Antisense oligomers against monoamine oxidase B and uses thereof
An antisense oligomer targeting MAO-B mRNA expression addresses the challenges of liver diseases, obesity, and neurological disorders by reducing oxidative stress and improving brain monoamine levels, offering a promising therapeutic approach.
Patent Information
- Application Number
- JP2024570717
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-05-30
- Filing Date
- 2023-05-30
- Publication Date
- 2025-06-12
- Estimated Expiration
- 2043-05-30
AI Technical Summary
Current treatments for liver diseases, obesity, and neurological diseases do not effectively address the underlying issues related to monoamine oxidase B (MAO-B) expression, which contributes to oxidative stress and neuronal damage.
Development of an antisense oligomer that specifically hybridizes with the mRNA sequence of MAO-B, regulating its expression and reducing the production of hydrogen peroxide, thereby mitigating oxidative stress and neuronal damage.
The antisense oligomer effectively suppresses MAO-B mRNA and protein expression, leading to reduced oxidative stress, improved monoamine levels in the brain, and potential therapeutic benefits for liver diseases, obesity, and neurological disorders such as Alzheimer's disease.
Smart Images

Figure 2025518230000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an antisense oligomer against monoamine oxidase B and its use, and relates to a gene encoding monoamine oxidase B, specifically, an antisense oligomer that regulates the amount of mRNA or protein, and its use for the prevention, reduction or treatment of liver diseases, obesity or neurological diseases.
[0002]
Background Art
[0003] MAO (Monoamine oxidase) is particularly located in the outer mitochondrial membrane of the liver and brain and is known to promote the oxidative deamination reaction of monoamine neurotransmitters such as dopamine. Through the reaction promoted by MAO, hydrogen peroxide (H 2 O 2 ) that induces oxidative stress and neuronal cell death is known to be produced.
[0004] There are MAO-A and MAO-B in MAO, and MAO-B is abundant in neurons and astrocytes that release serotonin and is known to be selectively inhibited by potent inhibitors such as selegiline and rasagiline.
[0005] In particular, in the human brain, the expression level of monoamine oxidase B (Monoamine oxidase B, MAO-B) is known to increase with age and increase in activity in neurological diseases (Park et al., Sci Adv. 2019 Mar 20; 5(3): e aav0316).
[0006] Under the above technical background, the inventors of the present application confirmed an antisense oligomer against monoamine oxidase B, and confirmed that the antisense oligomer can be used for the prevention, reduction or treatment of neurological diseases by regulating the expression of mRNA encoding monoamine oxidase B, and thus completed the present invention.
[0007]
[0008]
Summary of the Invention
Problems to be Solved by the Invention
[0009] An object of the present invention is to provide an antisense oligomer that regulates the expression of a gene encoding monoamine oxidase B.
[0010] Another object of the present invention is to provide a pharmaceutical composition for preventing, reducing or treating liver diseases or neurological diseases containing the antisense oligomer. Another object of the present invention is to provide a method for preventing, reducing or treating liver diseases or neurological diseases by administering the antisense oligomer. Another object of the present invention is to provide a manufacturing use of a composition for preventing, reducing or treating liver diseases or neurological diseases containing the antisense oligomer.
Means for Solving the Problems
[0011] In order to achieve the above object, the present invention provides an oligomer capable of hybridizing with at least 8 consecutive nucleobases of the nucleic acid sequence of the pre-mRNA sequence of the entire nucleobase MAOB (MAOB whole pre-mRNA sequence) and having a length of 10 nt to 50 nt.
[0012] The present invention also provides an oligomer capable of hybridizing with at least 8 consecutive nucleobases of one sequence selected from the group consisting of SEQ ID NOs: 2, 3, and 9 and having a length of 10 nt to 50 nt.
[0013] The present invention also provides an oligomer capable of hybridizing with at least 8 consecutive nucleobases of the sequence of SEQ ID NO: 9 and having a length of 10 nt to 50 nt.
[0014] Furthermore, the present invention provides an oligomer comprising a sequence selected from the group consisting of SEQ ID NOs: 22, 23, and 29.
[0015] Furthermore, the present invention provides an oligomer comprising the sequence of SEQ ID NO: 29.
[0016] Furthermore, the present invention provides an oligomer having the following sequence and chemical structure:
[0017] T*GAAC*6*6*5*5*5*7*7*6*5*6*ACGA*G;
[0018] G*ATCA*6*5*7*7*6*6*8*6*8*6*CAGC*T; and
[0019] C*ACTA*5*8*6*5*6*5*8*5*8*8*TAGC*C,
[0020] where PS is phosphorothioate; 2’MOE is 2’-O-methoxyethyl. A = 2’MOE-A, C = 2’MOE-5’-methyl-C, G = 2’MOE-G, T = 2’MOE-T, 5 = DNA-A, 6 = DNA-5’-methyl-C, 7 = DNA-G, 8 = DNA-T, and *=PS.
[0021] Furthermore, the present invention provides a composition comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent.
[0022] Furthermore, the present invention provides a composition for preventing, reducing, or treating liver disease or neurological disease, comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent. The present invention also provides a method for preventing, reducing, or treating liver disease or neurological disease, comprising administering the composition comprising the oligomer and at least one pharmaceutically acceptable carrier or diluent. Another object of the present invention is to provide a manufacturing use of a composition for preventing, reducing, or treating liver disease or neurological disease, comprising a composition comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent.
[0023] The present invention also provides a composition for preventing, reducing, or treating fatty liver, comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent. The present invention also aims to provide a method for preventing, reducing, or treating fatty liver, which comprises administering a composition comprising the oligomer and at least one pharmaceutically acceptable carrier or diluent. Another object of the present invention is to provide a use for manufacturing a composition for preventing, reducing, or treating fatty liver, which composition comprises an oligomer and at least one pharmaceutically acceptable carrier or diluent.
[0024] The present invention also provides a composition for preventing, reducing, or treating obesity, comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent. The present invention also aims to provide a method for preventing, reducing, or treating obesity, which comprises administering a composition comprising the oligomer and at least one pharmaceutically acceptable carrier or diluent. Another object of the present invention is to provide a use for manufacturing a composition for preventing, reducing, or treating obesity, which composition comprises an oligomer and at least one pharmaceutically acceptable carrier or diluent.
[0025] BRIEF DESCRIPTION OF THE DRAWINGS
[0026]
Fig. 1a-1b
[0027]
Fig. 2
[0028]
Fig. 3a
[0029]
Fig. 3b
[0030]
Fig. 4a
[0031]
Fig. 4b
[0032]
Fig. 5a
[0033]
Fig. 5b
[0034]
Fig. 6a
[0035]
Fig. 6b
[0036]
[0037]
Mode for Carrying Out the Invention
[0038] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly employed in the art.
[0039] The antisense oligomers (oligonucleotides) according to the present invention can suppress the expression of the gene encoding monoamine oxidase B, specifically, mRNA. The antisense oligomers (oligonucleotides) according to the present invention contain a sequence complementary to the mRNA encoding monoamine oxidase B.
[0040] "Antisense activity" means any detectable or measurable activity that contributes to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, the antisense activity is a decrease in the amount or expression of the target nucleic acid or the protein encoded by such a target nucleic acid. The antisense activity according to the present invention acts on the target nucleic acid encoding monoamine oxidase B and decreases the amount or expression of the encoded monoamine oxidase B protein.
[0041] "Targeting", "target to" or "targeted" means specifically hybridizing to a target nucleic acid and inducing a favorable effect.
[0042] "Target nucleic acid", "target RNA" and "target RNA transcript" all mean a nucleic acid that can be targeted by an antisense oligomer.
[0043] The present invention includes oligomers capable of hybridizing to a target nucleic acid through hydrogen bonding.
[0044] "Suppression" means a decrease in the level of a target nucleic acid or a target protein in the presence of an antisense compound complementary to the target nucleic acid as compared to the level of the target nucleic acid or the target protein in the absence of the antisense oligomer.
[0045] "Antisense oligomer" includes a single-stranded oligonucleotide having a nucleobase sequence that enables hybridization to a corresponding site or segment of a target nucleic acid.
[0046] The present invention relates to an oligomer that is capable of hybridizing to at least 8 consecutive nucleobases of the nucleic acid sequence of the pre-mRNA sequence of the entire MAOB and has a length of 10 nt to 50 nt.
[0047] The said sequence is chrX:43,766,610 - 43,882,450 (hg38, (-) strand, length 115,841 bp) and can include the sequence of SEQ ID NO: 41. The oligomer according to the present invention is capable of hybridizing to at least 8 consecutive nucleobases among the following nucleic acid sequences.
[0048] The oligomer according to the present invention is capable of hybridizing to at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 or at least 18 consecutive nucleobases among the said nucleic acid sequences.
[0049] In hybridization, the conditions used to achieve a specific level of stringency vary depending on the nature of the nucleic acid being hybridized. For example, the length of the nucleic acid site being hybridized, the degree of homology, the nucleotide sequence composition (e.g., GC / AT composition ratio) and the nucleic acid type (e.g., RNA, DNA), etc. are considered in selecting the hybridization conditions. Additional considerations are whether the nucleic acid is immobilized, for example, on a filter or the like.
[0050] Examples of conditions that are carried out very strictly are as follows: 2XSSC / 0.1% SDS at room temperature (hybridization conditions); 0.2XSSC / 0.1% SDS at room temperature (low stringency conditions); 0.2XSSC / 0.1% SDS at 42 °C (conditions with normal stringency); 0.1XSSC at 68 °C (conditions with high stringency). The washing process can be carried out using one of these conditions. For example, conditions with high stringency can be used, or each of the above conditions can be used, and the described conditions can be repeated in whole or in part for 10 to 15 minutes each in the order described above. However, as described above, the optimal conditions vary depending on the specific hybridization reaction involved and can be determined through experiments. Generally, conditions with high stringency are used for the hybridization of important probes.
[0051] At least one of the base pairs forming the hybridization can include wobble base pairs G:U, I:A, I:C, or I:U.
[0052] The present invention includes an oligomer having a length of 10 nt to 50 nt and capable of hybridizing with at least 8 consecutive nucleic acid bases of one sequence selected from the group consisting of SEQ ID NOs: 1 to 20.
[0053] [Table 1]
[0054] One embodiment is an antisense oligomer comprising 18 to 21 linked nucleosides, capable of hybridizing with at least 8 consecutive nucleobases of a sequence selected from the group consisting of SEQ ID NOs: 1 to 20, and comprising an oligomer having a length of 10 nt to 50 nt. It can include an oligomer capable of hybridizing with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 or at least 18 consecutive nucleobases of a sequence selected from the group consisting of SEQ ID NOs: 1 to 20, and having a length of 10 nt to 50 nt.
[0055] One embodiment can be an antisense oligomer comprising 15 to 25 linked nucleosides, capable of hybridizing with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 or at least 18 consecutive nucleobases of a sequence selected from the group consisting of SEQ ID NOs: 1 to 20, and can include an oligomer having a length of 10 nt to 50 nt.
[0056] One embodiment can be an antisense oligomer comprising 18 to 21 linked nucleosides, capable of hybridizing with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 or at least 18 consecutive nucleobases of a sequence selected from the group consisting of SEQ ID NOs: 1 to 20, and can include an oligomer having a length of 10 nt to 50 nt.
[0057] Specifically, it can include an oligomer capable of hybridizing with 18 or more, 19 or more, 20 consecutive nucleobases of a sequence selected from the group consisting of SEQ ID NOs: 1 to 20, and having a length of 10 nt to 50 nt.
[0058] Furthermore, the present invention relates to an oligomer that is capable of hybridizing with at least 8 consecutive nucleic acid bases of one sequence selected from the group consisting of SEQ ID NO: 2, 3, or 9 and has a length of 10 nt to 50 nt.
[0059] It can include an oligomer that is capable of hybridizing with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases of a sequence selected from the group consisting of SEQ ID NO: 2, 3, and 9 and has a length of 10 nt to 50 nt.
[0060] At least one of the base pairs forming the hybridization can include wobble base pairs G:U, I:A, I:C, or I:U.
[0061] Furthermore, the present invention is an oligomer that is capable of hybridizing with at least 8 consecutive nucleic acid bases of the sequence of SEQ ID NO: 9 and has a length of 10 nt to 50 nt.
[0062] It can include an oligomer that is capable of hybridizing with at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases of the sequence of SEQ ID NO: 9 and has a length of 10 nt to 50 nt.
[0063] At least one of the base pairs forming the hybridization can include wobble base pairs G:U, I:A, I:C, or I:U.
[0064] "Consecutive nucleic acid bases" means nucleic acid bases that are immediately adjacent to each other. "Inter-nucleoside linkage" refers to the chemical bond between each nucleoside. "Linked nucleosides" means adjacent nucleosides that are bonded together.
[0065] "Nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acid (siRNA), and microRNAs (miRNA). Further, a nucleic acid can include combinations of these elements within a single molecule.
[0066] "Nucleic acid base" means a heterocyclic moiety that can pair with the bases of other nucleic acids.
[0067] "Nucleic acid base sequence" means the order of consecutive nucleic acid bases that is not related to any arbitrary sugar, linkage, or nucleic acid base modification.
[0068] "Nucleoside" means a nucleic acid base linked to a sugar.
[0069] "Nucleotide" means a nucleoside having a phosphate group commonly linked to the sugar portion of the nucleoside.
[0070] "Oligomer" means a polymer of linked monomeric subunits that can hybridize to a region of a nucleic acid molecule.
[0071] "Oligonucleotide" means a polymer of linked nucleosides, each of which can be independently modified or unmodified.
[0072] "Single-stranded oligonucleotide" means an oligonucleotide that does not hybridize to a complementary strand.
[0073] At least one of the base pairs forming the hybridization can include wobble base pairs G:U, I:A, I:C, or I:U. The antisense oligomer according to the present invention can include, for example, a sequence having 90% or more sequence homology with a sequence selected from the group consisting of SEQ ID NOs: 21 to 40.
[0074] Specifically, it can include a sequence having a sequence homology of 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% with a sequence selected from the group consisting of SEQ ID NOs: 21 to 40.
[0075] The antisense oligomer according to the present invention can include, for example, a sequence having a sequence homology of 90% or more with one or more sequences selected from the group consisting of SEQ ID NOs: 22, 23, and 29.
[0076] Specifically, it can include a sequence having a sequence homology of 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% with one or more sequences selected from the group consisting of SEQ ID NOs: 22, 23, and 29. The antisense oligomer according to the present invention can include one of the sequences selected from the group consisting of SEQ ID NOs: 22, 23, and 29.
[0077] The antisense oligomer according to the present invention can include, for example, a sequence having a sequence homology of 90% or more with the sequence of SEQ ID NO: 29.
[0078] Specifically, it can include a sequence having a sequence homology of 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% with the sequence of SEQ ID NO: 29. The antisense oligomer according to the present invention can include, for example, the sequence of SEQ ID NO: 29.
[0079] As used herein, "homology" means the percent identity between polynucleotide moieties. "Identity" means the degree to which sequences are functionally or structurally identical based on polynucleotide sequences through a comparison window. Sequence homology can be confirmed by comparing sequences with programs such as BLASTN and BLASTX, which are developed based on standard software, for example, BLAST (Proc. Natl. Acad. Sci. USA, 90, 5873 - 5877, 1993).
[0080] In one embodiment, the antisense oligomer according to the present invention can comprise 20 linked nucleosides. Specifically, the antisense oligomer according to the present invention can comprise one or more sequences selected from the group consisting of SEQ ID NO: 22, 23, and 29.
[0081] TGAACCCAAAGGCACACGAG (SEQ ID NO: 22);
[0082] GATCACAGGCCTCTCCAGCT (SEQ ID NO: 23); and
[0083] CACTAATCACATATTTAGCC (SEQ ID NO: 29).
[0084] In particular, the antisense oligomer according to the present invention can comprise the sequence of SEQ ID NO: 29.
[0085] The complementary sequences herein also have the meaning of including some base deletions and incomplete complementarity corresponding to the extent that can suppress the expression of mRNA encoding monoamine oxidase B.
[0086] "Nucleoside" means a nucleobase linked to a sugar, and "nucleotide" means a nucleoside having a phosphate group commonly linked to the sugar moiety of the nucleoside. "Nucleobase" means a heterocyclic moiety that can pair with the bases of other nucleic acids.
[0087] "Oligomer" means a polymer of linked monomer subunits that can hybridize to at least a region of a nucleic acid molecule.
[0088] The nucleosides can include modifications. For example, the internucleoside linkages can include modified internucleoside linkages or can include modified sugars.
[0089] Specifically, the internucleoside linkages can be phosphorothioate, boranophosphate, or methyl phosphonate linkages.
[0090] The internucleoside linkages according to the present invention can be sooosssssssssssooos linkages. s is a phosphorothioate internucleoside linkage and o can be a phosphodiester internucleoside linkage.
[0091] The nucleosides can include the following modified sugars:
[0092] Modifications of substitution at the 2'-carbon position of the sugar structure to 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2' MOE), 2'-O-methoxyethyl-5'-methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro.
[0093] The nucleosides can include, for example, phosphorothioate, boranophosphate, or methyl phosphonate linkages as internucleoside linkages; and modifications of substitution at the 2'-carbon position of the sugar structure to 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2' MOE), 2'-O-methoxyethyl-5'-methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro.
[0094] The nucleoside can be characterized by including a modification selected from the group consisting of, for example, the following modifications. The modification is a modification of the sugar moiety, for example, a modification at the 2'-carbon position of the sugar structure in the nucleotide, specifically, a modification to 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'-MOE), 2'-O-methoxyethyl-5'-methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro; a modification of the nucleotide bond to phosphorothioate, boranophosphate, or methylphosphonate; a modification to PNA (peptide nucleic acid), LNA (locked nucleic acid), or UNA (unlocked nucleic acid) form; and can include a phosphate group.
[0095] "2'-O-methoxyethyl" (also 2'-MOE and 2'-O(CH 2 ) 2 -OCH 3 ) means an O-methoxy-ethyl modification at the 2'-position of the furanosyl ring.
[0096] "2'-O-methoxyethyl nucleotide" means a nucleotide containing a 2'-O-methoxyethyl-modified sugar moiety.
[0097] "Modified sugar" refers to a substitution or change from a natural sugar.
[0098] "5-methylcytosine" means cytosine modified with a methyl group attached at the 5'-position. 5-methylcytosine is a modified nucleobase.
[0099] "Modified internucleoside linkage" means a substitution or any change from a naturally occurring internucleoside bond.
[0100] "Modified nucleobase" means any nucleobase that is not adenine, cytosine, guanine, thymidine, or uracil. "Modified nucleobase" means adenine (A) and guanine (G), which are purine bases, and thymine (T), cytosine (C), and uracil (U), which are pyrimidine bases.
[0101] "Modified nucleotide" means a nucleotide having independently modified sugar moiety, modified internucleoside linkage, or modified nucleobase. "Modified nucleoside" means a nucleoside having independently modified sugar moiety or modified nucleobase.
[0102] "Modified oligonucleotide" means an oligomer containing at least one modified nucleotide.
[0103] The antisense oligomers according to the present invention may include, but are not limited to, trivalent GalNAc (N-acetylgalactosamine) or pentavalent GalNAc (N-acetylgalactosamine).
[0104] The antisense oligomers according to the present invention may include modifications to 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'methyl, 5'-methyl or phosphorothioate linkages.
[0105] Another aspect relates to an antisense oligomer comprising 12 to 30 linked nucleosides, including at least 8 consecutive nucleobases of a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 2, 3, and 9.
[0106] One embodiment is an antisense oligomer comprising 18 to 21 linked nucleosides and comprising at least 8 consecutive nucleobases of a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 2, 3, and 9. It can comprise at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive nucleobases of a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 2, 3, and 9.
[0107] One embodiment can be an antisense oligomer comprising 15 to 25 linked nucleosides and can comprise at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive nucleobases of a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 2, 3, and 9.
[0108] One embodiment can be an antisense oligomer comprising 18 to 21 linked nucleosides and can comprise at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 consecutive nucleobases of a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 2, 3, and 9.
[0109] Specifically, it can comprise 18 or more, 19 or more, 20 consecutive nucleobases of a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 2, 3, and 9.
[0110] Another aspect relates to an antisense oligomer comprising 12 to 30 linked nucleosides and comprising at least 8 consecutive nucleobases of the sequence of SEQ ID NO: 9.
[0111] One embodiment is an antisense oligomer comprising 18 to 21 linked nucleosides and containing at least 8 consecutive nucleobases of the sequence of SEQ ID NO: 9. It can contain at least 9, at least 10, at least 11, at least 12, at least 13, at least 14 or at least 15 consecutive nucleobases of a sequence selected from the group consisting of the sequences of SEQ ID NO: 2, 3 and 9.
[0112] One embodiment can be an antisense oligomer comprising 15 to 25 linked nucleosides and can contain at least 9, at least 10, at least 11, at least 12, at least 13, at least 14 or at least 15 consecutive nucleobases of the sequence of SEQ ID NO: 9.
[0113] One embodiment can be an antisense oligomer comprising 18 to 21 linked nucleosides and can contain at least 9, at least 10, at least 11, at least 12, at least 13, at least 14 or at least 15 consecutive nucleobases of the sequence of SEQ ID NO: 9.
[0114] Specifically, it can contain 18 or more, 19 or more, 20 consecutive nucleobases of the sequence of SEQ ID NO: 9.
[0115] The present invention relates to an antisense oligomer targeting a gene encoding monoamine oxidase B containing a sequence selected from the group consisting of the sequences of SEQ ID NO: 2, 3 and 9. In particular, the antisense oligomer according to the present invention can contain the sequence of SEQ ID NO: 9.
[0116] The oligomer according to the present invention can have a length of 13 nt to 35 nt or can have a length of 16 nt to 25 nt. The oligomer can be 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt or 25 nt.
[0117] Each of the nucleosides of the sequences selected from the group consisting of SEQ ID NOs: 2, 3, and 9 can include modifications. For example, the internucleoside linkage can include a modified internucleoside linkage or can include a modified sugar.
[0118] Specifically, the internucleoside linkage can be a phosphorothioate, boranophosphate, or methylphosphonate linkage. At least one of the modified internucleoside linkages can be a phosphorothioate linkage.
[0119] The internucleoside linkage according to the present invention can be a sooosssssssssssooos linkage. s is a phosphorothioate internucleoside linkage and o can be a phosphodiester internucleoside linkage.
[0120] At least one nucleoside of the oligomer can include a modified sugar different from DNA or RNA. The nucleoside can include a sugar modified as follows:
[0121] Modification of substitution with 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'-MOE), 2'-O-methoxyethyl-5'-methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro at the 2'-carbon position of the sugar structure.
[0122] The nucleoside can be characterized by including a modification selected from the group consisting of, for example, the following modifications. The modification includes a modification of the sugar moiety, for example, a modification at the 2'-carbon position of the sugar structure in the nucleotide, specifically, a modification to 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'-methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro; a modification of the nucleotide bond to phosphorothioate, boranophosphate, or methylphosphonate; a modification to PNA (peptide nucleic acid), LNA (locked nucleic acid), or UNA (unlocked nucleic acid) form; and can include a phosphate group.
[0123] The antisense oligomer according to the present invention can include a modification to 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'-methyl, 5'-methyl, or phosphorothioate bond. At least one nucleoside of the oligonucleotide can have 2'-O-methoxyethyl (2'MOE).
[0124] Each of the nucleosides in the sequence of SEQ ID NO: 9 can include a modification. For example, the internucleoside linkage can include a modified internucleoside linkage or can include a modified sugar.
[0125] Specifically, the internucleoside linkage can be a phosphorothioate, boranophosphate, or methylphosphonate linkage.
[0126] The internucleoside linkage according to the present invention can be a sooosssssssssssooos linkage. s is a phosphorothioate internucleoside linkage, and o can be a phosphodiester internucleoside linkage.
[0127] The nucleoside can include a sugar modified as follows:
[0128] Modifications of substitution with 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'-methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro at the 2'-carbon position of the sugar structure.
[0129] The nucleoside can be characterized in that it contains modifications selected from the group consisting of, for example, the following. The modifications are modifications of the sugar moiety, for example, modifications at the 2'-carbon position of the sugar structure within the nucleotide, specifically, modifications to 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'-methyl, 2'-O-aminoethyl, 5'-methyl, 2'-O-propyl, 2'-methylthioethyl, or 2'-fluoro; modifications to phosphorothioate, boranophosphate, or methylphosphonate of the nucleotide bond; modifications to PNA (peptide nucleic acid), LNA (locked nucleic acid), or UNA (unlocked nucleic acid) forms; and can contain a phosphate group.
[0130] The oligomer according to the present invention can contain modifications to 2'-O-methoxyethyl (2'MOE), 2'-O-methoxyethyl-5'-methyl, 5'-methyl, or phosphorothioate bonds.
[0131] At least one nucleoside of the oligomer can be a nucleotide analog in which an additional ring is formed in the sugar moiety.
[0132] The modified sugar of at least one nucleoside of the oligomer can be bicyclic (cEt) or LNA (locked nucleic acid).
[0133] "Bicyclic sugar" means a furanosyl ring modified by the linkage of ring atoms on two non-identical carbons. A bicyclic sugar is a modified sugar.
[0134] The bicyclic sugar contains a 4’-CH(CH 3 )-O-2’ bridge. In one embodiment, at least one modified sugar contains 2’-O-methoxyethyl.
[0135] The oligomer comprises a. a gap segment consisting of 8 to 12 linked deoxynucleosides;
[0136] a 5’ wing segment consisting of 3 to 7 linked nucleosides; and
[0137] a 3’ wing segment consisting of 3 to 7 linked nucleosides; and
[0138] b. the gap segment is located between the 5’ wing segment and the 3’ wing segment,
[0139] c. each nucleoside of each wing segment can be an oligomer containing a modified sugar.
[0140] The oligomer is 20 in length and comprises a gap segment consisting of 10 linked deoxynucleosides;
[0141] a 5’ wing segment consisting of 5 linked nucleosides; and
[0142] a 3’ wing segment consisting of 5 linked nucleosides; and
[0143] the gap segment is located between the 5’ wing segment and the 3’ wing segment,
[0144] each nucleoside of each wing segment can be an oligomer containing 2’-O-methoxyethyl sugar (2’-MOE ribose).
[0145] The internucleoside linkage of the antisense oligomer, which is a linkage of sooosssssssssssooos, where s is a phosphorothioate internucleoside linkage and o can be a phosphodiester internucleoside linkage.
[0146] When the oligomer has a length of 18:
[0147] It includes a gap segment consisting of 8 linked deoxynucleosides,
[0148] a 5'-wing segment consisting of 5 linked nucleosides, and
[0149] a 3'-wing segment consisting of 5 linked nucleosides,
[0150] The gap segment is located between the 5'-wing segment and the 3'-wing segment,
[0151] and each nucleoside of each wing segment can be an oligomer containing 2'-O-methoxyethyl sugar (2'-MOE ribose).
[0152] When the oligomer has a length of 20:
[0153] It includes a gap segment consisting of 8 linked deoxynucleosides,
[0154] a 5'-wing segment consisting of 6 linked nucleosides, and
[0155] a 3'-wing segment consisting of 6 linked nucleosides,
[0156] The gap segment is located between the 5'-wing segment and the 3'-wing segment,
[0157] and each nucleoside of each wing segment can be an oligomer containing 2'-O-methoxyethyl sugar (2'-MOE ribose).
[0158] "Gapmer" means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is located between each external region having one or more nucleosides, and the nucleosides including the internal region are chemically distinct from the nucleosides including each external region. The internal region may be referred to as a "gap segment", and the external region may be referred to as a "wing segment".
[0159] "Gap-extended" means a chimeric antisense compound having a 5' and 3' wing segment having 1 to 6 nucleosides and a gap segment of 12 or more contiguous 2'-deoxyribonucleosides located immediately adjacent thereto.
[0160] In one embodiment, at least one nucleoside can include a modified nucleobase. The modified nucleobase can be 5-methylcytosine (5mC).
[0161] Specifically, the antisense oligomer according to the present invention can be selected from the group consisting of the following configurations.
[0162] JPEG2025518230000003.jpg20170PS, phosphorothioate; 2’MOE, 2’-O-methoxyethyl. A = 2’MOE-A, C = 2’MOE-5’-methyl-C, G = 2’MOE-G, T = 2’MOE-T, 5 = DNA-A, 6 = DNA-5’-methyl-C, 7 = DNA-G, 8 = DNA-T, *=PS
[0163] The present invention also relates to a pharmaceutical composition for preventing, reducing or treating a neurological disease containing the oligomer. The present invention also relates to a method for preventing, reducing or treating a neurological disease including the step of administering an antisense oligomer to an individual. The present invention also relates to the use of the composition for preventing, reducing or treating a neurological disease containing the antisense oligomer in the manufacture.
[0164] The oligomers according to the present invention can be MAO-B inhibitors. The present invention relates to a method for reducing the amount of MAOB mRNA or protein in an animal, including administering the oligomers according to the present invention to the animal to reduce the amount of MAOB mRNA or protein. Through this, the formation of oxygen radicals can be reduced, and the amount of useful monoamines in the brain can be increased. In addition, MAO-B in brain diseases and brain injuries including Alzheimer's disease promotes the putrescine metabolism process in reactive astrocytes and produces excessive GABA. Therefore, the antisense oligomer MAO-B inhibitor according to the present invention acts as an inhibitor of GABA production by astrocytes and can restore nerve signal transmission and brain function. The nerve diseases can be, for example, Parkinson's disease (PD), Alzheimer's disease (AD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), frontotemporal dementia, corticobasal degeneration, or progressive supranuclear palsy (PSP), but are not limited thereto.
[0165] The oligomers according to the present invention can be used for the prevention, alleviation or treatment of liver diseases. Specifically, the liver disease can be fatty liver. The present invention also relates to a pharmaceutical composition for the prevention, alleviation or treatment of liver diseases containing the oligomers. The present invention also relates to a method for the prevention, alleviation or treatment of liver diseases including the step of administering an antisense oligomer to an individual. The present invention also relates to the use of the composition containing the antisense oligomer for the manufacture of a composition for the prevention, alleviation or treatment of liver diseases.
[0166] Furthermore, the present invention relates to a pharmaceutical composition for preventing, reducing, or treating obesity, which comprises the oligomer. The present invention also relates to a method for preventing, reducing, or treating obesity, which comprises administering an antisense oligomer to an individual. The present invention further relates to the use of the composition for preventing, reducing, or treating obesity, which comprises the antisense oligomer, in the manufacture of a medicament.
[0167] As used herein, "treatment" can be used in the sense that it includes all of the alleviation or improvement of symptoms, the reduction of the scope of a disease, the delay or alleviation of disease progression, the improvement, alleviation, or stabilization of a disease state, partial or complete recovery, the prolongation of survival, and other advantageous treatment outcomes.
[0168] The present invention relates to a composition comprising an oligomer and at least one pharmaceutically acceptable carrier or diluent.
[0169] In addition to the active ingredient, the pharmaceutical composition can be produced by further comprising one or more pharmaceutically acceptable carriers. The pharmaceutically acceptable carrier must be compatible with the active ingredient of the present invention, and can be used by mixing saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components. Other ordinary additives such as antioxidants, buffers, and bacteriostatic agents can be added as necessary. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added, and can be formulated into injection dosage forms such as aqueous solutions, suspensions, and emulsions.
[0170] It includes any pharmaceutically acceptable salt, ester, or salt of such an ester, or any other oligomer that can provide (directly or indirectly) a biologically active metabolite or its residue when administered to an animal including a human. Thus, for example, it relates to pharmaceutically acceptable salts of antisense oligomers, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, without limitation, the following: sodium and potassium salts.
[0171] The composition and the second formulation can be co-administered. When the second formulation is included in "co-administration", it may be a single pharmaceutical composition or separate pharmaceutical compositions. The second formulation can be administered via the same or a different route of administration as the composition. Co-administration includes simultaneous or sequential administration.
[0172] The present invention relates to a method for reducing the amount of MAOB mRNA or protein in an animal, which includes administering the composition according to the present invention to the animal in order to reduce the amount of MAOB mRNA or protein.
[0173] The animal can be a primate such as a human or a monkey, a dog, a pig, a cow, a sheep, a goat, a mouse, or a rat, but is not limited thereto. The animal can be, for example, a human.
[0174] The method of administering the pharmaceutical composition can be determined by a person of ordinary skill in the art based on the symptoms of a normal patient and the severity of the disease.
[0175] The pharmaceutical composition of the present invention can be administered parenterally. The route of administration of the composition according to the present invention is not limited thereto, and for example, oral, intravenous, intramuscular, intraarterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, enteral, sublingual, or topical administration is possible. The pharmaceutical composition of the present invention can be administered to the CNS (central nervous system). The pharmaceutical composition of the present invention can be administered by intrathecal injection.
[0176] In some cases, the pharmaceutical composition of the present invention can be administered by intravenous injection or subcutaneous injection.
[0177] The dosage of the composition according to the present invention varies depending on factors such as the patient's weight, age, gender, health status, diet, administration time, method, excretion rate, or severity of the disease, and can be easily determined by an ordinary expert in the technical field. In addition, for clinical administration, the composition of the present invention can be formulated into an appropriate dosage form using known techniques.
[0178] "Dosage" means the amount of a pharmaceutical formulation provided in a single administration or over an indicated period. The dosage can be administered as one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dosage may require a volume that cannot be easily accommodated in a single injection, and two or more injections can be used to achieve the desired dosage. The drug can be administered over a long period or continuously by infusion. The dosage can be referred to as the amount of the pharmaceutical formulation per hour, per day, per week, or per month.
[0179]
[0180]
Examples
[0181] Hereinafter, the present invention will be described in more detail through examples. It will be apparent to those having ordinary knowledge in the art that these examples are merely for illustrating the present invention and should not be construed as limiting the scope of the present invention by these examples.
[0182]
[0183] Example 1. MaoB knockdown ASO screening
[0184]
[0185] In the Huh7 cell line, it was tested to confirm the possibility of suppressing MAOB mRNA expression level. The candidate group of a33 - a52 was transfected with 200 nM of ASO over 48 hours. According to Figure 1a and Figure 1b, among the candidate groups of a33 - a52, candidates A34, A35, and A41 showed significant suppression of MAOB expression level (Error bar: 95% confidence interval).
[0186] JPEG2025518230000004.jpg190156
[0187] Example 2. MaoB knockdown lead ASO test
[0188]
[0189] KD test was performed on the Huh7 cell line. Each 200 nM of ASO was transfected over 48 hours. As a result of repeating the experiment on Huh7 in the candidate groups of A34, A35, and A41 derived from the screening of the a33 - a52 candidate group, as shown in Figure 2, repetitive and effective suppression of MAOB expression level was shown.
[0190]
[0191] Example 3. MaoB ASO KD test
[0192] 3 - 1. MaoB ASO KD test in p1 mice
[0193] 25 μg of PBS, control ASO (a114), and ASO targeting MAOB (a41) were intracerebroventricularly injected (ICV injection, 2.0 mm ventral from the skin surface) into C57BL / J on the first day after birth. A 33G injection needle was used for ICV injection. Eight days after ICV injection, all brains were dissected into cerebrum, thalamus, and cerebellum. The Rneasy mini prep kit (Qiagen) was used for mRNA isolation and purification from the mice injected with ASO. For cDNA synthesis, the SuperScript III First - Strand Synthesis System (Invitrogen TM) was used. qRT-PCR was performed using PowerUp TM SYBR TM Green Master Mix (Applied Biosystems TM ), 500 nM primers, and 10 ng of cDNA from the brains injected with ASO. The following primer sequences were used for qRT-PCR. mMAOB forward: 5-’AGTTGAGCGGCTGATACACT-3’, reverse: 5’-TGGCCCATCTCATCCATTGT-3’; GAPDH forward: 5’-TGATGACATCAAGAAGGTGGTGAAG-3’, reverse: 5’-TCCTTGGAGGCCATGTAGGCCAT-3’. The relative mRNA expression levels were calculated using the comparative Ct method and normalized to the GAPDH mRNA levels.
[0194] According to Figure 3a, when performing the safety confirmation test and the expression level suppression confirmation test (1 day after birth) through survival rate measurement during MAOB ASO injection, the A34, A35, and A41 candidate group ASOs were injected into C57BL / 6j animals on the first day after birth, and an experiment was conducted to confirm whether there were any problems with viability. It was confirmed that the A41 candidate had no problems with survival.
[0195] According to Figure 3b, when the A34, A35, and A41 candidate group ASOs were injected into C57BL / 6j animals on the first day after birth and the MAOB mRNA expression level was measured, it was confirmed that MAOB mRNA expression was suppressed in the cerebrum, thalamus, and cerebellum of the group injected with A41.
[0196]
[0197] 3 - 2. MaoB ASO KD Test in APP / PS1 Mice
[0198]
[0199] The control group ASO (a114) and ASO targeting MAOB (a41) at 500 μg were intracerebroventricularly injected into adult C57BL / 6J mice (toxicity and knockdown efficiency tests) and APP / PS1 mice. The mice were anesthetized with vaporized isoflurane and placed in a stereotaxic frame (Kopf). The scalp was incised and holes were drilled in the skull over the ventricles (anteroposterior +0.3 mm, medial / lateral -0.8 mm from bregma, dorsal / ventral -2.5 mm from the brain surface). The ASO (at a concentration of 100 μg / μL) was loaded into a glass needle and injected into the ventricle at a rate of 1 μL / min for 5 minutes (a total of 5 μL) using a syringe pump (KD Scientific). Adult C57BL / 6J mice were used for the knockdown efficiency and toxicity tests. The brains were dissected 2 weeks after thalamus, cerebrum, and cerebellum injections. RNA was isolated using Rneasy miniprep kit (Qiagen). cDNA was synthesized from mRNA using an oligodT primer and the SuperScript III First-Strand Synthesis System (Invitrogen) kit. Gene expression levels were measured by qRT-PCR of 10 ng cDNA using the PowerUp SYBR Green Master Mix (Applied Biosystems). The APP / PS1 mice were used for behavioral tests and electrophysiology more than 2 weeks after injection.
[0200] During the injection of MAOB ASO in adults, the results of the safety confirmation experiment and the expression level suppression confirmation test through survival rate measurement are shown in Figure 4a. The A41 candidate group ASO was injected into C57BL / 6j animals for 12 months, and the MAOB mRNA expression level was measured. As a result, it was confirmed that the MAOB mRNA expression was suppressed in the cerebrum, thalamus, and cerebellum.
[0201]
[0202] Before the passive avoidance test, the mice were handled daily for 7 days by the experimenter's hand. In the passive avoidance test, the mice were placed in a two-compartment shuttle box (light / dark) equipped with a constant current shock generator (Scitech). On the acquisition day, the mice were placed in the corner of the light chamber for 60 seconds (habituation), and the shutter between the two chambers was opened. When the mouse passed through the shutter, the shutter closed immediately, and an aversive electric shock (0.5 mA, 2 seconds) was delivered to the grid floor. After the shock, the mouse was returned to the cage, and the holding test was performed 24 hours after the acquisition test. For the maintenance test, the mouse was placed in the corner of the light chamber, and the shutter was opened after 1 minute. The latency to enter the dark chamber was automatically recorded up to a maximum of 540 seconds.
[0203] The results of the memory recovery experiment through MAOB ASO injection in the Alzheimer's model are shown in Figure 4b. As a result of injecting MAOB ASO A41 into the Alzheimer's animal model APP / PS1, it was confirmed that the decreased memory was recovered to a level similar to that of the normal group.
[0204]
[0205] 3-3. MaoB ASO KD test (tonic GABA recording) in APP / PS1 mice
[0206]
[0207] Brain slices were prepared from APP / PS1 transgenic mice and WT littermates at approximately 13 to 16 months of age. The mice were deeply anesthetized with isoflurane. After anesthesia, the brain was quickly removed from the skull and placed in 93 mM NMDG, 2.5 mM KCl, 1.2 mM NaH 2 PO 4 、30 mM NaHCO 3 、20 mM HEPES, 25 mM glucose, 5 mM sodium ascorbate, 2 mM thiourea, 3 mM sodium pyruvate, 10 mM MgSO 4 、and 0.5 mM CaCl 2It was precipitated in an ice-cold NMDG-based cutting solution containing sodium ascorbate, 2 mM thiourea, 3 mM sodium pyruvate, 10 mM MgSO 4 and 0.5 mM CaCl 2 (300 mOsm - 310 mOsm, pH adjusted with 10 N HCl).
[0208] The cutting fluid was gas-treated with 95% O 2 and 5% CO 2 Hippocampal slices were obtained by vibrating a microtome (DSK, Linearslicer 7N) with 300-μm-thick coronal hippocampal slices and maintained at room temperature in a chamber filled with water containing extracellular artificial cerebrospinal fluid.
[0209] The liquid (aCSF) solution (126 mM NaCl, 24 mM NaHCO 3 , 1 mM NaH 2 PO 4 , 2.5 mM KCl, 2.5 mM CaCl 2 , 2 mM MgCl 2 , and 10 mM D-(+)-glucose (pH 7.4)) was gas-treated with 95% O 2 and 5% CO 2 Before recording the slices, they were incubated in room-temperature aCSF for at least 1 hour. Whole-cell patch-clamp recordings were made from the cell bodies of granule cells in the DG. The holding potential was -70 mV. The pipette resistance was typically 5 - 7 megaohms, and the internal solution (135 mM CsCl, 4 mM NaCl, 0.5 mM CaCl 2 , 10 mM Hepes, 5 mM EGTA, 2 mM Mg-adenosine triphosphate, 0.5 mM Na 2-guanosine triphosphate, and 10 mM QX-314, CsOH (adjusted to 7.2 at 278 mOsm - 285 mOsm). Before measuring the tonic current, the baseline current was stabilized with d-AP5 (50 μM) and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 20 μM). The amplitude of the tonic GABA current was measured by the shift of the baseline after the administration of bicuculline (100 mM) using the Clampfit program. The tonic current was measured from the baseline to the bicuculline-treated current.
[0210]
[0211] The experimental results of measuring the amount of tonic GABA through MAOB ASO injection in the Alzheimer's model are shown in Fig. 5a. As a result of injecting MAOB ASO A41 into the Alzheimer's animal model APP / PS1, tonic GABA at a level of approximately 3.2 pA was measured. This is a relatively low amount compared to the amount of tonic GABA measured in the same existing Alzheimer's animal model shown in Fig. 5b.
[0212]
[0213] 3 - 4. Mao BASO KD test (measurement of body weight change) in high-fat diet mice
[0214]
[0215] For all experiments conducted in the high-fat diet mouse model, mice with a C57BL / 6J background derived from the Jackson Laboratory (stock number 000664) in the United States were used. Six-week-old male C57BL / 6J mice (DBL, Chungbuk, South Korea) were fed a high-fat diet (60% kcal fat, D12492, Research Diets Inc.) or a normal diet (Teklad, 2018S, Envigo) for 6 weeks to 23 weeks. PBS and 3.5 mg / kg of ASO (a143) were used as the control group, and ASO targeting MAOB (a41 conjugated with GalNAc) was used. The high-fat diet mice were anesthetized with vaporized isoflurane, and 200 μl of ASO was injected subcutaneously using a syringe loaded with ASO (at a concentration of 3.5 mg / kg) while grasping the neck muscles. Injections were performed twice at week 0 and week 2 during a total observation period of 5 weeks, and body weight was measured once a week from week 0 to week 5.
[0216] The experimental results of the weight loss effect through MAOB ASO injection in the fatty liver and obesity models are shown in Figure 6a. In high-fat diet mice as fatty liver and obesity animal models, after injecting ASO targeting MAOB, it was confirmed that the body weight decreased significantly compared to the control group.
[0217]
[0218] 3-5. MaoB ASO KD test in high-fat diet (HFD) mice (fatty liver phenotype)
[0219]
[0220] Each mouse used in 3-4 was deeply anesthetized with isoflurane at week 5, and then each organ was immediately isolated. The liver tissue was fixed with 4% PFA overnight, and additional procedures were performed. Histological changes in lipid droplets were confirmed through hematoxylin and eosin (H&E) staining. Mayer’s hematoxylin was used for all slides as the control staining.
[0221] A significant increase in triglyceride was observed in the liver of high-fat diet mice, which is a trait similar to the trait of fatty liver. The experimental results of the fatty liver recovery effect through MAOB ASO injection in high-fat diet mice are shown in Fig. 6b. As a result of injecting ASO targeting MAOB in high-fat diet mice, it was confirmed that triglyceride significantly decreased compared to the control group.
[0222]
Industrial Applicability
[0223] According to the present invention, by reducing the amount of mRNA or protein encoding monoamine oxidase B, it can be effectively used for the prevention, alleviation or treatment of neurological diseases or liver diseases.
[0224]
[0225] In the above, specific parts of the content of the present invention have been described in detail. However, for those with ordinary knowledge in the art, such specific descriptions are only preferred embodiments, and it will be obvious that the scope of the present invention is not limited thereby. Therefore, it can be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.
[0226]
Sequence Listing Free-Text
[0227] An electronic file was attached.
Claims
1. An oligomer having a length of 13 nt to 35 nt that suppresses MAOB gene expression through hybridization with at least 13 consecutive nucleobases of the nucleic acid sequence of the MAOB whole pre-mRNA sequence (MAOB whole pre-mRNA sequence) described in Accession No. 41 and Watson-Crick type base pairs (Watson-Crick pairing) A:T or G:C or wobble base pairs (wobble pairing) G:U, I:A, I:C, or I:U.
2. The oligomer according to claim 1, wherein at least 13 consecutive nucleobases of one sequence selected from the group consisting of SEQ ID NOs: 1 to 20 can hybridize through Watson-Crick type base pairs A:T or G:C or wobble base pairs G:U, I:A, I:C, or I:U and has a length of 13 nt to 35 nt.
3. The oligomer according to claim 1, wherein at least 13 consecutive nucleobases of one sequence selected from the group consisting of SEQ ID NOs: 2, 3, and 9 can hybridize through Watson-Crick type base pairs A:T or G:C or wobble base pairs G:U, I:A, I:C, or I:U and has a length of 13 nt to 35 nt.
4. The oligomer according to claim 1, wherein at least 13 consecutive nucleobases of the sequence of SEQ ID NO: 9 can hybridize through Watson-Crick type base pairs A:T or G:C or wobble base pairs G:U, I:A, I:C, or I:U and has a length of 13 nt to 35 nt.
5. The oligomer according to claim 1, having the following sequence and chemical structure: T*GAAAC*6*6*5*5*5*7*7*6*5*6*ACGA*G; G*ATCA*6*5*7*7*6*6*8*6*8*6*CAGC*T; or C*ACTAA*5*8*6*5*6*5*8*5*8*8*TAGC*C, where PS, phosphorothioate; 2′MOE, 2′-O-methoxyethyl. A = 2′MOE-A, C = 2′MOE-5′-methyl-C, G = 2′MOE-G, T = 2′MOE-T, 5 = DNA-A, 6 = DNA-5′-methyl-C, 7 = DNA-G, 8 = DNA-T, *=PS.
6. The oligomer according to claim 1, having the following sequence and chemical structure: C*ACT A*5*8*6*5*6*5*8*5*8*8*TAGC*C, where PS, phosphorothioate; 2’MOE, 2’-O-methoxyethyl. A = 2’MOE-A, C = 2’MOE-5’-methyl-C, G = 2’MOE-G, T = 2’MOE-T, 5 = DNA-A, 6 = DNA-5’-methyl-C, 7 = DNA-G, 8 = DNA-T, *=PS.
7. The oligomer according to claim 6, comprising GalNAc (N-acetylgalactosamine).
8. The oligomer according to claim 7, wherein trivalent GalNAc (N-acetylgalactosamine) is linked to the 5’ or 3’ terminal phosphate of the oligomer.
9. A composition comprising a salt of the oligomer compound according to any one of claims 1 to 8 and at least one pharmaceutically acceptable carrier or diluent.
10. The composition according to claim 9, wherein the salt is a sodium salt or a potassium salt.
11. The composition according to claim 9, for preventing, reducing or treating a neurological disease.
12. The composition according to claim 11, wherein the neurological disease is Alzheimer's disease.
13. The composition according to claim 9, for preventing, reducing or treating a liver disease.
14. The composition according to claim 13, wherein the liver disease is fatty liver.
15. The composition according to claim 9, for preventing, reducing or treating a metabolic disease.
16. The composition according to claim 15, wherein the metabolic disease is obesity. [MAOB pre-mRNA sequence] SEQ ID NO: 41: chrX: 43,766,610-43,882,450 (hg38, (-) strand, length 115,841 bp) [Target and ASO sequence]
Citation Information
Patent Citations
Alpha-aminoamide derivative compound and pharmaceutical composition comprising same
US20170298011A1
Haloallylamine dual amine oxidase inhibitors
WO2021258159A1