Plants with enhanced pathogen resistance

By reducing the expression of Pub21 and optionally Pub17 proteins in tomato plants, the plants achieve improved resistance to necrotrophic pathogens like Botrytis cinerea and Alternaria solani, overcoming the limitations of existing breeding methods.

JP2025520505APending Publication Date: 2025-07-03SYNGENTA CROP PROTECITON AG +3
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024573779
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-17
Filing Date
2023-06-16
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Current breeding methods for tomato plants are ineffective against necrotrophic pathogens like Botrytis cinerea and Alternaria solani, as they rely on dominant R genes that are not applicable and quantitative resistance conferred by QTLs is complex and difficult to use.

Method used

Modifying tomato plants to reduce the expression or activity of the Pub21 and optionally Pub17 proteins, which are associated with increased resistance to lesion-forming pathogens, using methods such as CRISPR/Cas9 gene editing or RNA interference.

Benefits of technology

The modified tomato plants exhibit enhanced resistance to pathogens like Botrytis cinerea and Alternaria solani, providing a simpler and more effective alternative to traditional breeding strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025520505000001_ABST
    Figure 2025520505000001_ABST
Patent Text Reader

Abstract

The present invention relates to novel tomato plants having improved resistance to pathogens that form lesions. The present invention further relates to plant parts and seeds derived from said tomato plants, and methods of producing said tomato plants or increasing resistance to pathogens that form lesions in tomato plants. Further aspects of the present invention relate to modified Pub21 nucleic acid sequences and Pub21 protein sequences, combinations of modified Pub21 and Pub17 nucleic acid sequences, and combinations of Pub21 and Pub17 protein sequences, with such improved resistance to pathogens that form lesions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to novel tomato plants having improved resistance to pathogens that form lesions. The present invention further relates to plant parts and seeds derived from said tomato plants, and methods for producing said tomato plants, or methods for increasing resistance to pathogens that form lesions in tomato plants. A further aspect of the present invention relates to modified Pub21 nucleic acid sequences and Pub21 protein sequences, combinations of modified Pub21 and Pub17 nucleic acid sequences, and combinations of Pub21 and Pub17 protein sequences, which are associated with such improved resistance to pathogens that form lesions.

Background Art

[0002] Valuable cultivated plants such as tomatoes are hosts to over 200 species of a wide variety of pests and pathogens. In the practice of plant breeding, one of the most significant challenges since the 1950s has been to breed for resistance to the most destructive pests and pathogens by transferring disease resistance (R) genes from wild relatives to cultivated plants. Today, about 20 pathogens can be genetically controlled by R genes derived from relatively few wild species. In most cases, single-gene resistance controlled by a single dominant gene is introgressed into cultivated varieties (Bai et al., 2018). Most of the dominant R genes that have been cloned so far can be classified into two groups: (1) plasma membrane receptors including receptor-like kinases (RLKs, encoded by the I-3 gene) and receptor-like proteins (RLPs, encoded by the Cf gene and the Ve-1 gene); and (2) intracellular receptors represented by proteins having a nucleotide binding site and a leucine-rich repeat domain (NBS-LRR) in most cases. These plant receptors can recognize pathogen molecules and effectors known as pathogen-associated molecular patterns and confer pathogen-induced resistance (Dangl et al., 2013).

[0003] The transfer of dominant R genes from wild species to cultivated varieties has been very successful for (hemi)biotrophic pathogenic microorganisms. The mode of action of these R genes has been the subject of large-scale studies over the past 20 years and has been shown to rely, in most cases, on a mechanism called effector-triggered immunity (ETI). Effector molecules of biotrophic pathogens are thought to be important in the suppression of so-called PAMP-triggered immunity (PTI). Recognition of microbial effector molecules by plant receptor proteins (the products of R genes) induces programmed cell death (“hypersensitive response”, HR), thereby preventing further invasion of the pathogen.

[0004] However, dominant R genes that confer resistance to necrotrophic pathogens that form lesions, particularly Botrytis cinerea and Alternaria solani, common tomato pathogens, have not been identified (Adhikari et al., 2017; Bai et al., 2018). The immune responses described above are not effective against such pathogenic microorganisms. On the contrary, necrotrophs are thought to hijack host cell death pathways in response to effector molecules (Mengiste, 2012; Vleeshouwers and Oliver 2014; Shi et al., 2016). Therefore, it is important to develop alternative breeding strategies that avoid the use of plant receptor genes that recognize effectors.

[0005] Currently available resistance to pathogens that form lesions is mostly quantitative and is conferred by many quantitative trait loci (QTLs, Poland et al., 2009; Bai et al., 2018). In contrast to R-gene-mediated qualitative resistance, the molecular mechanisms of quantitative resistance conferred by QTLs are not yet understood. It has been suggested that resistance QTLs can be conditioned by genes involved in defense signaling, genes that regulate morphological traits, and genes that encode components of chemical warfare (Poland et al., 2009; Roux et al., 2014). In breeding, QTLs are difficult to use because of their small individual QTL effects on resistance. For example, the disease resistance to Botrytis cinerea and A. solani in certain lines of wild tomatoes is at a good level against related species (ten Have et al., 2007; Smith et al., 2014), but the resistance level decreases when introgression into the S. lycopersicum background is carried out, indicating that the genetic background of resistance in wild species is very complex (Finkers et al., 2007; Smith et al., 2014).

[0006] In 2010, a novel method for breeding resistant crops was presented: the use of the susceptibility (S) genes of plants impaired (Pavan et al., 2010). The S genes are plant genes that encode proteins exploited by pathogens for their own benefit during the infection process (Pavan et al., 2010). These S genes can be classified into three groups (Van Schie and Takken 2014): (i) genes that enable basic plant - pathogen compatibility, promoting host recognition and invasion; (ii) genes that encode negative regulators of immune signaling; (iii) genes that enable persistent compatibility and pathogen proliferation, fulfilling the metabolic or structural requirements of the pathogen. When such genes are dysfunctional due to mutation or lack of expression, it prevents the pathogen from colonizing the plant. Thus, the disabling S genes confer a recessive resistance trait, in contrast to recognition - based resistance governed by dominant R genes. The method using S genes offers fundamentally different opportunities for controlling diseases caused by lesion - forming microorganisms. However, many S genes remain undiscovered, and the concept of using them to produce pathogen - resistant plants has not been tested or achieved in major cultivated plants such as tomato.

Summary of the Invention

Problems to be Solved by the Invention

[0007] The present invention addresses one or more of the above problems in the art and aims to provide alternative means for increasing plant resistance to lesion - forming pathogens, particularly in tomato plants.

Means for Solving the Problems

[0008] According to a first aspect of the present invention, there is provided a tomato plant or plant material having a reduced level, activity or expression of the Pub21 protein, which confers increased resistance to a lesion - forming pathogen relative to a reference tomato plant or plant material.

[0009] In one embodiment, a tomato plant or plant material having a reduced level, activity, or expression of the Pub21 protein further comprises a reduced level, activity, or expression of the Pub17 protein, conferring increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material according to the first aspect of the present invention. In one embodiment, the modified Pub21 and Pub17 alleles confer increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material.

[0010] In one embodiment, a tomato plant or plant material is modified to reduce the level, activity, or expression of the Pub21 protein. Thus, in one embodiment, there is a tomato plant or plant material modified to reduce the level, activity, or expression of the Pub21 protein, conferring increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material.

[0011] In one embodiment, a tomato plant or plant material is modified to reduce the levels, activities, or expressions of the Pub21 and Pub17 proteins. Thus, in one embodiment, there is a tomato plant or plant material modified to reduce the level, activity, or expression of the Pub21 protein, conferring increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material, and further modified to reduce the level, activity, or expression of the Pub17 protein.

[0012] In one embodiment, a tomato plant or plant material comprises a modified Pub21 allele and optionally a modified Pub17 allele. In one embodiment, the plant or plant material comprises a Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or its ortholog or homolog, the Pub21 allele comprising a mutation, and optionally a Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or its ortholog or homolog, the Pub17 allele further comprising a mutation. In one embodiment, the modified Pub21 allele and optionally the Pub17 allele confer increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material. Thus, in one embodiment, there is provided a tomato plant or plant material comprising a Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or its ortholog or homolog, the Pub21 allele comprising a mutation that results in a decrease in the level, activity or expression of the Pub21 protein that confers increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material. In another embodiment, there is provided a tomato plant or plant material comprising a Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or its ortholog or homolog and a Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or its ortholog or homolog, wherein the Pub21 allele and the Pub17 allele each comprise a mutation that results in a decrease in the level, activity or expression of the Pub21 protein and the Pub17 protein, respectively, that confer increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material.

[0013] According to a second aspect of the invention, there is provided a method of increasing resistance to a lesion-forming pathogen in a tomato plant or plant material, the method comprising decreasing the level, activity or expression of a Pub21 protein in the tomato plant or plant material.

[0014] In one embodiment, the method according to the second aspect of the invention further comprises reducing the level, activity or expression of the Pub17 protein in the tomato plant or plant material.

[0015] In one embodiment, the method comprises modifying a tomato plant to reduce the level, activity or expression of the Pub21 protein in the tomato plant or plant material. In one embodiment, the method comprises modifying a tomato plant to reduce the level, activity or expression of the Pub21 protein and the Pub17 protein in the tomato plant or plant material. Thus, in one embodiment, there is a method of increasing the resistance of a tomato plant or plant material to a pathogen that forms lesions, the method comprising modifying a tomato plant to reduce the level, activity or expression of the Pub21 protein, and optionally, the Pub17 protein, in the tomato plant or plant material.

[0016] In one embodiment, the method comprises obtaining a mutant population of tomato plants and selecting tomato plants that contain a modified Pub21 allele. In one embodiment, the method comprises obtaining a mutant population of tomato plants and selecting tomato plants that contain a modified Pub21 allele and a modified Pub17 allele. In one embodiment, the method comprises selecting a tomato plant that contains a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, the sequence containing a mutation, and optionally, the plant further contains a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, the sequence containing a mutation.

[0017] Therefore, in one embodiment, there is a method of increasing resistance to a pathogen that forms lesions in a tomato plant or plant material, the method comprising obtaining a mutant population of tomato plants and selecting a plant comprising a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, the mutant comprising a mutation that results in a decrease in the level, activity or expression of the Pub21 protein. In another embodiment, there is a method of increasing resistance to a pathogen that forms lesions in a tomato plant or plant material, the method comprising obtaining a mutant population of tomato plants and selecting a plant comprising a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, the mutant comprising a mutation, and further comprising a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, the mutant comprising a mutation, wherein the Pub21 and Pub17 alleles each result in a decrease in the level, activity or expression of the Pub21 and Pub17 proteins.

[0018] In one embodiment, the increased resistance can be to a reference tomato plant or plant material.

[0019] According to a third aspect of the present invention, there is provided a method of producing a tomato plant having increased resistance to a pathogen that forms lesions, the method comprising decreasing the level, activity or expression of the Pub21 protein in a tomato plant or plant material.

[0020] In one embodiment according to the third aspect of the present invention, the method further comprises decreasing the level, activity or expression of the Pub17 protein in the tomato plant or plant material.

[0021] In one embodiment, the method comprises modifying a tomato plant to reduce the level, activity or expression of the Pub21 protein in the tomato plant or plant material, and optionally, the method further comprises modifying the tomato plant or plant material to reduce the level, activity or expression of the Pub17 protein in the tomato plant or plant material. Thus, in one embodiment, there is provided a method for producing a tomato plant having increased resistance to a pathogen that forms lesions, the method comprising modifying a plant to reduce the level, activity or expression of the Pub21 protein, and optionally, further comprising modifying the plant to reduce the level, activity or expression of the Pub17 protein in the tomato plant or plant material.

[0022] In one embodiment, the method comprises obtaining a mutant population of tomato plants and selecting a plant that contains a modified Pub21 allele and optionally further contains a modified Pub17 allele. In one embodiment, the method comprises selecting a tomato plant that contains a Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, the Pub21 allele containing a mutation, and optionally, the plant further contains a Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, the Pub17 allele containing a mutation.

[0023] Thus, in one embodiment, there is provided a method for producing a tomato plant having increased resistance to a pathogen that forms lesions, the method comprising obtaining a mutant population of tomato plants and selecting a modified tomato plant that contains a modified Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, the modified Pub21 allele containing a mutation that results in a reduction in the level, activity or expression of the Pub21 protein, and optionally, the plant further contains a modified Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, the modified Pub17 allele containing a mutation that results in a reduction in the level, activity or expression of the Pub17 protein.

[0024] In one embodiment, the increased resistance can be to a reference tomato plant or plant material.

[0025] According to a fourth aspect of the present invention, there is provided a method of enhancing the growth of a tomato plant by increasing the resistance of the tomato plant or plant material to a pathogen that forms lesions, the method comprising reducing the level, activity or expression of the Pub21 protein in the tomato plant or plant material.

[0026] In one embodiment of the fourth aspect of the present invention, the method further comprises reducing the level, activity or expression of the Pub17 protein in the tomato plant or plant material.

[0027] In one embodiment, the method comprises modifying a tomato plant to reduce the level, activity or expression of the Pub21 protein in the tomato plant or plant material. In one embodiment, the method comprises modifying a tomato plant to reduce the level, activity or expression of the Pub21 protein in the tomato plant or plant material and to reduce the level, activity or expression of the Pub17 protein in the tomato plant or plant material.

[0028] Thus, in one embodiment, there is a method of enhancing the growth of a tomato plant by increasing the resistance of the tomato plant or plant material to a pathogen that forms lesions, the method comprising modifying a tomato plant to reduce the level, activity or expression of the Pub21 protein, and optionally further comprising modifying the tomato plant to reduce the level, activity or expression of the Pub17 protein in the tomato plant or plant material.

[0029] In one embodiment, the method includes obtaining a mutant population of tomato plants and selecting a plant that contains a modified Pub21 allele. In one embodiment, the method includes obtaining a mutant population of tomato plants and selecting a plant that contains a modified Pub21 allele and a modified Pub17 allele. In one embodiment, the method includes selecting a tomato plant that contains a Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, the Pub21 allele containing a mutation, and optionally, the plant further contains a Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, the Pub17 allele containing a mutation. Thus, in one embodiment, there is a method for enhancing the growth of a tomato plant by increasing the resistance of the tomato plant or plant material to a pathogen that forms lesions, the method including obtaining a mutant population of tomato plants and selecting a modified plant that contains a modified Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, the modified Pub21 allele containing a mutation that results in a decrease in the level, activity, or expression of the Pub21 protein, and optionally, the plant further contains a modified Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, the modified Pub17 allele containing a mutation that results in a decrease in the level, activity, or expression of the Pub17 protein.

[0030] In one embodiment, the increased resistance can be obtained relative to a reference tomato plant or plant material.

[0031] According to a fifth aspect of the present invention, there is provided a method for identifying a tomato plant having increased resistance to a pathogen that forms lesions, relative to a reference tomato plant or plant material, the method comprising determining the level, activity, or expression of Pub21 protein in one or more tomato plants and comparing it to the level, activity, or expression of Pub21 protein in the reference tomato plant, and selecting a tomato plant having a decrease in the level, activity, or expression of Pub21 protein relative to the reference tomato plant, wherein a decrease in the level, activity, or expression of Pub21 protein means increased resistance to a pathogen that forms lesions, relative to the reference tomato plant.

[0032] In one embodiment of the fifth aspect of the present invention, a method for identifying a tomato plant having increased resistance to a pathogen that forms lesions, relative to a reference tomato plant or plant material, further comprises determining the level, activity, or expression of Pub17 protein in one or more tomato plants and comparing it to the level, activity, or expression of Pub17 protein in the reference tomato plant, and selecting a tomato plant having a decrease in the level, activity, or expression of Pub17 protein relative to the reference tomato plant, wherein a decrease in the level, activity, or expression of Pub17 protein means increased resistance to a pathogen that forms lesions, relative to the reference tomato plant.

[0033] In one embodiment, the method includes obtaining a mutant population of tomato plants. In one embodiment, a method for identifying a tomato plant having increased resistance to a pathogen that forms lesions, relative to a reference tomato plant or plant material, the method comprising obtaining a mutant population of tomato plants; determining the level, activity, or expression level of the Pub21 protein in one or more tomato plants of a population of tomato plants and comparing this to the level, activity, or expression of the Pub21 protein in the reference tomato plant; and selecting a plant having a decrease in the level, activity, or expression of the Pub21 protein relative to the reference tomato plant, wherein a decrease in the level, activity, or expression of the Pub21 protein means increased resistance to a pathogen that forms lesions, relative to the reference tomato plant.

[0034] In another embodiment, a method for identifying a tomato plant having increased resistance to a pathogen that forms lesions, relative to a reference tomato plant or plant material, the method comprising obtaining a mutant population of tomato plants; determining the level, activity, or expression level of the Pub21 protein and the Pub17 protein in one or more tomato plants of a population of tomato plants and comparing this to the level, activity, or expression of the Pub21 protein and the Pub17 protein in the reference tomato plant; and selecting a plant having a decrease in the level, activity, or expression of the Pub21 protein and the Pub17 protein relative to the reference tomato plant, wherein a decrease in the level, activity, or expression of the Pub21 protein and the Pub17 protein means increased resistance to a pathogen that forms lesions, relative to the reference tomato plant.

[0035] In one embodiment, the method includes obtaining a mutant population of tomato plants and screening tomato plants that contain a modified Pub21 allele and optionally a modified Pub17 allele. In one embodiment, the method includes screening tomato plants that contain a Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, including a mutation, and optionally, the plant contains a Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, including a mutation. Thus, in one embodiment, there is a method for identifying a tomato plant having increased resistance to a pathogen that forms lesions relative to a reference tomato plant or plant material, the method comprising obtaining a mutant population of tomato plants and screening the population of tomato plants for the presence of a Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, including a mutation that results in a decrease in the level, activity or expression of the Pub21 protein, and selecting the tomato plants having the Pub21 allele. Accordingly, in another embodiment, there is a method for identifying a tomato plant having increased resistance to a pathogen that forms lesions relative to a reference tomato plant or plant material, the method comprising obtaining a mutant population of tomato plants and screening the population of tomato plants for the presence of a Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof, including a mutation that results in a decrease in the level, activity or expression of the Pub21 protein, and a Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof, including a mutation that results in a decrease in the level, activity or expression of the Pub17 protein, and selecting the tomato plants having the Pub21 allele and the Pub17 allele.

[0036] According to a sixth aspect of the present invention, there is provided a plant part obtained from the tomato plant of the first aspect.

[0037] In one embodiment, the plant part is a fruit. In one embodiment, the plant part comprises a modified Pub21 allele and optionally a modified Pub17 allele. In one embodiment, the plant part comprises a Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or its ortholog or homolog, including a mutation, and optionally further comprises a Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or its ortholog or homolog, including a mutation.

[0038] According to a seventh aspect of the present invention, there is provided a seed capable of producing the tomato plant of the first aspect.

[0039] In one embodiment, the seed comprises a modified Pub21 allele. In one embodiment, the seed comprises a modified Pub21 allele and a modified Pub17 allele. In one embodiment, the seed comprises a Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or its ortholog or homolog, including a mutation, and optionally further comprises a Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or its ortholog or homolog, including a mutation.

[0040] According to an eighth aspect of the present invention, there is provided an isolated polynucleotide sequence having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or its ortholog or homolog, the polynucleotide sequence including a mutation at position 890 of SEQ ID NO: 1 or a corresponding position.

[0041] In one embodiment, the isolated polynucleotide comprises or consists of a sequence according to SEQ ID NO: 2.

[0042] In one embodiment, the isolated polynucleotide sequence is capable of conferring increased resistance to a pathogen that forms lesions. Preferably, when expressed in a plant or plant material, it is capable of conferring increased resistance to a pathogen that forms lesions.

[0043] According to a ninth aspect of the present invention, there is provided an isolated polypeptide sequence encoded by the polynucleotide sequence of the eighth aspect.

[0044] In one embodiment, the isolated polypeptide sequence consists of the amino acid sequence according to SEQ ID NO: 4 (truncated Pub21 protein sequence) or a portion thereof, or an amino acid sequence having at least 70% identity thereto.

[0045] In one embodiment, the isolated polypeptide sequence is capable of conferring increased resistance to a pathogen that forms lesions. Preferably, when present in a plant or plant material, it is capable of conferring increased resistance to a pathogen that forms lesions.

[0046] According to a tenth aspect of the present invention, there is provided a vector or expression construct comprising the polynucleotide sequence of the eighth aspect.

[0047] In one embodiment, the vector or expression construct may further comprise a polynucleotide sequence encoding a modified Pub17 allele. In one embodiment, the polynucleotide sequence encoding the modified Pub17 allele has at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or its ortholog or homolog, wherein the sequence comprises a mutation at position 1477 of SEQ ID NO: 39 or a corresponding position.

[0048] According to an eleventh aspect of the present invention, there is provided a host cell comprising the polynucleotide sequence according to the eighth aspect, the vector according to the tenth aspect, or the polypeptide according to the ninth aspect.

[0049] In one embodiment, the host cell may further comprise a polynucleotide sequence encoding a modified Pub17 allele, or a vector encoding a modified Pub17 allele. In one embodiment, the polynucleotide sequence encoding the modified Pub17 allele has at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or its ortholog or homolog, wherein the sequence comprises a mutation at position 1477 of SEQ ID NO: 39 or a corresponding position.

[0050] According to a twelfth aspect of the present invention, there is provided a method of producing hybrid seeds, the method comprising crossing a first tomato plant of the first aspect with a second tomato plant and then obtaining seeds.

[0051] According to a thirteenth aspect of the present invention, there is provided a kit for detecting a Pub21 allele conferring resistance to a pathogen that forms lesions in a tomato plant, the kit comprising a pair of PCR oligonucleotide primers, wherein the primer pair comprises a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12; or a forward primer of SEQ ID NO: 36, a first reverse primer of SEQ ID NO: 38, and a second reverse primer of SEQ ID NO: 37.

[0052] In one embodiment, the kit is for use in gene-specific PCR and comprises a forward primer of SEQ ID NO: 11 and a reverse primer of SEQ ID NO: 12.

[0053] In one embodiment, the kit is for use in allele-specific PCR and comprises a forward primer of SEQ ID NO: 36, a first reverse primer of SEQ ID NO: 38, and a second reverse primer of SEQ ID NO: 37.

[0054] In one embodiment of the 13th aspect, a kit for detecting the Pub17 allele for pathogen resistance that forms lesions in tomato plants is further provided, the kit comprising a pair of PCR oligonucleotide primers including the forward primer of SEQ ID NO: 42 and the reverse primer of SEQ ID NO: 41; or the first forward primer of SEQ ID NO: 44, the second forward primer of SEQ ID NO: 43, and the reverse primer of SEQ ID NO: 45.

[0055] In one embodiment, the kit is for use in gene-specific PCR and includes the forward primer of SEQ ID NO: 42 and the reverse primer of SEQ ID NO: 41.

[0056] In one embodiment, the kit is for use in allele-specific PCR and includes the first forward primer of SEQ ID NO: 44, the second forward primer of SEQ ID NO: 43, and the reverse primer of SEQ ID NO: 45.

[0057] In the present invention, instead of using classical R genes or introgressing several (minor) effect QTLs, the principle of the mutant S gene is used to achieve resistance to pathogens that form lesions.

[0058] The inventors have further discovered that Solanaceae plants having a dysfunctional mutant allele of the S gene, Pub21, particularly increase pathogen resistance to pathogens that form lesions. These examples show that Solanaceae plants that are homozygous for this mutant Pub21 allele are significantly less susceptible to necrotrophic pathogens including Botrytis and Alternaria. The inventors have shown that this is the case under several different genetic backgrounds.

[0059] Furthermore, the inventor has identified a novel S gene, Pub17, which was not previously known to be a susceptibility gene in Solanaceae species. The inventor has further discovered that Solanaceae plants having dysfunctional mutant alleles of both the S genes, Pub21 and Pub17, exhibit an even further increased pathogen tolerance, particularly to pathogens that form lesions. Advantageously, the combination of the dysfunctional mutant alleles of the S genes, Pub21 and Pub17, has a synergistic effect in increasing pathogen tolerance.

[0060] Advantageously, the Pub21 allele and optionally the Pub17 allele can be used in crop breeding to obtain a population of Solanaceae plants that are less prone to being severely affected by necrotrophic pathogens than existing varieties.

[0061] Accordingly, the present invention provides an alternative to the problem of controlling pathogens that form lesions in Solanaceae crops, which is much simpler than using QTLs or R genes. Assuming that the Solanaceae family of plants is one of the largest families of cultivated plants, including not only tomatoes but also potatoes and peppers, such resistant plants of the present invention are economically important. Using the present invention, the damage caused by these pathogens can be limited and the crop yield in the Solanaceae family can be increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0062]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

[0063] Here, further features and embodiments of the present invention are described under the heading section. Any feature in any section may be combined in any executable combination with any of the above aspects or embodiments of the present invention.

[0064] **Definitions** Technical terms and expressions used within the scope of this application should generally be given the meanings commonly applied to them in the related technologies of plant breeding and cultivation, unless specifically indicated otherwise herein.

[0065] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes one or more plants, and reference to "a cell" includes a mixture of cells, tissues, and the like.

[0066] As used herein, the term "about," when referring to a value, or to an amount of mass, weight, time, volume, concentration or proportion, means a variation of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from a particular amount (such variation amounts being appropriate in the context of the present invention).

[0067] A "cultivated" plant is understood within the scope of the present invention to refer to a plant that has been developed and cultivated by human intervention for agricultural use and / or for human consumption and is no longer in its natural state, excluding wild strains. By way of example, in embodiments, a "cultivated plant" is a hybrid plant.

[0068] "Allele" is understood within the scope of the present invention to refer to alternative or variant forms of various genetic units associated with the same or different forms of a gene, which are alternative in genetic traits because they are located at the same locus on homologous chromosomes. Such alternative or variant forms can be the result of single nucleotide polymorphisms, insertions, inversions, translocations or deletions, or can be the result of gene regulation caused, for example, by chemical or structural modifications, transcriptional regulation or post-translational modification / regulation. In a diploid cell or organism, the two alleles of a given gene or genetic element typically occupy corresponding loci on a pair of homologous chromosomes.

[0069] The term "trait" refers to a characteristic or phenotype. In the context of the present invention, the nematode resistance trait is an improved nematode resistance trait. Traits can be inherited in dominant or recessive form or in partial or incomplete dominant form. Traits can be monogenic or polygenic, or can result from the interaction of one or more genes with the environment. A plant can be homozygous or heterozygous for a trait.

[0070] The terms "hybrid", "hybrid plant", and "hybrid progeny" refer to an individual produced from genetically different parents (e.g., an individual that is genetically heterozygous or nearly heterozygous).

[0071] The term "inbred line" refers to a population that is genetically homozygous or nearly homozygous. An inbred line can be obtained, for example, through several cycles of brother / sister breeding or selfing or in the production of dihaploid plants.

[0072] The term "dihaploid line" refers to a stable inbred line derived from another culture. Some pollen grains (haploids) cultivated in a specific medium and environment can develop embryos containing n chromosomes. These embryos are then "doubled" to contain 2n chromosomes. The progeny of these embryos are called "dihaploids" and are essentially no longer segregating (stable).

[0073] The term "cultivar" or "variety" refers to a derived variety for horticulture, distinct from natural varieties. In certain embodiments of the present invention, the cultivar or variety is commercially available.

[0074] The term "rootstock" refers to a plant used as the receiving part for grafting. Typically, the rootstock plant and the scion have different genotypes. In an embodiment, the plant according to the present invention is used as a rootstock plant.

[0075] The term "genetically fixed" refers to a genetic element stably integrated into the genome of a plant that normally does not contain that genetic element. When genetically fixed, the genetic element can be transmitted to other plants in an easy and predictable manner by sexual crossbreeding.

[0076] A "plant cell" is the structural and physiological unit of a plant that includes a protoplast and a cell wall. A plant cell can be in the form of an isolated single cell or a cultured cell, or can be part of a highly organized unit such as a plant tissue, a plant organ, or a whole plant.

[0077] "Plant cell culture" means a culture of plant units such as, for example, protoplasts, cultured cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various developmental stages.

[0078] "Plant organ" is a differentiated part of a plant that is distinct and visually structured, such as a root, stem, leaf, flower bud or embryo.

[0079] As used herein, "plant tissue" means a group of plant cells organized into structural and functional units. Any plant tissue in a plant or in culture is included. This term includes, but is not limited to, an entire plant, a plant organ, a plant seed, a tissue culture, and any group of plant cells organized into structural and / or functional units. The use of this term, with or without any specific type of plant tissue listed above or encompassed by this definition, is not intended to exclude any other type of plant tissue.

[0080] As used herein, the term "breeding" and its grammatical variations refer to any process of generating individuals of progeny. Breeding can be sexual or asexual or any combination thereof. Exemplary non-limiting types of breeding include crossing, selfing, derivation of doubled haploids, and combinations thereof.

[0081] As used herein, the phrase "established breeding population" refers to a collection of potential breeding partners that are generated by and / or used as parents in a breeding program, such as a commercial breeding program. Members of an established breeding population are typically well characterized genetically and / or phenotypically. For example, several phenotypic traits of interest can be evaluated, for example, under different environmental conditions, at multiple locations and / or at different times. Alternatively or in addition, one or more loci associated with the expression of a phenotypic trait can be identified, and one or more members of the breeding population can be genotyped with respect to one or more loci and one or more genetic markers associated with one or more loci.

[0082] As used herein, the term "diploid individual" refers to an individual having two sets of chromosomes, typically one from each of its two parents. However, in certain embodiments, it is understood that a diploid individual can inherit the sets of "mother" and "father" chromosomes from the same single organism, for example, when a plant self-fertilizes to produce the next generation of the plant.

[0083] "Homozygosity" is understood within the scope of the present invention to refer to similar alleles at one or more corresponding loci on homologous chromosomes.

[0084] "Heterozygosity" is understood within the scope of the present invention to refer to different alleles at one or more corresponding loci on homologous chromosomes.

[0085] A "dominant" allele is understood within the scope of the present invention to refer to an allele that determines the phenotype when present in a heterozygous or homozygous state.

[0086] A "recessive" allele refers to an allele that determines the phenotype only when present in a homozygous state.

[0087] "Locus" is understood within the scope of the present invention to refer to a region on a chromosome that contains a gene or any other genetic element or factor contributing to a trait.

[0088] As used herein, a "marker locus" refers to a region on a chromosome that is present in an individual's genome and contains a nucleotide or polynucleotide sequence associated with one or more target loci, which may include any other genetic determinant or factor contributing to a gene or trait. A "marker locus" also refers to a region on a chromosome that contains a polynucleotide sequence complementary to a genomic sequence such as the sequence of a nucleic acid used as a probe.

[0089] As used herein, the terms "sexual cross" and "sexual reproduction" as related to the subject matter of the present disclosure refer to the production of progeny by the fusion of gametes (e.g., by fertilization such as the production of seeds by pollination in plants). "Sexual cross" or "cross-fertilization" is, in certain embodiments, the fertilization of one individual by another (e.g., cross-pollination in plants). The term "selfing" refers, in certain embodiments, to the production of seeds by self-fertilization or self-pollination, i.e., where the pollen and ovules are from the same plant.

[0090] As used herein, the term "genetic marker" refers to a characteristic of an individual's genome (e.g., a nucleotide or polynucleotide sequence present in the individual's genome) associated with one or more loci of interest. In certain embodiments, a genetic marker is, depending on the context, a polymorphism in the population of interest or a locus occupied by a polymorphism. Examples of genetic markers include, among many others, single nucleotide polymorphisms (SNPs), indels (i.e., insertions / deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPD), cleaved amplified polymorphic sequences (CAPS) markers, diversity array technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs). Genetic markers can be used, for example, to identify the location of loci containing alleles on a chromosome that contribute to the variability of a phenotypic trait. The term "genetic marker" can also refer to a polynucleotide sequence complementary to a genomic sequence such as the sequence of a nucleic acid used as a probe.

[0091] A "gene marker" can be physically located at a position on a chromosome that is within or outside of the locus to which it is related (i.e., within or outside of a gene, respectively). In other words, gene markers are typically used when the position on a chromosome corresponding to the gene or functional variation, e.g., within a regulatory element outside of the gene, that corresponds to the target locus has not been identified and there is a recombination rate other than zero between the gene marker and the target locus. However, the subject matter of the present disclosure can also use gene markers that are physically within the boundaries of the locus (e.g., within a genomic sequence corresponding to a gene such as a polymorphism within an intron or exon of a gene, without limitation). In certain embodiments of the subject matter of the present disclosure, one or more gene markers include from 1 to 10 markers, and in certain embodiments, one or more gene markers include more than 10 gene markers.

[0092] As used herein, the term "genotype" refers to the genetic constitution of a cell or organism. The "genotype of an individual with respect to a set of gene markers" includes the specific alleles with respect to one or more gene marker loci present in the individual's haplotype. As is known in the art, a genotype can relate to a single locus or multiple loci, whether or not the loci are related and / or linked. In certain embodiments, an individual's genotype relates to one or more genes such that one or more of the genes are involved in the expression of a target phenotype (e.g., a quantitative trait as defined herein). Thus, in certain embodiments, a genotype includes a profile of one or more alleles present in an individual at one or more loci of a quantitative trait. In certain embodiments, a genotype is expressed with respect to a haplotype (defined below herein).

[0093] As used herein, the term "genetic resource" refers to the entire genotype of a population or other group of individuals (e.g., a species). The term "genetic resource" can also refer to plant material, e.g., a group of plants that function as a repository of various alleles. The phrase "adapted genetic resource" refers to, for example, plant material that has demonstrated genetic superiority for a given environmental or geographical area, while the phrases "non-adapted genetic resource", "original genetic resource" and "exotic genetic resource" refer to, for example, plant material for which the genetic value is unknown or unproven for a given environmental or geographical area, and thus, the phrase "non-adapted genetic resource" refers, in certain embodiments, to plant material that is not part of an established breeding population and has no known relationship to the members of an established breeding population.

[0094] As used herein, the phrase "nucleic acid" refers to any physical strand of monomeric units corresponding to a chain of nucleotides, including polymers of nucleotides (e.g., typical DNA, cDNA or RNA polymers), modified oligonucleotides (e.g., oligonucleotides containing bases not typical of biological RNA or DNA, such as 2'-O-methylated oligonucleotides), etc. In certain embodiments, the nucleic acid can be single-stranded, double-stranded, multi-stranded or combinations thereof. Unless otherwise indicated, a particular nucleic acid sequence of the subject matter of the present disclosure optionally includes or encodes a complementary sequence in addition to any sequence explicitly shown.

[0095] As used herein, the term "plurality" refers to two or more. Thus, "a plurality of individuals" refers to at least two individuals. In certain embodiments, the term plurality refers to more than half of the whole. For example, in certain embodiments, "a plurality of populations" refers to more than half of the members of that population.

[0096] As used herein, the term "progeny" refers to the progeny of a particular cross. Typically, progeny result from the breeding of two individuals, although some species (especially some plants and hermaphroditic animals) are capable of self-fertilization (i.e., the same plant serves as the donor of both male and female gametes). Progeny can be, for example, F1, F2, or of any subsequent generation.

[0097] The term "recipient plant" is used herein to denote a plant that is to receive DNA obtained from a donor plant that contains a modified allele conferring improved resistance to a pathogen that forms lesions.

[0098] "Donor plant" is understood to mean, within the scope of the present invention, a plant that confers a modified allele associated with improved resistance to a pathogen that forms lesions. As used herein, the phrase "qualitative trait" refers to a phenotypic trait that is controlled by one or several genes that exhibit a major phenotypic effect. For this reason, qualitative traits typically segregate simply.

[0099] "Selection by marker" is understood to refer, within the scope of the present invention, to the use of genetic markers that detect, for example, one or more nucleic acids from a plant, such that the nucleic acids are associated with a desired (or undesired) trait so that plants having the gene for the desired (or undesired) trait can be identified and those plants can be used (or avoided) in a selective breeding program.

[0100] A "single nucleotide polymorphism (SNP)" is a DNA sequence variation that occurs when a single nucleotide (A, T, C, or G) in the genome (or other shared sequence) differs between members of a biological species or between paired chromosomes of an individual. For example, two sequenced DNA fragments from different individuals, AAGCCTA and AAGCTTA, contain a single nucleotide difference. In this case, there are two alleles: C and T. The basic principle of SNP arrays is the same as that of DNA microarrays. These are a collection of DNA hybridization, fluorescence microscopy, and DNA capture. The three components of an SNP array are an array containing nucleic acid sequences (i.e., amplified sequences or targets), one or more labeled allele-specific oligonucleotide probes, and a detection system that records and interprets the hybridization signals.

[0101] "PCR (polymerase chain reaction)" is understood within the scope of the present invention to refer to a method that generates a relatively large amount of a specific region or subset of genomic DNA, thereby enabling various analyses based on those regions.

[0102] "PCR primer" is understood within the scope of the present invention to refer to a relatively short fragment of single-stranded DNA that is used in the PCR amplification of a specific region of DNA.

[0103] "Phenotype" is understood within the scope of the present invention to refer to distinguishable characteristics of genetically controlled traits.

[0104] As used herein, the phrase "phenotypic trait" refers to the appearance or other detectable characteristics of an individual that result from the interaction of its genome, proteome, and / or metabolome with the environment.

[0105] "Polymorphism" is understood within the scope of the present invention to refer to the presence of two or more different forms of a gene, gene marker, or inherited trait, or a population of gene products that can be obtained, for example, by alternative splicing, DNA methylation, etc.

[0106] "Selective breeding" is understood within the scope of the present invention to refer to a breeding plan that uses plants having or exhibiting desirable traits as parents.

[0107] "Test" plants are understood within the scope of the present invention to refer to plants used to genetically characterize traits in the plants being tested. Typically, the plants being tested are crossed with "test" plants, and the segregation ratios of traits in the progeny of the cross are scored.

[0108] As used herein, a "probe" refers to a group of atoms or molecules that can recognize and bind to a specific target molecule or cellular structure, and thus enable the detection of the target molecule or structure. In particular, a "probe" refers to a labeled DNA or RNA sequence that can be used to detect and quantify the presence of complementary sequences by molecular hybridization.

[0109] As used herein, the term "hybridizes" refers to conventional hybridization conditions, preferably 5×SSPE, 1% SDS, 1×Denhardt's solution used as a solution, and / or hybridization temperature of 35°C to 70°C, preferably 65°C. After hybridization, preferably, first 2×SSC, 1% SDS is used, followed by 0.2×SSC, and washing is performed at a temperature of 35°C to 75°C, particularly 45°C to 65°C, but particularly 59°C (see the cited references of Sambrook et al. for the definitions of SSPE, SSC, and Denhardt's solution). For example, the high stringency hybridization conditions described in Sambrook et al. (supra) are particularly preferred. Particularly preferred stringent hybridization conditions exist, for example, when hybridization and washing are performed at 65°C as shown above. For example, non-stringent hybridization conditions using hybridization and washing performed at 45°C are less preferred, and those performed at 35°C are even less preferred.

[0110] According to the present invention, the term "position corresponding to position X" (where X is any number found in each context in the present application) includes not only each position in the sequence numbers described below, but also any sequence corresponding to the Pub21 allele and optionally the Pub17 allele, or encoding the Pub21 protein and optionally the Pub17 protein, where, after alignment with the reference sequence number, each position may have a different number, but corresponds to that shown for the reference sequence number. Alignment of the Pub21 allele sequence or Pub21 protein sequence, and optionally the Pub17 allele sequence or Pub17 protein sequence, can be performed by applying various alignment tools in a practical manner, for example, by applying the tools described below.

[0111] "Sequence identity". The terms "identical" or "identity" with respect to two or more nucleic acid or protein sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of the same amino acid residues or nucleotides when compared and aligned for maximum correspondence when measured using one of the following sequence comparison algorithms or by visual inspection. When the lengths of the two sequences being compared are different, sequence identity preferably relates to the percentage of nucleotide residues of the shorter sequence that are identical to the nucleotide residues of the longer sequence. As used herein, the percent identity / homology between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap (i.e., % identity = number of identical positions / total number of positions × 100). Comparison of sequences and determination of the percent identity between two sequences can be performed using a mathematical algorithm as described hereinafter in this specification. For example, sequence identity can be determined, as is conventional, using a computer program such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, WI 53711). Bestfit utilizes the Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489 locus homology algorithm to find the segment with the highest sequence identity between two sequences. When using Bestfit or another sequence alignment program to determine whether a particular sequence has, for example, 95% identity with a reference sequence of the present invention, the parameters are preferably adjusted such that the percentage of identity is calculated over the entire length of the reference sequence and such that homology gaps of up to 5% of the total number of nucleotides in the reference sequence are allowed. When using Bestfit, the so-called default parameters are preferably left at their preset ("initial") values.Deviations seen in the comparison between a given sequence and the above-described sequences of the present invention can be caused, for example, by addition, deletion, substitution, insertion or recombination. Such sequence comparison can preferably also be performed using the program "fasta20u66" (version 2.0u66 by William R. Pearson and the University of Virginia, September 1998; see also W. R. Pearson (1990), Methods in Enzymology 183, 63-98, the attached examples and http: / / workbench.sdsc.edu / ). For this purpose, "initial" parameter settings can be used.

[0112] Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "specifically hybridize" means that when a particular nucleotide sequence is present in a complex mixture (e.g., of the whole cell) DNA or RNA, the molecule binds, forms a duplex or hybridizes only to that sequence under stringent conditions. "Substantially bind" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and includes small mismatches that can be accommodated by reducing the stringency of the hybridization medium to achieve the desired detection of the target nucleic acid sequence.

[0113] "Stringent hybridization conditions" and "stringent hybridization wash conditions" for nucleic acid hybridization experiments such as Southern and Northern hybridization are sequence-dependent and vary under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. General guidelines for nucleic acid hybridization can be found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays" Elsevier, New York. Generally, highly stringent hybridization and wash conditions are selected to be about 5°C below the thermal melting point for a particular sequence at a defined ionic strength and pH. Typically, under "stringent conditions", the probe hybridizes to its target subsequence but not to other sequences.

[0114] The "thermal melting point" is the temperature at which (at a defined ionic strength and pH) 50% of the target sequence hybridizes to a perfectly matching probe. Very stringent conditions are the melting temperature (T m) is selected to be equal to. Examples of stringent hybridization conditions for hybridization of complementary nucleic acids having more than 100 complementary residues on a filter in a Southern or Northern blot are 50% formamide containing 1 mg of heparin at 42°C, and the hybridization is carried out overnight. An example of highly stringent washing conditions is 0.15 M NaCl at 72°C for about 15 minutes. An example of stringent washing conditions is washing with 0.2× SSC at 65°C for 15 minutes (see Sambrook (below) for an explanation of the SSC buffer). Often, a low stringency wash is performed to remove background probe signal before high stringency washing. For example, an example of moderately stringent washing for a double-strand of more than 100 nucleotides is 1× SSC at 45°C for 15 minutes. For example, an example of low stringency washing for a double-strand of more than 100 nucleotides is 4 - 6× SSC at 40°C for 15 minutes. For short probes (e.g., about 10 - 50 nucleotides), stringent conditions typically include a salt concentration of less than about 1.0 M Na ions at pH 7.0 - 8.3, typically about 0.01 - 1.0 M Na ion concentration (or other salts), and the temperature is typically at least about 30°C. Stringent conditions can also be achieved by the addition of destabilizing agents such as formamide. Generally, a signal-to-noise ratio of 2-fold (or more) of that observed for an irrelevant probe in a particular hybridization assay indicates detection of a particular hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins they encode are substantially identical. This occurs, for example, when copies of the nucleic acid are formed using the maximum codon degeneracy allowed by the genetic code.

[0115] As used herein, "homolog" refers to a functional equivalent, i.e., a protein that has the same activity as a Pub21 protein or a Pub17 protein having an amino acid sequence as defined herein, but may have a limited number of amino acid substitutions, deletions, insertions or additions within the amino acid sequence. A homolog may have a lower sequence identity, e.g., at least 20%, at least 25%, at least 30%, at least 35% or at least 40% or more sequence identity, with the Pub21 protein or Pub17 protein identified herein, but has the ability to perform the same function.

[0116] As used herein, "ortholog" is a homolog and thus a functional equivalent, but is found in a different species, i.e., it refers to a protein that has the same activity as a Pub21 protein or a Pub17 protein as defined herein, but is present in a different species of plant.

[0117] Tomato plant "Plant", as used herein, is any plant at any stage of development. Preferably, in most embodiments of the present invention, the plant is a tomato plant. Preferably, in most embodiments of the present invention, the plant is any of the following tomato species: Solanum lycopersicum, Solanum habrochaites, Solanum pimpinellifolium, Solanum pennellii, Solanum arcanum, Solanum cheesmaniae, Solanum chilense, Solanum chmielewskii, Solanum corneliomulleri, Solanum galapagense, Solanum neorickii or Solanum peruvianum. Preferably, in most embodiments of the present invention, the plant is a Solanum lycopersicum plant.

[0118] Suitably, the plant may be any variety or cultivar of Solanum lycopersicum, such as, for example, Alicante, Adoration, Azoychka, Beefsteak, Better Boy, Black Krim, Brandywine, Campari, Celebrity, Cherokee, Early Girl, Fourth of July, Garden Peach, Gardeners Delight, Germa Johnson, Guilette F1, Granadero, Great White, Green Zebra, Hanover, Hillbilly, Japanese Black Trifele, Jersey Boy, Jubilee, Juliet, Lillians Yellow, Matt’s Wild Cherry, Micro-Tom, Moneymaker, Monterosa, Montserrat, Mortgage Lifter, Mr. Stripey, Pantano Romanesco, Plum, Raf, Rebellion, Currant, Roma, Rutgers, San Marzano, Santorini, Supersweet, Tomaccio, Yellow Pear, Zebra, etc.Suitably, the plant may be a cultivated species of Solanum lycopersicum.

[0119] However, in some embodiments, the plant may be any Solanaceae plant. Suitably, the plant may be selected from any Solanaceae plant such as tomato, tobacco, pepper, potato, or eggplant. Suitably, the plant may be selected from any Solanaceae genus of plants such as Lycianthes, Cestrum, Nolana, Physalis, Lycium, Solanum, Brunfelsia, and Nicotiana. Suitably, the plant may be selected from any Solanaceae species of plants such as Solanum tuberosum, Solanum lycopersicum, Capsicum annuum, Capsicum sp., Capsicum frutescens, Solanum melongena, Physalis peruviana, Physalis pruinosa, Physalis philadelphica, Nicotiana rustica, and Nicotiana tabacum.

[0120] Suitably, any reference to a tomato plant, its parts or materials, when used herein, can be replaced by another Solanaceae plant, its parts or materials.

[0121] In one embodiment, the plant is a crop, or an economically and / or agriculturally valuable plant. In one embodiment, the plant is a Solanaceae crop.

[0122] In some embodiments, the plant is a self-propagating, digenomic haploid or hybrid plant.

[0123] Plant part or material The terms "plant" or "plant part" or "plant material" hereinafter refer to plant parts, organs or tissues obtainable from a tomato plant according to the invention, including but not limited to leaves, stems, roots, flowers or flower parts, fruits, shoots, gametophytes, sporophytes, pollen, anthers, microspores, egg cells, zygotes, embryos, meristematic sites, callus tissue, seeds, cuttings, cells or tissue cultures. Preferably, any reference to "plant" herein also encompasses plant parts or materials.

[0124] Preferably, the plant part or material may be any plant part, organ or tissue obtainable from a cultivated tomato plant, preferably a cultivated tomato plant, preferably a Solanum lycopersicum plant of the cultivated variety of the present invention.

[0125] Preferably, the tomato plant part or material further exhibits improved resistance to a pathogen that forms lesions, as compared to a reference tomato plant part or material. In some embodiments, this resistance may only exist when the part or material is grown into a tomato plant. Therefore, preferably, the tomato plant part or material shows a decrease in the level, activity or expression of the Pub21 protein, and optionally a decrease in the level, activity or expression of the Pub17 protein, as compared to the reference tomato plant part or material. Preferably, the tomato plant part contains a modified Pub21 allele, preferably has the ability to express the modified Pub21 allele, and optionally the tomato plant part further contains a modified Pub17 allele, preferably has the ability to express the modified Pub17 allele.

[0126] Suitably, the term plant material may include propagation material obtainable from the tomato plants according to the invention. Suitable propagation material may be cuttings, roots, fruits, tubers, bulbs, rhizomes, meristems, etc. Suitably, the propagation material further exhibits improved resistance compared to a reference propagation material against pathogens that form lesions. Therefore, suitably, the propagation material exhibits a decrease in the level, activity or expression of the Pub21 protein, and optionally further exhibits a decrease in the level, activity or expression of the Pub17 protein, compared to the reference propagation material. Suitably, the propagation material contains a modified Pub21 allele and optionally a modified Pub17 allele, and suitably has the ability to express the modified Pub21 allele, and optionally, suitably, has the ability to express the modified Pub17 allele. Suitably, the propagation material can be propagated to a tomato plant, suitably a tomato plant having improved resistance compared to a reference tomato plant against pathogens that form lesions. Suitably, it is a tomato plant having a decrease in the level, activity or expression of the Pub21 protein, and optionally further having a decrease in the level, activity or expression of the Pub17 protein, compared to the reference tomato plant. Suitably, it contains a modified Pub21 allele, optionally further contains a modified Pub17 allele, and is a tomato plant having the ability to express the modified Pub21 allele and optionally the modified Pub17 allele. "Propagation" refers to the process of growing a plant from a plant part or material (e.g., a plant protoplast or explant). Such regeneration techniques rely on the manipulation of specific plant hormones in a tissue culture growth medium. The choice of methodology for the propagation step is not decisive. See, for example, Ammirato et al., Handbook of Plant Cell Culture - Crop Species. Macmillan Publ. Co. (1984).

[0127] The invention also extends to fruits. In a further aspect of the invention, fruits produced by the tomato plants according to the invention are provided.

[0128] Suitably, the fruit is a tomato fruit. Suitably, the fruit can be obtained from a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant of the present invention. Suitably, the tomato fruit further exhibits improved resistance to a pathogen that forms lesions as compared to a reference tomato fruit. Suitably, the tomato fruit exhibits a decrease in the level, activity or expression of the Pub21 protein and optionally further includes a decrease in the level, activity or expression of the Pub17 protein as compared to a reference tomato fruit. Suitably, the tomato fruit contains a modified Pub21 allele and is suitably capable of expressing the modified Pub21 allele. Optionally, the tomato fruit further contains a modified Pub17 allele and is suitably capable of expressing the modified Pub17 allele.

[0129] The present invention also extends to one or more seeds. In a further aspect of the present invention, tomato seeds produced by a tomato plant according to the present invention are provided.

[0130] "Plant seed" as used herein is a seed that grows into a plant, preferably a tomato plant according to the present invention. The term "seed" encompasses seeds and vegetative propagules of all kinds, including but not limited to true seeds, seed pieces, underground stolons, bulbs, corms, fruits, tubers, kernels, cuttings, and harvested mulberry.

[0131] Suitably, the seed is capable of producing a tomato plant that exhibits improved resistance to a pathogen that forms lesions as compared to a reference tomato plant. Suitably, the seed exhibits a decrease in the level, activity or expression of the Pub21 protein and optionally a decrease in the level, activity or expression of the Pub17 protein as compared to a reference tomato seed. Suitably, the seed contains a modified Pub21 allele and can be grown into a tomato plant that suitably expresses the modified Pub21 allele. Suitably, the seed contains a modified Pub21 allele and a Pub17 allele and can be grown into a tomato plant that suitably expresses the modified Pub21 allele and the Pub17 allele.

[0132] In one embodiment, the seed is a tomato seed that produces a tomato plant according to the present invention. Preferably, the tomato seed can be obtained from a cultivated tomato plant, more preferably a cultivated Solanum lycopersicum plant of the present invention. Preferably, the tomato seed contains a modified Pub21 allele and optionally further contains a modified Pub17 allele, and preferably grows into a tomato plant that expresses the modified Pub21 allele and optionally further expresses the modified Pub17 allele.

[0133] The seed may be a treated seed or an untreated seed. For example, the seed can be treated to improve germination, for example, by priming the seed or by sterilization to protect against seed-borne pathogens. In another example, the seed can be coated with any available coating agent to improve, for example, plantability, seed emergence, and protection against seed-borne pathogens. The seed coating can be in any form of seed coating, which can be any form including, but not limited to, pelleting, film coating, and encrustment.

[0134] Method for reducing the level, activity or expression of the Pub21 protein Preferably, the level, activity or expression of the Pub21 protein, and optionally the level, activity or expression of the Pub17 protein, can be reduced in the tomato plants of the present invention by any means. However, preferably, it is not reduced by an essentially biological process.

[0135] Suitably, the term "reducing the level, activity or expression of the Pub21 protein" can refer to underexpression, suppression or temporal or spatial misexpression of the Pub21 polypeptide in a plant or plant material and / or a decrease in the biological effect or activity of the Pub21 protein in a plant or plant material. Suitably, the term "reducing the level, activity or expression of the Pub21 protein and the Pub17 protein" can refer to underexpression, suppression or temporal or spatial misexpression of the Pub21 polypeptide and the Pub17 polypeptide in a plant or plant material and / or a decrease in the biological effect or activity of the Pub21 protein and the Pub17 protein in a plant or plant material.

[0136] Suitably, the term "reducing the level, activity or expression of the Pub21 protein, optionally reducing the level, activity or expression of the Pub17 protein" can refer to underexpression, suppression or temporal or spatial misexpression of the Pub21 polypeptide and optionally the Pub17 polypeptide in a plant or plant material and / or a decrease in the biological effect or activity of the Pub21 protein and optionally the Pub17 protein in a plant or plant material.

[0137] This can be achieved by various standard techniques well known in the art. Suitably, a decrease in the level of the Pub21 protein and optionally a decrease in the Pub17 level in a plant may be a decrease in the amount of the Pub21 protein and optionally a decrease in the amount of the Pub17 protein. Suitably, the amount of Pub21 and optionally Pub17 proteins localized within the cells of a plant, for example within the cells of leaf tissue, is compared with the amount of the Pub21 protein within the same tissue within the same species of natural plant at the same stage when grown under the same conditions and, if present, also the Pub17 protein, in the absence of a planned modification of the expression level (i.e., an unmodified reference plant).

[0138] Suitably, the level, activity or expression of the Pub21 protein, and optionally the level, activity or expression of the Pub17 protein, is reduced by modification of the tomato plant. Preferably, this is by genetic modification of the tomato plant. Suitably, the genetic modification of the tomato plant may be a transient modification or a stable modification. In one embodiment, the resulting tomato plant is stably modified.

[0139] Suitably, stable transformation refers to a polynucleotide that is capable of being integrated into the plant host chromosome such that the host genetic material can be permanently and genetically modified, and the transformed cells can continue to express the traits conferred by this genetic material even after several generations of cell division. Suitably, transient transformation of a plant cell refers to a cell that contains heterologous DNA or RNA and has the ability to express the traits conferred by the heterologous genetic material without completely integrating the genetic material into the cell's DNA.

[0140] Suitably, the genetic modification of the tomato plant can be achieved by any known means in the art, for example, by random mutagenesis, transformation, homologous recombination, or gene editing. Suitable random mutagenesis techniques may be chemical, gamma ray, UV, or X-ray mutagenesis. Suitable gene editing techniques may be, for example, by the CRISPR-Cas system (especially CRISPR-Cas9 or CRISPR-Cas13, hereinafter any reference to Cas9 may also refer to other Cas proteins such as Cas13), zinc finger nucleases, or TALENs.

[0141] Alternatively, the level, activity or expression of Pub21 protein, and optionally the level, activity or expression of Pub17 protein, are reduced by suppression. Preferably, by suppression of the expression of the Pub21 gene, and optionally further suppression of the expression of the Pub17 gene, and thereby suppression of the expression of the Pub21 protein, and optionally further suppression of the expression of the Pub17 protein. Preferably, suppression of the Pub21 gene expression, and optionally further suppression of the Pub17 gene expression, can be achieved by using any known means in the art, for example, RNAi, miRNA, siRNA, nuclease-deficient CRISPR / Cas system, i.e., CRISPRi, modified TALE, or Zn finger.

[0142] Preferably, the resulting tomato plant or plant material may be transgenic or non-transgenic. In one embodiment, the tomato plant or plant material is non-transgenic.

[0143] The plants, parts or plant materials of the present invention are produced by a process involving some degree of genetic transformation events; i.e., transgenic in the sense that genetic material from one species is isolated, introduced and incorporated into the genetic material of the recipient plant using methods of genetic transformation well known to those skilled in the art. This approach may also include synthetic nucleic acid sequences generated according to design.

[0144] Alternatively, the plants or plant materials of the present invention may be non-transgenic in the sense that the genetic material of the plant, part or cell has been modified by a process involving, for example, Crispr-Cas-based gene editing by which modification of the identity of individual nucleotide bases or multiple bases is achieved within the genome. Again, such methods of gene editing of plant genetic material and the regeneration of the whole plant from the starting point of the modified plant protoplasts, plant cells or plant tissues are well known to those skilled in the art.

[0145] In one embodiment, a modification is used to reduce the level, expression or activity of the Pub21 protein and optionally the level, expression or activity of the Pub17 protein in tomato plants. Preferably, the modification is carried out by chemical mutagenesis or CRISPR / Cas9-mediated gene editing. Preferably, in such an embodiment, the Pub21 gene sequence is modified and optionally the Pub17 gene sequence is modified. Preferably, the Pub21 gene sequence and optionally the Pub17 gene sequence each contain one or more modifications as a result of the method of modification.

[0146] Preferably, chemical mutagenesis may be carried out by exposing tomato plants to chemical mutagens such as ethyl methanesulfonate (EMS), ethyl nitrosourea (ENU), NMU (nitrosomethylurea), methyl methanesulfonate (MMS), ethidium bromide, psoralen, acridine orange, or sodium azide. Preferably, the tomato plants are exposed to EMS. Preferably, the seeds of the tomato plants are exposed to EMS and then the tomato plants are grown from the seeds. Preferably, the seeds may be pre-soaked in distilled water. Preferably, the seeds may be pre-soaked for 2 to 15 hours, preferably about 8 hours. Preferably, the seeds are treated with a 0.5% to 10% EMS dilution, preferably 1% - 5%, preferably 1% EMS dilution. Preferably, the seeds are treated for 6 to 48 hours, preferably 12 to 24 hours, preferably about 12 hours.

[0147] Preferably, CRISPR / Cas9 gene editing is carried out by introducing the components of the CRISPR / Cas9 system into tomato plants. Preferably, the CRISPR-Cas system enables target-specific cleavage of genomic DNA induced by a Cas9 endonuclease complexed with a guide RNA (gRNA) that binds complementarily to the target DNA sequence. Preferably, the components of the CRISPR / Cas9 system are a Cas9 endonuclease protein and a suitable guide RNA that is complementary to the target sequence within the plant's genome.

[0148] As used herein, the term "guide RNA" or "gRNA" generally refers to an RNA molecule (or a group of RNA molecules collectively) that can bind to a CRISPR system effector, such as a Cas or Cpf1 protein, and contribute to targeting the Cas or Cpfl protein to a specific location within a target polynucleotide (e.g., DNA). The guide RNA can be, for example, a modified single RNA molecule (sgRNA) when the sgRNA comprises a crRNA segment and optionally a tracrRNA segment. The guide RNA can also be a dual-guide system where the crRNA and tracrRNA molecules are physically distinct molecules that interact there to form a duplex for the recruitment of a CRISPR system effector, such as Cas9, and for the targeting of that protein to a target polynucleotide.

[0149] As used herein, the term "crRNA" or "crRNA segment" refers to an RNA molecule or a portion of an RNA molecule that includes a guide sequence that targets a polynucleotide, a stem sequence involved in protein binding, and optionally, a 3'-overhang sequence. The guide sequence that targets the polynucleotide is a nucleic acid sequence that is complementary to a sequence in the target DNA (e.g., the Pub21 allele or the Pub17 allele). This guide sequence that targets the polynucleotide is also referred to as a "protospacer". In other words, the guide sequence of the crRNA molecule that targets the polynucleotide interacts with the target DNA in a sequence-specific manner via hybridization (i.e., base pairing). As such, the nucleotide sequence of the guide sequence of the crRNA molecule that targets the polynucleotide can vary and determines the location within the target DNA where the guide RNA and the target DNA will interact.

[0150] The guide sequence targeting the polynucleotide of the crRNA molecule can be modified (e.g., by genetic engineering) to hybridize to any desired sequence within the target DNA. The guide sequence targeting the polynucleotide of the crRNA molecule of the present invention can have a length of from about 12 nucleotides to about 100 nucleotides. For example, the guide sequence targeting the polynucleotide of crRNA can have a length of from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 40 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, or from about 12 nt to about 19 nt. For example, the guide sequence targeting the polynucleotide of crRNA can have a length of from about 17 nt to about 27 nt.

[0151] Preferably, the CRISPR / Cas9 complex can be introduced into tomato plants as one or more polynucleotides and / or proteins. Preferably, the CRISPR / Cas9 complex can be introduced into tomato plants as one or more polynucleotides encoding the components of the complex. Preferably, the one or more polynucleotides can be included in one or more vectors. Preferably, the CRISPR / Cas9 complex can be introduced into tomato plants by any known means of transformation. Those skilled in the art will understand that the technology of CRISPR / Cas9 gene editing in plants is well known, and for example, see Wada, N., et al., (2020) “Precision genome editing in plants: state-of-the-art in CRISPR / Cas9-based genome engineering” BMC Plant Biology volume 20, Article number: 234.

[0152] "Transformation" refers to the process of introducing an exogenous nucleic acid molecule (e.g., a recombinant polynucleotide) into a cell or protoplast, and furthermore, the exogenous nucleic acid molecule is integrated into the host cell genome or organelle genome (e.g., chloroplast or mitochondrion) or has the ability to replicate autonomously. "Transformed" or "transgenic" refers to a cell, tissue, organ, or organism into which a foreign nucleic acid, e.g., an expression vector or a recombinant nucleic acid molecule, has been introduced. Preferably, the means of transformation is, for example, Agrobacterium sp.-mediated transformation, vacuum infiltration, floral dip, spraying, particle gun or microprojectile gun, protoplast transformation, electroporation, microinjection, electrophoresis, pollen tube pathway, silicon carbide or liposome-mediated transformation, uptake by roots, direct injection into xylem or phloem, or other forms of direct DNA uptake, gene transfer via a disarmed Ti plasmid vector carried by Agrobacterium tumefaciens.

[0153] Suitably, by changing the sequence of the guide RNA, the Cas9 endonuclease can be programmed to cleave DNA at a site complementary to the guide RNA. The guide RNA suitable for use in the present invention can be selected from a guide RNA that is complementary to or targets a sequence in the Pub21 gene and optionally a guide RNA that is complementary to or targets a sequence in the Pub17 gene. Suitably, the guide RNA can preferably be complementary to or target a sequence in the U-box domain or the ARM repeat domain of the Pub21 gene of SEQ ID NO: 1 or its ortholog or homolog, and optionally preferably the Pub17 gene of SEQ ID NO: 39 or its ortholog or homolog. Suitable guide RNAs can be designed to target specific sequences in the Pub21 gene and optionally the Pub17 gene using widely available bioinformatics tools. Suitably, the guide RNA is a single guide RNA.

[0154] In one embodiment, the guide RNA designed to target a specific sequence in the Pub21 gene is selected from one or more of the following sequences: sgRNA1 of SEQ ID NO: 23, sgRNA2 of SEQ ID NO: 24, and sgRNA3 of SEQ ID NO: 25. Suitably, in some embodiments, two or more guide RNAs can be used in combination to direct the CRISPR / Cas9 complex to cleave the Pub21 gene at multiple positions. Suitably, in one embodiment of the present invention, all three guide RNAs of SEQ ID NOs: 23-25 are used.

[0155] In one embodiment, any additional guide RNA designed to target a specific sequence in the Pub17 gene is selected from one or more of the following sequences: sgRNA1 of SEQ ID NO: 51, sgRNA2 of SEQ ID NO: 52, sgRNA3 of SEQ ID NO: 53, and sgRNA4 of SEQ ID NO: 54. Preferably, in some embodiments, two or more guide RNAs can be used in combination to direct the CRISPR / Cas9 complex to cleave the Pub17 gene at multiple positions. Preferably, in one embodiment of the present invention, all four guide RNAs of SEQ ID NOs: 51-54 are used.

[0156] Preferably, in one embodiment of the present invention, two or more guide RNAs are used in combination to direct the CRISPR / Cas9 complex to cleave the Pub21 gene at multiple positions and to direct the CRISPR / Cas9 complex to cleave the Pub17 gene at multiple positions. Preferably, in such embodiments, a plurality of guide RNAs selected from SEQ ID NOs: 23-25 and SEQ ID NOs: 51-54 are used. Preferably, in some embodiments, all of the guide RNAs of SEQ ID NOs: 23-25 and SEQ ID NOs: 51-54 are used.

[0157] Preferably, by a method comprising modifying a tomato plant, preferably one or more modifications are introduced into the Pub21 allele of the tomato plant, and optionally, by a method comprising modifying the tomato plant, one or more modifications are further introduced into the Pub17 allele of the tomato plant. Therefore, preferably, the tomato plant comprises a modified Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) that has a mutation resulting in a decrease in the level, activity or expression of the Pub21 protein as compared to a reference tomato plant, and optionally, the tomato plant further comprises a modified Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) that has a mutation resulting in a decrease in the level, activity or expression of the Pub17 protein as compared to the reference tomato plant.

[0158] Suitably, the modified Pub21 allele and the Pub17 allele each preferably contain certain mutations, hereinafter defined, preferably in relation to the modified Pub21 allele and the modified Pub17 allele.

[0159] In another embodiment, by using suppression, the levels, expression or activity of the Pub21 protein and optionally the Pub17 protein in the tomato plant are reduced. Preferably, the suppression is effected by RNA interference, particularly known as RNAi. Preferably, in such an embodiment, the Pub21 gene sequence and optionally the Pub17 gene sequence are not modified. Preferably, in such an embodiment, the expression of the Pub21 gene sequence and optionally the Pub17 gene sequence is inhibited or suppressed. Preferably, in such an embodiment, the expression of the Pub21 gene sequence and optionally the Pub17 gene sequence is silenced.

[0160] Preferably, the RNAi suppression is effected by introducing into the tomato plant one or more polynucleotide sequences encoding an RNAi agent that is complementary to the target DNA sequence. Two types, such as microRNA (miRNA) and small interfering RNA (siRNA), as small RNA molecules, form the core of RNA interference. These small RNAs can induce an enzyme complex to degrade messenger RNA (mRNA) molecules and thus reduce their activity by preventing translation via post-transcriptional gene silencing. Furthermore, transcription can be inhibited via the transcriptional silencing mechanism of RNA interference, through which the enzyme complex catalyzes DNA methylation at genomic positions complementary to the duplex siRNA or miRNA.

[0161] Accordingly, in some embodiments of the present invention, inhibitory RNAs that help inhibit the expression of the Pub21 protein, such as siRNA, miRNA, or another RNAi, are used, and optionally, inhibitory RNAs that help inhibit the expression of the Pub21 protein and optionally the Pub17 protein, such as siRNA, miRNA, or another RNAi, are used. The inhibitory RNAs can be synthesized and delivered to plants, or can be expressed in plants from suitable expression constructs.

[0162] RNAi and methods of its implementation are well known in the art. RNAi agents can be chemically or enzymatically synthesized extracellularly and subsequently delivered to cells (see, for example, Fire, et al., Nature, 391:806-11 (1998); Tuschl, et al., Genes and Dev., 13:3191-97 (1999); and Elbashir, et al., Nature, 411:494-498 (2001)); or can be expressed in vivo by appropriate vectors within cells (see, for example, U.S. Patent No. 6,573,099).

[0163] Preferably, the RNAi agent is miRNA or siRNA. Preferably, the RNAi agent comprises a polynucleotide sequence complementary to a target sequence in the Pub21 gene and optionally further comprises a polynucleotide sequence complementary to a target sequence in the Pub17 gene. Suitable means for transforming tomato plants with such polynucleotide sequences, or vectors containing said polynucleotide sequences, are described above.

[0164] Suitable RNAi agent sequences are preferably complementary to or target sequences in the U-Box domain, ARM repeat domain, or the region between these two domains of the Pub21 gene of SEQ ID NO: 1 or its orthologs or homologs, and optionally, further RNAi agent sequences are preferably complementary to or target sequences in the UND domain, U-Box domain, or ARM repeat domain of the Pub17 gene of SEQ ID NO: 39 or its orthologs or homologs and can be selected from RNAi agent sequences. In one embodiment, the sequence complementary to or targeting the region between the U-Box domain and the ARM repeat domain of the Pub21 gene or the sequence in the ARM repeat domain is selected from any of the following sequences: RNAi1 of SEQ ID NO: 5 and RNAi10 of SEQ ID NO: 6. Preferably, in some embodiments, two or more RNAi agents may be used in combination. Preferably, in one embodiment of the present invention, both RNAi agents of SEQ ID NO: 5 and SEQ ID NO: 6 are used. In one embodiment, the sequence complementary to or targeting the sequence in the UND domain or U-Box domain of the Pub17 gene is selected from any of the following sequences: RNAi3 of SEQ ID NO: 46 and RNAi7 of SEQ ID NO: 47. Preferably, in some embodiments, two or more RNAi agents may be used in combination. Preferably, in one embodiment of the present invention, both RNAi agents of SEQ ID NO: 46 and SEQ ID NO: 47 are used.

[0165] Preferably, in one embodiment, two or more RNAi agents can be used in combination to target sequences in the Pub21 gene and sequences in the Pub17 gene. Preferably, in such an embodiment, multiple RNAi agents may be used, and preferably, the multiple RNAi agents are selected from SEQ ID NO: 5 and SEQ ID NO: 6, and also from SEQ ID NO: 46 and SEQ ID NO: 47. Preferably, in some embodiments, all RNAi agents of SEQ ID NO: 5 and SEQ ID NO: 6, and SEQ ID NO: 46 and SEQ ID NO: 47 are used.

[0166] Modified Pub21 allele and Pub21 protein In some embodiments, the tomato plant comprises a modified Pub21 allele that reduces the level, expression or activity of the corresponding Pub21 protein. Preferably, the modified Pub21 allele is not the result of an essentially biological process. Preferably, the modified Pub21 allele is artificially created. In some embodiments, a tomato plant, or any plant part, seed, or product therefrom, is not exclusively obtained by an essentially biological process according to the present invention. Preferably, the modified Pub21 allele causes increased resistance to lesion-forming pathogens.

[0167] In one embodiment, the tomato plant comprises two copies of the modified Pub21 allele and is thus homozygous for the modified Pub21 allele.

[0168] Preferably, the modified Pub21 nucleic acid sequence comprises at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele), or an ortholog or homolog thereof, and the nucleic acid sequence comprises a mutation that results in a decrease in the level, activity or expression of the Pub21 protein. Preferably, the modified Pub21 nucleic acid sequence is a modified Pub21 allele.

[0169] Preferably, the modified Pub21 nucleic acid sequence comprises at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 1 (wild-type Pub21 allele), or an ortholog or homolog thereof. Preferably, at any level of identity, the sequence further comprises a mutation that results in a decrease in the level, activity or expression of the Pub21 protein. Preferably, the modified Pub21 nucleic acid sequence is a modified Pub21 allele.

[0170] Suitably, the modified Pub21 nucleic acid sequence may contain one or more mutations. Suitably, each mutation results in a decrease in the level, activity or expression of the Pub21 protein. Suitably, the modified Pub21 nucleic acid sequence is a modified Pub21 allele.

[0171] Suitably, the modified Pub21 nucleic acid sequence contains a mutation in the ARM region of SEQ ID NO: 1 (wild-type allele), or the corresponding region in its ortholog or homolog. Suitably, the mutation is a SNP. Suitably, the SNP is a T-to-A SNP. Suitably, the mutation is present at nucleotide position 890 of SEQ ID NO: 1 (wild-type Pub21 allele), or the corresponding position in its ortholog or homolog, for example. Therefore, suitably, the modified Pub21 nucleic acid sequence contains a T-to-A SNP at position 890 of SEQ ID NO: 1 (wild-type Pub21 allele), or the corresponding position. Suitably, the modified Pub21 nucleic acid sequence is a modified Pub21 allele.

[0172] Therefore, suitably, the modified Pub21 nucleic acid sequence contains at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele), or its ortholog or homolog, and the nucleic acid sequence contains a T-to-A SNP at position 890 of SEQ ID NO: 1 (wild-type Pub21 allele), or the corresponding position, resulting in a decrease in the level, activity or expression of the Pub21 protein. Suitably, the modified Pub21 nucleic acid sequence is a modified Pub21 allele.

[0173] In one embodiment, the modified Pub21 allele contains SEQ ID NO: 2 (modified Pub21 allele). In one embodiment, the modified Pub21 allele consists of SEQ ID NO: 2 (modified Pub21 allele).

[0174] A further aspect of the present invention relates to an isolated nucleic acid sequence according to SEQ ID NO: 2 (modified Pub21 allele), and vectors, expression cassettes and host cells containing said sequence.

[0175] Preferably, the Pub21 protein is encoded by the Pub21 nucleic acid sequence. Therefore, preferably, the Pub21 protein is also modified. Preferably, the Pub21 protein modification is caused by modification of the Pub21 nucleic acid sequence of the Pub21 allele as described above.

[0176] Preferably, the Pub21 protein is cleaved. Preferably, the cleavage is caused by a premature stop codon in the Pub21 nucleic acid sequence. Preferably, the premature stop codon is caused by a mutation in the Pub21 nucleic acid sequence, preferably by an SNP mutation in the Pub21 nucleic acid sequence. Therefore, preferably, the modified Pub21 protein is cleaved at the C-terminus. Preferably, the modified Pub21 protein is cleaved at the C-terminus at position L297 of SEQ ID NO: 3 (wild-type Pub21 protein) or at a corresponding position in its ortholog or homolog, for example.

[0177] Preferably, the Pub21 protein comprises an amino acid sequence that is part of SEQ ID NO: 3 (wild-type Pub21 protein) or follows its ortholog or homolog. Preferably, the Pub21 protein comprises an amino acid sequence that follows at least 50%, 60%, 70%, 80%, or 90% of the full length of SEQ ID NO: 3 (wild-type Pub21 protein) or its ortholog or homolog. Preferably, the Pub21 protein is not composed of SEQ ID NO: 3 or its ortholog or homolog. Preferably, the Pub21 protein comprises an amino acid sequence that follows approximately 60-70% of the full length of SEQ ID NO: 3 (wild-type Pub21 protein) or its ortholog or homolog. Preferably, the Pub21 protein comprises an amino acid sequence that follows 70% of the full length of SEQ ID NO: 3 (wild-type Pub21 protein) or its ortholog or homolog.

[0178] Preferably, the modified Pub21 protein consists of amino acids 1-296 of SEQ ID NO: 3 (wild-type Pub21 protein).

[0179] Preferably, the modified Pub21 protein is composed of an amino acid sequence having at least 70% identity with SEQ ID NO: 4 (modified Pub21 protein) or a portion thereof. Preferably, the modified Pub21 protein is composed of an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 4 (modified Pub21 protein) or a portion thereof.

[0180] Preferably, the modified Pub21 protein is composed of an amino acid sequence according to SEQ ID NO: 4 (modified Pub21 protein) or a portion thereof.

[0181] Preferably, the portion thereof of SEQ ID NO: 4 may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the full length of SEQ ID NO: 4 (modified Pub21 protein).

[0182] Preferably, the modified Pub21 protein may contain one or more additional mutations. Preferably, each mutation results in a decrease in the level, activity or expression of the Pub21 protein.

[0183] A further aspect of the invention relates to an isolated polypeptide sequence according to SEQ ID NO: 4 (modified Pub21 protein), or a portion thereof, and a host cell containing said polypeptide.

[0184] In a further aspect of the invention, there is provided a plant or plant part or seed containing a modified Pub21 protein as defined herein.

[0185] Modified Pub17 allele and Pub17 protein In some embodiments described elsewhere herein, the tomato plant comprises a modified Pub21 allele that reduces the level, expression or activity of the corresponding Pub21 protein, and in addition, the tomato plant may further comprise a modified Pub17 allele that further reduces the level, expression or activity of the corresponding Pub17 protein.

[0186] As used herein, the "Pub17 allele" or "Pub17 protein" is included in the tomato plant in combination with the modified Pub21 allele or modified Pub21 protein as described above.

[0187] Preferably, the modified Pub17 allele is not the result of an essentially biological process. Preferably, the modified Pub17 allele is artificially created. In some embodiments, the tomato plant, or any plant part, seed, or product therefrom according to the present invention is not exclusively obtained by an essentially biological process. Preferably, the modified Pub21 allele and the Pub17 allele provide increased resistance to lesion-forming pathogens.

[0188] In one embodiment, the tomato plant comprises two copies of the modified Pub17 allele and is thus homozygous for the modified Pub17 allele.

[0189] Preferably, the modified Pub17 nucleic acid sequence comprises at least 70% identity with SEQ ID NO: 39 (wild type Pub17 allele), or an ortholog or homolog thereof, and the nucleic acid sequence comprises a mutation that results in a decrease in the level, activity or expression of the Pub17 protein. Preferably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0190] Preferably, the modified Pub17 nucleic acid sequence comprises at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity with SEQ ID NO: 39 (wild-type Pub17 allele), or its ortholog or homolog. Preferably, at any level of identity, the sequence further comprises a mutation that results in a decrease in the level, activity or expression of the Pub17 protein. Preferably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0191] Preferably, the modified Pub17 nucleic acid sequence may comprise one, or two or more mutations. Preferably, each mutation results in a decrease in the level, activity or expression of the Pub17 protein. Preferably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0192] Preferably, the modified Pub17 nucleic acid sequence comprises a mutation in the ARM region of SEQ ID NO: 39 (wild-type Pub17 allele), or the corresponding region in its ortholog or homolog. Preferably, the mutation is an SNP. Preferably, the SNP is an A to T SNP. Preferably, the mutation is present at nucleotide position 1477 of SEQ ID NO: 39 (wild-type Pub17 allele), or the corresponding position in its ortholog or homolog, for example. Therefore, preferably, the modified Pub17 nucleic acid sequence comprises an A to T SNP at position 1477 of SEQ ID NO: 39 (wild-type Pub17 allele), or the corresponding position. Preferably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0193] Therefore, preferably, the modified Pub17 nucleic acid sequence comprises at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele), or its ortholog or homolog, wherein said nucleic acid sequence comprises an A to T SNP at position 1477 of SEQ ID NO: 39 (wild-type Pub17 allele), or the corresponding position, which results in a decrease in the level, activity or expression of the Pub17 protein. Preferably, the modified Pub17 nucleic acid sequence is a modified Pub17 allele.

[0194] In one embodiment, the modified Pub17 allele comprises SEQ ID NO: 48 (modified Pub17 allele). In one embodiment, the modified Pub17 allele consists of SEQ ID NO: 48 (modified Pub17 allele).

[0195] A further aspect of the invention relates to an isolated nucleic acid sequence according to SEQ ID NO: 48 (modified Pub17 allele), and vectors, expression cassettes and host cells comprising said sequence.

[0196] Preferably, the Pub17 protein is encoded by the Pub17 nucleic acid sequence. Therefore, preferably, the Pub17 protein is also modified. Preferably, the Pub17 protein modification is caused by a modification to the Pub17 nucleic acid sequence of the Pub17 allele as described above.

[0197] Preferably, the Pub17 protein is cleaved. Preferably, the cleavage is caused by a premature stop codon in the Pub17 nucleic acid sequence. Preferably, the premature stop codon is caused by a mutation in the Pub17 nucleic acid sequence, preferably by a SNP mutation in the Pub17 nucleic acid sequence. Therefore, preferably, the modified Pub17 protein is cleaved at the C-terminus. Preferably, the modified Pub17 protein is cleaved at the C-terminus, at most at position R493 of SEQ ID NO: 49 (wild-type Pub17 protein) or at a corresponding position in its ortholog or homolog, for example.

[0198] Preferably, the Pub17 protein comprises an amino acid sequence that follows a part of SEQ ID NO: 49 (wild-type Pub17 protein) or its ortholog or homolog. Preferably, the Pub17 protein comprises an amino acid sequence that follows at least 50%, 60%, 70%, 80%, or 90% of the full length of SEQ ID NO: 49 (wild-type Pub17 protein) or its ortholog or homolog. Preferably, the Pub17 protein is not composed of SEQ ID NO: 49 or its ortholog or homolog. Preferably, the Pub17 protein comprises an amino acid sequence that follows about 70%, more specifically 72%, of the full length of SEQ ID NO: 49 (wild-type Pub17 protein) or its ortholog or homolog.

[0199] Preferably, the modified Pub17 protein consists of amino acids 1 to 492 of SEQ ID NO: 49 (wild-type Pub17 protein).

[0200] Preferably, the modified Pub17 protein consists of an amino acid sequence that follows SEQ ID NO: 50 (modified Pub17 protein) or a part thereof and has at least 70% identity therewith. Preferably, the modified Pub17 protein consists of an amino acid sequence that has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 50 (modified Pub17 protein) or a part thereof.

[0201] Preferably, the modified Pub17 protein consists of an amino acid sequence that follows SEQ ID NO: 50 (modified Pub17 protein) or a part thereof.

[0202] Preferably, the part of SEQ ID NO: 50 may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the full length of SEQ ID NO: 50 (modified Pub17 protein).

[0203] Preferably, the modified Pub17 protein may contain one or more additional mutations. Preferably, each mutation results in a decrease in the level, activity, or expression of the Pub17 protein.

[0204] A further aspect of the invention relates to an isolated polypeptide sequence according to SEQ ID NO: 50 (modified Pub17 protein), or a portion thereof, and a host cell comprising said polypeptide.

[0205] In a further aspect of the invention, in addition to the modified Pub21 protein described above, a plant or plant part or seed comprising the modified Pub17 protein as defined herein is provided.

[0206] A pathogen that forms lesions Preferably, the pathogen that forms lesions may be any pathogen that forms one or more lesions on the tissue of a tomato plant. Preferably, on the stem, leaves and / or fruit of a tomato plant. Preferably, the lesion may be a local necrosis or chlorosis area of the affected tissue.

[0207] Preferably, the pathogen that forms lesions may be a biotrophic, hemibiotrophic or necrotrophic pathogen. In one embodiment, the pathogen that forms lesions is a necrotrophic pathogen.

[0208] Preferably, the pathogen that forms lesions may be a bacterium, fungus, virus, protozoan, or archaebacterium. Preferably, the pathogen that forms lesions is a fungus or virus or oomycete, or any combination thereof.

[0209] Preferably, the pathogen that forms the lesion is an oomycete. Preferably, the oomycete that forms the lesion may be selected from Phytophthora infestans, Hyaloperonospora arabidopsidis, Phytophthora ramorum, Phytophthora sojae, Phytophthora capsici, Plasmopara viticola, Phytophthora cinnamomi, Pythium ultimum, Albugo Candida, and Phytophthora parasitica.

[0210] Preferably, the pathogen that forms the lesion is a virus. The virus that preferably forms the lesion may be selected from one or more of the following: for example, Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Pepino mosaic virus (PepMV), Cucumber mosaic virus (CMV), Potato Virus Y (PVY), double stripe mosaic TMV+CMV, Tobacco Etch virus (TEV), Tomato ringspot virus (TRSV), Tomato Aspermy (TAV), Tomato yellow leaf curl virus (TYLCV), and Tomato brown rugose fruit virus (ToBRFV).

[0211] Suitably, the pathogen that forms the lesion is a fungus. The fungus that forms a suitable lesion may be selected from any of the following species: Cochliobolus heterostrophus, Cochliobolus carbonum, Cochliobolus victoriae, Alternaria alternata, Alternaria solani, Alternaria brassicola, Periconia circinata, Pyrenophora tritici-repentis, Bipolaris sacchari, Phyllosticta maydis, Stagonospora nodorum, Stemphylium vesicarium, Botrytis fabae, Botrytis elliptica, Botrytis cinerea, Sclerotinia sclerotiorum, Mollinia fructicola, Fusarium graminearum, Septoria tritici, Cercospora zeae-maydis, Exserohilum turcicum, Leptosphaeria maculans, Ascochyta rabiei, Diaporthe toxica, Phoma medicaginis, Leptosphaerulina trifoliTrifoli, Pseudopeziza medicaginis, Stemphyllium botryosum, Stagonospora metiloti, Pleiochaeta setosa, Fusarium oxysporum, Rhizoctonia solani, and Pythium spp.

[0212] Preferably, the pathogen that forms the lesion is a pathogen that attacks tomato plants. Preferably, in that case, the tomato plant is the host. Therefore, preferably, the pathogen that forms the lesion is a tomato pathogen, preferably a necrotrophic tomato pathogen, preferably a necrotrophic fungal tomato pathogen or a necrotrophic viral tomato pathogen. Suitable necrotrophic fungi that attack tomato plants may be selected from Alternaria alternata, Alternaria solani, Botrytis cinerea, Sclerotinia sclerotiorum, Stemphyllium botryosum, Fusarium oxysporum, and Pythium spp. Suitable necrotrophic viruses that attack tomato plants may be selected from Tomato yellow leaf curl virus (TYLCV) and Tomato brown rugose fruit virus (ToBRFV).

[0213] Preferably, the pathogen that forms the lesion belongs to the genus Botrytis or Alternaria. Therefore, preferably, the pathogen that forms the lesion may be selected from species such as Alternaria alternata, Alternaria solani, Alternaria brassicola, Botrytis fabae, Botrytis elliptica, and Botrytis cinerea.

[0214] Alternatively, the pathogen that forms the lesion may be a hemibiotrophic tomato pathogen, preferably a hemibiotrophic oomycete tomato pathogen. Suitable hemibiotrophic oomycetes that affect tomato plants may be Phytophthora infestans, Phytophthora capsici, or Phytophthora parasitica.

[0215] In one embodiment, the pathogen that forms the lesion is Botrytis cinerea or Alternaria solani.

[0216] In one embodiment, the pathogen that forms the lesion is Phytophthora infestans.

[0217] Preferably, the pathogen that forms the lesion causes a disease in the plant. Suitable diseases may be selected from blight, Botrytis blight, gray mold, white mold, early blight, late blight, leaf blight, powdery mildew, rot, leaf spot, fruit rot, brown leaf spot, black leaf spot, yellow-brown leaf spot, gray leaf spot, head blight, ear rot, lesion, stem canker, stem blight, black stem disease, crown rot, damping-off, root rot, and seedling damping-off.

[0218] Preferably, the pathogen that forms lesions causes a disease that is preferably a necrotic disease in which cell death occurs. Preferably, the pathogen that forms lesions causes a disease selected from blights such as Botrytis blight, early blight, or late blight, molds such as gray mold, and rots. Therefore, preferably, the plants of the present invention have increased resistance or decreased susceptibility to necrotic diseases. Preferably, they have increased resistance or decreased susceptibility to blights such as Botrytis blight, early blight, or late blight, molds such as gray mold, or rots. In one embodiment, the plants of the present invention have increased resistance or decreased susceptibility to blight, preferably Botrytis blight.

[0219] In one embodiment, the tomato plants of the present invention have increased resistance to blight caused by a pathogen that forms lesions. In one embodiment, the tomato plants of the present invention have increased resistance to blight caused by a fungal or oomycete or viral pathogen that forms lesions. In one embodiment, the tomato plants of the present invention have increased resistance to blight caused by a necrotrophic or hemibiotrophic pathogen. In one embodiment, the tomato plants of the present invention have increased resistance to blight caused by a necrotrophic or hemibiotrophic fungal or oomycete pathogen. In one embodiment, the tomato plants of the present invention have increased resistance to blight caused by a Botrytis or Alternaria pathogen. In one embodiment, the tomato plants of the present invention have increased resistance to blight caused by Botrytis cinerea or Alternaria solani, preferably Botrytis cinerea.

[0220] Suitably, the tomato plants of the present invention can have increased resistance to pathogens that form two or more lesions, and thereby can have increased resistance to two or more diseases. Suitably, the tomato plants of the present invention can have increased resistance to a combination of pathogens that form the lesions described herein, or preferably to any combination of the diseases described herein that can be caused by pathogens that form lesions.

[0221] Suitably, the tomato plants of the present invention can have increased resistance to any combination of pathogens that form fungal lesions, pathogens that form viral lesions, and / or pathogens that form oomycete lesions. Suitably, the tomato plants of the present invention can have increased resistance to any combination of the pathogens listed above. Suitably, the tomato plants of the present invention can have increased resistance to any combination of Botrytis cinerea and Alternaria solani.

[0222] Increased resistance Suitably, the tomato plants of the present invention have increased resistance relative to a reference tomato plant, preferably increased resistance relative to a reference tomato plant to a pathogen that forms a lesion.

[0223] A suitable reference tomato plant is a control plant. Preferably, such a reference tomato plant has the same genetic background as the tomato plant of the invention, but does not include a decrease in the level of the Pub21 protein, and optionally does not include a decrease in the level, expression or activity of the Pub17 protein. Preferably, the reference tomato plant may be a wild-type plant. Preferably, the reference tomato plant may be a tomato plant belonging to the same plant variety as the plant of the invention, and does not include a decrease in the level of the Pub21 protein, and optionally does not include a decrease in the level, expression or activity of the Pub17 protein. The term "plant variety" is understood herein according to the UPOV definition. Preferably, the reference tomato plant has not been modified to reduce the level of the Pub21 protein, and optionally has not been modified to reduce the level, expression or activity of the Pub17 protein. Preferably, the reference tomato plant does not contain a modified Pub21 allele, and optionally does not contain a modified Pub17 allele. Preferably, the reference tomato plant contains the wild-type Pub21 allele and the wild-type Pub17 allele. Preferably, the reference tomato plant is grown over the same period and under the same conditions as the tomato plant of the invention. Preferably, the reference tomato plant is an isogenic line, an inbred line or a hybrid, provided that it has the same genetic background as the tomato plant of the invention, except that the reference tomato plant does not include the level, expression or activity of the modified Pub21 protein, and optionally does not include the level, expression or activity of the modified Pub17 protein, and preferably does not contain the modified Pub21 allele, and optionally does not contain the modified Pub17 allele of the invention.

[0224] For example, the reference tomato plant may include the tomato reference genome HEINZ or the Moneymaker tomato reference genome (https: / / www.ebi.ac.uk / ena / browser / view / SAMEA2340764) in the context of the present invention.

[0225] Preferably, the tomato plant of the invention has a statistically significant increase in resistance to a pathogen that forms one or more lesions, compared to the reference tomato plant.

[0226] Preferably, resistance to a pathogen that forms lesions can be measured by a significant decrease in the number of lesions per tomato plant or plant material. Preferably, this can be measured using, for example, a Mann-Whitney test (α = 1, 2.5 or 5%) or a Student's test (P < 0.05). Preferably, the plants of the present invention have at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% fewer lesions than the reference tomato plants. Preferably, the tomato plants of the present invention have 25 - 50% fewer lesions than the reference tomato plants.

[0227] Preferably, resistance to a pathogen that forms lesions can be measured by a significant decrease in the diameter of the lesions on the tomato plant or plant material, preferably a decrease in the average diameter of the lesions on the tomato plant. Preferably, this can be measured using, for example, a Mann-Whitney test (α = 1, 2.5 or 5%) or a Student's test (P < 0.05). Preferably, the tomato plants of the present invention have lesions that are at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% smaller than the lesions on the reference tomato plants, preferably when measured by the average diameter of the lesions on the tomato plant. Preferably, the plants of the present invention have lesions that are 20 - 30% smaller than the lesions on the reference tomato plants, preferably when measured by the average diameter of the lesions on the tomato plant.

[0228] Preferably, such measurements of resistance are calculated after the step of exposing the tomato plant or a part thereof to a pathogen that forms lesions for a suitable period. A suitable period is a period sufficient for the pathogen that forms lesions to infect the tomato plant or a part thereof and cause the appearance of lesions. The suitable period may be 1 - 28 days, preferably 1 day - 14 days, preferably 1 day - 7 days after the exposure of the tomato plant or a part thereof to the pathogen that forms lesions.

[0229] Suitably, resistance to a pathogen that forms lesions can be enhanced by modification of both the Pub21 allele and the Pub17 allele.

[0230] Suitably, in embodiments where both the Pub21 and Pub17 proteins are reduced, the decrease in the diameter of lesions on a tomato plant or plant material, preferably the decrease in the average diameter of lesions on a tomato plant, is greater than when either the Pub21 protein or the Pub17 protein is reduced alone. Suitably, such a plant of the invention preferably has lesions that are 40 - 70%, preferably 40%, 50%, 60% or 70% smaller than the lesions on a reference tomato plant, as measured by the average diameter of lesions on the tomato plant.

[0231] Method of screening Aspects of the invention further relate to a method of identifying or screening for tomato plants having increased resistance to a pathogen that forms one or more lesions.

[0232] Suitably, the method relates to identifying tomato plants within a population having the desirable trait of increased resistance to a pathogen that forms one or more lesions. Suitably, the population of plants may be a mutant population or a wild population of tomato plants. Suitably, the mutant population of tomato plants can be produced by mutagenesis as described elsewhere herein. Suitably, by chemical mutagenesis, preferably by use of a chemical mutagen such as EMS. Therefore, suitably, the method may include an initial step of obtaining or producing a mutant population of tomato plants, preferably by EMS mutagenesis.

[0233] Suitably, tomato plants can be directly identified as having resistance to a pathogen that forms lesions, or alternatively or additionally, tomato plants can be indirectly identified by having a decrease in the level, expression or activity of the Pub21 protein, optionally further having a decrease in the level, expression or activity of the Pub17 protein.

[0234] Suitably, the identification of resistance to pathogens that form lesions in tomato plants can be determined by inoculation or exposure assays. Here, preferably, the tomato plants are exposed to the pathogens that form lesions, and the response is evaluated in comparison to reference tomato plants. Increased resistance to pathogens that form lesions can be determined by assays such as, for example, the detached leaf assay as performed in the examples herein. Thus, preferably, the method may include the step of performing an inoculation or exposure assay on each tomato plant, optionally on a population of tomato plants. Preferably, such assays may include identifying plants that show a decrease in the number and / or average size of lesions compared to reference plants when exposed to the pathogens that form lesions. A preferred level of decrease is defined elsewhere herein.

[0235] Alternatively or additionally, resistance to pathogens that form lesions in tomato plants can be determined by identifying tomato plants that have a modified Pub21 allele and optionally further have a modified Pub17 allele. Preferably, it is to identify tomato plants that have a modified Pub21 allele with the mutations described above and optionally a modified Pub17 allele. Preferably, this can be determined by molecular methods such as PCR or genomic sequencing of tomato plants. Preferably, this can be determined by genotyping the tomato plants. Genotype evaluation of plants includes techniques such as isozyme electrophoresis, restriction fragment length polymorphism (RFLP), randomly amplified polymorphic DNA (RAPD), optionally arbitrarily primed polymerase chain reaction (AP-PCR), allele-specific PCR (AS-PCR), DNA amplification fingerprinting (DAF), sequence characterized amplified regions (SCAR), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), also referred to as "microsatellites".

[0236] "Sequencing DNA" refers to, for example, determining the nucleic acid sequence of a DNA fragment of a gene. Standard methods and commercially available services are known in the art. Basic methods for DNA sequencing include the Maxam-Gilbert method and the chain termination method. Also, high-throughput technologies have been developed and are preferably used in the methods of the present invention. These high-throughput technologies include, but are not limited to, massively parallel signature sequencing (MPSS), polony sequencing, 454 pyrosequencing, Illumina (Solexa) sequencing, combinatorial probe anchor synthesis (cPAS), SOLiD sequencing, ion torrent semiconductor sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, single molecule real time (SMRT) sequencing, and nanopore DNA sequencing.

[0237] Preferably, the presence or absence of the modified Pub21 allele and optionally the presence or absence of the modified Pub17 allele can be determined by PCR using a double-stranded DNA dye or a fluorescent reporter probe, for example, real-time PCR. Preferably, a specific primer pair complementary to the modified Pub21 allele described herein, which is related to the kit, is used, and optionally, a specific primer pair complementary to the modified Pub17 allele is further used. Preferably, the primer pair detects the presence of an SNP at position 890 of the Pub21 allele according to SEQ ID NO: 1, or at a corresponding position, and optionally, an additional primer pair detects the presence of an SNP at position 1477 of the Pub17 allele according to SEQ ID NO: 39, or at a corresponding position. Therefore, preferably, the method includes performing PCR using suitable primers, such as those defined for a kit, followed by sequencing the resulting amplification product, or optionally, in a population of tomato plants, performing genomic sequencing of the tomato plant or each tomato plant.

[0238] As used herein, the term "primer" refers to an oligonucleotide that anneals to a nucleic acid target and can serve as a starting point for DNA synthesis when placed under conditions where synthesis of the primer extension product is induced (e.g., in the presence of agents for polymerization such as nucleotides and DNA polymerase, and at suitable temperature and pH). The primer (in some examples, an extension primer, and in some examples, an amplification primer) may be single-stranded for maximum efficiency in extension and / or amplification. The primer may be an oligodeoxyribonucleotide. The primer is typically long enough to prime the synthesis of an extension and / or amplification product in the presence of agents for polymerization. The minimum length of the primer can depend on many factors including, but not limited to, the temperature of the primer and the composition (A / T vs G / C content) of the primer. In the context of amplification primers, these are typically provided as a pair of bidirectional primers consisting of one forward and one reverse primer, or as a pair of forward primers commonly used in the art of DNA amplification, e.g., in PCR amplification.

[0239] Thus, preferably, a method of identifying or screening tomato plants may include using the SNP at position 890 of the Pub21 allele according to SEQ ID NO: 1, or at a corresponding position, as a marker for identifying the presence of resistance to a pathogen that forms lesions within the tomato plant, and optionally, the method may further include using the SNP at position 1477 of the Pub17 allele according to SEQ ID NO: 39, or at a corresponding position. Preferably, this is for identifying the presence of the modified Pub21 allele and optionally the presence of the modified Pub17 allele of the invention within the tomato plant.

[0240] Accordingly, a further aspect of the invention is the use of the SNP at position 890 of the Pub21 allele of SEQ ID NO: 1, or at a corresponding position, for the identification and / or diagnostic selection and / or genotyping of resistance alleles against pathogens forming lesions in a tomato plant or a part thereof, and optionally the use of the SNP at position 1477 of the Pub17 allele of SEQ ID NO: 39, or at a corresponding position. Preferably, in a cultivated tomato plant.

[0241] Preferably, the identification or screening method further comprises the step of selecting that tomato plant or each tomato plant identified as having a reduced level, expression or activity of the Pub21 protein and optionally further having a reduced level, expression or activity of the Pub17 protein, and / or selecting that tomato plant or each tomato plant identified as having increased resistance to one or more pathogens forming lesions as a result.

[0242] Preferably, the identification or screening method may further comprise the step of breeding each selected tomato plant, preferably to form progeny. Preferably, the screening method may further comprise additional rounds of screening the progeny and breeding the selected progeny having the desired trait. Preferably, this may comprise additional steps of screening the progeny for the presence of the desired trait and one or more further steps of breeding the selected progeny, as described above.

[0243] Methods of hybridizing and breeding A hybrid or cultivated plant can be produced by crossing a first plant of the invention with a second reference plant to obtain progeny. Preferably, the hybrid or cultivated plant is a tomato plant.

[0244] Suitably, the generation of a hybrid tomato plant involves crossing a first tomato plant according to the present invention with a second reference tomato plant as defined above. Suitably, the reference tomato plant lacks a decrease in the level, expression or activity of the Pub21 protein and optionally further lacks a decrease in the level, expression or activity of the Pub17 protein. Suitably, the reference tomato plant lacks the modified Pub21 allele described herein. Suitably, the reference tomato plant lacks the modified Pub21 allele and the Pub17 allele described herein. However, suitably, the reference plant belongs to the same species as the tomato plant of the present invention, preferably the same variety as the tomato plant of the present invention. Suitably, the reference plant and the plant of the present invention are tomato plants.

[0245] Suitably, the first plant contains at least one copy, preferably two copies, of the modified Pub21 allele of the present invention. Suitably, the first plant contains at least one copy of the modified Pub21 allele and at least one copy of the modified Pub17 allele of the present invention. Suitably, the first plant contains two copies of the modified Pub21 allele of the present invention and two copies of the modified Pub17 allele of the present invention.

[0246] A method of providing a cultivated tomato plant, preferably a Solanum lycopersicum plant of the cultivated variety, a plant part or a seed, comprising: a) crossing a first plant according to any of the preceding embodiments with a second plant lacking the Pub21 allele and optionally further lacking the Pub17 allele of the present invention; b) obtaining progeny plants; c) optionally selecting said progeny plants, characterized in that said plants exhibit improved resistance to pathogens that form lesions; is provided.

[0247] Suitably, by crossing tomato plants, progeny, preferably hybrid progeny, are produced. Suitably, a method of producing hybrid tomato plants optionally comprises selecting hybrid tomato plants from progeny that exhibit increased resistance to a pathogen that forms lesions and / or comprise a decrease in the level, expression or activity of the Pub21 protein, and optionally further comprise a decrease in the level, expression or activity of the Pub17 protein. Suitably, selection of hybrid tomato plants having desired traits can be achieved using the screening techniques described above. Thus, suitably, the selecting step can be carried out by detecting the presence of the modified Pub21 allele of the invention by performing PCR using the primer pair of SEQ ID NOs: 11 and 12, and preferably subsequently sequencing the resulting amplification product. Optionally, a further selecting step can be carried out by detecting the presence of the modified Pub17 allele of the invention by performing PCR using the primer pair of SEQ ID NOs: 41 and 42, and preferably subsequently sequencing the resulting amplification product. Alternatively, the selecting step may comprise selecting plants from progeny that show a decrease in the number and / or average size of lesions when exposed to a pathogen that forms lesions, as compared to a reference plant. Suitable levels of decrease are defined elsewhere herein.

[0248] A further aspect of the invention is a method for producing a cultivated tomato plant, preferably a cultivated Solanum lycopersicum plant, that exhibits improved resistance to a pathogen that forms lesions, as compared to a reference tomato plant, comprising: a) providing seeds of a tomato plant according to the invention; b) germinating said seeds and growing them into mature fertile tomato plants; c) inducing self-pollination of said tomato plants under a) to grow tomato fruits and harvesting fertile seeds therefrom; d) growing tomato plants from the seeds harvested under c) and selecting tomato plants having increased resistance to a pathogen that forms lesions; Relates to a method comprising.

[0249] Preferably, the selection of tomato plants having a desired trait can be achieved using the screening techniques described above.

[0250] Thus, the plants exemplified herein can be used in breeding programs to develop additional at least partially lesion-forming pathogen-resistant plants, for example, commercial varieties of such plants. According to such a method, a first parent plant can be used in a cross with a second parent plant, where at least one of the first parent plant or the second parent plant contains at least one nucleic acid molecule encoding a modified Pub21 allele, and optionally, at least one of the first parent plant or the second parent plant further contains at least one nucleic acid molecule encoding a modified Pub17 allele, as described herein. One application of the process is in the production of F1 hybrid plants. Another aspect of the process is that the process can be used for the development of new parents, digenomic haploids or inbred lines. For example, with the plant lines described herein, they can be crossed with any second plant, and each of the resulting hybrid progeny can be self-pollinated and / or sibbed over about 5 to 7 generations or more generations, thereby obtaining a number of different parent lines. Next, these parent lines can be crossed with other lines, and the resulting hybrid progeny can be analyzed for advantageous traits. In this way, new lines conferring desirable traits can be identified. The various breeding methods can be used in methods including monoploidy, pedigree breeding, single-seed descent, improved single-seed descent, recurrent selection, and backcrossing.

[0251] Use A further aspect of the invention relates to the use of the tomato plants of the invention or parts thereof, or seeds, for growing tomato plants and then harvesting crop yields, seeds, and / or fruits. Preferably, the method of growing the plants is known in the art. In one embodiment, the crop yield is preferably tomato fruit.

[0252] A further aspect of the invention relates to the use of a tomato plant of the invention, or a part thereof, or seeds, for sowing in a field, greenhouse, or plastic house. In a further embodiment, the invention relates to the use of a cultivated plant, preferably a cultivated tomato plant, more preferably a Solanum lycopersicum plant, plant part or seed according to any of the preceding embodiments as a rootstock plant.

[0253] A further aspect of the invention relates to the use of propagation material resistant to pathogens forming lesions, obtainable from a tomato plant according to the invention, for growing tomato plants. Suitably, the resistance to pathogens forming the lesions can preferably be determined in an assay by assaying the propagation material. A suitable assay may be the detached leaf assay according to the examples herein. Alternatively, the resistance of the propagation material to pathogens forming lesions can be determined by molecular methods for identifying the presence of the modified Pub21 allele described herein and optionally further identifying the presence of the modified Pub17 allele. Suitably, the growth of tomato plants from the propagation material can be carried out by culturing the propagation material according to techniques known in the art.

[0254] A further aspect of the invention relates to the use of the modified Pub21 allele for conferring increased resistance to pathogens forming lesions on tomato plants lacking said allele, and optionally further to the use of the modified Pub17 allele of the invention. Suitably, further details of the modified Pub21 allele and optionally the modified Pub17 allele are presented above. Suitably, the modified Pub21 allele and optionally the modified Pub17 allele can be introduced into a plant, or the plant can be modified to contain the modified Pub21 allele and optionally the modified Pub17 allele of the invention. Suitable techniques for providing plants having the modified Pub21 allele and optionally the modified Pub17 allele of the invention are described above.

[0255] A further aspect of the invention relates to the use of a tomato plant according to the invention for transferring the trait of resistance to pathogens forming lesions to a tomato plant lacking said trait. Preferably, the trait is conferred by a modified Pub21 allele and optionally a modified Pub17 allele. Preferably, further details of the modified Pub21 allele and optionally the modified Pub17 allele are as defined above. Preferably, a method of transferring a trait to a plant is known in the art.

[0256] Kit The invention further provides a kit for detecting alleles of the trait of resistance to pathogens forming lesions in tomato plants. Preferably, a kit for detecting the modified Pub21 allele of the invention in a plant and optionally a further kit for detecting the modified Pub17 allele. In one embodiment, the plant is a tomato plant.

[0257] Preferably, such kits can be used in the screening methods above.

[0258] Suitably, the kit comprises at least one PCR primer pair having a forward primer and a reverse primer that specifically bind to the Pub21 coding sequence. Suitably, the primers used can either specifically bind to the Pub21 gene or specifically bind to a modified Pub21 allele. Suitably, the primer that binds to the Pub21 gene can bind to a region of the gene adjacent to the modification, preferably adjacent to the SNP at position 890 of SEQ ID NO: 1. Therefore, suitably, in PCR using such primers, if subsequently present, sequencing is used to identify the modified allele. Suitably, the presence of the modification can be directly detected by a primer that specifically binds to the modified Pub21 allele. Suitably, no subsequent sequencing step is required. Suitably, the kit may comprise a PCR primer pair comprising forward and reverse primers that are complementary to the Pub21 coding sequence. Suitably, the forward primer consists of SEQ ID NO: 11. Suitably, the reverse primer consists of SEQ ID NO: 12. Therefore, suitably, the modified Pub21 allele can be detected using the kit, preferably by subsequent sequencing of the resulting amplification product. Suitably, in such embodiments, the kit is intended for use in gene-specific PCR.

[0259] Suitably, the resulting amplification product is generated from PCR. Suitably, the amplification product is sequenced and contains an SNP from T to A at position 890 of SEQ ID NO: 1 (wild-type Pub21 allele) or the corresponding position in an ortholog or homolog sequence, for example. Therefore, suitably, the SNP is used as a marker, and preferably, the T890A mutation is used as a marker, preferably as a marker for pathogen resistance forming a lesion.

[0260] Suitably, the kit may alternatively comprise a pair of PCR primers, a forward primer and a reverse primer, that specifically bind to the modified Pub21 allele of the present invention. Suitably, the forward primer specifically binds to the modified Pub21 allele of the present invention. Suitably, the forward primer is complementary to the modified Pub21 sequence. Suitably, the forward primer consists of SEQ ID NO: 36. Suitably, the reverse primer consists of SEQ ID NO: 38. Suitably, the kit may further comprise a second reverse primer that specifically binds to the wild-type Pub21 allele. Suitably, the second reverse primer is complementary to the unmodified Pub21 sequence. Suitably, the second reverse primer consists of SEQ ID NO: 37. Suitably, the kit may comprise three primers in total; a forward primer according to SEQ ID NO: 36, a first reverse primer according to SEQ ID NO: 38 and a second reverse primer according to SEQ ID NO: 37. Thus, suitably, the kit, if present, can detect both the modified Pub21 allele and the wild-type Pub21 allele.

[0261] Suitably, in such an embodiment, the kit is for use in allele-specific PCR, suitably, particularly, for example, competitive allele-specific PCR, known as KASP PCR as described in (Semagn et al. 2014). Thus, suitably, each reverse primer comprises an indicator molecule, such as a fluorescent molecule. Suitably, the indicator molecule is linked to the reverse primer, suitably, the first reverse primer and the second reverse primer. Suitable fluorescent molecules may be FAM or HEX. Suitably, in one embodiment, the first reverse primer comprises FAM and the second reverse primer comprises HEX.

[0262] In embodiments that include the modified Pub21 allele and the additional Pub17 allele, the additional primer set used can either specifically bind to the Pub17 gene or specifically bind to the modified Pub17 allele. Preferably, the primer that binds to the Pub17 gene can bind to a region of the gene adjacent to the modification, preferably adjacent to the SNP at position 1477 of SEQ ID NO: 39. Therefore, preferably, in PCR using such primers, subsequent sequencing is used to identify the modified allele, if present. Preferably, the primer that specifically binds to the modified Pub17 allele can directly detect the presence of the modification. Preferably, the subsequent sequencing step may not be required. Preferably, the kit may include a pair of PCR primers, a forward primer and a reverse primer, that are complementary to the Pub17 coding sequence. Preferably, the forward primer consists of SEQ ID NO: 42. Preferably, the reverse primer consists of SEQ ID NO: 41. Therefore, preferably, the modified Pub17 allele can be detected using the kit, preferably by subsequent sequencing of the obtained amplification product. Preferably, in such embodiments, the kit is for use in gene-specific PCR.

[0263] Preferably, the resulting amplification product is generated from PCR. Preferably, the amplification product is sequenced and contains an A-to-T SNP at position 1477 of SEQ ID NO: 39 (wild-type Pub17 allele) or the corresponding position in, for example, an ortholog or homolog sequence. Therefore, preferably, the SNP is used as a marker, and preferably, the A1477T mutation is used as a marker, preferably as a marker for pathogen resistance that forms lesions.

[0264] Suitably, the kit may alternatively comprise a pair of PCR primers, a forward primer and a reverse primer, that specifically bind to the modified Pub17 allele of the present invention. Suitably, the forward primer specifically binds to the modified Pub17 allele of the present invention. Suitably, the forward primer is complementary to the modified Pub17 sequence. Suitably, the forward primer consists of SEQ ID NO: 44. Suitably, the reverse primer consists of SEQ ID NO: 45. Suitably, the kit may further comprise a second forward primer that specifically binds to the wild-type Pub17 allele. Suitably, the second forward primer is complementary to the unmodified Pub17 sequence. Suitably, the second forward primer consists of SEQ ID NO: 43. Suitably, the kit may comprise three primers in total; a first forward primer according to SEQ ID NO: 44, a reverse primer according to SEQ ID NO: 45 and a second forward primer according to SEQ ID NO: 43. Thus, suitably, the kit, if present, can detect both the modified Pub17 allele and the wild-type Pub17 allele.

[0265] Suitably, in such embodiments, the kit is intended for use in allele-specific PCR, suitably, particularly, for example, competitive allele-specific PCR, known as KASP PCR as described in (Semagn et al. 2014). Thus, suitably, each forward primer comprises an indicator molecule, such as a fluorescent molecule. Suitably, the indicator molecule is linked to the forward primer, suitably, the first forward primer and the second forward primer. Suitable fluorescent molecules may be FAM or HEX. Suitably, in one embodiment, the first forward primer comprises FAM and the second forward primer comprises HEX.

[0266] Thus, suitably, the present invention further discloses the use of the SNP markers according to the present invention for the diagnostic selection and / or genotyping of alleles of the trait of pathogen resistance that forms lesions in cultivated plants, particularly cultivated tomato plants, more specifically cultivated Solanum lycopersicum plants.

[0267] The present invention relates to the use of the SNP markers according to the present invention for identifying the presence of alleles of the trait of pathogen resistance forming lesions in plants according to the present invention, in particular cultivated tomato plants, more specifically Solanum lycopersicum plants, and / or for monitoring the gene transfer of alleles of the trait of pathogen resistance forming lesions into cultivated plants according to the present invention, described herein according to the present invention, in particular cultivated tomato plants, more specifically Solanum lycopersicum plants.

[0268] Preferably, the SNP marker is identified by one of the above PCR methods, preferably using the above primers.

[0269] Preferably, the kit may further comprise other components suitable for carrying out PCR, such as polymerase, salts, buffers, instructions for use, etc.

[0270] A further aspect of the present invention relates to an amplification product obtained from PCR comprising the primer pair that correlates with the trait of pathogen resistance forming lesions and co-segregates with the trait of pathogen resistance forming lesions or the disclosed marker. Preferably, the amplification product is a nucleic acid.

[0271] A further aspect of the present invention is a polynucleotide having at least 70% identity with the amplification product, or preferably hybridizing to the amplification product with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% identity to the amplification product. Preferably, the amplification product can be used to generate new primers and / or probes for identifying modified Pub21 alleles. Preferably, the amplification product can be used to generate new primers and / or probes for further identifying modified Pub17 alleles. Preferably, these are induced markers or probes that are genetically related to the trait of pathogen resistance forming lesions. Preferably, such induced markers or probes can be equally used to identify plants having increased resistance to pathogens forming lesions.

Examples

[0272] Materials and Methods Plant Materials Two different tomato varieties were used in this experiment: cv. Micro-Tom (MT) and cv. Moneymaker (MM). MT seeds were obtained from Beekenkamp Plants B.V. (Maasdijk, The Netherlands).

[0273] Development of the Micro-Tom EMS Population Assuming that the tomato cultivar Micro-Tom (MT) offers advantages such as, for example, small size, the potential to grow at high density, and a short life cycle (Meissner et al. 1997), MT was selected as the tomato cultivar for the EMS population in our laboratory (Yan et al. 2021). Overall, five batches of approximately 1000 MT seeds (M0) were pre-soaked in distilled water for 8 hours and treated overnight with 1% EMS dilution. The resulting M1 seeds were thoroughly washed with distilled water and sown in the greenhouse. The plants were grown at 60% relative humidity and a day / night temperature of 21°C / 19°C during a 16-hour day / 8-hour night regime. Three-week-old seedlings were individually transplanted into 14-cm pots and grown until ripe fruits could be harvested. The collected M2 seeds were surface-sterilized with 2% HCl (hydrogen chloride), followed by treatment with a 10% trisodium phosphate (TSP) solution for at least 1 hour, and then air-dried. From the first two batches, 5 to 10 fruits per plant were harvested. However, for the last three batches, all developed fruits were harvested to collect more seeds.

[0274] Gray mold (Botrytis cinerea) disease assay The detached leaf assay (DLA) was performed according to a modified version of the potato DLA described by Sun et al. (2017). The DLA for MT plants consisted of collecting the middle leaflets of the third leaf from each plant in the 20 / M2 family and placing them in square Petri dishes containing water agar medium (in MilliQ® water, 15 g / L of micro agar) at 6 leaflets / Petri dish. The DLA for MM consisted of collecting the third leaf (the left, middle, and right leaflets of three shoot tips) from 6-week-old plants and placing all three leaflets in square Petri dishes prepared as above. The leaves were inoculated abaxial side with 5 to 6 two-μl droplets of the Botrytis cinerea strain B05.10 (Amselem et al. 2011). The spores were added to a mixture of PDA (potato dextrose agar) and PDB (potato dextrose broth) at the final concentration of half-strength PDB (12 g / l) and 1×10 6Suspended under the conditions of 0.3% agar at a density of spores / ml. After inoculation, the dishes were grouped (16 - 18 Petri dishes per group), and each group was placed on a tray containing a sheet of wet filter paper. The tray was placed inside a plastic bag to obtain 100% humidity. They were maintained at 18 °C (16 hours of light / 8 hours of darkness). On the 3rd and 4th days post - inoculation (dpi), a digital caliper was used to measure the lesion diameter on the leaves (Mitutoyo nr 500 - 161 - 30, Mitutoyo Nederland B.V., Veenendaal, The Netherlands).

[0275] The stem assay was performed by cutting the third, fourth, and fifth leaves from 6 - week - old plants and leaving leaf - stalk fragments approximately 2.5 cm long. On the leaf - stalk surface, 10 μl of Botrytis cinerea strain B05.10 was inoculated at a density of 1×10 6 spores / ml. The plants were maintained in a high - humidity plastic tent for 24 hours. On the 3rd, 6th, 10th, 14th, 17th, and 21st days post - inoculation, the symptoms were scored. The score was based on the following 0 - 4 scale: 0: The unchanged leaf - stalk fragment is equivalent to the mock treatment; 1: The leaf - stalk fragment is partially or completely thinned with brown discoloration; 2: External stem infection has started with small brown rings observed on the main stem around the axils of the inoculated leaf - stalk fragments; 3: The brown rings become irregular and are spreading upward and downward along the stem, indicating spread of infection throughout the stem; and 4: Sufficient main - stem infection and wilting of the plant, accompanied by internal browning, disintegration of the stem tissue, and finally folding and overturning of the plant top. In addition, leaf - stalk detachment was recorded.

[0276] Alternaria solani disease assay The detached leaf assay (DLA) was performed according to a modified version of the potato DLA described by Sun et al. (2017). The DLA for MT followed the same process as for Botrytis cinerea. The DLA for MM consisted of collecting the leaflets at the shoot tips of the third, fourth, and fifth true leaves from 6-week-old plants, and placing all three leaflets in square Petri dishes prepared as above. The leaves were inoculated on the adaxial side with 5–6 ten-μl droplets of the A. solani isolate “altNL03003” (accession number CBS143772). Spore collection was performed according to the method reported previously (Wolters et al. 2019). The spores were suspended in a mixture of PDA (potato dextrose agar) and PDB (potato dextrose broth) at the final concentration of half-strength PDB (12 g / l) and 0.3% agar at a density of 1×10 5 spores / ml. After inoculation, the dishes were grouped (16–18 Petri dishes per group), and each group was placed in a tray containing a sheet of moist filter paper. The tray was placed inside a plastic bag to obtain 100% humidity. They were maintained at 18 °C (16 h light / 8 h dark). On days 5 and 7 post inoculation (dpi), the lesion diameter on the leaves was measured using a digital caliper (Mitutoyo nr 500-161-30, Mitutoyo Nederland B.V., Veenendaal, The Netherlands).

[0277] Additional disease assays Screening for modified susceptibility to tomato powdery mildew (Pseudoidium neolycopersici) Wageningen isolate On-Ne was performed as described by Bai et al. (2003). Disease assays using the Phytophthora infestans isolates PIC99177 or C65 were performed using DLA as described by Sun et al. (2016).

[0278] Development of segregating populations A mutant M2042 showing reduced susceptibility to Botrytis cinerea was self-pollinated until M4 lines were obtained. Four M4 lines (M2042-1-1, M2042-1-2, M2042-1-4 and M2042-1-5) were fixed due to a mutation in the tomato gene Pub17 (Solyc02g072080) that confers reduced susceptibility. M4 plant M2042-1-2-12 was crossed with MM, and progeny (homozygous pub17 mutants) from F2 plants 1 - 66 were used in disease assays.

[0279] Also, M4 line M2042-1-3 showed lower susceptibility but segregated due to an (unrelated) additional mutation. This additional mutation (shown to be a mutation in the tomato gene Pub21 as described below) resulted in different plant morphology (lighter green, smaller leaves) in combination with an even more powerful reduction in lesion size after Botrytis infection. The M4 plant (M2042-1-3-10) fixed for stronger resistance and small light green leaves was crossed with MM and F1 seeds were collected. Five F1 plants were then self-pollinated and F2 seeds were collected. Single and double mutant F3, F4 and F5 lines were selected.

[0280] Screening for d and sp mutations from Micro-Tom The tomato cultivar Micro-Tom contains at least two mutations involved in small-sized plants in the genes Self-Pruning (Sp; Solyc06g074350) and Dwarf (D; Solyc02g089160) (Marti et al. 2006). A high-resolution melting (HRM) assay was developed for the identification of Micro-Tom SNPs, which are the determinants of the (sp, self-pruning) phenotype. The forward and reverse primers adjacent to exon 2, SP_F (TGAGACGGACAAGATGACATGA) SEQ ID NO: 7 and SP_R (TGTCATTTCCCCTTCCAAAGT) SEQ ID NO: 8, were designed to obtain a 218 bp PCR product. These primers were used in PCR with the LightScanner® System (Idaho Technology) with Phire™ Hot Start DNA Polymerase (ThermoFischer) and LCGreen® Plus+ (BioChem) under amplification conditions of 30 seconds at 98°C, 40 cycles of 5 seconds at 98°C, 5 seconds at 57°C, and 15 seconds at 72°C, followed by 30 seconds at 72°C, 30 seconds at 94°C, 30 seconds at 25°C, and subsequent cooling to 10°C. Three different genotypes (homozygous SpSp, heterozygous Spsp, and homozygous spsp) could be distinguished using melting curve analysis.

[0281] For the identification of Micro-Tom SNPs that are factors of the dwarf (d) phenotype in the F2 population, CAPS markers were used together with primer C (GGAACTTGGTGTAGCAGAAATTTCCACATTTC) SEQ ID NO: 9 in exon 8 and primer D (TTAGTGAGCTGAAACTCTAATCCGTAGAC) SEQ ID NO: 10 in exon 9 (Marti et al. 2006). PCR was carried out using DreamTaq polymerase at a melting temperature of 60°C. Next, the 243 bp PCR product was incubated with the restriction enzyme HpyCH4V at 47°C for 4 hours. Thereafter, the product was run on a 1.5% TBE gel at 110 V for 1 hour. Digestion of the PCR product into 152 bp and 91 bp fragments indicated the presence of the wild-type (MM-like) allele, while the undigested product indicated the presence of the MT allele.

[0282] Identification of mutant genes by bulked segregant analysis combined with whole-genome sequencing (BSA-WGS) (Pub17 and Pub21) A total of 205 F2 plants from a cross between the EMS mutant M2042-1-3-10 and the wild-type susceptible cultivar Moneymaker (MM) were tested for resistance to the grey mould fungus (B. cinerea) by detached leaf assay. Lesion sizes could be distinguished into three classes: large, medium and small. The distribution of plants within the classes (9:6:1) supports the hypothesis that two mutant genes are factors and / or necessary for the extreme resistance phenotype. Plants showing either very small or very large lesion diameter sizes were selected and inoculated again to confirm resistance or susceptibility. Finally, 13 plants with the smallest lesions and 14 plants with the largest lesions were selected. DNA was isolated from leaf samples of these plants using the DNeasy Plant Mini Kit (Qiagen). DNA concentrations were measured using NanoDrop® and Qubit® (ThermoFisher Scientific). DNA from resistant and susceptible F2 plants was pooled equimolarly, resulting in two DNA pools M2042-3R and M2042-3S. These DNA pools were sequenced by Novogene Ltd (Hong Kong) (whole-genome resequencing, WGS). In this case, a 350 bp insert DNA library was prepared. Paired-end sequencing was performed on the Illumina® HiSeq platform with a read length of 150 bp at each end (PE150) and a genomic coverage of approximately 35-fold for each sample. Reads were mapped to the tomato Heinz reference genome (version SL2.50), and SNP detection was performed using SAMtools.

[0283] A total of 2,028,009 SNPs were identified. For each pool, the number of reads containing the reference (Heinz) allele and the number of reads containing the alternative allele were recorded per SNP position. Several calculations were performed: 1) the total number of reference allele (REF) reads and alternative allele (ALT) reads per SNP position per pool (total number of reads = coverage = read depth); 2) the percentage of alternative alleles per SNP position per pool; %ALT = (ALT / [REF + ALT]) * × 100; 3) the difference in the percentage of alternative alleles per SNP position between the resistant and sensitive pools (%ALT[R] - %ALT[S]). Next, SNP filtering per chromosome was performed as follows: 1) only SNPs were retained when the total number of reads in the resistant pool (M2042 - 3R) was ≥ 35 (coverage was at least 35); 2) only SNPs were retained when %ALT[R] was ≥ 85. Theoretically, the alternative allele should be present at 100% in the resistant pool. However, a lower percentage was selected to be on the safe side. After this, each chromosome was examined for the occurrence of generally contiguous regions with a large difference in the percentage of alternative alleles per SNP position between M2042 - 3R and M2042 - 3S (%ALT[R] - %ALT[S] > 50).

[0284] For chromosome 2, the region from 33 to 47 Mbp (SL2.50 reference genome) met this criterion. This region contains the Pub17 gene. SNPs were identified in the chromosome 2 region: a [T / A] SNP at position SL2.50ch02:41352738 in the gene Solyc02g072080 (SlPub17) that results in a premature stop codon R493 * . In the M2042 - 3R pool, the frequency of the mutant allele of Pub17 was 100%. This mutant allele has previously been found to confer moderate resistance to the gray mold fungus (B. cinerea) (details on the identification and confirmation of the Pub17 mutation are presented below).

[0285] In addition, the short arm of chromosome 11 showed a large difference in the percentage of alternative alleles around the SNP position between the M2042-3R and M2042-3S pools. The following filtering consisted of the selection of SNPs when the alternative alleles were absent in the wild-type Micro-Tom bulk (MTWT) as well as in the resistant and sensitive pools (M2042R and M2042S) obtained to identify the Pub17 mutation (details on the identification and confirmation of the Pub17 mutation are presented below), but were present in the pools M2042-3R and M2042-3S of the extremely resistant M2042-1-3-10. Subsequently, the SNPs were filtered to select non-synonymous SNPs within the exons of the annotated genes when the alternative alleles were present in the resistant and sensitive pools (M2042-3R and M2042-3S), but were absent in the wild-type Micro-Tom pool (MTWT). In this way, one SNP (T890A) was found within the coding sequence of the gene Solyc11g006030 (SlPub21), which results in a premature stop codon (L297 * ) in the deduced protein sequence. The presence of the SNP was confirmed by sequencing the 248 bp PCR product obtained using the adjacent primer AWPUB21F (5’-CATCAAGTGAAAATAACAAGAA-3’) SEQ ID NO: 11, and AWPUB21R (5’-CAAAATTGAAGTTGAACATTC-3’) SEQ ID NO: 12.

[0286] Identification of the mutated gene by bulk segregant analysis combined with whole-genome sequencing (BSA-WGS) (Pub17 alone) Overall, 200 F2 plants from a cross between the EMS mutant M2042 and the wild-type susceptible cultivar (Moneymaker) were assayed for resistance to the grey mould pathogen (B. cinerea). Plants showing either very small lesion diameter sizes or very large lesion diameter sizes were selected and re-inoculated to confirm resistance or susceptibility. Finally, 18 plants with the smallest lesions and 18 plants with the largest lesions were selected. DNA was isolated from leaf samples of these plants and from 10 individual wild-type MT plants using the DNeasy Plant Mini Kit (Qiagen). DNA concentrations were measured using NanoDrop® and Qubit® (ThermoFisher Scientific). DNA from resistant and susceptible F2 plants, as well as wild-type MT plants, was pooled equimolarly, resulting in three DNA pools: M2042R, M2042S and MTWT. These DNA pools were sequenced by Novogene Ltd (Hong Kong) (whole-genome re-sequencing, WGS). In this case, a 350 bp insert DNA library was prepared. Paired-end sequencing was performed on the Illumina® HiSeq platform with a read length of 150 bp at each end (PE150) and a genomic coverage of approximately 35-fold for each sample. Reads were mapped to the tomato Heinz reference genome (version SL2.50), and SNP detection was performed using SAMtools.

[0287] Overall, 2,659,728 SNPs were identified. For each pool, the number of reads containing the reference (Heinz) allele and the number of reads containing the alternative allele were recorded per SNP position. Several calculations were performed: 1) the total number of reference allele (REF) reads and alternative allele (ALT) reads per SNP position per pool (total number of reads = coverage = read depth); 2) the percentage of alternative alleles per SNP position per pool; %ALT = (ALT / [REF + ALT]) *100; 3) The difference in the percentage of alternative alleles per SNP position between the resistant and susceptible pools (%ALT[R]-%ALT[S]). Next, SNP filtering per chromosome was performed as follows: 1) Only SNPs were retained when the total number of reads in the resistant pool (M2042R) was ≧35 (coverage was at least 35); 2) Only SNPs were retained when %ALT[R] was ≧80. Theoretically, the alternative allele should be present at 100% in the resistant pool. However, a lower percentage was selected to be on the safe side. After this, each chromosome was examined for the occurrence of a generally continuous region with a large difference in the percentage of alternative alleles per SNP position between M2042R and M2042S (%ALT[R]-%ALT[S]>50). For chromosome 2, there was a 6.6 Mbp region that met this criterion between position 40900926 and position 47531242 (SL2.50 reference genome). The next filtering consisted of the selection of SNP positions within the exons of annotated genes when the alternative allele was present in the resistant and susceptible pools (M2042R and M2042S) but absent in the wild-type Micro-Tom pool (MTWT). In the chromosome 2 region, SNPs were identified at SNP positions that were filtered when coverage was ≧35, %ALT[R]≧80, and (%ALT[R]-%ALT[S]>50): premature stop codon R493 * The [T / A] SNP at position SL2.50ch02:41352738 in the gene Solyc02g072080 (SlPub17) that results in

[0288] Associate the Pub17 mutation with Botrytis resistance (Pub17) For individual F2 plants of the M2042R pool and the M2042S pool, the sequence of the candidate gene Pub17 was examined for the presence and homozygosity of alternative SNPs. The progeny were tested for Botrytis resistance, and it was examined whether segregation of disease resistance occurred, associating resistance with the mutation.

[0289] Determination of gene expression levels by RT-qPCR (Pub17 and Pub21) Gene expression levels were determined by performing RT-qPCR on plant cDNA synthesized using the iScript cDNA Synthesis Kit (BioRad) for RNA extracted through the RNeasy Plant Mini Kit (Qiagen). Primers specific for Pub17, PUB17_qPCR_Fw1 (5’-GGAAGTGAAGGTGTTGCGA-3’) SEQ ID NO: 13 and PUB17_qPCR_Rv1 (5’-GCAATGAGGAAATGGCAGTAG-3’) SEQ ID NO: 14, were developed and a 100 bp PCR product was obtained. Additionally, primers specific for Pub21, PUB21_qPCR_Fw (5’-TGAAGAAGGGAAACAAAAGGCT-3’) SEQ ID NO: 15, and PUB21_qPCR_Rv (5’-AGTTGAACATTCTGTGGCCA-3’) SEQ ID NO: 16, were developed and a 100 bp PCR product was obtained. Along with the primers Ef1a-Fw (5’-ATTGGAAACGGATATGCCCCT-3’) SEQ ID NO: 17 and Ef1a-Rv (5’-TCCTTACCTGAACGCCTGTCA-3’) SEQ ID NO: 18, elongation factor 1 alpha (Ef1α) was used as a reference gene and a 101 bp PCR product was obtained. RT-qPCR was performed using a CFX96 Real-Time PCR Instrument (BioRad), where two technical replicates per sample were used. The relative expression of Pub21 was calculated by the ΔΔC T method (Livak & Schmittgen 2001).

[0290] RNAi and CRISPR transformation for candidate gene confirmation (Pub21) Two Pub21 RNAi constructs were generated using the binary vector pHellsgate8 (Helliwell and Waterhouse 2003). This vector contains the CaMV 35S promoter driving the expression of inverted repeats and the kanamycin resistance gene as a selectable marker. Primers were designed to amplify a fragment of Pub21 from the tomato gDNA sequence of cv. Moneymaker. RNAi fragment 1 was amplified using the forward primer caccATTGAAGCTCGACGAGGGAA (SEQ ID NO: 19) and the reverse primer CGTCATCGCCGATAACAAGT (SEQ ID NO: 20) to obtain a 195 bp product (SEQ ID NO: 5) targeting the U-box domain of the Pub21 protein. RNAi fragment 10 was amplified using the forward primer caccCGGTGATATACTCTATTATCTC (SEQ ID NO: 21) and the reverse primer GTCAATCCATGTTCATAAGC (SEQ ID NO: 22) to obtain a 205 bp product (SEQ ID NO: 6) targeting the ARM repeat domain. The forward primers contained CACC at the 5’ end for directional cloning into the pENTR / D-TOPO (ThermoFisher) vector. Primers were used in blunt-end PCR using Phusion™ High-Fidelity DNA Polymerase (ThermoFisher), and the PCR products were cleaned up using the QIAquick PCR Purification Kit (Qiagen). The resulting DNA was cloned into pENTR / D-TOPO and transformed into E. coli DH5α. Cultures were plated on LB medium containing spectinomycin (100 μg / ul) and grown overnight at 37 °C. Plasmid DNA of the clones was sequenced to verify the presence of the correct insert.

[0291] The CRISPR / Cas9 construct was designed to create deletions within the Pub21 coding sequence using three sgRNAs flanking the Cas9 endonuclease gene and the NPTII plant selectable marker. The sgRNAs were designed using the online predictor tool of CCTop-CRISPR / Cas9 targets (https: / / crispr.cos.uni-heidelberg.de / ; Stemmer et al. 2015) and the tomato genome (Solanum lycopersicum cv. Heinz SL2.50) as a reference for target site evaluation. From the list of sgRNAs presented by the online predictor, only sgRNAs without exon off-target sites were selected. Furthermore, the selected sgRNAs were refined by verifying that their GC content was between 30% and 80% (http: / / www.endmemo.com / bio / gc.php) and that their secondary structures were evaluated according to Liang et al. (2016) (http: / / unafold.rna.albany.edu / ?q=mfold / RNA-Folding-Form; Zuker, 2003). Additional scoring tools were used to compare, validate, and select the best four sgRNAs (https: / / sgrnascorer.cancer.gov / ; Chari et al. 2017), (https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-design; Sanson et al., 2018), (http: / / crispr.wustl.edu / ; Wong et al. 2015). The distance between the sgRNA target sites was 200 - 900 bp. The Pub21 sgRNAs were selected to target different protein domains using sgRNA1 (AAACATCGAGAAATGGATCG) SEQ ID NO: 23, sgRNA2 (AATCGATTCGTCTCAAGTAA) SEQ ID NO: 24 located within the U-box domain, and sgRNA3 (GATAGAGTGGATTGCTTTGA) SEQ ID NO: 25 located within the ARM repeat domain.The constructs were built using the Golden Gate cloning system (Engler et al. 2008). The selected sgRNAs were developed by using primers containing the sequence for the forward primer (5’-TGTGGTCTCA[sgRNA sequence]GTTTTAGAGCTAGAAATAGCAAG-3’) SEQ ID NO: 26 and the sequence for the reverse primer (5’-TGTGGTCTCAAGCGTAATGCCAACTTTGTAC-3’) SEQ ID NO: 27. Each forward and reverse primer pair was subjected to a level 0 reaction together with the plasmid plCH86966 containing the kanamycin resistance gene as a template. Next, the level 0 product was subjected to PCR clean-up (QIAquick PCR Purification Kit, Qiagen) and a level 1 reaction was constructed using the clean product. The level 1 reaction consisted of combining the plasmid pICHSL01009 (AtU6 promoter), the plasmids designated for each guide position (pICH47751, pICH47761, pICH47772, and pICH47781), and the clean product from the level 0 reaction. sgRNA3 was cloned twice in pICH47772 and pICH47781 of the level 1 plasmid. The reactions were performed by digesting the designated plasmids with BsaI / Eco31I and religating with T4 DNA (Thermo Scientific, Bleiswijk, The Netherlands) and cloned into Escherichia coli (E. coli) DH5α as follows: pICH47751 (position 1 of sgRNA1), pICH47761 (position 2 of sgRNA2), pICH47772 (position 3 of sgRNA3), and pICH47781 (position 4 of sgRNA3). The plasmids were purified using the Qiagen® Plasmid Prep Kit (Qiagen Benelux B.V., Venlo, The Netherlands).The level 1 construct was digested with BpiI / BpsI together with NPTII (pICH47732), Cas9 (pICH47742), and linker (pICH41822), and recloned into the binary vector pAGM4723 of level 2 by religation with T4 DNA, and cloned into Escherichia coli (E. coli) DH5α. The level 2 construct was purified, sequenced, and verified.

[0292] Two RNAi constructs and one CRISPR / Cas9 construct against Pub21 were transformed into electrocompetent Agrobacterium tumefaciens AGL1+virG cells. Transformation of tomato cv. MM was performed as previously described by Huibers et al. (2013).

[0293] Analysis of CRISPR transformants and RNAi transformants (Pub21) To determine the presence of mutations in the CRISPR transformants, DNA was isolated from young leaves using CTAB buffer (1 M Tris-HCl pH 7.5, 0.5 M EDTA pH 8.0, 5 M NaCl, 2% CTAB). Next, genomic DNA was subjected to gene-specific PCR using DreamTaq DNA polymerase (Thermo Scientific, Bleiswijk, The Netherlands) with the forward primer FWD_MR_GY_CRISPR (5’-TCCATCTCATTTTCTTTGTCCGA-3’) SEQ ID NO: 28 and the reverse primer REV_AW_GY_CRISPR (5’-TGCTGAGATCCTCCAAAACTATCA-3’) SEQ ID NO: 29, which flank all three sgRNAs and yield a 1358 bp PCR product for the wild-type (WT) allele. In addition, primers AWPUB21F2 (5’-AATAAATTCACTTTTCCCATATA-3’) SEQ ID NO: 30 and AWPUB21R2 (5’-GCCGATAACAAGTCCTTC-3’) SEQ ID NO: 31, which flank sgRNA1 and sgRNA2 and yield a 705 bp PCR product, were used to identify and confirm small indels. The PCR products were sent to Macrogen Europe (Amsterdam, The Netherlands) for sequencing.

[0294] To confirm the integration of the T-DNA of the silencing construct into the genome of the RNAi transformant, PCR was performed to detect the presence of the NPTII gene and the 35S promoter. A 421-bp PCR product was obtained using the forward primer NPTII_421_Fw (5’-GAAGGGACTGGCTGCTATTG-3’), SEQ ID NO: 32, and the reverse primer NPTII_421_Rv (5’-AATATCACGGGTAGCCAACG-3’), SEQ ID NO: 33, which are the forward and reverse primers used to detect the NPTII gene. A 597-bp region was amplified using the forward primer 35S_597_Fw (5’-TACAAAGGCGGCAACAAAC-3’), SEQ ID NO: 34, and the reverse primer 35S_597_Rv (5’-AGCAAGCCTTGAATCGTCC-3’), SEQ ID NO: 35, which are the forward and reverse primers used to detect the 35S promoter.

[0295] RNAi and CRISPR Transformation (Pub17) for Candidate Gene Confirmation Two Pub17 RNAi constructs were generated using the binary vector pHellsgate12 (Helliwell and Waterhouse 2003). This vector contains the CaMV 35S promoter driving the expression of inverted repeats and the kanamycin resistance gene as a selectable marker. Primers were designed to amplify fragments of the Pub17 from the tomato gDNA sequence of cv. Moneymaker. The primer sequences are shown in Table 13. RNAi fragment 7 was amplified using the forward primer caccGGTGTGGGAAATTGATGGCA (SEQ ID NO: 57) and the reverse primer AAACGGCAGCCTTTTACCTG (SEQ ID NO: 58) to obtain a 176bp product targeting the UND domain of the Pub17 protein. RNAi fragment 3 was amplified using the forward primer caccAGCCCACATCCTCAGTTCTC (SEQ ID NO: 55) and the reverse primer CATATGTCTGCCCTGTTGCC (SEQ ID NO: 56) to obtain a 240bp product targeting the U-box domain. The forward primers contained CACC at the 5’ end for directional cloning into the pENTR / D-TOPO (ThermoFisher) vector. The primers were used in blunt-end PCR using Phusion™ High-Fidelity DNA Polymerase (ThermoFisher), and the PCR products were cleaned up using the QIAquick PCR Purification Kit (Qiagen). The resulting DNA was cloned into pENTR / D-TOPO and transformed into E. coli DH5α. Cultures were plated on LB medium containing spectinomycin (100 μg / ul) and grown overnight at 37°C. Plasmid DNA of the clones was sequenced to verify the presence of the correct insert.

[0296] The CRISPR / Cas9 construct was designed to create deletions within the Pub17 coding sequence using four sgRNAs flanking the Cas9 endonuclease gene and the NPTII plant selectable marker. The sgRNAs were designed using the online predictor tool of CCTop-CRISPR / Cas9 targets (https: / / crispr.cos.uni-heidelberg.de / ; Stemmer et al. 2015), with the tomato genome (Solanum lycopersicum cv. Heinz SL2.50) used as a reference for target site evaluation. From the list of sgRNAs presented by the online predictor, only sgRNAs without exon off-target sites were selected. Furthermore, the selected sgRNAs were refined by verifying that their GC content was between 30% and 80% (http: / / www.endmemo.com / bio / gc.php) and that their secondary structures were evaluated according to Liang et al. (2016) (http: / / unafold.rna.albany.edu / ?q=mfold / RNA-Folding-Form; Zuker, 2003). Additional scoring tools were used to compare, validate, and select the best four sgRNAs (https: / / sgrnascorer.cancer.gov / ; Chari et al. 2017), (https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-design; Sanson et al., 2018), (http: / / crispr.wustl.edu / ; Wong et al. 2015). The distance between the sgRNA target sites was approximately 600 bp.The sgRNAs were selected to target different protein domains using guide 1 (GGAAATGACCTGAAATCGAA) SEQ ID NO: 51 located within the UND domain, guide 2 (TTCTATATCGAGGTGGATGG) SEQ ID NO: 52 located within the U-box domain, and guides 3 (GAGATTTGGGCACACCACAG) SEQ ID NO: 53 and 4 (CAGGAACAAAGCGCGCAAGG) SEQ ID NO: 54 located within the ARM repeat domain. Constructs were built using the Golden Gate cloning system (Engler et al. 2008). The selected sgRNAs were developed by using primers containing the sequence (5’-TGTGGTCTCA[sgRNA sequence]GTTTTAGAGCTAGAAATAGCAAG-3’) SEQ ID NO: 26 for the forward primer and the sequence (5’-TGTGGTCTCAAGCGTAATGCCAACTTTGTAC-3’) SEQ ID NO: 27 for the reverse primer. Each forward and reverse primer pair was subjected to a level 0 reaction together with the plasmid plCH86966 containing the kanamycin resistance gene as a template. Next, the level 0 product was subjected to PCR clean-up (QIAquick PCR Purification Kit, Qiagen), and a clean product was used to construct a level 1 reaction. The level 1 reaction consisted of combining the plasmid pICHSL01009 (AtU6 promoter), the plasmids designated for each guide position (pICH47751, pICH47761, pICH47772, and pICH47781), and the clean product from the level 0 reaction. The reaction was carried out by digesting the designated plasmids with BsaI / Eco31I and religating with T4 DNA (Thermo Scientific, Bleiswijk, The Netherlands) and cloned into Escherichia coli (E. coli) DH5α as follows:: pICH47751 (position 1 of sgRNA guide 1), pICH47761 (position 2 of sgRNA guide 2), pICH47772 (position 3 of sgRNA guide 3), and pICH47781 (position 4 of sgRNA guide 4).Plasmids were purified using the Qiagen® Plasmid Prep Kit (Qiagen Benelux B.V., Venlo, The Netherlands). Level 1 constructs were digested with BpiI / BpsI together with NPTII (pICH47732), Cas9 (pICH47742), and linker (pICH41822), and re-ligated with T4 DNA to construct the level 2 binary vector pAGM4723, which was then cloned into Escherichia coli DH5α. The level 2 constructs were purified, sequenced, and verified.

[0297] Two RNAi constructs and one CRISPR / Cas9 construct against Pub17 were transformed into electrocompetent Agrobacterium tumefaciens AGL1+virG cells. Transformation of tomato cv. MM was performed as previously described by Huibers et al. (2013).

[0298] Analysis of CRISPR transformants and RNAi transformants (Pub17) To determine the presence of mutations in the CRISPR transformants, DNA was isolated from young leaves using CTAB buffer (1 M Tris-HCl pH 7.5, 0.5 M EDTA pH 8.0, 5 M NaCl, 2% CTAB). Next, the genomic DNA was subjected to gene-specific PCR using DreamTaq DNA polymerase (Thermo Scientific, Bleiswijk, The Netherlands). Two different forward primers such as FWD_MR_GX_CRISPR (5’-ACGGCGTTATCTTCTGAGCT-3’) SEQ ID NO: 40 and AWPUB17_F1 (5’-AGAGAGTGGGACGCAGATT-3’) SEQ ID NO: 42 were used and individually paired with the reverse primer REV_MR_GX_CRISPR (5’-CATGCTCACACCGTTGGAAT-3’) SEQ ID NO: 41 to obtain PCR products of 1942 bp and 827 bp respectively for the wild-type (WT) allele. For sequencing, the PCR products were sent to Macrogen Europe (Amsterdam, The Netherlands).

[0299] To confirm the integration of the T-DNA of the silencing construct into the genome of the RNAi transformants, PCR was performed to detect the presence of the NPTII gene and the 35S promoter. A 421 bp PCR product was obtained with the forward primer NPTII_421_Fw (5’-GAAGGGACTGGCTGCTATTG-3’) SEQ ID NO: 32 and the reverse primer NPTII_421_Rv (5’-AATATCACGGGTAGCCAACG-3’) SEQ ID NO: 33, which are the forward and reverse primers used to detect the NPTII gene. A 597 bp region was amplified with the forward primer (5’-TACAAAGGCGGCAACAAAC-3’) SEQ ID NO: 34 and the reverse primer 35S_597_Rv (5’-AGCAAGCCTTGAATCGTCC-3’) SEQ ID NO: 35, which are the forward and reverse primers used to detect the 35S promoter.

[0300] Statistical analysis A one-way ANOVA F-test using R studio v1.1.463 (2016) was performed on the data points of each DLA experiment. Following the ANOVA test, a post hoc test was conducted using the Tukey HSD method to perform multiple pairwise comparisons.

[0301] Development of KASP markers for the Pub21 mutation The KASP™ marker assay (Semagn et al., 2014) was developed to track EMS-induced mutations in the Pub21 gene within the F2 population. The forward primer KPUB21_RT_Fw76 (5’-AGTGAAAATAACAAGAAAATTGTGTC-3’), SEQ ID NO: 36, was used in combination with two reverse primers. The first, KPUB21_RTWT_Rv1HEX (5’-GAAGGTCGGAGTCAACGGATTCCACAAGCATTTCAACAACCA-3’), SEQ ID NO: 37, is specific for the wild-type allele, while the second reverse primer, KPUB21_RTmut_Rv1FAM (5’-GAAGGTGACCAAGTTCATGCTCCACAAGCATTTCAACAACCT-3’), SEQ ID NO: 38, is specific for the Pub21 mutant allele. The reverse primer for the WT sequence was labeled with the HEX dye, while the reverse primer for the mutant sequence was labeled with the FAM dye. For the PCR KASP V4.0 2X master mix 96 / 384, Low Rox (LCG group) was used. PCR was carried out according to the KASP thermal protocol provided by the manufacturer (LCG group). Plates were read on a plate reader (Bio-Rad C1000 thermal cycler), and data were analyzed using Bio-Rad CFX Maestro 1.1.

[0302] Development of KASP markers for the Pub17 mutation The KASP (trademark) marker assay (Semagn et al. 2014) was developed to track EMS-induced mutations in the Pub17 gene within the F2 population. Two forward primers were designed, such as the K_RTWT_For1 sequence number 43: 5’-GAAGGTGACCAAGTTCATGCTGTCTGGCTTTGATAGTTGGAGTTTTGT-3’ for the wild-type allele and the K_RTmut_For1 sequence number 44: GAAGGTCGGAGTCAACGGATTGTCTGGCTTTGATAGTTGGAGTTTTGA for the pub17 mutant allele. The reverse primer K_RT_Rev705’-GTTGCTGCAGCATTTTCCCGTG-3’ sequence number 45 was used in combination with the forward primers. The forward primer for the WT sequence was labeled with the HEX dye, while the forward primer for the mutant sequence was labeled with the FAM dye. For the PCR KASP V4.02X master mix 96 / 384, Low Rox (LCG group) was used. The PCR was carried out according to the KASP thermal protocol provided by the manufacturer (LCG group). The plate was read with a plate reader (Bio-Rad C1000 thermal cycler), and the data were analyzed using Bio-Rad CFX Maestro 1.1.

[0303] Results Reduced susceptibility to Botrytis cinerea in the tomato mutant M2042 To identify the S gene against necrotrophic fungi, the Micro-Tom EMS population (Yan et al. 2021) developed at Wageningen University-Plant Breeding was screened. The EMS population consisted of 4500 M2 families, 692 of which were screened for phenotypic changes including dwarfism, light green leaves, modified leaf shape, modified flower morphology and color, and modified fruit color. The M2 families were subjected to disease tests with three pathogens each, including leaf blight (Phytophthora infestans isolate C65 or PIC99177), gray mold (Botrytis cinerea strain B05.10), and powdery mildew (Pseudoidium neolycopersici strain On-Ne). The gray mold (B. cinerea) disease assay led to the identification of M2 family M2042 (Figure 1A), and plant 1 of which showed reduced susceptibility and reduced mycelial growth compared to the WT control 9 days after inoculation. Furthermore, when the same plant from M2042 was tested for P. infestans (P. infestans), plant 1 showed smaller lesions with necrotic spots and reduced / stopped mycelial growth 14 days after inoculation compared to the wild type. The mutation in M2042 was fixed in the M4 strain, and in the subsequent Botrytis disease assay, moderate resistance was confirmed, showing a 20-30% decrease in lesion diameter compared to Micro-Tom.

[0304] Early stop codon mutation of Pub21 (Solyc11g006030) in mutant M2042 Involved in smaller lesions after infection with Botrytis cinerea, the mutation in M2042 fixed in M3 lines M2042-1-1 and M2042-1-2 (moderate resistance, designated IR) was shown to result in a premature stop codon in the gene Solyc02g072080 (Pub17) (see below). However, the progeny of M3 plant M2042-1-3 showed segregation of highly resistant (R) M4 plants (a.o. M2042-1-3-10 and M2042-1-3-14; Figure 1A) in addition to moderately resistant (IR) plants (a.o. M2042-1-3-5). This suggested the role of another unrelated mutation in addition to the mutation identified in Solyc02g072080 (Pub17). To identify the additional mutation in M2042-1-3-10, this M4 plant was crossed with the susceptible cultivar Moneymaker (MM) (Figure 1B). Five F1 plants were self-pollinated to obtain segregating F2 progeny. Subsequently, the additional mutation was mapped through bulk segregant analysis and whole-genome sequencing (BSA-WGS) approaches. A segregating F2 population of 205 plants was first phenotyped by measuring the lesion diameter of all plants to construct three different pools of highly resistant, moderately resistant, and susceptible plants to Botrytis cinerea. First, DLA was performed on all 205 plants, and an external inspection of the plants showing the minimum lesion diameter, medium lesion diameter, and maximum lesion diameter was carried out. This was followed by a second confirmation and further selection of the plants found under extreme conditions. Plants with extreme phenotypes were selected for two pools, resistant (M2042-3R) and susceptible (M2042-3S), with 13 plants and 14 plants per pool, respectively. In pool M2042-3R, in addition to the mutation in the gene Solyc02g072080 (Pub17), another interesting non-synonymous mutation was identified through whole-genome sequencing and further filtering of SNPs as described in the Materials and Methods. This mutation consisted of a T→A SNP at position 890 in the coding region of the gene Solyc11g006030, which results in a premature stop codon L297 * and was composed of a T→A SNP at position 890 in the coding region of the gene Solyc11g006030 (Figure 2). This gene is the tomato ortholog of Pub21.

[0305] Early stop codon mutation of PUB17 (Solyc02g072080) in mutant M2042 The mutation found in M2042, which is involved in smaller lesions (moderate resistance, designated as IR) after infection with Botrytis cinerea, was mapped through bulk segregant analysis and whole-genome sequencing (BSA-WGS) approaches. A segregating F2 population of 200 plants (Figure 1A) obtained from the cross of M2042-1-2-12 with MM was first phenotyped by measuring the lesion diameter of all plants, and two different pools of resistant and susceptible plants to Botrytis cinerea were constructed. First, DLA was performed on all 200 plants, and an external inspection of the plants showing the minimum and maximum lesion diameters was carried out. Subsequently, a second confirmation and further selection of the plants found under extreme conditions were performed. Plants with extreme phenotypes were selected for the two pools of "resistant" and susceptible, and 18 plants were selected per pool. As a control, a third pool consisting of wild-type Micro-Tom plants was developed. Interesting non-synonymous mutations were first identified through whole-genome sequencing and further filtering of SNPs as described in the materials and methods. The mutation was an A→T SNP at position 1477 in the coding region of the gene Solyc02g072080, which resulted in a premature stop codon R493 * (Figure 13). This gene is the tomato ortholog of Pub17.

[0306] To determine the relative expression levels of candidate genes, RT-qPCR was performed using wild-type MT plants and M4 progeny (M2042-1-1-17 and M2042-1-2-12, Figure 1A) showing moderate resistance. Leaves were mock-inoculated or inoculated with the gray mold fungus (B. cinerea), and samples were collected at three time points: 0 hours, 24 hours, and 48 hours post-infection (hpi). The expression of Pub17 was significantly induced upon infection with the gray mold fungus (B. cinerea) in wild-type MT (Figure 14). However, the expression of Pub17 was not induced in the mutants M2042-1-1-17 and M2042-1-2-12.

[0307] To examine whether the Pub17 mutation is associated with Botrytis resistance, disease assays were performed using the progeny of selected M4 and F2 plants derived from crosses between MM and M4 plant M2042-1-2-12 (Figure 1A, Table 1). F3 and M5 progeny plants were tested for resistance to the gray mold fungus (B. cinerea) to evaluate whether they segregated for the phenotype.

[0308]

Table 1

[0309] Progeny of M4 plants M2042-1-2-7 and M2042-1-2-12, and F2 plants 1-66, 2-59, 3-10, and 3-26, which are homozygous mutants for Pub17, all showed smaller lesion sizes than the wild-type control M2042-1-20-19. In contrast, the progeny of F2 plant 3-39, which is heterozygous for the Pub17 gene (one mutant allele, one wild-type allele), showed segregation in response to Botrytis infection (Table 1).

[0310] F3 progeny of 3-39 were genotyped for the Pub17 gene. Overall, among 24 progeny plants, 4 homozygous mutant plants were identified (Table 2). All 4 homozygous mutant plants exhibited lesions smaller than those of heterozygous wild-type progeny and homozygous wild-type progeny. Collectively, these results support the hypothesis that mutations causing premature stop codons in Pub17 are variants that are factors for the moderate resistance of M2042 to the gray mold pathogen (B. cinerea).

[0311]

Table 2

[0312] Gene expression levels of the mutant Pub17 gene and Pub21 gene To determine the relative expression levels of the mutant genes of both Pub17 and Pub21, RT-qPCR was performed using wild-type MT plants and M4 progeny (double mutant M2042-1-3-14) showing strong resistance. Leaves were mock-inoculated or inoculated with the gray mold pathogen (B. cinerea), and samples were collected at 3 time points: 0 hours, 24 hours, and 48 hours post-infection (hpi). The expression of Pub17 was significantly induced upon infection with the gray mold pathogen (B. cinerea) in wild-type MT (Figure 3A). However, the expression of Pub17 was not induced in the mutant M2042-1-3-14. Similarly, the expression of Pub21 was highly induced upon infection with the gray mold pathogen (B. cinerea) in wild-type MT (Figure 3B), while the expression remained low in the mutant M2042-1-3-14.

[0313] Botrytis resistance in single pub17 mutants, single pub21 mutants, and double pub17pub21 mutants Individual F2 plants from the cross between MM and EMS mutant M2042-1-3-10 were genotyped for the Micro-Tom-specific mutations d (dwarf) and sp (self-pruning) in addition to the Pub17 and Pub21 alleles. Individuals were selected and self-pollinated to obtain progeny that were homozygous for the MM alleles of D and SP and homozygous for both the Pub17 and Pub21 mutant alleles (double mutants), or for the Pub21 mutant allele only in combination with homozygosity for the wild-type allele of Pub17 (single Pub21 mutants) (Figure 1B). Six single Pub21 strains and two double mutant strains were screened for Botrytis resistance using the DLA approach and compared to five single Pub17 mutant strains derived from M2042-1-2-12 (Figure 1A) and control MM plants. The average lesion diameter was calculated (Figure 4).

[0314] The single Pub17 and Pub21 mutants showed equivalent average lesion diameters that were significantly different from the average of the control MM plants. Thus, both mutations confer moderate resistance to Botrytis. The double Pub17 / Pub21 mutants showed an even greater reduction in average lesion diameter, which is thought to be a strong resistance response. These results indicate that mutations in Pub17 and Pub21 have an additive effect on Botrytis resistance.

[0315] Silencing of Pub21 expression by RNAi results in increased resistance to Botrytis cinerea To analyze whether the silencing of the identified Pub21 gene is sufficient to confer reduced susceptibility to the gray mold pathogen (B. cinerea) and whether there are no other genes involved (associated), two RNAi constructs targeting Pub21 were prepared using RNAi fragment 1 (195 bp) targeting the region between the U-box domain and the ARM repeat, and RNAi fragment 10 (205 bp) targeting the ARM repeat domain (Figure 5). A total of 18 RNAi transformants were obtained using constructs RNAi1 and 17 and construct RNAi10. After the introduction of the transformants into the greenhouse, some of the RNAi transformants were found to show slight self-necrosis on the leaves. T2 progeny were obtained from these primary transformants.

[0316] From the segregating T2 families, individual plants were selected based on the presence of distinct and strong fragments after PCR using NPTII primers, indicating the presence of the T-DNA. T3 progeny were obtained from these selected plants (Table 3). qRT-PCR was used to determine the relative expression levels of Pub21. The expression levels of Pub21 are low in wild-type plants, complicating the accurate measurement of the silencing levels. Nevertheless, several RNAi transformant T3 families showing lower levels of expression than the control plants were identified (Figure 6).

[0317] Subsequently, these five Pub21 RNAi T3 families were subjected to disease assays. Each family was tested for the presence or segregation of the NPTII transgene. In the stem assay and the detached leaf assay (DLA), the B05.10 strain of the gray mold pathogen (B. cinerea) was inoculated onto NPTII-positive T3 plants. Non-transgenic Moneymaker (MM) plants and the RNAi family TV202240 showing no presence of NPTII were used as susceptibility controls.

[0318]

Table 3

[0319] In the stem assay, petiole stumps were inoculated and monitored over 21 days. Disease severity index (DSI) scores of 0 - 4 were shown as "abs" in the case of observed increased damage or detachment of petiole stumps. The plants began to show symptoms on the 6th day after inoculation. At 14 dpi, notable differences among families occurred in the case of TV202231 and TV202234 showing minimal symptoms. By the 21st day, in the case of Moneymaker showing the most severe stem damage with the highest percentages of DSI 3 and 4, stem damage had progressed in all groups.

[0320] Also, the Pub21 RNAi families underwent a detached leaf assay (DLA) with Botrytis inoculation. On the 3rd and 4th days post inoculation (dpi), the lesion diameters on infected leaves were measured (Figure 7). TV202218, TV202234, and TV202241 of the Pub21 RNAi T3 families showed on average the smallest lesions clearly different from the negative control. The data were further analyzed to determine whether significant differences existed among families. A Tukey's HSD multiple pairwise comparison test was performed between the mean lesion diameters of each T3 family. The leaves of TV202218, TV202234, and TV202241 of the T3 families showed a significant difference in mean lesion diameter (p < 0.0001) compared to the negative control MM and the T3 family TV202240, while the negative control showed no significant difference between each other at both 3 dpi and 4 dpi. NPTII-containing plants of TV202215 and TV202231 of the T3 families were selected for the disease assay, but the difference in mean lesion size between these families and the negative control MM and TV202240 was not significant.

[0321] The three families with the smallest lesion diameters had relative Pub21 expression levels lower than 0.50 (Table 3), while the two families with similar lesion diameters as the negative control had relative Pub21 expression levels higher than 0.50. Therefore, the level of resistance to Botrytis correlated with the silencing level of Pub21.

[0322] In summary, the results of the Pub21 T3 family from the DLA and stem assays further show that silencing of Pub21 gene expression results in increased resistance to the gray mold pathogen (B. cinerea).

[0323] Mutation of wild-type Pub21 by CRISPR / Cas9 results in increased resistance to the gray mold pathogen (B. cinerea) To further test whether the mutation of Pub21 in the EMS mutant M2042 was sufficient to obtain a decrease in susceptibility to Botrytis, CRISPR / Cas9-targeted mutagenesis of Pub21 was performed using a construct with three sgRNAs (Figure 8).

[0324] The tomato cultivar Moneymaker was transformed with this construct, and 37 transformants were obtained. The primary transformants were genotyped using the primer pairs FWD_MR_GY_CRISPR and REV_AW_GY_CRISPR adjacent to all three sgRNAs, and a 1358 bp PCR product in WT plants was obtained (Figure 8). Furthermore, PCR was performed using the primers AWPUB21F2 and AWPUB21R2 adjacent to sgRNA1 and sgRNA2 (Figure 8). The PCR products of all 37 transformants were sequenced using both forward and reverse primers. As a result, two transformants with mutant alleles consisting of small deletions were identified. For seed production, two cuttings from each transformant were transferred to the greenhouse (Table 4).

[0325]

Table 4

[0326] T3 progeny could be obtained from these T2 Pub21 CRISPR plants with small deletions (Table 5). T3 family TV202269 was a homozygous mutant with a 4 bp deletion. T3 family TV202281 had segregated for the mutant allele with a 4 bp deletion, while T3 family TV202285 had segregated for the mutant allele with a 1 bp insertion. Only TV202278 and TV202283 of the T3 family contained the wild-type allele.

[0327]

Table 5

[0328] For each mutant allele, the effect of the mutation on the predicted protein sequence was determined. A 4 bp deletion at the sgRNA1 target site in families TV202269 and TV202281 resulted in a premature stop codon at amino acid position 64, while a 1 bp insertion at the sgRNA1 target site in family TV202285 resulted in a frameshift and a premature stop codon at amino acid position 98. Thus, in both cases, the premature stop codon occurred at an earlier position than in the case of the EMS M2042 pub21 mutant plants.

[0329] T3 progeny were subjected to both Botrytis cinerea stem assay and DLA using the B05.10 line. T3 plants forming segregating families were genotyped and clustered into three groups: homozygous mutants, heterozygous, and homozygous wild-type (Table 6). Heterozygous wild-type and homozygous wild-type plants of these families, together with TV202278 and TV202283 of the T3 family and non-transformed MM plants, were used as susceptible controls.

[0330]

Table 6

[0331] In the stem assay, the inoculated petioles were monitored over 21 days. The plants began to show symptoms 6 days after inoculation, but stem infection (DSI3) was only observed by day 14. At this point, clear differences were observed between, on the one hand, the homozygous mutant plant families TV202269, TV202281, and TV202285, and the control (homozygous WT) families TV202278 and TV202283, and, on the other hand, the heterozygous plant families TV202281 and TV202285. The negative control showed the highest level of susceptibility to Botrytis cinerea.

[0332] In addition to the stem assay, a detached leaf assay (DLA) was performed on the same families. In the detached leaf assay, the lesion diameters for the infected leaves were measured on days 3 and 4 after inoculation (Figure 9). The susceptible control group showed similar lesion diameters for Botrytis cinerea. In all three homozygous Pub21 CRISPR mutant T3 families / groups, smaller lesion diameters for Botrytis cinerea were observed compared to the negative control. The data were further analyzed to determine whether the differences between the groups were significant. A Tukey HSD multiple pairwise comparison was performed between the mean lesion diameters of each (selected) T3 family, in preparation for a post hoc comparison between the homozygous mutant group and the control group. The homozygous mutant plants of the three families TV202285, TV202269, and TV202281 were significantly different (p < 0.0001) from the control group consisting of heterozygous WT plants and homozygous WT plants.

[0333] Silencing of Pub17 expression by RNAi results in increased resistance to Botrytis cinerea To analyze whether the silencing of the identified Pub17 gene is sufficient to confer reduced susceptibility to the gray mold pathogen (B. cinerea) and whether there are no other (mutant) genes involved, two RNAi constructs targeting Pub17 were generated. RNAi fragment 7 (176 bp) targeted the UND domain, and RNAi fragment 3 (239 bp) targeted the U - BOX domain (Figure 15). A total of 50 RNAi transformants were obtained. After transferring the transformants to the greenhouse, the relative expression levels of Pub17 could be determined for 24 RNAi transformants containing fragment 3 and 19 RNAi transformants containing fragment 7 (Figure 16).

[0334] RNAi fragment 3 seemed to be slightly more efficient than RNAi fragment 7 in silencing (Figure 16). The transformant T1 RNAi3 - 5 (T2 progeny TV181088, Table 7), which had the lowest Pub17 gene expression, was selected as the main candidate for further testing. On the other hand, as part of the RNAi transformants, one RNAi3 transformant (3 - 29, TV181105) and one RNAi7 transformant (7 - 33, TV181136; not included in Figure 16) were observed to show slight self - necrosis on the leaves. We speculated that this could be the result of silencing Pub17. Therefore, these two RNAi families TV181105 and TV181136 were also selected for further testing.

[0335] From the segregating T2 families TV181088 and TV181136, individual plants were selected based on the presence of distinct and strong fragments after PCR using NPTII primers, indicating the presence of T - DNA. T3 progeny were obtained from these selected plants (Table 7). Subsequently, in the stem assay and detached leaf assay (DLA), the B05.10 strain of the gray mold pathogen (B. cinerea) was inoculated onto the Pub17 - silenced transformants by T3 RNAi. MM plants and the RNAi family (TV192024) that did not show the presence of NPTII were used as susceptible controls.

[0336] In the stem assay, petiole fragments were inoculated and monitored over 21 days. Disease severity index (DSI) scores of 0 - 4 were shown as "abs" in the case of increased damage observed or detachment of petiole fragments. Plants began to show symptoms on day 6 after inoculation. Two negative controls, MM and TV192024, showed susceptibility to Botrytis cinerea and had a relatively high percentage of petioles with a DSI of 3 or 4. On the other hand, transformants with expression silenced by Pub17 RNAi showed a lower level of susceptibility to Botrytis cinerea based on a low percentage of stems with a DSI of 3 or 4, and families TV192027 and TV192029 had the lowest susceptibility phenotypes.

[0337]

Table 7

[0338] At the same time, DLA was performed on the T3 families with expression silenced by Pub17 RNAi of T1 transformants 3 - 5 and 7 - 33 (Table 7). On days 3 and 4 post inoculation (dpi), lesion diameters on infected leaves were measured (Figure 17).

[0339] The results of the DLA test showed that two control MMs and TV192024 showed similar lesion diameter sizes of the gray mold fungus (B. cinerea) (Figure 17). In contrast, significantly smaller gray mold fungus (B. cinerea) lesions were observed on the leaves from the families TV192025, TV192026, TV192027, TV192028, and TV192029 in which expression was stopped by Pub17 RNAi at both 3 dpi and 4 dpi. Multiple pairwise comparisons of Tukey HSD were performed on the lesion diameters of all groups. The leaves of all the families TV192025, TV192026, TV192027, TV192028, and TV192029 in which expression was stopped by Pub17 RNAi showed a significant difference in the average lesion diameter (p < 0.05) compared to the negative control MMs and the T3 family TV192024, while the negative controls showed no significant difference from each other at both 3 dpi and 4 dpi.

[0340] Only T3 progeny were obtained later from family T2 TV181105 whose expression was stopped by another RNAi. Therefore, both stem and leaf assays were performed as Botrytis tests on the isolated T2 family. T2 plants were genotyped for the presence of NPTII to distinguish between transgenic and non-transgenic plants. The stem test results showed that transgenic TV181105 plants had a lower level of susceptibility to Botrytis cinerea compared to non-transgenic T2 plants and negative control MM, based on the low percentage of stems showing DSI3 and the absence of stems showing DSI4. In the detached leaf assay, lesion diameter sizes were compared between the control, plants lacking MM and NPTII, and T2 plants containing NPTII (TV05, Figure 18). Similar to the previously tested Pub17 RNAi family, a clear difference was observed between the lesion diameter of transgenic TV181105 plants and that of the control. Multiple pairwise comparisons by Tukey's HSD confirmed that transgenic T2 TV181105 plants had smaller lesion diameters than the negative control (p<0.05). On the other hand, the negative controls also showed statistical differences among themselves.

[0341] Mutation of wild-type Pub17 by CRISPR / Cas9 confers increased resistance to Botrytis cinerea To further test whether the mutation of Pub17 in the EMS mutant M2042 is sufficient to obtain reduced susceptibility to Botrytis, CRISPR / Cas9-targeted mutagenesis of Pub17 was performed using a construct with four sgRNAs (Figure 19).

[0342] The tomato cultivar Moneymaker was transformed in this construct, and 56 transformants were obtained. The primary transformants were genotyped using specific primer pairs adjacent to all four sgRNAs (Figure 19) or exclusively the last two sgRNAs (Figure 19) (the primers are presented in Table 14). Four out of the 56 CRISPR Pub17 transformants with clearly mutant alleles were identified through PCR and electrophoresis (Figure 20).

[0343] In the case of CRISPR transformants 9, 21, and 36, in addition to the PCR products with the size of the wild-type allele, smaller PCR products were observed in both PCRs. In the case of plant 46, the small PCR product of approximately 700 bp indicated that a large deletion had occurred between the first sgRNA target site and the last sgRNA target site. Thus, amplification of the mutant allele was not possible with the primer combinations used in panel B. On the other hand, plant 36 showed three distinct PCR fragments and was able to show a chimeric mutant. The bands were excised from the gel and sequenced using the primers used to obtain the PCR products. The sequence of the mutant allele was aligned with the WT sequence to find the exact size of each deletion. The results are shown in Figure 21.

[0344] Small deletion or insertion mutations could not be identified by gel electrophoresis. Therefore, the PCR products of all transformants showing bands of approximately WT size were also sequenced. This led to the identification of plant 7, an additional two-allele mutant with a 1-bp deletion and a 1-bp insertion in one mutant allele, while the second mutant allele had two separate 1-bp insertions (Figure 22).

[0345] A summary of the identified mutations is presented in Table 8. The size of the deletions was recorded, and the positions related to the Pub17 sgRNAs were selected for the construct. Most of the mutations occurred within the region targeted by sgRNA3.

[0346]

Table 8

[0347] For each mutant allele, the effect of the mutation on the predicted protein sequence was determined.

[0348] Deletions in plants 21 and 46 and a 5-bp deletion in one of the alleles of plant 36 resulted in premature stop codons, while the rest resulted in out-of-frame mutations.

[0349] T3 progeny were obtained from T2 plants with deletions of a few to 345 bp (Table 9). T3 Pub17 CRISPR transformants were subjected to the gray mold (B. cinerea) stem assay and DLA using the B05.10 strain. All transformants tested were homozygous mutants for indel mutations in Pub17. MM plants and the T2 Pub17 CRISPR transformant family TV181133, which did not show the presence of the mutations observed in its T1 parental plant 21, were used as susceptible controls.

[0350]

Table 9

[0351] For the stem assay, the inoculated petioles were monitored over 21 days, and symptoms were detected at 6 dpi. The negative controls, MM and the T2 Pub17 transformant family TV181133, showed the highest level of susceptibility to Botrytis cinerea, followed by the T3 families TV192008 and TV192012, as indicated by a relatively high percentage of stems with a DSI of 4. On the other hand, all of the T3 Pub17 CRISPR families TV192007, TV192009, TV192016, TV192019, TV192014, and TV192023 showed reduced susceptibility to Botrytis cinerea based on a low percentage of stems with a DSI of 3 or 4.

[0352] On the 3rd and 4th days after inoculation, the lesion diameter on the infected leaves was measured in the detached leaf assay (Figure 23). The two control groups of MM and TV181133 showed similar lesion diameters for the gray mold fungus (B. cinerea). Significantly smaller lesion diameters of the gray mold fungus (B. cinerea) (p < 0.001) were observed in all eight Pub17 CRISPR mutant T3 families compared to the two negative controls.

[0353] Increased resistance to other pathogens As previously mentioned, the original mutant M2042 was found to show a reduced susceptibility to the necrotrophic fungus Botrytis cinerea and in addition to the hemibiotrophic oomycete Phytophthora infestans. The M2042 mutant did not show a change in response to the biotrophic fungus Pseudoidium neolycopersici, i.e., the mutant had the same susceptibility as the wild-type Micro-Tom. To analyze whether the silencing or mutation of the Pub21 gene affected the susceptibility to other tomato pathogens, first, a detached leaf assay (DLA) was performed on EMS-derived Pub17 / Pub21 double mutants using the necrotrophic fungus Alternaria solani and compared it with single pub17 mutants and wild-type control plants. The results of measuring the lesion diameter size at 5 dpi are shown in Figure 10. Similar to what was observed in the Botrytis assay (Figure 4), the pub17 single mutants showed smaller lesions than both wild-type controls, and the Pub17 / Pub21 double mutants showed an even smaller lesion size. This indicated that the Pub21 mutation also resulted in a reduced susceptibility to Alternaria solani.

[0354] Next, DLA for Alternaria solani was performed on Pub21 RNAi transformants and CRISPR mutants. The results are shown in FIGS. 11 and 12. Similar to the results from the Botrytis assay, a clear trend for the RNAi transformants was revealed (FIG. 11), showing differences between the negative control and RNAi T3 families TV202218, TV202234, and TV202241. The data were further analyzed to determine whether significant differences occurred between groups. According to the Tukey HSD multiple pairwise comparison test, TV202218, TV202234, and TV202241 of the T3 family showed significant differences (p<0.0001) in mean lesion diameter when compared to the negative control MM and T3 family TV202240, while the negative control showed no significant differences between each other at both 5 dpi and 7 dpi. The mean lesion sizes of NPTII-containing plants of T3 families TV202215 and TV202231 were not significantly different from those of the negative control MM and TV192024 on either the 5th or 7th day. This may indicate that families TV202215 and TV202231 contain the Pub21 silencing construct, but the level of silencing is not sufficient to achieve a reduced susceptibility to Alternaria solani, as in the case of TV202218, TV202234, and TV202241 of the T3 family.

[0355] Also, in the case of Pub21 CRISPR mutants (FIG. 12), the DLA results for Alternaria showed the same trend as the DLA results for Botrytis. Homozygous mutant T3 plants of CRISPR families TV202285, TV202269, and TV202281 clearly exhibited smaller lesions than the negative control. According to the Tukey HSD multiple pairwise comparison, it was shown that the homozygous mutant plants of the three families TV202285, TV202269, and TV202281 were significantly different from the control group consisting of heterozygous WT plants and homozygous WT plants (p<0.0001).

[0356] In summary, it has been shown that the suppression or mutation of the tomato Pub21 gene confers increased resistance to Alternaria solani and Botrytis cinerea.

[0357] The Pub17 and pub21 single and double mutants show increased resistance to Phytophthora infestans As described above, the EMS and CRISPR mutants of tomato pub17 and pub21, and the double pub17 and pub21 EMS mutants showed smaller lesions when inoculated with Botrytis cinerea and Alternaria solani. Therefore, these mutants and the pub17 / pub21 double mutants were tested against an additional pathogen, Phytophthora infestans, and were shown to have increased resistance to it.

[0358] To test this, the following T4 plant families were used (12 plants per family). Table 10 shows how the pub17 CRISPR mutant plant families used in this example were obtained as progeny from the T3 families in Table 9 above, and lists the mutation types for the CRISPR single mutant plant families. Table 11 shows how the pub21 CRISPR mutant plant families used in this example were either the T3 family TV202269 described in Table 6 above or obtained as progeny from the T3 families described in Table 6 above, and lists the mutation types for the CRISPR single mutant plant families. 1. pub17 CRISPR mutants: · TV202081-T4: 2×1bp insertion in pub17 · TV202085-T4: 1bp deletion, 1bp insertion in pub17 · 5 bp deletion in TV202099-T4:pub17 · 345 bp deletion in TV202096-T4:pub17

[0359]

Table 10

[0360] 2. pub21 CRISPR mutants: · 4 bp deletion in TV202269-T3:pub21 · 4 bp deletion in TV212098-T4:pub21 · 1 bp insertion in TV212087-T4:pub21

[0361]

Table 11

[0362] The following single and double EMS mutants were obtained from the EMS mutants described above, as shown in Figures 1C and 1D. 3. pub17 EMS mutants: · 21-0252 pub17 BC1S2 (Figure 1C) · 21-0269 pub17 BC2S2 (Figure 1C) 4. pub21 EMS mutants: · A45 pub21 BC2S2 (Figure 1D) · A43 pub21 BC2S2 (Figure 1D) 5. pub17 / pub21 EMS double mutants: · A29 double mutant F3 (Figure 1D) · A25 double mutant F3 (Figure 1D) 6. Control: · MM (Moneymaker variety, no pub17 or pub21 modification)

[0363] Using the Phytophthora infestans isolate PIC99177 as described above, a detached leaf assay was performed and the disease index was scored at 4 and 7 days after inoculation. The disease score is the disease severity in increasing order: R9 = 0 or 1, R8 = 2, R7 = 3, V5 = 4, V6 = 5, V7 = 6; the symptoms are described in Table 12.

[0364]

Table 12

[0365] As can be seen from the results shown in Figure 24, the trend for all tested pub mutants is that disease progression is slower compared to MM. In addition, the best results were obtained for the pub17 / pub21 double mutant.

[0366] References Amselem J, Cuomo CA, van Kan JAL et al. (2011) Genomic analysis of the necrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLoS Genet 7: e1002230. Bai Y, Huang C-C, van der Hulst R, Meijer-Dekens F, Bonnema G, Lindhout P (2003) QTLs for tomato powdery mildew resistance (Oidium lycopersici) in Lycopersicum parviflorum G1.1601 co-localize with two qualitative powdery mildew resistance genes. Mol Plant-Microbe Interact 16: 169 - 176. Benito EP, ten Have A, van ’t Klooster JW, van Kan JAL (1998) Fungal and plant gene expression during synchronized infection of tomato leaves by Botrytis cinerea. Eur J Plant Pathol 104:207-220. Chetelat RT, Stamova L (1999) Tolerance to Botrytis cinerea. Acta Hortic 487:313-316. Cheung N, Tian L, Liu X, Li X (2020) The destructive fungal pathogen Botrytis cinerea - Insights from genes studied with mutant analysis. Pathogens 9:923. Davis J, Yu D, Evans W, Gokirmak T, Chetelat RT, Stotz HU (2009) Mapping of loci from Solanum lycopersicoides conferring resistance or susceptibility to Botrytis cinerea in tomato. Theor Appl Genet 119:305-314. Dean R, van Kan JAL, Pretorius ZA, Hammond-Kosack KE, Di Pietro A, Spanu PD, Rudd JJ, Dickman M, Kahmann R, Ellis J, Foster GD (2012) The Top 10 fungal pathogens in molecular plant pathology. Mol Plant Pathol 13:414-430. Diez MJ, Nuez F (2008) Tomato. In: Vegetables II (pp.249-323). Springer, New York, NY. Egashira H, Kuwashima A, Ishiguro H, Fukushima K, Kaya T, Imanishi S (2000) Screening of wild accessions resistant to gray mold (Botrytis cinerea Pers.) in Lycopersicon. Acta Physiologiae Plantarum 22:324 - 326. Elad Y, Williamson B, Tudzynski P, Delen N (eds) (2007) Botrytis: Biology, Pathology and Control. Springer, Dordrecht, The Netherlands. Engler C, Kandzia R, Marillonnet S (2008) A one pot, one step, precision cloning method with high throughput capability. PloS One 3: e3647. Finkers R, van den Berg P, van Berloo R, ten Have A, van Heusden AW, van Kan JAL, Lindhout P (2007a) Three QTLs for Botrytis cinerea resistance in tomato. Theor Appl Genet 114:585 - 593. Finkers R, van Heusden AW, Meijer - Dekens F, van Kan JAL, Maris P, Lindhout P (2007b) The construction of a Solanum habrochaites LYC4 introgression line population and the identification of QTLs for resistance to Botrytis cinerea. Theor Appl Genet 114:1071 - 1080. Finkers R, Bai Y, van den Berg P, van Berloo R, Meijer-Dekens F, ten Have A, van Kan J, Lindhout P, van Heusden AW (2008) Quantitative resistance to Botrytis cinerea from Solanum neorickii. Euphytica 159:83-92. Guimaraes RL, Chetelat RT, Stotz HU (2004) Resistance to Botrytis cinerea in Solanum lycopersicoides is dominant in hybrids with tomato, and involves induced hyphal death. Eur J Plant Pathol 110:13-23. Hanika K, Schipper D, Chinnappa S, Oortwijn M, Schouten HJ, Thomma BPHJ, Bai Y (2021) Impairment of tomato WAT1 enhances resistance to vascular wilt fungi despite severe growth defects. Front Plant Sci 12:721674. He Q, McLellan H, Boevink PC, Sadanandom A, Xie C, Birch PRJ, Tian Z (2015) U-box E3 ubiquitin ligase PUB17 acts in the nucleus to promote specific immune pathways triggered by Phytophthora infestans. J Exp Bot 66:3189-3199. Huibers RP, Loonen AEHM, Gao D, Van den Ackerveken G, Visser RGF, Bai Y (2013) Powdery mildew resistance in tomato by impairment of SlPMR4 and SlDMR1. PLoS One 8: e67467. Jiang Y, Yu D (2016) The WRKY57 transcription factor affects the expression of jasmonate ZIM-domain genes transcriptionally to compromise Botrytis cinerea resistance. Plant Physiol 171: 2771 - 2782. Joergensen IH (1992) Discovery, characterization and exploitation of Mlo powdery mildew resistance in barley. Euphytica 63: 141 - 152. Kusch S, Panstruga R (2017) mlo-based resistance: an apparently universal “weapon” to defeat powdery mildew disease. Mol Plant-Microbe Interact 30: 179 - 189. Lin T, Zhu G, Zhang J, Xu X, Yu Q, Zheng Z, Zhang Z, Lun Y, Li S, Wang X, Huang Z, Li J, Zhang C, Wang T, Zhang Y, Wang A, Zhang Y, Lin K, Li C, Xiong G, Xue Y, Mazzucato A, Causse M, Fei Z, Giovannoni JJ, Chetelat RT, Zamir D, Staedler T, Li J, Ye Z, Du Y, Huang S (2014) Genomic analyses provide insights into the history of tomato breeding. Nature Genet 46:1220 - 1226. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 -ΔΔC T method. Methods 25:402 - 408. Marti E, Gisbert C, Bishop GJ, Dion MS, Garcia-Martinez JL (2006) Genetic and physiological characterization of tomato cv. Micro-Tom. J Exp Bot 57:2037 - 2047. McLellan H, Chen K, He Q, Wu X, Boevink PC, Tian Z, Birch PRJ (2020) The ubiquitin E3 ligase PUB17 positively regulates immunity by targeting a negative regulator, KH17, for degradation. Plant Comm 1:100020. Meissner R, Jacobson Y, Melamed S, Levyatuv S, Shalev G, Ashri A, Elkind Y, Levy A (1997) A new model system for tomato genetics. Plant J 12:1465 - 1472. Ni X, Tian Z, Liu J, Song B, Li J, Shi X, Xie C (2010) StPUB17, a novel potato UND / PUB / ARM repeat type gene, is associated with late blight resistance and NaCl stress. Plant Sci 178:158 - 169. Nicot PC, Moretti A, Romiti C, Bardin M, Caranta C, Ferriere H (2002) Differences in susceptibility of pruning wounds and leaves to infection by Botrytis cinerea among wild tomato accessions. TGS Report 52:24 - 26. Prins TW, Tudzynski P, von Tiedemann A, Tudzynski B, Ten Have A, Hansen ME, Tenberge K, van Kan JAL (2000) Infection strategies of Botrytis cinerea and related necrotrophic pathogens. In Kronstad JW (ed) Fungal Pathology (pp.33 - 64). Springer, Dordrecht. Qin T, Liu S, Zhang Z, Sun L, He X, Lindsey K, Zhu L, Zhang X (2019) GhCyP3 improves the resistance of cotton to Verticillium dahliae by inhibiting the E3 ubiquitin ligase activity of GhPUB17. Plant Mol Biol 99:379 - 393. Richards JK, Xiao C-L, Jurick II WM (2021) Botrytis spp.: A contemporary perspective and synthesis of recent scientific developments of a widespread genus that threatens global food security. Phytopathol 111:432 - 436. RStudio Team (2016). RStudio: Integrated Development for R. RStudio, Inc., Boston, MA URL http: / / www.rstudio.com / . Semagn K, Babu R, Hearne S, Olsen M (2014) Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement. Mol Breed 33:1 - 14. Schouten HJ, Tikunov Y, Verkerke W, Finkers R, Bovy A, Bai Y, Visser RGF (2019) Breeding has increased the diversity of cultivated tomato in The Netherlands. Front Plant Sci 10:1606. Smith JE, Mengesha B, Tang H, Mengiste T, Bluhm BH (2014) Resistance to Botrytis cinerea in Solanum lycopersicoides involves widespread transcriptional reprogramming. BMC Genomics 15:334. Sun K, van Tuinen A, van Kan JAL, Wolters AMA, Jacobsen E, Visser RGF, Bai Y (2017) Silencing of DND1 in potato and tomato impedes conidial germination, attachment and hyphal growth of Botrytis cinerea. BMC Plant Biology 17:235. Sun K, Wolters AMA, Loonen AEHM, Huibers RP, van der Vlugt R, Goverse A, Jacobsen E, Visser RGF, Bai Y (2016) Down-regulation of Arabidopsis DND1 orthologs in potato and tomato leads to broad-spectrum resistance to late blight and powdery mildew. Transgenic Res 25:123-138. ten Have A, van Berloo R, Lindhout P, van Kan JAL (2007) Partial stem and leaf resistance against the fungal pathogen Botrytis cinerea in wild relatives of tomato. Eur J Plant Pathol 117:153-166. van Baarlen P, Woltering EJ, Staats M, van Kan JAL (2007) Histochemical and genetic analysis of host and non-host interactions of Arabidopsis with three Botrytis species: an important role for cell death control. Molecular Plant Pathology 8: 41 - 54. van Kan JAL (2006) Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends Plant Sci 11: 247 - 253. van Kan JAL, Shaw MW, Grant-Downton RT (2014) Botrytis species: relentless necrotrophic thugs or endophytes gone rogue? Mol Plant Pathol 15: 957 - 961. Verlaan MG, Szinay D, Hutton SF, de Jong H, Kormelink R, Visser RGF, Scott JW, Bai Y (2011) Chromosomal rearrangements between tomato and Solanum chilense hamper mapping and breeding of the TYLCV resistance gene Ty-1. Plant J 68: 1093 - 1103. Williamson B, Tudzynski B, Tudzynski P, van Kan JAL (2007) Botrytis cinerea: the cause of grey mould disease. Mol Plant Pathol 8: 561 - 580. Yan Z, Appiano M, van Tuinen A, Meijer-Dekens F, Schipper D, Gao D, Huibers R, Visser RGF, Bai Y, Wolters AMA (2021) Discovery and characterization of a novel tomato mlo mutant from an EMS mutagenized Micro-Tom population. Genes 12:719. Yang C-W, Gonzalez-Lamothe R, Ewan RA, Rowland O, Yoshioka H, Shenton M, Ye H, O’Donnell E, Jones JDG, Sadanandom A (2006) The E3 ubiquitin ligase activity of Arabidopsis PLANT U-BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense. Plant Cell 18:1084-1098. Zhang H, Zhang W, Jian G, Qi F, Si N (2016) The genes involved in the protective effects of phytohormones in response to Verticillium dahliae infection in Gossypium hirsutum. J Plant Biol 59:194-202.

[0367] Brief description of the sequences Micro-Tom wild-type Pub21 coding sequence (SEQ ID NO: 1)

Chem.

Chem.

Chem.

Chem.

Chem.

Chem.

[0368]

Table 13-1

[0369]

Table 13-2

[0370] Pub17 sequence Pub17 MicroTom wild-type allele sequence (SEQ ID NO: 39)

Chem.

[0371]

Table 14

[0372] Pub17-KASP assay K_RTWT_For1 primer (SEQ ID NO: 43)

Chem.

Chem.

Chem.

Chem.

Chem.

Chem.

Chem.

Claims

1. A tomato plant or plant material having a reduced level, activity, or expression of the Pub21 protein, which confers increased resistance to pathogens that form lesions on a reference tomato plant or plant material.

2. The tomato plant or plant material according to claim 1, which is modified to reduce the level, activity, or expression of the Pub21 protein.

3. The tomato plant or plant material according to claim 1 or 2, comprising a modified Pub21 allele.

4. The tomato plant or plant material according to claim 3, wherein the modified Pub21 allele comprises at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or its ortholog or homolog, and the Pub21 allele comprises a mutation, optionally, the mutation is present at nucleotide position 890 of SEQ ID NO: 1 (wild-type Pub21 allele) or a corresponding position.

5. The tomato plant or plant material according to claim 4, wherein the mutation is an SNP, preferably an SNP from T to A.

6. The tomato plant or plant material according to any one of claims 1 to 5, further having a reduced level, activity, or expression of the Pub17 protein.

7. A plant part obtained from the tomato plant according to any one of claims 1 to 6.

8. A seed capable of producing the tomato plant according to any one of claims 1 to 6.

9. A method for increasing the resistance of a tomato plant or plant material to a pathogen that forms lesions, comprising reducing the level, activity, or expression of the Pub21 protein in the tomato plant or plant material, optionally, further comprising reducing the level, activity, or expression of the Pub17 protein in the tomato plant or plant material.

10. A method for producing a tomato plant having increased resistance to a pathogen that forms lesions, comprising reducing the level, activity, or expression of the Pub21 protein in the tomato plant or plant material, optionally, further comprising reducing the level, activity, or expression of the Pub17 protein in the tomato plant or plant material.

11. The method according to claim 9 or 10, wherein the method comprises modifying the tomato plant or plant material to reduce the level, activity or expression of the Pub21 protein in the tomato plant or plant material, and optionally, the method further comprises modifying the tomato plant or plant material to reduce the level, activity or expression of the Pub17 protein in the tomato plant or plant material.

12. Obtaining a mutant population of tomato plants and selecting a modified tomato plant comprising a modified Pub21 allele having at least 70% identity with SEQ ID NO: 1 (wild-type Pub21 allele) or its ortholog or homolog and comprising a mutation that results in a decrease in the level, activity or expression of Pub21 in the tomato plant or plant material, and optionally, the modified tomato plant further comprises a modified Pub17 allele having at least 70% identity with SEQ ID NO: 39 (wild-type Pub17 allele) or its ortholog or homolog and comprising a mutation that results in a decrease in the level, activity or expression of Pub17 in the tomato plant or plant material. The method according to any one of claims 9 to 11.

13. A method for identifying a tomato plant having increased resistance to a pathogen that forms lesions, relative to a reference tomato plant or plant material, comprising: (a) determining the level, activity, or expression of the Pub21 protein and optionally the Pub17 protein in one or more tomato plants and comparing this to the level, activity, or expression of the Pub21 protein and optionally the Pub17 protein in the reference tomato plant; (b) selecting a tomato plant having a decrease in the level, activity, or expression of the Pub21 protein and optionally the Pub17 protein relative to the reference tomato plant; wherein the decrease in the level, activity, or expression of the Pub21 protein and optionally the Pub17 protein means increased resistance to the pathogen that forms lesions, relative to the reference tomato plant.

14. A method for identifying a tomato plant having increased resistance to a pathogen that forms a lesion, relative to a reference tomato plant or plant material, comprising: (a) obtaining a population of mutant tomato plants; (b) screening the population of tomato plants for the presence of a Pub21 allele having at least 70% identity to SEQ ID NO: 1 (wild-type Pub21 allele) or an ortholog or homolog thereof and comprising a mutation that results in a decrease in the level, activity or expression of the Pub21 protein in the tomato plant or plant material, and optionally screening the population of tomato plants for the presence of a Pub17 allele having at least 70% identity to SEQ ID NO: 39 (wild-type Pub17 allele) or an ortholog or homolog thereof and comprising a mutation that results in a decrease in the level, activity or expression of the Pub17 protein in the tomato plant or plant material; (c) selecting tomato plants having the Pub21 allele and optionally the Pub17 allele. [

15. ] The pathogen that forms the lesion is a necrotrophic fungal pathogen, preferably selected from Alternaria alternata, Alternaria solani, Botrytis cinerea, Sclerotinia sclerotiorum, Stemphylium botryosum, Fusarium oxysporum, and Pythium spp, preferably the pathogen that forms the lesion is Botrytis cinerea, the tomato plant or plant material according to any one of claims 1 to 6, the plant part according to claim 7, the seed according to claim 8, or the method according to any one of claims 9 to 14.