Peptide-modified AAV capsids having enhanced muscle tropism

Abstract

The present invention relates to a peptide-modified AAV capsid having increased muscle transduction efficiency. The present invention also relates to an induced recombinant AAV vector particle packaging a gene of interest, and its use in gene therapy, particularly in gene therapy for treating muscle diseases.

Description

Technical Field

[0001] The present invention relates to a peptide-modified AAV capsid having improved muscle transduction efficiency. The present invention also relates to an induced recombinant AAV vector particle packaging a gene of interest, and its use in gene therapy, particularly in gene therapy for treating muscle diseases.

Background Art

[0002] Recombinant adeno-associated virus (rAAV) vectors are widely used for gene transfer in vivo, and currently, clinical trials using AAV vectors are being conducted for the treatment of several diseases.

[0003] AAV is a non-pathogenic virus belonging to the genus Dependoparvovirus within the family Parvoviridae. AAV is a non-enveloped virus composed of a capsid with a diameter of approximately 26 nm and a single-stranded DNA genome of 4.7 kb. The genome has two genes, rep and cap, which are flanked by two palindromic regions named inverted terminal repeats (ITRs) that serve as the viral origin of replication and packaging signal. The cap gene encodes three structural proteins, VP1, VP2, and VP3, which constitute the icosahedral AAV capsid through alternative splicing and translation from different start codons. VP1, VP2, and VP3 share the same C-terminus, which is all of VP3. Using AAV2 as a reference, VP1 has a sequence of 735 amino acids (GenBank accession number YP_680426.1; access date August 13, 2018); VP2 (598 amino acids) starts at threonine 138 (T138), and VP3 (533 amino acids) starts at methionine 203 (M203). The three different VPs contribute to the AAV2 capsid in a ratio of 1 VP1:1 VP2:10 VP3. The capsids of all AAV serotypes are assembled from 60 VP monomers containing approximately 50 copies of VP3, 5 copies of VP2, and 5 copies of VP1. The rep gene encodes four proteins, Rep78, Rep68, Rep52, and Rep40, which are required for viral replication. Recombinant AAV vectors encapsidate an ITR-flanked rAAV genome in which a therapeutic gene expression cassette replaces the AAV protein-coding sequences in the genome.

[0004] Tissue tropism is determined by the capsid serotype, and commonly used AAV serotypes isolated from humans and non-human primates can transduce specific organs more efficiently than others. For example, there are AAV6, AAV8, AAV9, and AAV-rh74 in muscle tissue.

[0005] A library of AAV capsid variants displaying short random peptides on the surface of various AAV serotypes has been generated to screen for gene therapy vectors with altered cell specificity and / or transduction efficiency (outlined in Buning et al., Molecular Therapy: Methods & Clinical Development, 2019, 12, 248). AAV capsids containing the insertion of peptides containing the RGD motif, which is known to bind to several different cell surface integrins, have been reported to improve gene delivery in muscle after systemic administration. The AAV capsids most efficient for muscle transduction in mouse, non-human primate and / or human primary myotubes display the peptides RGDLGLS or P1 (AAVMYO or AAV9P1), RGDLTTP (MyoAAV 1A), GPGRGDQTTL (MyoAAV 2A), SNSRGDYNSL (MyoAAV 4A), ENRRGDFNNT (MyoAAV 4E), SAQRGDYVGL (MyoAAV 3A), QERRGDYTSM (MyoAAV 4C) inserted into variable region VIII (WO2019 / 207132; Weinmann et al., Nature communications, 2020, 11, 5432; Tabebordbar et al., Cell, 2021, 184, 4919 - 4938).

[0006] The ability to efficiently, selectively and safely transduce muscle with systemically delivered AAV vectors can be beneficial for gene therapy of many human diseases.

Prior Art Documents

Patent Documents

[0007]

Patent Document 1

Patent Document 2

Patent Document 3

Non-Patent Documents

[0008] [Non-Patent Document 1] Buning et al., Molecular Therapy: Methods & Clinical Development, 2019, 12, 248 [Non-Patent Document 2] Weinmann et al., Nature communications, 2020, 11, 5432 [Non-Patent Document 3] Tabebordbar et al., Cell, 2021, 184, 4919 - 4938 [Non-Patent Document 4] Hynes, Cell, 2002, 110, 673 - 687 [Non-Patent Document 5] Dong et al., Nature Struct. Mol. Biol., 2014, 21, 1091 - 1096 [Non-Patent Document 6] Dong et al., Nature, 2017, 542, 55 - 59 [Non-Patent Document 7] Kotecha et al., Nature communications, 2017, 8, 15408 [Non-Patent Document 8] Alford et al., J. Chem. Theory Comput, 2017, 13, 6, 3031 - 3048 [Non-Patent Document 9] Aponte-Ubillus et al., Applied Microbiology and Biotechnology, 2018, 102: 1045 - 1054 pages [Non-Patent Document 10] McCarty et al., Gene Therapy, 2003, Dec., 10(26), 2112 - 2118 pages [Non-Patent Document 11] Babi Ramesh Reddy Nallamilli et al., Annals of Clinical and Translational Neurology, 2018, 5, 1574 - 1587 pages [Non-Patent Document 12] Ayuso E. et al. (Hum. Gene Ther. 2014, 25, 977-987)

Non-Patent Document 13

Summary of the Invention

Means for Solving the Problems

[0009] The present inventors have shown that a recombinant adeno-associated virus (AAV) capsid containing the insertion of a peptide RGDLXXL / I (where XX is different from GS and ST) (SEQ ID NO: 1) that binds to integrin heterodimer alpha-αVβ6 (ITGAV-B6) has an increased transduction efficiency in muscle, particularly after systemic delivery of the recombinant AAV vector.

[0010] Therefore, the present invention relates to a recombinant adeno-associated virus (AAV) capsid protein comprising the insertion of at least one copy of a peptide comprising the motif RGDLXXL / I (where XX is different from GS and ST) (SEQ ID NO: 1), wherein the recombinant AAV capsid protein modified by the peptide has an increased transduction efficiency in muscle compared to a recombinant AAV capsid protein not modified by the peptide.

[0011] In some embodiments, the insertion is an insertion into variable region IV.

[0012] In some embodiments, the recombinant AAV capsid protein is a hybrid of an AAV serotype 9 capsid protein and an AAV serotype 74 capsid protein.

[0013] In some preferred embodiments, the insertion is an insertion at position 452; preferably, the peptide insertion replaces the residues at positions 453-459, and the positions shown are determined by alignment with SEQ ID NO: 20.

[0014] In some embodiments, the motif is RGDLX1X2L / I, where X1 is G, A, L, K, or Q, and X2 is R, K, E, D, A, L, T, I, or V. In some specific embodiments, the motif is a sequence selected from the group consisting of RGDLGRL (SEQ ID NO: 2), RGDLGEL (SEQ ID NO: 3), RGDLATI (SEQ ID NO: 4), RGDLAEL (SEQ ID NO: 5), RGDLQVL (SEQ ID NO: 6), and RGDLAEI (SEQ ID NO: 7); preferably SEQ ID NO: 2 or SEQ ID NO: 4; more preferably having SEQ ID NO: 2. In some specific embodiments, the peptide is a sequence selected from the group consisting of TDGRGDLGRLGP (SEQ ID NO: 14), SEPRGDLGELNA (SEQ ID NO: 15), EPRRGDLATIGS (SEQ ID NO: 16), TDQRGDLAELHG (SEQ ID NO: 17), APVRGDLQVLAP (SEQ ID NO: 18), and APVRGDLAEINP (SEQ ID NO: 19); preferably SEQ ID NO: 14 or SEQ ID NO: 16; more preferably including SEQ ID NO: 14. In some more preferred embodiments, the recombinant AAV capsid protein is any one of SEQ ID NOs: 21 - 26; preferably SEQ ID NO: 21 or SEQ ID NO: 23; more preferably a sequence having at least 85% identity with SEQ ID NO: 21.

[0015] The present invention also relates to a polynucleotide encoding a recombinant AAV capsid protein according to the present disclosure.

[0016] The present invention further relates to a recombinant plasmid containing the polynucleotide according to the present disclosure.

[0017] Another aspect of the present invention relates to an AAV vector particle packaging a gene of interest and containing a recombinant AAV capsid protein according to the present disclosure. In some embodiments, the gene of interest is selected from the group consisting of a therapeutic gene; a gene encoding a therapeutic protein or peptide, such as a therapeutic antibody or antibody fragment and a genome editing enzyme; and a therapeutic RNA, such as an interfering RNA, a guide RNA for genome editing, and a gene encoding an antisense RNA having the ability to skip exons.

[0018] Another aspect of the invention relates to a pharmaceutical composition comprising a therapeutically effective amount of AAV vector particles according to the present disclosure, or cells stably transduced by said AAV vector particles according to the present disclosure.

[0019] Another aspect of the invention relates to a pharmaceutical composition according to the present disclosure for use as a medicament in gene therapy, preferably for the treatment of muscle diseases. In some preferred embodiments, the pharmaceutical composition targets a gene that is the cause of a muscle disease selected from dystrophinopathy and limb-girdle muscular dystrophy; preferably a gene selected from the group comprising DMD, CAPN3, DYSF, FKRP, DNAJB6, ANO5, SGCA, SGCB and SGCG.

Mode for Carrying Out the Invention

[0020] Modified AAV capsid protein The present invention relates to a recombinant adeno-associated virus (AAV) capsid protein comprising the insertion of at least one copy of a peptide comprising the motif RGDLXXL / I (where XX is different from GS and ST) (SEQ ID NO: 1), wherein the recombinant AAV capsid protein modified by the peptide has an increased transduction efficiency in muscle compared to a recombinant AAV capsid protein not modified by the peptide.

[0021] Integrins are a class of adhesion receptors that contain 18 alpha subunits and 8 beta subunits, which form 24 different integrin heterodimers (Hynes, Cell, 2002, 110, 673 - 687). The motif RGDLXXL / I (where XX can be any pair of amino acids except GS and ST) (SEQ ID NO: 1) is highly enriched in skeletal muscle tissue and binds with high affinity to the integrin heterodimer αVβ6 (ITGAV - B6), which is upregulated in dystrophic muscle as shown in the examples of this application. In this motif, LxxL / I forms an amphipathic α - helix that binds within the hydrophobic pocket of the B6 subunit. The motif can be found in the prodomains of TGF - β1, TGF - β3, and the FMDV virus capsid, all of which specifically bind to ITGAV - B6 (Dong et al., Nature Struct. Mol. Biol., 2014, 21, 1091 - 1096; Dong et al., Nature, 2017, 542, 55 - 59; Kotecha et al., Nature communications, 2017, 8, 15408; Protein Data Bank accession numbers 5FFO, 4UM9 and 5NEM). Therefore, the peptide containing the motif RGDLXXL / I of SEQ ID NO: 1 according to the present invention binds to muscle cells in vivo, particularly in subjects suffering from muscle diseases, and directs or targets the capsid - modified rAAV vector having the peptide to muscle cells and tissues.

[0022] The modified AAV capsid protein according to the present invention is a functional AAV capsid that can form recombinant AAV vector particles for transducing muscle cells, tissues or organs in vitro or in vivo. Further, the modified AAV capsid protein according to the present invention has an increased transduction efficiency in muscle compared to the corresponding unmodified AAV capsid protein from which it is derived.

[0023] The excellent transduction efficiency of muscle by the modified AAV capsid protein according to the present invention can be determined by measuring the ability of AAV vector particles containing the modified AAV capsid protein to transduce muscle cells, tissues or organs in vitro or in vivo using standard assays well known in the art, such as those disclosed in the examples of the present application. AAV vector transduction can be determined in vitro or in vivo by measuring vector genome copy number or transgene expression. The vector genome copy number per diploid genome can be measured by standard assays well known in the art, such as real-time PCR assays. Transgene expression is preferably measured by standard assays well known in the art using a reporter gene, such as luciferase or a fluorescent protein (GFP or others), such as in vivo or in vitro quantitative bioluminescence or fluorescence assays in vivo or in vitro. For example, the muscle transduction level can be determined by local or systemic administration of AAV vector particles having a modified AAV capsid protein in an animal model, such as the mouse model well known in the art and disclosed in the examples of the present application. An AAV vector containing the corresponding unmodified AAV capsid protein is used for comparison.

[0024] Increased transduction efficiency at the muscle level refers to an increased level of transduction in muscle (a higher or elevated level), particularly a transgene expression level that is at least 1.5-fold, preferably 3, 5, 10, 50, 100-fold or more increased compared to an unmodified AAV capsid protein in at least one muscle cell, tissue or organ, or a vector copy number that is at least 1.1-fold, preferably 1.5, 2, 2.5, 3, 3.5-fold or more increased compared to an unmodified AAV capsid protein in at least one muscle cell, tissue or organ. As a result of the higher level of transduction in muscle, the modified AAV capsid proteins according to the invention have an improved in vivo distribution. This means that it significantly better targets muscle tissue or organ (i.e., improved specificity) without increasing the targeting of other (non-target) tissues, particularly the liver.

[0025] As used herein, the term "muscle" refers to cardiac muscle (i.e., the heart) and skeletal muscle. The term "muscle cell" refers to myocytes, myotube cells, myoblasts, and / or satellite cells. Skeletal muscles are classified into different groups based on their anatomical location in the body. The transduction efficiency or affinity of the modified AAV capsids according to the invention in different skeletal muscle groups may be measured in mouse tibialis anterior (TA), extensor digitorum longus (EDL), quadriceps (Qua), gastrocnemius (Ga), soleus (Sol), triceps, biceps and / or diaphragm; particularly in mouse tibialis anterior (TA), diaphragm and / or quadriceps (Qua) muscles. The expression "muscle transduction" refers to the affinity for the heart and various skeletal muscles present in the body.

[0026] In the following description, amino acid residues are designated by the standard one-letter amino acid code.

[0027] "A", "an", and "the" include plural referents unless the context clearly indicates otherwise. Thus, the terms "a" (or "an"), "one or more", or "at least one" are used interchangeably herein; unless otherwise specified, "or" means "and / or".

[0028] The modified AAV capsid protein according to the present invention is a recombinant protein.

[0029] As used herein, "sequence" refers to one amino acid or at least two contiguous amino acids.

[0030] In this description, an insertion at or into a given position of an AAV capsid protein sequence refers to an insertion after the amino acid residue at that position.

[0031] The term "identity" refers to sequence similarity between two polypeptide molecules or between two nucleic acid molecules. When the positions in both of the compared sequences are occupied by the same base or the same amino acid residue, the respective molecules are identical at that position. The percentage of identity between two sequences corresponds to the number of matching positions shared by the two sequences divided by the number of positions being compared, multiplied by 100. Generally, the comparison is made when the two sequences are aligned to give maximum identity. Identity may be calculated by alignment using, for example, the GCG (Genetics Computer Group, Program Manual for the GCG Package, Version 7, Madison, Wisconsin) pileup program, or any of a sequence comparison algorithm, such as BLAST, FASTA or CLUSTALW.

[0032] In some embodiments, the modified AAV capsid according to the present invention increases the transduction level in muscle after systemic delivery of the AAV vector.

[0033] In some embodiments, the RGDLXXL / I motif according to the present invention consists of RGDLX1X2L / I, where X1 is G, A, L, K or Q, and X2 is R, K, E, D, A, L, T, I or V. This motif was identified by modeling sequences that can improve the binding of the RGDLXXL / I motif to ITGAV-B6 or maintain the stability of the capsid protein. In some specific embodiments, the RGDLXXL / I motif according to the present invention is a sequence selected from the group consisting of RGDLGRL (SEQ ID NO: 2), RGDLGEL (SEQ ID NO: 3), RGDLATI (SEQ ID NO: 4), RGDLAEL (SEQ ID NO: 5), RGDLQVL (SEQ ID NO: 6) and RGDLAEI (SEQ ID NO: 7); preferably SEQ ID NO: 2 or SEQ ID NO: 4; more preferably consisting of SEQ ID NO: 2. In some specific embodiments, the peptide comprises the Z-RGDLXXL / I motif according to the present invention, where Z is G, P, Q, V or R; preferably G or R. In a specific embodiment, the peptide comprises a sequence selected from the group consisting of GRGDLGRL (SEQ ID NO: 8), PRGDLGEL (SEQ ID NO: 9), RRGDLATI (SEQ ID NO: 10), QRGDLAEL (SEQ ID NO: 11), VRGDLQVL (SEQ ID NO: 12) and VRGDLAEI (SEQ ID NO: 13); preferably SEQ ID NO: 8 or 10; more preferably comprising SEQ ID NO: 8.

[0034] In some embodiments, the RGDLXXL / I or Z-RGDLXXL / I motif according to the present invention is flanked at the N-terminus and / or C-terminus by a sequence of up to 5 (1, 2, 3, 4 or 5) amino acids, which may be the same or different; preferably by a sequence of 2 amino acids, which may be the same or different. According to the present invention, the sequences at the N-terminus and C-terminus of the motif are the adjacent sequences directly adjacent to the N-terminus and C-terminus of the motif. The N-terminus and C-terminus adjacent sequences are advantageously selected from the group consisting of TD, GP, EP and GS; preferably TD or EP at the N-terminus, and GP or GS at the C-terminus. In some specific embodiments, the peptide is a sequence selected from the group consisting of TDGRGDLGRLGP (SEQ ID NO: 14), SEPRGDLGELNA (SEQ ID NO: 15), EPRRGDLATIGS (SEQ ID NO: 16), TDQRGDLAELHG (SEQ ID NO: 17), APVRGDLQVLAP (SEQ ID NO: 18) and APVRGDLAEINP (SEQ ID NO: 19); preferably SEQ ID NO: 14 or 16; more preferably comprising or consisting of SEQ ID NO: 14. Peptides comprising the RGDLXXL / I motif according to the present invention generally consist of a sequence of up to 30 amino acids. The peptide may consist of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 amino acids. In some embodiments, the peptide consists of a sequence of up to 25, 20 or 15 amino acids. Preferably, the targeting peptide consists of 12, 13, 14 or 15 amino acids, more preferably 12 amino acids.

[0035] In some embodiments, the modified AAV capsid protein according to the present invention comprises up to 5 (1, 2, 3, 4 or 5) copies of a peptide comprising the RGDLXXL / I motif according to the present invention.

[0036] One or more peptides comprising the RGDLXXL / I motif according to the present invention are inserted into sites that are exposed on the surface of the AAV capsid. Sites on the AAV capsid surface that are exposed and permit peptide insertion, i.e., that do not affect virus capsid assembly and packaging, are well known in the art and include variable regions (VRs) that form loops, particularly at the apex of the protrusions, such as VR-IV, -V, and -VIII (outlined in Buning et al., Molecular Therapy: Methods & Clinical Development, 2019, 12, 248-). By numbering in the AAV8 capsid protein sequence, VR-IV corresponds to Y445 - A476 (broad definition) or Q451 - L462 (narrow definition); VR-V corresponds to C485 - G515 (broad definition) or R490 - T509 (narrow definition); VR-VIII corresponds to I581 - L604 (broad definition) or L586 - I595 (narrow definition). Peptide insertion sites are advantageously located at sites in the general VP3 region for exposure on the AAV capsid surface, such as positions 587, 588, 589, 453, 520 (in combination with position 584), 584, and 585 according to the numbering in the AAV2 capsid protein sequence. Peptide insertion sites are indicated by reference to the AAV2 or AAV8 capsid amino acid sequence. The AAV2 capsid (VP1) protein sequence corresponds to GenBank accession number YP_680426.1 as of August 13, 2018. The AAV8 capsid (VP1) protein sequence corresponds to GenBank accession number YP_077180.1 as of August 13, 2018. After sequence alignment of any other AAV capsid sequence with the AAV2 or AAV8 capsid sequence using standard protein sequence alignment programs well known in the art, such as BLAST, FASTA, CLUSTALW, etc., one of ordinary skill in the art can readily obtain the corresponding positions of peptide insertion sites in other AAV capsid sequences.The insertion sites of VR-VIII are positions 590 of AAV1; positions 587 or 588 of AAV2; position 586 of AAV3 or AAV4; position 575 of AAV5; position 585 of AAV6; positions 585 or 590 of AAV8; positions 588 or 589 of AAV9; position 589 of AAV9.rh74.

[0037] In some preferred embodiments, the modified AAV capsid according to the present invention comprises at least an RGDLXXL / I peptide insertion into variable region IV (VR-IV) or variable region VIII (VR-VIII), preferably into VR-IV. Preferably, the insertion in VR-IV is an insertion at position 450 (T450) according to the numbering in the AAV2 capsid sequence; in the AAV9.rh74 hybrid capsid protein sequence (SEQ ID NO: 8), the corresponding position is 452 (S452). The insertion in VR-VIII is preferably an insertion at position 587 (N587) according to the numbering in the AAV2 capsid protein; in the AAV9.rh74 capsid protein sequence, this position is 589 (N589).

[0038] The RGDLXXL / I peptide may be inserted between two consecutive amino acids of the AAV capsid protein sequence (without deletion), or some or all of the residues at the insertion site may be replaced (with deletion). In some embodiments, the RGDLXXL / I peptide replaces the residues at positions 451-457 of the AAV2 capsid protein sequence, which corresponds to the residues at positions 453-459 of the AAV9.rh74 capsid protein sequence.

[0039] The modified AAV capsid protein can be derived from any natural or artificial AAV capsid serotype, including hybrid serotypes and variant serotypes. Non-limiting examples of AAV capsid serotypes from which the modified AAV capsid protein can be derived include AAV1, AAV2, AAV3 (including 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV2i8, AAVrh10, AAVrh39, AAVrh43, AAVrh74, AAV-LK03, AAV2G9, AAV.PHP, AAV-Anc80, AAV3B, and hybrids of AAV9 and AAVrh74. In some embodiments, the modified AAV capsid protein is from an AAV serotype selected from the group consisting of AAV6, AAV8, AAV9, AAVrh74, and hybrids of AAV9 and AAVrh74. In some preferred embodiments, the modified AAV capsid protein is from AAV8, AAV9, or a hybrid of AAV9 and AAVrh74; or from AAV9, or a hybrid of AAV9 and AAVrh74, more preferably a hybrid of AAV9 and AAVrh74. The AAV9 capsid corresponds in particular to the amino acid sequence GenBank accession number AY530579.1 of the access date June 24, 2004. The hybrid of AAV9 and AAVrh74 is preferably AAV9.rh74 disclosed in WO2019 / 193119; more preferably the AAV9.rh74 capsid having the amino acid sequence, SEQ ID NO: 20.

[0040] In some preferred embodiments, the modified AAV capsid protein is from the AAV9.rh74 serotype and contains a peptide containing the RGDLXXL / I motif according to the present invention inserted at position 452 of the AAV9.rh74 capsid protein sequence and replacing the residues at positions 453 - 459. In some preferred embodiments, the peptide comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 2 - 19, preferably SEQ ID NOs: 2, 4, 8, 10, 14, or 16; more preferably SEQ ID NOs: 2, 8, or 14.

[0041] In some more specific embodiments, the modified AAV capsid protein comprises or consists of any one of SEQ ID NOs: 21-26; preferably SEQ ID NO: 21 or 23; more preferably a sequence comprising or consisting of the sequence of SEQ ID NO: 21 or 23; even more preferably a sequence having at least 85%, 87%, 88%, 90%, 95%, 97%, 98% or 99% identity to SEQ ID NO: 21. The variants according to the invention do not have mutations in the peptide containing the RGDLXXL / I motif or Z-RGDLXXL / I motif according to the invention, and preferably also in the 5 amino acid sequences before and after the insertion site; preferably in the 10 amino acid sequences.

[0042] In some embodiments, the modified AAV capsid protein is a modified VP1, VP2 or VP3 protein. In some specific embodiments, the modified VP1, VP2 or VP3 protein is derived from any one of SEQ ID NOs: 21-26; preferably SEQ ID NO: 21 or 23; more preferably SEQ ID NO: 21. VP2 corresponds to the amino acid sequence from T138 to the end of any one of SEQ ID NOs: 21-26. VP3 corresponds to the amino acid sequence from M204 to the end of any one of SEQ ID NOs: 21-26.

[0043] In some embodiments, the modified AAV capsid protein is a chimeric VP1 or VP2 protein comprising a peptide insertion into the general VP3 region of a certain AAV serotype, as well as the VP1-specific and / or VP2-specific N-terminal regions from other AAV serotypes (e.g., AAV serotypes different from the serotype of the VP3 region). In some specific embodiments, the chimeric VP1 or VP2 protein is derived from SEQ ID NO: 9 or 10.

[0044] In various embodiments of the present invention, the amino acid sequence of the modified AAV capsid protein may be advantageously selected to have the lowest predicted energy using suitable methods available in the art, such as the Rosetta energy function for macromolecular modeling and design (outlined in Alford et al., J. Chem. Theory Comput, 2017, 13, 6, 3031 - 3048). For example, the Rosetta energy function is used to extract pairs of sequences with thoroughly low energy structures. This method ensures that the designed modified AAV capsid remains stable and can thus maintain or even improve AAV vector productivity.

[0045] Use for the production of polynucleotides, vectors, and AAV vectors Another aspect of the present invention is a polynucleotide encoding a recombinant modified AAV capsid protein in an expressible form. The polynucleotide may be DNA, RNA, or a synthetic or semi-synthetic nucleic acid.

[0046] In some embodiments, the polynucleotide encodes a modified AAV9.rh74 capsid protein comprising or consisting of a peptide comprising a sequence selected from the group consisting of SEQ ID NOs: 2 - 19, preferably SEQ ID NOs: 2, 4, 8, 10, 14, or 16; even more preferably SEQ ID NOs: 2, 8, or 14.

[0047] In some preferred embodiments, the polynucleotide encodes a modified AAV9.rh74 capsid protein comprising or consisting of a sequence having at least 85%, 87%, 88%, 90%, 95%, 97%, 98%, or 99% identity to SEQ ID NO: 21 or SEQ ID NO: 23, preferably SEQ ID NO: 21.

[0048] In some more preferred embodiments, the polynucleotide comprises any one of SEQ ID NOs: 27-32; preferably SEQ ID NO: 27 or 29; more preferably a sequence having at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity to SEQ ID NO: 27. The nucleotide sequence, SEQ ID NO: 27, encodes a modified AAV9.rh74 capsid protein of SEQ ID NO: 21. The nucleotide sequence, SEQ ID NO: 29, encodes a modified AAV9.rh74 capsid protein of SEQ ID NO: 23. The polynucleotide is a functional polynucleotide sequence, which means that the sequence of this polynucleotide encodes a modified AAV capsid protein according to the present invention.

[0049] In some embodiments, the polynucleotide further encodes an AAV rep (Rep) protein, preferably in a form capable of expressing Rep from AAV2.

[0050] The polynucleotide is advantageously inserted into a recombinant vector, which includes, in a non-limiting manner, linear or circular DNA or RNA molecules consisting of chromosomal, extrachromosomal, synthetic or semi-synthetic nucleic acids, such as in particular viral vectors, plasmids or RNA vectors. Numerous vectors into which the nucleic acid molecule of interest can be inserted for introduction into a eukaryotic host cell and maintenance therein are known per se; the choice of the appropriate vector depends on the use envisaged for this vector (e.g., replication of the sequence of interest, expression of this sequence, maintenance of this sequence in chromosomal form, or alternatively integration into the host chromosomal material), and also on the nature of the host cell.

[0051] In some embodiments, the vector is a plasmid.

[0052] The recombinant vector for use in the present invention is an expression vector containing a modified AAV capsid protein (AVV Cap) and possibly also appropriate means for the expression of the AAV Rep protein. Usually, each coding sequence (modified AAV Cap and AAV Rep) is inserted into separate expression cassettes either in the same vector or separately. Each expression cassette contains regulatory sequences that enable the expression of the corresponding protein in AAV-producing cells, such as in particular a promoter, a promoter / enhancer, a start codon (ATG), a stop codon, a coding sequence (open reading frame or ORF) operably linked to a transcription termination signal. Alternatively, the modified AAV Cap and AAV Rep proteins may be expressed from a unique expression cassette using an internal ribosome entry site (IRES) inserted between two coding sequences or viral 2A peptides. Additionally, the codon sequences encoding the modified AAV Cap and, where present, AAV Rep are preferably optimized for expression in AAV-producing cells, particularly human-producing cells.

[0053] Another aspect of the present invention is a cell stably transformed with a recombinant vector for the expression of a modified AAV capsid protein and preferably also an AAV Rep protein. The cell stably expresses (produces cell line) the modified AAV capsid and AAV Rep proteins. The producing cells are preferably human cells.

[0054] The vector, preferably a recombinant plasmid, or the cell is useful for producing a hybrid AAV vector containing the hybrid AAV capsid protein of the present invention using standard AAV production methods well known in the art (review in Aponte-Ubillus et al., Applied Microbiology and Biotechnology, 2018, 102: 1045-1054).

[0055] An AAV vector is usually produced by co - transfecting a cell suitable for AAV production with a plasmid (AAV transfer plasmid) containing a recombinant AAV vector genome that contains a gene of interest inserted into an expression cassette flanked by AAV ITRs, and a plasmid that expresses AAV Rep and Cap proteins. Alternatively, an AAV transfer plasmid may be transfected into a production cell (a cell that stably expresses AAV Rep and Cap proteins) according to the present invention.

[0056] Briefly stated, after transfection of the above - mentioned plasmids in the presence of sufficient helper functions to enable packaging of the rAAV vector genome into AAV capsid particles, the cells are incubated for a sufficient time to enable production of AAV vector particles, the cells are then harvested and lysed, and the AAV vector particles are purified by standard purification methods such as affinity chromatography and iodixanol or cesium chloride density gradient ultracentrifugation.

[0057] AAV particles, cells Another aspect of the present invention is an AAV particle comprising a modified recombinant AAV capsid protein of the present invention.

[0058] AAV particles comprise modified VP1, VP2, and / or VP3 capsid proteins according to the invention. In some embodiments, the AAV particles comprise modified VP1, VP2, and VP3 capsid proteins of the same serotype. In some embodiments, the AAV particles further or alternatively comprise chimeric VP1 and / or VP2 capsid proteins, and a modified VP3 protein according to the invention. In some embodiments, the AAV particles are mosaic AAV particles that further comprise another AAV capsid protein from a natural or artificial AAV serotype other than the serotype of the modified AAV capsid comprising the chimeric modified AAV capsid, and the mosaic AAV particles have increased muscle transduction efficiency or levels. Artificial AAV serotypes may be, without limitation, chimeric AAV capsids, recombinant AAV capsids, or humanized AAV capsids. Such artificial capsids can be generated by any suitable technique using a selected AAV sequence (e.g., a fragment of the VP1 capsid protein) together with a heterologous sequence obtained from a different selected AAV serotype, from non - contiguous portions of the same AAV serotype, from a non - viral AAV source, or from a non - viral source.

[0059] Preferably, the AAV particles are recombinant AAV (rAAV) vector particles. AAV vector particles are suitable for gene therapy directed to muscle cells, tissues or organs in an individual. The rAAV vector particles package a gene of interest. The genome of the rAAV vector may be either a single-stranded genome or a self-complementary double-stranded genome (McCarty et al., Gene Therapy, 2003, Dec., 10(26), pp. 2112-2118). Self-complementary vectors are generated by deleting the terminal resolution site (trs) from one of the AAV terminal repeats. These modified vectors, whose replicative genome is half the length of the wild-type AAV genome, tend to package DNA dimers. The AAV genome is flanked by ITRs. In certain embodiments, the AAV vector is a pseudotype vector, i.e., its genome and capsid are derived from different serotypes of AAV. In some preferred embodiments, the genome of the pseudotype vector is derived from AAV2. The rAAV vector particles can be obtained using standard AAV production methods well known in the art as disclosed above.

[0060] By "gene of interest" is meant a gene useful for a particular application, such as, without limitation, diagnosis, reporting, modification, therapy and genome editing.

[0061] For example, the gene of interest may be a therapeutic gene, a reporter gene or a genome editing enzyme.

[0062] By "gene of interest for therapy", "therapeutic gene of interest", or "heterologous gene of interest" is meant a gene encoding a therapeutic gene or a therapeutic protein, peptide or RNA.

[0063] The gene of interest is any nucleic acid sequence having the ability to modify a target gene or target cell pathway in the cells of a target organ (i.e., muscle). For example, the gene may modify the expression, sequence, or regulation of a target gene or cell pathway. In some embodiments, the gene of interest is a functional version of a gene or a fragment thereof. The functional version of the gene includes the wild-type gene, variant genes, such as variants belonging to the same family and others, or truncated versions that at least partially preserve the functionality of the encoded protein. The functional version of the gene is useful for replacement or additional gene therapy to replace a gene that is deficient or non-functional in a patient. In other embodiments, the gene of interest is a gene that inactivates a dominant allele that causes an autosomal dominant genetic disease. A fragment of the gene is useful as a recombination template for use in combination with a genome editing enzyme.

[0064] Alternatively, the gene of interest may encode a protein of interest (e.g., an antibody or antibody fragment, a genome editing enzyme) or RNA for a particular application. In some embodiments, the protein is a therapeutic antibody or antibody fragment, or a therapeutic protein including a genome editing enzyme. In some embodiments, the RNA is a therapeutic RNA.

[0065] In some embodiments, the sequence of the gene of interest is optimized for expression in the individual to be treated, preferably a human individual. Sequence optimization may include several changes in the nucleic acid sequence, which include codon optimization, an increase in GC content, a decrease in the number of CpG islands, a decrease in the number of alternative open reading frames (ARFs), and / or a decrease in the number of splice donor and splice acceptor sites.

[0066] The gene of interest is a functional gene capable of producing a protein, peptide, or RNA encoded in the target cells of the disease (i.e., muscle cells). In some embodiments, the gene of interest is a human gene. The AAV viral vector contains the gene of interest in an expressible form in the cells of the target organs (i.e., muscle cells) including cardiomyocytes and skeletal muscle cells. In particular, the gene of interest is operably linked to appropriate regulatory sequences for the expression of the transgene in the target cells, tissues, or organs of an individual. Such sequences well-known in the art include, in particular, promoters, and further regulatory sequences having the ability to further control the expression of the transgene, such as, without limitation, enhancers, terminators, introns, silencers, particularly tissue-specific silencers, and microRNAs. The gene of interest is operably linked to a ubiquitous, tissue-specific, or inducible promoter that is functional in the cells of the target organ (i.e., muscle). The gene of interest may be inserted into an expression cassette further comprising the additional regulatory sequences disclosed above.

[0067] Examples of ubiquitous promoters include the CAG promoter, phosphoglycerate kinase 1 (PGK) promoter, cytomegalovirus enhancer / promoter (CMV), SV40 early promoter, retrovirus Rous sarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter, β-actin promoter, and EF1 promoter. Muscle-specific promoters include, without limitation, the desmin (Des) promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain (alpha-MHC) promoter, myosin light chain 2 (MLC-2) promoter, cardiac troponin C (cTnC) promoter, human skeletal actin (HSA) promoter, or synthetic muscle-specific promoters, such as upstream sequences derived from the SpC5-12 promoter, CK6 promoter.

[0068] RNA is preferably complementary to a target DNA or RNA sequence or binds to a target protein. For example, the RNA is an interfering RNA such as shRNA, microRNA, a guide RNA (gRNA) for use in combination with a Cas enzyme or a similar enzyme for genome editing, an antisense RNA having the ability to exon skip, such as a modified small nuclear RNA (snRNA) or a long non-coding RNA. The interfering RNA or microRNA may be used to regulate the expression of a target gene involved in a muscle disease. The guide RNA in complex with a Cas enzyme or a similar enzyme for genome editing may be used to modify the sequence of a target gene, particularly to correct the sequence of a mutant / defective gene or to modify the expression of a target gene involved in a disease, particularly a neuromuscular disease. The antisense RNA having the ability to exon skip is particularly used to correct the reading frame and restore the expression of a defective gene having a disrupted reading frame. In some embodiments, the RNA is a therapeutic RNA.

[0069] The genome editing enzyme according to the present invention is any enzyme or enzyme complex having the ability to modify a target gene or target cell pathway, particularly in muscle cells. For example, the genome editing enzyme may modify the expression, sequence or regulation of a target gene or cell pathway. The genome editing enzyme is preferably an artificial nuclease, such as, without limitation, a meganuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a Cas enzyme from a clustered regularly interspaced palindromic repeats (CRISPR)-Cas system, and similar enzymes. Genome editing enzymes, particularly artificial nucleases such as Cas enzymes and similar enzymes, generate double-strand breaks (DSBs) or single-strand DNA breaks in the target genomic locus (nickases such as Cas9 (D10A)) and may be functional nucleases used for site-specific genome editing applications including, without limitation, gene correction, gene replacement, gene knock-in, gene knockout, mutagenesis, chromosomal translocation, and chromosomal deletion. For site-specific genome editing applications, the genome editing enzyme, particularly an artificial nuclease such as a Cas enzyme and similar enzymes, may be used in combination with a homologous recombination (HR) matrix or template (also named DNA donor template) that modifies the target genomic locus by homologous recombination induced by the double-strand break (DSB). In particular, the HR template may introduce a transgene of interest into the target genomic locus or repair a mutation in the target genomic locus, preferably in an abnormal or defective gene, that causes a muscle disorder such as a neuromuscular disease. Alternatively, the genome editing enzyme, such as a Cas enzyme and similar enzymes, may be engineered to be nuclease-deficient and used as a DNA-binding protein for various genome manipulation applications, such as, without limitation, transcriptional activation, transcriptional repression, epigenomic modification, genome imaging, and DNA or RNA pull-down.

[0070] The present invention also relates to isolated cells, particularly cells from an individual, which have been stably transduced with the rAAV vector particles of the present invention. The individual is preferably the patient to be treated. In some embodiments, the cells are muscle cells, progenitor cells or pluripotent stem cells according to the present disclosure, such as induced pluripotent stem cells (iPS cells), embryonic stem cells, fetal stem cells and adult stem cells.

[0071] Pharmaceutical compositions and therapeutic uses Another aspect of the present invention is a pharmaceutical composition comprising at least an active agent selected from the AAV vector particles or cells of the present disclosure, and a pharmaceutically acceptable carrier.

[0072] The rAAV vector particles, cells and derived pharmaceutical compositions of the present invention may be used for treating diseases by gene therapy, particularly targeted gene therapy directed to muscle cells or tissues. The cells and derived pharmaceutical compositions of the present invention may be used for treating diseases by cell therapy, particularly cell therapy directed to muscle cells.

[0073] As used herein, "gene therapy" refers to the treatment of an individual involving the delivery of a nucleic acid of interest to the cells of the individual for the purpose of treating a disease. Delivery of the nucleic acid is generally achieved using a delivery vehicle, also known as a vector. The rAAV vector particles of the present invention may be used to deliver genes to the cells of a patient.

[0074] As used herein, "cell therapy" refers to the process by which cells stably transduced with the rAAV vector particles of the present invention are delivered to an individual in need thereof by any suitable means, such as intravenous injection (infusion), or injection (implantation or transplantation) into the tissue of interest. In certain embodiments, cell therapy includes the steps of collecting cells from an individual, transducing the individual's cells with the rAAV vector particles of the present invention, and administering the stably transduced cells back to the patient. As used herein, "cells" refers to isolated cells, natural or artificial cell aggregates, bioartificial cell scaffolds, and bioartificial organs or tissues.

[0075] Gene therapy can be performed by gene transfer, gene editing, exon skipping, RNA interference, trans-splicing, or any other genetic modification of any coding or regulatory sequence in a cell, including those contained in the nucleus, in the mitochondria, or as symbiotic nucleic acids, such as, without limitation, viral sequences contained in a cell.

[0076] The two main types of gene therapy are as follows: - Therapies aimed at providing a functional replacement gene for a defective / abnormal gene: This is replacement or addition gene therapy; - Therapies aimed at gene or genome editing: In such cases, the aim is to provide the cell with the tools necessary to correct a sequence or modify the expression or regulation of a defective / abnormal gene, such that a functional gene is expressed or an abnormal gene is suppressed (inactivated): This is gene editing therapy.

[0077] In additive gene therapy, the gene of interest may be a functional version of a gene that is defective or mutant in the patient, for example, as applicable in the case of a genetic disease. In such cases, the gene of interest restores the expression of the functional gene. To this end, the correct version of this gene is provided into the target cells (i.e., muscle cells) of the affected patient by gene editing or gene replacement, which can contribute to an effective therapy against the disease.

[0078] Gene or genome editing is performed on one or more genes of interest, such as - genes encoding therapeutic RNAs as defined above, such as interfering RNAs, such as shRNA or microRNA, guide RNAs (gRNAs) for use in combination with Cas enzymes or similar enzymes, or antisense RNAs having the ability to exon skip, such as modified small nuclear RNAs (snRNAs); and - genes encoding genome editing enzymes as defined above, such as artificial nucleases, such as meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), Cas enzymes or similar enzymes; or combinations of such genes, and also may be fragments of functional versions of genes for use as recombinant templates as defined above are used.

[0079] Gene therapy is used to treat muscle diseases. Muscle diseases include various hereditary (genetic) and acquired diseases or disorders that affect the structure or function of muscles, including skeletal and cardiac muscles. The diseases may be caused by trauma, infection, degeneration, structural or metabolic disorders, tumors, inflammation or autoimmune disorders, or other causes. Non-limiting examples of muscle diseases that can be treated by gene therapy include neuromuscular hereditary disorders, such as muscular hereditary disorders; cancers and autoimmune diseases.

[0080] In some embodiments, the target gene for gene therapy (additive gene therapy or gene editing) is the gene that causes neuromuscular disease. Neuromuscular hereditary disorders include, in particular, muscular dystrophy, congenital muscular dystrophy, congenital myopathy, distal myopathy, other myopathies, myotonic syndrome, ion channel muscle diseases, malignant hyperthermia, metabolic myopathy, hereditary cardiomyopathy, congenital myasthenic syndrome, motor neuron diseases, hereditary neuropathy, hereditary motor and sensory neuropathy, and other neuromuscular disorders.

[0081] Specific examples of neuromuscular hereditary disorders that can be treated using the capsid-modified rAAV according to the present invention are listed below.

[0082] - Dystrophinopathy is a spectrum of X-linked muscle diseases caused by pathogenic variants in the DMD gene that encodes the protein dystrophin. Dystrophinopathy includes Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and DMD-related dilated cardiomyopathy.

[0083] - Limb-girdle muscular dystrophy (LGMD) is a group of disorders that are clinically similar to DMD but occur in both sexes as a result of autosomal recessive and autosomal dominant inheritance. Limb-girdle dystrophy is caused by mutations in genes encoding sarcoglycans and other proteins associated with the muscle cell membrane that interact with dystrophin. The term LGMD1 refers to genotypes showing dominant inheritance (autosomal dominant), while LGMD2 refers to types with autosomal recessive inheritance. Pathogenic variants have been reported at more than 50 loci (LGMD1A–LGMD1G; LGMD2A–LGMD2W). Calpainopathy (LGMD2A) is caused by mutations in the gene CAPN3, for which more than 450 pathogenic variants have been described.Genes contributing to the LGMD phenotype include anoctamin 5 (ANO5), blood vessel epicardial substance (BVES), calpain 3 (CAPN3), caveolin 3 (CAV3), CDP-L-ribitol pyrophosphorylase A (CRPPA), dystroglycan 1 (DAG1), desmin (DES), DnaJ heat shock protein family (Hsp40) homolog, subfamily B, member 6 (DNAJB6), dysferlin (DYSF), fukutin-related protein (FKRP), fukutin (FKT), GDP-mannose pyrophosphorylase B (GMPPB), heterogeneous nuclear ribonucleoprotein D like (HNRNPDL), LIM zinc finger domain containing 2 (LIMS2), lamin A:C (LMNA), myotilin (MYOT), plectin (PLEC), protein O-glucosyltransferase 1 (PLOGLUT1), protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta1,2-) (POMGNT1), protein O-mannose kinase (POMK), protein O-mannosyltransferase 1 (POMT1), protein O-mannosyltransferase 2 (POMT2), sarcoglycan alpha (SGCA), sarcoglycan beta (SGCB), sarcoglycan delta (SGCD), sarcoglycan gamma (SGCG), titin-cap (TCAP), transportin 3 (TNPO3), torsin 1A interacting protein 1 (TOR1AIP1), trafficking protein particle complex 11 (TRAPPC11), tripartite motif containing 32 (TRIM 32), and titin (TTN).The major contributing genes to the LGMD phenotype include CAPN3, DYSF, FKRP, and ANO5 (Babi Ramesh Reddy Nallamilli et al., Annals of Clinical and Translational Neurology, 2018, 5, pp. 1574 - 1587).

[0084] - Emery - Dreifuss muscular dystrophy (EDMD) caused by a defect in one of the genes including the EMD gene (encoding emerin), the FHL1 gene, and the LMNA gene (encoding lamin A and C).

[0085] - Nesprin - 1 and Nesprin - 2 - related muscular dystrophies caused by defects in the SYNE1 and SYNE2 genes respectively; LUMA - related muscular dystrophy caused by a defect in the TMEM43 gene; LAP1B - related muscular dystrophy caused by a defect in the TOR1AIP1 gene.

[0086] - Facioscapulohumeral muscular dystrophy type 1 (FSHD1A) associated with defects in, for example, the DUX4 gene (shortening of the D4Z4 macrosatellite repeat in the subtelomeric region of chromosome 4q35) or the FRG1 gene; Facioscapulohumeral muscular dystrophy type 2 (FSHD1B) caused by a defect in the SMCHD1 gene.

[0087] - Spinal muscular atrophy is a genetic disorder caused by mutations in the survival motor neuron 1 (SMN1) gene, which is characterized by weakness and wasting (atrophy) in the muscles used for movement.

[0088] - X-linked myotubular myopathy is a genetic disorder that affects the muscles used for movement (skeletal muscles) and is caused by mutations in the myotubularin (MTM1) gene, which occurs almost exclusively in males. This condition is characterized by muscle weakness (myopathy) and a decrease in muscle tone (hypotonia).

[0089] - Titinopathy is a hereditary disorder caused by mutations in the titin (TTN) gene. Both dominant and recessive TTN mutations have been reported to cause a wide spectrum of myocardial and skeletal muscle diseases. Dominant titinopathy includes hereditary myopathy with early respiratory failure (HMERF), which is caused by a mutation in exon 344 and is associated with early respiratory failure, and tibial muscular dystrophy (TMD). Recessive titinopathy includes limb-girdle muscular dystrophy 2J, juvenile or early adult-onset distal titinopathy, Emery-Dreifuss-like myopathy without cardiomyopathy, and congenital myopathy with or without heart disease.

[0090] - Pompe disease is a genetic disorder caused by mutations in the acid alpha-glucosidase (GAA) gene. Mutations in the GAA gene prevent acid alpha-glucosidase from effectively breaking down glycogen, which causes this sugar to accumulate to toxic levels in the lysosome. This accumulation damages organs and tissues throughout the body, particularly muscles, leading to the progressive signs and symptoms of Pompe disease.

[0091] - Glycogen storage disease III (GSD3) is an autosomal recessive metabolic disorder caused by homozygous or compound heterozygous mutations in the gene encoding glycogen debranching enzyme, amylo-alpha-1,6-glucosidase, 4-alpha-glucanotransferase (AGL), which is associated with the accumulation of abnormal glycogen with short outer chains. Clinically, patients with GSD III present with hepatomegaly, hypoglycemia, and growth retardation in infancy or early childhood. Muscle weakness in those with IIIa is minimal in childhood but may become more severe in adulthood; some patients develop cardiomyopathy.

[0092] In some embodiments, the target gene for gene therapy (additional gene therapy or gene editing) is a gene (CAPN3, DYSF, FKRP, ANO5, DNAJB6 gene and others, e.g., SGCA, SGCB, SGCG) that is the cause of a neuromuscular disease selected from the group including dystrophinopathy (DMD gene) and limb-girdle muscular dystrophy (LGMD). In some preferred embodiments, the target gene for gene therapy is selected from the group consisting of DMD, CAPN3, DYSF, FKRP, DNAJB6, ANO5, SGCA, SGCB, and SGCG.

[0093] A specific example of gene editing could be the treatment of limb-girdle muscular dystrophy 2A (LGMD2A) caused by mutations in the calpain-3 gene (CAPN3). Other non-limiting examples could be the treatment of mutations in the DMD or TNT gene.

[0094] Thus, gene editing or gene replacement can provide the correct version of this gene to the muscle cells of the affected patient, which can contribute to an effective treatment for this disease. Other hereditary diseases of the muscle listed above can be treated by gene replacement or gene editing using the same principle.

[0095] Replacement or addition gene therapy may be used to treat cancer, particularly rhabdomyosarcoma. The gene of interest in cancer may regulate the cell cycle or metabolism and migration of tumor cells, or induce the death of tumor cells. For example, in combination therapy to induce a preferably persistent anti-tumor immune response, inducible caspase-9 can be expressed in muscle cells and serve as a trigger for cell death.

[0096] Gene editing may be used to modify gene expression in target cells (i.e., muscle cells) or disrupt the viral cycle in such cells in the case of autoimmunity or cancer. In such cases, preferably, the gene of interest is selected from those encoding guide RNA (gRNA), site-specific endonucleases (TALEN, meganuclease, zinc finger nuclease, Cas nuclease), DNA template, and RNAi components such as shRNA and microRNA. Tools such as CRISPR / Cas9 may be used for this purpose.

[0097] In some embodiments, gene therapy is used to treat diseases that affect other tissues by expression of a therapeutic gene in muscle tissue. This is useful, particularly in patients with concurrent liver disorders, such as hepatitis including viral hepatitis or toxic hepatitis, to avoid expression of the therapeutic gene in the liver. The therapeutic gene preferably encodes a therapeutic protein, peptide, or antibody that can be secreted from muscle cells into the bloodstream and delivered therein to other target tissues such as the liver. Examples of therapeutic genes include, without limitation, factor VIII, factor IX, and the GAA gene.

[0098] In various embodiments of the present invention, the pharmaceutical composition comprises a therapeutically effective amount of rAAV vector particles or cells. In the context of the present invention, a therapeutically effective amount is an amount sufficient to reverse, mitigate or inhibit the progression of a disorder or condition to which such terms apply, or to reverse, mitigate or inhibit the progression of one or more symptoms of a disorder or condition to which such terms apply. The terms "effective dose" or "effective dosage" are defined as an amount sufficient to achieve or at least partially achieve the desired effect.

[0099] The effective dose is determined and adjusted depending on factors such as the composition used, the route of administration, the physical characteristics of the individual under consideration, such as sex, age and weight, concurrent medications, and other factors recognized by those skilled in the art.

[0100] In various embodiments of the present invention, the pharmaceutical composition comprises a pharmaceutically acceptable carrier and / or vehicle.

[0101] "Pharmaceutically acceptable carrier" refers to a medium that, when appropriately administered to a mammal, particularly a human, does not produce a harmful, allergic or other adverse reaction. A pharmaceutically acceptable carrier or excipient refers to any kind of non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation aid.

[0102] Preferably, the pharmaceutical composition contains a pharmaceutically acceptable vehicle for injectable formulations. These may in particular be isotonic, sterile, saline solutions (sodium mono- or di-phosphate, sodium chloride, potassium, calcium or magnesium etc. or mixtures of such salts), or, depending on the case, dry, particularly freeze-dried compositions that allow the constitution of an injectable solution by addition of sterile water or physiological saline.

[0103] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or suspensions. The solution or suspension may be compatible with the viral vector and may contain additives that do not prevent the viral vector particles from entering the target cells. In all cases, the form must be sterile and fluid to the extent that easy syringe needle passage exists. It must be stable under the conditions of production and storage and must be protected from the contaminating action of microorganisms such as bacteria and fungi. Examples of suitable solutions are buffers such as phosphate buffered saline (PBS) or Ringer's lactate.

[0104] The present invention also provides a method of treating a disease by expression of a therapeutic gene in a target tissue (i.e., muscle tissue), the method comprising administering to a patient a therapeutically effective amount of the pharmaceutical composition described above.

[0105] The present invention also provides a method of treating a muscle disorder, the method comprising administering to a patient a therapeutically effective amount of the pharmaceutical composition described above.

[0106] A further aspect of the present invention relates to the use of the rAAV vector particles, cells, pharmaceutical compositions according to the present disclosure in the production of a medicament for the treatment of muscle disorders, in particular neuromuscular hereditary diseases according to the present disclosure.

[0107] A further aspect of the present invention relates to the rAAV vector particles, cells, pharmaceutical compositions according to the present disclosure for use as a medicament and / or for use in gene therapy, in particular for the treatment of muscle disorders, in particular neuromuscular hereditary diseases according to the present disclosure.

[0108] A further aspect of the present invention relates to the use of the rAAV vector particles, cells, pharmaceutical compositions according to the present disclosure for the treatment of muscle disorders, in particular neuromuscular hereditary diseases according to the present disclosure.

[0109] A further aspect of the present invention relates to a pharmaceutical composition for the treatment of muscle disorders, in particular neuromuscular hereditary diseases according to the present disclosure, comprising the rAAV vector particles, cells according to the present disclosure as active ingredients.

[0110] A further aspect of the invention relates to a pharmaceutical composition comprising rAAV vector particles and cells according to the disclosure for treating muscle disorders, in particular neuromuscular genetic diseases according to the disclosure.

[0111] As used herein, the terms "patient" or "individual" include human and other mammalian subjects to whom either prophylactic or therapeutic treatment is administered. Preferably, the patient or individual according to the invention is human.

[0112] "Treatment", or "treating", as used herein, refers to the application or administration of a therapeutic agent or combination of therapeutic agents to a patient, or to the application or administration of said therapeutic agent to an isolated tissue or cell line from a patient having a disease, particularly a muscle disorder, for the purpose of curing, recovering, alleviating, mitigating, altering, treating, remitting, improving or affecting a disease or any symptom of a disease. In particular, the term "treating" or "treatment" refers to reducing or alleviating at least one adverse clinical symptom associated with a disease.

[0113] The term "treatment" or "treating" is also used herein in the context of prophylactic administration of a therapeutic agent.

[0114] The pharmaceutical composition of the present invention is generally administered in an effective dosage and for a period of time effective to induce a therapeutic effect in a patient according to known procedures. The pharmaceutical composition may be administered by any convenient route, which may be, for example, in a non-limiting manner, by infusion or bolus injection, or by absorption through an epithelium or mucosa (e.g., oral mucosa, rectal and intestinal mucosa, etc.). Administration can be systemic, local or a combination of local and systemic; systemic includes parenteral and oral, and local includes topical and local regions. Systemic administration is preferably parenteral, such as subcutaneous (SC), intramuscular (IM), intravascular, such as intravenous (IV) or intraarterial; intraperitoneal (IP); intradermal (ID), epidural or otherwise. Administration may be, for example, by injection or perfusion. In some preferred embodiments, administration is parenteral, preferably intravascular, such as intravenous (IV) or intraarterial. Parenteral administration is advantageously by injection or perfusion.

[0115] The various embodiments of the present disclosure are combinable with each other, and the present disclosure encompasses various combinations of the embodiments of the present disclosure.

[0116] The practice of the present invention uses conventional techniques within the skill of the art, unless otherwise indicated. Such techniques are well described in the literature.

[0117] The present invention will now be illustrated by way of non-limiting examples with reference to the accompanying drawings.

Brief Description of the Drawings

[0118]

Figure 1

Figure 2

Figure 3A

Figure 3B

Example

[0119] Construction and in vivo distribution of capsid-modified rAAV vectors 1. Materials and methods 1.1. Plasmid construction Plasmids containing a hybrid AAV9.rh74 capsid modified by various peptides containing the motif RGDLXXL / I (where XX is different from GS and ST) (SEQ ID NO: 1) were derived from plasmid pRep2-Cap9rh74 containing the AAV2 Rep and hybrid AAV9.rh74 capsid (Cap9rh74_WT) genes, which were disclosed in WO2019 / 193119, using standard cloning techniques. Peptides 4um9 or 4um9_native (TDGRGDLGRLGP), 4um9_modified (SEPRGDLGELNA), 5ffo or 5ffo_native (EPRRGDLATIGS), 5ffo_modified (TDQRGDLAELHG), 5nem_native (APVRGDLQVLAP) and 5nem_modified (APVRGDLAEINP) were inserted into variable region 4 (VR-IV) between residues S452 and Q460 of the hybrid AAV9.rh74 capsid protein sequence, thereby replacing residues T453 - T459. Bacterial clones were verified by sequencing. The resulting peptide-modified hybrid AAV9.rh74 capsids (VP1 protein) were named Cap9rh74_VR4-4um9 or Cap9rh74_VR4-4um9.Nat (SEQ ID NO: 21), Cap9rh74_VR4-4um9.Mod (SEQ ID NO: 22), Cap9rh74_VR4-5ffo or Cap9rh74_VR4-5ffo.Nat (SEQ ID NO: 23), Cap9rh74_VR4-5ffo.Mod (SEQ ID NO: 24), Cap9rh74_VR4-5nem.Nat (SEQ ID NO: 25) and Cap9rh74_VR4-5nem.Mod (SEQ ID NO: 26). The corresponding coding sequences are SEQ ID NOS: 27 - 32. A modified hybrid AAV9.rh74 capsid (Cap9rh74-HB-P1) containing peptide P1 (RGDLGLS) flanked by AAA and SG inserted at position 589 (e.g., between N589 and A590) of the hybrid AAV9.rh74 capsid sequence disclosed in WO2022 / 053630 was used for comparison.

[0120] 1.2. rAAV Production Recombinant adeno-associated virus (rAAV) containing modified and unmodified AAV9rh74, containing the GFP-luciferase transgene under the control of the CMV promoter, was produced at Genethon as described by Ayuso E. et al. (Hum. Gene Ther. 2014, 25, 977-987). The viral genome was quantified as described by Rohr et al. (J. Virol. Methods, 2002, 106, 81-88). The rAAV titer is expressed as the viral genome copy number (vg).

[0121] 1.3 In vivo experiments Animals were handled in accordance with French and European legislation. The procedures involving animals were approved by the local ethics committee and by the Ministry of Higher Education, Research and Innovation (APAFIS#19736). Six-week-old mice (n = 4 per group) were administered rAAV expressing GFP-luciferase by intravenous (IV) injection at a dose of 1x10 13 vg / kg. Bioluminescence images were acquired in vivo 14 days after injection. Three weeks after injection, the mice were sacrificed by cervical dislocation, and several muscles and organs: tibialis anterior muscle, diaphragm, heart, liver, kidney and lung were collected as samples.

[0122] 1.4 In vivo bioluminescence Bioluminescence images were acquired in vivo 20 days after injection. The mice were anesthetized by inhalation of isoflurane, and 100 μl of 50 mg / ml D-luciferin (Life Technologies, California, USA) was injected intraperitoneally. In vivo imaging was performed using an IVIS® Lumina Imaging system (PerkinElmer).

[0123] 1.5 Vector copy number quantification gDNA and viral DNA were extracted from various muscles and organs sampled using the NucleoMag Pathogen kit (Macherey-Nagel) and the KingFisher Flex instrument (ThermoFisher Scientific).

[0124] Viral genome copies were quantified to detect the CMV promoter from the vector and the viral genome copies were quantified to detect Rplp0 (60S acidic ribosomal protein P0) as an internal standard of the sample using Thermo Scientific Absolute qPCR ROX Mix, primers (forward: CATCAATGGGCGTGGATAGC (SEQ ID NO: 35); reverse: GGAGTTGTTACGACATTTTGGAAA (SEQ ID NO: 36)) and probe (ATTTCCAAGTCTCCACCC, FAM (SEQ ID NO: 37)) by multiplex qPCR in a Light Cycler 480 instrument (Roche), and primers (forward: CTCCAAGCAGATGCAGCAGA (SEQ ID NO: 38); reverse: ATAGCCTTGCGCATCATGGT (SEQ ID NO: 39)) and probe (CCGTGGTGCTGATGGGCAAGAA, VIC (SEQ ID NO: 40)).

[0125] 1.6. Luciferase assay in vitro The sample was homogenized (5 m / sec, 40 sec) using a FastPrep-24 Classic instrument (MP Biomedicals) in lysis buffer (25 mM Tris-phosphate, 15% glycerol, 1 mM DTT, 1 mM EDTA, 8 mM MgCl2, 0.2% Triton X-100) containing protease inhibitor cocktail (cOmpleteTM ULTRA Tablets, Mini EDTA-free, EASYpack Protease Inhibitor Cocktail Tablets REF:5892791001). The sample was subjected to 3 freeze / thaw cycles. After centrifugation (5 min, 10000 g, +4°C), 10 μl of the supernatant was transferred to a white opaque plate. Luminescence signals were measured from the sample homogenate using an EnSpire multimode plate reader (PerkinElmer), and a pumping system that allows dispensing of 100 μl of assay buffer (identical to the lysis buffer but without Triton X-100 and with 2 nM ATP, Sigma, REF:10519979001) and 100 μl of 167 μM D-luciferin. Protein quantification to normalize the luminescence signal by the amount of protein in the sample was performed using a Pierce BCA protein assay kit.

[0126] 2. Results Recombinant AAV vectors targeting integrin heterodimer αVβ6 (ITGAV-B6) were designed for the following reasons. First, ITGB6 expression is highly upregulated in human skeletal muscle (Figs. 1A - 1B). Although not overexpressed in muscle tissue, ITGAV expression in muscle is significantly higher than in the liver, which is interesting for liver off-targeting. Second, single-nucleus sequencing in mouse muscle tissue revealed high expression levels of both transcripts in muscle cell nuclei, and in the dystrophy model DMD delta51Even higher levels were previously observed in (Chemello et al., PNAS, 2020, 117, 29691 - 29701). These results are particularly interesting for targeting muscle tissue, especially in muscular dystrophy. Mechanistically, ITGAV - B6 binds with high affinity to the RGDLxxL / I motif, where LxxL / I forms an amphipathic α - helix that binds within the hydrophobic pocket of the B6 subunit. The motif can be found in the prodomains of TGF - β1, TGF - β3, and the FMDV virus capsid, all of which bind specifically to ITGAV - B6 (Dong et al., Nature Struct. Mol. Biol., 2014, 21, 1091 - 1096; Dong et al., Nature, 2017, 542, 55 - 59; Kotecha et al., Nature communications, 2017, 8, 15408; Protein Data Bank accession numbers 5FFO, 4UM9, and 5NEM).

[0127] Capsid - modified rAAV was designed using the hybrid capsid Cap9rh74 as a backbone. The entire loop in the VR - IV (VR4) region was replaced with 8 amino acids of the xRGDLxxL / I motif obtained from Protein Data Bank: 4UM9, 5FFO, and 5NEM. To enable a stable conformation of the RGD motif in the VR4 loop, a suitable linker (2 amino acids) was added to each end of the peptide. The Rosetta energy function was used to select the construct with the best energy score for experimental validation. Recombinant AAV vectors containing the modified capsid and the CMV - GFP / Luc transgene expression cassette were produced and purified. All capsid - modified rAAV were produced with excellent titers comparable to the titers obtained for wild - type AAV_Cap9rh74 for most capsid - modified rAAV (AAV9.rh74: 3.26x10 13 VG / mL) (AAV_Cap9rh74_VR4 - 4um9.Nat: 8.1x10 13 VG / mL; AAV_Cap9rh74_VR4 - 4um9.Mod: 1.2x10 13VG / mL; AAV_Cap9rh74_VR4-5ffo. Nat: 3x10 13 VG / mL; AAV_Cap9rh74_VR4-5ffo. Mod: 3.5x10 12 VG / mL; AAV_Cap9rh74_VR4-5nem. Nat: 1.5x10 12 VG / mL; AAV_Cap9rh74_VR4-5nem. Mod: 3.1x10 13 VG / mL).

[0128] Next, the binding of capsid-modified rAAV to the ITGAV-B6 heterodimer was examined. First, a 293 cell line that simultaneously overexpresses hITGAV and hITGB6 was constructed using the piggyBac™ transposon system. Then, the purified capsid-modified rAAV was infected into either 293_WT or 293_ITGAV-B6 at two different doses, 5E9 and 5E10 vg. All capsid-modified rAAV showed dose-dependent luciferase activity levels that were 100-1000 times higher than that of wild-type AAV_Cap9rh74.

[0129] During muscle differentiation, ITGB6 is highly expressed only at the differentiated myotube stage and not in satellite cells or myoblasts. To analyze the correlation between ITGAV-B6 expression levels in the muscle system and rAAV infectivity, capsid-modified rAAV was tested in human myoblasts and myotubes (Figure 2). As predicted, the infection levels of all capsid-modified rAAV were very low at the myoblast stage. All tested capsid-modified rAAV showed increased infectivity in myotubes compared to wild-type AAV_Cap9rh74.

[0130] Next, the in vivo distribution of the capsid-modified rAAV was tested by intravenous injection in wild-type mice and after determination of vector copy number and luciferase activity. Also, AAV_Cap9rh74-HB-P1 was included as a positive control for muscle enrichment and liver detargeting vectors. As shown by bioluminescence imaging, all AAV-modified variants are highly enriched in muscle compared to Cap9rh74-WT. Furthermore, luciferase activity and VCN assays confirmed higher transduction levels in all muscles compared to Cap9rh74_WT (Figures 3A and 3B). Cap9rh74_VR4-4um9 increases the transduction level in the quadriceps muscle by 100-fold compared to wild-type Cap9rh74 and approximately 3-fold compared to Cap9rh74-HBP1 (Figures 3A and Table 1).

[0131]

Table 1

[0132] Using this approach, at least two promising candidates (Cap9rh74_VR4-4um9 and Cap9rh74_VR4-5ffo) were produced that were produced with high titers, with high affinity for the ITGAV-B6 heterodimer, and showed high infectivity in human myotubes and high muscle transduction efficiency.

[0133] List of sequences

[0134]

Table 2

Claims

**Claim 1** A recombinant adeno-associated virus (AAV) capsid protein comprising at least one copy of an insertion of a motif RGDLXXL / I (where XX is different from GS and ST) (SEQ ID NO: 1), wherein the recombinant AAV capsid protein modified by the peptide has an increased transduction efficiency in muscle compared to a recombinant AAV capsid protein not modified by the peptide. **Claim 2** The recombinant AAV capsid protein according to claim 1, wherein the insertion is an insertion into variable region IV. **Claim 3** The recombinant AAV capsid protein according to claim 1 or 2, which is a hybrid of an AAV serotype 9 (AAV9) capsid protein and an AAV serotype 74 (AAVrh74) capsid protein. **Claim 4** The recombinant AAV capsid protein according to claim 2 or 3, wherein the insertion is an insertion at position 452, preferably the peptide insertion replaces the residues at positions 453 - 459, and the indicated position is determined by alignment with SEQ ID NO:

20. **Claim 5** wherein the motif is RGDLX 1 X 2 is L / I, wherein X 1 is G, A, L, K or Q, and X 2 is R, K, E, D, A, L, T, I or V, the recombinant AAV capsid protein according to any one of claims 1 to 4. **Claim 6** The recombinant AAV capsid protein according to claim 5, wherein the motif is a sequence selected from the group consisting of RGDLGRL (SEQ ID NO: 2), RGDLGEL (SEQ ID NO: 3), RGDLATI (SEQ ID NO: 4), RGDLAEL (SEQ ID NO: 5), RGDLQVL (SEQ ID NO: 6) and RGDLAEI (SEQ ID NO: 7); preferably SEQ ID NO: 2 or SEQ ID NO: 4; more preferably having SEQ ID NO:

2. **Claim 7** The recombinant AAV capsid protein according to claim 6, wherein the peptide is a sequence selected from the group consisting of TDGRGDLGRLGP (SEQ ID NO: 14), SEPRGDLGELNA (SEQ ID NO: 15), EPRRGDLATIGS (SEQ ID NO: 16), TDQRGDLAELHG (SEQ ID NO: 17), APVRGDLQVLAP (SEQ ID NO: 18) and APVRGDLAEINP (SEQ ID NO: 19); preferably SEQ ID NO: 14 or 16; more preferably comprising or consisting of SEQ ID NO:

14. **Claim 8** The recombinant AAV capsid protein according to claim 7, comprising any one of SEQ ID NOs: 21 - 26; preferably SEQ ID NO: 21 or 23; more preferably a sequence having at least 85% identity with SEQ ID NO:

21. **Claim 9** A polynucleotide encoding a recombinant AAV capsid protein according to any one of claims 1 to 8.

10. A recombinant plasmid containing the polynucleotide according to claim 9.

11. An AAV vector particle packaging a gene of interest and containing a recombinant AAV capsid protein according to any one of claims 1 to 8.

12. The AAV vector particle according to claim 11, wherein the gene of interest is selected from the group consisting of a therapeutic gene; a gene encoding a therapeutic protein or peptide, such as a therapeutic antibody or antibody fragment and a genome editing enzyme; and a therapeutic RNA, such as an interfering RNA, a guide RNA for genome editing, and a gene encoding an antisense RNA having the ability to skip exons.

13. A pharmaceutical composition comprising a therapeutically effective amount of the AAV vector particle according to claim 11 or 12, or a cell stably transfected with the AAV vector particle according to claim 11 or 12.

14. The pharmaceutical composition according to claim 13, for use as a medicament in gene therapy.

15. The pharmaceutical composition according to claim 13, for use in the treatment of muscle diseases.

16. A gene that is the cause of a muscle disease selected from dystrophinopathy and limb-girdle muscular dystrophy; preferably, a pharmaceutical composition for use according to claim 15, which targets a gene selected from the group consisting of DMD, CAPN3, DYSF, FKRP, DNAJB6, ANO5, SGCA, SGCB, and SGCG.

Images