Therapeutic Compounds and Compositions

Abstract

The present invention relates to siRNA molecules specific for mRNA 5 encoding a mutant form of FGFR3 (fibroblast growth factor receptor 3) protein. More particularly, the present invention relates to such siRNA molecules for use in the treatment of achondroplasia.

Description

Technical Field

[0001] The present invention relates to small interfering (si) RNA molecules specific for mRNA encoding a mutant form of FGFR3 (fibroblast growth factor receptor 3) protein. More particularly, the present invention relates to such siRNA molecules for use in the treatment of achondroplasia.

Background Art

[0002] Achondroplasia (ACH) is a type of skeletal dysplasia caused by the FGFR3 (fibroblast growth factor receptor 3) gene and is the most common cause of disproportionate short stature in humans. FGFR3 mutations are also involved in other skeletal dysplasias such as hypochondroplasia and lethal osteochondrodysplasia. All cases of ACH result from autosomal dominant mutations, with the missense mutation p.Gly380Arg (located in the FGFR3 transmembrane domain) accounting for approximately 97% of cases. (Shiang R et al. (1994) Cell 78:335-342, DOI:10.1016 / 0092-8674(94)90302-6; Ornitz DM and Legeai-Mallet L (2017) Developmental Dynamics 246:291-309, DOI:10.1002 / DVDY.24479).

[0003] ACH is a rare disease, and it is estimated that about 250,000 people worldwide are affected. If left untreated, it is associated with multiple orthopedic and neurological complications. Patients with achondroplasia often also suffer from chronic pain that can have a profound negative impact on quality of life (Pauli RM (2019) Orphanet Journal of Rare Diseases 14:1, https: / / doi.org / 10.1186 / sl3023-018-0972-6). Currently, there are few therapies available for achondroplasia, and for them to be effective, they must be administered within a limited time frame from birth to puberty. (Ornitz DM and Legeai-Mallet L (2017) Developmental Dynamics 246:291-309, DOI: 10.1002 / DVDY.24479).

[0004] Clinically used treatments for achondroplasia are limited to invasive orthopedic surgeries such as hip or knee replacement and limb lengthening procedures, and a few pharmaceutical interventions including growth hormone therapy. Limb lengthening surgery involves cutting the cortical long bones (femur and / or tibia) and then gradually stretching the limb over several months to increase the bone length. This procedure is effective in increasing height but is time-consuming, painful, and associated with complications such as increased risk of infection, muscle problems, and fractures. Growth hormone (GH) therapy involves the administration of recombinant human growth hormone (rhGH). This has been shown to result in a moderate increase in growth that is further increased when rhGH is co-administered with thyroid hormone. However, GH therapy involves daily subcutaneous injections and is thought to be ineffective in cases associated with spinal and lower limb deformities. Importantly, these treatments are not curative and, if complications occur, can further negatively impact the patient's quality of life. (Wrobel W et al. (2021) Int. J. Mol. Sci. 22:5573, DOI: https: / / doi.org / 10.3390 / ijms22115573).

[0005] Several alternative non-surgical therapies are under development, but most are still in testing or in the pre-clinical stage. The most advanced of these is BioMarin's vosoritide, a C-type natriuretic peptide (CNP) analogue that is involved in normal longitudinal growth. In 2021, vosoritide was approved by both the FDA and the EMA for the treatment of achondroplasia. Others include small molecules targeting FGFR3 signaling, such as the tyrosine kinase inhibitor infliximab (NVP-BGJ398 / BGJ398), which is currently in a Phase II clinical trial (NCT04265651). However, these therapies are not the targeted therapies and reduce overall FGFR3 signaling. Furthermore, they may have varying effectiveness against different symptoms associated with achondroplasia. These treatments are effective in increasing bone length, but their effects on other important aspects, such as disproportion, axial skeleton, and foramen magnum stenosis (all of which can be associated with further complications), have not yet been confirmed. In general, since achondroplasia therapies are long-term, there is also a need for treatments that can be delivered in a form suitable for pediatric patients and with side effects minimized to a dose-tolerable level.

[0006] Accordingly, there is still a need for new therapies for achondroplasia and other skeletal dysplasias that are reliable, effective, and do not interfere with the patient's quality of life. The present invention addresses this need.

Summary of the Invention

Means for Solving the Problems

[0007] According to a first aspect, the present invention is an siRNA molecule comprising at least 17 consecutive nucleotides selected from the sequence GCAGGCAUCCUCAGCUACX M GGGUGGGCUUCUUCCUGU (SEQ ID NO: 1), wherein X M is selected from nucleotides A and C, and the consecutive nucleotides selected from SEQ ID NO: 1 are found at position 19 of SEQ ID NO: 1, where X MAn siRNA molecule that must contain nucleotides, or a variant of the siRNA molecule having at least one and no more than six nucleotide substitutions with respect to SEQ ID NO: 1, provided that X at the position of the variant siRNA molecule corresponding to position 19 of SEQ ID NO: 1 M There is no nucleotide substitution, and thus it is selected from nucleotides A and C, and a variant is provided that is not a 19-nucleotide siRNA having the sequence GAAGGCAUCCUCAGCUACA.

[0008] According to a second aspect of the present invention, the sequence GX1AGX2X3AUCCX4CX5X6X 7U X8X9X M X 10 X 11 X 12 X 13 X 14 GX 15 CX 16 UCX 17 UX 18 An siRNA molecule comprising at least 17 consecutive nucleotides selected from CUGU (SEQ ID NO: 14), where X M is selected from nucleotides A and C, and the consecutive nucleotides selected from SEQ ID NO: 14 do not contain the X found at position 19 of SEQ ID NO: 14 M must contain nucleotides, X1 is selected from C and U, X2 is selected from G and U, X3 is selected from C and U, X4 is selected from A and U, X5 is selected from A and U, Xe is selected from G and U, X7 is selected from C, G, and U, X8 is selected from A and U, X9 is selected from C and U, X 10 is selected from G, A, and U, X 11 is selected from G and U, X 12 is selected from G and A, X 13 is selected from A and U, X 14 is selected from G and C, X 15 is selected from G and C, X 16 is selected from A and U, X 17 is selected from A and U, X 18An siRNA molecule is provided, which is selected from C and U.

[0009] According to a third aspect of the present invention, there is provided a method for producing the siRNA molecule or its variant disclosed herein, the method comprising the step of synthesizing the siRNA molecule or its variant.

[0010] According to a fourth aspect of the present invention, there is provided a pharmaceutical composition comprising the siRNA molecule or its variant disclosed herein and a pharmaceutically acceptable carrier.

[0011] According to a fifth aspect of the present invention, (i) lipid particles containing hydrolyzable silicon, and (ii) a complex comprising the siRNA or its variant disclosed herein associated with the lipid particles is provided.

[0012] According to a sixth aspect of the present invention, (i) particles containing hydrolyzable silicon, (ii) optionally, one or more lipids, and (iii) a complex comprising the siRNA or its variant disclosed herein associated with the particles is provided.

[0013] According to a seventh aspect of the present invention, (i) particles containing hydrolyzable silicon, (ii) optionally, one or more lipids, and (iii) an siRNA targeting an mRNA encoding a mutant FGFR3 protein, wherein the siRNA targets a part of the mRNA sequence containing a nucleotide encoding a Gly to Arg mutation at position 380 of the protein, and the siRNA is associated with the particles, a complex comprising the siRNA is provided.

[0014] According to an eighth aspect of the present invention, there is provided the siRNA molecule or its variant, pharmaceutical composition, or complex disclosed herein for use as a medicament.

[0015] According to a ninth aspect of the present invention, there is provided an siRNA molecule or a variant thereof, a pharmaceutical composition, or a complex disclosed herein for use in the treatment of achondroplasia.

[0016] According to a tenth aspect of the present invention, there is provided an siRNA molecule or a variant thereof, a pharmaceutical composition, or a complex disclosed herein for use in downregulating the expression of an FGFR3 protein having a Gly to Arg mutation (G380R) at position 380.

[0017] According to an eleventh aspect of the present invention, there is provided a method for treating achondroplasia in a mammalian subject in need thereof, the method comprising administering to the mammalian subject a pharmaceutically effective dose of an siRNA molecule or a variant thereof, a pharmaceutical composition, or a complex disclosed herein.

[0018] It will be understood, of course, that features described in relation to one aspect of the invention may be incorporated into other aspects of the invention. For example, the methods, pharmaceutical compositions, and complexes of the present invention may incorporate any of the features described in relation to the siRNA molecules (or variants thereof) of the present invention, and vice versa. BRIEF DESCRIPTION OF THE DRAWINGS

[0019]

Figure 1A

Figure 1B

Figure 2

Figure 3

Figure 4

Figure 5A

Figure 5B

Figure 6

Figure 7A

Figure 7B

Figure 7C

Figure 7D

Figure 8A

Figure 8B

Figure 9

Figure 10

Figure 11

Figure 12

DETAILED DESCRIPTION OF THE INVENTION

[0020] ACH is caused by an autosomal dominant mutation in the FGFR3 gene, resulting in the expression of a mutant gain-of-function FGFR3 protein containing a Gly to Arg substitution at position 380. Patients affected with ACH carry the mutant FGFR3 allele and a normal (non-mutant) FGFR3 allele, and thus, the inventors hypothesized that ACH could be treated using an RNAi-based approach. In particular, the inventors developed a mutation-driven targeted therapy based on the use of siRNAs that can complement and result in the degradation of mutant FGFR3 mRNA.

[0021] Accordingly, the present invention relates, in part, to siRNA molecules that can target and down-regulate mRNA encoding mutant FGFR3 protein. Accordingly, such siRNA molecules are useful for treating or preventing ACH. Advantageously, the siRNA molecules of the present invention can selectively target and down-regulate messenger RNA (mRNA) encoding mutant FGFR3 protein, i.e., the siRNA molecules down-regulate mutant mRNA but do not substantially down-regulate the expression of wild-type mRNA (encoded by the normal, non-mutant FGFR3 allele). Advantageously, the siRNA molecules of the present invention can differentially affect the amounts of mutant mRNA and wild-type / normal mRNA present in a cell such that the amount of wild-type / normal mRNA in the cell is greater than the amount of mutant mRNA in the cell. This can be achieved by down-regulating the amount of mutant mRNA in the cell without substantially down-regulating the amount of wild-type mRNA in the cell, or by up-regulating the amount of wild-type mRNA in the cell without substantially down-regulating the amount of mutant mRNA in the cell, or by down-regulating the amount of wild-type mRNA in the cell while also up-regulating the amount of mutant mRNA in the cell.

[0022] Accordingly, the inventors designed siRNAs that specifically target mutant mRNA. This was achieved by designing siRNAs that are complementary to regions of mutant mRNA that contain point mutations encoded by the mutant human FGFR3 gene. In certain embodiments, the inventors' siRNA design strategy includes the addition of additional nucleotide mismatches compared to the corresponding target sequences of mutant FGFR3 mRNA to enhance siRNA specificity. Accordingly, such siRNA molecules will have two nucleotide mismatches to the wild-type FGFR3 mRNA sequence (the disease-causing point mutation and the additional nucleotide mismatches).

[0023] The inventors herein demonstrate that they were able to design siRNA sequences that can bind to and degrade only mutant FGFR3 mRNA without substantially affecting normal / wild-type FGFR3 mRNA. Thus, the latter can be translated into normal proteins sufficient to restore normal FGFR3 function, which is known as "haplosufficiency".

[0024] The siRNA-based strategies described herein are advantageous because they are highly specific for mutant FGFR3 and have no or minimal off-target effects when compared to other therapeutic options, including blocking antibodies, aptamers, decoy receptors, and inhibitors of tyrosine kinase activity. Furthermore, siRNA molecules are more specific than other RNAi molecules, including miRNAs. Indeed, miRNAs are not specific for a single mRNA but can target different unrelated mRNAs simultaneously and cannot be designed in a mutation-specific manner.

[0025] Another advantage of the inventors' approach is represented by the low or non-existent risk of overdosage. Indeed, the inventors advantageously target mutant FGFR3 signaling with minimal or no downregulation of normal FGFR3, so the maximum effect of the siRNA should be to normalize FGFR3 signaling.

[0026] As described above, siRNA causes gene silencing by targeting mRNA. siRNA is a short (usually about 19 - 25 nucleotides) double-stranded RNA molecule that works by utilizing the RNA interference response. This distinguishes them from single-stranded antisense oligonucleotides (ASOs), another tool used for oligonucleotide-induced gene silencing that bind directly to mRNA. When siRNA enters a cell, it is first recognized and processed by the protein machinery of the RNA-induced silencing complex (RISC). Subsequently, the siRNA strand complementary to the target mRNA (also known as the "guide strand") is incorporated into RISC. When the guide strand binds to the target mRNA, Argonaute, one of the proteins in RISC, cleaves the mRNA, which then triggers the exonucleolytic degradation of the cleaved mRNA. Thus, the expression of the target mRNA, and thus the protein encoded by that mRNA, are both downregulated by siRNA.

[0027] Definitions As used herein, the term "coding sequence (CDS)" refers to the portion of a gene's DNA that encodes mRNA, specifically, the strand of the DNA double helix that contains a sequence equivalent to that of the corresponding mRNA (the DNA coding sequence contains thymine instead of uracil as found in mRNA). This is also known as the "coding strand" or "sense strand" of the DNA.

[0028] The term "template strand" as used herein refers to the strand of the DNA double helix within a gene that serves as the template for mRNA transcription, i.e., the strand complementary to the coding sequence or coding strand. The template strand may also be referred to as the "antisense strand".

[0029] As used herein, the term "siRNA" refers to short (usually about 19-25 nucleotides) RNA molecules that may be at least partially double-stranded or fully double-stranded and may be used for post-transcriptional gene silencing. siRNA includes a first strand having a sequence identical or substantially similar to the sequence of the target mRNA that hybridizes to a second complementary strand. The siRNA molecule need not be double-stranded along its entire length. For example, advantageous siRNA molecules of the invention may be double-stranded along the length of the sequence complementary to the target mRNA (taking into account the possibility of one or two mismatches with the target mRNA as described herein), but may have single-stranded overhangs at one or both 3'-ends of the double-stranded molecule (the single-stranded overhangs may or may not be complementary to the target mRNA). The sequences of the siRNA molecules disclosed herein are represented with respect to the first strand, i.e., the sequence identical or substantially similar to the sequence of the target mRNA. In certain embodiments, the siRNA molecules described herein may have overhangs of single-stranded sequences at one or both ends of the molecule. For example, the siRNA molecules described herein may have overhangs at one or both 3'-ends of the double-stranded portion of the siRNA molecule. The overhangs may advantageously be 1 or 2 nucleotides in length, and the nucleotides may be an extension of the sequence complementary to the target mRNA or the nucleotides may be non-complementary sequences, such as UU overhangs or deoxythymidine dinucleotide (dTdT) overhangs. When overhangs are present at both 3'-ends, the overhangs may be symmetric or asymmetric.

[0030] References to GFP herein should be understood as references to enhanced green fluorescent protein (EGFP).

[0031] siRNA molecule In one aspect, the invention is an siRNA molecule comprising at least 17 contiguous nucleotides selected from the sequence GCAGGCAUCCUCAGCUACX M GGGUGGGCUUCUUCCUGU (SEQ ID NO: 1), wherein XM is selected from nucleotides A and C, and the continuous nucleotides selected from SEQ ID NO: 1 are X found at position 19 of SEQ ID NO: 1 M is a siRNA molecule that must contain nucleotides, or a variant of a siRNA molecule having at least one and no more than six nucleotide substitutions relative to SEQ ID NO: 1, provided that X at the position of the variant siRNA molecule corresponding to position 19 of SEQ ID NO: 1 M has no nucleotide substitution, and thus provides a variant selected from nucleotides A and C

[0032] In one embodiment of this aspect, the present invention is a siRNA molecule comprising at least 17 continuous nucleotides selected from SEQ ID NO: GCAGGCAUCCUCAGCUACX M GGGUGGGCUUCUUCCUGU (SEQ ID NO: 1), wherein X M is selected from nucleotides A and C, and the continuous nucleotides selected from SEQ ID NO: 1 are X found at position 19 of SEQ ID NO: 1 M is a siRNA molecule that must contain nucleotides, or a variant of a siRNA molecule having at least one and no more than six nucleotide substitutions with respect to SEQ ID NO: 1, provided that X at the position of the variant siRNA molecule corresponding to position 19 of SEQ ID NO: 1 M has no nucleotide substitution, and thus is selected from nucleotides A and C, and the variant provided is not a 19-nucleotide siRNA having the sequence GAAGGCAUCCUCAGCUACA

[0033] In one embodiment of this aspect, a siRNA molecule comprising at least 17 continuous nucleotides selected from SEQ ID NO: GCAGGCAUCCUCAGCUACX M GGGUGGGCUUCUUCCUGU (SEQ ID NO: 1), wherein X M is selected from nucleotides A and C, and the continuous nucleotides selected from SEQ ID NO: 1 are X found at position 19 of SEQ ID NO: 1 MAn siRNA molecule that must contain nucleotides, or a variant of the siRNA molecule having at least one and no more than six nucleotide substitutions with respect to SEQ ID NO:1, provided that the X at the position of the variant siRNA molecule corresponding to position 19 of SEQ ID NO:1 M The nucleotide is not substituted and is thus selected from nucleotides A and C, and the variant is provided wherein the siRNA molecule does not consist of the sequence GAAGGCAUCCUCAGCUACA.

[0034] In one embodiment of this aspect, the sequence GCAGGCAUCCUCAGCUACX M An siRNA molecule comprising at least 17 consecutive nucleotides selected from GGGUGGGCUUCUUCCUGU (SEQ ID NO:1), wherein X M is selected from nucleotides A and C, and the consecutive nucleotides selected from SEQ ID NO:1 do not contain the X nucleotide found at position 19 of SEQ ID NO:1 M An siRNA molecule that must contain nucleotides, or a variant of the siRNA molecule having at least one and no more than six nucleotide substitutions with respect to SEQ ID NO:1, provided that the X at the position of the variant siRNA molecule corresponding to position 19 of SEQ ID NO:1 M The nucleotide is not substituted and is thus selected from nucleotides A and C, and the variant is provided wherein the siRNA molecule does not contain a sequence having the sequence GAAGGCAUCCUCAGCUACA.

[0035] In one embodiment of this aspect, the siRNA molecule or its variant comprises at least 18 or at least 19 consecutive nucleotides selected from the sequence of SEQ ID NO:1. In another embodiment of this aspect, the siRNA molecule or its variant comprises at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive nucleotides selected from the sequence of SEQ ID NO:1.

[0036] In one embodiment of this aspect, the maximum length of the siRNA molecule or its variant is 30, 29, 28, 27, 26 or fewer nucleotides, for example 25 or fewer nucleotides.

[0037] In one embodiment of this aspect, the length of the siRNA molecule or its variant is 17 - 25 nucleotides, preferably 19 - 23 nucleotides. In another embodiment of this aspect, the length of the siRNA molecule or its variant is 20 - 23 nucleotides. In another embodiment of this aspect, the length of the siRNA molecule or its variant is 19 - 22 nucleotides, 19 - 21 nucleotides, or 19 - 20 nucleotides. In another embodiment of this aspect, the length of the siRNA molecule is 19 nucleotides.

[0038] In one embodiment of this aspect, the variant of the siRNA molecule has at least one and no more than five nucleotide substitutions relative to SEQ ID NO: 1, and the X M nucleotide at the position of the variant siRNA molecule corresponding to position 19 of SEQ ID NO: 1 is not substituted, and thus is selected from nucleotides A and C. In another embodiment of this aspect, the variant of the siRNA molecule has at least one and no more than four nucleotide substitutions relative to SEQ ID NO: 1, provided that the X M nucleotide at the position of the variant siRNA molecule corresponding to position 19 of SEQ ID NO: 1 is not substituted, and thus is selected from nucleotides A and C. In another embodiment of this aspect, the variant of the siRNA molecule has at least one and no more than three nucleotide substitutions relative to SEQ ID NO: 1, provided that the X M nucleotide at the position of the variant siRNA molecule corresponding to position 19 of SEQ ID NO: 1 is not substituted, and thus is selected from nucleotides A and C. In another embodiment of this aspect, the variant of the siRNA molecule has at least one and no more than two nucleotide substitutions relative to SEQ ID NO: 1, provided that the X MThe nucleotide is not substituted and is thus selected from nucleotides A and C. In another embodiment of this aspect, the variant of the siRNA molecule has only one nucleotide substitution relative to SEQ ID NO:1, provided that X at the position of the variant siRNA molecule corresponding to position 19 of SEQ ID NO:1 M The nucleotide is not substituted and is thus selected from nucleotides A and C.

[0039] In one embodiment of this aspect, the siRNA molecule or its variant is at least partially double-stranded, i.e., it comprises a second strand that is substantially or completely complementary to the siRNA sequence disclosed herein. In another embodiment of this aspect, the siRNA molecule or its variant is double-stranded along its entire length, i.e., it comprises a second strand that is completely complementary to the siRNA sequence disclosed herein. The siRNA molecule or its variant of the present invention may have single-stranded sequence overhangs at one or both 3'-ends of one or both of the double-stranded portions of the molecule. For example, the siRNA or its variant of the present invention may have single-stranded overhangs at one or both 3'-ends of 1, 2, 3, or 4 nucleotides, such as 2 nucleotides. Advantageously, the siRNA molecule or its variant of the present invention has single-stranded overhangs of, for example, 2 nucleotides at both 3'-ends of the double-stranded molecule. Advantageously, the overhang nucleotides do not contain G nucleotides. In another embodiment of this aspect, the overhang nucleotides of the siRNA molecule or its variant are an extension of a sequence complementary to the target mRNA, or the overhang nucleotides are non-complementary sequences, such as UU or deoxythymidine dinucleotide (dTdT).

[0040] In one embodiment of this aspect, X within the siRNA molecule or its variant M is nucleotide A. In another embodiment of this aspect, X within the siRNA molecule or its variant M is nucleotide C.

[0041] In one embodiment of this aspect, the length of the siRNA molecule or its variant is at least 19 nucleotides, and the A of the siRNA molecule or its variant corresponding to the 19th position of SEQ ID NO: 1 can be found at any position of the siRNA molecule or its variant. In another embodiment of this aspect, the length of the siRNA molecule or its variant is 19 - 25 nucleotides, and the A of the siRNA molecule or its variant corresponding to the 19th position of SEQ ID NO: 1 can be found at the 1st, 6th, 9th, 15th, or 19th position of the siRNA molecule or its variant. In another embodiment of this aspect, the length of the siRNA molecule or its variant is 19 - 25 nucleotides, and the A of the siRNA molecule or its variant corresponding to the 19th position of SEQ ID NO: 1 can be found at the 1st, 6th, or 9th position of the siRNA molecule or its variant. In another embodiment of this aspect, the length of the siRNA molecule or its variant is 19 - 25 nucleotides, and the A of the siRNA molecule or its variant corresponding to the 19th position of SEQ ID NO: 1 can be found at the 6th position of the siRNA molecule or its variant. In one embodiment of this aspect, the siRNA molecule or its variant has the sequence X1X2UAX3X M contains GGGUGGX4CX5UCUU (SEQ ID NO: 2), XM is selected from the group consisting of A and C, and X1, X2, X3, X4, and X5 are each independently selected from the group consisting of A, G, C, and U. In another embodiment of this aspect, the siRNA molecule or its variant contains SEQ ID NO: 2, X1 is selected from G and U, X2 is selected from C and U, X3 is selected from C and U, X4 is selected from G and C, and X5 is selected from A and U. In another embodiment of this aspect, the siRNA molecule or its variant contains SEQ ID NO: 2 and X4 is G. In another embodiment of this aspect, the siRNA molecule or its variant contains SEQ ID NO: 2, X1 is G, X2 is C, X3 is selected from C and U, X4 is G, and X5 is selected from A and U. In another embodiment of this aspect, the siRNA molecule is selected from the group consisting of GCUAUAGGGUGGGCUUCUU (SEQ ID NO: 3) and GCUACAGGGUGGGCAUCUUU (SEQ ID NO: 4). In one embodiment of this aspect, the siRNA molecule or its variant has the sequence X MComprising X1X2GUGGGCUUCX3UX4CUGU (SEQ ID NO: 5), where X M is selected from the group consisting of A and C, and X1, X2, X3, and X4 are each independently selected from the group consisting of A, G, C, and U. In another embodiment of this aspect, the siRNA molecule or its variant comprises SEQ ID NO: 5, X1 is selected from G and A, X2 is selected from G and U, X3 is selected from A and U, and X4 is selected from C and U. In another embodiment of this aspect, the siRNA molecule or its variant comprises SEQ ID NO: 5 and X3 is U. In another embodiment of this aspect, the siRNA molecule or its variant comprises SEQ ID NO: 5, X1 is selected from A and G, X2 is G, X3 is U, and X4 is selected from C and U. In another embodiment of this aspect, the siRNA molecule is selected from the group consisting of AAGGUGGGCUUCUUCCUGU (SEQ ID NO: 6) and AGGGUGGGCUUCUUUCUGU (SEQ ID NO: 7).

[0042] In one embodiment of this aspect, the siRNA molecule or its variant has the sequence X1CAGCUAX2X M X3GGX4X5GGCUU (SEQ ID NO: 8), where X M is selected from the group consisting of A and C, and X1, X2, X3, X4, and X5 are each independently selected from the group consisting of A, G, C, and U. In another embodiment of this aspect, the siRNA molecule or its variant comprises SEQ ID NO: 8, X1 is selected from A and U, X2 is selected from C and U, X3 is selected from G and U, X4 is selected from A and U, and X5 is selected from C and G. In another embodiment of this aspect, the siRNA molecule or its variant comprises SEQ ID NO: 8 and X2 is C. In another embodiment of this aspect, the siRNA molecule is selected from the group consisting of UCAGCUACAGGGUCGGCUU (SEQ ID NO: 9) and UCAGCUACAGGGAGGGCUU (SEQ ID NO: 10).

[0043] In one embodiment of this aspect, the siRNA molecule or its variant has the sequence X1CAUCCUCAGCX2X3X4X MComprising X5GX6U (SEQ ID NO: 11), X M is selected from the group consisting of A and C, and X1, X2, X3, X4, X5, and X6 are each independently selected from the group consisting of A, G, C, and U. In another embodiment of this aspect, the siRNA molecule or its variant comprises SEQ ID NO: 8, X1 is selected from G and U, X2 is selected from C and U, X3 is selected from A and U, X4 is selected from C and U, X5 is selected from G and U, and X6 is selected from G and A. In another embodiment of this aspect, the siRNA molecule has a sequence having the sequence GCAUCCUCAGCUAUAGGGU (SEQ ID NO: 12).

[0044] In one embodiment of this aspect, the siRNA molecule or its variant comprises the sequence GX1AGGX2AUCCUCX3GX4UAX5X m (SEQ ID NO: 13), X M is selected from the group consisting of A and C, and X1, X2, X3, X4, and X5 are each independently selected from the group consisting of A, G, C, and U. In another embodiment of this aspect, the siRNA molecule or its variant comprises SEQ ID NO: 13, X1 is selected from C and U, X2 is selected from C and U, X3 is selected from A and U, X4 is selected from G and C, and X5 is selected from C and U.

[0045] In one embodiment of this aspect, the siRNA molecule or its variant comprises a sequence included in the definition of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, or SEQ ID NO: 13, and in each of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, and SEQ ID NO: 13, X M is A. In this regard, reference to the sequence included in the definition of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, or SEQ ID NO: 13 refers to a sequence having the full length of SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, or SEQ ID NO: 13, i.e., 19 nucleotides.

[0046] In one embodiment of this aspect, the siRNA molecule comprises a sequence selected from the group consisting of the following.

[0047]

Table 1

[0048] In another embodiment of this aspect, the present invention includes an siRNA molecule selected from the above table, in which the A nucleotide shown in bold is replaced by a C nucleotide.

[0049] Additional siRNA molecules can be designed, or the siRNA molecules described herein can be modified based on one or more of the following principles: (i) aiming for a GC content in the range of 30-50%; (ii) avoiding target sequences having homology of more than 16-17 consecutive base pairs to other coding sequences as identified by BLAST (http: / blast.ncbi.nlm.nih.gov / Blast.cgi); and (iii) including a UU dinucleotide overhang at the 3' end.

[0050] According to a second aspect of the present invention, the sequence GX1AGX2X3AUCCX4CX5X6X7UX8X9X M X 10 X 11 X 12 X 13 X 14 GX 15 CX 16 UCX 17 UX 18 An siRNA molecule comprising at least 17 consecutive nucleotides selected from CUGU (SEQ ID NO: 14), wherein X M is selected from nucleotides A and C, the consecutive nucleotides selected from SEQ ID NO: 14 must include the XM nucleotide found at position 19 of SEQ ID NO: 14, X1 is selected from C and U, X2 is selected from G and U, X3 is selected from C and U, X4 is selected from A and U, X5 is selected from A and U, X6 is selected from G and U, X7 is selected from C, G, and U, X8 is selected from A and U, X9 is selected from C and U, X 10is selected from G, A, and U, and X 11 is selected from G and U, and X 12 is selected from G and A, and X 13 is selected from A and U, and X 14 is selected from G and C, and X 15 is selected from G and C, and X 16 is selected from A and U, and X 17 is selected from A and U, and X 18 is selected from C and U.

[0051] In one embodiment of this aspect, the siRNA molecule or its variant comprises at least 18 or at least 19 consecutive nucleotides selected from the sequence of SEQ ID NO: 14. In another embodiment of this aspect, the siRNA molecule or its variant comprises at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive nucleotides selected from the sequence of SEQ ID NO: 14.

[0052] In one embodiment of this aspect, the maximum length of the siRNA molecule or its variant is 30 or less, 29 or less, 28 or less, 27 or less, 26 or less, or 25 or less nucleotides. In another embodiment of this aspect, the length of the siRNA molecule or its variant is 17 - 25 nucleotides, 18 - 24 nucleotides, or 19 - 23 nucleotides. In another embodiment of this aspect, the length of the siRNA molecule or its variant is 19 - 22 nucleotides, 19 - 21 nucleotides, or 19 - 20 nucleotides. In another embodiment of this aspect, the length of the siRNA molecule is 19 nucleotides.

[0053] In one embodiment of this aspect, the siRNA molecule is at least partially double-stranded. In another embodiment of this aspect, the siRNA molecule or its variant is double-stranded along its entire length. In another embodiment of this aspect, the siRNA molecule or its variant has single-stranded sequence overhangs at one or both ends of the molecule. In another embodiment of this aspect, the siRNA or its variant has a single-stranded overhang at the 3'-end of 1, 2, 3, or 4 nucleotides. Advantageously, the overhang nucleotides do not contain G nucleotides. In another embodiment of this aspect, the siRNA molecule or its variant comprises a 3'-overhang having the sequence UU.

[0054] In one embodiment of this aspect, X within the siRNA molecule or its variant M is nucleotide A. In another embodiment of this aspect, X within the siRNA molecule or its variant M is nucleotide C.

[0055] In one embodiment of this aspect, X within the siRNA molecule or its variant 15 is nucleotide G, and X 17 is nucleotide U.

[0056] In one embodiment of this aspect, the siRNA molecule comprises a sequence selected from the group consisting of the following.

[0057]

Table 2

[0058] In another embodiment of this aspect, the invention comprises an siRNA molecule selected from the above table, wherein the A nucleotide shown in bold is replaced by a C nucleotide.

[0059] Method for siRNA synthesis According to a third aspect of the present invention, there is provided a method for producing an siRNA molecule or a variant thereof disclosed herein, the method comprising the step of synthesizing the siRNA molecule or the variant thereof.

[0060] Methods for siRNA synthesis are known in the art, and those skilled in the art will be able to select an appropriate method for synthesizing the siRNA molecules or variants thereof disclosed herein. Synthetic methods can include in vitro approaches such as chemical synthesis (e.g., via the GeneAssist™ Custom siRNA Builder commercial service provided by ThermoFisher) or in vitro transcription of a suitable DNA template (e.g., using the Ambion® Silencer® siRNA Construction Kit provided by ThermoFisher). Alternatively, the synthesis of siRNA can be achieved via the introduction into cells of a DNA-based expression system, such as an siRNA expression plasmid, a viral vector, or a PCR-generated siRNA expression cassette such as those described in Castanotto D., (2002), RNA 8:1454-60. Such systems allow the siRNA molecule to be expressed directly in vivo without the need to transfect the siRNA molecule into cells. Thus, in one embodiment of this third aspect, the step of synthesizing the siRNA molecule or the variant thereof can be carried out using chemical synthesis, in vitro transcription, or a cell-based siRNA expression system (e.g., an siRNA expression plasmid, a viral vector, or a PCR siRNA expression cassette). In one embodiment of this aspect, the step of synthesizing the siRNA molecule or the variant thereof is carried out using chemical synthesis or in vitro transcription. In one embodiment of this aspect, the step of synthesizing the siRNA molecule or the variant thereof is carried out using chemical synthesis.

[0061] Pharmaceutical composition According to a fourth aspect of the present invention, there is provided a pharmaceutical composition comprising an siRNA molecule or a variant thereof disclosed herein and a pharmaceutically acceptable carrier.

[0062] Pharmaceutically acceptable carriers suitable for use according to the fourth aspect of the present invention, and their formulations, are known in the art and are described in standard pharmaceutical treatises such as Remington’s Pharmaceutical Sciences by E.W. Martin, or Wang, Y.J. or Hanson, M.A., Journal of Parenteral Science and Technology, Technical Report No. 10, Supp. 42:2S, 1988. Further examples of such carriers are described, for example, in the European Pharmacopoeia (Ph.Eur.) 2019 and Handbook of Pharmaceutical Excipients (9th Edition, 2020; Pharmaceutical Press (UK) and American Pharmaceutical Association (US)). A person skilled in the art would be able to select a suitable carrier for a pharmaceutical composition comprising the siRNA molecule or a variant thereof disclosed herein.

[0063] In one embodiment of this aspect, the pharmaceutical composition comprises a polymer selected from the group consisting of hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose, methylcellulose, carbomer, hyaluronan, chitosan, N-trimethylchitosan, N-carboxymethylchitosan, sodium carboxymethylcellulose, polygalacturonic acid, sodium alginate, xanthan gum, xyloglucan gum, scleroglucan, polyvinyl alcohol, and polyvinylpyrrolidine.

[0064] In one embodiment of this aspect, the pharmaceutical composition comprises the complex described herein.

[0065] Particles containing silicon complexed with siRNA Advantageously, the siRNA molecule or a variant thereof of the present invention is delivered in vivo using, for example, lipid particles containing hydrolyzable silicon. Thus, according to the fifth aspect of the present invention, (i) Lipid particles containing hydrolyzable silicon, and (ii) A complex comprising the lipid particles and an siRNA or a variant thereof disclosed herein associated therewith is provided.

[0066] As described below, the term "lipid particles containing hydrolyzable silicon" refers to particles containing hydrolyzable silicon and one or more lipids.

[0067] In one embodiment of this aspect, the lipid particles containing hydrolyzable silicon contain hydrolyzable elemental silicon.

[0068] In a sixth aspect of the present invention, (i) Particles containing hydrolyzable silicon, (ii) Optionally, one or more lipids, and (iii) A complex comprising the particles and an siRNA or a variant thereof disclosed herein associated therewith is provided.

[0069] In one embodiment of this aspect, the particles containing hydrolyzable silicon contain hydrolyzable elemental silicon.

[0070] In one embodiment of these fifth and sixth aspects, the siRNA or a variant thereof is associated with the particles in that it is, for example, electrostatically bound to the particles.

[0071] In one embodiment of these fifth and sixth aspects, the particles containing hydrolyzable silicon in the complex are nanoparticles, for example, silicon-stabilized hybrid lipid nanoparticles (sshLNP (trademark)) manufactured by SiSaf Ltd (Guildford, UK).

[0072] As used herein, the term "silicon-stabilized hybrid lipid nanoparticles" refers to nanoparticles that contain silicon and at least some lipid and have at least some micelle properties. Thus, the lipid molecules present tend to arrange in micelles or micelle-like structures (i.e., structures having at least some micelle properties). Micelles or micelle-like lipid particles are different from liposomes that contain a lipid bilayer, but the term "micelles or micelle-like lipid particles" as used herein allows for at least some liposome-type structures within the particles, and for this reason, they can be referred to as "hybrid" particles.

[0073] Silicon-stabilized hybrid lipid nanoparticles are generally disclosed in UK Patent No. 2210794.0 (incorporated herein by reference and obtainable from other patent applications, e.g., the publications of international patent applications claiming priority therefrom, or files available at the time of publication). Advantageous methods for making silicon-stabilized hybrid lipid nanoparticles are generally disclosed in UK Patent No. 2300914.5 (which is also incorporated herein by reference and can also be obtained from other patent applications, e.g., at the time of publication of international patent applications claiming priority therefrom or files available at the time of publication).

[0074] Conventional lipid particles, including lipid nanoparticles (LNPs), have shown some promise as vectors for the delivery of therapeutic nucleic acids, particularly for the delivery of therapeutic RNA. RNA is particularly prone to degradation during formulation and storage. Various pharmaceutical compositions have been proposed to limit the extent of RNA degradation. One way to limit RNA degradation is to attempt to encapsulate the RNA in protective micelle lipids. For example, European Patent No. 3677567A1 discloses lipid particles having mRNA molecules encapsulated therein.

[0075] However, the use of LNPs for RNA delivery is associated with various challenges. Among these challenges is the requirement to form micelles or micelle-like lipid particles at elevated temperatures. The exact temperature required depends on the lipid used, but typically a temperature of about 60 °C is needed. Such high temperatures cause significant degradation of RNA and other labile active ingredients. This can be countered to some extent by the use of modified active ingredients, such as modified RNA. U.S. Patent No. 9,504,651 B2 discloses a method of forming micelle lipid particles “around” mRNA, and it is notable that at least 70% of the mRNA is encapsulated. Of the 30% that is not encapsulated, much appears to be degraded.

[0076] There are also challenges associated with keeping micelles or micelle-like lipid particles “stable”. As discussed in UK Patent Nos. 2,210,794.0 and 2,300,914.5, small lipid particles can have a tendency to coalesce into larger particles. Thus, improving “stability” involves both countering the tendency of small micelles or micelle-like lipid particles to coalesce into larger particles and countering the tendency of charged lipids, which are part of the micelles or micelle-like lipid particles, to lose their charge. Considerable research has been conducted in this area regarding the production of novel lipids with advantageous properties and the development of formulations of multiple lipids with advantageous properties in the ability to form stable micelles or micelle-like particles.

[0077] In silicon-stabilized hybrid lipid nanoparticles, silicon particles (which are themselves smaller than micelles or micelle-like structures) can be “sprayed” onto the surface of the micelle or micelle-like structure and / or “into” the surface of the lipid particle (i.e., they partially penetrate into the lipid particle, but part of the silicon particle is accessible on the surface), thereby not only inhibiting the tendency of the lipid particles to coalesce with each other but also coordinating with any charged lipid component of the lipid particle, thereby protecting it and also providing an excellent ability to form complexes with RNA in the lipid particle.

[0078] The complexes of the present invention based on silicon-stabilized hybrid lipid nanoparticles, particularly sshLNP™, advantageously enable the electrostatic binding of high-capacity, strongly condensed RNA, thus protecting the RNA from hydrolysis and extending its in vivo survival. Furthermore, silicon-stabilized hybrid lipid nanoparticles, particularly sshLNP™, provide a positive charge and a high ζ potential for improving the electrostatic binding of RNA, thereby preventing premature dissociation of RNA from the complex.

[0079] In summary, one advantage of silicon-stabilized hybrid lipid nanoparticles is the improved stability of micelles or micelle-like lipid particles.

[0080] Another advantage of silicon-stabilized hybrid lipid nanoparticles, particularly sshLNP™, is to provide a method for improving the stability of micelles or micelle-like microparticles, which method is less dependent on the use of certain novel lipids, particularly cationic or ionizable lipids, which may be subject to technical challenges, supply constraints and intellectual property restrictions for use.

[0081] By using silicon-stabilized hybrid lipid nanoparticles, a wider range of lipids can be used, including lipids that are less costly and more readily available than some of the special lipids that may be required to be used in prior art methods and products to obtain micelles or micelle-like lipid particles with sufficient performance, to form a sufficiently stable delivery vehicle for RNA.

[0082] Conversely, silicon-stabilized hybrid lipid nanoparticles may also be used together with advantageous prior art "high-performance" specialized lipids to achieve even better performance.

[0083] Thus, silicon-stabilized hybrid lipid nanoparticles utilize the discovery that silicon particles (especially particles containing hydrolyzable silicon) can be used to stabilize micelles or micelle-like lipid particles, inhibit their aggregation, help cationic lipids and ionizable lipids retain their charges, and promote the ability of micelles or micelle-like lipid particles to protect nucleic acids by stabilizing the nucleic acids on the surface of the micelles or micelle-like lipid particles rather than by encapsulation.

[0084] Such an arrangement advantageously allows micelles or micelle-like lipid particles to be prepared in the absence of nucleic acids, and the nucleic acids can be added to the particles only after they are fully formed and any process involving high temperatures is completed, as described in UK Patent No. 2210794.0 and UK Patent No. 2300914.5. Thus, such sshLNP™ can also advantageously be prepared, stored, delivered to a clinic, and then administered into a patient after being complexed with RNA (e.g., siRNA or variants thereof disclosed herein). The delivery vehicle can be stored separately from the RNA until near the time it is to be administered to the patient. Since the delivery vehicle does not contain RNA while it is stored, there is no need to store it at a particularly low temperature, such as below 4°C, to specifically stabilize the RNA.

[0085] Notably, complexes based on silicon-stabilized hybrid lipid nanoparticles, especially sshLNP™, are very versatile because silicon-stabilized hybrid lipid nanoparticles (especially sshLNP™) have a very high surface area (>700 m 2 / g), a pore volume >1 cm 3 / g, a stable nanostructure, an adjustable pore diameter (2 - 10 nm), two functional surfaces (external and internal), control over particle size and shape, and a modifiable particle surface via ionizable mesoporous silicon.

[0086] Examples of sshLNP™ silicon-stabilized hybrid lipid nanoparticles suitable for use in the complexes of the present invention include SIS0012 (having undoped silicon), SIS0012 2LBS (having doped silicon), SIS0013 (having doped silicon), and modified versions thereof (e.g., -N, -T, and -Q variants that can be prepared by adding 0.2 mg of NAD, tyrosine, or quercetin, respectively, as additional components).

[0087] The composition and manufacture of such sshLNP™ silicon-stabilized hybrid lipid nanoparticles, including SIS0012, SIS0013, and SIS0012 2LBS, are described elsewhere in this specification. The composition and manufacture of these sshLNP™ silicon-stabilized hybrid lipid nanoparticles, as well as SIS0013-N, SIS0013-T, and SIS0013-Q, are also described in UK Patent Application No. 2300912.9, the disclosure of which is incorporated herein by reference in its entirety (and can also be obtained at the time of publication of other patent applications, e.g., international patent applications claiming priority therefrom, or from files published at the time of publication).

[0088] The complexes according to these fifth and sixth aspects of the present invention can be prepared by combining an siRNA molecule or a variant thereof with a suitable solvent such as water, particles containing hydrolyzable silicon, and one or more lipids. The composition may optionally further comprise one or more amino acids (e.g., glycine or a mixture of amino acids containing glycine) and optionally one or more non-reducing disaccharides such as trehalose. Suitable preparation methods include dispersing the lipid component in a solvent such as methanol, forming a thin film of the lipid by evaporating the solvent, for example, in a rotary evaporator, and hydrating the lipid with an aqueous solution containing activated hydrolyzable silicon particles, e.g., particles having an average particle size of less than 100 nm, a non-reducing disaccharide such as trehalose, and one or more amino acids such as glycine. The composition may optionally be passed through filters (e.g., 0.4 μm and 0.1 μm filters) to achieve complexation and dispersion of the particles. The composition may optionally be stored at 4° C. optionally to cause further complexation. The carrier thus prepared may then be complexed with an aqueous solution of siRNA or a variant thereof in a ratio in the range of 1:6 to 1:16 (1 represents the nucleic acid). The preferred ratio is 1:8 to 1:12, where 1:8 usually allows for a slightly excess of the biological substance and 1:12 allows for a slightly excess of the carrier.

[0089] The hydrolyzable silicon of the lipid particles of the fifth aspect may be in the form of silicon particles. The silicon particles may be pure silicon or substantially pure silicon (or pure doped silicon or substantially pure doped silicon), or another hydrolyzable silicon-containing material (or another hydrolyzable doped silicon-containing material). If they are not pure silicon, they contain at least 50% by weight of silicon, i.e., contain at least 50% by weight of silicon atoms based on the total mass of the atoms in the particles. For example, the silicon particles may contain at least 60, 70, 80, 90, or 95% of silicon. The silicon particles preferably exhibit a hydrolysis rate of at least 10% of the hydrolysis rate of pure silicon particles of the same size, for example, in PBS buffer at room temperature. Assays for the hydrolysis of silicon-containing materials are widely known in the art (see, for example, WO 2011 / 001456, which is incorporated herein by reference). The silicon particles of the present invention may contain some silica, but the silica is not hydrolyzable silicon, and at least half of the silicon atoms in the particles are in the form of elemental silicon (or doped elemental silicon).

[0090] The hydrolyzable silicon-containing particles of the sixth aspect of the present invention may be pure silicon or substantially pure silicon (or pure doped silicon or substantially pure doped silicon), or another hydrolyzable silicon-containing material (or another hydrolyzable doped silicon-containing material). When the silicon is not pure silicon, the silicon contains at least 50% by weight of silicon, that is, contains at least 50% by weight of silicon atoms based on the total mass of the atoms in the particles. For example, the silicon may contain at least 60, 70, 80, 90, or 95% of silicon. The silicon preferably exhibits a hydrolysis rate of at least 10% of the hydrolysis rate of pure silicon particles of the same size, for example, in PBS buffer at room temperature. Assays for the hydrolysis of silicon-containing materials are widely known in the art (see, for example, WO 2011 / 001456, which is incorporated herein by reference). The silicon of the present invention may contain some silica, but the silica is not hydrolyzable silicon, and at least half of the silicon atoms are in the form of elemental silicon (or doped elemental silicon).

[0091] Particles containing hydrolyzable silicon may be nanoparticles. The nanoparticles may have a nominal diameter of about 1 to about 500 nm, such as about 1 to about 250 nm, such as about 1 to about 100 nm (e.g., about 30 nm), or for example about 5 to about 400 nm, such as about 50 to about 350 nm, such as about 80 to about 310 nm, such as about 100 to about 250 nm, such as about 120 to about 240 nm, such as about 150 to about 220 nm, such as about 200 nm. They can be made from either pure silicon or a hydrolyzable silicon-containing material. They are preferably porous, especially mesoporous. The nominal diameter mentioned above may refer to the average diameter, and at least 90% of the total mass of the particles in a sample of the particles can fall within the specified size range. The particle size can be ascertained or confirmed, for example, by transmission electron microscopy (TEM) using the NIST-NCL Joint Assay Protocol NCL Joint Assay Protocol, PCC-X, version 1.1, "Measuring the size of nanoparticles using TEM", revised February 2010: https: / / tsapps.nist.gov / publication / get_pdf.cfm?pub_id=854083.

[0092] Particles containing hydrolyzable silicon can be made porous by standard techniques such as contacting the particles with a hydrofluoric acid (HF) / ethanol mixture and applying an electric current. By varying the HF concentration as well as the current density and exposure time, the pore density and their sizes can be controlled and monitored by scanning electron microscopy and / or nitrogen adsorption-desorption volumetric isotherm measurements. When the particles are porous, their total surface area increases due to their porosity. For example, their surface area can increase by at least about 50% or at least about 100% compared to the surface area of the corresponding non-porous particles. According to certain embodiments, the porosity is at least 30, 40, 50, or 60%. This means that 30, 40, 50, or 60% of the particle volume is pore space, respectively. Preferred pore diameters range from about 1 nm to about 50 nm, such as about 5 nm to about 25 nm, such as about 1 nm to about 5 nm.

[0093] The hydrolyzable silicon of the fifth or sixth aspect may be hydrolyzable-doped silicon or may contain hydrolyzable-doped silicon. As used herein, the term "doped silicon" may refer to silicon that behaves as an extrinsic semiconductor due to the presence of dopant atoms. The dopant atoms may be substitutional (replacing Si atoms) dopant atoms or may contain them. Additionally or alternatively, the dopant atoms may be interstitial (non-substituting within Si atoms) dopant atoms or may contain them.

[0094] Silicon may optionally be n-doped or p-doped. The present invention includes embodiments in which silicon is doped with one or more elements selected from B, P, Mg, Ca, Cu, Ga, Al, In, Bi, Ge, Li, Xe, N, Au, and Pt. The dopant may be an n-dopant, such as phosphorus. Most preferably, the dopant is a p-dopant. Most preferably, the dopant is boron. The use of p-dopants is particularly suitable for stabilizing negatively charged nucleic acids.

[0095] The production of doped silicon is well understood in the semiconductor industry and includes ion implantation and diffusion methods. Alternatively, silicon can be doped using a diffusion method to increase the amount of dopant present in the silicon. As an example of the diffusion method, silicon powder and a doping reagent (e.g., B2O3 for boron doping) are placed in a bowl, mixed, placed in an N2 atmosphere, and further heated to a temperature of 1050 °C to 1175 °C for several minutes to diffuse the dopant (e.g., boron) into the silicon.

[0096] According to certain embodiments, the doping of silicon is in large amounts. A large amount of boron doping is particularly preferred. High-concentration doping means at least 1×10 3 per cm 15It is understood to mean doping with dopant atoms. The doping level corresponds to a specific resistivity. For example, when boron is used as the dopant, preferably, 1 cm 3 per 1×10 20 The doping level of dopant atoms corresponds to a resistivity of about 1 mohm-cm. For example, at least about 1X10 16 boron atoms / cm 3 to about 1X10 20 boron atoms / cm 3 Boron may be present at levels up to.

[0097] Advantageously, doping with hydrolyzable silicon can have a beneficial effect on the electrostatic behavior of silicon. Doping can provide improved loading of siRNA or variants thereof into the complexes disclosed herein. Without being bound by theory, this is thought to help stabilize the RNA while it is circulating in vivo, and thus increase the in vivo half-life of the RNA until it reaches the target cells and is then released. Thus, more RNA can reach the target cells during a given period after administration and more efficient RNA delivery can be achieved compared to the case where undoped particles are used. The term "in vivo half-life of RNA" as used herein is understood to refer to the in vivo elimination half-life of the RNA, i.e., the period it takes for the amount of RNA to decrease by about half when administered. The term "amount of RNA" is also understood to refer to the amount of RNA or its derivatives having the same or substantially the same intended pharmaceutical effect.

[0098] Doping with a p-dopant (e.g., boron) can result in improved binding to negatively charged RNA, particularly RNA having a net negative charge at a pH of about 7.4 (since this is the typical physiological pH), such as the siRNA or variants thereof disclosed herein.

[0099] When silicon is referred to as "undoped" in this specification (such as the particles of composition SIS0012), it means that there are no dopant atoms or only a small amount, for example, up to about 1×10 3 per cm 2 which may mean that dopant atoms are present. Additionally or alternatively, "undoped" silicon may mean silicon that does not behave as an extrinsic semiconductor.

[0100] Preferably, the ratio of silicon to nucleic acid is from 0.01:1 to 1:8, for example, 1:1 to 1:6, 1:1 to 1:5, 1:1 to 1:4, or 1:1 to 1:3. Preferably, the ratio of silicon to nucleic acid is 1:1 to 1:3. Advantageously, this ratio of silicon to nucleic acid further affects the release rate of the nucleic acid carried by the particles and stabilizes the nucleic acid carried by the particles.

[0101] At least 30% by weight, for example at least 50% by weight, for example at least 80% by weight, for example at least 90% by weight of the nucleic acid (such as the mRNA or pDNA disclosed herein, or siRNA or its variants) is associated with the silicon particles. This means that the nucleic acid is non-covalently associated with the silicon. Without being bound by theory, it is assumed that when this occurs, the random movement (Brownian motion) of the nucleic acid decreases and the chance of the nucleic acid being degraded decreases.

[0102] The term "lipid" as used herein is understood to include fatty acids and fatty acid derivatives, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, and polyketides. The term "lipid" may include lipidated oligopeptides (a term used interchangeably with the term lipopeptide herein) in which a short peptide sequence is conjugated to one or more fatty acid chains. Thus, one or more lipids may include one or more lipidated oligopeptides.

[0103] One or more lipids may include ionizable lipids, cationic lipids (e.g., DOTAP); helper lipids, such as phospholipids (e.g., DOPE); structural lipids, such as cholesterol-based lipids; and / or polyethylene glycol (PEG) lipids (e.g., DSPE-PEG2000).

[0104] One or more lipids may include phosphatidylcholine (PC), hydrogenated PC, stearylamine (SA), dioleoylphosphatidylethanolamine (DOPE), cholesteryl 3β-N-(dimethylaminoethyl) carbamate hydrochloride (DC-chol); 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), PEGylated 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), e.g., DSPE-PEG 2000 , and one or more of derivatives thereof. In certain embodiments, the lipids include, or consist of, DOTAP, DOPE, and DSPE-PEG 2000 .

[0105] Surface treatment of the particles with lipids has been found to assist in controlling the rate of nucleic acid release. The type of lipid used to treat the surface of the nanoparticles can affect the rate of nucleic acid release. In particular, surface treatment of silicon particles with lipids has a beneficial effect on the surface charge of the silicon particles, provides them with the zeta potential necessary to improve nucleic acid loading, and controls the rate of nucleic acid release at the target site. The presence of at least one lipid enables the hydrolysis rate of silicon to be controlled such that silicon hydrolyzes to bioavailable orthosilicic acid (OSA) degradation products rather than insoluble polymer hydrolysis products. Control of the nucleic acid release rate can advantageously adjust the length of time that nucleic acid protection is maintained in vivo and in the presence of various body fluids, particularly with respect to protection. For example, more nucleic acid can be delivered to target cells over a given period of time than for compositions that are otherwise identical.

[0106] In certain embodiments, the lipid(s) may have an average molecular weight in the range of 500 to 1000 (e.g., when the lipid contains one or more of a cationic lipid (e.g., DTDTMA (ditetradecyltrimethylammonium), DOTMA (2,3-dioleyloxypropyl-1-trimethylammonium), DHDTMA (dihexadecyltrimethylammonium), DOTAP (1,2-dioleoyl-3-trimethylammonium propane), helper lipid, structural lipid), helper lipid, structural lipid, and PEG lipid, and is selected from one or more of PC, hydrogenated PC, SA, DOPE, DOTAP, DTDTMA, DHDTMA, DC, cholesterol, and derivatives thereof). The ratio of lipid (i.e., total lipid component) to silicon may be from 1:1 to 40:1, such as from 1:1 to 20:1, such as from 1:1 to 18:1, 1:1 to 16:1, 1:1 to 11:1, 1:1 to 10:1, 1:1 to 9:1, 1:1 to 8:1, 1:1 to 13:1, 2:1 to 12:1, 2:1 to 11:1, 2:1 to 10:1, 2:1 to 9:1, 2:1 to 8:1, e.g., from 1:1 to 7:1, 2:1 to 7:1, 3:1 to 6:1, 4:1 to 5:1, before any extrusion of the filtration process is carried out.

[0107] As described herein, the one or more lipids may be or may include one or more structural lipids (e.g., cholesterol-based lipids). However, the one or more lipids may optionally exclude structural lipids. Thus, the one or more lipids may exclude sterols, and in particular, they may exclude cholesterol. It has been found that the compositions of the present disclosure do not need to rely on these types of lipids on which conventional RNA delivery systems typically depend. Thus, the compositions disclosed herein have the potential to provide alternatives to RNA delivery systems that rely on these types of lipids, particularly cholesterol. This can be advantageous when cholesterol is not available or (e.g., due to effects in the body) its use is otherwise not possible.

[0108] As described herein, one or more lipids may comprise one or more lipidated oligopeptides. Preferably, each of the one or more lipidated oligopeptides comprises a fatty acid chain having from about 12 to about 18 carbon atoms. Preferably, each of the one or more lipidated oligopeptides comprises from 3 to 20 amino acid residues. Thus, the lipidated oligopeptide may be a lipidated tetrapeptide, a lipidated pentapeptide, or a lipidated hexapeptide.

[0109] The lipid or lipid component may, in some embodiments, be or comprise a phospholipid. The term "phospholipid" refers to a lipid that includes a fatty acid chain and a phosphate group. Particularly preferred phospholipids are glycerophospholipids. Particularly suitable phospholipids are those in which the polar head group is bonded to a quaternary ammonium moiety, such as phosphatidylcholine (PC) or hydrogenated phosphatidylcholine. Another example of a phospholipid is DOPE (phosphatidylethanolamine or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine).

[0110] Preferably, the side chain(s) of the phospholipid is / are an aliphatic side chain(s) having 15 or more carbon atoms or an ether side chain having 6 or more repeating ether units, such as a polyethylene glycol chain or a polypropylene glycol chain. Lipids having an ether side chain may be referred to as "PEG-lipids" or "PEGylated" lipids. The PEG lipid may be a phospholipid having a PEG side chain, such as 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), for example DSPE-mPEG2000.

[0111] The lipid component may include one or more of phosphatidylcholine (PC), hydrogenated PC, stearylamine (SA), dioleoylphosphatidylethanolamine (DOPE), DOTAP, cholesteryl 3β-N-(dimethylaminoethyl) carbamate hydrochloride (DC)-cholesterol, and derivatives thereof. In certain embodiments, the lipid component may consist essentially of phosphatidylcholine, hydrogenated phosphatidylcholine, stearylamine, or combinations thereof.

[0112] A lipid to boron-doped silicon molar ratio of 0.8:1 to 20:1, such as 1:1, 6:1, 8:1, or 10:1, or 12:1, or 16:1, has been found to be particularly advantageous.

[0113] The lipid or lipid component may, in some embodiments, be or include an ionizable lipid. The term "ionizable lipid" refers to a lipid that has a charge that varies depending on the lipid pKa and the environmental pH, for example, remaining uncharged at physiological pH but becoming protonated (positively charged) at low pH. However, one or more lipids may optionally exclude ionizable lipid(s). Thus, as described above, the compositions disclosed herein advantageously may not rely overly on the use of specific novel lipids that include ionizable lipids, which may be subject to technical challenges, supply constraints, and intellectual property limitations on their use.

[0114] In some embodiments, the lipid or lipid component may be a cationic lipid or may include a cationic lipid. The term "cationic lipid" refers to a positively charged molecule having a cationic head group attached to a hydrophobic tail via a suitable spacer. Examples include DTDTMA (ditetradecyltrimethylammonium), DOTMA (2,3-dioleyloxypropyl-1-trimethylammonium), DOTAP, DHDTMA (dihexadecyltrimethylammonium), and stearylamine (SA). The positive charge is typically stabilized by a negative counterion. In certain embodiments, particularly with respect to vaccine compositions, the cationic lipid is DOTAP or includes DOTAP. DOTAP exists in S and R enantiomeric forms and can exist as the S, R form or a racemate. Optionally, of the total DOTAP present by weight, the R and S forms can be in approximately equal amounts (i.e., about 60% or less by weight of the total DOTAP present in either form). For example, at least about 80, 90, 95, 98, or 99% of the total DOTAP is of the R type. For example, at least about 80, 90, 95, 98, or 99% of the total DOTAP is of the S type.

[0115] In certain embodiments, one or more lipids may optionally comprise or consist essentially of a combination of DOTAP, DOPE, and a PEG-lipid (particularly DSPE-PEG 2000 ). In certain embodiments, one or more lipids may optionally comprise or consist essentially of a combination of DOTAP and DOPE. The weight ratio of DOTAP:DOPE can range from about 1:2 to about 2:1, for example, about 1:1. The weight ratio of DOTAP:PEG-lipid can range from about 10:1 to about 5:1, for example, about 7:1. The weight ratio of DOPE:PEG-lipid can range from about 10:1 to about 5:1, for example, about 7:1.

[0116] Nevertheless, as described herein, silicon doping may allow for the use of less cationic lipid, such as DOTAP, compared to conventional compositions for RNA delivery (lipid nanoparticles including cationic lipids, LNPs, etc.). Cationic lipids may be suitable for the electrostatic charge of polyanionic nucleic acids (including various forms of RNA), but their amine-rich nature can cause cytotoxicity, immunogenicity, and non-specific tissue accumulation.

[0117] Thus, in one embodiment, one or more lipids may optionally exclude cationic lipids. As described herein, cationic lipids may not be necessary, particularly when doped silicon, more specifically p-doped silicon, is used.

[0118] Overall, the compositions disclosed herein offer the possibility of using less lipid (particularly less cationic lipid such as less DOTAP and / or less ionizable lipid) in the RNA delivery vehicle compared to conventional RNA delivery vehicles that do not contain hydrolyzable silicon particles (e.g., conventional liposomal nucleic acid delivery vehicles such as those conventionally used for in vivo RNA delivery). Additionally or alternatively, the hydrolyzable silicon particles can offer the possibility for the RNA delivery vehicle to be formulated with a wider range of lipids while still providing transfection efficiency, storage stability, and / or targeted delivery to a particular type of tissue or a particular type of cell. This, in turn, can lead to a reduced reliance in the art on specific lipids, particularly cationic lipids, that may be specifically formulated for the purpose of RNA delivery and thus may be less cost-effective or not readily available.

[0119] As described herein, the presence of one or more lipids in the complex according to the sixth aspect of the invention is optional. Thus, in some embodiments, no lipids are present in the complex according to the sixth aspect of the invention. As described above, the compositions disclosed herein offer the possibility of using less lipid and thus may offer the possibility of not using any lipid in the delivery of siRNA.

[0120] Optionally, in addition to or instead of one or more lipids, the particles of the complex according to the sixth aspect of the invention may comprise one or more non-lipid stabilizers for siRNA, such as quercetin, tyrosine, nicotinamide adenine dinucleotide (NAD) or derivatives thereof.

[0121] Optionally, in addition to or instead of one or more lipids, the particles of the complex according to the sixth aspect of the invention may comprise a peptide containing a cell surface receptor (e.g., integrin) recognition sequence that confers a degree of cell specificity for in vivo delivery of siRNA. The peptide may have a "head group" containing the cell surface receptor recognition sequence and a "tail" that can non-covalently bind to siRNA and / or silicon.

[0122] Optionally, in addition to or instead of one or more lipids, the particles of the complex according to the sixth aspect of the present invention may contain a polycationic nucleic acid binding component. The term "polycationic nucleic acid binding component" is well known in the art and can refer to a polymer having at least three repeats of cationic amino acid residues or other cationic units having a positively charged group, and such a polymer can form a complex with a nucleic acid under physiological conditions. Examples of nucleic acid binding polycationic molecules are oligopeptides containing one or more cationic amino acids. The polycationic nucleic acid binding component can be, for example, an oligo-lysine molecule, an oligo-histidine molecule, an oligo-arginine molecule, an oligo-ornithine molecule, an oligo-diaminopropionic acid molecule, an oligo-diaminobutyric acid molecule, or a complex oligomer containing or consisting of any combination of histidine, arginine, lysine, ornithine diaminopropionic acid, and diaminobutyric acid residues. Further examples of polycationic components include dendrimers and polyethyleneimine.

[0123] Treating lipid-treated silicon particles with an amino acid can also provide a beneficial stabilizing effect on nucleic acids. Treating lipid-treated silicon particles with an amino acid has been shown to stabilize nucleic acids in biological fluids, such as in eye tissue, plasma, and tissue fluid. Lipid-treated particles formulated with an amino acid in this way can be particularly suitable for delivery to the body, for example by transdermal injection.

[0124] In one embodiment, the complex according to the sixth aspect of the present invention may further contain one or more amino acids.

[0125] In the broadest sense, the term "amino acid" encompasses any artificial or naturally occurring organic compound containing an amine functional group (-NH2) and a carboxyl functional group (-COOH). It includes α, β, γ, and δ amino acids. It includes amino acids in any chiral configuration. The amino acid may in particular be a naturally occurring amino acid. It may be a proteinogenic or non-proteinogenic amino acid (e.g., carnitine, levothyroxine, hydroxyproline, ornithine, or citrulline).

[0126] One or more amino acids may help to stabilize the silicon particles themselves. In vivo, one or more amino acids may help to regulate the hydrolysis rate of the doped silicon such that silicon hydrolyzes to a biologically available orthosilicic acid (OSA) degradation product rather than an insoluble polymer hydrolysis product. In this way, one or more amino acids may complement the function of one or more lipids of the present disclosure. Control of the hydrolysis rate of silicon may affect the release rate of an API associated with the silicon (e.g., an siRNA or variant thereof disclosed herein). Control of the API release rate may in particular regulate the length of the period during which protection of the API is sustained in vivo and in the presence of various body fluids. Thus, more API may be delivered to target cells over a given period than in an otherwise identical composition.

[0127] In one embodiment, the amino acid is glycine.

[0128] Additionally or alternatively, amino acids that are neutral or positively charged at physiological pH (about pH 7.4), such as tyrosine or arginine, can stabilize negatively charged APIs (e.g., nucleic acids such as siRNA or derivatives thereof disclosed herein). On the other hand, amino acids that are neutral or negatively charged at physiological pH (about pH 7.4) can stabilize positively charged APIs. Nevertheless, interactions based on the charges arising from the combination of doped Si, lipid(s), and amino acid(s) and / or other interactions (e.g., steric interactions) can be such that positively charged amino acid(s) at physiological pH can help stabilize positively charged APIs or negatively charged amino acid(s) at physiological pH can help stabilize negatively charged APIs.

[0129] The weight ratio of one or more lipids (i.e., total lipid component) to amino acid(s) may range from about 40:1 to about 1:1, for example, about 32:1.

[0130] Additionally or alternatively, the complex according to this fifth or sixth aspect of the invention may contain one or more non-reducing disaccharides, particularly trehalose. The weight ratio of one or more lipids (i.e., total lipid component) to non-reducing disaccharide may range from about 20:1 to about 1:1, for example, about 16:1.

[0131] In a seventh aspect of the invention, (i) particles containing hydrolyzable silicon, (ii) optionally, one or more lipids, and (iii) an siRNA targeting mRNA encoding a mutant FGFR3 protein, wherein the siRNA targets a part of the mRNA sequence containing a nucleotide encoding the Gly to Arg mutation at position 380 of the protein, and the siRNA is associated with the particles, a complex containing the siRNA is provided.

[0132] In one embodiment of this aspect, the sequence of the siRNA exactly corresponds to a portion of the mRNA sequence that contains a nucleotide encoding the Gly to Arg mutation at position 380 of the protein, or the sequence of the siRNA contains a one-nucleotide difference from a portion of the mRNA sequence that contains a nucleotide encoding the Gly to Arg mutation at position 380 of the protein, provided that the one-nucleotide difference is not one of the nucleotides encoding the Gly to Arg mutation at position 380 of the protein.

[0133] In a further embodiment of this aspect, the siRNA, the particles containing hydrolyzable silicon, and the lipid (if present) are as defined elsewhere herein.

[0134] Medical Use The siRNA molecules, pharmaceutical compositions, and complexes disclosed herein find use in the medical field for treating and / or preventing diseases or disorders associated with the G380R mutation in FGFR3, particularly diseases or disorders caused by mutations that result in the expression of mutant FGFR3 proteins with abnormal gain-of-function. Accordingly, in an eighth aspect of the invention, there is provided an siRNA molecule or variant thereof, a pharmaceutical composition, or a complex disclosed herein for use as a medicament.

[0135] According to a ninth aspect of the invention, there is provided an siRNA molecule or variant thereof, a pharmaceutical composition, or a complex disclosed herein for use in the treatment of achondroplasia.

[0136] In one embodiment of this aspect, the siRNA molecule or its variant, pharmaceutical composition, or complex for use as disclosed herein is administered to a prepubescent human subject, such as a human aged 1 to 12 years old, such as 1 to 10 years old, 1 to 9 years old, 2 to 8 years old, or 2 to 7 years old. In another embodiment of this aspect, a human subject, such as a human aged 1 to 12 years old, is treated with the siRNA molecule or its variant, pharmaceutical composition, or complex for a total period of 1 month to 7 years, such as 2 months to 6 years, such as 3 months to 5 years, such as 4 months to 3 years, such as 6 months, 1 year, 2 years, or 3 years. For example, a human subject as defined herein can be administered the siRNA or its variant disclosed herein once a month for a period of several months or years, such as for 6 months or for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 years.

[0137] According to a tenth aspect of the present invention, there is provided an siRNA molecule or its variant, pharmaceutical composition, or complex as disclosed herein for use in downregulating the expression of an FGFR3 protein having a Gly to Arg mutation (G380R) at position 380.

[0138] In one embodiment of this aspect, the siRNA molecule or its variant, pharmaceutical composition, or complex for use as disclosed herein is administered to a prepubescent human subject, such as a human aged 1 to 12 years old, such as 1 to 10 years old, 1 to 9 years old, 2 to 8 years old, or 2 to 7 years old. In another embodiment of this aspect, a human subject, such as a human aged 1 to 12 years old, is treated with the siRNA molecule or its variant, pharmaceutical composition, or complex for a total duration of 0.5 to 7 years, such as 1 to 6 years, such as 1 to 5 years, such as 1 to 3 years, such as 1, 2, or 3 years.

[0139] According to an eleventh aspect of the present invention, there is provided a method for treating achondroplasia in a mammalian subject in need thereof, the method comprising administering to the mammalian subject a pharmaceutically effective dose of an siRNA molecule or its variant, pharmaceutical composition, or complex as disclosed herein.

[0140] In one embodiment of this aspect, the mammal is a human. In another embodiment of this aspect, the mammal is prepubertal, for example a human aged 1 to 12 years, for example 1 to 10 years, 1 to 9 years, 2 to 8 years, or 2 to 7 years. In another embodiment of this aspect, a human, for example a human aged 1 to 12 years, is treated with the siRNA molecule or its variant, pharmaceutical composition, or complex for a total duration of 0.5 to 7 years, for example 1 to 6 years, for example 1 to 5 years, for example 1 to 3 years, for example 1, 2, or 3 years.

[0141] The amount of the siRNA molecule or its variant, pharmaceutical composition, or complex disclosed in the present invention required to achieve a therapeutic effect varies depending on the specific route of administration and the characteristics of the subject during treatment (e.g., age, weight, gender, or other concurrent medical conditions), and can be readily determined by a conventional skilled physician and administered.

[0142] The siRNA molecule or its variant, pharmaceutical composition, or complex disclosed herein may be administered by systemic injection or, for example, by local administration to a mucosa. Advantageously, the siRNA molecule or its variant, pharmaceutical composition, or complex is administered systemically, for example parenterally, for example intravenously.

[0143] Optimization of siRNA molecules The siRNA molecules described herein can be further optimized for in vivo use through various chemical modifications. Such chemical modifications can, for example, improve the stability of the RNA duplex, further reduce the potential for off-target effects, improve pharmacokinetics, and / or reduce immunogenicity. Thus, one or more nucleotides in the siRNA molecule or its variant disclosed herein can be chemically modified, for example, at the 2'-position of the ribose ring, for example, through 2'-alkoxy, 2'-methoxy, 2'-ethoxy, 2'-fluoro, 2'-O-(2-methoxyethyl), 2'-O-benzyl, 2'-O-methyl-4-pyridinyl, 2'-amino, 2'-aminoethyl, or 2'-guanidinopropyl modifications.

[0144] The siRNA or its variants disclosed herein may also be combined with a carrier, such as a polymeric carrier, to optimize the delivery of siRNA to target cells. Thus, the siRNA molecule or its variants disclosed herein can be bound or complexed with a carrier, such as a polymeric carrier, such as polyethyleneimine (PEI) or its derivatives (e.g., polyethyleneimine-polyethylene-glycol-N-acetylgalactosamine (PEI-PEG-GAL) or polyethyleneimine-polyethylene glycol-tri-N-acetylgalactosamine (PEI-PEG-triGAL)).

[0145] The phosphate backbone of the siRNA or its variants disclosed herein may be modified to increase resistance to nuclease degradation. This can be done at the 5' or 3' end (to enhance resistance to exonucleases) or over the entire siRNA molecule (to enhance resistance to endonucleases). Such modifications include phosphorothioate linkages that replace non-bridging oxygen in the phosphate backbone with sulfur atoms. Thus, the siRNA molecule or its variants disclosed herein may contain one or more phosphorothioate linkages.

[0146] The siRNA or its variants disclosed herein may contain different types of modified nucleotides. The siRNA molecule or its variants disclosed herein may include one or more modified nucleotides, for example, one or more modified nucleotides independently selected from the group consisting of 2'-fluoro, 2'-amino, 2'-thio, and 2'-deoxy modified ribonucleotides. The one or more modified nucleotides may be present in the sense strand or the antisense strand, for example, a 2'-fluoro modified ribonucleotide present within the sense strand.

[0147] The siRNA molecules or variants thereof disclosed herein may include, for example, one or more modified nucleotides, such as one or more modified nucleotides independently selected from the group consisting of 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-aminouridine, 2'-amino-adenosine, 2'-amino-guanosine, and 2'-amino-butyryl-pyrene-uridine.

[0148] The siRNA molecules or variants thereof disclosed herein may include modified nucleotides selected from the group consisting of, for example, 5-bromouridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 5-fluorocytidine, and 5-fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine, and 5-amino-allyl-uridine.

[0149] The siRNA molecules or variants thereof disclosed herein may, for example, include one or more 2'-O-methyl (2'OMe) modifications, where a methyl group is added to the 2'-hydroxyl of the ribose moiety, thus forming 2'OMe-guanosine, 2'0Me-uridine, 2'OMe-adenosine, or 2'OMe-cytosine. Such modifications can be made independently at one or more positions of the siRNA molecule.

[0150] The siRNA molecule may be modified by substituting ribose with a different sugar moiety, such as a 6-carbon moiety such as glucose. Thus, the siRNA molecules or variants thereof disclosed herein may be modified by substituting different moieties of ribose, such as galactose, mannose, dextrose, glucose, sucrose, or trehalose moieties.

[0151] siRNA can be conjugated to various moieties via terminal or non-terminal nucleotides. Thus, the siRNA molecules or variants thereof disclosed herein can be conjugated to moieties such as N-acetylgalactosamine, N-acetylcysteine, N-acetylaspartic acid, N-acetyltyrosine, or N-acetylprocainamide via any terminal or non-terminal nucleotide.

[0152] Here, the present invention will be further described with respect to the following non-limiting examples.

Example

[0153] Example 1: FGFR3 G380R In silico design of specific siRNAs and primer pairs Mutant FGFR3 G380R SiRNA sequence candidates specific to the mutant FGFR3 mRNA were identified and then analyzed using in silico techniques. The coding DNA sequences used as a basis for analyzing the siRNA sequences are shown in Table 1 below.

[0154]

Table 3

[0155] The first sequence in the table is a modified NM_000142 sequence with a single G1138A mutation inserted. The column titled "Set" indicates to which set the wild-type transcript was classified for homology analysis. The wild-type NM_000142 sequence was placed in a separate "Hum_wtl" set to enable direct comparison with the mutant transcript version. The remaining human NM sequences were grouped into another set, and all mouse NM sequences were grouped as a fourth set.

[0156] Variant FGFR3 G380RStarting from the DNA sequence encoding [[ID=]], various siRNAs were designed to complement the point mutation region in the mRNA of the mutant human FGFR3 gene. All siRNAs contained a single nucleotide substitution involved in the ACH phenotype (i.e., the G1138A mutation in the human FGFR3 gene). To enhance siRNA specificity, the siRNA design strategy optionally included additional nucleotide mismatches compared to the corresponding target sequence of the mutant FGFR3 mRNA (i.e., up to two mismatches compared to the corresponding wild-type mRNA).

[0157] The designed siRNA molecules were then analyzed in silico. The important criteria used for the analysis all included the calculation of the average normalized number of mismatches across all alternative transcripts in a specific set of sequences (see Table 1 and the paragraphs following Table 1) within the core (central) 8 nt of the sequence under standard physiological salt conditions, as well as the calculation of the maximum net free energy difference between the siRNA antisense sequences that bind to all intended target context sequences (usually human genes) compared to the described set of sequences (such as mouse NM). siRNA molecules having the largest difference in ΔG between the Hummut set and the Humwtl set, or having ≧0.5 mismatches between these two sets in the central 8 nt core of the siRNA, were considered to have favorable characteristics. Further criteria used to analyze potential siRNA sequences included the following. ● Oligomer monomer ΔG: The folding free energy calculated for the siRNA that folds itself; ● Target monomer ΔG: The folding free energy calculated for the target context sequence that folds itself; ● Oligomer homodimer ΔG: The binding free energy calculated for the binding of the siRNA to another copy of itself; ● Heterodimer net ΔG: The net binding free energy for the binding of the antisense siRNA to the target context sequence while accounting for competition with other folded structures; ● The number of mismatches between the sense siRNA (excluding TT overhangs) and the human wild-type sequence that best matches without considering bulges and frameshifts; ● The percentage of the full-length siRNA sequence that is either G or C; ● Predicted binding to homologous sequences in human-derived mutant and wild-type genes and wild-type mouse transcripts (preferably having good homology to the mutant but low homology to other sequences).

[0158] Thirty siRNA sequence candidates were identified and are shown in Table 2 below. Mutant FGFR3 G380R Primer pairs specific for the mRNA were also designed (Table 3). These are useful for gene expression analysis (an essential tool for monitoring gene downregulation induced by siRNA treatment) while excluding confounding effects of wild-type FGFR3 expression.

[0159]

Table 4

[0160]

Table 5

[0161] Example 2: FGFR3 WT and FGFR3 G380R - Generation of FGFR3 For in vitro screening, FGFR3 WT and FGFR3 G380R expressing cells were either wild-type (FGFR3 WT ) or the G380R mutant (FGFR3 G380R)Generated via stable transfection of HEK293 cells with GFP-tagged expression vectors carrying any of the FGFR3 gene variants. Briefly, the human CDS of the wild-type FGFR3 gene was cloned into the pcDNA3.1 / CT-GFP fusion expression vector containing a neomycin resistance cassette to generate the expression vector (Figure 1A). Mutant FGFR3 G380R expression vectors were obtained by site-directed mutagenesis of the wild-type FGFR3 CDS. The presence of the target mutations was confirmed by Sanger sequencing (Figure 1B). After generation, the expression vectors were transfected into HEK293 cells using Lipofectamine® 3000 reagent, and the transfected cells were positively selected by applying the antibiotic Geneticin (G-418) for 4 weeks. At the end of the selection process, GFP expression was confirmed at the mRNA and protein levels by real-time RT-PCR (Figure 2A) and fluorescence microscopy (Figure 2B), respectively. The results showed that both HEK-FGFR3 WT and HEK-FGFR3 G380R cells expressed high levels of GFP, further confirming the success of the transfection. Since the expression vectors used generate FGFR3-GFP fusion proteins, GFP expression is directly related to FGFR3 expression and can be used to monitor both gene and protein expression, representing a reliable readout for the screening of FGFR3 G380R specific siRNAs.

[0162] Example 3: FGFR3 WT and FGFR3 G380R Expression In vitro screening of FGFR3 G380R specific siRNA candidates in HEK293 cells expressing FGFR3 Using the transfected HEK cells prepared in Example 2, a preliminary siRNA screening was performed. The screening was performed without affecting the expression of wild-type FGFR3 (FGFR3 WT ), while mutant FGFR3 G380RThe effectiveness of siRNA candidates in downregulating mRNA was taken into consideration. Thirty FGFR3 G380R specific siRNA candidates were selected for a preliminary screening from the first subset of 10 siRNAs (Table 4).

[0163]

Table 6

[0164] Briefly, both HEK-FGFR3 WT and HEK-FGFR3 G380R cells were treated for 48 hours with 100 nM of the selected siRNAs in combination with Dharmafect transfection reagent. Vehicle (Dharmafect)-treated HEK cells were used as a control. At the end of the experiment, RNA was isolated and the effectiveness and specificity of the siRNA candidates were evaluated via RT-PCR analysis of GFP mRNA expression. The results are shown in Figure 3 and Table 5 below. As the results show, FGFR3 G380R -siRNA numbers 6 and 8 (SEQ ID NOs: 3 and 4, respectively) were particularly effective in downregulating mutant FGFR3 G380R mRNA without affecting the expression of the wild-type counterpart (Figure 3B) (-50% and -40%, respectively) (Figure 3A).

[0165]

Table 7

[0166] Example 4: In vitro testing of FGFR3 G380R specific siRNA candidates complexed with nanoparticles containing hydrolytic silicon in FGFR3-expressing HEK293 cells G380R FGFR3 siRNA candidates numbers 6 and 8 (SEQ ID NOs: 3 and 4, respectively) were selected and FGFR3 G380R prepared in Example 2 and FGFR3 G380R and FGFR3WT Further in vitro screening was performed using the expressed HEK293 cells. The siRNA was complexed with silicon-stabilized hybrid lipid nanoparticles (sshLNP (trademark)) (“BioCouriers”) manufactured by SiSaf (Guildford, UK).

[0167] The nanoparticles used were SIS0013 and SIS0012 2LBS (formulated with doped material) and undoped SIS0012. The nanoparticle and siRNA complexes were produced using the protocol described in UK Patent Application No. 2300912.9 and outlined below. Briefly, the nanoparticle composition was as follows. ● SIS0012 (undoped Si) formulation ○ DOTAP: 7.25 mg ○ DOPE: 7.30 mg ○ mPEG 2000 -DSPE: 1.45 mg ○ Si (undoped): 1 mg ○ Glycine: 0.5 mg ○ Trehalose: 1 mg ○ Nuclease-free water: up to 10 mL ● SIS0013 (doped Si) formulation ○ DOTAP: 7.25 mg ○ DOPE: 7.3 mg ○ mPEG 2000 -DSPE: 1.45 mg ○ Boron-doped Si, approximately 5×10 18 boron atoms / cm 3 : 1 mg ○ Glycine: 0.5 mg ○ Trehalose: 1 mg ○ Nuclease-free water: up to 10 mL ● SIS0012 2 LBS (doped Si) formulation ○ DOTAP: 7.75 mg ○ DOPE: 8.25 mg ○ Boron-doped Si, approximately 5×10 18 boron atoms / cm 3 : 1 mg ○ Glycine: 0.5 mg ○ Trehalose: 1 mg ○ Nuclease-free water: up to 10 mL

[0168] Additional details of the components disclosed above for SIS0012, SIS0013, and SIS0012 2LBS are as follows. a) Si (as "SiNPs": porous silicon particles with an average diameter of 30 nm. Doped for SIS0013 and SIS0012 2LBS (5×10 18 boron atoms / cm 3 ). Activated by exposure to methanol and subsequently slowly evaporated to produce an activated SiNP (dry, solid) powder. b) Trehalose ("THR"): as a solid powder. c) Glycine ("GLY": as a solid powder. d) SiNP + GLY + THR solution: As a brownish suspension obtained by sonicating and suspending 50 mg of activated SiNP; 50 mg of THR; and 25 mg of GLY in 50 mL of nuclease-free water for 60 minutes. e) DOTAP-Cl solution: As a solution obtained by mixing 50 mg of DOTAP in 10 mL of methanol and subsequently sonicating at 40 °C for 30 minutes until completely dissolved. f) DOPE solution: As a solution obtained by mixing 50 mg of DOPE in 10 mL of methanol and subsequently sonicating at 40 °C for 30 minutes until completely dissolved. g) mPEG 2000 -DSPE solution: As a solution obtained by mixing 40 mg of mPEG 2000 -DSPE in 8 mL of methanol and subsequently sonicating at 40 °C for 30 minutes until completely dissolved.

[0169] The method for preparing the SIS0012, SIS0012-2LBS, or SIS0013 complex is as follows. Preparation of lipid film a) All lipids (for SIS0012 and SIS0013: DOPE, DOTAP and mPEG2000 - DSPE; for SIS0012 2LBS: DOPE and DOTAP) were mixed in a glass round - bottom flask. b) The solvent was evaporated using a rotary evaporator in a 40 °C water bath.

[0170] Rehydration of the film a) 1 mL of a brownish - colored suspension of SiNP (SIS0013 and SIS0012 2LBS: doped; SIS0012: undoped) + GLY + THR (1 mg / mL SiNP; 0.5 mg / mL GLY; 1 mg / mL THR) was added to the lipid membrane together with 9 mL of nuclease - free water (thus, the total volume of the brownish - colored suspension and nuclease - free water combined is 10 mL). b) The flask was covered with parafilm and then the flask was stirred in a 60 °C water bath for 10 minutes, thus rehydrating the lipid membrane with 10 mL of liquid. c) The resulting suspension was left to stand at room temperature for several hours and then stored at 4 °C.

[0171] Extrusion The suspension obtained in step (c) of "Rehydration of the film" was passed through polycarbonate membrane filters with pore sizes of 0.4 μm and 0.1 μm. The suspension was passed through each pore size 10 times at 60 °C. The resulting products are SIS0012 using undoped SiNP, and SIS0013 or SIS0012 2LBS using doped SiNP.

[0172] Preparation of the siRNA complex An appropriate amount of SIS0012, SIS0012 2LBS, or SIS0013 suspension (having a nominal total lipid concentration of 1.6 mg / mL) was mixed with the required amount of siRNA stock solution (having a concentration of 2 mg / mL), and the final concentration of siRNA was adjusted using nuclease-free water prior to the complex formation incubation step. The samples were mixed thoroughly by gentle pipetting and incubated at room temperature for 60 minutes to complete complex formation. After incubation, the samples were stored at 4 °C before use in subsequent experiments.

[0173] GFP-tagged FGFR3 generated in Example 2 G380R HEK293 cells expressing were seeded at a cell density of 500K, transfected for 24 hours, and evaluated 48 hours later. GFP gene expression was evaluated by real-time PCT, represented by the fold change compared to the vehicle control, and normalized by human GAPDH. SIS0013 and SIS0012 2LBS (formulated using the doped material) both G380R -when complexed with siRNA candidate numbers 6 and 8 (SEQ ID NOs: 3 and 4), significantly decreased GFP expression (Table 6).

[0174]

Table 8

[0175] Example 5: In vivo formation in a chondrodysplasia mouse model For in vivo testing of siRNA, a humanized knock-in (KI) mouse model of achondroplasia (ACH) with a mutant human heterozygous FGFR3 gene encoding the G380R mutation is generated. In this model, FGFR3 G380RUsing the human mutant FGFR3 cDNA (NM_000142.5) encoding the protein, the wild-type allele in the mouse Fgfr3 gene is replaced. This mouse model fully recapitulates human diseases and is the best choice for developing siRNA-based therapeutic approaches (Lee YC, Song IW, Pai YJ et al. (2017), Knock-in (KI) human FGFR3 achondroplasia mutation as a mouse model for human skeletal dysplasia. Sci Rep 7:43220, DOI: 10.1038 / srep43220). To generate the KI mouse model, the targeting vector is designed to replace the mouse Fgfr3 gene with the human FGFR3 coding DNA sequence encoding the G380R mutation using homologous recombination. A schematic diagram of the vector design and subsequent homologous recombination is shown in Figure 4.

[0176] Next, this vector is used to generate mouse embryonic stem cells (ESCs) (strain 129 / Sv, agouti) carrying the human FGFR3 coding DNA sequence encoding the G380R mutation. The obtained ESCs are injected into the blastocysts of C57B1 / 6J female mice. From the chimeras thus obtained, three males with the highest percentage of chimerism (evaluated by coat color) are selected. These are mated with three wild-type females (B6-FGFR3WT / WT). From the F1 generation produced by this mating, approximately six pups per litter with 40 - 50% transmission of the mutation (F1 generation) are obtained. Males with a heterozygous genotype derived from F1 are mated with wild-type females until F10 is reached. In each mating, digital biopsies taken after weaning are used to select the desired genotype by genotyping analysis. siRNA candidates are tested using this in vivo mouse model of ACH, and their effects on the expression of the mutant FGFR3 allele in vivo and their effects on the disease are determined.

[0177] Example 6: Achondroplasia Mouse Model (FGFR3 G380RIn vivo generation and genotyping of KI mice In this model, FGFR3 G380R The wild-type allele of the mouse Fgfr3 gene was replaced using a human mutant FGFR3 cDNA (NM_000142.5) encoding the protein. The mouse model was generated with appropriate modifications based on (Lee YC, Song IW, Pai YJ et al. (2017), Knock-in human FGFR3 achondroplasia mutation as a mouse model for human skeletal dysplasia. Sci Rep 7:43220, DOI: 10.1038 / srep43220).

[0178] The outline of this approach is shown in Example 5. This model fully recapitulates human diseases and is the best choice for developing siRNA-based therapeutic approaches.

[0179] The targeting vector was designed by Biogem in collaboration with the University of L’Aquila (UNIVAQ). Through homologous recombination, the vector was designed to replace the mouse Fgfr3 gene with a human FGFR3-encoding DNA sequence carrying the G380R mutation (Figure 5). Then, the targeting vector was used to transfect mouse embryonic stem cells (ESCs) via electroporation, and two of several hundred (about 300) ESC clones were identified as being useful for generating appropriate chimeras (Table 7). Therefore, these clones were selected, injected into recipient blastocysts, and transplanted into foster mothers.

[0180] Chimeras obtained from the ESC KI experiments were subjected to two different mating strategies to optimize the success rate in obtaining the desired animal model. ● Strategy 1: Mate the wild-type (WT) animals and then the chimeras with deletor FlpE animals (to remove the neomycin cassette). ● Strategy 2: Mate deletion body FlpE animals with chimeras. All mice produced from these mating strategies were subjected to tail biopsies, and the relevant samples were genotyped to select heterozygous (HT) mice for generating stable ACH colonies.

[0181] Screening of ACH primers against ESC clone-derived genomic DNA and genotyping of mice derived from mating of chimeras with WT animals and then with FlpE (Strategy 1)

[0182]

Table 9

[0183] ES cell clones were digested and genomic DNA was extracted. All extracted DNA samples were resuspended in TE buffer with an initial volume of 20 μL and analyzed by Nanodrop to evaluate the concentration and purity of genomic DNA. One DNA sample derived from the 1B3 ES cell clone and one sample derived from the 22 / S9 (WT) ES cell clone were selected and normalized (for all samples, to obtain a DNA concentration of 100 ng / μL for use in the PCR system) for PCR analysis. The selected DNA samples were analyzed using 10 different reaction mixes each containing a specific primer pair for testing (Table 8). The results are shown in Figure 6. The actual sequences of all primers tested for identifying heterozygous animals in the genotyping experiment are shown in Table 12 at the end of this example.

[0184]

Table 10

[0185] Table 9 shows samples obtained from the offspring of the mating between chimeras and WT animals. Analysis of the tail biopsy samples listed in Table 9 using primer mix 10 (in Table 8) revealed animals with the neomycin cassette (NEO+HT, i.e., FGFR3 0380RIt was possible to distinguish animals with mutations) from animals with neomycin negativity (NEO-WT, i.e., without the desired mutation) (Figure 7). A total of 24 neomycin-positive animals and 33 neomycin-negative animals were identified. Neomycin-positive animals were selected for further mating with FlpE mice and subsequent generation of stable ACH colonies. The primer sequences in Primer Mix 10 (Table 8) were as follows. Forward NEO ACH: CCTGCAGCCTGTTGACAATT [SEQ ID NO: 69] Reverse NEO ACH: CATCAGAGCAGCCGATTGTC [SEQ ID NO: 70]

[0186]

Table 11

[0187] Genotyping of mice derived from chimeras directly mated with FlpE animals (Strategy 2) In addition, biopsy samples were analyzed for pups generated in a second mating strategy in which chimeras were directly mated with FlpE mice (listed in Table 10). Analysis Using Primer Mix 10, some of the tail biopsy samples listed in Table 10 were able to distinguish animals carrying FlpE (FLP-e+, i.e., potential HTs carrying the FGFR3 G380R mutation) from FlpE-negative animals (FLP-e-, i.e., without the desired mutation) (Figure 8). A total of 9 FlpE-positive animals and 24 FlpE-negative animals were identified.

[0188]

Table 12

[0189] To further identify the Flp-e mice, additional PCR tests were performed based on the following primers listed in Table 11. The DNA samples derived from the biopsies of the selected mice used for the analysis were Sample 16 (FLP-e+ female Agouti) and Sample 22 (FLP-e+ male Black). The results are shown in Figure 9. Primer Mix 4 in Table 11 was selected for use in further analysis. The primer sequences of Primer Mix 4 in Table 11 were as follows. Reverse ACH Geno 0: GCTTGGTCTGTGGGACTGTT [SEQ ID NO: 60] Forward ACH MUT Geno 2: ACGACTCCGTGTTTGCCCAC [SEQ ID NO: 66]

[0190]

Table 13

[0191]

Table 14

[0192] For the purpose of identifying HT animals without the neomycin cassette, two additional samples were tested (Sample 4: NEO+ female agouti; Sample 3: NEO- female agouti). These results compared with Samples 16 and 22 are shown in Figure 10. As can be seen from the presence of the higher molecular weight bands observed in Samples 16 and 22, both Samples 16 and 22 contained the G380R mutation, while Samples 3 and 4 did not. Additional samples (47, 50, 55, 56, 89, 93, 95, and Samples 3 and 22 as comparison samples) were also tested using Primer Mix 4, and the results are shown in Figure 11. Samples 47, 50, 93, and 95 contained the G380R mutation. Then, all the G380R positive samples analyzed (16, 22, 47, 50, 93, and 95) were tested for the presence of the neomycin cassette using Samples 4 (NEO+) and Sample 3 (NEO-) as reference samples, and were found to be neomycin negative (Figure 12).

[0193] Additional testing of samples obtained from the second FlpE mating strategy identifies HT neomycin-free individuals that are also positive for ACH pathology. Animals from this second pool are incorporated into the current ACH colonies initially derived from the first mating strategy.

[0194] Example 7: Short-term screening of in vivo siRNA formulations and evaluation of in vivo distribution in the femoral growth plate and visceral organs Briefly, the in vivo distribution study is performed using Cy5-tagged siRNA identified by in vitro screening described herein, in combination with lipid particles containing hydrolyzable silicon to form complexes as described elsewhere herein. Five-day-old or 3-month-old C57BL / 6 male wild-type mice (6 mice / group) are injected via the intraperitoneal (i.p.) route with the selected siRNA / SiS complex. The control group is given an empty SiS-biocourier. Mice are sacrificed at 0 min, 30 min, 1 h, 6 h, 24 h, and 48 h post-injection, and their organs are harvested to evaluate the distribution of the complex by analyzing Cy5 fluorescence in the different organs. Organ extracts are analyzed by fluorometry and organ frozen sections are analyzed by confocal microscopy. The siRNA molecules are also directly detected by stem-loop RT-PCR.

[0195] Pharmacokinetic studies are performed using 3-month-old C57BL / 6 male wild-type mice (6 mice / group) with implanted catheters, and a single injection of the fluorescent siRNA / lipid / Si complex is administered as described in the in vivo distribution study above. Blood is collected through the jugular cannula of the live mice at selected blood sampling time points according to a moderate elimination scheme (predicted t less than about 600 min 1 / 2 ). Sampling is performed at t = 0, 15 min, 30 min, 1 h, 2 h, 6 h, 24 h, and 48 h post-injection. Fluorescence levels in serum are evaluated using fluorescence quantification, and direct siRNA detection in serum is performed using stem-loop RT-PCR.

[0196] For toxicity investigation, both the maximum tolerance (single dose, escalating) and dose range finding tests (single dose, repeated) are conducted. These tests use 3-month-old C57BL / 6 male wild-type mice (6 mice / group) treated with either the siRNA / lipid / Si complex as described in the in vivo distribution test (experiment) above or 0.9% w / v NaCl solution (control). Blood collection is performed via a jugular vein cannula. The evaluations performed are as follows. ● Daily clinical observations; ● Measurement of body weight (per change in dose level); ● Food consumption analysis (per change in dose level); ● Clinical pathology at sacrifice by hematology, blood chemistry, and inflammatory cytokine ELISA assays; ● Postmortem evaluation: organ weights and gross features; ● Postmortem evaluation: tissue preservation and target organ histopathology (liver, heart, lung, spleen, kidney, bone, muscle, and brain).

[0197] The present invention has been described and illustrated in connection with specific embodiments, but it will be understood by those skilled in the art that the present invention is useful in many different variations that are not specifically illustrated herein.

[0198] In the above description, if an integral invention or element having known, obvious, or foreseeable equivalents is described, such equivalents are incorporated herein as if individually expressly stated. The true scope of the present invention should be construed to include any such equivalents, and the claims should be referred to to determine this true scope. It will also be understood by the reader that the entirety or features of the present invention described as preferred, advantageous, convenient, etc. are optional and do not limit the scope of the independent claims. Furthermore, it should be understood that such optional integers or features may be possible advantages in some embodiments of the present invention, while being undesirable and thus absent in other embodiments.

Claims

1. An siRNA molecule comprising at least 17 consecutive nucleotides selected from the sequence GCAGGCCAUCCUCAGCUCXMGGGGUGGGGCUUCCUUCCUGU (Sequence ID 1), X Ｍ The sequence of nucleotides selected from nucleotides A and C, and selected from SEQ ID NO: 1, is X, which is found at position 19 of SEQ ID NO:

1. Ｍ An siRNA molecule that must contain a nucleotide, or a variant of the siRNA molecule having at least one and no more than six nucleotide substitutions with respect to SEQ ID NO: 1, wherein the position of the variant siRNA molecule corresponding to position 19 of SEQ ID NO: 1 is X Ｍ A variant in which the nucleotides are not substituted and are therefore selected from nucleotides A and C, and the siRNA molecule is not a 19-nucleotide siRNA having the sequence GAAGGCCAUCCUCAAGCUACA.

2. GCUACAGGGUGGGCAAUCUU (Sequence Number 4) and GCUAUAGGGGUGCU A siRNA molecule according to claim 1, selected from the group consisting of UCUU (Sequence ID 3).

3. The siRNA molecule or variant thereof according to claim 1, wherein the siRNA molecule or variant thereof comprises at least 18 or at least 19 consecutive nucleotides selected from the sequence of Sequence ID No.

1.

4. The siRNA molecule or its mutant has a maximum length of 30 or less nucleotides, preferably 25 or less nucleotides. For example, the length of the siRNA molecule or its variant is 17 to 25 nucleotides, preferably 19 to 23 nucleotides. For example, the length of the siRNA molecule or its variant is 20 to 23 nucleotides. The siRNA molecule or a variant thereof according to claim 1.

5. The siRNA molecule or variant thereof according to claim 1, which is at least partially double-stranded, preferably fully double-stranded, for example, along the length of a sequence complementary to the target mRNA.

6. The siRNA molecule or variant thereof according to claim 5, further comprising single-stranded overhangs at one or both of its 3' ends, preferably having sequence UU.

7. X Ｍ The siRNA molecule or a variant thereof according to claim 1, wherein is nucleotide A.

8. The siRNA molecule or variant thereof according to claim 7, wherein the length of the siRNA molecule or variant thereof is at least 19 nucleotides, and the nucleotide A of the siRNA molecule or variant thereof corresponding to position 19 of SEQ ID NO: 1 can be found at any position of the siRNA molecule or variant thereof.

9. The siRNA molecule or its variant has a length of 19 nucleotides, and the nucleotide A of the siRNA molecule or its variant corresponding to position 19 of SEQ ID NO: 1 can be found at position 1, 6, 9, 15, or 19 of the siRNA molecule or its variant. For example, the A in the siRNA molecule or its variant corresponding to position 19 of SEQ ID NO: 1 may be found at position 1, position 6, or position 9 of the siRNA molecule or its variant. The siRNA molecule or a variant thereof according to claim 8.

10. Consensus array X １ X ２ UAX ３ X Ｍ GGGUGGX ４ CX ５ comprising a sequence selected from the group of sequences defined by UCUU (SEQ ID NO: 2), X Ｍ is selected from the group consisting of A and C, X １ , X2, X3, X ４ , and X ５ each independently selected from the group consisting of A, G, C, and U, the siRNA molecule or variant thereof according to claim 1.

11. An siRNA molecule according to claim 10, selected from the group consisting of GCUAUAGGGUGGGCUUCUU (Sequence ID 3) and GCUACAGGGGUGGGCAUCUU (Sequence ID 4).

12. Consensus Array X Ｍ X １ X ２ GUGGGCUUCX ３ UX ４ Includes a sequence selected from the group of sequences defined by CUGU (sequence number 5), X Ｍ X is selected from the group consisting of A and C. １ , X2, X ３ , and X ４ The siRNA molecule or a variant thereof according to claim 1, wherein each of these is independently selected from the group consisting of A, G, C, and U.

13. The siRNA molecule according to claim 12, selected from the group consisting of AAGGUGGGGCUUCUUCCUGU (SEQ ID NO: 6) and AGGGUGGGGCUUCUUCUGUGU (SEQ ID NO: 7).

14. Consensus Array X １ CAGCUAX ２ X Ｍ X ３ GGX ４ X ５ Includes a sequence selected from the group of sequences defined by GGCUU (sequence number 8), X Ｍ X is selected from the group consisting of A and C. １ , X2, X ３ , X ４ , and X ５ The siRNA molecule or a variant thereof according to claim 1, wherein each of these is independently selected from the group consisting of A, G, C, and U.

15. The siRNA molecule according to claim 14, selected from the group consisting of UCAGCUACAGGGUCGGCUU (SEQ ID NO: 9) and UCAGCUACAGGGAGGGCUU (SEQ ID NO: 10).

16. Consensus Array X １ CAUCCUCAGCX ２ X ３ X ４ XMX ５ GX ６ Includes an array selected from the group of arrays defined by U (sequence number 11), X Ｍ X is selected from the group consisting of A and C. １ , X2, X ３ , X ４ , X ５ , and X ６ The siRNA molecule or a variant thereof according to claim 1, wherein each of these is independently selected from the group consisting of A, G, C, and U.

17. The siRNA molecule according to claim 16, having the sequence GCAUCCUCACAGCUAUAGGGGU (Sequence ID 12).

18. Consensus Array GX １ AGGX ２ AUCCUCX ３ GX ４ UAX ５ X Ｍ Includes an array selected from the group of arrays defined by (Sequence ID 13), X Ｍ X is selected from the group consisting of A and C. １ , X2, X ３ , X ４ , and X ５ The siRNA molecule or a variant thereof according to claim 1, wherein each of these is independently selected from the group consisting of A, G, C, and U.

19. The siRNA molecule according to claim 1, comprising a sequence selected from the group consisting of the following. Table 1

20. Array GX １ AGX ２ X ３ AUCCX ４ CX ５ X ６ X ７Ｕ X ８ X ９ X Ｍ X １０ X １１ X １２ X １３ X １４ GX １５ CX １６ UCX １７ UX １８ An siRNA molecule comprising at least 17 consecutive nucleotides selected from CUGU (SEQ ID NO: 14), wherein X Ｍ The sequence of nucleotides selected from nucleotides A and C, and selected from SEQ ID NO: 14, is X, which is found at position 19 of SEQ ID NO:

14. Ｍ It must contain nucleotides, X １ X is selected from C and U, X2 is selected from G and U, X3 is selected from C and U, X4 is selected from A and U, X5 is selected from A and U, X6 is selected from G and U, X7 is selected from C, G and U, X ８ X is selected from A and U, X9 is selected from C and U, X １０ is selected from G, A, and U, X １１ is selected from G and U, X １２ The is selected from G and A, X １３ A and U are selected, X １４ is selected from G and C, X １５ is selected from G and C, X １６ A and U are selected, X １７ A and U are selected, X １８ A siRNA molecule in which C and U are selected.

21. The siRNA molecule according to claim 20, wherein the siRNA molecule comprises at least 18 or at least 19 consecutive nucleotides selected from the sequence of SEQ ID NO:

14.

22. The maximum length of the siRNA molecule is 30 nucleotides or less, preferably 25 nucleotides or less. For example, the length of the siRNA molecule is 17 to 25 nucleotides, preferably 19 to 23 nucleotides. The siRNA molecule according to claim 20.

23. X Ｍ The siRNA molecule according to claim 20, wherein X is A.

24. The siRNA molecule according to claim 20, comprising a sequence selected from the group consisting of the following. Table 2

25. A pharmaceutical composition comprising an siRNA molecule or a variant thereof according to any one of claims 1 to 24 and a pharmaceutically acceptable carrier.

26. The pharmaceutical composition according to claim 25, wherein the pharmaceutical composition comprises a polymer selected from the group consisting of hydroxypropyl methylcellulose (HPMC), hydroxypropyl cellulose, methylcellulose, carbomer, hyaluronan, chitosan, N-trimethylchitosan, N-carboxymethylchitosan, sodium carboxymethylcellulose, polygalacturonic acid, sodium alginate, xanthan gum, xyloglucan gum, scleroglucan, polyvinyl alcohol, and polyvinylpyrrolidine.

27. ​​(i) Lipid particles containing hydrolyzable silicon, and (ii) A complex comprising the siRNA or a variant thereof according to claim 1, which is associated with the lipid particles. or (i) Particles containing hydrolyzable silicon, (ii) Selectively one or more lipids, and (iii) A complex comprising the siRNA or a variant thereof according to claim 1, which is associated with the particle. Or, (i) Particles containing hydrolyzable silicon, (ii) Selectively one or more lipids, and (iii) A complex comprising a siRNA that targets mRNA encoding a mutant FGFR3 protein, wherein the siRNA targets a portion of an mRNA sequence containing a nucleotide encoding a mutation from Gly to Arg at position 380 of the mutant FGFR3 protein, and the siRNA is associated with the particle.

28. A pharmaceutical composition according to claim 25 for use as a pharmaceutical.

29. The pharmaceutical composition according to claim 25 for use in the treatment of achondroplasia.

30. The pharmaceutical composition according to claim 25, for use in downregulating the expression of FGFR3 protein having a mutation from Gly to Arg (G380R) at position 380.

Images