those skilled in the art.

[0074] The term "treatment" as used herein can be used to mean including all therapeutic and prophylactic treatments, including applications for treating diseases in mammals including humans and all forms of medication. Further, the term includes inhibiting or delaying the progression of the disease; restoring or repairing a damaged or defective function to partially or completely relieve the disease; or stimulating an inefficient process; or relieving a serious disease. At this time, "prevention" can be used to mean alleviating or reducing the pathological state or disease of an individual.

[0075] Pharmacokinetic parameters such as bioavailability and underlying parameters such as clearance rate can also affect efficacy. Therefore, "improved efficacy" (for example, improvement in efficacy) can be attributed to improved pharmacokinetic parameters and improved efficacy, and can be measured by comparing parameters such as clearance rate and treatment or improvement of inflammatory diseases in test animals or human subjects.

[0076] The pharmaceutical composition of the present invention is administered in a "therapeutically effective amount".

[0077] As used herein, the term "administer" means introducing a predetermined substance into an individual by a suitable method, and the administration route of the composition can be through any general route as long as it can reach the target tissue. It can be administered intraperitoneally, intravenously, intramuscularly, subcutaneously, intradermally, orally, topically, intranasally, intratracheally, rectally, but is not limited thereto.

[0078] As used herein, the term "therapeutically effective amount" or "pharmaceutically effective amount" means the amount of a compound or composition effective for preventing or treating a target disease, which is sufficient to treat the disease at a reasonable benefit / risk ratio applicable to medical treatment and does not cause side effects. The level of the effective amount can be determined by factors including the patient's health status, type and severity of the disease, activity of the drug, sensitivity to the drug, administration method, administration time, administration route and excretion rate, treatment period, ingredients including the formulation or drugs used simultaneously, and other factors well known in the pharmaceutical field. In one embodiment, the therapeutically effective amount means the amount of a drug effective for treating an inflammatory disease.

[0079] At this time, the pharmaceutical composition can further contain a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier can be any carrier as long as it is a non-toxic substance suitable for delivery to a patient. It can contain distilled water, alcohol, fats, waxes, and inert solids as carriers. Pharmaceutically acceptable adjuvants (buffers, dispersants) can also be included in the pharmaceutical composition.

[0080] Specifically, the pharmaceutical composition contains a pharmaceutically acceptable carrier and can be manufactured into a parenteral dosage form by an administration route by a conventional method known in the art. Here, "pharmaceutically acceptable" means that it does not suppress the activity of the active ingredient and at the same time does not have more toxicity than applicable to the application (formulation) subject.

[0081] When the pharmaceutical composition is manufactured into a parenteral dosage form, it can be formulated in the form of injections, transdermal administration agents, nasal inhalants, and suppositories by methods known in the art together with a suitable carrier. When formulating into an injection, as a suitable carrier, sterile water, ethanol, polyols such as glycerol or propylene glycol, or mixtures thereof can be used. Preferably, isotonic solutions such as Ringer's solution, PBS (phosphate buffered saline) containing triethanolamine, sterile water for injection, 5% dextrose, etc. can be used. Regarding the formulation of pharmaceutical compositions, it is known in the art, and specifically, references such as [Remington’s Pharmaceutical Sciences (19th ed., 1995)] can be referred to. The said reference is regarded as a part of this specification.

[0082] The preferred dosage of the pharmaceutical composition may be in the range of 0.01 μg / kg to 10 g / kg per day, or in the range of 0.01 mg / kg to 1 g / kg, depending on the patient's condition, weight, gender, age, severity of the patient, and administration route. Administration can be carried out once to several times a day or divided into once a month to once every two weeks. Such dosages should not be construed as limiting the scope of the present invention in any way.

[0083] The subjects to which the pharmaceutical composition can be applied (formulated) are mammals and humans, and particularly preferably in the case of humans. The pharmaceutical composition of the present invention can further contain any compound or natural extract known to have a therapeutic effect on inflammatory diseases.

[0084] Another aspect of the present invention provides the use of the anti-WARS1 antibody or its fragment for manufacturing a medicament for preventing or treating inflammatory diseases. Here, the inflammatory disease, prevention, treatment, anti-WARS1 antibody or its fragment are as described above.

[0085] Another aspect of the present invention provides a use of the anti-WARS1 antibody or a fragment thereof for the prevention or treatment of inflammatory diseases. Here, the inflammatory disease, prevention, treatment, anti-WARS1 antibody or a fragment thereof are as described above.

[0086] Another aspect of the present invention provides a method for preventing or treating an inflammatory disease, comprising the step of administering the anti-WARS1 antibody or a fragment thereof to an individual. Here, the inflammatory disease, treatment, anti-WARS1 antibody or a fragment thereof, and administration are as described above. The individual may be a mammal, preferably a human. Also, the individual may be a patient suffering from an inflammatory disease or an individual with a high likelihood of suffering from an inflammatory disease.

[0087] The administration route, dosage, and frequency of administration of the antibody or a fragment thereof can be administered to the subject in various ways and amounts depending on the condition of the patient and the presence or absence of side effects, and the optimal administration method, dosage, and frequency of administration can be selected by a person skilled in the art within an appropriate range. The preferred dosage of the anti-WARS1 antibody or a fragment thereof may be in the range of 0.01 μg / kg to 10 g / kg per day, or 0.01 mg / kg to 1 g / kg, depending on the condition, weight, gender, age, severity of the patient, and administration route. Administration can be carried out once a day to several times a day or once a month to once every two weeks. Such dosages should not be construed as limiting the scope of the present invention in any way.

[0088] In addition, the antibody or a fragment thereof can be administered in combination with any compound or natural extract known to have a therapeutic effect on inflammatory diseases, or formulated into a combination preparation with other drugs.

[0089] [Mode for Carrying Out the Invention] Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes of one or more specific examples, and the scope of the present invention is not limited to these examples.

[0090] Example 1. Production of GKB101 To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of the anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50) and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 53) encoding a polypeptide comprising a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 18) and a constant region (SEQ ID NO: 19) of the anti-WARS1 antibody light chain were cloned into pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2), respectively. At this time, the antibody information used is as shown in Tables 2 and 3 below.

[0091] The above vectors were introduced into Expi293 cells using Expifectamine 293 reagent (Thermo fisher) at a ratio of 1:1 to co-express the heavy chain and the light chain in the same cells. After shaking culture for about 5 days after introducing the vectors, the cell culture solution was centrifuged, the supernatant was collected, and the antibody was separated and purified.

[0092] Specifically, the collected supernatant was loaded onto a Hitrap MabselectSure column (GE Healthcare Life Sciences), washed with PBS to remove non-specific binding. Proteins specifically binding to the column were separated using 100 mM Citrate buffer (pH 3.0) + 300 mM NaCl. The eluate obtained by FPLC (Fast protein liquid chromatography) was loaded onto size exclusion chromatography (GE Healthcare Life Sciences) to obtain a high-purity antibody. The purified anti-WARS1 antibody was named "GKB101" (Table 1, Figures 3a and 3b).

[0093]

Table 1

[0094] Example 2. Production of mutants of GKB101 To produce an antibody that specifically binds to WARS1, based on GKB101 of Example 1 above, the sequences of CDR2 and / or CDR3 in the light chain variable region were changed to generate several mutants. At this time, the antibody information used is shown in Tables 2 and 3 below.

[0095] The light chain mutants of GKB101 were amplified by PCR, and the primer base sequences used to amplify the genes containing the mutation sites of CDR2 and CDR3 in the light chain variable region are shown in Table 4.

[0096] Each L-CDR2 and L-CDR3 mutant containing the respective mutation was subjected to PCR using Vector template (pcDNA3.3-GKB101) and the primers (10 pmol each) under the conditions of 98°C / 1 min, 98°C / 10 sec, 55°C / 15 sec, 72°C / 5 min, 28 cycles, and 72°C / 5 min. The gene containing the mutation site was amplified. Then, after adding 0.5 μl of DpnI restriction enzyme to the PCR product, it was reacted with the enzyme at 37°C for 30 minutes. After the enzyme reaction, the purified PCR product was mixed with NEBuilder Master mix (NEB, Cat# E2621), reacted at 50°C for 60 minutes, and then transformed into DH5α competent cells to select positive clones.

[0097]

Table 2

[0098]

Table 3

[0099]

Table 4

[0100] At this time, the nucleic acid sequence encoding ANSHRPS is GCTAATAGTCATCGGCCAAGC (SEQ ID NO: 70), and the nucleic acid sequence encoding GAWDDSLSAYV is GGTGCTTGGGATGATAGCCTGAGTGCTTATGTC (SEQ ID NO: 71).

[0101] Example 2.1. Production of S53I To produce an antibody that specifically binds to WARS1 (SEQ ID NO: 94), a polynucleotide (SEQ ID NO: 52) encoding a polypeptide containing a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 9) and a constant region (SEQ ID NO: 10) of the anti-WARS1 antibody heavy chain, a linker (SEQ ID NO: 50), and an Fc region (SEQ ID NO: 51), and a polynucleotide (SEQ ID NO: 54) encoding a polypeptide containing a signal peptide (SEQ ID NO: 1), a variable region (SEQ ID NO: 21) and a constant region (SEQ ID NO: 19) of the anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0102] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "S53I" (Table 5, Figures 3a and 3b).

[0103]

Table 5

[0104] Example 2.2. Production of S53L To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of the anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 55) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 23) and a constant region (Accession No. 19) of the anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0105] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "S53L" (Table 6, Figures 3a and 3b).

[0106]

Table 6

[0107] Example 2.3. Production of S53T To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of the anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 56) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 25) and a constant region (Accession No. 19) of the anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0108] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "S53T" (Table 7, Figures 3a and 3b).

[0109]

Table 7

[0110] Example 2.4. Production of S53V To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of the anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 57) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 27) and a constant region (Accession No. 19) of the anti-WARS1 antibody light chain were respectively cloned into pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0111] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "S53V" (Table 8, Figures 3a and 3b).

[0112]

Table 8

[0113] Example 2.5. Production of S53Q To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of an anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 58) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 29) and a constant region (Accession No. 19) of an anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0114] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "S53Q" (Table 9, Figures 3a and 3b).

[0115] [Table 9]

[0116] Example 2.6. Production of H54I To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of an anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 59) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 31) and a constant region (Accession No. 19) of an anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0117] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "S53I" (Table 10, Figures 3a and 3b).

[0118]

Table 10

[0119] Example 2.7. Production of H54L To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of an anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 60) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 33) and a constant region (Accession No. 19) of an anti-WARS1 antibody light chain were respectively cloned into pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0120] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "H54L" (Table 11, Figures 3a and 3b).

[0121]

Table 11

[0122] Example 2.8. Production of H54K To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of the anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 61) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 35) and a constant region (Accession No. 19) of the anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0123] The vector was introduced into Expi293 cells by the same method as in Example 1, and the antibody was isolated and purified, and named "H54K" (Table 12, Figures 3a and 3b).

[0124]

Table 12

[0125] Example 2.9. Production of H54Q To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of the anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 62) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 37) and a constant region (Accession No. 19) of the anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0126] The vector was introduced into Expi293 cells by the same method as in Example 1, and the antibody was isolated and purified, and named "H54Q" (Table 13, Figures 3a and 3b).

[0127]

Table 13

[0128] Example 2.10. Production of H54F To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of an anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 63) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 39) and a constant region (Accession No. 19) of an anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0129] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "H54F" (Table 14, Figures 3a and 3b).

[0130]

Table 14

[0131] Example 2.11. Production of SH / IL To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of the anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 64) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 41) and a constant region (Accession No. 19) of the anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0132] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "SH / IL" (Table 15, Figures 3a and 3b).

[0133]

Table 15

[0134] Example 2.12. Production of SH / LL To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of the anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 65) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 43) and a constant region (Accession No. 19) of the anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0135] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "SH / LL" (Table 16, Figures 3a and 3b).

[0136]

Table 16

[0137] Example 2.13. Production of SH / QL To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of an anti-WARS1 antibody heavy chain, a linker (Accession No. 50), and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 66) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 45) and a constant region (Accession No. 19) of an anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0138] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "SH / QL" (Table 17, Figures 3a and 3b).

[0139]

Table 17

[0140] Example 2.14. Production of SHL / ILN To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of the anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 67) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 47) and a constant region (Accession No. 19) of the anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0141] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "SHL / ILN" (Table 18, Figures 3a and 3b).

[0142]

Table 18

[0143] Example 2.15. Production of SHL / LLN To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of the anti-WARS1 antibody heavy chain, a linker (Accession No. 50) and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 68) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 48) and a constant region (Accession No. 19) of the anti-WARS1 antibody light chain were respectively inserted into the pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0144] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "SHL / LLN" (Table 19, Figures 3a and 3b).

[0145]

Table 19

[0146] Example 2.16. Production of SHL / QLN To produce an antibody that specifically binds to WARS1 (Accession No. 94), a polynucleotide (Accession No. 52) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 9) and a constant region (Accession No. 10) of an anti-WARS1 antibody heavy chain, a linker (Accession No. 50), and an Fc region (Accession No. 51), and a polynucleotide (Accession No. 69) encoding a polypeptide comprising a signal peptide (Accession No. 1), a variable region (Accession No. 49) and a constant region (Accession No. 19) of an anti-WARS1 antibody light chain were respectively inserted into pOptiVEC (Thermo fisher, Figure 1) and pcDNA3.3 vector (Thermo fisher, Figure 2).

[0147] The vector was introduced into Expi293 cells by the same method as in Example 1 to isolate and purify the antibody, which was named "SHL / QLN" (Table 20, Figures 3a and 3b).

[0148]

Table 20

[0149] Example 3. Confirmation of the binding ability of anti-WARS1 antibody to WARS1 Example 3.1. Confirmation of the binding ability of anti-WARS1 antibody to WARS1 at the in vitro level The binding ability of the anti-WARS1 antibody of the present invention prepared by the same method as in Example 1 and Example 2 to the WARS1 protein was confirmed by Direct ELISA and sandwich ELISA methods.

[0150] Specifically, for direct ELISA, 1 μg / mL of recombinant protein WARS1 derived from human, marmoset (NHP), mouse, rat, or pig was coated onto a 96-well plate (Maxisorp, Thermo Fisher), and then blocked with PBS containing 1% BSA at room temperature for 1 hour. Antibodies of GKB101 or its mutants were diluted in a concentration-dependent manner, added to each coated well, reacted at room temperature for 1 hour, and then washed four times with PBST (PBS + Tween 20). Each well was treated with an antibody conjugated with HRP (anti-Human IgG, Cell Signaling), reacted for 1 hour, and then washed with PBST. Finally, after color development with TMB substrate (BD), absorbance was measured at 490 nm (NIVO) (Figures 4a - 5).

[0151] For sandwich ELISA, 1 μg / mL of antibody of GKB101 or its mutant was coated onto a 96-well plate (Maxisorp, Thermo Fisher), and then blocked with PBS containing 1% BSA at room temperature for 1 hour. Recombinant WARS1 proteins from human, marmoset (NHP), mouse, rat, or pig were diluted in a concentration-dependent manner, added to each well coated with the antibody, reacted at room temperature for 1 hour, and then washed four times with PBST (PBS + Tween 20). Each well was reacted with an anti-his tag antibody (Santa Cruz) for 1 hour. After washing four times with PBST (PBS + Tween 20), it was reacted with an antibody conjugated with HRP (anti-Mouse IgG, Santa Cruz) for 1 hour, then color developed with TMB substrate (BD), and absorbance was measured at 490 nm (NIVO) (Figures 6a - 6c).

[0152] As a result, in the measurement and comparison of the binding affinity of the anti-WARS1 antibody to the recombinant WARS1 protein of GKB101 antibody and its mutant antibodies, it was confirmed that all of them had a binding affinity equal to or stronger than that of the GKB101 antibody against the recombinant WARS1 proteins derived from human, marmoset (NHP), mouse, rat, and pig.

[0153] For human-derived recombinant proteins, S53Q, H54K, SH / QL, SHL / ILN, SHL / LLN, and SHL / QLN antibodies have a K d value of approximately 10 -12 M, and for marmoset (NHP)-derived recombinant proteins, the K d values of SHL / ILN, SHL / LLN, and SHL / QLN antibodies are at approximately 10 -12 M level.

[0154] For mouse-derived recombinant proteins, the K d values of S53V, S53Q, H54K, H54Q, SH / QL, SHL / ILN, SHL / LLN, and SHL / QLN antibodies are approximately 10 -12 M. For rat-derived recombinant proteins, the K d values of S53V, S53Q, H54L, H54K, H54Q, SH / QL, SHL / ILN, SHL / LLN, and SHL / QLN antibodies are approximately 10 -12 M. For pig-derived recombinant proteins, the K d values of S53L, S53V, S53Q, H54K, and H54Q antibodies are approximately 10 -9 M. As a result, high binding affinity with a K d value of approximately 10 -12 M level was observed for S53V, S53Q, H54L, H54K, H54Q, SH / QL, SHL / ILN, SHL / LLN, and SHL / QLN antibodies against the WARS1 recombinant protein.

[0155] Example 3.2. Confirmation of the binding ability of anti-WARS1 antibody to WARS1 using Western blot The binding ability of the anti-WARS1 antibody of the present invention prepared by the same method as in Example 1 and Example 2 to the WARS1 protein was confirmed by Western blot.

[0156] At this time, WARS1 recombinant protein (derived from human, mouse, pig, marmoset (NHP) or rat), cell culture supernatant and human or mouse serum were used as the WARS1 protein sample. In particular, the cell culture supernatant was obtained by treating the human monocyte cell line THP-1 or the mouse macrophage cell line J774.1A with LPS (lipopolysaccharide, 100 ng / mL) for 24 hours to induce an inflammatory response, and then using the supernatant of the cell culture.

[0157] 30 μg each of WARS1 recombinant protein (derived from human, mouse, pig, marmoset (NHP) or rat), the cell supernatant obtained by the above method, and mouse or human serum were loaded onto 8% SDS-PAGE, and then transferred to a PVDF membrane (Millipore). Then, the membrane was reacted with 1 μg / mL of GKB101 or its mutant antibody for 1 hour each, and then washed 3 times with TBST (TBS + Tween 20). Then, after reacting with a secondary antibody (anti-human IgG HRP, Millipore) for 1 hour, it was washed 3 times with TBST, treated with ECL (West (registered trademark) bright ECL, Advanta), and protein expression was confirmed (LAS-4000, Fujifilm).

[0158] As a result, as shown in Figure 7, all of the GKB101 antibody and its mutant antibodies of the present invention were able to specifically detect WARS1 in the recombinant protein, the culture supernatant of THP-1 cells or J774A.1 cells, and human or mouse serum. In particular, the S53I, S53L, S53V, S53Q, H54I, H54K, H54Q, H54F and SH / LL antibodies were able to detect the recombinant protein derived from pig equally or more effectively than the GKB101 antibody.

[0159] Example 4. Epitope mapping A peptide corresponding to the WHEP domain sequence of the human WARS1 protein of the produced anti-WARS1 antibody of the present invention and an alanine-mutated human WARS1 protein were prepared, and the binding ability of the anti-WARS1 antibody thereto was confirmed by the ELISA method.

[0160] Specifically, for epitope mapping using the peptide, after coating the anti-WARS1 antibody at a concentration of 1 μg / mL on a 96-well plate (Maxisorp, Thermo fisher), it was blocked with PBS containing 1% BSA at room temperature for 1 hour. Each peptide labeled with biotin was diluted in a concentration-dependent manner and added to each coated well, reacted at room temperature for 1 hour, and then washed 4 times with PBST (PBS + Tween20). Streptavidin (R&D systems) conjugated with HRP was added to each well, reacted for 1 hour, and then washed with PBST. Finally, after color development with TMB substrate (BD), the absorbance was measured at 490 nm (NIVO) (Figure 8).

[0161] As a result, among the GKB101 antibody and its mutant antibodies, S53L, H54K, SH / IL, SH / LL, SHL / ILN, and SHL / LLN all showed strong binding forces in the five peptides. Among these, for the peptide of the WHEP domain sequence of human WARS1, H54K, SH / QL, SHL / ILN, and SHL / QLN showed binding forces equal to or greater than those of GKB101 when compared.

[0162] For epitope mapping using a human recombinant WARS1 protein in which specific amino acids in the WHEP domain region were substituted, an anti-WARS1 antibody was coated on a 96-well plate (Maxisorp, Thermo fisher) at a concentration of 1 μg / mL, and then blocked with PBS containing 1% BSA at room temperature for 1 hour. Each WARS1 protein was diluted to 50 ng / mL and added to each coated well, reacted at room temperature for 1 hour, and then washed 4 times with PBST (PBS + Tween20). An anti-his tag antibody (Santa cruz) was reacted with each well for 1 hour. After washing 4 times with PBST (PBS + Tween20), it was reacted with an HRP-conjugated antibody (anti-mouse IgG, Santa cruz) for 1 hour, developed with TMB substrate (BD), and then the absorbance was measured at 490 nm (NIVO) (Figs. 9a - 9c).

[0163] As a result, it was found that the sequences R20, R24, K27, I36, I43, and K47 of the human WARS1 WHEP domain were all common epitopes for the GKB101, S53I, S53Q, S53I, H54K, and H54Q antibodies.

[0164] Example 5. Confirmation of the neutralizing ability of specific antibodies of anti-WARS1 antibody to WARS1 in vitro The neutralizing ability of the anti-WARS1 antibody of the present invention produced by the same method as in Example 1 and Example 2 against WARS1 was confirmed in vitro.

[0165] Specifically, mouse macrophage cell line J774A.1 cells were seeded at 4 × 10 4 cells / well in a 96-well cell culture plate (Nunc) and cultured for 24 hours. At this time, the cells were cultured using high glucose DMEM (Gibco) containing 10% FBS and 1% penicillin-streptomycin. The antigen-antibody mixture was prepared by mixing human-derived WARS1 recombinant protein (5 μg) and the anti-WARS1 antibody of the present invention (5 μg) and reacting them in an incubator at 37°C for 2 hours.

[0166] Two hours before treating the cells with the antigen - antibody mixture, the cell culture medium was freshly exchanged, and then the antigen - antibody mixture prepared by the above method was used to treat the cells in each well. After about 15 hours, the culture solution of each cell was centrifuged, the supernatant was collected, and then the TNF - α concentration in the supernatant was measured (ELISA MAX TM Standard Set Mouse TNF - α, BioLegend). At this time, IgG was used as a control group for the anti - WARS1 antibody.

[0167] As a result, in mouse macrophages, among the 17 anti - WARS1 antibodies according to the present invention, 7 antibodies (GKB101, S53I, S53L, S53Q, H54K, SHL / LLN, and SHL / QLN antibodies) inhibited the increased TNF - α secretion by WARS1 by 40% or more. In addition, S53I, S53L, S53Q, and SHL / LLN antibodies showed neutralizing ability against WARS1 equal to or better than that of the GKB101 antibody (Figure 10).

[0168] Example 6. Confirmation of the activity of anti-WARS1 antibody in vivo To confirm the activity of the anti - WARS1 antibody of the present invention at the in vivo level, mice induced with severe sepsis by injecting CS (cecal slurry) were used.

[0169] Specifically, CS (cecal slurry) was injected into mice (C57BL / 6, Korea BioLink, 8 - week - old) at a dose of 21 mg, and Isotype IgG1, GKB101 antibody, S53I antibody, S53Q or S53K antibody were intraperitoneally administered 3 times in total at concentrations of 2.5 mg / kg, 5 mg / kg, or 10 mg / kg at 4 hours, 8 hours, and 12 hours later (Figure 11). Then, the survival of the mice was observed up to 72 hours.

[0170] As a result of performing efficacy evaluation using S53I, S53Q, and H54K in a severe sepsis mouse model, in the case of S53I, there was no tendency for the survival rate to increase in a dose - dependent manner, while for S53Q and H54K antibodies, it was confirmed that the survival rate increased significantly at concentrations of 2.5 mg / kg and 10 mg / kg.

[0171] Hereinafter, the improvement effect of the anti-WARS1 antibody on inflammatory diseases through examples was confirmed using H54K, which is a variant of the anti-WARS1 antibody. Therefore, in the following examples, the anti-WARS1 antibody, H54K, and M105A can be described in a mixed manner.

[0172] II. Evaluation of the efficacy of anti-WATRS1 antibody in suppressing respiratory injury using a chronic obstructive pulmonary disease mouse model Example 7. Confirmation of the anti-inflammatory activity of anti-WARS1 antibody in chronic obstructive pulmonary disease-related cell lines To confirm the therapeutic effect of the anti-WARS1 antibody (H54K) on chronic obstructive pulmonary disease, the anti-inflammatory activity of the anti-WARS1 antibody was confirmed using cells involved therein.

[0173] At this time, human lung fibroblast cell line (HLF, ATCC, PCS-201-013) was used as the cells and cultured in DMEM containing 10% FBS and 1% antibiotic / antifungal agent.

[0174] Specifically, the cell line was inoculated into a 96-well plate at 2×10 4 cells / well and cultured in DMEM containing 0.1% FBS for 24 hours. At this time, WARS1 (10 μg / mL) and anti-WARS1 antibodies (3C6, GKB101, H54K, 5 μg / mL) or PBS were mixed and reacted at 37°C for 1 hour. The prepared WARS1 / anti-WARS1 antibody mixture was treated with the prepared cells and cultured for an additional 16 hours. After 16 hours, the culture medium was taken, and the concentrations of IL-8 (Biolegend, 430515) and IL-6 (BioLegend, #431304) in the culture medium were measured by ELISA. At this time, WARS1 treated with PBS was used as the control group.

[0175] As a result, as shown in Fig. 14, in human lung fibroblasts, in the WARS1 alone treatment group (control group), the secretion of IL-8 and IL-6 increased. On the contrary, in the WARS1 and anti-WARS1 antibody treatment group, the secretion of IL-8 and IL-6 decreased in a concentration-dependent manner compared with the control group. In particular, it was confirmed that the decrease was the largest in the H54K antibody treatment group.

[0176] Example 8. Preparation of standard tobacco extract As experimental materials, 60 standard tobacco CM7 (coresta monitoring cigarette 7), isopropanol (Merck), ethanol (Merck), and n-heptadecane (Sigma-Aldrich) were prepared. As experimental equipment, an automatic smoking machine (automatic smoking machine, ISO3308 standard product, model: RM20, Heinr Borgwaldt) was used.

[0177] Example 8.1. Collection of Standard Tobacco Smoke The collection of standard tobacco CM7 smoke condensate was carried out in a smoking room (temperature 22 ± 2 °C, relative humidity 60 ± 5%) based on the ISO3402 regulation. Using the RM20 automatic smoking machine based on the ISO3308 regulation, the smoking volume was 35.0 ± 0.3 mL, the smoking cycle was 60 ± 0.5 seconds, the smoking time was 2.00 ± 0.02 seconds, and the length of the butt was the tip paper length + 3 mm (overwrap + 3 mm). The cigarette was burned by the ISO standard smoking method, and the tobacco smoke condensate was collected with a 92 mm Cambridge filter (Cambridge filter, ISO3308 standard product).

[0178] Example 8.2. Measurement of the Weight of Tobacco Smoke Condensate Before smoking, the weight of the cigarette holder with the Cambridge filter before combustion was measured according to the ISO 4387 standard. After combustion by the method of Example 8.1, the condensate of the tobacco smoke was collected by the Cambridge filter, and the weight of the cigarette holder was measured. The content of the condensate of the tobacco smoke (TPM, total particulate matter) was calculated (ISO 4387, 2000). When the standard tobacco was burned three times, the weight of TPM was 16.0621 mg for 19 cigarettes, 15.9135 mg for 20 cigarettes, and 15.5380 mg for 20 cigarettes. Therefore, the total number of standard tobacco samples was 59, and the weight of TPM was 47.5136 mg.

[0179] Example 8.3. Extraction of Standard Tobacco Smoke Condensate The Cambridge filter that had collected the tobacco smoke condensate by the method of Example 8.1 was separated from the cigarette holder and placed in a 100 mL Erlenmeyer flask each. 50 mL of the extraction solvent isopropanol was added to each and mixed. The mixture was left standing at room temperature for 8 hours or more to extract the tobacco smoke condensate. After extraction, the extract was filtered, concentrated with a vacuum filtration concentrator, and the concentrated solutions in the three Erlenmeyer flasks were collected in a scintillation vial and completely concentrated using nitrogen gas.

[0180] In the tobacco smoke condensate concentrated by the above method, the content of total particulate matter (TPM) was calculated using the following formula 1.

[0181] <Formula 1> TPM (mg / cig) = (W FHA - W FBH ) / N Here, TPM: Total particulate dust matter WFHA: Weight of the Filter Holder after smoking WFHB: Weight of the Filer Holder before smoking N: Number of cigarettes smoked per trap (cig.)

[0182] Example 9. Verification of the Effect of Anti-WARS1 Antibody on Suppressing Respiratory Injury Using a Mouse Model of Chronic Obstructive Pulmonary Disease Example 9.1. Establishment of a Mouse Model of Chronic Obstructive Pulmonary Disease Seven-week-old male specific pathogen-free (SPF) BALB / c mice (18 g to 20 g) were supplied by Orient Bio Inc. The animals were sufficiently provided with solid samples (antibiotic-free, Samyang samples) and water until the day of the experiment, and were allowed to acclimatize for one week in an environment with a temperature of 22 ± 2°C, humidity of 55 ± 15%, and a 12-hour light-dark cycle before being used in the experiment. And for the ethical, scientific validity examination and efficient management of the animal experiment, approval was obtained from the Institutional Animal Care and Use Committee (IACUC) of Daejeon University.

[0183] The LPS / CS mixture for establishing a chronic obstructive pulmonary disease (COPD) mouse model was prepared by mixing 100 μg / mL of lipopolysaccharide (LPS) and 4 mg of cigarette smoking extract (CSE) at a ratio of 1:1. After seven-week-old male BALB / c mice were anesthetized with ketamine and rumph, the LPS / CS mixture was aspirated into the mice's nose and mouth at a total of 100 μl per mouse (50 μl each) once a week for three weeks by the intra-nazal-trachea (INT) injection method to create a COPD mouse model.

[0184] At this time, the experimental groups were divided into i) an untreated normal group (Normal), ii) a PBS control group (CON), iii) an Isotype IgG1 antibody (3 mg / kg, i.p.) administration group, and iv) an anti-WARS1 antibody (H54K) administration group. At this time, each sample was administered 1 hour before the administration of LPS and CS (Figure 15). Hereinafter, in the present invention, the H54K antibody, which is the anti-WARS1 antibody, can be described as being used in combination with the M105A antibody.

[0185] After the experiment, blood, bronchoalveolar lavage fluid, and lung tissue were isolated from the mice to evaluate the respiratory injury inhibitory effect of the anti-WARS1 antibody (H54K). At this time, the result values of each experimental group were expressed as mean ± standard error of the mean (SEM), and the numerical data between experimental populations were verified for significance by Duncan's multiple comparison tests after one-way analysis of variance (ANOVA).

[0186] Example 9.2. Pathological Analysis of Lung Tissue The airway and lung tissues obtained from the experimental mice of Example 9.1 were stained with hematoxylin and eosin (H&E) staining, Masson Trichrome staining (M-T staining), or Periodic acid-Schiff (PAS)-Alcian Blue (AB) staining methods, respectively, and then the tissue morphology was analyzed by observation with an optical microscope.

[0187] Example 9.2.1. Observation of Inflammatory Immune Cell Infiltration in Airways and Lung Tissue through H&E Staining Specifically, after the administration was completed, the excised airway and lung tissues were reacted with 4% paraformaldehyde (PFA) for one day for fixation, and then paraffin tissue section slides were prepared. The paraffin tissue section slides were washed three times with xylene solution and 100% ethanol, respectively, to remove the paraffin.

[0188] The tissue slides from which paraffin had been removed through the above process were reacted with hematoxylin solution for 5 minutes, and then washed successively with running water and 1% hydrochloric acid. Then, after washing the slides with running water, they were neutralized with 1% ammonia solution (diluted in 70% ethanol), washed again with running water, and reacted with eosin solution for 2 minutes. After the reaction was completed, the slides were reacted successively with 70% - 100% ethanol solutions and reacted with xylene solution for 3 minutes. At this time, the process of reacting with the xylene solution was carried out a total of 3 times. Finally, after enclosing the tissue slides with a cover slip, the morphology of the tissue was observed with an optical microscope.

[0189] As a result, as shown in Fig. 16a, compared with the normal group, infiltration of inflammatory immune cells was observed around the airways in the IgG1 administration group. In addition, it was observed that destruction of alveolar cells due to exacerbation of inflammation also progressed. On the other hand, in the anti-WARS1 antibody (H54K) administration group, it was confirmed that infiltration of inflammatory immune cells decreased and alveolar cells were maintained.

[0190] Example 9.2.2. Observation of Collagen Deposition in Lung Tissue through Masson Trichrome Staining Masson Trichrome (M-T) staining was performed on lung tissue slides prepared by the same method as in Example 9.2.1.

[0191] Specifically, after reacting the paraffin-removed slides with Bouin's solution at 60°C, taking them out and cooling them, they were sequentially reacted with Weigert's Hematoxylin solution, Briebrich Scarlet solution, Phosphotungstic phosphomolybdic acid, and Aniline blue solution. Finally, after reacting with 1% acetic acid solution, the lung tissue section slides were sealed with a cover slip, and the degree of collagen deposition in the tissue was confirmed with an optical microscope.

[0192] As a result, as shown in Fig. 16a, high collagen deposition was observed around tracheole and alveolar cells in the IgG1 administration group. On the other hand, it was confirmed that collagen deposition as described above decreased in the anti-WARS1 antibody (H54K) administration group.

[0193] Example 9.2.3. Observation of Mucus Secretion in Airway Tissue through Periodic acid-Schiff-Alcian Blue Staining Airway tissues excised from the experimental mice of Example 9.1 were stained by the Periodic acid-Schiff-Alcian Blue (PAS-AB) staining method using Periodic Acid Schiff (Sigma Aldrich, 395B) on tissue slides prepared by the same method as in Example 9.2.1.

[0194] Specifically, tissue slides from which paraffin had been removed were sequentially reacted with an Alcian blue solution, a 0.5% Periocid acid solution, and a Schiff's solution. After reaction with each solution, the slides were thoroughly washed with running water. After the slides stained through the above process were reacted with a hematoxylin solution, they were washed with water and then sequentially reacted with ethanol solutions with concentrations of 70% to 100% for dehydration. Finally, the tissue slides were sealed with a cover glass and then observed under an optical microscope.

[0195] As a result, as shown in Fig. 16b, it was observed that in the anti-WARS1 antibody (H54K) administration group, the amount of mucus in goblet cells existing around the airways decreased compared with the IgG1 administration group.

[0196] Example 9.3. Analysis of Inflammatory Cytokine Concentrations in Airways, Bronchoalveolar Lavage Fluid, Lung Tissue, and Serum In the lung tissue obtained from the experimental mice of Example 9.1, the concentrations of inflammatory cytokines and chemokines were measured.

[0197] At this time, the samples were collected as follows. First, for the bronchoalveolar lavage fluid, after the bronchi and lung tissues were washed with 1 mL of PBS by tracheal intubation of the mouse, the fluid was collected. The washing fluid was used as the bronchoalveolar lavage (BAL) fluid (BALF).

[0198] Also, a part of the lung tissue was excised, protein lysis buffer was added to a concentration of 100 μg / mL, and the tissue was lysed. The lysate was centrifuged at 13,000 rpm, and only the supernatant was collected and used as a lung tissue sample.

[0199] For the serum sample, after blood was obtained by cardiac puncture, it was transferred to a heparin tube and centrifuged at 2,000 rpm for 20 minutes at room temperature to obtain the sample.

[0200] For each sample obtained through the above process, the concentrations of mCXCL2 / MIP-2, mIL-6, and mMIP1α were measured for each cytokine or chemokine using mouse CXCL2 / MIP-2 ELISA (R&D systems), mouse IL-6 ELISA (BioLegend), and mouse MIP1-α ELISA (R&D systems) kits.

[0201] As a result, as shown in Figure 17a (bronchoalveolar lavage fluid) and Figure 17b (lung tissue), CXCL1 and CXCL2, IL-6, TNFα, and TARC increased in the Isotype IgG1 administration group or the PBS administration group compared to the normal group. On the contrary, it was observed that in the anti-WARS1 antibody (H54K) administration group, it decreased by about 1 / 4 to about 1 / 2 compared to the Isotype IgG1 administration group or the PBS administration group. All data were expressed as standard error of the mean (SEM) and analyzed using an ANOVA statistical program.

[0202] Also, to confirm gene expression, a part of the lung tissue was excised, and after adding Trizol (invitrogen, 15596026), mRNA was extracted according to the manufacturer's protocol. Using the mRNA as a template, cDNA was synthesized using the cDNA EcoDry Premix (Random Hexamers) kit (Takara, 639546), and the expression of each gene was confirmed by q-PCR using SYBR Green real-time PCR master mix (Applied biosystems, 4309155). At this time, the primers used are shown in Table 21 below.

[0203]

Table 21

[0204] As a result, as shown in Fig. 17c, it was confirmed that the expression of cough-inducing genes (MUC5AC, TRPA1, TRPV1) and eotaxin, an eosinophil inflammation gene, was significantly increased in the PBS administration group compared to the normal group. On the other hand, in the anti-WARS1 antibody (H54K) administration group, it was confirmed that the expression of the above genes was decreased compared to the PBS administration group or the Isotype IgG1 administration group.

[0205] From the above results, it was confirmed that the anti-WARS1 antibody (H54K) can suppress the expression of inflammatory cytokines, chemokines, cough-inducing genes and eosinophil inflammation genes in COPD model mice.

[0206] Example 9.4. Analysis of Immune Cells in Airways, Bronchoalveolar Lavage Fluid, Lung Tissue, and Serum The serum, bronchoalveolar lavage fluid and immune cells in the lung tissue obtained from the experimental mice of Example 9.1 were analyzed by flow cytometry.

[0207] At this time, the bronchoalveolar lavage fluid was obtained by the same method as in Example 9.3.

[0208] Lung tissue samples were prepared by the following method. First, a part of the lung tissue was mixed with a collagenase solution at a concentration of 1 mg / mL, pulverized using a GentleMacs C-tube, and then cultured with shaking at 37°C for 30 minutes. The shaken culture solution was passed through a 70 μm cell strainer to collect single cells.

[0209] Immunofluorescence staining was performed on the lung tissue samples prepared as described above and the cells obtained from the bronchoalveolar lavage fluid. At this time, the antibodies used were PE-anti-CD3e antibody (553064, BD Pharmingen), FITC-anti-CD8 antibody (553031, BD Pharmingen), PE-anti-CD4 antibody (553047, BD Pharmingen), PE-anti-Gr-1 antibody (553128, BD Pharmingen), FITC-anti-CD69 antibody (55732, BD Pharmingen), FITC-anti-CD11b antibody (553310, BD Pharmingen) and PE-anti-B220 antibody (561878, BD Pharmingen). Each of the above antibodies was treated with the respective cells and allowed to react in the dark at 4°C for 30 minutes. After the reaction, the cells were washed with FACS buffer (0.5% FBS, 0.02% NaN 3 in PBS) more than three times and then analyzed by flow cytometry. The above analysis values were used with the FlowJo program (FlowJo TM v7 Software, BD Biosciences) to classify the respective immune cells into CD3+, CD4+, CD8+, CD4+CD69+, CD8+CD69+, CD4+CD62L-CD44+high, Gr-1+SiglecF- (neutrophils), CD11b+Gr-1+ (granulocytes), Gr-1-SiglecF+ (eosinophils) and Gr-1+highSiglecF+ (eosinophils_high), and analyze the distribution (%) of each cell.

[0210] As a result, as shown in FIGS. 18a, 18b and 20, compared with the normal group, the number of infiltrated total cells and lymphocytes (especially B lymphocytes, activated T lymphocytes), neutrophils, macrophages and granulocytes increased by about 3 to 100 times in the Isotype IgG1 administration group or the PBS administration group. On the contrary, in the anti-WARS1 antibody (H54K) administration group, it was observed that the level decreased to approximately 1 / 2 at most compared with the Isotype IgG1 administration group or the PBS administration group. All data were expressed as standard error of the mean (SEM) and analyzed using an ANOVA statistical program.

[0211] Example 9.5. Analysis of Immune Cells in Mediastinal Lymph Nodes The immune cells in the mediastinal lymph nodes obtained from the mouse experiment of Example 9.1 were analyzed by the same method as in Example 9.4.

[0212] The mediastinal lymph node samples were prepared as follows. First, after laparotomy of the chest, the medial bilateral and lateral bilateral mediastinal lymph nodes located in the superior vena cava near the thymus were excised using scissors and forceps, and then passed through a 70-μm cell strainer to recover single cells.

[0213] Immunofluorescent staining was performed on the mediastinal lymph node cells prepared as described above using the same antibodies and method as in Example 9.4. The flow cytometry values were classified into CD3+, CD4+, CD8+, CD4+CD69+, CD8+CD69+ and CD11c+B220- immune cells respectively using the FlowJo program (FlowJo TM v7 Software, BD Biosciences), and the distribution (%) of each cell was analyzed.

[0214] As a result, as shown in FIG. 19, it was confirmed that the total number of infiltrated cells increased in the Isotype IgG1 administration group or the PBS administration group compared with the normal group. In particular, in the IgG1 administration group, CD4+ T lymphocytes and CD8+ T lymphocytes increased and were activated by more than 5-fold. On the contrary, in the anti-WARS1 antibody (H54K) administration group, it was observed that the level decreased to approximately 1 / 2 at most compared with the Isotype IgG1 administration group or the PBS administration group. All data were expressed as standard error of the mean (SEM) and analyzed using the ANOVA statistical program.

[0215] Example 9.6. Analysis of Immune Cells in Blood Immune cells in the erased blood mononuclear cells (PBMC, peripheral blood mononuclear cell) obtained from the mouse experiment of Example 9.1 were analyzed by the same method as in Example 9.4. At this time, the PBMC sample was prepared by opening the chest, collecting blood from the ventricle with a heparin (20 - 30 μl) syringe, mixing the blood with ACK solution (Thermos Fisher, A1049201), and removing red blood cells.

[0216] Immunofluorescence staining was performed on the immune cells in the PBMC prepared as described above. At this time, the antibodies used were PE - anti - CD3e antibody (553064, BD Pharmingen), FITC - anti - CD8 antibody (553031, BD Pharmingen), PE - anti - CD4 antibody (553047, BD Pharmingen), PE - anti - Gr - 1 antibody (553128, BD Pharmingen), FITC - anti - CD19 antibody (553785, BD Pharmingen), and PerCP Cy5 - anti - SiglecF antibody (565526, BD Pharmingen). Each of the above antibodies was treated with the respective cells and allowed to react in the dark at 4°C for 30 minutes. After the reaction, the cells were washed with FACS buffer (0.5% FBS, 0.02% NaN 3 in PBS) and then analyzed by flow cytometry. The above analysis values were used with the FlowJo program (FlowJo TM v7 Software, BD Biosciences) to classify the respective immune cells into CD3+, CD19+, CD4+, CD8+, and Gr - 1+SiglecF - (neutrophils), and analyze the distribution (%) of each cell.

[0217] As a result, as shown in Figure 20, compared with the normal group, the distribution of lymphocytes in the blood increased in the Isotype IgG1 administration group or the PBS administration group. On the contrary, in the anti - WARS1 antibody (H54K) administration group, it was observed that the distribution decreased by approximately 30% compared with the PBS or Isotype IgG1 administration group. All data were expressed as standard error of the mean (SEM) and analyzed using the ANOVA statistical program.

[0218] III. Verification of the Effect of Anti-WARS1 Antibody on Improving Inflammatory Bowel Disease Example 10. Verification of the Effect of Anti-WARS1 Antibody Treatment on Improving Intestinal Permeability in Colorectal Cancer Cell Lines To confirm the therapeutic effect of the anti-WARS1 antibody (H54K) against inflammatory bowel disease, the effect of improving intestinal permeability by treating with the anti-WARS1 antibody was confirmed using intestinal epithelial cells.

[0219] At this time, human intestinal epithelial cell line (Caco-2, ATCC, HTB-37) was used for the cells. The cells were cultured in DMEM medium containing 10% FBS and 1% antibiotic / antifungal agent.

[0220] Specifically, the cell line was seeded at 3×10 in a 6-well plate 5Cells were each inoculated into wells and cultured in DMEM medium containing 0.1% FBS for 24 hours. At this time, WARS1 (10 μg / mL) and anti-WARS1 antibodies (3C6, GKB101, H54K, 5 μg / mL) or PBS were mixed and reacted at 37°C for 1 hour to prepare. The prepared WARS1 / anti-WARS1 antibody mixture was treated with the prepared cells and cultured for an additional 16 hours. After 16 hours, the culture medium was removed and fixed with 4% formaldehyde at room temperature for 5 minutes. The fixed cells were treated with 0.1% Triton X-100 and reacted for 5 minutes to enhance the cell permeability of the antibody. After blocking with 2% BSA for 1 hour, the anti-human ZO-1 (Invitrogen, 1A12) antibody was diluted 1:500 in 1% BSA, treated with the cells, and reacted at 4°C overnight. Then, the secondary antibody conjugated with FITC (Jackson ImmunoResearch, 200-002-037) was diluted 1:1000 in 1% BSA, treated with the cells, and reacted at room temperature for 1 hour. The cell nuclei were treated with DAPI (4’,6-diamidino-2-phenylindole, Sigma-Aldrich, D8417) (1 μl) and stained. The fluorescence-stained cells were confirmed using a confocal microscope (LSM700 confocal laser scanning microscope, Carl Zeiss). Also, the cell images were analyzed using Zen 3.0 software (blue edition).

[0221] As a result, as shown in Figure 37, when WARS1 was treated on intestinal epithelial cells (Caco-2 cells), the expression of ZO-1 (tight junction) decreased, but it was confirmed that it reopened again by treatment with the anti-WARS1 antibody. In particular, the largest recovery effect was observed in the H54K antibody treatment group.

[0222] Through the above results, it was confirmed that the intestinal permeability can be improved by the anti-WARS1 antibody in inflammatory bowel disease.

[0223] Example 11. Verification of the Effect of Anti-WARS1 Antibody on Improving Inflammatory Bowel Disease Using a Mouse Model of Inflammatory Bowel Disease Example 11.1. Establishment of a Mouse Model of Inflammatory Bowel Disease The DSS mouse model (dextran sulfate sodium-induced colitis model) was used as a mouse model of inflammatory bowel disease. Female B57BL / 6 mice (Orient Bio Inc.) aged 6 to 10 weeks were used and housed in an SPF experimental animal room where a constant temperature and humidity were maintained at 21 - 23°C and 40 - 45% relative humidity, respectively. Also, the number of experimental animals per cage was kept at 4 or less, and the cages were changed and the feed was supplied three times a week.

[0224] DSS (MP biomedical, reagent-grade, MW 36 - 50 kDa, 160110) was dissolved in sterilized water at a concentration of 2.5%. Then, 100 mL of the 2.5% DSS solution per mouse cage was replaced and supplied once every two days. Clinical examinations were regularly performed until the end of the experiment to confirm the degree of inflammation progression and the body weight was measured. At this time, if the body weight decreased by 25% or more from the body weight on the test start day, euthanasia was performed from an ethical dimension. The experiment ended when it was judged that the clinical index of the control group reached the maximum on the 7th to 8th day from the start of the experiment.

[0225] The test groups were divided into a total of 4 groups (Figure 21). The administration of DSS was started on day 0, and on days 1, 3, and 5, a negative control substance (vehicle, saline), Isotype IgG1 (5 mg / kg, Bio X cell, BP0297), and anti-WARS1 antibody (GKB101, H54K, 5 mpk each) were intraperitoneally administered, respectively. At this time, saline as the vehicle was orally administered.

[0226] The occurrence and degree of inflammation were observed once a day from the start to the end of the experiment, scored from 0 to 4 points, and the total was used as the disease activity index (DAI). Also, the body weight was measured once a day, scored from 0 to 4 points, and used for DAI measurement.

[0227] All data were expressed as standard error of the mean (SEM) and analyzed using an ANOVA statistical program.

[0228] Example 11.2. Clinical Index Evaluation Example 11.2.1. Clinical Activity Index Evaluation In the DSS mouse model, in order to confirm the effect of anti-WARS1 antibody on improving inflammatory bowel disease, the clinical activity index (disease activity index: DAI) was quantitatively evaluated based on the occurrence of inflammatory symptoms and changes in body weight of the experimental mice in Example 11.1 (Figure 22a).

[0229] As a result, as shown in Figure 22b, the clinical activity index (disease activity index: DAI) was significantly decreased in the anti-WARS1 antibody (GKB101, H54K) administration group compared with the control group (saline), and it was confirmed that the decrease was particularly significant in the H54K administration group (*p < 0.05, ****p < 0.0001).

[0230] Similar trends were also observed from the results of analyzing the AUC (area under the curve) of the clinical indicators during the administration period of the clinical indicators.

[0231] Through the above results, it was confirmed that the anti-WARS1 antibody, especially H54K, has an effect on improving inflammatory bowel disease.

[0232] Example 11.2.2. Body Weight Evaluation In addition, as a result of evaluating the body weight loss score, which is one of the evaluation items of DAI, although the body weight loss was significant compared with the normal group (con), no statistically significant difference was observed in the anti-WARS1 antibody administration group compared with the Isotype IgG1 administration group.

[0233] Example 11.2.3. Evaluation of Intestinal Bleeding The rectal bleeding score of the experimental mice in Example 11.1 was evaluated.

[0234] As a result, as shown in Fig. 23, it was confirmed that intestinal bleeding was significantly reduced in the anti-WARS1 antibody (GKB101, H54K) administration group compared to the control group (saline) (****p < 0.0001). A similar trend was observed from the results of analyzing the AUC of the intestinal bleeding score during the administration period.

[0235] Example 11.2.4. Evaluation of Fecal Consistency Score The stool consistency score was evaluated in the experimental mice of Example 11.1.

[0236] As a result, as shown in Fig. 24, the stool consistency score decreased in the anti-WARS1 antibody (GKB101, H54K) administration group compared to the control group (saline). In particular, it was confirmed that the score significantly decreased in the H54K administration group (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001). A similar trend was observed from the results of analyzing the AUC of the stool consistency score during the administration period.

[0237] Example 11.2.5. Measurement of Intestinal Length Colon tissue was excised from the experimental mice of Example 11.1, and the length of the intestine was measured. As a result, as shown in Fig. 25, the length of the large intestine decreased in the control group (saline). On the contrary, in the anti-WARS1 antibody (GKB101, H54K) administration group, the damage to the large intestine was significantly reduced compared to the control group. In particular, it was confirmed that the reduction was significant in the H54K administration group (*p < 0.05).

[0238] Example 11.2.5. Measurement of Spleen Weight The spleen was excised from the experimental mice of Example 11.1, and the weight of the spleen was measured. As a result, as shown in Fig. 26, the spleen weight increased in the control group (PBS) compared to the untreated group. On the contrary, it was confirmed that the weight of the spleen significantly decreased in the anti-WARS1 antibody (H54K) administration group (**p < 0.01).

[0239] Example 11.3. Confirmation of the Expression of Immune Factors in Intestinal Tissue Intestinal tissues were excised from the experimental mice of Example 11.1 by site, proteins and mRNAs were isolated, and the expression of immune factors was confirmed in each sample.

[0240] Protein samples were prepared by the following method. First, after excising the entire intestine or the distal site, a protein lysis buffer was added to lyse the tissue. After centrifuging the lysate at 13,000 rpm, only the supernatant was obtained, quantified, and used as an intestinal tissue sample.

[0241] The proteins separated as described above were used to measure the concentrations of IL-1β (R&D systems, DY401), TNF-α (BioLegend, 430915), MCP-1 (R&D systems, DY479), IFN-γ (R&D systems, DY485), CXCL2 / MIP2 (R&D systems, DY425), IL-6 (BioLegend, 431315), IL-17A (R&D Systems, DY421), and MIP1α (R&D systems, DY450).

[0242] In addition, the expression of WARS1 was measured as follows. The 96-well plate (Maxisorp, Thermo fisher) was coated with the WARS1 monoclonal antibody at a concentration of 1 μg / mL and then blocked with PBS containing 1% BSA at room temperature for 1 hour. The sample or recombinant WARS1 was added to the coated wells respectively, reacted at room temperature for 1 hour, and then washed 4 times with PBST (PBS + Tween20). The anti-WARS1 antibody (MirimGENE Co., Ltd) was added to each well, reacted at room temperature for 1 hour, and then washed 4 times with PBST. After reacting with the secondary antibody conjugated with HRP (anti-rabbit IgG, HRP-conjugated antibody) for 1 hour, it was washed with PBST, developed with TMB substrate (BD), and the OD value was measured at 490 nm (VersaMax Microplate reader).

[0243] Trizol (invitrogen, 15596026) was added to the same intestinal site as the protein sample for mRNA, and then RNA was extracted using the RNeasy RNA isolation kit (QIAGEN) according to the manufacturer's protocol. Using the RNA as a template, cDNA was synthesized using the cDNA EcoDry Premix (Random Hexamers) kit (Takara, 639546), and the expression of immune factors was confirmed by q-PCR. At this time, the primers used are shown in Table 22.

[0244]

Table 22

[0245] As a result, as shown in Fig. 27, it was confirmed that the protein expressions of WARS1, TNF-α, IL-6, MIP1α and MCP-1 were significantly decreased in the anti-WARS1 antibody (GKB101, H54K) administration group compared with the control group (saline). In particular, more decrease was observed in the H54K antibody administration group. Also, the mRNA expressions of immune factors such as TNF-α, IFN-γ, MCP-1, IL-6 and iNOS were also significantly decreased in the anti-WARS1 antibody administration group compared with the control group, and in particular, it was confirmed that the most decrease was observed in the H54K antibody administration group (Fig. 28). At this time, it was confirmed that the expression of WARS1 in the intestinal tissue was also significantly decreased.

[0246] Through the above results, it was confirmed that the anti-WARS1 antibodies (GKB101, H54K) can suppress the expression of inflammatory immune factors in intestinal tissue in an inflammatory bowel disease model, and in particular, it was confirmed that the H54K variant antibody has more excellent inhibitory activity compared with the GKB101 antibody.

[0247] Example 11.4. Morphological Evaluation of Intestinal Tissue Intestinal tissue was excised from the experimental mice of Example 11.1, and H&E staining was performed in the same manner as in Example 9.2.1 to observe the morphology of the intestinal tissue.

[0248] As a result, as shown in Fig. 29, it was confirmed that the damage of intestinal tissue and the infiltration of immune cells were decreased in the anti-WARS1 antibody administration group compared with the control group (saline). In particular, the above effect was more excellent in the H54K antibody administration group than in the GKB101 antibody administration group.

[0249] IV. Verification of the Effect of Anti-WARS1 Antibody on Improving Rheumatoid Arthritis Example 12. Confirmation of the Anti-inflammatory Activity of Anti-WARS1 Antibody in Rheumatoid Arthritis-related Cell Lines To confirm the therapeutic effect of the anti-WARS1 antibody (H54K) on rheumatoid arthritis, the anti-inflammatory activity of the anti-WARS1 antibody was confirmed using cells involved in rheumatoid arthritis.

[0250] At this time, cells were osteoclasts differentiated from the human fibroblast-like synoviocyte cell line (FLS, fibroblast like synoviocyte cell line, cell applications, 408K-05a), the mouse macrophage cell line J774A.1 cells, and the mouse macrophage cell line RAW264.7 cells.

[0251] Specifically, the above cell lines were each seeded in a 96-well plate at 2×10 4 cells / well and cultured in DMEM containing 0.1% FBS for 24 hours. At this time, WARS1 (10 μg / mL) and anti-WARS1 antibody (H54K, 10 μg / mL) were mixed and reacted at 37°C for 1 hour for preparation. The prepared WARS1 / anti-WARS1 antibody mixture was treated with the prepared cells and cultured for an additional 16 hours. After 16 hours, the culture medium was taken, and the concentrations of CXCL2 (R&D systems, DY452), MMP3 (R&D systems, DY548), IL-6 (BioLegend, #431304), and TNF-α (BioLegend, #430904) in the culture medium were measured by ELISA. In the case of the J774A.1 cell experiment, IgG was used as a control group for the anti-WARS1 antibody. RAW264.7 cells were cultured in 10% FBS / DMEM medium containing 50 ng / mL of recombinant protein mouse RANKL (PeproTech, 315-11) for 5 days to induce differentiation into osteoclasts. Thereafter, only the differentiated osteoclasts were collected, and the ability of the anti-WARS1 antibody to inhibit the activity of osteoclasts was confirmed under the same conditions as the neutralization method of the above WARS1 (10 μg / mL) and anti-WARS1 antibody (H54K, 10, 12.5, 25 μg / mL).

[0252] As a result, as shown in Figure 30, it was confirmed that the inflammatory response through cell activity by the treatment of WARS1 was decreased by the treatment with the anti-WARS1 antibody (H54K) in osteoclasts derived from J774A.1 cells, FLS cells, and RAW264.7 cells.

[0253] Example 13. Verification of the Effect of Anti-WARS1 Antibody on Improving Rheumatoid Arthritis Using a Rheumatoid Arthritis Model Example 13.1. Establishment of a Rheumatoid Arthritis Model Using the CIA (Collagen-Induced Arthritis) mouse model, which is an arthritis model, the ameliorating effect of anti-WARS1 antibody (H54K) on inflammatory arthritis was confirmed.

[0254] As for the mice, 7-week-old male DBA / 1J mice were used and they were bred in an SPF experimental animal room where a constant temperature and humidity were maintained at 21 - 23°C and 40 - 45% relative humidity (IACUC No. 2021 - 0133).

[0255] Also, the number of experimental animals per cage was kept at 6 or less, and the cages were changed and the feed was supplied twice a week. First, to prepare the CIA mouse model, for the stimulant for arthritis induction, bovine type II collagen was dissolved in 10 mM acetic acid to a concentration of 2 mg / mL, and then it was mixed with CFA (Complete Freund’s adjuvant, 2 mg / mL) at 1:1 (v / v) for preparation. The collagen prepared by the above method was intradermally injected into the tails of 7-week-old mice at 100 μL per mouse to proceed with the primary immunization. 21 days after the primary immunization, IFA (Incomplete Freund’s adjuvant) and bovine type II collagen were mixed at 1:1 (v / v), emulsified, and then intradermally injected into the mouse tails at 100 μL per mouse to proceed with the secondary immunization. The mice that had undergone the secondary immunization were randomly divided and used as the experimental groups. The experimental groups were divided into an Isotype IgG1 administration group (5 mg / kg) and an anti-WARS1 antibody (H54K, 5 mg / kg) administration group. The administration was carried out by intraperitoneal injection 10 times in total, once every 2 days starting from the day of the secondary immunization (day 21).

[0256] Example 13.2. Clinical Index Evaluation of Arthritis In the experimental mice of Example 13.1, the onset of arthritis and the clinical evaluation of the severity in the feet were evaluated according to the clinical index criteria (Figure 32a) since the administration of the experimental substance began.

[0257] As a result, as shown in Fig. 32b, compared with the Isotype IgG1 administration group, the severity of arthritis decreased in the anti-WARS1 antibody (KB101, H54K) administration group, and it was confirmed that it significantly decreased especially in the H54K antibody administration group (IgG1 administration group vs anti-WARS1 antibody administration group (H54K), 7.85 ± 0.319 vs 4.59 ± 0.182, *p < 0.05). A similar aspect to the results during the administration period was also observed from the results of analyzing the AUC of the clinical arthritis severity (CAI, clinical arthritis index).

[0258] The arthritis incidence also decreased in the anti-WARS1 antibody (GKB101, H54K) administration group compared with the Isotype IgG1 administration group, and it was confirmed that it significantly decreased especially in the H54K antibody administration group (Isotype IgG1 vs anti-WARS1 antibody (H54K), 46.42 ± 7.945 vs 12.5 ± 3.689, **p < 0.01). It was also confirmed from the results of the AUC analysis of the arthritis incidence that it significantly decreased in the anti-WARS1 antibody (H54K) administration group compared with the Isotype IgG1 administration group (Isotype IgG1 vs anti-WARS1 antibody (H54K), 99.99 ± 9.817 vs 35 ± 3.931, *p < 0.05).

[0259] Through the above results, it was confirmed that the anti-WARS1 antibody has a therapeutic effect in the rheumatoid arthritis model, and especially that the H54K antibody is more effective than the GKB101 antibody.

[0260] Example 13.3. Analysis of the Concentrations of Inflammatory Factors and Osteoclast Factors in Serum and Ankle Joints In the experimental mice of Example 13.1, serum and foot joints were obtained, and the concentrations of inflammatory cytokines and chemokines were measured.

[0261] Specifically, after removing the skin tissue from the joint tissue of the mouse foot, a protein lysate buffer was added to lyse the tissue. The lysate was centrifuged at 13,000 rpm, and the supernatant was obtained, quantified, and used as joint tissue protein.

[0262] Using the protein, serum and WARS1, inflammatory cytokines and chemokines in the foot joints were measured by ELISA using the mouse CXCL2 / MIP-2 ELISA (R&D systems) kit, mouse IL-6 ELISA (BioLegend) kit, mouse MIP1-α ELISA (R&D systems) kit, MMP3 (R&D systems, DY548), IL-6 (BioLegend, #431304), TNF-α (BioLegend, #430904), IL-17A, IL-17F, MMP9, RANKL and IL-1β kits, and the method was carried out according to the manufacturer's method.

[0263] As a result, as shown in FIGS. 33a to 33d, it was observed that the concentrations of WARS1, IL-17A, IL-17F, TNF-α, IL-6, MIP1α, CXCL2 / MIP2 (IL-8 homologue), IL-1β and MMP3 were significantly decreased in the anti-WARS1 antibody (H54K) administration group compared with the Isotype IgG1 administration group (FIGS. 33a to 33d). At this time, all data were expressed as standard error of the mean (SEM) and analyzed using an ANOVA statistical program.

[0264] Through the above results, it was confirmed that the anti-WARS1 antibodies (GKB101, H54K) not only suppressed the expression of inflammatory cytokines and chemokines but also suppressed the expression of chondrocyte disrupting factor / osteoclast differentiation factor in the rheumatoid arthritis model.

[0265] V. Verification of the Effect of Anti-WARS1 Antibody on Improving Dermatitis Example 14. Confirmation of the Anti-inflammatory Activity of Anti-WARS1 Antibody in Human Skin Cell Lines In atopic dermatitis, to confirm the anti-inflammatory activity of the anti-WARS1 antibody (H54K) and its target mechanism for cell migration and proliferation inhibition, human dermal fibroblasts (adult) (HDFa, human dermal fibroblast adult, ATCC, PCS-201-012) and human keratinocytes (HaCat, human keratinocyte) were used. The cells were cultured in DMEM containing 10% FBS and 1% antibiotic / antifungal agent.

[0266] Specifically, to confirm the anti-inflammatory activity, HDFa and HaCat cells were seeded in 96-well plates at 2×10 4 cells / well and cultured in DMEM containing 0.1% FBS for 24 hours. To secrete WARS1, Staphylococcus aureus (antibiotic-resistant strain bank, CCARM2307) was treated at a multiplicity of infection (MOI) of 10, and PBS (vehicle) or 1.25 μg / mL of anti-WARS1 antibody (H54K) was treated respectively. After additional 16-hour culture, each cell culture supernatant was collected, and the concentrations of IL-8 (BioLegend, #431504), MCD1 (R&D systems, DY336), TARC (R&D systems, DY364) and WARS1 in the culture supernatant were measured using ELISA. At this time, the concentration of WARS1 in the cell culture supernatant was measured by the same method as in Example 11.3.

[0267] Also, to confirm the cell migration and proliferation inhibitory effects, HDFa and HaCat cells were seeded in 24-well plates at 1×10 5 cells / well and cultured in DMEM containing 0.1% FBS for 24 hours. Then, the culture bottom of the well was scratched using a micro-tip to form a certain cell-free space. Then, WARS1 (20 μg / mL) and anti-WARS1 antibody (H54K, 20 μg / mL) were mixed and reacted at 37°C for 1 hour. The mixture was treated in the well and cultured for an additional 16 hours. After 16 hours, each well was observed under an optical microscope, and cell migration and proliferation were recorded by photographs.

[0268] As a result, as shown in FIGS. 34a to 34c, the secretion of WARS1 by Staphylococcus aureus treatment of HDFa cells and HaCat cells increased, whereas the secretion of WARS1 and IL-8 significantly decreased by treatment with anti-WARS1 antibody (H54K). It was also confirmed that the migration and proliferation of the cells were decreased by anti-WARS1 antibody treatment.

[0269] Example 15. Verification of the Effect of Anti-WARS1 Antibody on Improving Atopic Dermatitis in an Atopic Mouse Model Example 15.1. Preparation of an atopic mouse model For the mice, 8-week-old female NC / Nga mice were used and they were housed in an SPF experimental animal room where the temperature was maintained at 21 to 23°C and the relative humidity was maintained at 40 to 45% with constant temperature and humidity. Also, the number of experimental animals per cage was accommodated to 3 or less, and the cages were exchanged once a week and the feed was supplied.

[0270] First, to prepare an atopic mouse model, the upper part of the back of NC / Nga mice was depilated 1 day before the start of the experiment, and the fat components of the skin site to be coated were removed using a 4% aqueous SDS solution. After being completely dried for about 1 hour, 100 mg of Biostir AD (atopic dermatitis-inducing reagent, house dust mite) ointment was uniformly applied to the depilated site using a flat stick. The application of Biostir AD ointment was performed 3 times a week for 4 weeks (a total of 12 times). SpA (Staphylococcus protein A, Sigma Aldrich) was applied to the back site 3 times at 5-day intervals at 200 μg per mouse (200 μg / mouse) starting from the 14th day. Anti-WARS1 antibody (H54K) (10 mg / kg) or Isotype IgG1 (10 mg / kg) was intraperitoneally administered 3 times a week for a total of 6 times. At this time, Isotype IgG1 was used as a control group, and dexamethasone was used as a positive control group. Dexamethasone was intraperitoneally administered 3 times a week at a concentration of 10 mg / kg for a total of 6 times (FIG. 35).

[0271] Example 15.2. Evaluation of clinical indicators To confirm the effect of anti-WARS1 antibody (H54K) on improving atopic dermatitis, in an atopic mouse model, Isotype IgG1, dexamethasone, or anti-WARS1 antibody (H54K) was administered, and skin erythema / bleeding, wounds / dryness, edema, and exfoliation were observed, and the expression of atopic dermatitis was clinically evaluated.

[0272] As a result, as shown in Figure 36, the skin inflammation score of the Isotype IgG1 administration group increased significantly for the four indicators compared with the normal group (naive, the group without induced dermatitis). On the contrary, in the case of the anti-WARS1 antibody administration group, the dermatitis index decreased significantly compared with the Isotype IgG1 administration group.

[0273] VI. Verification of the effect of anti-WARS1 antibody on improving macrophage activation syndrome Example 16. Confirmation of the anti-inflammatory activity of anti-WARS1 antibody in a macrophage activation syndrome model using CpG Example 16.1. Preparation of a macrophage activation syndrome model using CpG The CpG (CpG oligodeoxynucleotides (ODN)-induced macrophage activation syndrome model) mouse model was used as a macrophage activation syndrome mouse model. Female B57BL / 6J mice at 8 - 10 weeks of age were used, and they were housed in an SPF experimental animal center where the temperature was maintained at 21 - 23°C and the relative humidity at 40 - 45% with constant temperature and humidity. Also, the number of individuals per cage was set at 5, and the cages were changed once a week and the feed was supplied.

[0274] CpG ODN (InvivoGen, Class B, tlrl-1826) was diluted in PBS at a concentration of 45 μg / 200 μl, stored at -80°C, and then intraperitoneally administered to each mouse at 200 μl once a day every other day for a total of 5 times (days 0, 2, 4, 6, 8). One day after the last administration (day 9), blood was collected from the hearts of the anesthetized mice by respiration, and then the liver and spleen were collected to confirm the inflammatory indicators and the degree of cell activity. The state of the mice was checked once a day until the end of the experiment.

[0275] The test groups were divided into a total of 6 groups and proceeded. Two hours after CpG administration every day on the days of CpG administration,

[0276] The sex control group was intraperitoneally administered PBS, Isotype IgG (10 mg / kg, Bio X cell, BP0297), and anti-WARS1 antibody [(H54K, 5, 10, 15 mg / kg) or GKB101 (10 mg / kg)] according to each concentration. All data were expressed as standard error of the mean (SEM) and analyzed by multiple comparison using ANOVA statistical method (Figure 38).

[0277] Example 16.2. Analysis of WARS1 and inflammatory cytokine expression in liver tissue A part of the mouse liver tissue of Example 16.1 was collected and the liver tissue was lysed using gentleMACS TM Octo Dissociator (Miltenyi Biotec) and Trizol (Takara, 9109, 1 mL). In the lysed liver tissue, RNA was isolated and cDNA was synthesized in the same manner as in Example 11.3, and then gene expression was confirmed by q-PCR using the primers in Tables 22 and 23.

[0278]

Table 23

[0279] As a result, as shown in Figure 40b, the expression of WARS1 and inflammatory cytokines and chemokines decreased in the anti-WARS1 antibody (GKB101, H54K) administration group compared with the PBS administration group or the Isotype IgG administration group. Particularly in the H54K antibody administration group, the expression of WARS1, inflammatory cytokines, and chemokines decreased in a concentration-dependent manner. In the CpG mouse model, to confirm the effect of reducing WARS1 in the liver tissue by the anti-WARS1 antibody (GKB101, H54K), a part of the mouse liver tissue was collected, protein lysis buffer was added, and then the liver tissue was placed in an M tube (Miltenyi Biotec, 130-093-236) and gentleMACS TMIt was homogenized using an Octo Dissociator (Miltenyi Biotec). Subsequently, WARS1 was measured by the same method as in Example 11.3.

[0280] As a result, as shown in Fig. 40a, it was confirmed that the expression of WARS1 in the liver tissue of the anti-WARS1 antibody (GKB101, H54K) administration group was decreased compared to the PBS administration group or the Isotype IgG1 administration group. Particularly in the H54K antibody administration group, the expression of WARS1 decreased in a concentration-dependent manner.

[0281] Example 16.3. Ferritin analysis in blood In the CpG mouse model, to confirm the effect of reducing ferritin in plasma by the anti-WARS1 antibody (GKB101, H54K), after collecting blood by cardiac puncture of the mouse, it was transferred to a heparin tube and centrifuged at 2,000 rpm for 20 minutes at room temperature to prepare plasma. Ferritin was measured using an ELISA kit (ferritin kit, Abcam, ab157713) according to the manufacturer's protocol.

[0282] As a result, as shown in Fig. 39, it was confirmed that the level of ferritin in the serum was significantly decreased in the H54K antibody administration group (15 mg / kg) compared to the PBS administration group or the Isotype IgG1 administration group.

[0283] Example 16.4. Distribution of immune cells in the spleen In the CpG mouse model, to confirm the changes in the distribution (%) of T cells and the distribution (%) of natural killer cells (NK cells) by the anti-WARS1 antibody, after removing the spleen of the mouse, single cells were obtained by passing through a 70 μm cell strainer. Immunofluorescence staining was performed on the cells. At this time, the antibodies used were as shown in Table 24 below.

[0284]

Table 24

[0285] Each of the antibodies excluding the anti-mouse IFN-γ antibody was treated in each of the cell sample tubes, and after reacting for 20 minutes, it was washed with FACS buffer. The tube samples for confirming the distribution of activated Th1 cells were fixed / permeabilized using fix / perm buffer (invitrogen, 00-5523-00). After treating the sample tubes with a PE anti-mouse IFN-γ antibody and reacting, it was washed with FACS buffer and flow cytometry was performed. The analysis values were used to classify the immune cells into CD45+CD11b+CD27-NK1.1+ (activated NK cells) and CD45+CD3+CD8+IFNγ+ (activated Th1 cells) using the FlowJo program (FlowJo TM v7 Software, BD Biosciences), and the distribution (%) of each cell was analyzed. As a result, as shown in Fig. 41a, the distribution (%) of NK cells increased in the PBS administration group and the Isotype IgG1 administration group compared to the normal group. On the contrary, in the anti-WARS1 antibody (GKB101, H54K) administration group, it was confirmed that the distribution of NK cells decreased compared to the PBS administration and Isotype IgG1 administration groups. In particular, in the case of the H54K antibody administration group, the distribution (%) of NK cells decreased in a concentration-dependent manner.

[0286] Example 17. Analysis of immune cell infiltration in liver tissue In the CpG mouse model, to confirm the effect of the anti-WARS1 antibody (GKB101, H54K) on the infiltration of immune cells into the liver tissue, one lobe of the liver layer of the excised mouse was collected and fixed in a 10% formalin solution (Sigma, HT501128) for about 1 day. The fixed tissue was observed by performing H&E staining in the same manner as in Example 11.1.

[0287] As a result, as shown in Fig. 41b, it was confirmed that immune cell infiltration decreased in the liver tissue of the anti-WARS1 antibody (H54K, GKB101) administration group compared to the PBS administration group and the Isotype IgG1 administration group.

Claims

1. A heavy chain variable region comprising an H-CDR1 containing the amino acid sequence of SEQ ID NO: 3, an H-CDR2 containing the amino acid sequence of SEQ ID NO: 5, and an H-CDR3 containing the amino acid sequence of SEQ ID NO: 7, and A light chain variable region comprising an L-CDR1 containing the amino acid sequence of SEQ ID NO: 12, an L-CDR2 containing the amino acid sequence of SEQ ID NO: 95 below, and an L-CDR3 containing the amino acid sequence of SEQ ID NO: 96 below, an anti-WARS1 antibody or a fragment thereof: N-terminus - Ala Asn Xaa1 Xaa2 His Arg Pro Ser - C-terminus (SEQ ID NO: 95), where Xaa1 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, Xaa2 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro, wherein when Xaa1 is Ser, Xaa2 is not His, N-terminus - Gly Ala Trp Asp Asp Ser Xaa3 Ser Ala Tyr Val - C-terminus (SEQ ID NO: 96), where Xaa3 is Ala, Val, Ile, Leu, Met, Phe, Tyr, Trp, Lys, Arg, His, Asp, Ser, Thr, Glu, Asn, Gln, Cys, Gly or Pro.

2. The anti-WARS1 antibody or a fragment thereof according to claim 1, wherein the antibody or a fragment thereof specifically binds to WARS1.

3. The anti-WARS1 antibody or a fragment thereof according to claim 1, wherein the antibody or a fragment thereof specifically binds to WARS1.

4. The anti-WARS1 antibody or a fragment thereof according to claim 1, wherein Xaa3 is Leu or Asn.

5. The light chain variable region is an L-CDR1 containing the amino acid sequence of SEQ ID NO: 12, an L-CDR2 containing any amino acid sequence selected from the group consisting of SEQ ID NOs: 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42 and 44, and an L-CDR3 containing the amino acid sequence of SEQ ID NO: 16 or SEQ ID NO: 46, the anti-WARS1 antibody or a fragment thereof according to claim 1.

6. The anti-WARS1 antibody or fragment thereof according to claim 1, wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:

9.

7. The anti-WARS1 antibody or fragment thereof according to claim 1, wherein the light chain variable region comprises any amino acid sequence selected from the group consisting of SEQ ID NOs: 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 48, and 49.

8. The anti-WARS1 antibody or fragment thereof according to claim 1, wherein the antibody comprises an Fc region.

9. A polynucleotide encoding the anti-WARS1 antibody or fragment thereof according to any one of claims 1 to 8.

10. An expression vector comprising the polynucleotide according to claim 9.

11. A transformed cell into which the expression vector according to claim 10 has been introduced.

12. A method for producing an anti-WARS1 antibody or fragment thereof, comprising culturing the transformed cell according to claim 11 and obtaining the anti-WARS1 antibody or fragment thereof.

13. A pharmaceutical composition for preventing or treating an inflammatory disease, comprising the anti-WARS1 antibody or fragment thereof according to any one of claims 1 to 8 as an active ingredient.

14. ​ The inflammatory disease is any one selected from the group consisting of peritonitis, osteomyelitis, cellulitis, meningitis, encephalitis, pancreatitis, trauma-induced shock, cystic fibrosis, stroke, Lyme disease, polyarteritis nodosa, allergic vasculitis, Lou Gehrig's granulomatosis, giant cell arteritis, synovitis, tenosynovitis, epicondylitis (tennis elbow), Henoch-Schönlein purpura, multicentric reticulohistiocytosis, sarcoidosis, hemochromatosis, sickle cell disease and other abnormal hemoglobinopathies, hyperlipoproteinemia, hypogammaglobulinemia, familial Mediterranean fever, recurrent fever, sepsis, septic shock, multiple organ dysfunction syndrome, bronchopulmonary dysplasia, inflammatory bowel disease, chronic obstructive pulmonary disease (COPD), macrophage activation syndrome (MAS), systemic lupus erythematosus, scleroderma, atopic dermatitis, psoriasis, anaphylaxis, dermatitis, diabetic retinopathy, retinitis, macular degeneration, uveitis, conjunctivitis, arthritis, rheumatoid arthritis, ankylosing spondylitis, osteoarthritis, osteoporosis, allergy, diabetes, diabetic nephropathy, pyelonephritis, nephritis, Sjögren's syndrome, autoimmune pancreatitis, periodontal disease, asthma, graft-versus-host disease, chronic pelvic inflammatory disease, endometritis, rhinitis, transplant rejection and chronic prostatitis, the pharmaceutical composition for preventing or treating the inflammatory disease according to claim 13.

15. Use of the antibody or fragment thereof according to claim 1 for preventing or treating an inflammatory disease.

16. A method for preventing or treating an inflammatory disease, comprising the step of administering the antibody or fragment thereof according to claim 1 to an individual.

Images