ABCA4 splicing molecule

Nucleic acid trans-splicing molecules correct ABCA4 gene mutations by replacing defective exons with functional ones, addressing the lack of therapies for ABCA4-related retinopathies and restoring ABCA4 protein function to halt retinal degeneration.

JP2025521102APending Publication Date: 2025-07-08SEA SQUIRT THERAPY CO
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024566858
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-01-04
Filing Date
2023-05-12
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

Current therapies are lacking for ABCA4-related retinopathies such as Stargardt disease, which are severe and rare hereditary retinal diseases caused by pathogenic variants in both alleles of the ABCA4 gene, affecting both adults and children, with no approved treatments available.

Method used

Development of nucleic acid trans-splicing molecules that encode an RNA exon editor to trans-splice an endogenous ABCA4 pre-mRNA, replacing mutated exons with functional exons, thereby correcting mutations and restoring ABCA4 protein function.

Benefits of technology

The trans-splicing molecules achieve therapeutically relevant RNA exon editing, leading to partial restoration of ABCA4 bioactivity, reducing toxic compound accumulation, and potentially halting or reversing retinal degeneration.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025521102000001_ABST
    Figure 2025521102000001_ABST
Patent Text Reader

Abstract

This specification provides nucleic acid trans-splicing molecules (e.g., pre-mRNA trans-splicing molecules (RTMs); RNA exon editing molecules) that can correct mutations in the ABCA4 gene. Such molecules are useful for the treatment of disorders such as ABCA4-related retinal dystrophy (e.g., Stargardt disease or cone-rod dystrophy). Also described herein are methods of using the nucleic acid trans-splicing molecules described herein to correct mutations in ABCA4 and thereby treat disorders associated with mutations in ABCA4, as well as the use of the nucleic acid trans-splicing molecules described herein for the treatment of disorders associated with mutations in ABCA4, and the use of the nucleic acid trans-splicing molecules described herein in the preparation of a medicament for the treatment of disorders associated with mutations in ABCA4.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - reference to related applications This application claims the benefit of U.S. Provisional Application No. 63 / 341,665, filed May 13, 2022, and U.S. Provisional Application No. 63 / 478,472, filed Jan. 4, 2023, each of which is hereby incorporated by reference in its entirety.

[0002] Sequence Listing This application includes a Sequence Listing that has been electronically submitted in XML format and is hereby incorporated by reference in its entirety. The XML copy created on May 10, 2023, is named 61313 - 703_601_SL.xml and is 1,315,456 bytes in size. Field of the Invention

[0003] Compositions, methods, and uses involving trans - splicing molecules for correcting mutations in ABCA4 (ATP - binding cassette, sub - family A, member 4) are described herein.

Background Art

[0004] Recessive genetic mutations in ABCA4 are the cause of the onset of progressive blindness, including Stargardt disease and cone - rod dystrophy. ABCA4, which is localized along the marginal region of the photoreceptor outer segment disc membrane, functions as a transporter (or “flippase”) of N - retinylidene - phosphatidylethanolamine (N - Ret - PE) from the lumen of the disc membrane to the cytoplasmic leaflet. Defects in the ABCA4 protein lead to the accumulation of toxic retinoid compounds and ultimately to the death of photoreceptor and retinal pigment epithelial cells. The 6882 - bp coding sequence of ABCA4 is too large to be delivered in its entirety by a single AAV vector. Furthermore, as hundreds of mutations causing disease are found throughout the gene, a single base - editing approach will not be able to address many patients. Thus, alternative strategies for correcting mutations in the ABCA4 gene are needed in the art.

Summary of the Invention

[0005] ABCA4 - related retinopathies, such as Stargardt disease, are severe and rare hereditary retinal diseases caused by pathogenic variants in both alleles of the ABCA4 gene, affecting both adults and children. The estimated prevalence of Stargardt disease is 1 in 8 - 10,000 worldwide, accounting for approximately 7% of retinal dystrophies. ABCA4 has been characterized as the causative gene for autosomal recessive Stargardt disease, but several other retinal phenotypes are also associated with ABCA4 mutations. In fact, ABCA4 - related retinopathies are collectively thought to be the most frequent cause of Mendelian - inherited retinal degenerations. Individuals with ABCA4 - related retinopathies are typically diagnosed within the first 20 years of life and, depending on the severity of the specific mutation, may completely lose their central vision by adulthood.

[0006] Currently, there are no approved therapies for ABCA4 - related retinopathies. Thus, there remains a large unmet medical need to develop disease - modifying therapies for both adults and children affected by loss - of - function ABCA4 mutations.

[0007] Through extensive research, the inventors have identified nucleic acid elements that result in nucleic acid trans-splicing molecules incorporating characteristics that address technical challenges related to, for example, increasing trans-splicing efficiency and the levels of trans-splicing proteins thereby produced. Thus, the inclusion of the identified elements into nucleic acid trans-splicing molecules (e.g., RNA trans-splicing molecules) presents various solutions to problems associated with the implementation of past nucleic acid trans-splicing molecules, such as problems related to insufficient trans-splicing efficiency. Accordingly, the inventors have designed nucleic acid trans-splicing molecules that achieve the goal of providing options for therapeutic intervention in diseases associated with gene mutations, thereby being able to bring great benefits to patients through correction of those gene mutations at the RNA level. Many patients with diseases associated with gene mutations have few treatment options, if any, and thus many have unmet needs. For example, patients with progressive blindness associated with mutations in ABCA4 are a representative patient population with unmet needs.

[0008] To address these unmet needs, a trans-splicing solution, also referred to as exon editing, is described herein, which involves delivering a therapeutic nucleic acid trans-splicing construct encoding an RNA exon editor designed to trans-splice an endogenous ABCA4 pre-mRNA containing at least one mutation, whereby trans-splicing replaces an exon in the endogenous ABCA4 pre-mRNA, at least one of which contains at least one mutation, with an exon from a therapeutic RNA exon editor encoding a functional (e.g., wild-type) amino acid sequence, thus correcting at least one mutation in the endogenous ABCA4 pre-mRNA. In some embodiments, the RNA exon editor can be delivered directly to the cell. The terms "nucleic acid trans-splicing molecule", "RNA exon editing molecule", "RNA exon editor", "exon editor", and "RNA trans-splicing construct" are used interchangeably herein.

[0009] In some embodiments, the nucleic acid trans-splicing molecule comprises (a) a coding sequence (CDS) containing an ABCA4 exon, (b) a linker domain containing the sequence of SEQ ID NO: 27, or a sequence having at least 90% identity to SEQ ID NO: 27, and (c) a binding domain that anneals to a binding site within the endogenous ABCA4 pre-mRNA, wherein the CDS, linker domain, and binding domain are operably linked in the 5' to 3' direction. Also described herein are methods for treating retinopathies associated with mutations in ABCA4, and its use in the preparation of a medicament for treating retinopathies associated with mutations in ABCA4.

[0010] In some embodiments, the nucleic acid trans-splicing molecule described herein is a CDS that (a) comprises, consists essentially of, or consists of any one variant of SEQ ID NOs: 53-55, wherein any one variant of SEQ ID NOs: 53-55 comprises at least one nucleotide mutation in at least one potential splice site listed in Table 3, and the at least one nucleotide mutation reduces the use of the potential splice site at each of the at least one potential splice sites that comprises the at least one nucleotide mutation, (b) optionally, a linker domain, and (c) optionally, a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, wherein the CDS, the linker domain if present, and the binding domain if present are operably linked in the 5' to 3' direction. In some embodiments, the variant of SEQ ID NO: 55 comprises any one of SEQ ID NOs: 56-59. In some embodiments, the variant of SEQ ID NO: 55 comprises SEQ ID NO: 56. Also described herein are the treatment of retinopathies associated with mutations in ABCA4, its use in the preparation of a medicament for the treatment of retinopathies associated with mutations in ABCA4, and a method for the treatment of retinopathies associated with mutations in ABCA4.

[0011] In one aspect, provided herein is a nucleic acid trans-splicing molecule (or a vector comprising or encoding a nucleic acid trans-splicing molecule), the nucleic acid trans-splicing molecule operably from 5' to 3' comprises: (a) a 5' regulatory domain comprising, for example, a native 5' ABCA4 untranslated region; (b) a CDS comprising a functional sequence of a 5' ABCA4 exon; (c) a splicing domain configured to mediate trans-splicing; and (d) a binding domain configured to bind to a binding site within an endogenous ABCA4 pre-mRNA, the nucleic acid trans-splicing molecule being configured to trans-splice the CDS to endogenous ABCA4, thereby replacing the endogenous 5' ABCA4 exon sequence with the functional sequence of the 5' ABCA4 exon. In some embodiments, the 5' regulatory domain further comprises a constitutive promoter, such as a CMV / CMV promoter (CMV enhancer and promoter), or a variant thereof. In some embodiments, the native 5' ABCA4 untranslated region comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 12 or 13 (e.g., at least 85% sequence identity to SEQ ID NO: 12 or 13, at least 90% sequence identity, 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity). In some embodiments, the 5' regulatory domain comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 14 or 15 (e.g., at least 85% sequence identity to SEQ ID NO: 14 or 15, at least 90% sequence identity, 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity).

[0012] In some embodiments, the binding site is within intron 22 of ABCA4. In some embodiments, the binding site comprises any one or more (e.g., any six or more, any eight or more, any ten or more, any twelve or more, any eighteen or more, any twenty or more, any twenty-four or more, any fifty or more, any one hundred or more, or any one hundred and fifty or more (e.g., 150)) of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16. In some embodiments, the binding site comprises any one or more (e.g., any six or more, any eight or more, any ten or more, any twelve or more, any eighteen or more, any twenty or more, any twenty-four or more, any fifty or more, any one hundred or more, or any one hundred and fifty or more (e.g., 150)) of nucleotides 1160 to 1309 of SEQ ID NO: 16. In some embodiments, the binding domain that binds to the binding site has at least 80% sequence identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to the binding site within SEQ ID NO: 16. In some embodiments, the binding domain comprises SEQ ID NO: 17 or 18.

[0013] In some embodiments, the splicing domain comprises GTAAGT, GUAAGT, GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, or GUAACU.

[0014] In some embodiments, the nucleic acid trans-splicing molecule further comprises a linker domain. In some embodiments, the linker domain is longer than 25 nucleotides in length (e.g., 25 - 50 nucleotides in length, 35 - 45 nucleotides in length, or about 40 nucleotides in length (e.g., 40-mer linker)). In some cases, the linker domain has at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CTGGTGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO: 27), or comprises the same.

[0015] In other cases, the linker domain is a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CCGAATACGACACGTACAAGATCT (SEQ ID NO: 29), or comprises the same. In other cases, the linker domain is a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO: 31), or comprises the same.

[0016] In another aspect, provided is a nucleic acid trans-splicing molecule comprising, operably linked in the 5' to 3' direction: (a) a CDS comprising a functional sequence of a 5' ABCA4 exon, (b) a splicing domain configured to mediate trans-splicing, the splicing domain comprising GTAAGT, GUAAGT, GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, or GUAACU, and (c) a binding domain configured to bind to a binding site within endogenous intron 22 of ABCA4, wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4 exon 23, thereby replacing the endogenous 5' ABCA4 exon sequence with the functional sequence of the 5' ABCA4 exon. In some embodiments, the nucleic acid trans-splicing molecule comprises a 5' regulatory domain operably linked to the 5' side of the CDS. In some embodiments, the 5' regulatory domain comprises a native 5' ABCA4 untranslated region having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 90% sequence identity, 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to a native 5' ABCA4 untranslated region, such as SEQ ID NO: 12 or 13. In some embodiments, the 5' regulatory domain further comprises a constitutive promoter, such as the CMV promoter.

[0017] In some embodiments, the nucleic acid trans-splicing molecule further comprises a linker domain. In some embodiments, the linker domain is longer than 25 nucleotides in length (e.g., 25-50 nucleotides in length, 35-45 nucleotides in length, or about 40 nucleotides in length (e.g., 40-mer linker)). In some cases, the linker domain has at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to CTGGTGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO: 27), or comprises such a nucleic acid sequence. In other cases, the linker domain has at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to CCGAATACGACACGTACAAGATCT (SEQ ID NO: 29), or comprises such a nucleic acid sequence. In other cases, the linker domain has at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO: 31), or comprises such a nucleic acid sequence.

[0018] In some embodiments, the binding site comprises any one or more (e.g., any 6 or more, any 8 or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150)) of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16. In some embodiments, the binding site comprises any one or more (e.g., any 6 or more, any 8 or more, any 10 or more, any 12 or more, any 18 or more, any 20 or more, any 24 or more, any 50 or more, any 100 or more, or any 150 or more (e.g., 150)) of nucleotides 1160 to 1309 of SEQ ID NO: 16. In some embodiments, the binding domain that binds to the binding site has at least 80% sequence identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to SEQ ID NO: 17 or 18. In some embodiments, the binding domain comprises SEQ ID NO: 17 or 18.

[0019] In another aspect, provided is a nucleic acid trans-splicing molecule comprising, operably linked in the 5' to 3' direction: (a) a CDS comprising a functional sequence of the 5' ABCA4 exon, (b) a splicing domain configured to mediate trans-splicing, (c) a linker domain 25 to 50 nucleotides in length, and (d) a binding domain configured to bind to a binding site within endogenous intron 22 of ABCA4, wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4 exon 23, thereby replacing the endogenous 5' ABCA4 exon sequence with the functional sequence of the 5' ABCA4 exon. In some embodiments, the linker domain is 35 to 45 nucleotides in length, or about 40 nucleotides in length (e.g., a 40-mer linker). In some cases, the linker domain has at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CTGGTGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO: 27), or comprises such a nucleic acid sequence. In other cases, the linker domain has at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CCGAATACGACACGTACAAGATCT (SEQ ID NO: 29), or comprises such a nucleic acid sequence.In other cases, the linker domain is a nucleic acid sequence having at least 80% identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO: 31), or comprises the same.

[0020] In some embodiments, the nucleic acid trans-splicing molecule comprises a 5' regulatory domain operably linked to the 5' side of the CDS. In some embodiments, the 5' regulatory domain comprises a native 5' ABCA4 untranslated region having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 90% sequence identity, 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to SEQ ID NO: 12 or 13. In some embodiments, the 5' regulatory domain further comprises a constitutive promoter, such as the CMV / CMV promoter.

[0021] In some embodiments, the splicing domain comprises GTAAGT, GUAAGT, GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, or GUAACU.

[0022] In some embodiments, the binding site comprises any one or more (e.g., any six or more, any eight or more, any ten or more, any twelve or more, any eighteen or more, any twenty or more, any twenty-four or more, any fifty or more, any one hundred or more, or any one hundred and fifty or more (e.g., 150)) of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16. In some embodiments, the binding site comprises any one or more (e.g., any six or more, any eight or more, any ten or more, any twelve or more, any eighteen or more, any twenty or more, any twenty-four or more, any fifty or more, any one hundred or more, or any one hundred and fifty or more (e.g., 150)) of nucleotides 1160 to 1309 of SEQ ID NO: 16. In some embodiments, the binding domain that binds to the binding site has at least 80% sequence identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to SEQ ID NO: 17 or 18. In some embodiments, the binding domain comprises SEQ ID NO: 17 or 18.

[0023] In some embodiments of any of the preceding aspects, the nucleic acid trans-splicing molecule comprises a 3' transcription terminator domain. In some embodiments, the 3' transcription terminator domain forms a triple helix structure that effectively caps the 3' end of the trans-splicing molecule. In some embodiments, the 3' transcription terminator domain comprises a wild-type MALAT1 sequence. In some embodiments, the 3' transcription terminator domain comprises a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 32 or 33 (e.g., at least 85% sequence identity to SEQ ID NO: 32 or 33, at least 90% sequence identity, 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity).

[0024] In some embodiments of any of the preceding aspects, the CDS comprises ABCA4 exons 1-22 or a variant thereof (e.g., a codon-optimized variant thereof).

[0025] In some embodiments of any of the preceding aspects, the nucleic acid trans-splicing molecule comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 40-50 (e.g., at least 85% sequence identity to any one of SEQ ID NOs: 40-50, at least 90% sequence identity, 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity).

[0026] In some embodiments of any of the foregoing aspects, the endogenous ABCA4 pre-mRNA has at least one mutation associated with an ABCA4-related retinal dystrophy (e.g., autosomal recessive ABCA4-related retinal dystrophy, e.g., Stargardt disease or cone-rod dystrophy). In some embodiments, the mutation is expressed in photoreceptor cells and / or retinal pigment epithelial cells.

[0027] In another aspect, a nucleic acid trans-splicing molecule is described that comprises, operably linked in the 5' to 3' direction: (a) a CDS comprising a functional sequence of a 5' ABCA4 exon, (b) a splicing domain configured to mediate trans-splicing, and (c) a binding domain having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to any one of SEQ ID NOs: 17-24, wherein the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to the endogenous ABCA4 exon 23, thereby replacing the endogenous 5' ABCA4 exon sequence with the functional sequence of the 5' ABCA4 exon.

[0028] In another aspect, provided herein is an isolated DNA molecule comprising SEQ ID NO: 18, or a vector thereof.

[0029] In another aspect, provided herein is an isolated RNA molecule comprising SEQ ID NO: 17, or a vector thereof.

[0030] In another aspect, provided herein is an isolated nucleic acid (e.g., DNA or RNA) encoding a nucleic acid trans-splicing molecule described in any of the preceding embodiments or any of the preceding aspects, e.g., a vector encoding a nucleic acid trans-splicing molecule of any of the preceding embodiments or any of the preceding aspects.

[0031] In another aspect, provided herein is a proviral plasmid comprising a nucleic acid trans-splicing molecule described in any of the preceding embodiments or any of the preceding aspects.

[0032] In another aspect, provided herein is an adeno-associated virus (AAV) comprising a sequence encoding a nucleic acid trans-splicing molecule described in any of the preceding embodiments or any of the preceding aspects. In some embodiments, the AAV preferentially targets photoreceptor cells and / or retinal pigment epithelial cells. In some embodiments, the AAV is AAV8, AAV5, or AAV2.

[0033] In another aspect, provided herein is a composition comprising a nucleic acid trans-splicing molecule, vector, proviral plasmid, or AVV described in any of the preceding embodiments or any of the preceding aspects. In some embodiments, the composition comprises a pharmaceutically acceptable excipient.

[0034] In another aspect, provided herein is a method of expressing functional ABCA4 in a target cell (e.g., in vitro or in vivo). In some embodiments, the method comprises transducing the target cell with a nucleic acid trans-splicing molecule, vector, AAV, or composition described in any one of the foregoing aspects. In some embodiments, the method replaces 20% or more of the target ABCA4 mRNA in the target cell (e.g., as measured by the trans-spliced ABCA4 RNA or the corresponding protein resulting from translation of the trans-spliced RNA, e.g., in cultured human cells). In some embodiments, the method replaces 38% or more of the target ABCA4 mRNA in the target cell (e.g., as measured by the trans-spliced ABCA4 RNA or the corresponding protein resulting from translation of the trans-spliced RNA, e.g., in cultured human cells). In some embodiments, the functional ABCA4 (the corresponding protein resulting from translation of the trans-spliced RNA) is the full-length ABCA4 protein.

[0035] In another aspect, provided herein is a method of reducing ABCA4 retinopathy-related lipofuscin and / or A2E accumulation in a subject (e.g., a mammal, e.g., a primate, e.g., a human). In some embodiments, the method comprises transducing target retinal cells in the subject with a nucleic acid trans-splicing molecule, vector, AAV, or composition described in any of the preceding embodiments or aspects. In some embodiments, the subject is a non-human primate or a human (e.g., a human diagnosed with ABCA4-related retinal dystrophy). In some embodiments, the nucleic acid trans-splicing molecule, vector, or AAV is administered to the subject by ocular administration (e.g., by subretinal administration).

[0036] In another aspect, provided herein is a method of correcting at least one mutation in the 5' ABCA4 exon sequence in target cells of a subject (e.g., a mammal, e.g., a primate, e.g., a human). In some embodiments, the method comprises administering to the subject a nucleic acid trans-splicing molecule, vector, composition, or AAV as described in any of the preceding embodiments or aspects. In some embodiments, the subject is a non-human primate or a human (e.g., a human diagnosed with ABCA4-related retinal dystrophy). In some embodiments, the nucleic acid trans-splicing molecule, vector, or AAV is administered to the subject by ocular administration (e.g., by subretinal administration).

[0037] In another aspect, provided herein is a method of treating ABCA4-related retinal dystrophy in a subject (e.g., a mammal, e.g., a primate, e.g., a human). In some embodiments, the method comprises administering to the subject, in a therapeutically effective amount, a nucleic acid trans-splicing molecule, vector, AAV, or composition as described in any of the preceding embodiments or aspects. In some embodiments, the ABCA4-related retinal dystrophy is associated with a mutation in the 5' ABCA4 exon sequence (e.g., a mutation in any one or more of exons 1-22 of ABCA4). In some embodiments, the ABCA4-related retinal dystrophy is Stargardt disease or cone-rod dystrophy. BRIEF DESCRIPTION OF THE DRAWINGS

[0038]

Figure 1

Figure 2

Figure 3A

Figure 3B

Figure 3D

Figure 4

Figure 5A

Figure 5B

Figure 5C

Figure 6

Figure 7

Figure 8A

Figure 8B

Figure 9

Figure 10A

Figure 10B

Figure 11A

Figure 11B

Figure 11C

Figure 11D

Figure 11E

Figure 11F

Figure 12A

Figure 12B

Figure 13

Figure 14A

Figure 14B

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20A

Figure 20B

Figure 21A

Figure 21B

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30A

Figure 30B

Figure 30C

Figure 31

DETAILED DESCRIPTION OF THE INVENTION

[0039] The compositions and methods described herein involve trans-splicing molecules (e.g., pre-mRNA trans-splicing molecules) for treating diseases or disorders caused by mutations in the ABCA4 gene. The compositions and methods described herein use gene therapy (e.g., in vivo gene therapy, e.g., delivered by adeno-associated virus) to treat diseases caused by at least one mutation in ABCA4, such as Stargardt disease or cone-rod dystrophy.

[0040] ABCA4 is approximately 6.8 kb in size, contains 50 exons, and encodes a 250 kDa ATP-binding cassette transporter protein that is expressed in photoreceptor cells and RPE cells. ABCA4 is a transmembrane protein that localizes specifically to the edges and incisions of the outer segment discs of rod and cone photoreceptors. In the retina, ABCA4 transports N-retinylidene-phosphatidylethanolamine from the lumen to the cytoplasmic leaflet of the photoreceptor disc membrane, a process that, in combination with chemical isomerization, facilitates the removal of potentially toxic retinoid compounds. Conversely, dysfunction of ABCA4 results in the accumulation of bisretinoids such as di-retinal conjugate A2E in the retinal pigment epithelium (RPE). This debris, also known as lipofuscin, is thought to interfere with RPE metabolism and ultimately contribute to cell death. Current genotype-phenotype models correlate the degree of residual ABCA4 activity with the severity of the retinal disease phenotype. Since ABCA4-related retinopathies typically inherit in an autosomal recessive manner, individuals with 50% of the normal level of photoreceptor ABCA4 are expected to have normal retinal function. Data from Abca4 knockout mice indicate that a range of 10-25% correction of ABCA4 levels is sufficient to achieve relevant therapeutic effects, including reduction of toxic lipid accumulation in the retina.

[0041] Importantly, the inventors demonstrated complete rescue of ABCA4 protein levels in in vitro engineered human ABCA4 protein knockout (KO) cell lines harboring diseases mimicking premature termination codon mutations, and achieved therapeutically relevant levels of RNA exon editing in NHP retina and human retinal explants in vivo. More specifically, the inventors confirmed that AAV-ABCA4 exon editor treatment, which results in an ABCA4 RNA exon editing efficiency (RNA substitution %) of more than 20%, is sufficient to achieve 100% rescue of ABCA4 protein levels in vitro in the ABCA4 protein KO cell line. See, for example, FIG. 3C. A parental ABCA4 knock-in (KI) cell line containing a strong CAG promoter knocked in upstream of the endogenous ABCA4 locus was used as a reference for comparing the rescue efficiency of the ABCA4 protein. As described herein, the in vitro engineered human ABCA4 protein KO cell line was derived from the parental ABCA4 KI cell line by introducing a disease-mimicking premature termination codon mutation into the ABCA4 gene. Thus, the in vitro engineered human ABCA4 protein knockout cell line functions as an in vitro model system for predicting the therapeutic efficacy of the ABCA4 RNA exon editor (nucleic acid trans-splicing molecule) described herein.

[0042] Furthermore, the inventors have shown that a single subretinal injection of an exemplary AAV8-based ABCA4 exon editing molecule results in up to 37% RNA replacement in NHP eyes in vivo at 3 months (12 weeks). See, for example, FIG. 22. As used herein, 37% replacement means that 37% of the total ABCA4 mRNA quantified from the treated cells or tissue is present in exon-edited form. The exemplary AAV8-based ABCA4 exon editing molecule used in this study contains SEQ ID NO: 77, which shares the same regulatory elements and double stop codons present in SEQ ID NO: 90. Translation of full-length human / NHP ABCA4 protein expression due to RNA trans-splicing was also demonstrated in this study, and the expression levels show a trend according to the % RNA replacement. Additional NHP studies using various other AAV8-based ABCA4 exon editing molecules examined at different time points after treatment have demonstrated durable RNA exon editing and human / NHP ABCA4 protein expression resulting from RNA trans-splicing. See, for example, FIGS. 9 and 10B. Thus, the inventors have achieved therapeutically relevant RNA exon editing via spliceosome-mediated trans-splicing and resulting full-length ABCA4 protein expression mediated by a single AAV vector in NHP. In these studies, selected regulatory elements, a 40mer linker, and BD common to ABCA4-01 (SEQ ID NO: 90) have been demonstrated to result in sustained expression and exon editing activity up to the 3-month time point in NHP. See, for example, FIGS. 22A and 22B.

[0043] Further evidence presented herein demonstrates that an exemplary AAV8 packaged RNA exon editor, ABCA4-01 (SEQ ID NO: 90) encoded by an AAV vector plasmid containing SEQ ID NO: 82, can mediate trans-splicing of endogenous pre-RNA to an extent sufficient to at least partially restore ABCA4 bioactivity in cells in vitro and in vivo. ABCA4-01 (SEQ ID NO: 90) is illustrated in FIG. 13 and the length of the RNA exon editor extends from the 5' ITR to the 3' ITR. In some embodiments, SEQ ID NO: 78 [a portion of SEQ ID NO: 90 extending from the 5' UTR to the end of the MALAT1-Masc RNA (anti-mutation 1), see FIG. 13] can be used for the RNA exon editor. In some embodiments, a portion of SEQ ID NO: 78 extending from the CDS of exons 1-22 to the end of the MALAT1-Masc RNA containing anti-mut1 (e.g., SEQ ID NO: 69) illustrated in FIG. 13 can be combined with different 5' UTRs in the ABCA4 RNA exon editor with a reasonable expectation of success in achieving an equivalent restoration of ABCA4 bioactivity.

[0044] In addition to the above, FIGS. 30A-30C show results demonstrating robust in vivo ABCA4 RNA and protein replacement in NHPs six months after treatment with an exemplary AAV8 RNA exon editor construct (ABCA4-01; SEQ ID NO: 90). Briefly, the inventors treated wild-type cynomolgus monkeys with a single subretinal dose of ABCA4-01 (3.5E11 vg / eye). Next, the in vivo distribution of AAV vector genomic DNA copies (VGCs), exon editor RNA expression, and the percentage of edited ABCA4 RNA and protein were evaluated at the 6-month time point. Exon editor RNA expression correlated well with VGCs (FIG. 30A), resulting in a robust RNA replacement % (conversion of native ABCA4 RNA copies to edited copies) calculated as the percentage of edited ABCA4 RNA relative to the total (edited + native) ABCA4 RNA population present in neural retina samples (FIG. 30B). As shown in FIG. 30B, the RNA replacement percentage was in the range of about 40%-60% at this dose of ABCA4-01. This resulted in a therapeutically relevant level of the resulting human-NHP chimeric ABCA4 protein, as measured by the validated IA-MS assay (FIG. 30C). More specifically, the human NHP chimeric ABCA4 protein obtained from ABCA4 RNA editing in these animals was found to be present at 20-40% of the total ABCA4 protein (human-NHP + NHP) in the test samples. Furthermore, the inventors demonstrated up to 66% RNA replacement and up to 45% human / NHP chimeric ABCA4 protein in wild-type cynomolgus monkeys treated with a high dose of ABCA4-01 delivered by single subretinal injection. These results demonstrate that ABCA4-01 achieves therapeutically relevant levels of edited ABCA4 protein expression in NHPs, and that these levels exceed those of the rescued ABCA4 protein previously shown to have a therapeutic effect in the ABCA4 KO mouse model.

[0045] The inventors also evaluated ABCA4 exon editing in human photoreceptors by treating human donor retinal explants with ABCA4-01, an AAV8 RNA exon editor construct containing exemplary SEQ ID NO: 90. As described in detail herein, the inventors treated explants from multiple donors with ABCA4-01 (3.9E11 vg / retinal punch), incubated the cells for 21 days, and then extracted RNA. Analysis of the extracted RNA showed approximately 20-30% RNA substitution with the corresponding exons encoded by ABCA4-01 of endogenous exons 1-22 (Figure 31).

[0046] The inventors also demonstrated that the ABCA4 protein rescued in ABCA4 protein KO cells transfected with an overexpression plasmid encoding an N-terminal V5 epitope-tagged version of the RNA exon editor of ABCA4-01 (SEQ ID NO: 81) exhibited ATPase activity. As described herein, the activity of the ABCA4 protein rescued after trans-splicing mediated by the V5 epitope-tagged version of the RNA exon editor of ABCA4-01 (SEQ ID NO: 81) was evaluated with or without 40 μM all-trans retinal (ATR) after ABCA4 protein immunoprecipitation. These results show that the ABCA4 protein rescued in ABCA4 protein KO cells exhibited ATPase activity, as reflected by an increase in the basal level of ATPase activity in response to the addition of 40 μM all-trans retinal. See Figure 24. These results provide evidence that the exon-edited ABCA4 protein generated from ABCA4-01 (SEQ ID NO: 90) treatment exhibited the functional ATPase activity required for the elimination of ATR and 11-cis retinal from photoreceptors. These results demonstrate the restoration of ABCA4 biological activity after the expression of an exemplary ABCA4 RNA exon editor.

[0047] Accordingly, the results presented herein demonstrate the therapeutic potential of the ABCA4 RNA exon editors described herein (e.g., an RNA exon editor comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) and compositions comprising the same in the treatment of ABCA4-related retinopathies, in the preparation of a medicament for treating ABCA4-related retinal diseases, and in the use in a method for treating a subject having ABCA4-related retinopathy. ABCA4-related retinopathies that can be treated using the ABCA4 RNA exon editors described herein (e.g., an RNA exon editor comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) and compositions comprising the same include Stargardt disease-1 (STGD1); macular fundus; retinitis pigmentosa-19 (RP19); cone-rod dystrophy-3 (CORD3); and age-related macular degeneration-2 (ARMD2). In some embodiments, ABCA4-related retinopathies that can be treated using the ABCA4 RNA exon editors described herein (e.g., an RNA exon editor comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) and compositions comprising the same include hereditary retinal diseases associated with two allelic pathogenic mutations spanning exons 1-22 of the ABCA4 gene that are present together with a phenotype consistent with cone-rod dystrophy, Stargardt macular dystrophy, or macular fundus. Based on available data, approximately 60% of known mutations in ABCA4 can be corrected using the ABCA4 RNA exon editors described herein (e.g., an RNA exon editor encoded by a nucleic acid trans-splicing molecule comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69), and 70-85% of patients diagnosed with ABCA4-related retinopathies will benefit from treatment with the ABCA4 RNA exon editors described herein (e.g., an RNA exon editor comprising any one of SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69).

[0048] In addition to the above, one of ordinary skill in the art will understand that novel mutations are regularly identified within the ABCA4 gene and do not necessarily belong to a specific phenotype(s). One of ordinary skill in the art will also understand that CORD3 → STGD1 → RP19 is thought to represent diverse phenotypes based on the severity of the mutation. Thus, the RNA exon editors and constructs encoding the same, as well as compositions containing the same, can be advantageously used in the treatment of conditions / diseases associated with any and all mutations identified in exons 1-22 of the ABCA4 gene, and the phenotypes belonging to the latter can be characterized as knowledge regarding ABCA4 retinopathy evolves.

[0049] In some embodiments, the subject / patient is identified as having at least one mutation in exons 1-22 of the ABCA4 gene. In some embodiments, the subject / patient has its genotype identified and is identified as having at least one mutation in exons 1-22 of the ABCA4 gene. In some embodiments, a subject / patient whose genotype has already been identified is obtained in order to identify at least one mutation in exons 1-22 of the ABCA4 gene. In any of the models, the subject / patient is selected based on having at least one mutation in exons 1-22 of the ABCA4 gene, regardless of the timing of the genotype identification on which the selection process is based for the proposed treatment of such a subject / patient with the RNA exon editor described herein. Such a subject / patient will benefit from the use of the ABCA4 RNA exon editor described herein for treating ABCA4-related retinopathy, a medicament comprising the ABCA4 RNA exon editor described herein for treating ABCA4-related retinopathy, and a method for treating ABCA4-related retinopathy that requires administering the ABCA4 RNA exon editor or a composition containing the same described herein.

[0050] Stargardt disease-1 (STGD1) is caused by homozygous or compound heterozygous mutations in the ABCA4 gene (OMIM number 601691) on chromosome 1p22. More than 900 different mutations, including missense, splicing, truncating, and frameshift changes, have been reported in the ABCA4 gene and have been shown to be associated with retinal degeneration. Many of these mutations alter a single amino acid in the ABCA4 protein, resulting in the absence or reduction of ABCA4 activity in photoreceptor cells. The reduction of ABCA4 activity leads to the accumulation of vitamin A derivatives and lipofuscin within retinal cells, which is toxic to the retinal pigment epithelium and photoreceptors. Stargardt macular degeneration is a hereditary eye disorder that affects the retina, and more specifically, the macula, a region responsible for sharp central vision that is important for various visual tasks including reading, driving, and face recognition. In addition to central vision loss, subjects affected by Stargardt macular degeneration have nyctalopia, and some affected individuals also have color vision impairment. In the later stages of the disease course, the peripheral visual field may also show moderate to extensive limitations. The signs and symptoms of Stargardt macular degeneration typically occur from childhood to early adulthood, and patients show progressive bilateral vision loss over time, often deteriorating to 20 / 200 or worse.

[0051] Fundus flavimaculatus (FFM) is a subtype of the allelic form of Stargardt disease associated with mutations in the ABCA4 gene and peripherin-2 (PRPH2) gene. Fundus flavimaculatus, a type of fleck basal disease, derives its name from the widespread distribution of numerous yellow-white flecks on the fundus due to the deposition of lipofuscin. FFM is characterized by reticular atrophy of the retinal pigment epithelium and atrophy of the choroidal vessels. Central vision loss, color vision loss, photophobia, paracentral scotomas, and delayed dark adaptation are characteristic features of FFM. FFM tends to present later and progress more slowly than other Stargardt subtypes. When vision loss begins within the first 20 years of life, patients are usually diagnosed with Stargardt, but when the disease presents in the second half of life and progresses more slowly, patients are usually diagnosed with FFM.

[0052] Retinitis pigmentosa-19 (RP19) can be caused by homozygous or compound heterozygous mutations in the ABCA4 gene on chromosome 1p22. Retinitis pigmentosa is a hereditary eye disease characterized by progressive loss of peripheral vision and nyctalopia. Many genes have been associated with retinitis pigmentosa. Retinitis pigmentosa-19 is characterized by night blindness, peripheral vision loss, progressive retinal degeneration, tunnel vision, progressive vision loss, decreased vision at night or in dim light, loss of central vision in the advanced stage, and retinal pigment epithelium (RPE). Clinically, the fundus shows extensive outer retinal degeneration, bone spicule pigment deposition, vascular attenuation, waxy disc edema, and severe atrophy changes, as well as choroidal scarring of the macula.

[0053] Cone-rod dystrophy-3 (CORD3) is caused by homozygous or compound heterozygous mutations in the ABCA4 gene on chromosome 1p22. ABCA4 is one of the four major causative genes involved in the etiology of cone-rod dystrophy, and mutations in ABCA4 are associated with 30-60% of autosomal recessive cone-rod dystrophy. CORD3 is an autosomal recessive clinically heterogeneous retinal disorder, typically characterized by symptomatic rapidly progressive vision loss with initial photophobia and loss of color discrimination, followed by night blindness and progressive visual field loss. Cone degeneration appears at an early age, the retina is centrally involved, and the rods degenerate several years later. The diagnosis of cone-rod dystrophy is based on the medical history, fundus examination, and electroretinogram. Cone-rod dystrophy typically presents earlier and progresses much more rapidly than other ABCA4 retinopathies, and extensive macular atrophy occurs several years after onset. Currently, there is no therapy to halt the progression of the disease or restore vision, and the visual prognosis is poor. Management aims to slow the degenerative process, treat complications, and prepare the patient for issues related to the social and psychological impact of blindness.

[0054] Susceptibility to age-related macular degeneration-2 (ARMD2) is caused by mutations in the ABCA4 gene on chromosome 1p22. ARMD2 is a complex disorder characterized by the accumulation of drusen (accumulation of yellowish deposits) inside and beneath the RPE, and progressive atrophy of the macular RPE. These changes lead to the loss of photoreceptor function and visual impairment. Age-related macular degeneration is the main cause of vision loss in the elderly in developed countries. Visual impairment usually becomes prominent in the 60s or 70s and tends to worsen over time. Age-related macular degeneration mainly affects central vision, which is important for detailed tasks such as reading, driving, and face recognition. Two main types of age-related macular degeneration, dry type and wet type, are described. The dry type is far more common and accounts for 85-90% of all cases of age-related macular degeneration. This is characterized by the accumulation of drusen beneath the retina, atrophy of the macula, and slowly progressive vision loss. This condition usually affects both eyes. The wet type of age-related macular degeneration is associated with sudden and severe vision loss that can rapidly worsen. This type of condition is characterized by the growth of abnormal and fragile blood vessels beneath the macula due to overexpression of VEGF. These blood vessels leak blood and body fluids, which damage the macula, thereby blurring or distorting central vision. Wet-type macular degeneration can be treated using various therapies. For dry-type AMD, there is a single available therapy, a C3 inhibitor, which is only available to patients with geographic atrophy. There is currently no treatment for early forms of ARMD with no atrophy or fluid leakage and only drusen deposition.

[0055] I. Definitions As used herein, "trans-splicing" means binding a first RNA molecule comprising one or more exons (e.g., an exogenous exon or an exon that is part of the CDS of a trans-splicing molecule) to a second RNA molecule (e.g., a pre-mRNA molecule, e.g., an endogenous pre-mRNA molecule), and replacing a part of the second RNA molecule with a part of the first RNA molecule via a spliceosome-mediated mechanism. The general mechanism of an RNA trans-splicing reaction is illustrated in Figure 14B.

[0056] A "nucleic acid trans-splicing molecule" or "trans-splicing molecule" has three main elements: (a) a binding domain that confers specificity by tethering the trans-splicing molecule to its target gene (e.g., pre-mRNA), (b) a splicing domain (e.g., a splicing domain having 3' or 5' splice sites), and (c) a CDS that is configured to be trans-spliced onto the target nucleic acid and that can replace one or more exons (e.g., one or more mutant exons) in the target nucleic acid. A "pre-mRNA trans-splicing molecule" or "RTM" refers to a nucleic acid trans-splicing molecule that targets pre-mRNA. The terms "nucleic acid trans-splicing molecule" and "trans-splicing molecule" refer to both (1) DNA that encodes RNA (the RNA transcript is an effector molecule that physically binds to the target pre-mRNA), and (2) the RNA transcript itself. For clarity, the term "coding sequence" (e.g., trans-splicing molecule coding sequence) is used herein to specify that the subject encodes an effector (e.g., the coding sequence is DNA and the effector is RNA). In some embodiments, the trans-splicing molecule coding sequence can include, for example, cDNA as part of a functional exon (e.g., a functional ABCA4 exon) for replacement of a mutant ABCA4 exon.

[0057] As used herein, the term "exon editor" can be used to refer to a trans-splicing molecule or a vector containing the same (e.g., an AAV vector containing DNA encoding an RNA transcript that is a trans-splicing molecule).

[0058] As used herein, "trans-splicing efficiency" refers to the ratio of the detected expression level of a desired trans-splicing RNA product (i.e., a chimeric RNA molecule comprising a functional exon of a trans-splicing molecule operably linked to an endogenous target pre-mRNA produced by an RNA trans-splicing reaction) to the amount of DNA or RNA introduced for the trans-splicing molecule (or reference molecule). In some cases, the expression level of the trans-splicing RNA product is detected from RNA isolated from cells or tissues using RNA-seq.

[0059] As used herein, "RNA replacement %" refers to the portion of the total target mRNA population that has successfully undergone trans-splicing (TS) and is calculated by the following formula: On-target (ONT) TS% = 100 * (ONT copy number / (ONT copy number + native copy number)).

[0060] As used herein, "relative trans-splicing efficiency" refers to the ratio of a test trans-splicing efficiency to a reference trans-splicing efficiency, where the test trans-splicing efficiency is the trans-splicing efficiency of a trans-splicing molecule (e.g., a nucleic acid trans-splicing molecule described herein), and the reference trans-splicing efficiency is the trans-splicing efficiency of a reference molecule (e.g., a molecule having the same elements as the nucleic acid trans-splicing molecule except that the binding domain is replaced with a scrambled binding domain (e.g., a binding domain comprising or consisting of SEQ ID NO: 1, e.g., a binding domain comprising or consisting of SEQ ID NO: 2)). The relative trans-splicing efficiency of a trans-splicing molecule can be given as the ratio (also known as the fold increase) of the test trans-splicing RNA efficiency to the reference trans-splicing efficiency tested under similar conditions.

[0061] As used herein, the terms "operably linked" or "operatively linked" refer to the arrangement of elements, and the components so described are configured to perform their normal functions. A nucleic acid is "operably linked" when it is placed in a functional relationship with another nucleic acid sequence. The elements need not be adjacent to be operably linked. Thus, for example, intervening sequences can be present between operably linked sequences (e.g., a binding domain and a coding sequence can be separated by an intervening sequence and the binding domain is considered to be "operably linked" to the coding sequence).

[0062] As used herein, the term "CDS" refers to a nucleic acid sequence (e.g., an RNA sequence, a DNA sequence, or a combination of RNA and DNA) that encodes a protein (e.g., a target protein whose mutations have been corrected). Thus, a CDS can include one or more functional exons (e.g., the sequences of functional exons). In some cases, one or more functional exons of a CDS are not separated by introns (e.g., like an endogenous pre-mRNA) and are adjacent to each other (e.g., as cDNA). In some cases, a CDS can include one or more introns (e.g., native introns) or untranslated regions (UTRs, e.g., native UTRs) that are between or otherwise adjacent to exons (e.g., upstream or downstream of an exon).

[0063] As used herein, the "native 5' ABCA4 untranslated region" or "native 5' ABCA4 UTR" refers to a sequence more than 20 nucleotides in length having at least 90% sequence identity to the region of the native ABCA4 gene (e.g., the human ABCA4 gene) on the 5' side of the ATG start codon. An example of the native 5' ABCA4 untranslated region is shown by the DNA sequence of SEQ ID NO: 13 or the RNA sequence of SEQ ID NO: 12. Also included herein are variants of the native 5' ABCA4 untranslated region such as, for example, the DNA sequence of SEQ ID NO: 64 or the RNA sequence of SEQ ID NO: 65.

[0064] As used herein, the "functional array of 5' ABCA4 exons" refers to a nucleic acid sequence comprising one or more of ABCA4 exons 1-22 that encodes a functional (biologically active) portion of the ABCA4 protein. When trans-spliced to an endogenous ABCA4 exon 3' of the binding site, the functional array of 5' ABCA4 exons provides for the expression of a functional ABCA4 protein (e.g., a non-mutated ABCA4 protein). In some cases, the functional array of 5' ABCA4 exons includes the sequence of an exon adjacent to the exon to which the trans-splicing molecule is trans-spliced (e.g., a trans-splicing molecule that binds to ABCA4 intron 22 and trans-splices to endogenous ABCA4 exon 23 may include the functional array of 5' ABCA4 exons that includes exons 22, 21, 20, 19, etc.).

[0065] As used herein, the term "functional," when used in the context of a protein, refers to a biologically active protein. The term "functional" may also be used to refer to the amount of protein activity necessary to support normal cellular function. With respect to ABCA4, the term "functional" may be used, for example, in the context of photoreceptors and / or retinal epithelial cells, to refer to the amount of ABCA4 protein activity necessary to restore the activity level of ABCA4 to support normal cellular function. Such levels are sufficient to reduce or prevent the accumulation of toxic levels of bisretinoid compounds in photoreceptors and / or retinal epithelial cells. More specifically, defective (non-functional) ABCA4 protein results in the accumulation of 11-cis and all-trans retinal in photoreceptors, as well as lipofuscin in the retinal pigment epithelium. In the context of a reduction in ABCA4 activity or a negligible level of ABCA4 activity, or the treatment of a disorder associated with the use of a therapeutic agent comprising a nucleic acid trans-splicing molecule described herein, "functional" refers to, for example, restoring an amount of ABCA4 protein sufficient to eliminate one or more symptoms of a disorder associated with a reduced level of ABCA4 activity such as ABCA4-related retinal dystrophy. Examples of ABCA4-related retinal dystrophy include, for example, Stargardt macular dystrophy (Stargardt's disease), macular fundus flavimaculatus, and ABCA4-related cone-rod dystrophy. In some embodiments, such methods or uses lead to an increase in ABCA4 protein activity (functionally biologically active ABCA4 protein activity).In some embodiments, such an increase in ABCA4 protein activity restores the ABCA4 activity level to at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% (e.g., 96%, 97%, 98%, 99%, or 100%) of ABCA4 activity as compared to that of cells in which ABCA4 is present at normal wild-type levels, such as those present in cells expressing non-mutant ABCA4 (e.g., photoreceptors and / or retinal epithelial cells).

[0066] As used herein, "modified potential splice site", "attenuated potential splice site", or "potential splice site resistance" refers to a nucleic acid trans-splicing molecule or a portion thereof (e.g., a coding domain sequence therein) that has been modified to change individual nucleotides therein to reduce the frequency of splicing that occurs at a potential splice site in the context of a nucleic acid trans-splicing molecule. In some embodiments, the modification results in no change to the amino acid sequence encoded thereby. In some embodiments, the modification results in a change to the amino acid sequence encoded thereby. In some embodiments, the potential splice site-resistant nucleic acid sequence within the nucleic acid trans-splicing molecule is a coding domain sequence (CDS). In some embodiments, the potential splice site-resistant ABCA4 CDS comprises, consists essentially of, or consists of exons 1-22 of the ABCA4 gene, and the potential splice sites have been identified in the context of the nucleic acid trans-splicing molecule, and at least one of the potential splice sites has been modified to reduce the frequency of splicing at at least one site without changing the amino acid encoded thereby. Exemplary potential splice sites identified in ABCA4 exons 1-22 and the frequency of splicing at these sites are presented in Table 3. The nucleotide positions shown in the column having the header rtm_pos in the table refer to the position of the last nucleotide shown in column 3 or column 4 relative to the ATG codon (translation start site), with the A of this codon designated as position 1. Exemplary potential splice-resistant ABCA4 exon 1-22 sequences comprise, consist essentially of, or consist of any one of SEQ ID NOs: 56-59. In some embodiments, the exemplary potential splice-resistant ABCA4 exon 1-22 sequence comprises, consists essentially of, or consists of SEQ ID NO: 56.

[0067] As used herein, the "splicing domain" refers to a nucleic acid sequence having a motif that is recognized by a spliceosome and mediates trans-splicing. The splicing domain includes a splice site (e.g., a single splice site, i.e., only one splice site), which may be either a 3' splice site or a 5' splice site. The splicing domain may include other regulatory elements. For example, in some embodiments, the splicing domain includes splicing enhancers (e.g., exon splicing enhancers (ESEs) and intron splicing enhancers (ISEs)). In some embodiments, the splicing domain includes GUAAGT or GTAAGT. In some embodiments, the splice site consists essentially of GUAAGT or GTAAGT. In some embodiments, the splicing domain consists of GUAAGT or GTAAGT.

[0068] As used herein, the "binding domain" of a trans-splicing molecule is a polynucleotide sequence that binds to a target gene at a binding site via hybridization (i.e., complete or partial complementarity to the binding site).

[0069] As used herein, the term "binding site" refers to an endogenous polynucleotide sequence in a target mRNA (e.g., an mRNA of an endogenous gene, e.g., ABCA4) that is bound by the binding domain of a nucleic acid trans-splicing molecule. The binding site extends from the most 5'-side nucleotide bound by the binding domain to the most 3'-side nucleotide bound by the binding domain. In some embodiments, the binding site is the same length as the binding domain. In other embodiments, the binding site is 1 to 10 residues longer or shorter than the binding domain (i.e., some of the residues of either the binding site or the binding domain do not hybridize). In embodiments involving a binding domain having at least two non-overlapping sequences having at least 80% complementarity to the binding site, the binding site may be substantially shorter than the binding domain.

[0070] As used herein, "complementarity" and its grammatical variants refer to the percentage of nucleotide bases of a given sequence that pair by hydrogen bonding to a reference sequence. In the absence of a given percentage of complementarity, the terms "complementary" and "complementary to" refer to 100% complementarity.

[0071] As used herein, when each of the nucleotide bases of a given sequence pairs by hydrogen bonding to a reference sequence, the given sequence (e.g., a binding domain sequence) is "100% complementary" to, or has "100% complementarity" with, the reference sequence (e.g., an endogenous pre-mRNA binding site), thereby hybridizing to form a double-stranded sequence (e.g., via Watson-Crick base pairing, e.g., each A pairs with T or U, and each C pairs with G). For example, a binding domain in the antisense orientation to a binding site is complementary to the binding site. RNA pairing includes G pairing with U (wobble base pairing), and thus, an RNA binding domain having G-U pairing with its binding site can be 100% complementary to the binding site. Thus, a binding domain that is exactly the reverse complement of its binding site (i.e., the A of the binding domain pairs with the U of the binding site) can be modified to substitute any one or more of the As with Gs without substantially affecting binding.

[0072] As used herein, when X% of the nucleotide bases of a given sequence pair by hydrogen bonding to a reference sequence, e.g., hybridize to form a double-stranded sequence (e.g., via Watson-Crick base pairing, e.g., A pairs with T or U, and C pairs with G), the given sequence (e.g., a binding domain sequence) is "at least X% complementary" to the reference sequence (e.g., an endogenous pre-mRNA binding site), or has "X% complementarity". For example, a binding domain sequence having a length of 150 bases is at least 90% complementary to a binding site having a length of 150 bases if at least 135 of its 150 residues pair by hydrogen bonding to the binding site via Watson-Crick base pairing leaving 15 or fewer mismatched nucleotides.

[0073] As used herein, "binding" between a binding domain and an intron refers to hydrogen bonding (e.g., double helix formation, or Watson-Crick pairing) to an extent sufficient to mediate trans-splicing between the binding domain and the target intron by associating a trans-splicing molecule with a target (e.g., pre-mRNA). In some embodiments, the hydrogen bonding between the binding domain and the target intron is between nucleotide bases that are complementary to each other and are in an antisense orientation to each other (e.g., hybridize to each other).

[0074] The sequence of the binding domain can be complementary to the target sequence (e.g., pre-mRNA) of the target sequence by at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%. In some embodiments, the sequence of the binding domain can be 100% complementary to the target sequence of the pre-mRNA transcript.

[0075] In some embodiments, the sequence of the binding domain may have four or fewer mismatches to the target sequence of the pre-mRNA transcript. In some embodiments, the sequence of the binding domain may have three or fewer mismatches to the target sequence of the pre-mRNA transcript. In some embodiments, the sequence of the binding domain may have two or fewer mismatches to the target sequence of the pre-mRNA transcript. In some embodiments, the sequence of the binding domain may have one or fewer mismatches to the target sequence of the pre-mRNA transcript. In some embodiments, the sequence of the binding domain may have no mismatches to the target sequence of the pre-mRNA transcript.

[0076] The binding domain may specifically hybridize to the target sequence of the pre-mRNA transcript. For example, the binding domain may have 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% sequence complementarity to the target sequence of the pre-mRNA transcript. In some embodiments, the hybridization may be under physiological hybridization conditions (in vitro or in vivo cells). In some embodiments, the hybridization may be under stringent hybridization conditions.

[0077] In some embodiments, the binding domain "specifically hybridizes to" or is "specific for" the target sequence of the pre-mRNA. Such hybridization typically occurs at a Tm substantially higher than 37°C, more specifically at least 50°C, more specifically 60°C to about 90°C. Such hybridization more specifically corresponds to stringent hybridization conditions. At a given ionic strength and pH, Tm is the temperature at which 50% of the target sequence hybridizes to a complementary oligonucleotide for a perfectly matching probe.

[0078] As used herein, "artificial intron" refers to a non-coding nucleic acid sequence that (directly or indirectly) links a binding domain to a CDS. The artificial intron includes a splicing domain and may further include one or more spacer sequences and / or other regulatory elements.

[0079] As used herein, the term "mutation" is used to refer to any abnormal nucleic acid sequence that causes a defective protein product (e.g., a non-functional protein product, a non-biologically active protein, a protein product with reduced function, a protein product with abnormal function, and / or a protein product produced in less than or more than normal amounts). Mutations include base pair mutations (e.g., single nucleotide polymorphisms), missense mutations, frameshift mutations, deletions, insertions, and splice mutations. In some embodiments, a mutation refers to a nucleic acid sequence that is different from the corresponding wild-type nucleic acid sequence or a functional variant thereof in one or more portions of its sequence. In some embodiments, a mutation refers to a nucleic acid sequence that encodes a protein having an amino acid sequence different from the corresponding wild-type protein or a functional variant thereof. A "mutated exon" (e.g., a mutated ABCA4 exon) refers to an exon that contains a mutation or an exon sequence that reflects a mutation in a different region, e.g., a potential exon resulting from a mutation in an intron.

[0080] The term "ABCA4" (ATP-binding cassette subfamily A member 4), unless otherwise specified, refers to any vertebrate source, including mammals such as primates (e.g., humans, African green monkeys, and cynomolgus monkeys), and rodents (e.g., mice and rats), and any natural ABCA4 (also known as ARMD2, CORD3, ABCR, FFM, retinal-specific phospholipid transport ATPase ABCA4, Stargardt disease protein, RIMABC transporter, RIM ABC transporter, RIM protein, STGD1, RP19, or STGD) derived from any vertebrate source, including functionally equivalent or improved variants (e.g., natural or synthetic variants), mutants, mutant proteins, analogs, subunits, receptor complexes, isotypes, splice variants, and fragments thereof. Functionally equivalent and improved variants can be determined based on known ABCA4 signaling. ABCA4 encompasses full-length, untreated ABCA4, as well as any form of ABCA4 resulting from natural processing within the cell. An exemplary human ABCA4 sequence is provided as National Center for Biotechnology Information (NCBI) reference sequence: NG_009073.1. In some cases, ABCA4 is encoded by a therapeutic gene having at least 95% sequence identity to SEQ ID NO: 11 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 11), a functional portion thereof, and / or a codon-optimized variant thereof.

[0081] As used herein, "variant" refers to a polynucleotide that differs from a reference polynucleotide sequence, e.g., a naturally occurring polynucleotide sequence, or a reference polypeptide sequence such as any of the rAAV sequences described herein, by at least one nucleic acid residue, or a polypeptide (e.g., an AAV capsid sequence) that differs from a reference polypeptide sequence by at least one amino acid residue. In this context, the difference in at least one residue can include, for example, a substitution, deletion, or insertion of one nucleic acid for another nucleic acid residue, or a substitution of one amino acid for another amino acid residue. A variant can be a homolog, isoform, or transcript variant of a polynucleotide as defined herein, and a homolog, isoform, or transcript variant is characterized by the degree of identity or homology as defined herein, respectively.

[0082] In some cases, variants of polynucleotides or polypeptides include at least one nucleic acid substitution (e.g., 1 to 100 nucleic acid or amino acid substitutions, 1 to 50 nucleic acid or amino acid substitutions, 1 to 20 nucleic acid or amino acid substitutions, 1 to 10 nucleic acid or amino acid substitutions, e.g., 1 nucleic acid or amino acid substitution, 2 nucleic acid or amino acid substitutions, 3 nucleic acid or amino acid substitutions, 4 nucleic acid or amino acid substitutions, 5 nucleic acid or amino acid substitutions, 6 nucleic acid or amino acid substitutions, 7 nucleic acid or amino acid substitutions, 8 nucleic acid or amino acid substitutions, 9 nucleic acid or amino acid substitutions, or 10 nucleic acid or amino acid substitutions). Nucleic acid substitutions that result in expressed polypeptides having exchanged amino acids from the same class are referred to herein as conservative substitutions. In particular, these are amino acids having aliphatic side chains, positively or negatively charged side chains, side chains or amino acids having an aromatic group in the side chain, and the side chains can form hydrogen bridges, e.g., side chains having a hydroxyl functionality. Due to the conservative constitution, for example, an amino acid having a polar side chain can be substituted with another amino acid having a corresponding polar side chain, or, for example, an amino acid characterized by a hydrophobic side chain can be substituted with another amino acid having a corresponding hydrophobic side chain (e.g., serine (threonine) by threonine (serine), or leucine (isoleucine) by isoleucine (leucine)).

[0083] In some cases, insertions, deletions, and / or non-conservative substitutions are also encompassed by the term variant at positions that, for example, do not cause substantial modification of the three-dimensional structure of the protein. Modifications of the three-dimensional structure due to insertions (s) or deletions (s) can be readily identified by one skilled in the art, for example, using a CD spectrum (circular dichroism spectrum).

[0084] The term "identical" refers to the degree of identity between the sequences of two nucleic acid sequences. Sequence homology is determined by comparing two sequences aligned under standard conditions over the length of the sequences being compared. The sequences compared herein may have additions or deletions (e.g., gaps, etc.) in the optimal alignment of the two sequences. In some embodiments, sequence homology is calculated, for example, by creating an alignment using the ClustalW algorithm (Nucleic Acid Res., 1994, 22(22):4673 - 4680). Commonly available sequence analysis software such as VectorNTI, GENETYX, BLAST, or analysis tools provided by public databases may also be used.

[0085] As used herein, the terms "AAV" or "AAV serotype" refer to dozens of naturally occurring and available adeno - associated viruses, as well as engineered AAVs. Among the AAVs isolated or engineered from humans or non - human primates (NHPs) and well - characterized, human AAV2 was the first AAV developed as a gene delivery vector and has been widely used in efficient gene delivery experiments in different target tissues and animal models.

[0086] As used herein, in the context of AAV, the term variant means any AAV sequence derived from a known AAV sequence that shares at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or more sequence identity with an amino acid sequence or nucleic acid sequence. In another embodiment, the AAV capsid includes variants that may contain up to about 10% variation from any described or known AAV capsid sequence. That is, the AAV capsid shares about 90% to about 99.9%, about 95% to about 99%, or about 97% to about 98% identity with the AAV capsids provided herein and / or well-known in the art. In one embodiment, the AAV capsid shares at least 95% identity with an AAV capsid. When determining the percent identity of an AAV capsid, the comparison can be made in any of the variable proteins (e.g., vp1, vp2, or vp3).

[0087] The ITR or other AAV components can be readily isolated or manipulated from AAV using techniques available to those skilled in the art. Such AAV can be isolated, manipulated, or obtained from academic, commercial, or public sources (e.g., American Type Culture Collection, Manassas, Va.). Alternatively, AAV sequences can be manipulated via synthesis or other suitable means by referring to published sequences available in the literature or in databases such as, for example, GenBank, PubMed, etc. AAV viruses can be manipulated by conventional molecular biology techniques, which can enable the optimization of these particles for cell-specific delivery of nucleic acid sequences, minimization of immunogenicity, modulation of stability and particle lifespan, efficient degradation, accurate delivery to the nucleus, etc.

[0088] As used herein, the terms "subject," "individual," or "patient" include any mammal in need of these methods of treatment or prevention, including primates such as humans. Other mammals in need of such treatment or prevention include non-human primates (NHPs; e.g., cynomolgus monkeys and African green monkeys), dogs, cats, or other domestic animals, horses, livestock, laboratory animals (e.g., mice, rats, or rabbits), etc. The individual can be male or female. In one embodiment, the individual has a disease or disorder (e.g., ABCA4-related retinal dystrophy) resulting from a mutation in the ABCA4 gene. In another embodiment, the individual has a risk of developing a disease or disorder resulting from a mutation in the ABCA4 gene. In another embodiment, the individual exhibits clinical signs of a disease or disorder caused by a mutation in the ABCA4 gene, such as ABCA4-related retinal dystrophy. The individual can be of any age for which a treatment or prophylactic therapy can be beneficial. For example, in some embodiments, the individual is 0-5 years old, 5-10 years old, 10-20 years old, 20-30 years old, 30-50 years old, 50-70 years old, or 70 years or older. In another embodiment, the individual is 12 months of age or older, 18 months of age or older, 2 years of age or older, 3 years of age or older, 4 years of age or older, 5 years of age or older, 6 years of age or older, 7 years of age or older, 8 years of age or older, 9 years of age or older, or 10 years of age or older. In another embodiment, the individual has viable retinal cells (e.g., viable retinal cells sufficient to maintain partial or complete visual function).

[0089] As used herein, the terms "disorder associated with a mutation" or "mutation associated with a disorder" refer to a correlation between the disorder and the mutation. In some embodiments, the disorder associated with the mutation is known or suspected to be caused, in whole or in part, directly or indirectly, by the mutation. For example, an individual having the mutation can be at risk of developing the disorder, and that risk can further depend on other factors, such as other (e.g., independent) mutations (e.g., in the same or different genes), or environmental factors.

[0090] As used herein, the term "treatment" or its grammatical derivatives are defined as reducing the progression of a disease, decreasing the severity of disease symptoms, delaying the progression of disease symptoms, eliminating disease symptoms, or delaying the onset of disease. In some embodiments, the term "treatment" is used to refer to the sustained or durable effects of a therapeutic agent such as an RNA exon editor described herein. Evidence demonstrating the durable therapeutic effects of the RNA exon editors described herein is shown, for example, in FIGS. 22 and 31. In some embodiments, the effects of the treatments provided herein persist for at least 1, 2, 3, 4, 5, 6, or more. In some embodiments, the nucleic acid trans-splicing molecule is administered only once in a lifetime.

[0091] As used herein, the term "prevention" of a disorder or its grammatical derivatives is defined as reducing the risk of onset of a disease, and is defined, for example, as a prophylactic therapy for an individual at risk of developing a disorder associated with a mutation. An individual can be characterized as "at risk" of developing a disorder by identifying a mutation associated with the disorder according to any suitable method known in the art or described herein. In some embodiments, an individual at risk of developing a disorder has one or more ABCA4 mutations associated with the disorder. Additionally, or alternatively, an individual can be characterized as "at risk" of developing a disorder if the individual has a family history of the disorder.

[0092] As used herein, the term "ABCA4-related retinopathy" includes diseases / conditions associated with mutations in ABCA4, including, for example, Stargardt disease-1 (STGD1), macular fundus, retinitis pigmentosa-19 (RP19), cone-rod dystrophy-3 (CORD3), and age-related macular degeneration-2 (ARMD2).

[0093] Treatment or prevention of a disorder in an individual can be effected by directly administering to the individual a trans-splicing molecule or an RNA exon editor (e.g., within a vector, e.g., an AAV vector or AAV particle). Alternatively, host cells comprising a trans-splicing molecule can be administered to the individual.

[0094] As used in the methods described herein, the term “administering” or grammatical derivations thereof means administering a trans-splicing molecule or an RNA exon editor (e.g., within a vector, e.g., an AAV vector or AAV particle) or composition, or cells treated ex vivo, to an individual in need thereof, e.g., an individual having a mutation or deletion of ABCA4. For example, in one embodiment where ocular cells (e.g., photoreceptors) are targeted, the method involves administering to the individual a trans-splicing molecule or an RNA exon editor (e.g., within a vector, e.g., an AAV vector or AAV particle), or a composition thereof, by subretinal injection. In another embodiment, intravitreal injection or injection via the episcleral vein can be performed as the administration. In another embodiment, the composition is administered systemically (e.g., intravenously). Further alternative methods of administration can be selected by one of ordinary skill in the art in light of the present disclosure.

[0095] As used herein, “regulating the expression of ABCA4” refers to decreasing the expression of endogenous mutant (non-functional) ABCA4 and / or increasing the expression of trans-spliced ABCA4. Regulating the expression of ABCA4 can be used, for example, to refer to decreasing the expression of endogenous (e.g., mutant) ABCA4 and / or increasing the expression of trans-spliced ABCA4 (e.g., an ABCA4 transcript or protein product having a trans-splicing molecule-mediated correction mutation site relative to its endogenous mutant transcript or protein product). Substituting an endogenous ABCA4 exon containing a mutation site via trans-splicing results in the expression of a functional ABCA4 protein.

[0096] As used herein, "codon optimization" refers to modifying a nucleic acid sequence to change individual nucleic acids without causing any change in the encoded amino acid. A sequence modified in this way is referred to herein as "codon optimized." This process can be performed on any of the sequences described herein to enhance expression or stability. Codon optimization can be performed, for example, by the methods described in U.S. Patent Nos. 7,561,972, 7,561,973, and 7,888,112, each of which is incorporated herein by reference in its entirety. The sequence surrounding the translation initiation site can be converted to a consensus Kozak sequence according to known methods. See, for example, Kozak et al, 1987. Nucleic Acids Res. 15(20):8125-8148, which is incorporated herein by reference in its entirety.

[0097] The term "pharmaceutically acceptable" means safe for administration to mammals such as humans. In some embodiments, a pharmaceutically acceptable composition is approved by a regulatory agency of the federal or state government or is listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, more specifically in humans.

[0098] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a therapeutic molecule (e.g., a trans-splicing molecule, or a trans-splicing molecule comprising a vector or cell of the invention) is administered together. Examples of suitable pharmaceutical carriers are described in "Remington’s Pharmaceutical Sciences," Mack Publishing Co., Easton, PA., 18th edition.

[0099] The terms "a" and "an" mean "one or more." For example, "gene" is understood to represent one or more such genes. Thus, the terms "a" and "an," "one or more," and "at least one" are used interchangeably herein.

[0100] Unless otherwise specified, the left end of a single-stranded nucleic acid (e.g., pre-mRNA transcript, oligonucleotide, etc.) sequence is the 5' end, and the left-hand direction of a single-stranded or double-stranded nucleic acid sequence is referred to as the 5' direction. Similarly, the right end or direction of a nucleic acid sequence (single-stranded or double-stranded) is the 3' end or direction. Generally, a region or sequence 5' to a reference point in a nucleic acid is referred to as "upstream", and a region or sequence 3' to a reference point in a nucleic acid is referred to as "downstream". Generally, the 5' direction or the end of an mRNA is the location where the initiation or start codon is located, and the 3' end or direction is the location where the stop codon is located.

[0101] As used herein, the term "about", unless otherwise specified, refers to a value within ±10% variation from a reference value.

[0102] II. Trans-splicing molecules In the design and discovery of exon editors, an approach combining computer analysis following screening of a Next Generation Sequencing (NGS)-based exon editor library to evaluate RNA replacement efficiency, as well as evaluation by RT-qPCR analysis following transfection of individual exon editors, and blot analysis to evaluate protein rescue, is used. The former approach utilizes the rational design and accumulated knowledge obtained from past screenings, along with the ability for multiplexed parallel throughput, and the latter approach is used both to test new hypotheses and to verify conclusions obtained from NGS-based methods.

[0103] Provided herein are nucleic acid trans-splicing molecules useful for correcting mutations in ABCA4 by replacing at least one mutant ABCA4 exon with a functional ABCA4 exon (e.g., an ABCA4 exon 5' of the binding site, e.g., exons 1-22 of ABCA4). In some embodiments, the nucleic acid trans-splicing molecule is a pre-RNA trans-splicing molecule (RTM). The design of the trans-splicing molecule allows for replacement of a defective or mutant portion of a pre-mRNA exon(s) with a nucleic acid sequence, e.g., an exon(s) having a functional (e.g., normal) sequence without the mutation. The functional sequence may be a wild-type naturally occurring sequence or some other modified, e.g., corrected sequence with codon optimization.

[0104] The trans-splicing molecule includes a binding domain, a splicing domain, and a CDS. In some embodiments, the nucleic acid trans-splicing molecule has a 5' regulatory domain having a native 5' ABCA4 untranslated region (e.g., a sequence having at least 80% sequence identity with any one of SEQ ID NOs: 12-15). In some embodiments, the nucleic acid trans-splicing molecule has a splice site of GUAAGT or GTAAGT. In some embodiments, the nucleic acid trans-splicing molecule has a linker domain longer than 25 nucleotides in length. In some embodiments, the nucleic acid trans-splicing molecule includes, consists essentially of, or consists of a linker domain having SEQ ID NO: 27, or a sequence having at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 27.

[0105] In some embodiments, the trans-splicing molecules described herein are operably linked in the 5' to 3' direction to: a 5' untranslated region, a coding domain sequence (e.g., a CDS, e.g., a sequence encoding a functional sequence of an ABCA4 exon, e.g., a functional sequence of an ABCA4 exon on the 5' side of a binding site), a splicing domain (e.g., a splice site), a linker domain, a binding domain, a 3' downstream region, and a terminator domain.

[0106] In some embodiments, the nucleic acid trans-splicing molecules described herein are configured to correct at least one mutation (e.g., two different mutations, each mutation present on a different allele of the ABCA4 gene in a subject) located in the 5' region of the ABCA4 gene (e.g., the region 5' of intron 22) by binding to the target intron 22 and mediating the trans-splicing of a CDS having a functional sequence of the 5' ABCA4 exon to an endogenous ABCA4 exon on the 3' side of the target intron. Thereby, such trans-splicing replaces the defective exon(s) and removes the defective portion of the target pre-mRNA, repairing the defective ABCA4 gene in the target cells of an individual and resulting in a functional ABCA4 mRNA capable of transcribing a functional ABCA4 protein in the cell.

[0107] In some embodiments, the trans-splicing molecule is up to 5,000 nucleotide bases in length, such as up to 4,900 nucleotide bases in length, up to 4,800 nucleotide bases in length, or up to 4,700 nucleotide bases in length (e.g., 3,000 - 4,000 nucleotide bases in length, 3,100 - 3,800 nucleotide bases in length, 3,200 - 3,700 nucleotide bases in length, or 3,300 - 3,500 nucleotide bases in length, e.g., 3,000 - 3,100 nucleotide bases in length, 3,100 - 3,200 nucleotides 3,200 - 3,300 nucleotide bases in length, 3,300 - 3,400 nucleotide bases in length, 3,400 - 3,500 nucleotide bases in length, 3,500 - 3,600 nucleotide bases in length, 3,600 - 3,700 nucleotide bases in length, 3,700 - 3,800 nucleotide bases in length, 3,800 - 3,900 nucleotide bases in length, 3,900 - 4,000 nucleotide bases in length, 4,000 - 4,100 nucleotide bases in length, 4,100 - 4,200 nucleotide bases in length, 4,200 - 4,300 nucleotide bases in length, 4,300 - 4,400 nucleotide bases in length, 4,400 - 4,500 nucleotide bases in length, 4,500 - 4,600 nucleotide bases in length, 4,600 - 4,700 nucleotide bases in length, 4,700 - 4,800 nucleotide bases in length, 4,800 - 4,900 nucleotide bases in length, or 4,900 - 5,000 nucleotide bases in length).

[0108] Due to the large size of the ABCA4 gene and the size constraints of AAV delivery, a single trans-splicing molecule configured to be packaged within an AAV vector (e.g., as a trans-splicing molecule coding sequence) may not cover all mutations within the ABCA4 gene that may be associated with the disorder, and thus, mutations along the entire length of the ABCA4 gene may not be corrected. Accordingly, the trans-splicing molecules described herein can be adapted as part of the methods described below to correct multiple mutations spanning the full length of the ABCA4 gene.

[0109] ABCA4 The ABCA4 gene targeted by the trans-splicing molecules described herein may contain one or more mutations associated with diseases such as Stargardt disease or cone-rod dystrophy (e.g., causing or correlating with) associated with ABCA4-related retinal dystrophy. An exemplary human ABCA4 sequence is provided as the reference sequence: NG_009073 by the National Center for Biotechnology Information (NCBI). In addition to the published sequences, all subsequent corrections, or naturally occurring conservative and non-disease-causing variant sequences occurring in human or other mammalian populations are also included. Also included are those that cause additional conservative nucleotide substitutions or codon optimization. The sequences provided by database accession numbers can be used to search for homologous sequences in the same or different mammalian organisms.

[0110] The ABCA4 nucleic acid sequences and the resulting expressed proteins are expected to tolerate certain minor modifications at the nucleic acid level, such as modifications to nucleotide bases that are, for example, silent, including, for example, preferred codons. In other embodiments, for example, nucleic acid base modifications (e.g., codon optimization) that change amino acids to improve the expression of the resulting peptide / protein are envisioned. In some embodiments, modifications of allelic variations caused by the natural degeneracy of the genetic code are envisioned.

[0111] Also included as modifications of the ABCA4 gene are analogs, or modified forms, of the encoded amino acid sequence. Typically, such analogs differ from the specifically identified protein by only 1 to 4 codon changes. Conservative substitutions are substitutions that occur within families of amino acids that are related in their side chains and chemical properties.

[0112] The nucleic acid sequence of the functional ABCA4 gene can be derived from any mammal that naturally expresses functional ABCA4 or its homologs. In other embodiments, specific modifications are made to the ABCA4 gene sequence to enhance its expression in target cells. Such modifications include codon optimization.

[0113] Mutations in specific ABCA4 exons are described, for example, in International Patent Publication No. WO2017 / 087900, which is incorporated herein by reference.

[0114] As described hereinabove, ABCA4 retinopathy is caused by pathogenic variants of the ABCA4 gene that are inherited in an autosomal recessive-like manner. Such pathogenic variants (mutations) include missense, nonsense, splicing, structural, and deep intronic variants. Missense variants account for most of the variants associated with ABCA4 retinopathy. In individuals with ABCA4 retinopathy, the individual has a mutation in ABCA4 on each allele. Compositions containing trans-splicing molecules can correct mutations on both alleles, regardless of the location of the mutation within the ABCA4 gene. For example, for an individual having a mutant ABCA4 exon 2 on the first allele and a mutant ABCA4 exon 9 on the second allele, a single 5’ trans-splicing molecule (5’ RNA editing molecule) encoding exons 1-22 can be used to replace mutant ABCA4 exon 2 and mutant ABCA4 exon 9. See, for example, FIG. 14A. Thus, in some embodiments, when two or more mutations are located in a portion of the ABCA4 gene that can be replaced by the same trans-splicing molecule spanning the two or more mutations, a single trans-splicing molecule having a coding region containing the functional ABCA4 exon(s) can replace one or more exons containing the mutations.

[0115] Alternatively, in some embodiments, the individual has an ABCA4 mutation with mutations in distant exons within the ABCA4 gene. For example, if an individual has mutant ABCA4 exon 2 on the first allele and mutant ABCA4 exon 49 on the second allele, two RNA editing molecules can be combined (e.g., in a composition) and used to replace each of the mutant exons. Such an approach would involve the use of a 5' trans-splicing molecule to replace mutant ABCA4 exon 2 and a 3' trans-splicing molecule to replace mutant ABCA4 exon 49. In such embodiments, the two trans-splicing molecules can be co-delivered as part of the same AAV vector or delivered with separate AAV vectors (e.g., if both trans-splicing molecules exceed the packaging limit of AAV).

[0116] Coding domain sequence In some embodiments, the CDS of the 5' trans-splicing molecule includes all ABCA4 exons (e.g., functional ABCA4 exons) that are 5' of the target ABCA4 intron (e.g., ABCA4 intron 22). For example, in embodiments where the 5' trans-splicing molecule targets ABCA4 intron 22, the CDS can include functional ABCA4 exons 1-22. In such embodiments, the CDS can be 2,000-4,500 bp in length. In some cases, both allelic mutations occur in the 5' portion of the target gene and a 5' trans-splicing molecule is selected to correct both mutations. In one embodiment, the binding domain binds to intron 22 and the CDS includes functional ABCA4 exons 1-22.

[0117] In some embodiments, the CDS (e.g., of the transgene encoding RTM) comprises the cDNA of an ABCA4 exon (e.g., a functional ABCA4 exon) for substitution of a mutant ABCA4 exon(s). For example, one or more functional ABCA4 exons within the CDS can be cDNA sequences. In some embodiments, the entire CDS is a cDNA sequence. Additionally or alternatively, all or part of the CDS, or one or more of its functional ABCA4 exons, can be a naturally occurring sequence (e.g., having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with an endogenous ABCA4 exon).

[0118] In some embodiments, all or a portion of the CDS, or one or more functional ABCA4 exons thereof, is a codon-optimized sequence in which the nucleic acid sequence has been modified, for example, to enhance expression or stability, without resulting in a change in the encoded amino acids. Codon optimization can be performed by methods such as those described in U.S. Patent Nos. 7,561,972, 7,561,973, and 7,888,112, each of which is hereby incorporated by reference in its entirety. As described herein, for delivery via recombinant AAV, in one embodiment, the CDS is a nucleic acid sequence up to 4,000 nucleotide bases in length (e.g., 3,000 - 4,000 nucleotide bases in length, 3,100 - 3,800 nucleotide bases in length, 3,200 - 3,700 nucleotide bases in length, or 3,300 - 3,500 nucleotide bases in length, e.g., 3,000 - 3,100 nucleotide bases in length, 3,100 - 3,200 nucleotide bases in length, 3,200 - 3,300 nucleotide bases in length, 3,300 - 3,400 nucleotide bases in length, 3,400 - 3,500 nucleotide bases in length, 3,500 - 3,600 nucleotide bases in length, 3,600 - 3,700 nucleotide bases in length, 3,700 - 3,800 nucleotide bases in length, 3,800 - 3,900 nucleotide bases in length, 3,900 - 4,000 nucleotide bases in length, e.g., about 3,108 nucleotide bases in length, about 3,285 nucleotide bases in length, about 3,375 nucleotide bases in length, about 3,503 nucleotide bases in length, about 3,630 nucleotide bases in length, about 3,540 nucleotide bases in length, about 3,363 nucleotide bases in length, about 3,273 nucleotide bases in length, about 3,145 nucleotide bases in length, or about 3,018 nucleotide bases in length).

[0119] In some embodiments, all or a portion of the CDS, or one or more functional ABCA4 exons thereof, are modified to mutate the potential splice sites identified therein. Through extensive experimental and computational analysis of the results, the inventors discovered that potential splice sites are utilized in the context of some embodiments of the ABCA4 exon editors described herein. In summary, the inventors conducted extensive experiments and analyses, including the generation of an off-target (OFT) library and its bioinformatics analysis, and surprisingly discovered numerous positions within the ABCA4 coding sequence (CDS) containing exons 1-22 where potential splicing occurs in the context of the trans-splicing molecules described herein. This discovery revealed an hitherto unappreciated problem that RNA exon editors (also referred to herein as RNA trans-splicing molecules or nucleic acid trans-splicing molecules) can be spliced at potential splice sites, thereby resulting in splicing variants of unwanted species that have potential downstream effects. To improve the trans-splicing efficiency and fidelity of the trans-splicing molecules described herein and thereby provide a solution to the problem of potential splice site utilization, the sequences of multiple potential splice sites were modified to disrupt and / or inactivate potential splice sites by introducing synonymous mutations. In some embodiments, the modified potential splice sites were identified based on the number of times the potential splice sites detected by bioinformatics analysis of the OFT library were utilized. In some embodiments, potential splice sites were modified for multiple potential splice site events. Such an approach takes advantage of the degeneracy of the genetic code, thereby allowing the introduction of desired modifications to reduce the use of potential splice sites without causing a change in the encoded amino acid. See, for example, Table 6 and Figure 26.

[0120] Using next-generation sequencing (NGS) approaches, the inventors were able to identify potential splice sites and quantify the usage frequency of potential splicing at each of different positions within the ABCA4 CDS including exons 1-22, thereby establishing a data-driven protocol that prioritized reducing the potential splicing used therein. See Table 3 and FIG. 26. As shown in Table 3, the identified potential splice sites are arranged in order of usage frequency determined by the mean counts per million (CPM) reads mapped / incorporated into sequences that do not contain synonymous mutations that disrupt the potential splice sites. Thus, the results and their bioinformatics analysis establish a prioritized list of potential splice sites in ABCA4 exons 1-22 that can be modified to generate an ABCA4 CDS with improved properties and functionality in the context of trans-splicing molecules.

[0121] In accordance with the results presented herein, the inventors established a usage frequency threshold that could advantageously be implemented if analysis and design for reduction of potential splice sites were possible via introduction of synonymous mutations. See Table 6. In some embodiments, the threshold based on the results shown in Table 3 is 10 CPM or more.

[0122] To evaluate the usage frequency of potential splicing after introduction of synonymous mutations, an NGS approach was also implemented. See Table 3 and FIG. 26. Confirmation of the reduction of potential splice sites by such an approach correlates the structural changes of the sequence modification (synonymous mutation) with the resulting function, namely, the generation of a potential splice site-resistant ABCA4 CDS.

[0123] In some embodiments, an RNA exon editor molecule, such as an ABCA4 exon editor, has nucleotide changes that reduce potential splice sites at one or more sites associated with off-target splicing within the exon editor molecule. Any or all of the changed nucleotide positions may be at the positions identified in Table 3. In some embodiments, the ABCA4 exon editor has nucleotide changes at one or more of the following positions (e.g., numbered according to SEQ ID NO: 56), and the nucleotide positions shown below refer to the 5' and 3' ends of the potential splice site nucleotide sequences reduced relative to the G of the ATG codon (translation start site), or any combination thereof. Nucleotide changes made in the sequences listed below are underlined. See also Table 3:

Chemical Formula

Chemical Formula

Chemical Formula

[0124] However, one of ordinary skill in the art will understand that other nucleotide changes may be made to disrupt the identified potential splice sites, and based on the results shown herein, will be able to envision and design such changes. In some embodiments, the ABCA4 exon editor has one or more of the nucleotide changes at the positions described above. See also Table 3. In some embodiments, the ABCA4 exon editor has a CDS sequence having at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% sequence identity to any one of the sequences shown in SEQ ID NOs: 56-59, or having 100% sequence identity. In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a potential splice site at one or more of the positions described above (e.g., numbered according to SEQ ID NO: 56), and has a CDS having at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% sequence identity to any one of the sequences shown in SEQ ID NOs: 56-58, or having 100% sequence identity. In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a potential splice site at one or more of the positions described above (e.g., numbered according to SEQ ID NO: 56), and has a CDS having at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 99.9% sequence identity to the sequence shown in SEQ ID NO: 56, or having 100% sequence identity. In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a potential splice site at at least one of the 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, or 45 positions shown in Table 3.

[0125] In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a potential splice site at at least one of the 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions shown in Table 3 that have a splice site usage frequency of at least 10 counts per million (also referred to herein as CPM), provided that positions listed in Table 3 that do not contain a splice site (e.g., positions 3083, 3103, or 3093) are excluded. In some embodiments, the ABCA4 exon editor molecule has a nucleotide change that reduces a potential splice site at 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or all of the potential splice sites, having a usage frequency of at least 10 cpm (excluding positions listed in Table 3 that do not contain a splice site (e.g., positions 3083, 3103, or 3093)) as measured by the assay described in Example 7 below.

[0126] In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a potential splice site at at least one of the 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions shown in Table 3 that have a splice site usage frequency of at least 5 counts per million (also referred to herein as CPM), provided that positions listed in Table 3 that do not contain a splice site (e.g., positions 3083, 3103, or 3093) are excluded. In some embodiments, the ABCA4 exon editor molecule has a nucleotide change that reduces a potential splice site at 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or all of the potential splice sites, having a usage frequency of at least 5 cpm (excluding positions listed in Table 3 that do not contain a splice site (e.g., positions 3083, 3103, or 3093)) as measured by the assay described in Example 7 below.

[0127] In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a potential splice site at at least one of the 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions shown in Table 3 having a splice site usage frequency of at least 3 counts per million (also referred to herein as CPM), provided that positions listed in Table 3 that do not contain a splice site (e.g., positions 3083, 3103, or 3093) are excluded. In some embodiments, the ABCA4 exon editor molecule has a nucleotide change that reduces a potential splice site at 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or all potential splice sites having a usage frequency of at least 3 cpm (excluding positions listed in Table 3 that do not contain a splice site (e.g., positions 3083, 3103, or 3093)) as measured by the assay described in Example 7 below.

[0128] In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a potential splice site at at least one of the 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions shown in Table 3 having a splice site usage frequency of at least 2 counts per million (also referred to herein as CPM), provided that positions listed in Table 3 that do not contain a splice site (e.g., positions 3083, 3103, or 3093) are excluded. In some embodiments, the ABCA4 exon editor molecule has a nucleotide change that reduces a potential splice site at 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or all potential splice sites having a usage frequency of at least 2 cpm (excluding positions listed in Table 3 that do not contain a splice site (e.g., positions 3083, 3103, or 3093)) as measured by the assay described in Example 7 below.

[0129] In some embodiments, the ABCA4 exon editor has a nucleotide change that reduces a potential splice site at at least one of the 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 positions shown in Table 3 that have a splice site usage frequency of at least 1 count per million (also referred to herein as CPM), provided that positions listed in Table 3 that do not contain a splice site (e.g., positions 3083, 3103, or 3093) are excluded. In some embodiments, the ABCA4 exon editor molecule has a nucleotide change that reduces a potential splice site at 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or all, potential splice sites that have a usage frequency of at least 1 cpm (excluding positions listed in Table 3 that do not contain a splice site, e.g., positions 3083, 3103, or 3093) as measured by the assay described in Example 7 below.

[0130] In addition to the ABCA4 exon editor, embodiments described herein include exon editors specific to other gene targets having nucleotide changes that reduce potential splice sites. Nucleotide changes that reduce potential splice sites can include changes that eliminate or reduce the ability of potential splice sites used in the splicing reaction. For example, potential splice sites identified in the context of an RNA exon editor typically include splice sites, polypyrimidine tracts, and branch points. In some embodiments, one or more nucleotide changes can be introduced into at least one of the splice site, polypyrimidine tract, or branch point of a potential splice site identified in the context of an RNA exon editor, or any combination thereof. In some embodiments, the nucleotide changes are determined to minimize the potential impact on the protein encoded thereby. One of ordinary skill in the art will understand that when nucleotide changes made to reduce the frequency of use of a potential splice site also change the amino acids encoded by the trans-splicing RNA, conservative amino acid changes are more preferred than non-conservative amino acid changes. Furthermore, such one of ordinary skill in the art can readily analyze the protein sequence and structure with an eye towards functional domains and important sequences therein to evaluate whether such changes are reasonably expected to alter the function of the protein encoded by the trans-splicing protein. One of ordinary skill in the art can also use assays known in the art to test proteins containing such amino acid changes to determine whether biological activity changes. In some embodiments, multiple nucleotides are changed within the identified potential splice site. In some situations, the determination of the number of nucleotides to be changed is made empirically based on in silico predictions and / or experimental results. In some embodiments, one or more (also referred to herein as at least one) synonymous mutations can be introduced into at least one of the splice site, polypyrimidine tract, or branch point of a potential splice site identified in the context of an RNA exon editor, or any combination thereof.Synonymous mutations do not change the amino acid sequence of the protein encoded by the trans-splicing RNA. In some embodiments, one or more synonymous mutations can be introduced into at least one of a potential splice site, polypyrimidine tract, or branch point of a potential splice site identified in the context of an RNA exon editor, or any combination thereof.

[0131] In addition to the above, the inventors analyzed experimental results and sequence information generally as follows. Changes to remove experimentally identified potential splice sites were made by searching for and replacing specific elements of the splice donor site. The AG site (and more strongly the CAG site) at the end of the splice donor site was prioritized for introduction of nucleotide changes. If the AG site was not present or could not be altered without introducing a non-synonymous mutation, the sequence 42 to 4 base pairs upstream of the splice site was scanned for a branch point sequence (a sequence matching YNAH). Any such identified branch point sequence was then analyzed and considered for introduction of nucleotide mutations (s) to reduce the use of the potential splice site at the experimentally identified potential splice site. Further, the sequence was also scanned for the presence of a polypyrimidine tract (multiple Ys immediately upstream of the terminal AG). Typically, such a polypyrimidine tract contains at least 5 pyrimidines within 10 base pairs upstream of the splice site. Once identified, such a polypyrimidine tract was then analyzed and considered for introduction of nucleotide mutations (s) to reduce the use of the potential splice site at the experimentally identified potential splice site.

[0132] In some embodiments, the potential splice sites that are altered to reduce off-target splicing, or the off-target splice sites, are sites that have been empirically identified as sites of off-target splicing. Such sites can be identified, for example, using the techniques described in Examples 6 and 7 below. In some embodiments, all potential splice sites having a usage frequency exceeding a predetermined threshold are changed by nucleotide changes that reduce the potential splice sites.

[0133] In some embodiments, the potential splice sites that are altered to reduce off-target splicing, or the off-target splice sites, are sites that are predicted to be sites of off-target splicing. Such predictions can be made based on sequence analysis to identify authentic splice sites, polypyrimidine tracts, and / or branch points of putative potential splice sites therein. Potential splice sites can have one more digit than authentic splice sites in the human genome and can have the same splicing recognition sequence as authentic splice sites, but are usually suppressed by molecular mechanisms that have not been well understood so far. Potential 5' splice sites often have the consensus NNN / GUNNNN or NNN / GCNNNN, where N is any nucleotide and " / " is the exon-intron boundary. Potential 3' splice sites often have the consensus NAG / N. Activation of potential splice sites can be positively influenced by the surrounding nucleotides that function to make the potential splice sites similar to those of typical consensus of authentic splice sites, namely, MAG / GURAGU and YAG / G respectively (where M is C or A, R is G or A, and Y is C or U).

[0134] In some embodiments, nucleotide changes that reduce potential splice sites cause a nucleotide sequence that matches the consensus sequence of a canonical splice site to no longer match the canonical sequence. In some embodiments, nucleotide changes that reduce potential splice sites eliminate potential splice site nucleotides. In some embodiments, nucleotide changes that reduce potential splice sites eliminate potential polypyrimidine tract nucleotides. In some embodiments, nucleotide changes that reduce potential splice sites eliminate potential branch point nucleotides. In some embodiments, nucleotide changes that reduce potential splice sites are synonymous nucleotide changes. In some embodiments, nucleotide changes that mitigate potential splice sites cause changes in the amino acids encoded by the exon editor. In some embodiments, the amino acid changes are conservative amino acid substitutions.

[0135] For example, as described in Table 3 and Examples 6 and 7, the inventors experimentally observed the use of potential splice sites in the RNA exon editors described herein. Further analysis of the localized / identified potential splice sites identified putative splice sites, polypyrimidine tracts, and branch points within the experimentally identified potential splice sites, and thus provided guidance as to which sequences should be modified to reduce the binding of potential splice sites. These results are generally applicable to RNA exon editors.

[0136] In some embodiments, RNA molecules are described herein, which molecules comprise, in the 5' to 3' direction, (a) a cDNA coding domain sequence, (b) a splice donor sequence, and (c) a binding domain sequence configured to bind to an intron of an endogenous RNA molecule, wherein the coding domain sequence comprises a nucleotide mutation relative to the endogenous RNA molecule sequence, the nucleotide mutation disrupting a potential splice site within the coding domain sequence, and the binding domain sequence. In some embodiments, the nucleotide mutation is a synonymous nucleotide mutation. In some embodiments, the potential splice site is experimentally identified. In some embodiments, the potential splice site is predicted based on in silico analysis.

[0137] Also included herein is a method of modifying an RNA molecule in a cell, the method comprising providing an exogenous RNA molecule to the cell, the molecule comprising, in the 5' to 3' direction, (a) a cDNA coding domain sequence comprising a nucleotide mutation different from that of an endogenous target RNA molecule in the cell, (b) a splice donor sequence configured to splice to a splice acceptor sequence of the endogenous target RNA molecule, and (c) a binding domain sequence configured to bind to an intron of the endogenous target RNA molecule, wherein the nucleotide mutation disrupts a potential splice site within the coding domain sequence of the exogenous RNA molecule. In some embodiments, the nucleotide mutation is a synonymous nucleotide mutation. In some embodiments, the potential splice site is experimentally identified. In some embodiments, the potential splice site is predicted based on in silico analysis.

[0138] Also included herein is a method of increasing the trans-splicing efficiency of an RNA exon editor, which includes introducing a mutation into the coding domain sequence of the RNA exon editor, the mutation disrupting a potential splice site in the coding domain sequence of the RNA exon editor. In some embodiments, the nucleotide mutation is a synonymous nucleotide mutation. See, for example, Table 6. In some embodiments, the potential splice site is experimentally identified. In some embodiments, the potential splice site is predicted based on in silico analysis.

[0139] Binding domain The ABCA4 trans-splicing molecules described herein are characterized by a binding domain (BD) configured to bind / anneal to a target ABCA4 intron and / or exon. In some cases, the target ABCA4 intron is ABCA4 intron 22. In one embodiment, the binding domain is a nucleic acid sequence that is at least 80% complementary (e.g., at least 85% complementary thereto, at least 90% complementary thereto, at least 91% complementary thereto, at least 92% complementary thereto, at least 93% complementary thereto, at least 94% complementary thereto, at least 95% complementary thereto, at least 96% complementary thereto, at least 97% complementary thereto, at least 98% complementary thereto, at least 99% complementary thereto, or 100% complementary thereto) to the sequence of the target ABCA4 intron pre-mRNA (e.g., the target ABCA4 intron), which can suppress endogenous target cis-splicing while enhancing trans-splicing between the trans-splicing molecule and the target ABCA4 pre-mRNA (e.g., by creating a chimeric molecule having a coding domain sequence having a portion of the endogenous ABCA4 mRNA and one or more functional ABCA4 exons encoding the wild-type ABCA4 amino acid sequence).In one embodiment, with a trans-splicing molecular coding sequence (e.g., a vector encoding a trans-splicing molecule), the binding domain coding sequence encodes a nucleic acid sequence that is at least 80% complementary to the sequence of the target ABCA4 intron pre-mRNA (e.g., at least 85% complementary thereto, at least 86% complementary thereto, at least 87% complementary thereto, at least 88% complementary thereto, at least 89% complementary thereto, at least 90% complementary thereto, at least 91% complementary thereto, at least 92% complementary thereto, at least 93% complementary thereto, at least 94% complementary thereto, at least 95% complementary thereto, at least 96% complementary thereto, at least 97% complementary thereto, at least 98% complementary thereto, at least 99% complementary thereto, or 100% complementary thereto).

[0140] In some cases, the present invention provides a trans-splicing molecule (or its vector) that binds to ABCA4 at intron 22. For example, the nucleic acid trans-splicing molecule is configured to trans-splice the CDS to endogenous ABCA4 exon 23. In particular, the trans-splicing molecules described herein include those in which the binding domain binds to a binding site having any one or more (e.g., 6 or more, 8 or more, 10 or more, or 12 or more) of nucleotides 1 to 510 or 880 to 1,350 of SEQ ID NO: 16.

[0141] In some cases, the binding domain comprises any six or more consecutive nucleotides within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22 (for example, any eight or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any ten or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any twelve or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any twenty or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any thirty or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any forty or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any fifty or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any one hundred or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any one hundred and fifty or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any two hundred or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22, any two hundred and fifty or more consecutive nucleic acids within nucleotides 1 to 510 or 880 to 1,350 of ABCA4 intron 22).

[0142] In some cases, the binding site comprises any six or more consecutive nucleotides within nucleotides 880 to 1,350 of ABCA4 intron 22 (for example, any eight or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any ten or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any twelve or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any twenty or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any thirty or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any forty or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any fifty or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any one hundred or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any one hundred and fifty or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any two hundred or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22, any two hundred and fifty or more consecutive nucleic acids within nucleotides 880 to 1,350 of ABCA4 intron 22).

[0143] In some cases, the binding domain has at least two non-overlapping sequences that have at least 80% complementarity to the binding site.

[0144] In some cases, the binding domain comprises a nucleic acid sequence having at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to UUGUUGGUAAAGGGUGUACAGCAAUUUCCUGGCUAUAUAGUUGCAAAAAUCAGGAGUUAACUAAAAAAAAAAACCCAAGGGAACUAAUUCAGCAGCAAAUUCCAGCAUAUUGGGACAAUAAUAACCAACAUUUCAUAGCUUCCUACAUAC (SEQ ID NO: 17).

[0145] In some embodiments, the binding domain is a DNA sequence having at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 18 TTGTTGGTAAAGGGTGTACAGCAATTTCCTGGCTATATAGTTGCAAAAATCAGGAGTTAACTAAAAAAAAAAACCCAAGGGAACTAATTCAGCAGCAAATTCCAGCATATTGGGACAATAATAACCAACATTTCATAGCTTCCTACATAC (SEQ ID NO: 18).

[0146] In some cases, the binding domain comprises a nucleic acid sequence having at least 80% identity (at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 19.

[0147] In some embodiments, the binding domain is a DNA sequence having at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 20.

[0148] In some cases, the binding domain comprises a nucleic acid sequence having at least 80% identity (at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 21.

[0149] In some embodiments, the binding domain is a DNA sequence having at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 22.

[0150] In some cases, the binding domain comprises a nucleic acid sequence having at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 23.

[0151] In some embodiments, the binding domain is a DNA sequence having at least 80% identity (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 24.

[0152] The binding domain can be operably linked on the 3'-side of the splicing domain (e.g., can be directly linked to the splicing domain or can have an intervening sequence connecting the 3'-end of the splicing domain and the 5'-end of the binding domain).

[0153] As detailed herein, the first step in the ABCA4 exon editor design began with the screening and selection of highly efficient BD sequences that are complementary to the target pre-mRNA intron. To achieve high CDS substitution potential and provide an exon editor useful for correcting mutations in a high proportion of the ABCA4-related retinopathy patient population within the limits of AAV packaging capacity (about 4.7 Kb), intron 22 of the ABCA4 gene was selected for the BD screen. The inventors applied both an NGS-based BD library approach and a bioluminescence-based approach to scan along the intron 22 sequence using exon editor variants with different BD sequences. The results of both methods were aligned, regions within the intron suitable for RNA exon editing were identified, leading to the selection of BD117 in some embodiments. See Figure 16.

[0154] Splicing domain The splicing domain can include splice sites, branch points, and / or polypyrimidine tract (PPT) tracts for mediating trans-splicing. In some embodiments, the splicing domain has a single splice site, which indicates that trans-splicing is preferentially designed rather than cis-splicing due to the absence of a corresponding splice site.

[0155] Alternative splicing domains can be selected by those skilled in the art according to well-known methods and principles. In one embodiment, the 5' splice site consensus sequence is the nucleic acid sequence AG / GURAGU (where / indicates the splice site). In another embodiment, any splicing regulatory signal can be maintained using endogenous splice sites corresponding to exons and introns proximal to the splice site.

[0156] In one embodiment, a suitable 5' splice site with a spacer is 5'-GTAAGAGAGCTCGTTGCGATATTAT-3' (SEQ ID NO: 25). In one embodiment, a suitable 5' splice site is AGGT. In some embodiments, the splice site (e.g., the 5' splice site) is GTAAGT or GUAAGT, or includes it. In some embodiments, the splice site (e.g., the 5' splice site) is GTAAGG, GUAAGG, GTAAGC, GUAAGC, GTAACT, GUAACU, CAAAGT, or CAAAGU, or includes them.

[0157] The splicing domain can be operably linked on the 5' side to the terminator domain (e.g., directly linked to the terminator domain or having an intervening sequence, such as a linker domain and / or a 3' downstream sequence, connecting the 3' end of the splicing domain and the 5' end of the terminator domain).

[0158] 5' untranslated region In some cases, the nucleic acid splicing molecule includes a 5' untranslated region. In some embodiments, the 5' untranslated region comprises, consists essentially of, or consists of the native 5' ABCA4 untranslated region. In some embodiments, the 5' untranslated region comprises a sequence having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to any one of SEQ ID NOs: 12-13.

[0159] In some embodiments, the 5' untranslated region can be operably linked to the 5' side of the CDS (e.g., directly linked to the CDS or having an intervening sequence connecting the 3' end of the 5' untranslated region and the 5' end of the CDS).

[0160] 5' regulatory domain In some cases, the nucleic acid trans-splicing molecule is operably linked to a 5' regulatory domain that is operably linked to the 5' side of the CDS (e.g., directly linked to the CDS or linked via an intervening domain such as an untranslated region). The 5' regulatory domain may include a promoter (e.g., a constitutive promoter such as the CMV promoter or the EF1-alpha promoter). In some cases, the 5' regulatory domain includes a promoter (e.g., a constitutive promoter such as the CMV promoter) operably linked to the native 5' ABCA4 untranslated region. In some embodiments, the 5' regulatory domain operably linked to the native 5' ABCA4 untranslated region comprises a sequence having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to any one of SEQ ID NOs: 14-15.

[0161] In some embodiments, the 5' regulatory domain may be operably linked to the 5' side of the CDS (e.g., directly linked to the CDS or having an intervening sequence connecting the 3' end of the 5' regulatory domain and the 5' end of the CDS).

[0162] Linker domain As discussed herein, increasing trans-splicing efficiency remains an important goal in the implementation of nucleic acid trans-splicing molecules as therapeutic agents. In attempts to design nucleic acid trans-splicing molecules having trans-splicing efficiency that can meet the requirements for use in therapeutic interventions, the inventors have tested thousands of linker sequences between the splice domain (SD) and the binding domain (BD), and have identified an exemplary linker called 40mer that improves performance to a statistically significant extent compared to the precursor linker (LinkD). See, for example, FIGS. 17A and 17B.

[0163] In addition to the above, the nucleic acid trans-splicing molecule may include a linker domain at one or more positions with the molecule. In some embodiments, the linker domain is operably linked 3' to the splicing domain or splice site (e.g., directly connected to the splicing domain or splice site). The linker domain can be of any suitable size. In some embodiments, the linker domain is longer than 25 nucleotides in length (e.g., 25 - 50 nucleotides in length, 35 - 45 nucleotides in length, or about 40 nucleotides in length (e.g., 40-mer linker)). In some embodiments the linker domain comprises, consists essentially of, or consists of a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) to CUGGUGCCCGCGGGCCGCGGAACCGGUUGGGGGCAUGUAC (SEQ ID NO: 26) or CTGGTGCCCGCGGGCCGCGGAACCGGTTGGGGGCATGTAC (SEQ ID NO: 27).

[0164] As described above, a 40mer linker containing SEQ ID NO: 26 (RNA) or SEQ ID NO: 27 (DNA) was selected from a library screening in the context of a trans-splicing molecule in which thousands of different elements are evaluated for function. The superiority of the 40mer linker is apparent, for example, in FIG. 1, which compares three different linkers in the context of different combinations of elements. In each context, the presence of the 40mer linker (shown as the linker corresponding to the lightest gray scale tone; the third linker shown from left to right in each ss context) was associated with the highest relative trans-splicing efficiency. Linker sequences are often included in trans-splicing molecules, and the linker sequence provides flexibility and accessibility to each element by being positioned between the splice donor and the binding domain. As described herein, the functional contributions of different elements were evaluated in different combinations for the activity brought about in the context of a trans-splicing molecule. The 40mer linker emerged from this screening as a lead candidate element that provides an improvement in trans-splicing activity in the context of a trans-splicing molecule, as exemplified by a statistically significant increase in the on-target (ONT) replacement % of ABCA4 RNA (FIG. 17A), as well as a significant increase in the level of trans-spliced ABCA4 protein (ONT) and a significant decrease in the level of non-spliced protein (NSP) compared to LinkD (FIG. 17B).

[0165] In some embodiments, the linker domain comprises, consists essentially of, or consists of a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with CCGAAUACGACACGUACAAGAUCU (SEQ ID NO: 28) or CCGAATACGACACGTACAAGATCT (SEQ ID NO: 29). In some embodiments, the linker domain comprises, consists essentially of, or consists of a nucleic acid sequence having at least 80% sequence identity (e.g., at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity) with GCUGCUGCUCAGUCUCCUGGGCUGG (SEQ ID NO: 30) or GCTGCTGCTCAGTCTCCTGGGCTGG (SEQ ID NO: 31).

[0166] Enhancer of RNA exon editor activity The inventors used a multifaceted experimental approach to engineer nucleic acid trans-splicing molecules with advantageous properties for their use in therapeutic interventions. Thus, the inventors sought to identify additional elements that could enhance RNA exon editor activity, for example, by increasing on-target (ONT) trans-splicing, increasing ONT ABCA4 trans-splicing protein levels, or decreasing non-splicing protein (NSP) levels, or any combination thereof. Thus, various elements were tested to determine whether the presence of the tested element enhanced the activity of the RNA exon editor as compared to what was observed with RNA exon editors lacking the tested element. Through a large-scale trial-and-error procedure that evaluated the scores of different elements and their different combinations in the context of individual trans-splicing molecules, the inventors identified the U1 binding site (UBS), a sequence element that results in an increase in ONT trans-splicing and a decrease in NSP levels in RNA exon editors that include the UBS as an additional element as compared to RNA exon editors lacking the UBS. See, for example, FIG. 13 (3X U1) and FIGS. 19A and 19B (3xUBS). In some embodiments, 3xUBS (also referred to as 3X U1) includes SEQ ID NO: 62. In some embodiments, 3xUBS (also referred to as 3X U1) includes at least one sequence comprising GGTAAGT or GGTAAGTAGAGTG (SEQ ID NO: 61) or GGTGAGTAGAGTG (SEQ ID NO: 83). In certain embodiments thereof, 3xUBS is positioned 3' of the linker domain. In certain embodiments thereof, 3xUBS is positioned 3' of the linker domain and 5' of the binding domain. In certain embodiments thereof, 3xUBS includes at least one sequence comprising GGTAAGT, and each of the at least one sequence comprising GGTAAGT further includes a flanking sequence. In such embodiments, 3xUBS includes at least one of GGTAAGTAGAGTG (SEQ ID NO: 61) or GGTGAGTAGAGTG (SEQ ID NO: 83).In some embodiments, the 3xUBS comprises at least one of CGTGGTAAGTAGAGTG (SEQ ID NO: 74; UBS1), ATGGGTAAGTAGAGTG (SEQ ID NO: 75; UBS2), or TGGGGTAAGTAGAGTG (SEQ ID NO: 76), or any combination thereof.

[0167] Thus, in some embodiments, an RNA exon editor comprising at least one UBS comprises at least one sequence comprising GGTAAGT or GGTAAGTAGAGTG (SEQ ID NO: 61). In that particular embodiment, the 3xUBS is positioned 3' of the linker domain in the RNA exon editor. In that particular embodiment, the 3xUBS is positioned 3' of the linker domain and 5' of the binding domain in the RNA exon editor. In some embodiments, an RNA exon editor comprising at least one UBS comprises at least one of CGTGGTAAGTAGAGTG (UBS1; SEQ ID NO: 74), ATGGGTAAGTAGAGTG (UBS2; SEQ ID NO: 75), or TGGGGTAAGTAGAGTG (UBS3; SEQ ID NO: 76), or any combination thereof. In some embodiments, an RNA exon editor comprising at least one UBS comprises at least one CGTGGTAAGTAGAGTG (UBS1; SEQ ID NO: 74). In some embodiments, an RNA exon editor comprising at least one UBS comprises CGTGGTAAGTAGAGTG (SEQ ID NO: 74, UBS1), ATGGGTAAGTAGAGTG (SEQ ID NO: 75, UBS2), and TGGGGTAAGTAGAGTG (SEQ ID NO: 76; UBS3).

[0168] According to the results presented herein, at least one UBS present in the context of a trans-splicing molecule is referred to herein as an enhancer. Exemplary enhancers described herein include at least one of CGTGGTAAGTAGAGTG (UBS1, SEQ ID NO: 74), ATGGGTAAGTAGAGTG (UBS2, SEQ ID NO: 75), or TGGGGTAAGTAGAGTG (UBS3, SEQ ID NO: 76), or any combination thereof. In some embodiments, the exemplary enhancer described herein includes at least one UBS comprising at least one CGTGGTAAGTAGAGTG (UBS1; SEQ ID NO: 74). In some embodiments, the exemplary enhancer described herein includes a UBS comprising CGTGGTAAGTAGAGTG (UBS1, SEQ ID NO: 74), ATGGGTAAGTAGAGTG (UBS2, SEQ ID NO: 75), and TGGGGTAAGTAGAGTG (UBS3, SEQ ID NO: 76).

[0169] The ability of a UBS that enhances RNA exon editor activity (included as an additional element to the RNA exon editor and positioned 3' to the linker and 5' to the BD; see FIG. 13) is at least surprising because the presence of at least one additional element that can potentially act as an alternative 5' splice site potentially competes with and / or interferes with the splice domain of the RNA exon editor (e.g., see FIG. 13; SD; existing authentic 5' splice site), and it was reasonable to predict that such competition / interference could reduce ONT trans-splicing. Thus, the increase in ONT trans-splicing observed to be brought about by the presence of an enhancer (UBS, e.g., at least one of UBS1, UBS2, or UBS3, or any combination thereof) in an RNA exon editor was unexpected and surprising. The enhancer also brought about a statistically significant reduction in NSP, and this observation further strongly demonstrated the surprising functional properties of this element in the context of an RNA exon editor.

[0170] The functional properties of the enhancer described herein have also been demonstrated in the context of RNA exon editors that contain different binding domains that bind to / target different introns in different target pre-mRNAs other than ABCA4 pre-mRNA. Results from exemplary RNA exon editors illustrate that the enhancer, including 3xUBS, provides surprisingly beneficial properties in the context of an RNA exon editor that targets intron A and intron B in non-ABCA4 pre-mRNA. More specifically, an RNA exon editor targeting non-ABCA4 pre-mRNA that includes the combination of 40mer + 3xUBS (SEQ ID NO: 62) showed a significant reduction in the level of NSP compared to an RNA exon editor that includes only 40mer (SEQ ID NO: 27). See, for example, FIGS. 27B and 28B. While reducing NSP, the combination of 40mer + 3xUBS (SEQ ID NO: 62) maintained levels of ONT trans-splicing protein similar to those of 40mer alone. As a comparison, each of the RNA exon editors in which 3xUBS has been shown to reduce NSP [intron 22 targeting ABCA4 pre-mRNA (FIG. 19B); intron A (FIG. 27B); and intron B (FIG. 28B)] includes the same cassette of 40mer + 3xUBS sequences, which supports the conclusion that the function provided by the presence of the 3xUBS sequence (SEQ ID NO: 62) is consistent regardless of the target intron and / or target pre-mRNA of the RNA exon editor.

[0171] The functionality conferred by the presence of the 3xUBS sequence (SEQ ID NO: 62) in nucleic acid trans-splicing molecules was also evident at the level of RNA trans-splicing %. Figures 19A (intron 22 targeting ABCA4 pre-mRNA), 28A (intron B), and 29 (intron C) illustrate that the presence of the 3xUBS sequence (SEQ ID NO: 62) can result in an increase in RNA trans-splicing %, as reflected by the increasing trend of RNA substitution %. Indeed, in an exemplary trans-splicing molecule targeting intron C, the presence of the 3xUBS sequence (SEQ ID NO: 62) resulted in a three-fold increase at the level of substitution %. These results suggest that this additional functional property of the 3xUBS sequence (SEQ ID NO: 62) that promotes the increasing trend of substitution % is consistent regardless of the target intron and / or target pre-mRNA of the RNA exon editor. It is notable that an RNA exon editor containing a binding domain (BD34) targeting intron C contains alternative 5' splice sites different from the 5' splice sites used in each of the RNA exon editors containing binding domains targeting intron 22, intron A, and intron B of ABCA4 pre-mRNA. These results demonstrate that the 3xUBS enhancer can confer different functionality with respect to elements in the context of an RNA exon editor, in addition to binding domain and pre-mRNA target specificity.

[0172] Accordingly, the inventors present evidence showing that enhancers such as those described herein (e.g., SEQ ID NO: 62) function in a binding domain-independent and target-independent manner, and thus can be generally used in the context of RNA exon editors, and the presence of the enhancer is expected to result in advantageous properties including a reduction in NSP levels reflected in the RNA substitution rate and an increase in potential trans-splicing activity.

[0173] Translation Enhancer of RNA Exon Editor Activity Increasing on-target (ONT) trans-splicing, increasing the ONT ABCA4 trans-splicing protein level, or decreasing the non-splicing protein (NSP) level, or a combination of any of these, the inventors have also discovered that in the context of the RNA exon editors described herein, AU-rich elements (AREs) exhibit surprising functional properties. The surprising properties of the AREs were discovered through a large-scale trial-and-error procedure that evaluated the scores of different elements and their different combinations in the context of individual trans-splicing molecules. The inventors have shown that the presence of an ARE results in a reduction in NSP levels for an RNA exon editor that includes the ARE as an additional element (40mer + ARE) compared to one that lacks the ARE (e.g., includes only the 40mer). In some experiments, the presence of an ARE also resulted in an increase in the ONT trans-splicing ABCA4 protein for an RNA exon editor that includes the ARE as an additional element (40mer + ARE) compared to one that lacks the ARE (e.g., includes only the 40mer alone). See, for example, FIGS. 13 (ARE) and 19B (40mer + ARE). Since the AREs resulted in a reduction in NSP levels and an increase in the ONT trans-splicing ABCA4 protein level, they are referred to herein as "translation enhancers."

[0174] In some embodiments, an exemplary ARE is a granulocyte macrophage colony-stimulating factor (GM-CSF) ARE and comprises a sequence comprising ATTTATATATTTATATTTTTAAAATATTTATTTATTTATTTATTTA (SEQ ID NO: 63), or a sequence having at least 90% identity to SEQ ID NO: 63. In some embodiments, the translation enhancer has at least 91% identity to SEQ ID NO: 63, at least 92% identity to SEQ ID NO: 63, at least 93% identity to SEQ ID NO: 63, at least 94% identity to SEQ ID NO: 63, at least 95% identity to SEQ ID NO: 63, at least 96% identity to SEQ ID NO: 63, at least 97% identity to SEQ ID NO: 63, at least 98% identity to SEQ ID NO: 63, or at least 99% identity to SEQ ID NO: 63. In some embodiments, SEQ ID NO: 63, or a sequence having at least 90% identity to SEQ ID NO: 63, is operably linked 3' to an enhancer (e.g., SEQ ID NO: 62). The core sequence is typically AUUUA (RNA; ATTTA in the DNA vector encoding it), and repeats of this core AUUUA element are often required for function. The ARE element is typically at least about 50 bases. Thus, in some embodiments, the ARE comprises repeats of a core AUUUA element that is at least about 50 bases.

[0175] The ability of an ARE (see FIG. 13, included as an additional element of the RNA exon editor) to enhance the activity of an RNA exon editor was surprising, as it increased the ONT trans-splicing ABCA4 protein level while reducing the NSP level. Thus, the ARE-mediated effect on the encoded protein level promotes the therapeutic potential of the RNA exon editor by preferentially increasing the therapeutic protein level (ONT trans-splicing ABCA4 protein level) and decreasing the NSP level.

[0176] An exemplary enhancer cassette in combination with an exemplary translation enhancer (40mer + 3XUBS + ARE, SEQ ID NO: 73) also results in a further significant reduction in NSP levels compared to those of RNA exon editors containing only the 40mer, 40mer + 3XUBS, or 40mer + ARE. Thus, this combination of elements (40mer + 3XUBS + ARE; SEQ ID NO: 73) exhibits particularly advantageous properties in the context of trans-splicing molecules such as those described herein.

[0177] The functional properties of the translation enhancer described herein have also been demonstrated in the context of an RNA exon editor that binds to / targets different introns in different target pre-mRNAs other than ABCA4 pre-mRNA, including different binding domains. Results from exemplary RNA exon editors illustrate that a translation enhancer containing an ARE (SEQ ID NO: 63) confers surprisingly beneficial properties in the context of an RNA exon editor that targets introns A and B in non-ABCA4 pre-mRNA. More specifically, an RNA exon editor targeting non-ABCA4 pre-mRNA containing a combination of 40mer+ARE (SEQ ID NO: 63) showed a significant reduction in the level of NSP compared to an RNA exon editor containing only 40mer (SEQ ID NO: 27). See, for example, FIGS. 27B and 28B. While reducing NSP, the combination of 40mer+ARE (SEQ ID NO: 63) maintained the level of ONT trans-splicing protein similar to that of 40mer alone. By comparison, each of the RNA exon editors shown to reduce NSP [intron 22 targeting ABCA4 pre-mRNA (FIG. 19B); intron A (FIG. 27B); and intron B (FIG. 28B)] contains the same cassette of 40mer+RNA sequence (SEQ ID 3444-3529 of SEQ ID 86), supporting the conclusion that the function conferred by the presence of the RNA sequence (SEQ ID NO: 63) is consistent regardless of the target intron and / or target pre-mRNA of the RNA exon editor. The decrease in NSP level was even more pronounced with the cassette of 40mer+3xUBS+ARE (SEQ ID NO: 73), demonstrating the combinatorial effect of these elements. These results demonstrate that an ARE translation enhancer can confer different functionality in the context of an RNA exon editor with respect to binding domain and pre-mRNA target specificity, and can act in a combinatorial manner with other elements to enhance the effectiveness of an RNA exon editor.

[0178] Accordingly, the inventors present evidence showing that translation enhancers such as those described herein (e.g., SEQ ID NO: 63) function in a binding domain-independent and target-independent manner, and thus can be generally used in the context of RNA exon editors, and it is expected that the presence of the translation enhancer will bring about advantageous properties including a reduction in NSP levels reflected in the RNA substitution rate.

[0179] Additional components or modifications In some cases, the trans-splicing molecule includes a 3' transcription terminator domain. In some embodiments, such a 3' transcription terminator domain forms a triple helix structure that effectively caps the 3' end of the trans-splicing molecule. In some cases, the 3' transcription terminator domain is derived from human long non-coding RNA MALAT1 (e.g., wild-type MALAT1). In some embodiments, the 3' transcription terminator domain includes a tRNA-like domain. A 3' transcription terminator domain useful as part of the present ABCA4 trans-splicing molecule is described in International Patent Publication No. WO2020 / 214973, which is hereby incorporated by reference in its entirety. For example, in some embodiments, the region of the RTM operably linked to the 3' end of the binding domain includes, consists essentially of, or consists of a terminator domain including a wild-type MALAT1+Masc RNA domain such as SEQ ID NO: 32 or SEQ ID NO: 33. In some embodiments, the region of the RNA exon editor operably linked to the 3' end of the binding domain includes, consists essentially of, or consists of a terminator domain including a mutant MALAT1+Masc RNA (anti-Mut1Masc RNA) domain such as SEQ ID NO: 66 (DNA) or SEQ ID NO: 67 (RNA).

[0180] In some cases, the trans-splicing molecule includes a 3' downstream (DS) region downstream of the binding domain (i.e., operably linked 3' to the binding domain) and / or upstream of the terminator domain (i.e., operably linked 5' to the terminator domain). In some cases, the 3' DS region is part of the terminator domain. The 3' DS region can directly connect the binding domain to the terminator region. In some embodiments, the 3' DS region is 6 to 10 nucleotides in length (e.g., 8 nucleotides in length). In some embodiments, the 3' DS region comprises any one of 3’DS-MALAT1 adjacent to 8-merRNA, AGGGUCAU; 3’DS-MALAT1 adjacent to 8-merDNA, AGGGTCAT; 3’DS-random 8-merRNA, CGAGCCUC; 3’DS-random 8-merDNA, CGAGCCTCC; 3’DS-MALAT1 adjacent to the first 6 of 8-merRNA, AGGGU; and 3’DS-MALAT1 adjacent to the first 6 of flanking 8-merDNA, AGGGT. In some embodiments, the 3' DS region consists of any one of 3’DS-MALAT1 adjacent to 8-merRNA, AGGGUCAU; 3’DS-MALAT1 adjacent to 8-merDNA, AGGGTCAT; 3’DS-random 8-merRNA, CGAGCCUC; 3’DS-random 8-merDNA, CGAGCCTCC; 3’DS-MALAT1 adjacent to the first 6 of 8-merRNA, AGGGU; and 3’DS-MALAT1 adjacent to the first 6 of flanking 8-merDNA, AGGGT.

[0181] In some embodiments, the binding of the trans-splicing molecule to the target pre-mRNA is mediated by percent complementarity (i.e., based on the base pairing properties of nucleic acids), triple helix formation, or protein-nucleic acid interactions (described in the documents cited herein). In one embodiment, the nucleic acid trans-splicing molecule comprises DNA, RNA, or a DNA / RNA hybrid molecule, and the DNA or RNA can be either single-stranded or double-stranded. Also included herein are RNAs or DNAs that can hybridize to one of the aforementioned RNAs or DNAs under stringent conditions, preferably washing several times at 60 °C in 2.5x SSC buffer and at 37 °C in a low buffer concentration, e.g., 0.5x SSC buffer. These nucleic acids can encode proteins that exhibit lipid phosphatase activity and / or association with the plasma membrane. When the trans-splicing molecule is synthesized in vitro, such trans-splicing molecule can be modified in the base moiety, sugar moiety, or phosphate backbone, for example, to improve the stability of the molecule, hybridization to the target mRNA, and transport into cells. For example, modification of the trans-splicing molecule to reduce the total charge can enhance cellular uptake of the molecule. Furthermore, modifications can be made to reduce susceptibility to nuclease or chemical degradation. The nucleic acid molecule can be synthesized in such a way that it is conjugated to another molecule, such as a peptide, a cross-linking agent that induces hybridization, a transport agent, a cleavage agent that induces hybridization, etc.

[0182] As a means of increasing intracellular stability and half-life, various other well-known modifications to the nucleic acid molecule can be introduced (see also above for oligonucleotides). Possible modifications are well known in the art. Modifications that can be made to the structure of the synthetic trans-splicing molecule include backbone modifications.

[0183] Exemplary ABCA4 RNA exon editor cassette map and overview Generally speaking, the ABCA4 RNA exon editor cassette (ABCA4 REEC) includes control components that drive the expression of the RNA exon editor, corresponding native sequences and 5’ UTR and CDS that replace any mutations that may exist within the target native sequence, a splice donor (SD) that interacts with the native splice acceptor (SA), a linker that may enable the flexibility and accessibility for this interaction to occur, a regulatory element that enhances trans-splicing (TS), a BD that targets the correct position of the pre-mRNA, and a terminator sequence that promotes TS and stability. These features are shown in FIG. 13 and Table 1 below, briefly described, and an exemplary ABCA4 REEC is presented.

Table 1

[0184] ABCA4 REEC Function Details and background regarding the features of the exemplary ABCA4 REEC embodiment presented in FIG. 13 are outlined below.

[0185] Inverted terminal repeat (ITR) sequences: The 5’ and 3’ ITR sequences flank the exemplary RNA exon editor sequence and are essential for adeno-associated virus (AAV) packaging of the transgene. The exemplary ABCA4 REEC contains a 130-nucleotide ITR sequence in the “flip orientation” derived from AAV2, which is commonly used in gene therapy.

[0186] CMV / CMV promoter: This regulatory sequence drives the expression of the exemplary exon editor transcript. It includes the cytomegalovirus (CMV) immediate early enhancer and the CMV immediate early promoter, and has been shown to drive high expression in non-human primate (NHP) photoreceptors and, as shown herein, in the NHP retina and the human retina. See, for example, FIGS. 8, 9, 31, and 32.

[0187] 5’UTR: The 5’ end of the exemplary exon editor RNA molecule starts with the native ABCA4 5’UTR sequence and maintains the native RNA sequence in the final ONT mRNA molecule resulting from TS. The UTR sequence is modified with five point mutations that remove putative or data-driven potential splice acceptor sites to reduce cis-splicing between exon editor transcripts or potential generation of TS.

[0188] Coding sequence (CDS): The exemplary ABCA4 REEC encodes exons 1-22 of the ABCA4 mRNA sequence to replace the corresponding native sequence following TS (additional details regarding exon 22 are presented below). Exons 1-21 are modified with 40 synonymous point mutations that remove putative or data-driven potential splice acceptor sites to reduce cis-splicing between exon editor transcripts or potential generation of TS.

[0189] Terminal exon 22: The encoded CDS in the exemplary ABCA4 REEC includes exon 22 and is thus referred to as the terminal exon as it is immediately prior to the splice donor (SD) site in the exon editor sequence and later ligates to the native exon 23 via TS to form the correct exon 22-23 junction. To facilitate the identification and quantification of ONT molecules formed by TS, exon 22 is modified with 29 synonymous point mutations. These mutations provide an opportunity to distinguish trans-spliced transcripts from endogenous transcripts by facilitating RT-qPCR analysis (quantification) as well as the design of selective primers / probes for next-generation sequencing (NGS)-based analysis (identification and quantification) without inducing changes in the amino acid to the protein sequence.

[0190] Spliced donor site (splicing domain, SD): Exemplary ABCA4 REECs contain a consensus U1 splice donor site (SD) located immediately downstream of terminal exon 22. This SD interacts with the splice acceptor (SA) site of endogenous intron 22 during the TS reaction mediated by the spliceosome, instead of the natural cis-splicing reaction that would otherwise occur between the endogenous intron 22 splice donor site and the SA site. The result of this TS event is the precisely formed exon 22-23 junction, with the upstream region derived from the exon editor and the downstream region containing the remainder of the natural ABCA4 pre-mRNA, which proceeds towards the formation of a mature mRNA molecule via its natural cis-splicing event.

[0191] Stop codon: Exemplary ABCA4 REECs contain a double stop codon immediately following the SD site. In fact, the last nucleotide of the GTAAGTSD site functions as the first nucleotide within the TAGTGA double stop codon. One purpose of this intentional stop codon is to eliminate the addition of foreign amino acids at the C-terminus in situations where the pre-spliced exon editor transcript exits the nucleus, enters the cytoplasm, and undergoes translation resulting in a truncated, splicing protein (NSP). Any such foreign amino acids at the C-terminus of the NSP can potentially cause an immunogenic risk that is avoided by the inclusion of the stop codon. The stop codon can also contribute to AU-rich element (ARE)-mediated decay, which the inventors hypothesized serves to degrade the pre-spliced exon editor RNA that leaks out into the cytoplasm, as discussed below.

[0192] 40-mer linker: The linker sequence positioned between the SD site and the downstream element can provide flexibility to the RNA structure and accessibility to the SD, which can be advantageous for an effective TS. The 40-mer linker emerged as a highly effective sequence from an extensive screening of thousands of linker candidates. For example, see Figure 1. The predicted secondary structure of the relevant region of the exon editor containing the 40-mer linker suggests that the presence of the 40-mer linker results in an open and accessible SD.

[0193] 3X U1 site: An exemplary ABCA4 REEC contains an enhancer that includes three tandem U1 sites downstream of the 40-mer linker. The U1 site is bound by U1 snRNP during the process of spliceosome-mediated splicing. Inclusion of three tandem U1 sites downstream of the primary SD site of this exon editor increased the RNA TS and decreased the observed NSP levels. The inventors hypothesized that these results may potentially be due to an increase in the association and retention with the spliceosome in the nucleus where TS occurs.

[0194] AU-rich element (ARE): An exemplary ABCA4 REEC contains an AU-rich element (ARE) derived from the mRNA of the granulocyte macrophage colony-stimulating factor (GM-CSF) gene. The presence of this ARE, together with the upstream stop codon, is designed to mimic a 3’UTR-like sequence. The inventors hypothesized that when pre-spliced exon editor RNA enters the cytoplasm, ARE RNA-binding proteins recognize the ARE sequence, leading to rapid degradation of the molecule, thereby reducing the level of NSP.

[0195] Binding domain (BD): The encoded BD of exemplary ABCA4 REEC directly associates the exon editor RNA with native ABCA4 pre-mRNA. Its 150 nucleotide (nt) sequence is complementary to a region of the same length (chr1:94041452~94041601) within intron 22 of the pre-mRNA. The intron position of the BD was selected through an iterative process of scanning intron 22 using an array of exon editors that branch with respect to the BD sequence at distinct intron positions. This scanning process involved both a next-generation sequencing (NGS)-based approach that evaluated thousands of BDs targeting intron 22 and an evaluation at the level of individual exon editors using bioluminescence or qPCR as readouts. See, for example, FIG. 16.

[0196] MALAT1 triple helix terminator: Exemplary ABCA4 REEC also includes a terminator sequence derived from the MALAT1 long non-coding RNA (lncRNA). This portion of the MALAT1 lncRNA contains a triple helix structure that can confer stability and nuclear retention to the exon editor RNA. The MALAT1 terminator provides a TS efficiency far exceeding that achieved when applying alternative terminators such as self-cleaving ribozymes. See, for example, FIG. 20A. Following this triple helix is an Rnase P cleavage site and a short sequence containing the MALAT1-associated small cytoplasmic RNA (Masc RNA) described below. Rnase P cleavage downstream of the triple helix defines the 3’ end of the exon editor transcript.

[0197] Masc RNA: The Masc RNA sequence in the exemplary ABCA4 REEC is thought to have an upstream Rnase P cleavage site and a downstream Rnase Z cleavage site adjacent, and upon processing, the exon editor transcript remains and exits the nucleus while binding to the TS. The Masc RNA is no longer present within the exon editor transcript after Rnase P cleavage, but including its sequence downstream of the MALAT1 triple helix when present in nature may contribute to achieving high-efficiency TS results. In the cytoplasm, Masc RNA is suspected to promote global protein translation and cell proliferation through interaction and upregulation with the multi-tRNA synthetase complex component glutaminyl-tRNA synthetase (QARS). To mitigate this potential risk, the Masc RNA sequence encoded within the exemplary ABCA4 REEC is mutated to contain a point mutation within its anticodon stem loop (referred to as anti-Mut1), which may disable the interaction with QARS and reliably increase the global protein synthesis rate. A second point mutation serves to maintain the native cloverleaf structure of Masc RNA by base pairing with the anti-Mut1 mutation. Importantly, the introduction of anti-Mut1 into the Masc RNA sequence does not impair TS efficiency. See, for example, FIG. 20B.

[0198] As described herein, exemplary ABCA4 REEC encodes an exemplary ABCA4 5' exon editor RNA molecule that functions in a 5' trans-splicing reaction mediated by the endogenous spliceosome. As shown in Figure 14A, after transcription of the exon editor RNA, an RNA sequence (binding domain; BD) within the exon editor that is complementary to intron 22 of the native ABCA4 pre-mRNA localizes the exon editor RNA to the pre-mRNA. Next, a trans-splicing (TS) reaction occurs between the splice donor site (SD) of the exon editor and the intron 22 splice acceptor site (SA) of the pre-mRNA. This reaction results in the replacement of the native endogenous pre-mRNA sequence from exon 1 to exon 22 with the corresponding coding sequence (CDS) provided by the exon-editor RNA, thereby correcting any mutations that may be present within that region of the native endogenous pre-mRNA. The resulting on-target (ONT) molecule undergoes translation to form a biologically active ABCA4 protein. See, for example, Figure 14A.

[0199] In addition to the above, although not wishing to be bound by theory, the RNA exon editors described herein are thought to function via spliceosome-mediated trans-splicing, which proceeds through a mechanism similar to cis-splicing. After transcription, the exon editor RNA diffuses in the nucleus together with the U1 snRNP deposited on its unpaired SD. Also in the nucleus, the endogenous (native) pre-mRNA target is transcribed from its genomic locus, and the removal of its intron via cis-splicing between the adjacent SD and splice acceptor (SA) sites occurs within seconds of the appearance of the SA of each intron. The trans-splicing process is initiated by base pairing between the binding domain (BD) of the exon editor and its complementary sequence located within intron 22 of the endogenous ABCA4 pre-mRNA, which must occur prior to the removal of the intron via cis-splicing. At this point, the spliceosome can proceed in either (1) lariat formation directed towards cis-splicing using the endogenous SD and SA sites, or (2) "Y-branch" formation directed towards trans-splicing using the SD of the exon editor paired with the endogenous SA. In the latter case, the first nucleotide (guanine) of the SD of the exon editor typically forms a covalent bond with the branch point of the intron, which is 15 - 50 bp upstream of the SA. The formation of this bond results in the separation of the downstream portion of the exon editor from the CDS portion ending with exon 22, which remains interacting with the spliceosome. Next, the spliceosome mediates the ligation of exon 22 of the exon editor to exon 23 of the endogenous pre-mRNA, while the intron is separated, resulting in the correct exon 22-23 junction. Finally, the Y-branch RNA consisting of the downstream portion of the exon editor RNA and the separated intron sequence undergoes rapid degradation, similar to the fate of the lariat RNA formed during cis-splicing. See, for example, FIG. 14B.

[0200] The ABCA4 exon editor may include one or more of the components shown in Table 1 above, or may exclude them. Individual functional components may advantageously be included in the ABCA4 exon editor without including all of the components shown in Table 1. For example, elements 3, 7, 8, 9, 10, and 12 provide advantages to the ABCA4 exon editor, but an effective ABCA4 exon editor may be produced without one or more of these elements.

[0201] Cell line assay In some cases, the trans-splicing molecules described herein are tested in cultured cell lines. To screen, select, and improve the functionality of RNA exon editors, cultured cell lines may be obtained or engineered to express the target ABCA4 pre-mRNA at sufficient levels. Since ABCA4 expression is extremely low in common, robust, and easily transfectable / transducible transformed cell lines, a HEK293T-based cell line called B6 was engineered to express both high ABCA4 RNA and protein levels. This was achieved via constitutive CAGGS promoter knock-in (KI) between the endogenous ABCA4 promoter and exon 1 via CRISPR-mediated homology-directed repair (HDR). PCR on genomic DNA revealed the insertion of the CAG promoter in at least one allele of B6 cells. Next, four different qPCR assays were used to confirm ABCA4 RNA expression in B6 cells. This was in contrast to parental HEK293T cells that do not express ABCA4. Protein translation in B6 cells was confirmed by Western blot. See Figure 3C.

[0202] To characterize the ability of an ABCA4 RNA exon editor to effectively correct targeted native pre-mRNA, the ability of the resulting trans-splicing on-target (ONT) RNA to undergo translation to produce full-length ABCA4 protein was evaluated. For this purpose, a knockout (KO) cell line (designated 17 + 06) was engineered based on the B6 cell line. 17 + 06 cells continued to produce high levels of ABCA4 RNA, but in contrast to the B6 cell line, 17 + 06 cells did not produce ABCA4 protein. Engineering of 17 + 06 cells was achieved by introducing mutations into the ABCA4 gene coding sequence using CRISPR and guide RNAs (gRNAs) targeting exons 3 and 4. B6 cells were subjected to two consecutive transfections to achieve a high mutation efficiency and disrupt the ABCA4 gene sequence. First, by applying a gRNA targeting exon 3, followed by applying a mixture of a gRNA targeting exon 3 and a gRNA targeting exon 4. Mutations were confirmed by Sanger sequencing applied to PCR amplicons generated from 17 + 06 genomic DNA and cDNA, with the latter functioning to confirm that mutations occurred within the allele where CAG insertion was successful during the process of generating the parental cell line, B6. RT-qPCR confirmed the persistence of ABCA4 RNA expression in the 17 + 06 cell line, and western blot analysis showed that translation of ABCA4 protein was abrogated. See Figure 3C.

[0203] RNA Exon Editor Screening Platform As described in FIG. 13, the 5′ RNA exon editor includes several functional sequence elements such as a binding domain (BD) for pre-mRNA targeting and a linker that enables access to the splice donor (SD) site. When engineering an RNA exon editor for a given gene target, various sequence options for each of these elements are tested for their ability to contribute to its high trans-splicing (TS) efficiency. Such testing can be accomplished by (A) cloning and transfecting individual RNA exon editor variants and analyzing the efficiency via RT-qPCR / ddPCR and Western blot, or (B) cloning and pooling RNA exon editors in a high-throughput (HT) library-based approach that relies on next-generation sequencing (NGS) and computational analysis to evaluate efficiency. The exemplary ABCA4 RNA exon editor construct, ABCA4 REEC, was developed by combining these approaches. Both approaches are described below.

[0204] Screening of RNA exon editors in individual formats: This approach can be applied to test a small number of variable elements within the RNA exon editor sequence prior to starting library-based multiplex screening, to validate the performance of RNA exon editors identified in multiplex screening, and / or to improve the performance of lead candidates. Evaluation of TS efficiency is performed at the RNA level and the protein level.

[0205] At the RNA level, TS activity is evaluated by isolating total RNA from cells, followed by reverse transcription and real-time quantitative PCR (RT-qPCR) to measure the RNA copy numbers of, for example, the following targets: RNF20 (a housekeeping gene for normalization); native (ABCA4) mRNA; exon editor RNA; on-target exon-edited RNA (ONT), which is the product of positive TS; ONT + exon editor + OFT (off-target) - a single assay that captures all three of these targets. OFT represents incorrect RNA molecules that can be trans-spliced by the RNA exon editor.

[0206] ONT TS efficiency, also called percent substitution, represents the portion of the total ABCA4 mRNA population that has been successfully TS and is calculated by the following formula: ONT TS% = 100 * (ONT copy number / (ONT copy number + native copy number)).

[0207] RNA exon editor TS efficiency is the portion of the RNA exon editor transcript population that has been correctly trans-spliced to ABCA4 RNA and is calculated by the following formula: exon editor TS% = 100 * (ONT copy number / (ONT copy number + exon editor copy number + OFT copy number)).

[0208] At the protein level, TS activity is measured via Western blot analysis applied to proteins extracted from cell or tissue samples via a protocol that enriches for membrane proteins in the case of ABCA4. The membrane protein Na+ / K+ ATPase is used as a loading control. The level of ONT protein is measured via an ABCA4-specific antibody (Ab). For constructs containing a tag, such as a V5 tag, at its N-terminus, the Western blot can be probed with an Ab specific to that tag (e.g., V5-specific Ab) to evaluate the ONT protein level.

[0209] RNA exon editor screening in library format: In addition to the above, the RNA exon editor can be screened in a high-throughput library format that relies on the synthesis of a DNA oligo library that can focus on specific properties of the exon editor, such as BD or the linker.

[0210] Confirmation of the full-length exon-edited ABCA4 mRNA sequence: To confirm that the ABCA4 mature mRNA generated from exon editing has a sequence predicted to result from an accurate trans-splicing reaction, including the correct exon 22-exon 23 junction, the inventors isolated and sequenced the edited ABCA4 RT-PCR product from ABCA4 KO cells transiently transfected with a plasmid encoding the ABCA4-01 exon editor. By Sanger sequencing, the correct mature mRNA sequence was confirmed in multiple randomly selected clones. In addition to confirming the correct exon 22-exon 23 junction, these sequencing results confirmed that the full-length exon-edited ABCA4 mature mRNA molecule has the predicted sequence over its entire length, including the CDS derived from the exon editor spanning exons 1-22 and the endogenous sequence spanning exons 23-50. These results provide further confidence that ABCA4 exon editing mediated by treatment with ABCA4-01 results in the intended correct ABCA4 mature mRNA sequence.

[0211] Evaluation of the ATPase functional activity of the exon-edited ABCA4 protein: The ABCA4 protein is a member of the superfamily of ATP-binding cassette (ABC) transporters and is preferentially localized along the marginal region of the outer segment disc membrane of photoreceptors. ABC transporters utilize the energy of ATP hydrolysis to move a diverse set of substrates unidirectionally across the cell membrane, from ions to lipids and peptides. The ABCA4 protein is activated when light entering the eye is converted into an electrical signal (phototransduction). Potentially toxic vitamin A derivatives are formed during phototransduction, and the ABCA4 protein helps remove at least two of these substances (all-trans retinal and 11-cis retinal) from the outer segment of photoreceptors. This photoreceptor clearance mechanism helps protect both photoreceptors and retinal pigment epithelial cells from the accumulation and secondary damage that can be induced by these molecules. As described above, recessive loss-of-function ABCA4 mutations result in the accumulation of these vitamin A derivatives, causing the accumulation of lipofuscin, including A2E (the bisretinoid pyridinium salt N-retinylidene-N-retinylethanolamine fluorophore found in lipofuscin), leading to retinal cytotoxicity and ultimately progressive vision loss.

[0212] ATPase activity, including the increase in activity due to substrate binding, is important for the function of the ABCA4 protein. Therefore, evaluating the ATPase activity of the ABCA4 protein translated from ABCA4 mRNA generated via exon editing functions as an overall indicator of the biological activity of ABCA4. Previous reports have shown that incubation of 40 μM all-trans retinal (ATR) with purified wild-type (WT) ABCA4 protein increases ATPase activity by 1.8 - 2.5-fold. With this information in mind, experiments were designed to evaluate the biological activity of exon-edited ABCA4 proteins.

[0213] The ATPase activity of the ABCA4 protein rescued in ABCA4 KO cells transfected with an overexpression plasmid encoding an N-terminal V5 epitope-tagged version of the RNA exon editor of ABCA4-01 (SEQ ID NO: 81) was evaluated with or without 40 μM of all-trans retinal (ATR) after immunoprecipitation of the ABCA4 protein using an established method. Initial data show basal levels of ATPase activity that increase in response to the addition of 40 μM of all-trans retinal. See Figure 24. Minimal background ATPase activity was detected in untransfected samples lacking ABCA4. These results provide evidence that the exon-edited ABCA4 protein generated from ABCA4-01 (SEQ ID NO: 90) treatment exhibits the functional ATPase activity required for the transport of all-trans retinal and excess 11-cis retinal from photoreceptor outer segments. In some embodiments, equivalent results are obtained by combining a fragment of SEQ ID NO: 90 (e.g., SEQ ID NO: 69) with different 5’UTRs. These results demonstrate the restoration of ABCA4 biological activity after expression of an exemplary ABCA4 RNA exon editor.

[0214] Overview of in vivo NHP studies supporting the use of ABCA4 exon editor therapeutics in ABCA4-related retinopathy patients: Example 4 presents evidence showing that an AAV8-based V5 epitope-tagged ABCA4 exon editor yields therapeutically relevant exon editing activity in African green monkeys (AGMs) one month after a single subretinal administration of 1E11 vg / injection. Notably, the initial lead vector tested in this study (SEQ ID NO: 42) was used as a basis for further optimization and final selection of elements present in ABCA4-01 (SEQ ID NO: 90) including the RNA exon editor containing SEQ ID NO: 78. See, e.g., Figures 4-12; Tables 1 and 2.

[0215] Example 8 presents evidence that selected regulatory elements in ABCA4-01 (SEQ ID NO: 90) result in sustained expression and exon editing activity up to the 3-month time point in the AGM. The AAV8 constructs tested in this trial contain an RNA exon editor that includes SEQ ID NO: 77 (the first 104 nucleotides include the native ABCA4 5’UTR followed by the ATG start codon for translation initiation), which is similar to the initial lead vector that includes (SEQ ID NO: 42), but differs in lacking the V5 epitope tag, includes a double stop codon following the splice domain, and produces a higher level of truncated ABCA4 non-splicing protein (NSP) in vitro when compared to ABCA4-01 (SEQ ID NO: 90). In particular, the AAV8 constructs tested in this trial contain an exon editor (SEQ ID NO: 77) similar to the early lead vector (SEQ ID NO: 42) that includes the early lead vector (SEQ ID NO: 42), which is well tolerated at 1 and 3 months post single subretinal dose of 4.3E10 vg / eye in all animals, further supporting the clinical approach using the related construct ABCA4-01 (SEQ ID NO: 90). See Figure 22. The ABCA4-01 RNA exon editor that includes SEQ ID NO: 90 (this time including SEQ ID NO: 78) differs from the RNA exon editor that includes SEQ ID NO: 77 used in this trial in that SEQ ID NO: 77 does not contain an enhancer (e.g., SEQ ID NO: 62) or a translation enhancer (e.g., SEQ ID NO: 63). However, each of SEQ ID NO: 77 and SEQ ID NO: 78 share the same regulatory elements and double stop codon.

[0216] Example 10 presents evidence showing that ABCA4-01 (SEQ ID NO: 90) confers sustained expression and exon editing activity in NHP up to the 6-month time point. More specifically, FIGS. 30A-30C show results demonstrating robust in vivo ABCA4 RNA and protein replacement in NHP 6 months after treatment with an exemplary AAV8 RNA exon editor construct (ABCA4-01; SEQ ID NO: 90). Briefly, wild-type cynomolgus monkeys were treated with a single subretinal dose of ABCA4-01 (presenting results for an exemplary dose of 3.5E11 vg / eye). The percent RNA replacement was in the range of about 40%-60% with this dose of ABCA4-01. This resulted in therapeutic levels of the resulting human-NHP chimeric ABCA4 protein, as measured by the validated IA-MS assay (FIG. 30C). More specifically, the human NHP chimeric ABCA4 protein derived from ABCA4 RNA editing in these animals was found to be present at 20-40% of the total ABCA4 protein (human-NHP+NHP) in the test samples. Maximum 66% RNA replacement and maximum 45% human / NHP chimeric ABCA4 protein were detected in wild-type cynomolgus monkeys treated with a high dose of ABCA4-01 (1E12 vg / eye) delivered by single subretinal injection. These results demonstrate that ABCA4-01 achieves therapeutically relevant levels of edited ABCA4 protein expression in NHP, and that these levels exceed those of the rescued ABCA4 protein, which have previously been shown to have a therapeutic effect in the ABCA4 KO mouse model.

[0217] Example 12 presents evidence that ABCA4-01, an exemplary AAV8 RNA exon editor construct containing SEQ ID NO: 90, functions in the context of human photoreceptors. Briefly, donor-derived retinal explants from multiple human donors were treated with ABCA4-01 (3.9E11 vg) to evaluate the activity of ABCA4-01 in human photoreceptors. Treatment with ABCA4-01 resulted in approximately 20-30% RNA substitution with the corresponding exons encoded by ABCA4-01 of endogenous exons 1-22 (Figure 31). Notably, the same lot of ABCA4-01 was also used in the investigational NHP study mentioned in Example 10, and the results in human subjects of NHP further demonstrated the translatability of ABCA4-01.

[0218] III. Vector Trans-splicing molecules can be delivered to target cells of an individual using a variety of techniques, for example, using recombinant adeno-associated virus (AAV) vectors or other vector modalities, for example, non-viral vectors. Accordingly, provided herein are vectors that contain / encode trans-splicing molecules (e.g., viral or non-viral vectors that contain / encode trans-splicing molecules, e.g., DNA vectors that contain / encode trans-splicing molecules). Any suitable nucleic acid vector can be used in conjunction with the compositions and methods of the invention to design and assemble trans-splicing molecules and components of recombinant AAV. In one embodiment, the vector is a recombinant AAV that carries a trans-splicing molecule driven by a promoter that expresses the trans-splicing molecule in selected cells of an individual. Methods for constructing recombinant vectors are well known in the art. See, for example, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, M.A. et al., Nat. Med., 2001, 7(1):33-40; and Walther W. and Stein U., Drugs 2000, 60(2):249-71.

[0219] In certain embodiments described herein, the trans-splicing molecule is delivered to selected cells in need of AAV vector-based therapy, such as photoreceptor cells. A variety of natural serotypes of AAV are available. There are many natural variants in the AAV capsid, enabling the identification and use of AAVs with properties particularly suitable for ocular or cochlear cells. Artificial AAV vectors can be engineered by conventional molecular biology techniques, thereby optimizing these particles for cell-specific delivery of the trans-splicing molecule nucleic acid sequence, minimizing immunogenicity, adjusting stability and particle lifetime, efficiently degrading, accurately delivering into the nucleus, etc. For example, such artificial capsids can be generated by any suitable technique that uses a selected AAV sequence (e.g., a fragment of the vp1 capsid protein) in combination with heterologous sequences obtained from different selected AAVs, non-contiguous portions of the same AAV, non-AAV viral sources, or non-viral sources. Artificial AAVs can be, but are not limited to, pseudotyped AAVs, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. Pseudotyped vectors in which the capsid of one AAV has been replaced with a heterologous capsid protein are useful for delivering the trans-splicing molecules described herein.

[0220] Expression of the trans-splicing molecules described herein can be achieved in selected cells by delivery with a recombinant or artificial AAV containing / encoding a sequence comprising the desired trans-splicing molecule. The use of AAV is a common mode of exogenous DNA delivery because it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. Among the well-characterized serotypes of AAV isolated from humans or non-human primates, human serotype 2 has been widely used in efficient gene transfer experiments in different target tissues and animal models.

[0221] In some embodiments, the AAV is AAV1 or a variant thereof (e.g., SEQ ID NO: 6 or 64 of US20030138772, or SEQ ID NO: 11 or 27 of US20150159173), AAV2 or a variant thereof (e.g., SEQ ID NO: 7 or 70 of US20030138772, SEQ ID NO: 7 or 23 of US20150159173, or SEQ ID NO: 7 of US20150159173), AAV2G9 or a variant thereof, AAV3 or a variant thereof (e.g., SEQ ID NO: 8 or 71 of US20030138772), AAV3a or a variant thereof, AAV3b or a variant thereof (e.g., SEQ ID NOs: 1 and 10 of US Patent No. 6,156,303), AAV3-3 or a variant thereof (e.g., SEQ ID NOs: 200 and 217 of WO2005033321), AAV4 or a variant thereof (e.g., SEQ ID NO: 63 of US20030138772), AAV4-4 or a variant thereof (e.g., SEQ ID NO: 201 or 218 of WO2005033321), AAV5 or a variant thereof (e.g., SEQ ID NO: 114 of US20030138772), AAV6 or a variant thereof (e.g., SEQ ID NO: 65 of US20030138772), AAV6.1 or a variant thereof (e.g., SEQ ID NO: 29 of US20150159173), AAV6.2 or a variant thereof, AAV6.1.2 or a variant thereof, AAV7 or a variant thereof (e.g., SEQ ID NOs: 1-3 of US20030138772), AAV7.2 or a variant thereof, AAV8 or a variant thereof (e.g., SEQ ID NOs: 4 and 95 of US20030138772) or AAV8(b) (having the amino acid sequence Pro-Glu-Arg-Thr-Ala-Met-Ser-Leu-Pro (SEQ ID NO: 132) at amino acid positions 587-595 compared to wild-type AAV8 (as described in US Patent No. 9,567,376, which is hereby incorporated by reference in its entirety)), AAV9 or a variant thereof (e.g., SEQ ID NOs: 5 and 100 of US20030138772), AAV9.9 or a variant thereof, AAV9.11 or a variant thereof, AAV9.13 or a variant thereof, AAV9.16 or its variant, AAV9.24 or its variant, AAV9.45 or its variant, AAV9.47 or its variant, AAV9.61 or its variant, AAV9.68 or its variant, AAV9.84 or its variant (see, e.g., N. Pulicherla et al. Molecular Therapy 19(6):1070-1078 (2011), which is incorporated herein by reference in its entirety), AAV10 or its variant (e.g., SEQ ID NO: 117 of US20030138772), AAV11 or its variant (e.g., SEQ ID NO: 118 of US20030138772), AAV12 or its variant (e.g., SEQ ID NO: 119 of US20030138772), AAV16.3 or its variant, AAV24.1 or its variant, AAV27.3 or its variant, AAV42.12 or its variant, AAV42-1b or its variant, AAV42-2 or its variant, AAV42-3a or its variant, AAV42-3b or its variant, AAV42-4 or its variant, AAV42-5a, or its variant, AAV42-5b or its variant, AAV42-6b or its variant, AAV42-8 or its variant, AAV42-10 or its variant, AAV42-11 or its variant, AAV42-12 or its variant, AAV42-13 or its variant, AAV42-15 or its variant, AAV42-aa or its variant, AAV43-1 or its variant, AAV43-12 or its variant, AAV43-20 or its variant, AAV43-21 or its variant, AAV43-23 or its variant, AAV43-25 or its variant, AAV43-5 or its variant, AAV44.1 or its variant, AAV44.2 or its variant, AAV44.5 or its variant, AAV223.1 or its variant, AAV223.2 or its variant, AAV223.4 or its variant, AAV223.5 or its variant, AAV223.6 or its variant, AAV223.7 or its variant, AAV1-7 / rh.48 or its variant, AAV1-8 / rh.49 or its variant, AAV2-15 / rh.62 or its variant, AAV2-3 / rh.61 or its variant, AAV2-4 / rh.50 or its variant, AAV2-5 / rh.51 or its variant, AAV3.1 / hu.6 or its variant, AAV3.1 / hu.9 or its variant, AAV3-9 / rh.52 or its variant, AAV3-11 / rh.53 or its variant, AAV4-8 / rh.64 or its variant, AAV4-9 / rh.54 or its variant (e.g., SEQ ID NO: 116 of WO2005033321), AAV4-19 / rh.55 or its variant (e.g., SEQ ID NO: 117 of WO2005033321), AAV5-3 / rh.57 or its variant, AAV5-22 / rh.58 or its variant, AAV7.3 / hu.7 or its variant, AAV16.8 / hu.10 or its variant, AAV16.12 / hu.11 or its variant, AAV29.3 / bb.1 or its variant, AAV29.5 / bb.2 or its variant, AAV106.1 / hu.37 or its variant, AAV114.3 / hu.40 or its variant, AAV127.2 / hu.41 or its variant, AAV127.5 / hu.42 or its variant, AAV128.3 / hu.44 or its variant, AAV130.4 / hu.48 or its variant, AAV145.1 / hu.53 or its variant, AAV145.5 / hu.54 or its variant, AAV145.6 / hu.55 or its variant, AAV161.10 / hu.60 or its variant, AAV161.6 / hu.61 or its variant, AAV33.12 / hu.17 or its variant, AAV33.4 / hu.15 or its variant, AAV33.8 / hu.16 or its variant, AAV52 / hu.19 or its variant, AAV52.1 / hu.20 and also its variants, AAV58.2 / hu.25 or its variants, AAVA3.3 or its variants, AAV3.4 or its variants, AAV3.5 or its variants, AA3.7 or its variants, AAVC1 or its variants, AAVC2 or its variants, AAVC5 or its variants, AAV-DJ or its variants (e.g., SEQ ID NO: 2 or 3 of US20140359799), AAV-DJ8 or its variants, AAVF3 or its variants, AAVF5 or its variants, AAVH2 or its variants, AAVH6 or its variants, AAVLK03 or its variants, AAVH-1 / hu.1 or its variants, AAVH-5 / hu.3 or its variants, AAVLG-10 / rh.40 or its variants, AAVLG-4 / rh.38 or its variants, AAVLG-9 / hu.39 or its variants, AAVN721-8 / rh.43 or its variants, AAVCh.5 or its variants (e.g., SEQ ID NO: 46 of US20150159173), AAVCh.5R1 or its variants, AAVcy.2 or its variants, AAVcy.3 or its variants, AAVcy.4 or its variants, AAVcy.5 or its variants (e.g., SEQ ID NO: 8 and 24 of US20150159173), AAVCy.5R1 or its variants, AAVCy.5R2 or its variants, AAVCy.5R3 or its variants, AAVCy.5R4 or its variants, AAVcy.6 or its variants, AAVhu.1 or its variants (e.g., WO2005033321), AAVhu.2 or its variants (e.g., SEQ ID NO: 143 of WO2005033321), AAVhu.3 or variants (e.g., SEQ ID NO: 145 of WO2005033321), AAVhu.4 or its variants (e.g., SEQ ID NO: 141 of WO2005033321), AAVhu.5 or its variants, AAVhu.6 or its variants (e.g., SEQ ID NO: 84 of WO2005033321), AAVhu.7 or its variant (e.g., SEQ ID NO: 150 of WO2005033321), AAVhu.9 or its variant (e.g., SEQ ID NO: 155 of WO2005033321), AAVhu.10 or its variant (e.g., SEQ ID NO: 156 of WO2005033321), AAVhu.11 or its variant (e.g., SEQ ID NO: 153 of WO2005033321), AAVhu.13 or its variant (SEQ ID NO: 16 and SEQ ID NO: 147 of US20150159173), AAVhu.15 or its variant (e.g., SEQ ID NO: 147 of WO2005033321), AAVhu.16 or its variant (e.g., SEQ ID NO: 148 of WO2005033321), AAVhu.17 or its variant (e.g., SEQ ID NO: 83 of WO2005033321), AAVhu.18 or its variant (e.g., SEQ ID NO: 149 of WO2005033321), AAVhu.19 or its variant (e.g., SEQ ID NO: 133 of WO2005033321), AAVhu20 or its variant (e.g., SEQ ID NO: 134 of WO2005033321), AAVhu.21 or its variant (e.g., SEQ ID NO: 135 of SEQ ID NO: WO2005033321), AAVhu.22 or its variant (e.g., SEQ ID NO: 138 of WO2005033321), AAVhu.23.2 or its variant (e.g., SEQ ID NO: 137 of WO2005033321), AAVhu.24 or its variant (e.g., SEQ ID NO: 136 of WO2005033321), AAVhu.25 or its variant (e.g., SEQ ID NO: 146 of WO2005033321), AAVhu.26 or its variant (e.g., SEQ ID NO: 17 and 33 of US20150159173), AAVhu.27 or its variant (e.g., SEQ ID NO: 40 of WO2005033321), AAVhu.28 or its variant (e.g., SEQ ID NO: 42 of US20150159173), AAVhu.29 or its variant (e.g., SEQ ID NO: 132 of WO2005033321), AAVhu.29R or its variant, AAVhu.31 or its variant (e.g., SEQ ID NO: 121 of WO2005033321), AAVhu.32 or its variant (SEQ ID NO: 122 of WO2005033321), AAVhu.34 or its variant (e.g., SEQ ID NO: 125 of WO2005033321), AAVhu.35 or its variant (e.g., SEQ ID NO: 164 of WO2005033321), AAVhu.37 or its variant (e.g., SEQ ID NOs: 18 and 34 of US20150159173), AAVhu.39 or... is that variant (e.g., SEQ ID NO: 102 of WO2005033321), AAVhu.40 or its variant (e.g., SEQ ID NO: 87 of WO2005033321), AAVhu.41 or its variant (e.g., SEQ ID NO: 91 of WO2005033321), AAVhu.42 or its variant (e.g., SEQ ID NO: 85 of WO2005033321), AAVhu.43 or its variant (e.g., SEQ ID NO: 160 of WO2005033321), AAVhu.44 or its variant (e.g., SEQ ID NO: 45 of US20150159173), AAVhu.44R1 or its variant, AAVhu.44R2 or its variant, AAVhu.44R3 or its variant, AAVhu.45 or its variant (e.g., SEQ ID NO: 127 of WO2005033321), AAVhu.46 or its variant (e.g., SEQ ID NO: 159 of WO2005033321), AAVhu.47 or its variant (e.g., SEQ ID NO: 128 of WO2005033321), AAVhu.48 or its variant (e.g., SEQ ID NO: 38 of US20150159173), AAVhu.48R1 or its variant, AAVhu.48R2 or its variant, AAVhu.48R3 or its variant, AAVhu.49 or its variant (e.g., SEQ ID NO: 189 of WO2005033321), AAVhu.51 or its variant (e.g., SEQ ID NO: 190 of WO2005033321), AAVhu.52 or its variant (e.g., SEQ ID NO: 191 of WO2005033321), AAVhu.53 or its variant (e.g., SEQ ID NOs: 19 and 35 of US20150159173), AAVhu.54 or its variant (e.g., SEQ ID NO: 188 of WO2005033321), AAVhu.55 or its variant (e.g., SEQ ID NO: 187 of WO2005033321), AAVhu.56 or its variant (e.g., SEQ ID NO: 192 of WO2005033321), AAVhu.57 or its variant (e.g., SEQ ID NO: 193 of WO2005033321), AAVhu.58 or its variant (e.g., SEQ ID NO: 194 of WO2005033321), AAVhu.60 or its variant (e.g., SEQ ID NO: 184 of WO2005033321), AAVhu.61 or its variant (e.g., SEQ ID NO: 185 of WO2005033321), AAVhu.63 or its variant (e.g., SEQ ID NO: 195 of WO2005033321), AAVhu.64 or its variant (e.g., SEQ ID NO: 196 of WO2005033321), AAVhu.66 or its variant (e.g., SEQ ID NO: 197 of WO2005033321), AAVhu.67 or its variant (e.g., SEQ ID NO: 198 of WO2005033321), AAVhu.14 / 9 or its variant, AAVhu.t19 or its variant, AAVrh.2 or its variant (e.g., SEQ ID NO: 39 of US20150159173), AAVrh.2R or its variant, AAVrh.8 or its variant (e.g., SEQ ID NO: 41 of US20150159173), AAVrh.8R or its variant, AAVrh.10 or its variant (e.g., SEQ ID NOs: 9 and 25 of US20150159173), AAVrh.12 or its variant, AAVrh.13 or its variant (e.g., SEQ ID NOs: 10 and 26 of US20150159173), AAVrh.13R or its variant, AAVrh.14 or its variant, AAVrh.17 or its variant, AAVrh.18 or its variant, AAVrh.19 or its variant, AAVrh.20 or its variant (e.g., SEQ ID NO: 1 of US20150159173), AAVrh.21 or its variant, AAVrh.22 or its variant, AAVrh.23 or its variant, AAVrh.24 or its variant, AAVrh.25 or its variant, AAVrh.31 or its variant, AAVrh.32 or its variant, AAVrh.33 or its variant, AAVrh.34 or its variant, AAVrh.35 or its variant, AAVrh.36 or its variant, AAVrh.37 or a variant thereof (e.g., SEQ ID NO: 40 of US20150159173), AAVrh.37R2 or a variant thereof, AAVrh.38 or a variant thereof (e.g., SEQ ID NO: 86 of WO2005033321), AAVrh.39 or a variant thereof (e.g., SEQ ID NO: 3, 20, or 36 of US20150159173), AAVrh.40 or a variant thereof (e.g., SEQ ID NO: 92 of WO2005033321)), AAVrh.43 or a variant thereof (e.g., SEQ ID NO: 21 and 37 of US20150159173), AAVrh.46 or a variant thereof (e.g., SEQ ID NO: 4 and 22 of US20150159173), AAVrh.48 or a variant thereof (e.g., SEQ ID NO: 44 of US20150159173), AAVrh.48.1 or a variant thereof (e.g., SEQ ID NO: 44 of US20150159173), AAVrh.48.1.2 or a variant thereof, AAVrh.48.2 or a variant thereof, AAVrh.49 or a variant thereof (e.g., SEQ ID NO: 103 of WO2005033321), AAVrh.50 or a variant thereof (e.g., SEQ ID NO: 108 of WO2005033321), AAVrh.51 or a variant thereof (e.g., SEQ ID NO: 104 of WO2005033321), AAVrh.52 or a variant thereof (e.g., SEQ ID NO: 96 of WO2005033321), AAVrh.53 or a variant thereof (e.g., SEQ ID NO: 97 of WO2005033321), AAVrh.54 or AAVrh.56 or a variant thereof (e.g., SEQ ID NO: 49 of US20150159173), AAVrh.56 or a variant thereof (e.g., SEQ ID NO: 152 of WO2005033321), AAVrh.57 or a variant thereof (e.g., SEQ ID NO: 105 of WO2005033321), AAVrh.58 or a variant thereof (e.g., SEQ ID NO: 48 of US20150159173), AAVrh.61 or a variant thereof (e.g., SEQ ID NO: 107 of WO2005033321), AAVrh.62 or a variant thereof (e.g., SEQ ID NO: 114 of WO2005033321), AAVrh.64 or a variant thereof (e.g., SEQ ID NO: 43 of US20150159173), AAVrh.64R1 or a variant thereof, AAVrh.64R2 or a variant thereof, AAVrh.67 or a variant thereof (e.g., SEQ ID NO: 47 of US20150159173), AAVrh.73 or a variant thereof (e.g., US20150159173), or AAVrh.74 or a variant thereof (e.g., SEQ ID NO: 6 of US2015015917). Non-limiting examples of variants include SEQ ID NOs: 9, 27-45, 47-62, 66-69, 73-81, 84-94, 96, 97, 99, and 101-113 of US20030138772 (the entire contents of which are incorporated herein by reference), and SEQ ID NOs: 1, 2, 4-82, 89, 90, 93-95, 98, 100, 101, 109-113, 118-120, 124, 126, 131, 139, 142, 151, 154, 158, 161, 162, 165-183, 202, 204-212, 215, 219, and 224-236 of WO2005033321 (the entire contents of which are incorporated herein by reference). In one embodiment, the AAV serotype is any of those described in US2021 / 0189430, the entire contents of which are incorporated herein by reference. The amino acid sequence of AAV may include one or more amino acid substitutions in the AAV capsid protein at one or more positions that interact with heparan sulfate proteoglycan, or at one or more positions corresponding to amino acids 484, 487, 527, 532, 585, or 588 (numbering based on the VP1 numbering of AAV2).

[0222] Unless otherwise specified, the AAV ITRs, and other selected AAV components described herein can be readily selected from, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or any of the AAV serotypes, including known and unknown AAV serotypes. In one embodiment, the ITR is derived from AAV2. The ITR or other AAV components can be readily isolated from AAV using techniques available to those skilled in the art. Such AAV can be isolated or obtained from academic, commercial, or public sources (e.g., American Type Culture Collection, Manassas, Va.). Alternatively, the AAV sequences can be obtained via synthesis or other suitable means by referring to published sequences available in the literature or in databases such as, for example, GenBank, PubMed, etc.

[0223] Desirable AAV fragments for assembly into vectors include the cap protein containing vp1, vp2, vp3, and hypervariable regions, the rep protein containing rep78, rep68, rep52, and rep40, and the sequences encoding these proteins. These fragments can be readily utilized in various vector systems and host cells. Such fragments can be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, but are not limited to, AAVs containing non-naturally occurring capsid proteins. Such artificial capsids can be generated by any suitable technique that uses a selected AAV sequence (e.g., a fragment of the vp1 capsid protein) in combination with heterologous sequences obtained from a different selected AAV, non-contiguous portions of the same AAV, a non-AAV viral source, or a non-viral source. Artificial AAVs can be, but are not limited to, pseudotyped AAVs, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. Pseudotyped vectors in which the capsid of one AAV is utilized with ITRs from an AAV having a different capsid protein are useful as described herein. In one embodiment, the AAV is AAV2 / 5 (i.e., an AAV having AAV2 ITRs and an AAV5 capsid). In another embodiment, the AAV is AAV2 / 8 (i.e., an AAV having AAV2 ITRs and an AAV8 capsid). In one embodiment, the AAV includes an AAV8 capsid. Such an AAV8 capsid includes the amino acid sequence found in NCBI reference sequence: YP_077180.1. In another embodiment, the AAV8 capsid includes the capsid encoded by nt2121-4337 of GenBank accession: AF513852.1.

[0224] In one embodiment, vectors useful in the compositions and methods described herein include at a minimum a sequence encoding a selected AAV serotype capsid, such as an AAV2 capsid, or a fragment thereof. In another embodiment, useful vectors include at a minimum a sequence encoding a selected AAV serotype rep protein, such as an AAV2 rep protein, or a fragment thereof. Optionally, such vectors may include both AAV cap and AAV rep proteins. In vectors where both AAV rep and AAV cap are provided, both the AAV rep sequence and the AAV cap sequence can be of one serotype origin, such as AAV2 origin.

[0225] Alternatively, vectors can be used in which the rep sequence is derived from an AAV serotype different from the one providing the cap sequence. In one embodiment, the rep sequence and the cap sequence are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In another embodiment, these rep sequences are fused in-frame to cap sequences of different AAV serotypes to form chimeric AAV vectors, such as those described in U.S. Patent No. 7,282,199, which is incorporated herein by reference.

[0226] Suitable recombinant AAV (rAAV) is generated by culturing a host cell comprising a nucleic acid sequence encoding an AAV serotype capsid protein, or a fragment thereof, as defined herein; a functional rep gene; for example, a minigene composed of AAV ITRs and a trans-splicing molecular nucleic sequence, and sufficient helper functions to permit packaging of the minigene into the AAV capsid protein. The components necessary to culture the host cell for packaging the AAV minigene into the AAV capsid can be provided in trans to the host cell. Alternatively, any one or more of the necessary components (e.g., minigene, rep sequence, cap sequence, and / or helper functions) can be provided by a stable host cell engineered to contain one or more of the necessary components using methods well known to those of skill in the art.

[0227] In one embodiment, the AAV comprises a promoter (or a functional fragment of a promoter). The selection of the promoter used in rAAV can be made from among a number of constitutive or inducible promoters that can express the selected transgene in the desired target cells. See, for example, the list of promoters identified in International Patent Publication No. WO2014 / 012482, which is incorporated herein by reference. In one embodiment, the promoter is cell-specific. The term "cell-specific" means that a particular promoter selected for use in a recombinant vector can induce the expression of the selected transgene in a particular cell type. In one embodiment, the promoter is specific for the expression of the transgene in photoreceptor cells. In another embodiment, the promoter is specific for expression in rods and / or cones. In another embodiment, the promoter is specific for the expression of the transgene in retinal pigment epithelial (RPE) cells. In another embodiment, the promoter is specific for the expression of the transgene in ganglion cells. In another embodiment, the promoter is specific for the expression of the transgene in Müller cells. In another embodiment, the promoter is specific for the expression of the transgene in bipolar cells. In another embodiment, the promoter is specific for the expression of the transgene in horizontal cells. In another embodiment, the promoter is specific for the expression of the transgene in amacrine cells. In another embodiment, the transgene is expressed in any of the cells described above.

[0228] In another embodiment, the promoter is the native promoter of the target gene to be expressed. Useful promoters include, but are not limited to, the rhodopsin promoter, red - green opsin promoter, blue opsin promoter, cGMP - phosphodiesterase promoter, mouse opsin promoter, rhodopsin promoter, alpha subunit of cone transduction, beta phosphodiesterase (PDE) promoter, retinitis pigmentosa promoter, NXNL2 / NXNL1 promoter, RPE65 promoter, slow retinal degeneration / peripherin - 2 (Rds / perph2) promoter, and VMD2 promoter.

[0229] Other conventional regulatory sequences included in the minigene or rAAV are also cited in documents such as WO2014 / 124282 and other literature and incorporated herein by reference. One of ordinary skill in the art can select from these and other expression control sequences without departing from the scope described herein.

[0230] The selected genetic element can be delivered by any suitable method including those described herein. The methods used to construct any of the embodiments described herein are well known to those of ordinary skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for generating rAAV virions are well known, and the selection of a suitable method is not limited to the methods and constructs described herein. See, for example, K. Fisher et al., J. Virol., 1993 70:520 - 532 and U.S. Patent No. 5,478,745 (each incorporated herein by reference).

[0231] In another embodiment, the trans-splicing molecule is contained in a proviral plasmid as disclosed in International Patent Publication No. WO2012 / 158757 (incorporated herein by reference). Such a proviral plasmid contains a modular recombinant AAV genome that is operatively associated with: a wild-type 5' AAV2 ITR sequence adjacent to unique restriction sites that allow for easy removal or replacement of the ITR; a promoter containing a 49-nucleotide cytomegalovirus sequence upstream of the cytomegalovirus (CMV)-chicken beta-actin sequence, or a photoreceptor-specific promoter / enhancer-containing promoter, the promoter being adjacent to unique restriction sites that allow for easy removal or replacement of the entire promoter sequence, and the upstream sequence being adjacent to unique restriction sites that allow for easy removal or replacement of only the CMV or enhancer sequence upstream of the promoter sequence. The trans-splicing molecule described herein can be inserted into the site of a multiple cloning polylinker, and the trans-splicing molecule is operably linked to and under the control of a promoter. Also part of such a plasmid is a bovine growth hormone polyadenylation sequence adjacent to unique restriction sites that allow for easy removal or replacement of the polyA sequence, and a wild-type 3' AAV2 ITR sequence adjacent to unique restriction sites that allow for easy removal or replacement of the 3' ITR. The plasmid backbone contains elements necessary for replication in bacterial cells, such as a kanamycin resistance gene, and is itself adjacent to a transcriptional terminator / insulator sequence.

[0232] In one embodiment, the proviral plasmid comprises (a) operably linked: (i) a wild-type 5’ AAV2 ITR sequence with an adjacent unique restriction site that permits facile removal or replacement of the ITR, and (ii) a promoter comprising (A) a 49-nucleotide CMV sequence upstream of the CMV-chicken beta-actin sequence, (B) a photoreceptor-specific promoter / enhancer, or (C) a neuron-specific promoter / enhancer, in a modular recombinant AAV genome. The promoter is adjacent to a unique restriction site that permits facile removal or replacement of the entire promoter sequence, and the upstream sequence is adjacent to a unique restriction site that permits facile removal or replacement of only the CMV or enhancer sequence upstream from the promoter sequence. Also, a portion of this proviral plasmid is a multiple cloning polylinker sequence that permits insertion of a trans-splicing molecular sequence comprising any of those described herein, the trans-splicing molecule being operably linked to the promoter and under the control of the promoter, a bovine growth hormone polyadenylation sequence with an adjacent unique restriction site that permits facile removal or replacement of the polyA sequence, and a wild-type 3’ AAV2 ITR sequence with an adjacent unique restriction site that permits facile removal or replacement of the 3’ ITR. The proviral plasmid also comprises elements necessary for replication in bacterial cells and a plasmid backbone further comprising a kanamycin resistance gene, the plasmid backbone being adjacent to a transcriptional terminator / insulator sequence. The proviral plasmid described herein also comprises a non-coding lambda phage 5.1 kb stuffer sequence in the plasmid backbone to increase the backbone length and prevent reverse packaging of non-functional AAV genomes.

[0233] In yet a further aspect, the promoter of the proviral plasmid is modified to reduce the size of the promoter to allow a larger trans-splicing molecular sequence to be inserted into rAAV. In one embodiment, a CMV / CBA hybrid promoter, which typically contains a total of about 1,000 base pairs of non-coding exons and introns, is replaced with a 130-base pair chimeric intron as described in International Patent Publication No. WO2017 / 087900, which is incorporated herein by reference in its entirety.

[0234] These proviral plasmids are then used in currently practiced packaging methods to generate recombinant viruses that express the trans-splicing molecular transgene carried by the proviral plasmid. Suitable production cell lines are readily selected by those skilled in the art. For example, suitable host cells can be selected from any biological organism including prokaryotic (e.g., bacterial) cells, as well as eukaryotic cells including insect cells, yeast cells, and mammalian cells. Briefly, the proviral plasmid is transfected into the selected packaging cells, where the proviral plasmid can be transiently present. Alternatively, a minigene or gene expression cassette containing adjacent ITRs is stably integrated into the genome of the host cell, either chromosomally or episomally. Suitable transfection techniques are known and can be readily utilized to deliver the recombinant AAV genome to the host cell. Typically, the proviral plasmid is cultured in a host cell that expresses the cap and / or rep proteins. In the host cell, a minigene consisting of a trans-splicing molecule having adjacent AAV ITRs is rescued and packaged into the capsid protein or envelope protein to form infectious virus particles. Thus, recombinant AAV infectious particles are produced by culturing packaging cells having the proviral plasmid in the presence of a viral sequence sufficient to allow packaging of the gene expression cassette viral genome into an infectious AAV envelope or capsid.

[0235] Alternatively, the trans-splicing molecule can be delivered using a non-AAV vector, such as a non-viral vector. Any suitable non-viral vector technology known in the art or described herein can be used. Such non-viral vectors suitable for delivery of the trans-splicing molecule include liposomes (e.g., cationic liposomes, unilamellar liposomes, or multilamellar liposomes), nanoparticles (e.g., polymeric nanoparticles, lipid nanoparticles (LNP), PEGylated nanoparticles (e.g., PEGylated LNP), peptide nanoparticles, metal nanoparticles, etc.), dendrimers (e.g., cationic dendrimers, e.g., polypropyleneimine dendrimers), exosomes (e.g., immunologically inert and / or targeted exosomes, e.g., those prepared using the techniques described in Alvarez-Erviti, et al., 2011, Nat. Biotechnol. 29:341), and microparticles. In some cases, the trans-splicing molecules described herein can be delivered using a cell-penetrating peptide (CPP), which can translocate across the plasma membrane of the target cell and facilitate delivery of the trans-splicing molecule into the interior of the target cell.

[0236] IV. Pharmaceutical Compositions and Provided herein is a pharmaceutical composition comprising an rAAV comprising a nucleic acid trans-splicing molecule, a proviral plasmid, or any of the ABCA4 nucleic acid trans-splicing molecules described herein. In some embodiments, the pharmaceutical composition comprises any of the 5' trans-splicing molecules described herein. In some embodiments, the pharmaceutical composition comprises a 5' trans-splicing molecule and a 3' trans-splicing molecule, e.g., the 5' trans-splicing molecule and the 3' trans-splicing molecule together contain a functional sequence of an ABCA4 exon and bind to the same target ABCA4 intron (e.g., intron 22).

[0237] Such pharmaceutical compositions can be prepared to be free of contamination and suitable for in vivo administration. The pharmaceutical compositions described herein can be evaluated for contamination by conventional methods and then formulated into pharmaceutical compositions intended for a suitable route of administration. Still other compositions containing trans-splicing molecules, such as naked DNA, can be similarly formulated using a suitable carrier. Such formulation involves the use of a pharmaceutically acceptable and / or physiologically acceptable vehicle or carrier, particularly for the purpose of administration to target cells (e.g., ocular cells). In one embodiment, carriers suitable for administration to target cells include buffered saline, isotonic sodium chloride solution, or other buffers, such as HEPES to maintain the pH at an appropriate physiological level, and optionally, other agents, pharmaceutical agents, stabilizers, buffers, carriers, adjuvants, diluents.

[0238] In some embodiments, the carrier is liquid for administration. Exemplary physiologically acceptable carriers include sterile pyrogen-free water and sterile pyrogen-free phosphate buffered saline. A variety of such well-known carriers are provided in U.S. Patent No. 7,629,322, which is incorporated herein by reference. In one embodiment, the carrier is isotonic sodium chloride solution. In another embodiment, the carrier is a balanced salt solution. In one embodiment, the carrier contains tween. When the virus is stored long term, it can be frozen in the presence of glycerol or TWEEN20.

[0239] In other embodiments, the compositions containing the trans-splicing molecules described herein include a surfactant. Useful surfactants can include, for example, Pluronic F68 (poloxamer 188, also known as LUTROL® F68). This is to prevent the attachment of AAV to an inert surface and thus ensure delivery of the desired dose. As an example, one exemplary composition designed for the treatment of an eye disease described herein comprises a recombinant adeno-associated vector carrying a nucleic acid sequence encoding a 5' trans-splicing molecule or a 3' trans-splicing molecule described herein under the control of a regulatory sequence that expresses the trans-splicing molecule in the eye cells of a mammalian subject, and a pharmaceutically acceptable carrier. The carrier is an isotonic sodium chloride solution and contains the surfactant Pluronic F68. In one embodiment, the trans-splicing molecule is any of those described herein.

[0240] In yet another exemplary embodiment, the composition comprises an rAAV virus containing any of the ABCA4 trans-splicing molecules described herein for ABCA4 gene correction, the nucleic acid sequence is under the control of a promoter that directs the expression of the trans-splicing molecule in photoreceptor cells, and the composition is formulated with a carrier suitable for subretinal injection and additional components. In yet another embodiment, a composition or a component for the production or assembly of this composition, including a carrier, rAAV particles, a surfactant, and / or components for generating rAAV, as well as suitable laboratory hardware for preparing the composition, can be incorporated into a kit. Such a kit can further include instructions for administering the composition to a subject as a therapeutic agent for an eye disease, such as Stargardt disease or Usher syndrome.

[0241] Also provided herein is a kit comprising a pharmaceutical composition containing a 5' trans-splicing molecule (e.g., the trans-splicing molecule is packaged in any of the AAV vectors described herein). In some embodiments, the kit includes instructions for mixing the pharmaceutical composition prior to administration.

[0242] V. Methods and Uses Patients with ABCA4 - related retinopathies present similar but not identical clinical features. The majority have lipofuscin accumulation and bilateral vision loss. ABCA4 - related Stargardt disease typically shows characteristic macular atrophy and often a metallic - like reflex on funduscopic examination. The foveal fundus is similar but has less macular atrophy and more yellow - white spots in the macula, which extend into the central - peripheral region. Subjects with ABCA4 - related cone - rod dystrophy exhibit visual symptoms such as vision loss, color vision impairment, and central scotomas.

[0243] The clinical symptoms of ABCA4 - related Stargardt disease can be classified into childhood onset, early - adult onset, and late - adult onset. Each of these groups may have unique variations in the phenotype that correlate with specific ABCA4 variants.

[0244] Childhood onset: Children with bi - allelic severe ABCA4 variants typically show more aggressive central vision loss, usually between 5 and 11 years of age, due to either macular dysfunction alone or in combination with cone - rod dystrophy.

[0245] Early - adult onset: These patients usually present with central vision loss due to foveal atrophy in their 20s or 30s. At presentation, funduscopic examination usually shows significant macular atrophy with numerous para - macular and peripheral spots. These patients often carry ABCA4 variants that moderately affect ABCA4 function (e.g., c.6079C>T and c.[2588G>C;5603A>T]) as either both alleles or a compound - heterozygous combination with null / severe ABCA4 variants.

[0246] Adult-onset: The definition of "late-onset" diseases varies from those over 35 years old to those over 50 years old. Therefore, patients can develop the disease in their 40s. Since the best-corrected visual acuity (BCVA), which can be explained by atrophy that preserves the fovea, is relatively well maintained, it is often incidentally identified by retinal screening.

[0247] Most cases of ABCA4-related retinopathy are diagnosed / symptomatic by the age of 20, which can have a significant impact on development, independence, education, and overall quality of life. Furthermore, some of the more severe forms, such as cone-rod dystrophy, develop in childhood at around 5 years of age. In one study of 95 patients with Stargardt disease, it was found that when visual acuity (VA) was below 20 / 40, visual loss progressed rapidly to 20 / 200. Additionally, the probability of maintaining VA of 20 / 40 or better in at least one eye was 52% at 19 years of age but decreased to 22% at 39 years of age. Earlier-onset and more severe cone-rod dystrophy, as well as Stargardt disease that develops in childhood, are generally associated with biallelic null variants of ABCA4. These childhood / early-onset types show symptomatic central scotomas and rapidly progressing atrophy, and most pediatric patients show involvement of rod photoreceptors at the time of diagnosis, which is an indicator of poor prognosis. Another consideration is the development of amblyopia in younger patients with ABCA4 retinopathy. Amblyopia results from early defects in visual development and leads to visual impairment, reduced stereopsis, and fusion disorders that are understood to be permanent if not corrected during the critical period of 7 to 9 years old. There are also some studies indicating that there is some potential for neuroplasticity in adolescence. Thus, the inventors expect higher efficacy in pediatric subjects treated with the ABCA4 exon editor described herein for retinopathy before they reach the critical period.

[0248] The above-described nucleic acid trans-splicing molecules (e.g., nucleic acid trans-splicing molecules and nucleic acid trans-splicing molecule-encoding vectors) and compositions are useful for expressing functional ABCA4 and / or regulating the expression of ABCA4 in target cells (e.g., ocular cells, retinal cells, photoreceptors, and / or RPE cells) of an individual in a method for treating a disease or disorder associated with a mutation in the ABCA4 gene, such as a disease or disorder associated with a mutation in the ABCA4 gene, including, for example, delaying or ameliorating symptoms associated with the diseases described herein, such as ABCA4-related retinal dystrophy, such as Stargardt disease and cone-rod dystrophy. The above-described nucleic acid trans-splicing molecules (e.g., nucleic acid trans-splicing molecules and nucleic acid trans-splicing molecule-encoding vectors) and compositions are further useful for expressing functional ABCA4 and / or regulating the expression of ABCA4 in target cells (e.g., ocular cells, retinal cells, photoreceptors, and / or RPE cells) of an individual, which is applicable to use for treating a disease or disorder associated with a mutation in the ABCA4 gene, including, for example, delaying or ameliorating symptoms associated with the diseases described herein, such as ABCA4-related retinal dystrophy, such as Stargardt disease and cone-rod dystrophy, or it is applicable for preparing an agent for treating a disease or disorder associated with a mutation in the ABCA4 gene, including, for example, delaying or ameliorating symptoms associated with the diseases described herein, such as ABCA4-related retinal dystrophy, such as Stargardt disease and cone-rod dystrophy. Such methods and uses involve contacting a target ABCA4 gene (e.g., ABCA4 pre-mRNA) with a trans-splicing molecule described herein [e.g., a 5' trans-splicing molecule described herein, or a mixture of both 3' and 5' splicing molecules, a composition containing the same (e.g., a pharmaceutical composition), or an agent containing the same] under conditions such that the CDS of the trans-splicing molecule is spliced to the target ABCA4 pre-mRNA and a portion of the target pre-mRNA having one or more deletions or mutations is replaced with a functional (i.e., healthy) or normal or wild-type or corrected mRNA of the target gene to correct the expression of ABCA4 in the target cells.Accordingly, the methods and compositions are used to treat eye diseases / lesions associated with specific mutations and / or gene expression.

[0249] In some cases, provided herein is a method of expressing functional ABCA4 in a target cell by contacting the target cell with any one of the nucleic acid trans-splicing molecules, vectors (e.g., AAV vectors), or compositions described herein (e.g., transducing). In one embodiment, contacting includes directly administering a composition (e.g., a pharmaceutical composition) to an affected individual. In another embodiment, contacting can be performed ex vivo using cultured cells and treated eye cells re-transplanted into an individual. In another embodiment, the method involves administering an rAAV having any one of the 5' ABCA4 trans-splicing molecules described herein. In yet another embodiment, the method involves administering a mixture of an rAAV carrying a 3' trans-splicing molecule and an rAAV carrying a 5' trans-splicing molecule. These methods include administering any of the compositions described herein to an individual in need thereof at an effective concentration.

[0250] In some embodiments, the method includes selecting one or more trans-splicing molecules for treating an individual having a disorder associated with a mutation(s) in ABCA4. In some embodiments, the use of one or more trans-splicing molecules for treating an individual having a disorder associated with a mutation(s) in ABCA4, or the use thereof in the preparation of a medicament for treating an individual having a disorder associated with a mutation(s) in ABCA4, is encompassed herein. Such methods and uses involve selecting one or more trans-splicing molecules for treating an individual having a disorder associated with a mutation in ABCA4, or using such selected one or more trans-splicing molecules for treating an individual having a disorder associated with a mutation in ABCA4, or using such selected one or more trans-splicing molecules in the preparation of a medicament for treating an individual having a disorder associated with a mutation(s) in ABCA4. Such selection can be based on the genotype of the individual. In some embodiments, the disorder associated with ABCA4 can be an autosomal recessive disorder. In some cases, the individual is homozygous or compound heterozygous for the mutation(s) in ABCA4. Methods for screening and identifying specific mutations in ABCA4 are well known in the art.

[0251] The method of the invention includes selecting a single trans-splicing molecule based on the location of a single mutation (e.g., a mutation in one allele of the individual) in ABCA4. In some cases, in the context of an autosomal recessive mutation, correcting only one of the two mutations may be sufficient to restore the activity of the functional protein, for example, if the second allele has a mutation in the opposite part of the ABCA4 gene, it is outside the scope of a single AAV-delivered trans-splicing molecule configured to correct the first mutation. Thus, in some embodiments, the method of the invention includes administering a single trans-splicing molecule, for example, to correct a single mutation on the 5' portion of the target gene, regardless of the location of mutations in other alleles.

[0252] Furthermore, the present invention involves selecting a single trans-splicing molecule for correcting two or more mutations on the 5' portion of the ABCA4 gene, whereby a single trans-splicing molecule capable of being packaged into an AAV vector can span both or all of the mutations and thereby correct both or all of the mutations.

[0253] In other embodiments, provided herein is a method for correcting multiple mutations within the ABCA4 gene using two trans-splicing molecules, namely a 5' trans-splicing molecule and a 3' trans-splicing molecule. In some embodiments, the entire ABCA4 gene is replaced upon binding and trans-splicing of both trans-splicing molecules, and the 5' trans-splicing molecule and the 3' trans-splicing molecule bind to the same target ABCA4 intron and replace the exons upstream and downstream of the target intron(s), respectively.

[0254] In some embodiments, the compositions provided herein are administered to an individual as a method of treating a disease or disorder. In some embodiments, the individual has a genetic disease such as an ABCA4-related retinopathy described herein. In some embodiments, the individual is at risk of having a genetic disease such as an ABCA4-related retinopathy described herein. In some embodiments, the individual is at high risk of having a disease or disorder resulting from an insufficient amount of a protein (e.g., an ABCA protein) or an insufficient activity of a protein (e.g., an ABCA protein). When an individual is "at high risk" of having a disease or disorder resulting from an insufficient amount of a protein or an insufficient activity of a protein, the method includes preventative or prophylactic treatment. For example, an individual may be at high risk of having such a disease or disorder due to a family history of the disease. Typically, individuals at high risk of having such a disease or disorder benefit from preventative treatment (e.g., by preventing or delaying the onset or progression of the disease or disorder).

[0255] The effective concentration of the recombinant adeno-associated virus having the trans-splicing molecule described in this specification is about 10 8 ~10 13 vector genomes (vg / mL). The rAAV infectious units are measured as described in McLaughlin et al., J. Virol. 1988, 62:1963. In another embodiment, the concentration is 10 9 ~10 13 vg / mL. In another embodiment, the effective concentration is about 1.5×10 11 vg / mL. In another embodiment, the effective concentration is about 5×10 11 vg / mL. In one embodiment, the effective concentration is about 1.5×10 10 vg / mL. In another embodiment, the effective concentration is about 2.8×10 11 vg / mL. In yet another embodiment, the effective concentration is about 1.5×1012 vg / mL. In another embodiment, the effective concentration is about 1.5×10 13 vg / mL.

[0256] In some embodiments, the concentration is 4.0×10 10 ~1×10 12 vg / eye. In some embodiments, the effective concentration is about 1.0×10 11 vg / eye. In some embodiments, the effective concentration is about 4.3×10 10 vg / eye.

[0257] To reduce undesirable effects such as toxicity and other problems associated with administration to the eye, such as the risk of retinal dysplasia and detachment, it is desirable that the minimum effective dose (total genome copies delivered) of the virus be utilized. The effective dose of the recombinant adeno-associated virus having the trans-splicing molecule described in this specification is about 10 8 ~10 13 vector genomes (vg) per dose (i.e., per injection). In one embodiment, the dose is 10 9 ~1013 It is in the range of vg. In another embodiment, the effective dose is about 1.5×10 11 vg. In another embodiment, the effective dose is about 5×10 11 vg. In one embodiment, the effective dose is about 1.5×10 10 vg. In another embodiment, the effective dose is about 2.8×10 11 vg. In yet another embodiment, the effective dose is about 1.5×10 12 vg. In another embodiment, the effective concentration is about 1.5×10 13 vg. These ranges or other doses in other units can be selected by the attending physician considering the age of the individual, the composition being administered, and the particular disorder; the physical condition of the individual being treated, including the size of the area being treated, the viral titer used, the route of administration, and the effect of the desired method.

[0258] The composition is delivered in a volume of about 50 μL to about 1 mL (including all numbers within the range), depending on the size of the area being treated, the viral titer used, the route of administration, and the effect of the desired method. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 70 μL. In another embodiment, the volume is 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is 200 μL. In another embodiment, the volume is about 250 μL. In another embodiment, the volume is about 300 μL. In another embodiment, the volume is about 350 μL. In another embodiment, the volume is about 400 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 750 μL. In another embodiment, the volume is about 850 μL. In another embodiment, the volume is about 1,000 μL.

[0259] In some embodiments, a composition comprising an RNA exon editor described herein (e.g., an RNA exon editor comprising SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) can be provided as a suspension suitable for injection. In some embodiments, an RNA exon editor described herein (e.g., an RNA exon editor comprising SEQ ID NO: 90, SEQ ID NO: 78, or SEQ ID NO: 69) can be administered by subretinal injection following pars plana vitrectomy in a 300 μL volume via a small gauge cannula.

[0260] In one embodiment, the volume and concentration of the rAAV composition are selected such that only a specific anatomical region having the target cells is affected. In another embodiment, the volume and / or concentration of the rAAV composition is a greater amount in order to reach a larger portion of the eye. Similarly, the dosage is adjusted for administration to other organs.

[0261] In some embodiments, the treatments and uses described herein replace 10% or more of the target ABCA4 mRNA in the target cells (e.g., 11% or more of the target ABCA4 mRNA in the target cell(s), 12% or more of the target ABCA4 mRNA in the target cell(s), 13% or more of the target ABCA4 mRNA in the target cell(s), 14% or more of the target ABCA4 mRNA in the target cell(s), 15% or more of the target ABCA4 mRNA in the target cell(s), 16% or more of the target ABCA4 mRNA in the target cell(s), 17% or more of the target ABCA4 mRNA in the target cell(s), 18% or more of the target ABCA4 mRNA in the target cell(s), or 19% or more of the target ABCA4 mRNA in the target cell(s)). In some embodiments, the treatments and uses described herein replace 20% or more of the target ABCA4 mRNA in the target cells [e.g., 21% or more of the target ABCA4 mRNA in the target cell(s), 22% or more of the target ABCA4 mRNA in the target cell(s), 23% or more of the target ABCA4 mRNA in the target cell(s), 24% or more of the target ABCA4 mRNA in the target cell(s), 25% or more of the target ABCA4 mRNA in the target cell(s), 26% or more of the target ABCA4 mRNA in the target cell(s), 27% or more of the target ABCA4 mRNA in the target cell(s), 28% or more of the target ABCA4 mRNA in the target cell(s), 29% or more of the target ABCA4 mRNA in the target cell(s), 30% or more of the target ABCA4 mRNA in the target cell(s), 31% or more of the target ABCA4 mRNA in the target cell(s), 32% or more of the target ABCA4 mRNA in the target cell(s), 33% or more of the target ABCA4 mRNA in the target cell(s), 34% or more of the target ABCA4 mRNA in the target cell(s), 35% or more of the target ABCA4 mRNA in the target cell(s), 36% or more of the target ABCA4 mRNA in the target cell(s), 37% or more of the target ABCA4 mRNA in the target cell(s), 38% or more of the target ABCA4 mRNA in the target cell(s), 39% or more of the target ABCA4 mRNA in the target cell(s), the target ABCA4 mRNA in the target cell(s)More than 40% of the mRNA, more than 41% of the target ABCA4 mRNA in the target cell(s), more than 42% of the target ABCA4 mRNA in the target cell(s), more than 43% of the target ABCA4 mRNA in the target cell(s), more than 44% of the target ABCA4 mRNA in the target cell(s), more than 45% of the target ABCA4 mRNA in the target cell(s), more than 46% of the target ABCA4 mRNA in the target cell(s), more than 47% of the target ABCA4 mRNA in the target cell(s), more than 48% of the target ABCA4 mRNA in the target cell(s), more than 49% of the target ABCA4 mRNA in the target cell(s), more than 50% of the target ABCA4 mRNA in the target cell(s), more than 51% of the target ABCA4 mRNA in the target cell(s), more than 52% of the target ABCA4 mRNA in the target cell(s), more than 53% of the target ABCA4 mRNA in the target cell(s), more than 54% of the target ABCA4 mRNA in the target cell(s), more than 55% of the target ABCA4 mRNA in the target cell(s), more than 56% of the target ABCA4 mRNA in the target cell(s), more than 57% of the target ABCA4 mRNA in the target cell(s), more than 58% of the target ABCA4 mRNA in the target cell(s), more than 59% of the target ABCA4 mRNA in the target cell(s), more than 60% of the target ABCA4 mRNA in the target cell(s), more than 61% of the target ABCA4 mRNA in the target cell(s), more than 62% of the target ABCA4 mRNA in the target cell(s), more than 63% of the target ABCA4 mRNA in the target cell(s), more than 64% of the target ABCA4 mRNA in the target cell(s), more than 65% of the target ABCA4 mRNA in the target cell(s), more than 66% of the target ABCA4 mRNA in the target cell(s), more than 67% of the target ABCA4 mRNA in the target cell(s), more than 68% of the target ABCA4 mRNA in the target cell(s), more than 69% of the target ABCA4 mRNA in the target cell(s), more than 70% of the target ABCA4 mRNA in the target cell(s), more than 75% of the target ABCA4 mRNA in the target cell(s), more than 80% of the target ABCA4 mRNA in the target cell(s), the target ABCA4 mRNA in the target cell(s)85% or more of the mRNA, 90% or more of the target ABCA4 mRNA in the target cell(s), 95% or more of the target ABCA4 mRNA in the target cell(s).

[0262] In some embodiments, the treatments and uses described herein replace 5% or more, such as 11% or more, 12% or more, 13% or more, 14% or more, 15% or more, 16% or more, 17% or more, 18% or more, 19% or more of the target ABCA4 protein in the target cells, of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s). In some embodiments, the treatments and uses described herein replace 20% or more, such as 21% or more, 22% or more, 23% or more, 24% or more, 25% or more, 26% or more, 27% or more, 28% or more, 29% or more, 30% or more, 31% or more, 32% or more, 33% or more, 34% or more, 35% or more, 36% or more, 37% or more, 38% or more, 39% or more, 40% or more of the target ABCA4 protein in the target cells, of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target ABCA4 protein in the target cell(s), of the target41% or more of the target ABCA4 protein in the target cell(s), 42% or more of the target ABCA4 protein in the target cell(s), 43% or more of the target ABCA4 protein in the target cell(s), 44% or more of the target ABCA4 protein in the target cell(s), 45% or more of the target ABCA4 protein in the target cell(s), 46% or more of the target ABCA4 protein in the target cell(s), 47% or more of the target ABCA4 protein in the target cell(s), 48% or more of the target ABCA4 protein in the target cell(s), 49% or more of the target ABCA4 protein in the target cell(s), 50% or more of the target ABCA4 protein in the target cell(s), 51% or more of the target ABCA4 protein in the target cell(s), 52% or more of the target ABCA4 protein in the target cell(s), 53% or more of the target ABCA4 protein in the target cell(s), 54% or more of the target ABCA4 protein in the target cell(s), 55% or more of the target ABCA4 protein in the target cell(s), 56% or more of the target ABCA4 protein in the target cell(s), 57% or more of the target ABCA4 protein in the target cell(s), 58% or more of the target ABCA4 protein in the target cell(s), 59% or more of the target ABCA4 protein in the target cell(s), 60% or more of the target ABCA4 protein in the target cell(s), 61% or more of the target ABCA4 protein in the target cell(s), 62% or more of the target ABCA4 protein in the target cell(s), 63% or more of the target ABCA4 protein in the target cell(s), 64% or more of the target ABCA4 protein in the target cell(s), 65% or more of the target ABCA4 protein in the target cell(s), 66% or more of the target ABCA4 protein in the target cell(s), 67% or more of the target ABCA4 protein in the target cell(s), 68% or more of the target ABCA4 protein in the target cell(s), 69% or more of the target ABCA4 protein in the target cell(s), 70% or more of the target ABCA4 protein in the target cell(s), 75% or more of the target ABCA4 protein in the target cell(s), 80% or more of the target ABCA4 protein in the target cell(s), 85% or more of the target ABCA4 protein in the target cell(s),90% or more of the target ABCA4 protein in the target cell(s), 95% or more of the target ABCA4 protein in the target cell(s).

[0263] When an increase in the functional ABCA4 protein level is mentioned, this increase can be clinically significant. This increase may be relative to the level of the functional ABCA4 protein in untreated subjects, or it may be relative to the amount of the functional ABCA4 protein in a similar population of subjects. This increase can be at least a 10% increase in the functional ABCA4 protein compared to the subject before treatment or a similar population of subjects. This increase can be at least a 20% increase in the functional ABCA4 protein compared to the subject before treatment or a similar population of subjects. This increase can be at least a 40% increase in the functional ABCA4 protein compared to the subject before treatment or a similar population of subjects. This increase can be at least a 50% increase in the functional ABCA4 protein compared to the subject before treatment or a similar population of subjects. This increase can be at least an 80% increase in the functional ABCA4 protein compared to the subject before treatment or a similar population of subjects. This increase can be at least a 100% increase in the functional ABCA4 protein compared to the subject before treatment or a similar population of subjects. This increase can be at least a 200% increase in the functional ABCA4 protein compared to the subject before treatment or a similar population of subjects. This increase can be at least a 500% increase in the functional ABCA4 protein compared to the subject before treatment or a similar population of subjects.

[0264] In some cases, the methods and uses described herein decrease BCA4-related lipofuscin in a subject (e.g., a subject having an ABCA4-related retinal dystrophy). In other cases, the methods and uses described herein decrease the accumulation of A2E in a subject (e.g., a subject having an ABCA4-related retinal dystrophy).

[0265] For each of the methods and uses described, the treatment or use can be employed to prevent the occurrence of further damage or to salvage tissue having a mild, moderate, or advanced disease. As used herein, the term "salvage" means preventing the progression of the disease, preventing the spread of damage to undamaged cells, and / or ameliorating the damage in damaged cells.

[0266] Thus, in one embodiment, the composition is administered prior to the onset of the disease. In another embodiment, the composition is administered prior to the onset of symptoms. In another embodiment, the composition is administered after the onset of symptoms. In yet another embodiment, the composition is administered when, for example, less than 90% of the target cells are functioning or remaining as compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 10% of the target cells are functioning or remaining as compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 20% of the target cells are functioning or remaining as compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 30% of the target cells are functioning or remaining as compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 40% of the target cells are functioning or remaining as compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 50% of the target cells are functioning or remaining as compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 60% of the target cells are functioning or remaining as compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 70% of the target cells are functioning or remaining as compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 80% of the target cells are functioning or remaining as compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 90% of the target cells are functioning or remaining as compared to a reference tissue. In yet another embodiment, the composition is administered when, for example, more than 95% of the target cells are functioning or remaining as compared to a reference tissue.

[0267] In yet another embodiment, any of the above methods or uses is carried out in combination with another therapy or secondary therapy. The therapy can be any currently known or yet-to-be-known therapy that helps to prevent, arrest, or ameliorate any of these mutations or deficiencies, or the effects associated therewith. The secondary therapy can be administered before, concurrently with, or after the administration of the above pharmaceutical composition. In one embodiment, the secondary therapy includes a non-specific approach for maintaining the health of retinal cells, such as the administration of neurotrophic factors, antioxidants, and / or anti-apoptotic agents. The non-specific approach is achieved through the injection of proteins, recombinant DNA, recombinant viral vectors, stem cells, fetal tissue, or genetically modified cells. The latter may include encapsulated genetically modified cells.

[0268] In another embodiment, the method includes performing functional tests and imaging tests to determine the effectiveness of the treatment. These tests include ERG and in vivo retinal imaging as described in U.S. Patent No. 8,147,823; International Patent Publication Nos. WO2014 / 011210 or WO2014 / 124282 (incorporated herein by reference). Additionally, visual field testing, perimetry (e.g., kinetic perimetry or full field static perimetry) and microperimetry, slit lamp examination, intraocular pressure measurement, dilated fundus ophthalmoscopy, motility testing, visual acuity, and / or color vision testing can be performed. The effectiveness is measured at a time point after the administration of the nucleic acid trans-splicing molecule and the RNA exon editor encoded thereby, or a composition (e.g., a pharmaceutical composition) containing the same described herein, to determine whether the symptoms of ABCA4-related retinopathy have decreased, for example, in a treated subject compared to an untreated subject. In some embodiments, the effectiveness can be measured, for example, by an improvement in visual acuity and / or color vision, or a decrease in lipofuscin including A2E accumulation.

[0269] In certain embodiments, it is desirable to perform non-invasive retinal imaging and functional testing to identify the regions of retained photoreceptors that are targets for treatment. In these embodiments, clinical diagnostic tests are used to determine the precise location(s) of one or more subretinal injection(s). These tests may include electroretinogram (ERG), perimetry, topographic mapping of retinal layers, and measurement of the thickness of those layers using confocal scanning laser ophthalmoscopy (cSLO) and optical coherence tomography (OCT), topographic mapping of cone density by adaptive optics (AO), and tests of eye function. In view of the imaging and functional testing, in some embodiments, more than one injection is performed in the same eye to target different regions of retained photoreceptors.

[0270] When used in these methods, the volume and viral titer of each injection are determined individually and may be the same as or different from other injections performed in the same or opposite eye. In another embodiment, a single, larger volume injection is performed to treat the entire eye. The dosage, administration, and regimen can be determined by the attending physician, taking into account the teachings of the present disclosure.

[0271] The following examples are not intended to limit the scope of the embodiments described herein. Those skilled in the art will understand that modifications can be made to the following examples that are intended to be encompassed by the spirit and scope of the present invention.

Example

[0272] The following examples provide non-limiting methods for generating the above compositions and for using the above compositions.

[0273] Example 1. Trans-splicing Efficiency in Cultured Human Cells ABCA4 trans-splicing molecules were tested in cultured human cells using a high-throughput NGS-based assay that tests various permutations in each trans-splicing molecule. The results are shown in Figure 1. Each ABCA4 trans-splicing molecule in this example included a 5' regulatory domain that included the CMV promoter and native 5' UTR, as well as the functional ABCA4 CDS. Domains that differed between trans-splicing molecules were the linker domain, binding domain (BD), 3'DS, and terminator. In this example, trans-splicing molecules were transfected into cells as plasmids and detected by unique molecular identifiers (UMIs) according to a known RNA-seq method. The lead-out of trans-splicing efficiency indicates that certain domains showed improved trans-splicing over many or all permutations. For example, here the 40-mer linker of SEQ ID NO: 27 unexpectedly showed the highest trans-splicing efficiency compared to shorter linkers of SEQ ID NOs: 29 and 31. Also, the binding domain having SEQ ID NO: 18 exhibited the highest trans-splicing efficiency among all binding domains tested. It should also be noted that certain combinations of linker domain, BD, and splice site (SS) resulted in surprisingly high levels of relative trans-splicing efficiency.

[0274] Example 2. Evaluation of Splice Sites The splice sites were tested using next-generation sequencing across a library of ABCA4 nucleic acid trans-splicing molecules having a total of 550 linker sequences. The five splice sites tested were CAAAGT, GTAACT, GTAAGC, GTAAGG, and GTAAGT. The RNA sequences encoded thereby are referred to herein as GUAAGU, GUAAGG, GUAAGC, and GUAACU, respectively. Figure 2 shows the trans-splicing activity (exon editing activity) in any unit. These results indicate that the splice site containing GTAAGT resulted in the highest trans-splicing activity among the five splice sites tested. Thus, the exemplary splicing domain described herein includes GUAAGT encoded by GTAAGT.

[0275] Example 3. ABCA4 Trans-Splicing in Cultured Human Cells Cultured human cells (HEK-293T) cells were transduced with various AAVs encoding ABCA4 trans-splicing molecules (RNA exon editors) at an MOI = 100,000 and incubated for 3 days, after which the cells were harvested. AAV-56 is an AAV vector encoding an ABCA4 trans-splicing molecule having SEQ ID NO: 40. AAV-274 is an AAV vector encoding an ABCA4 trans-splicing molecule having SEQ ID NO: 41. AAV-443 is an AAV vector encoding an ABCA4 trans-splicing molecule having SEQ ID NO: 42. AAV-497 is an AAV vector encoding an ABCA4 trans-splicing molecule having SEQ ID NO: 43. AAV-505 is an AAV vector encoding an ABCA4 trans-splicing molecule having SEQ ID NO: 44.

[0276] Membrane protein extraction was performed using conventional methods. Briefly, permeabilization buffer and protease / phosphatase inhibitors were added to the cells, vortexed, and incubated at 4 °C for 10 minutes. The permeabilized cells were centrifuged and the pellet was resuspended in solubilization buffer containing protease / phosphatase inhibitors. The samples were incubated at 4 °C for 30 minutes and then centrifuged. The supernatant containing the membrane proteins was transferred and stored at -80 °C.

[0277] RNA was extracted by conventional methods and quantified by RT-qPCR. The percentage of on-target ABCA4 trans-splicing was normalized against the copy number of the trans-splicing molecules. The RNA results showing the percentage of ABCA4 mRNA replaced by each trans-splicing molecule (exon editing) are shown in Figure 3A. A Western blot is shown in Figure 3B, using an anti-ABCA4 C-terminal antibody and an anti-NaK / ATPase antibody for loading control.

[0278] AAV-274, AAV-443, AAV-497, and AAV-505 each showed improved trans-splicing efficiency compared to AAV-56 (37.3%, 38.7%, 28.5%, and 28.5% respectively, compared to 23.8% for AAV-56). AAV-274 and AAV-443 each showed significantly higher on-target copy numbers compared to AAV-56.

[0279] A similar assay was performed using ABCA4 knock-in cells as a positive control and untreated HEK293T cells as a negative control to compare the trans-splicing efficiency between AAV-443-2 (SEQ ID NO: 45) and AAV-652 (SEQ ID NO: 46). Figure 3C shows a Western blot indicating protein expression in each replication of AAV-443-2 and AAV-652. The results are shown as fold change in Figure 3D. Notably, a complete recovery of ABCA4 protein levels was observed in ABCA4 knockout cells (Figure 3D).

[0280] Example 4. Evaluation of ABCA4 Trans-splicing Molecules in Non-Human Primates Recessive genetic mutations in ABCA4 are the cause of the onset of progressive blindness, including Stargardt disease 1 and cone-rod dystrophy 3. The 6882 bp coding sequence of ABCA4 is too large to be delivered in its entirety by a single AAV vector. Furthermore, as hundreds of mutations causing disease are found throughout the gene, a single base editing approach will not be able to address many patients. A large-scale exon editing solution was designed to deliver a therapeutic RNA construct capable of trans-splicing to endogenous ABCA4 pre-mRNA, thereby introducing a functional exon that corrects the innumerable mutations localized to the functional exon delivered by trans-splicing. In fact, RNA trans-splicing using a single AAV-based construct can address approximately 60% of the mutations in all patients. This example reports the editing efficiency and tolerability of an AAV-ABCA4 exon editor in vivo after subretinal injection in healthy African green monkey (AGM) non-human primates (NHPs).

[0281] Exon editors 443 (SEQ ID NO: 47), 274 (SEQ ID NO: 48), 497 (SEQ ID NO: 49), and 505 (SEQ ID NO: 50) were packaged into AAV8 vectors. AAV8 vector preparations were titrated using qPCR of common regulatory elements, and characterized by measuring total and empty capsids with a stanner, and measuring endotoxin levels. The results are shown in Table 2 below. [Table 2]

[0282] VP1, VP2, and VP3 proteins for each preparation were detected and visualized on an SDS gel run at 5×10 vg / well (Figure 4).

[0283] The GFP-encoding AAV vector containing the 5’ regulatory domain of accession number 15 (i.e., containing the CMV promoter and the native 5’ ABCA4 untranslated region) was subretinally administered to African green monkey (AGM) non-human primates (NHPs). The expression of GFP protein is shown in FIGS. 5A-5C. FIG. 5A is a live image showing the GFP protein. FIG. 5B is a micrograph showing anti-GFP immunohistochemistry (IHC) staining of a retinal section (photoreceptors and choroid are labeled) in the negative control on day 28. FIG. 5C is a micrograph showing anti-GFP IHC staining of a retinal section (photoreceptors and choroid are labeled) in an animal treated with the GFP exon editor on day 28. These results indicate that the 5’ regulatory domain results in robust protein expression in photoreceptors in vivo.

[0284] The ABCA4 exon editor was formulated as AAV8 and subretinally administered to AGM NHPs at 2 brebs per eye. Each injection was 100 μl containing 1×10 11 vg. The cSLO and OCT images at baseline, after subretinal injection, on days 14 and 28 are shown in FIG. 6. Superior and inferior blebs were observed after injection. A slight “shadow” of the bleb area was observed until day 28. On day 28, clinical scoring was performed using color fundus imaging of the vehicle, exon editor 443, and trans-splicing molecule 274 (FIG. 7). The total clinical scores of the vehicle, exon editor 443, and trans-splicing molecule 274 were 17, 0, and 1, respectively.

[0285] Exon editing by the ABCA4 exon editors was evaluated in the AGM NHP retina using quantitative RT-PCR to quantify RNA and Western blot to quantify the ABCA4 protein. To measure trans-spliced ABCA4 mRNA, quantitative RT-PCR was used to detect junctions in chimeric mRNA between the human and AGM sequences as shown in Figure 8A. For each ABCA4 exon editor, trans-spliced mRNA was quantified as edited copies per 10 ng of RNA (Figure 8B and Table 4).

Table 3

[0286] For each ABCA4 exon editor, tagged full-length trans-spliced ABCA4 protein was quantified by Western blot of the tag in membrane extracts from the retina. Exemplary Western blots showing full-length ABCA4 expression for exon editors 443, 274, 497, and 505 are shown in Figure 9.

[0287] To confirm that the expressed protein was chimeric human / AGM (and thus a trans-splicing product), mass spectrometry experiments were performed. Unique peptides that distinguish full-length AGM NHP ABCA4 from chimeric edited ABCA4 were identified by coupling immunoaffinity enrichment to MRM-MS. Peptide identity was confirmed by spiking with standards. In vehicle-treated retinas (Figure 10A), only NHP peptides were observed. In exon editor-treated retinas (Figure 10B), both human and NHP peptides were detected. This result confirms that full-length exon-edited mRNA was translated.

[0288] Throughout the trial, the health of the eyes was monitored. Generally, eye health was maintained after treatment with the AAV8 subretinal delivery exon editor as measured by retinal thickness (Figure 11A), intraocular pressure (Figure 11B), total clinical score (Figure 11C), vitreous cell score (Figure 11D), aqueous cell score (Figure 11E), and inflammatory keratotic particles (Figure 11F). Retinal thickness remained normal throughout the trial (Figure 11A). In intraocular pressure measurements, it was shown that intraocular pressure decreased on day 7 in vehicle-treated eyes and stabilized at subsequent time points (Figure 11B). In exon editor-treated eyes, intraocular pressure was maintained within the healthy range. Eye inflammation was evaluated by slit lamp microscopy and fundus examination (Figures 11C - 11F). Individual eyes treated with the exon editor showed some signs of mild to moderate inflammation, but these were not consistent for a particular editor or AAV preparation, suggesting that these observations were due to treatment in individual eyes.

[0289] All animals participating in the trial maintained good health. In measurements of body weight (Figure 12A) and heart rate (Figure 12B), no clinical signs indicating harmful systemic effects caused by administration of the exon editor were revealed. Daily cage-side observations were performed and food intake was monitored, but no changes were seen.

[0290] The trials described herein constitute the first report of trans-splicing in clinically relevant efficiency in the NHP...

Claims

**Claim 1** A nucleic acid trans-splicing molecule, comprising: (a) a coding domain sequence (CDS) containing an ABCA4 exon; (b) a linker domain containing the sequence of SEQ ID NO: 27 or a sequence having at least 85% identity to SEQ ID NO: 27; and (c) a binding domain that anneals to a binding site within the endogenous ABCA4 pre-mRNA, wherein the CDS, the linker domain, and the binding domain are operably linked in the 5' to 3' direction, said nucleic acid trans-splicing molecule. **Claim 2** A nucleic acid trans-splicing molecule, comprising: (a) a CDS comprising, consisting essentially of, or consisting of any one of the variants of SEQ ID NOs: 53 - 55, wherein any one of said variants of SEQ ID NOs: 53 - 55 contains at least one mutation at at least one potential splice site listed in Table 3, and said at least one nucleotide mutation reduces the use of the potential splice site at each of said at least one potential splice sites containing at least one nucleotide mutation, said CDS; (b) a linker domain; and (c) a binding domain that anneals to a binding site within the endogenous ABCA4 pre-mRNA, wherein the CDS, the linker domain, and the binding domain are operably linked in the 5' to 3' direction, said nucleic acid trans-splicing molecule. **Claim 3** The nucleic acid trans-splicing molecule according to claim 2, wherein said variant of SEQ ID NO: 55 contains any one of SEQ ID NOs: 56 - 59. **Claim 4** The nucleic acid trans-splicing molecule according to claim 3, wherein said variant of SEQ ID NO: 55 contains SEQ ID NO:

56. **Claim 5** The nucleic acid trans-splicing molecule according to any one of the preceding claims, wherein said linker domain contains a sequence having at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO:

27. **Claim 6** The nucleic acid trans-splicing molecule according to any one of the preceding claims, wherein the linker domain comprises, consists essentially of, or consists of SEQ ID NO:

27. **Claim 7** The nucleic acid trans-splicing molecule according to any one of the preceding claims, wherein the binding domain anneals to an intron of the endogenous ABCA4 pre-mRNA. **Claim 8** The nucleic acid trans-splicing molecule according to claim 7, wherein the intron of the endogenous ABCA4 pre-mRNA is intron 22. **Claim 9** The nucleic acid trans-splicing molecule according to any one of the preceding claims, wherein the binding domain comprises SEQ ID NO: 18 or SEQ ID NO:

20. **Claim 10** The nucleic acid trans-splicing molecule according to any one of the preceding claims, wherein the binding domain consists essentially of or consists of SEQ ID NO: 18 or SEQ ID NO:

20. **Claim 11** The nucleic acid trans-splicing molecule according to any one of the preceding claims, wherein the binding domain consists essentially of or consists of SEQ ID NO:

20. **Claim 12** The nucleic acid trans-splicing molecule according to any one of claims 1 or 5 to 11, wherein the CDS comprises ABCA4 exons 1 to 22 or a variant thereof. **Claim 13** The nucleic acid trans-splicing molecule according to claim 12, wherein the CDS comprises, consists essentially of, or consists of any one of SEQ ID NOs: 53 to 59. **Claim 14** A nucleic acid trans-splicing molecule, comprising: (a) a linker domain that comprises, consists essentially of, or consists of SEQ ID NO: 27 or a sequence having at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 27; (b) a binding domain that comprises, consists essentially of, or consists of SEQ ID NO: 18 or SEQ ID NO: 20; and (c) a CDS that comprises ABCA4 exons, wherein the CDS, the linker domain, and the binding domain are operably linked in the 5' to 3' direction. **Claim 15** The nucleic acid trans-splicing molecule according to claim 14, wherein the CDS comprises, consists essentially of, or consists of any one of SEQ ID NOs: 53 to 59.

16. A nucleic acid trans-splicing molecule, comprising: (a) a CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53 to 59; (b) a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27 or a sequence having at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to SEQ ID NO: 27; and (c) a binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 20, wherein the CDS, the linker domain, and the binding domain are operably linked in the 5' to 3' direction.

17. The nucleic acid trans-splicing molecule according to any one of the preceding claims, further comprising an enhancer comprising at least one sequence comprising GGTAAGT or SEQ ID NO:

61.

18. The nucleic acid trans-splicing molecule according to claim 17, wherein the enhancer is operably linked to the 3' side of the linker domain.

19. The nucleic acid trans-splicing molecule according to claim 17 or 18, wherein the enhancer comprises three sequences arranged in series and operably linked, and each of the three sequences comprises GGTAAGT or SEQ ID NO:

61.

20. The nucleic acid trans-splicing molecule according to any one of claims 17 to 19, wherein the enhancer comprises three sequences arranged in series, and the three sequences comprise SEQ ID NO:

62.

21. The nucleic acid trans-splicing molecule according to any one of the preceding claims, further comprising a translation enhancer, wherein the translation enhancer comprises SEQ ID NO: 63 or a sequence having at least 90% identity to SEQ ID NO: 63, and the sequence having at least 90% identity to SEQ ID NO: 63 or SEQ ID NO: 63 is operably linked to the 3' side of the enhancer.

22. The nucleic acid trans-splicing molecule according to claim 21, wherein the translation enhancer has at least 91% identity to SEQ ID NO: 63, at least 92% identity to SEQ ID NO: 63, at least 93% identity to SEQ ID NO: 63, at least 94% identity to SEQ ID NO: 63, at least 95% identity to SEQ ID NO: 63, at least 96% identity to SEQ ID NO: 63, at least 97% identity to SEQ ID NO: 63, at least 98% identity to SEQ ID NO: 63, or at least 99% identity to SEQ ID NO:

63.

23. The nucleic acid trans-splicing molecule according to any one of claims 21 or 22, wherein the translation enhancer comprises SEQ ID NO: 63, consists essentially of SEQ ID NO: 63, or consists of SEQ ID NO:

63.

24. The nucleic acid trans-splicing molecule according to any one of the preceding claims, further comprising a splicing domain comprising any one of GTAATGT, GTAATGG, GTAATGC, or GTAATCT.

25. The nucleic acid trans-splicing molecule according to any one of the preceding claims, further comprising a splicing domain comprising GTAATGT, consisting essentially of GTAATGT, or consisting of GTAATGT.

26. The nucleic acid trans-splicing molecule according to any one of the preceding claims, further comprising a 5' untranslated region.

27. The nucleic acid trans-splicing molecule according to claim 26, wherein the 5' untranslated region comprises SEQ ID NO: 13 or SEQ ID NO: 64, consists essentially of SEQ ID NO: 13 or SEQ ID NO: 64, or consists of SEQ ID NO: 13 or SEQ ID NO:

64.

28. The nucleic acid trans-splicing molecule according to any one of the preceding claims, further comprising a 3' transcription terminator domain.

29. The nucleic acid trans-splicing molecule according to claim 28, wherein the 3' transcription terminator domain encodes a ribonucleic acid that forms a triple helix structure that protects the 3' end of the trans-splicing molecule.

30. The nucleic acid trans-splicing molecule according to claim 28 or claim 29, wherein the 3' transcription terminator domain comprises the wild-type MALAT1 sequence (SEQ ID NO: 33) or a nucleic acid sequence having at least 80% identity to SEQ ID NO:

33.

31. The nucleic acid trans-splicing molecule according to claim 30, wherein the 3'-transcription terminator domain comprises a nucleic acid sequence having at least 80% identity with SEQ ID NO: 33, at least 85% identity with SEQ ID NO: 33, at least 90% identity with SEQ ID NO: 33, at least 91% identity with SEQ ID NO: 33, at least 92% identity with SEQ ID NO: 33, at least 93% identity with SEQ ID NO: 33, at least 94% identity with SEQ ID NO: 33, at least 95% identity with SEQ ID NO: 33, at least 96% identity with SEQ ID NO: 33, at least 97% identity with SEQ ID NO: 33, at least 98% identity with SEQ ID NO: 33, at least 99% identity with SEQ ID NO: 33, or 100% identity with SEQ ID NO:

33.

32. The nucleic acid trans-splicing molecule according to claim 28 or claim 29, wherein the 3'-transcription terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 33 or SEQ ID NO:

66.

33. The nucleic acid trans-splicing molecule according to any one of the preceding claims, further comprising at least one stop codon operably linked to the 3' side of the splicing domain.

34. Operably linked in the 5' to 3' direction: (a) a 5' untranslated region, (b) a CDS consisting essentially of or consisting of any one of SEQ ID NOs: 53 to 59, (c) a splicing domain, (d) at least one stop codon, (e) a linker domain consisting essentially of or consisting of SEQ ID NO: 27, (f) at least one enhancer, (g) a translation enhancer, (h) a binding domain consisting essentially of or consisting of SEQ ID NO: 18 or SEQ ID NO: 20, and (i) a 3'-transcription terminator domain, the nucleic acid trans-splicing molecule according to claim 33.

35. (a) the 5' untranslated region comprises, consists essentially of, or consists of SEQ ID NO: 13 or SEQ ID NO: 64, (b) the splicing domain comprises, consists essentially of, or consists of GTAAGT, (c) the at least one stop codon comprises, consists essentially of, or consists of two stop codons, and the first sequence of the two stop codons partially overlaps with the splicing domain sequence. (d) the at least one enhancer comprises, consists essentially of, or consists of three arrays arranged in series, each of the three arrays comprising GGTAAGT or SEQ ID NO: 61; (e) the translation enhancer comprises, consists essentially of, or consists of SEQ ID NO: 63; and (f) the 3' transcription terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 66, the nucleic acid trans-splicing molecule of claim 34.

36. A nucleic acid trans-splicing molecule, comprising: (a) a 5' untranslated region; (b) a CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53-59; (c) a splicing domain; (d) optionally, at least one stop codon; (e) a linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27; (f) at least one enhancer; (g) a translation enhancer; (h) a binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 18 or SEQ ID NO: 20; and (i) a 3' transcription terminator domain, wherein the 5' untranslated region, the CDS, the splicing domain, the at least one stop codon if present, the linker domain, the at least one enhancer, the translation enhancer, the binding domain, and the 3' transcription terminator domain are operably linked in the 5' to 3' direction, the nucleic acid trans-splicing molecule.

37. (a) the 5' untranslated region comprises, consists essentially of, or consists of SEQ ID NO: 13 or SEQ ID NO: 64; (b) the splicing domain comprises, consists essentially of, or consists of GTAAGT; (c) the at least one stop codon is present and comprises, consists essentially of, or consists of two stop codons, the first sequence of the two stop codons partially overlapping the splicing domain sequence; (d) the at least one enhancer comprises, consists essentially of, or consists of three arrays arranged in series, each of the three arrays comprising GGTAAGT or SEQ ID NO: 61; (e) the translation enhancer comprises, consists essentially of, or consists of SEQ ID NO: 63; and (f)The nucleic acid trans-splicing molecule according to claim 36, wherein the 3' transcription terminator domain comprises, consists essentially of, or consists of SEQ ID NO:

66.

38. Operably linked in the 5' to 3' direction: (a)A 5' untranslated region comprising, consisting essentially of, or consisting of SEQ ID NO: 13 or SEQ ID NO: 64, (b)A CDS comprising, consisting essentially of, or consisting of any one of SEQ ID NOs: 53 to 59, (c)A splicing domain comprising, consisting essentially of, or consisting of GTAATGT, (d)Two stop codons, wherein the first sequence of the two stop codons partially overlaps with the splicing domain sequence, and the sequence of the splicing domain in combination with the two stop codons comprises, consists essentially of, or consists of SEQ ID NO: 68, the two stop codons, (e)A linker domain comprising, consisting essentially of, or consisting of SEQ ID NO: 27, (f)An enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 62, (g)A translation enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 63, (h)A binding domain comprising, consisting essentially of, or consisting of SEQ ID NO: 18 or SEQ ID NO: 20, and (i)The nucleic acid trans-splicing molecule comprising a 3' transcription terminator domain comprising, consisting essentially of, or consisting of SEQ ID NO: 66

39. The nucleic acid trans-splicing molecule according to claim 37 or claim 38, wherein the nucleic acid trans-splicing molecule comprises, consists essentially of, or consists of SEQ ID NO: 69, SEQ ID NO: 78, or SEQ ID NO:

90.

40. The nucleic acid trans-splicing molecule according to any one of claims 1 to 20, wherein the nucleic acid trans-splicing molecule comprises, consists essentially of, or consists of SEQ ID NO: 70 or SEQ ID NO:

71.

41. The nucleic acid trans-splicing molecule according to any one of claims 1 to 12, wherein the nucleic acid trans-splicing molecule comprises a nucleic acid sequence having at least 80% identity with any one of SEQ ID NOs: 40 to 44, 46, or 48 to 50.

42. A ribonucleic acid trans-splicing molecule transcribed from a nucleic acid trans-splicing molecule according to any one of claims 1 to 41.

43. The nucleic acid trans-splicing molecule according to any one of claims 1 to 41, wherein the endogenous ABCA4 pre-mRNA contains at least one mutation associated with ABCA4-related retinal dystrophy.

44. The nucleic acid trans-splicing molecule according to claim 43, wherein the ABCA4-related retinal dystrophy is inherited in an autosomal recessive manner.

45. The nucleic acid trans-splicing molecule according to claim 43 or 44, wherein the ABCA4-related retinal dystrophy is associated with an allelic pathogenic mutation spanning exons 1 to 22 of the ABCA4 gene and a phenotype consistent with cone-rod dystrophy (e.g., cone-rod dystrophy-3), Stargardt macular dystrophy (e.g., Stargardt disease-1), macular fundus, retinitis pigmentosa-19, or age-related macular degeneration-2.

46. The nucleic acid trans-splicing molecule according to any one of claims 1 to 45, wherein the endogenous ABCA4 pre-mRNA containing the at least one mutation is expressed in photoreceptor cells or retinal pigment epithelial cells.

47. A vector comprising the nucleic acid trans-splicing molecule according to any one of claims 1 to 46.

48. The vector according to claim 47, wherein the vector contains a 5' regulatory domain operably linked to the 5' side of the CDS.

49. The vector according to claim 48, wherein the 5' regulatory domain is operably linked to the 5' untranslated region.

50. The vector according to any one of claims 48 or 49, wherein the 5' regulatory domain contains a constitutive promoter or a tissue-specific promoter.

51. The vector according to claim 50, wherein the constitutive promoter is a CMV promoter.

52. A proviral plasmid comprising the nucleic acid trans-splicing molecule according to any one of claims 1 to 46.

53. An adeno-associated virus (AAV) comprising the nucleic acid trans-splicing molecule according to any one of claims 1 to 46, wherein the AAV optionally contains a 5' regulatory domain operably linked to the 5' side of the nucleic acid trans-splicing molecule.

54. The AAV according to claim 53, wherein the AAV comprises a 5' regulatory domain operably linked on the 5' side of the CDS. **Claim 55** The AAV according to any one of claims 53 or 54, wherein the 5' regulatory domain is operably linked to a 5' untranslated region. **Claim 56** The AAV according to any one of claims 53 to 55, wherein the 5' regulatory domain comprises a constitutive promoter. **Claim 57** The AAV according to claim 56, wherein the constitutive promoter is a CMV promoter. **Claim 58** The AAV according to any one of claims 53 to 57, wherein the AAV preferentially targets photoreceptor cells and / or retinal pigment epithelial cells. **Claim 59** The AAV according to any one of claims 53 to 58, wherein the AAV is AAV8, AAV5, or AAV2. **Claim 60** A composition comprising a nucleic acid trans-splicing molecule according to any one of claims 1 to 46, a vector according to any one of claims 47 to 51, a proviral plasmid according to claim 52, or an AAV according to any one of claims 53 to 59. **Claim 61** The composition according to claim 60, comprising a pharmaceutically acceptable excipient. **Claim 62** A method for expressing biologically active ABCA4 in a target cell and restoring the functional level of ABCA4 protein in the target cell, the method comprising transducing the target cell with a nucleic acid trans-splicing molecule according to any one of claims 1 to 46, a vector according to any one of claims 47 to 51, a proviral plasmid according to claim 52, an AAV according to any one of claims 53 to 59, or a composition according to claim 60 or 61. **Claim 63** The method according to claim 62, wherein at least 5%, at least 10%, or at least 15% of the target ABCA4 mRNA in the target cell is replaced. **Claim 64** The method according to claim 63, wherein at least 20% of the target ABCA4 mRNA in the target cell is replaced. **Claim 65** The method according to claim 64, wherein at least 35% of the target ABCA4 mRNA in the target cell is replaced. **Claim 66** The method according to any one of claims 62 to 65, wherein the functional level of ABCA4 is restored in the target cells by expressing a full-length ABCA4 protein having biological function.

67. A method for reducing ABCA4-related lipofuscin and / or A2E accumulation in a subject, comprising transfecting or transducing target retinal cells in the subject with a nucleic acid trans-splicing molecule according to any one of claims 1 to 46, a vector according to any one of claims 47 to 51, a proviral plasmid according to claim 52, an AAV according to any one of claims 53 to 59, or a composition according to claim 60 or 61.

68. A method for correcting at least one mutation in the ABCA4 exon sequence in a target cell of a subject, comprising administering to the subject a nucleic acid trans-splicing molecule according to any one of claims 1 to 46, a vector according to any one of claims 47 to 51, a proviral plasmid according to claim 52, an AAV according to any one of claims 53 to 59, or a composition according to claim 60 or 61.

69. A method for treating a subject in need of treatment for ABCA4-related retinal dystrophy, comprising administering to the subject a nucleic acid trans-splicing molecule according to any one of claims 1 to 46, a vector according to any one of claims 47 to 51, a proviral plasmid according to claim 52, an AAV according to any one of claims 53 to 59, or a composition according to claim 60 or 61 in a therapeutically effective amount.

70. The method according to any one of claims 67 to 69, comprising subretinal administration of a nucleic acid trans-splicing molecule according to any one of claims 1 to 46, a vector according to any one of claims 47 to 51, a proviral plasmid according to claim 52, an AAV according to any one of claims 53 to 59, or a composition according to claim 60 or 61 to the subject.

71. The method according to any one of claims 67 to 70, wherein the subject is a non-human primate or a human.

72. The method according to any one of claims 67 to 71, wherein the subject is diagnosed with ABCA4-related retinal dystrophy.

73. For use in the treatment of subjects in need of treatment for ABCA4-related retinal dystrophy, the nucleic acid trans-splicing molecule according to any one of claims 1 to 46, the vector according to any one of claims 47 to 51, the proviral plasmid according to claim 52, the AAV according to any one of claims 53 to 59, or the composition according to claim 60 or 61.

74. For use in the preparation of a medicament for the treatment of subjects in need of treatment for ABCA4-related retinal dystrophy, the nucleic acid trans-splicing molecule according to any one of claims 1 to 46, the vector according to any one of claims 47 to 51, the proviral plasmid according to claim 52, the AAV according to any one of claims 53 to 59, or the composition according to claim 60 or 61.

75. The method according to any one of claims 67 to 72, wherein the ABCA4-related retinal dystrophy is related to an allelic pathogenic mutation spanning exons 1 to 22 of the ABCA4 gene and a phenotype consistent with cone-rod dystrophy, Stargardt macular dystrophy, or macular fundus.

76. A nucleic acid trans-splicing molecule comprising: (a) a linker domain comprising the sequence of SEQ ID NO: 27, or a sequence having at least 90% identity to SEQ ID NO: 27, consisting essentially of, or consisting of; (b) optionally, an enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 62; and (c) optionally, a translation enhancer comprising, consisting essentially of, or consisting of SEQ ID NO: 63, wherein the linker domain, the enhancer if present, and the translation enhancer if present are operably linked in the 5' to 3' direction.

77. Further comprising a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, The nucleic acid trans-splicing molecule according to claim 76, wherein the linker domain, the enhancer if present, the translation enhancer if present, and the binding domain are operably linked in the 5' to 3' direction.

78. Further comprising a CDS comprising an ABCA4 exon, The nucleic acid trans-splicing molecule according to claim 76 or claim 77, wherein the CDS, the linker domain, the enhancer if present, the translation enhancer if present, and the binding domain if present are operably linked in the 5' to 3' direction.

79. A 5' nucleic acid trans-splicing molecule, comprising: (a) an enhancer comprising GGTAAGT, or SEQ ID NO: 61, or at least one of a sequence having at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity to GGTAAGT or SEQ ID NO: 61, or consisting essentially of or consisting of such a sequence, and (b) optionally, a linker domain comprising SEQ ID NO: 27, or a sequence having at least 90% identity to SEQ ID NO: 27, or consisting essentially of or consisting of such a sequence, (c) optionally, a translation enhancer comprising SEQ ID NO: 63, or consisting essentially of or consisting of such a sequence, wherein, when present, the linker domain, the enhancer, and the translation enhancer if present are operably linked in the 5' to 3' direction; the 5' nucleic acid trans-splicing molecule.

80. A 5' nucleic acid trans-splicing molecule, comprising: (a) an enhancer comprising SEQ ID NO: 62, or a sequence having at least 90% identity to SEQ ID NO: 62, or consisting essentially of or consisting of such a sequence, and (b) optionally, a linker domain comprising SEQ ID NO: 27, or a sequence having at least 90% identity to SEQ ID NO: 27, or consisting essentially of or consisting of such a sequence, (c) optionally, a translation enhancer comprising SEQ ID NO: 63, or consisting essentially of or consisting of such a sequence, wherein, when present, the linker domain, the enhancer, and the translation enhancer if present are operably linked in the 5' to 3' direction; the 5' nucleic acid trans-splicing molecule.

81. Further comprising a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA The nucleic acid trans-splicing molecule according to claim 79 or claim 80, wherein when present, the linker domain, the enhancer, when present, the translation enhancer, and the binding domain are operably linked in the 5' to 3' direction.

82. Further comprising a CDS containing an ABCA4 exon, The nucleic acid trans-splicing molecule according to any one of claims 79 to 81, wherein the CDS, when present, the linker domain, the enhancer, when present, the translation enhancer, and when present, the binding domain are operably linked in the 5' to 3' direction.

83. A nucleic acid trans-splicing molecule, (a) a translation enhancer comprising a sequence having at least 90% identity to SEQ ID NO: 63, or consisting essentially of or consisting of SEQ ID NO: 63, (b) optionally, an enhancer comprising SEQ ID NO: 62, or consisting essentially of or consisting of SEQ ID NO: 62, and (c) optionally, a linker domain comprising a sequence having at least 90% identity to SEQ ID NO: 27, or consisting essentially of or consisting of SEQ ID NO: 27, wherein when present, the linker domain, when present, the enhancer, and the translation enhancer are operably linked in the 5' to 3' direction, the nucleic acid trans-splicing molecule.

84. Further comprising a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, The nucleic acid trans-splicing molecule according to claim 83, wherein when present, the linker domain, when present, the enhancer, the translation enhancer, and the binding domain are operably linked in the 5' to 3' direction.

85. Further comprising a CDS containing an ABCA4 exon, The nucleic acid trans-splicing molecule according to claim 83 or claim 84, wherein the CDS, when present, the linker domain, when present, the enhancer, the translation enhancer, and when present, the binding domain are operably linked in the 5' to 3' direction.

86. A nucleic acid trans-splicing molecule, Comprising a cassette containing a linker domain and an enhancer, the cassette comprising SEQ ID NO: 72, or consisting essentially of or consisting of SEQ ID NO: 72, the nucleic acid trans-splicing molecule.

87. Furthermore, it includes a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, The nucleic acid trans-splicing molecule according to claim 86, wherein the cassette and the binding domain are operably linked in the 5' to 3' direction. **Claim 88** Furthermore, it includes a CDS containing an ABCA4 exon, The nucleic acid trans-splicing molecule according to claim 86 or claim 87, wherein the CDS, the cassette, and, if present, the binding domain are operably linked in the 5' to 3' direction. **Claim 89** A nucleic acid trans-splicing molecule, including a cassette containing a linker domain, an enhancer, and a translation enhancer, the cassette comprising, consisting essentially of, or consisting of SEQ ID NO: 73, said nucleic acid trans-splicing molecule. **Claim 90** Furthermore, it includes a binding domain that anneals to a binding site within endogenous ABCA4 pre-mRNA, The nucleic acid trans-splicing molecule according to claim 89, wherein the cassette and the binding domain are operably linked in the 5' to 3' direction. **Claim 91** Furthermore, it includes a CDS containing an ABCA4 exon, The nucleic acid trans-splicing molecule according to claim 89 or claim 90, wherein the CDS, the cassette, and, if present, the binding domain are operably linked in the 5' to 3' direction. **Claim 92** A nucleic acid trans-splicing molecule, (a) comprising, consisting essentially of, or consisting of a 3' transcription terminator domain that includes a sequence having at least 95% identity to SEQ ID NO: 66, or SEQ ID NO: 66, said nucleic acid trans-splicing molecule. **Claim 93** The nucleic acid trans-splicing molecule according to claim 92, wherein the 3' transcription terminator domain comprises a nucleic acid sequence having at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity to SEQ ID NO: 66, or 100% identity to SEQ ID NO:

66. **Claim 94** The nucleic acid trans-splicing molecule according to claim 92 or claim 93, wherein the 3' transcription terminator domain comprises, consists essentially of, or consists of SEQ ID NO: 66.