Peptides for intracellular delivery

A peptide modified with a hydrophobic tail forms amphiphilic compounds for efficient intracellular delivery, addressing inefficiencies and cytotoxicity issues in current delivery methods, enhancing stability and safety.

JP2025522522APending Publication Date: 2025-07-15ウニベルシダーデデサンティアゴデコンポステーラ
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024575081
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-23
Filing Date
2023-06-23
Publication Date
2025-07-15

AI Technical Summary

Technical Problem

Current methods for intracellular delivery of biologically important molecules, such as nucleic acids and proteins, face challenges including low efficiency, cytotoxicity, immunogenicity, and instability of delivery vehicles, particularly non-viral vectors like lipids, peptides, and nanoparticles.

Method used

Development of a peptide modified with a hydrophobic tail to form an amphiphilic compound for intracellular delivery, comprising specific amino acid sequences and reactive groups for attaching hydrophobic tails, forming stable complexes with biologically important molecules.

Benefits of technology

The amphiphilic compounds effectively deliver biologically important molecules into cells with improved stability, efficiency, and reduced cytotoxicity, offering a viable alternative to existing viral and non-viral vectors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025522522000052
    Figure 2025522522000052
  • Figure 2025522522000053
    Figure 2025522522000053
  • Figure 2025522522000054
    Figure 2025522522000054
Patent Text Reader

Abstract

The present invention relates to a short peptide or a salt thereof which can be modified with an appropriate hydrophobic tail for generating an amphiphilic molecule useful for intracellular delivery of a biologically important molecule. Thus, the present invention also relates to an amphiphilic molecule and a complex between the amphiphilic molecule and a biologically important molecule. Furthermore, the present invention relates to the use of the peptide, the amphiphilic molecule and the complex for delivery of a biologically important molecule. The present invention relates to the peptide or a salt thereof, the amphiphilic molecule and the complex for use in medicine, particularly for use as a vaccine. A method for preparing the amphiphilic molecule and the complex of the present invention is also contemplated. Finally, the present invention relates to novel amino acids useful for synthesis of the peptides and molecules of the present invention.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a short peptide or a salt thereof that can be modified with a suitable hydrophobic tail to produce an amphiphilic compound useful for intracellular delivery of biologically important molecules. The present invention further relates to amino acids suitable for the synthesis of the peptide or a salt thereof of the present invention.

Background Art

[0002] The delivery of functional nucleic acids and / or proteins into cells continues to be a major challenge in chemistry, biology, and materials science. New methodologies and recent breakthroughs have renewed interest in the discovery and development of new tools for efficient intracellular delivery, such as the delivery of functional nucleic acids and / or proteins. However, despite all the progress that has been achieved in the past few years, the currently used technologies have important limitations. These can be related to the nucleic acid or protein cargo, or the delivery vehicle. The nucleic acid cargo has problems such as the potential permanent recombination of plasmids, the susceptibility of nucleic acids such as ssRNA to nuclease degradation, and the possible immunological responses that can be caused by any type of nucleic acid. The delivery vehicle can be either a viral vector or a non-viral vector. Although very efficient and in some cases selective, viral vectors have important limitations related to their potential biosafety concerns, their immunogenicity, and their low DNA packaging capacity. Alternatively, different non-viral vectors for achieving and improving the delivery of nucleic acids and proteins, including lipids, peptides, nanoparticles, polymers, and supramolecular systems, have been developed. However, non-viral vectors still present important barriers and limitations such as insufficient packaging and protection of the cargo, low stability of the resulting complexes, immunological responses, escape from the endocytosis pathway, and most importantly, low efficiency and high cytotoxicity. In this context, short cationic peptides have been described in the literature as suitable non-viral vectors when modified with appropriate chemical tails. For example, I. Louzao, R. Garcia-Fandino and J. Montenegro, Hydrazone-modulated peptides for efficient gene transfection, J. Mater. Chem. B, 2017 describes the formation of hydrazones for modulating the transfection activity of parent linear peptides in combination with plasmid DNA cargo.Similarly, I. Lostale - Seijo, et al., Peptide / Cas9 nanostructures for ribonucleoprotein cell membrane transport and gene edition, Chem. Sci., 2017 reported a supramolecular strategy for the direct delivery of Cas9 ribonucleoprotein by an amphiphilic transmembrane peptide prepared by hydrazone bond formation between a cationic peptide backbone and a hydrophobic aldehyde tail. These contributions suggest that the development of peptide - based non - viral vectors for a wide range of applications in the intracellular delivery of biologically important cargos is needed in the art.

Summary of the Invention

[0003] The inventors have found a peptide or a salt thereof that can be modified with a hydrophobic tail to produce an amphiphilic compound useful for the intracellular delivery of biologically important molecules.

[0004] In a first aspect, the present invention relates to a peptide or a salt thereof, a) the peptide or its salt has a length of 7 to 21 amino acids, b) the peptide or its salt comprises a basic amino acid residue selected from the group consisting of (i) arginine (R), (ii) histidine (H), and (iii) a reactive basic amino acid residue containing a reactive group in its side chain, and optionally a hydrophobic amino acid residue selected from the group consisting of alanine (A), valine (V), leucine (L), and isoleucine (I), and when present, the hydrophobic amino acid is less than 50% of the total number of amino acids of the peptide, c) the number of arginines in the peptide or its salt is 2 to 10, d) the number of histidines in the peptide or its salt is 0 to 3, e) the number of reactive basic amino acid residues containing a reactive residue in its side chain in the peptide or its salt is 3, f) the number of hydrophobic amino acids in the peptide or its salt is 0 to 8, g) There are two or fewer consecutive amino acids of the same residue in the amino acid sequence of the peptide, provided that this does not include reactive basic amino acid residues and the amino acid arginine that contain a reactive group in their side chains. In the case of the latter, there may be up to three consecutive arginines and / or up to three consecutive reactive basic amino acid residues that contain a reactive group in their side chains. h) The amino acids contained in the peptide or a salt thereof are L-amino acids and / or D-amino acids. Preferably, all the amino acids contained in the peptide are L-amino acids, or all the amino acids contained in the peptide are D-amino acids.

[0005] Preferably, the peptide or a salt thereof of the present invention is a cationic peptide. The peptide or a salt thereof of the present invention is suitable for forming the amphiphilic substance of the present invention as described below. In a preferred embodiment, the amino acid at the N-terminus of the peptide is arginine (R).

[0006] Preferably, the reactive basic amino acid residue that contains a reactive group in its side chain is an amino acid defined by formula (I):

Chemical formula

[0007] In a second aspect, the present invention relates to an amphiphilic molecule comprising a) a peptide or a salt thereof as defined in the first aspect of the present invention, and b) three hydrophobic tails and containing or alternatively consisting of these. Each hydrophobic tail is linked to the peptide or a salt thereof by a covalent bond formed by a reaction between (i) a reactive group of the side chain of a reactive basic amino acid residue of the peptide or a salt thereof and (ii) a precursor of the hydrophobic tail, and the precursor of the hydrophobic tail includes the hydrophobic tail and a second reactive group capable of reacting with the reactive group of the side chain of the reactive basic amino acid residue of the peptide or a salt thereof, relating to an amphiphilic molecule.

[0008] In a third aspect, the invention relates to a) at least one amphiphilic molecule as defined in the second aspect of the invention, and b) at least one biologically important molecule in a complex.

[0009] In a further aspect, the invention relates to the use of the peptide or a salt thereof of the invention, the amphiphilic molecule of the invention, or the complex of the invention for the delivery of a biologically important molecule.

[0010] In yet a further aspect, the invention relates to the peptide or a salt thereof of the invention, the amphiphilic molecule of the invention, or the complex of the invention for use in a medicament (as a drug).

[0011] In yet a further aspect, the invention relates to the peptide or a salt thereof of the invention, the amphiphilic molecule of the invention, or the complex of the invention for use as a vaccine or for use as an immunogenic composition. The invention further provides a vaccine comprising the peptide or a salt thereof of the invention, the amphiphilic molecule of the invention or the complex of the invention. Thus, the biologically important molecule may be capable of generating an immune response in a subject.

[0012] In another aspect, the present invention is a method for preparing an amphiphilic molecule according to the present invention, comprising contacting a solution of the peptide of the present invention dissolved in an organic solvent with a solution of a precursor of the hydrophobic tail, wherein the precursor of the hydrophobic tail has a reactive group that reacts with a reactive group of a side chain of a reactive basic amino acid residue of the peptide or a salt thereof under conditions sufficient for the formation of a covalent bond between the reactive group of the precursor of the hydrophobic tail and the reactive group of the peptide or a salt thereof, and the conditions are - when the reactive group of the hydrophobic tail precursor is an aldehyde, an acidic medium, or - when the reactive group of the hydrophobic tail precursor is an alcohol or a carboxylic acid, a basic medium and in the presence of a carboxylic acid activating reagent which refers to a method consisting of.

[0013] In a further aspect, the present invention refers to a method for preparing a complex according to the present invention, comprising contacting a solution of the amphiphilic molecule of the present invention with a solution in which at least one biologically important molecule is dissolved in a suitable medium under conditions sufficient to form a complex between the amphiphilic molecule and the biologically important molecule.

[0014] In a further aspect, the present invention is a method for in vitro delivery of a biologically important molecule to a cell population, comprising (i) contacting a first solution in which an amphiphilic molecule of the present invention is dissolved in a suitable solvent with a second solution containing a biologically important molecule in a suitable solvent under conditions sufficient for the formation of a complex between the amphiphilic molecule and at least one biologically important molecule; (ii) adding the complex obtained in step (i) to the cell population under conditions suitable for the delivery of the biologically important molecule to the cell population which relates to a method comprising.

[0015] In another aspect, the present invention is a method for obtaining a library comprising at least two different amphiphilic molecules according to the present invention, the method comprising contacting at least "n" peptides or salts thereof according to the present invention in an organic solvent with at least "3n" hydrophobic tail precursors, each precursor comprising a hydrophobic tail and a reactive group that reacts with a reactive group of the side chain of a basic amino acid of the peptide or salt thereof, the contacting being carried out under conditions sufficient for the formation of a covalent bond between the hydrophobic tail precursor and the reactive group of the side chain of the basic amino acid of the peptide or salt thereof. "n" corresponds to a natural number such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. Preferably, the contacting step of the method for obtaining a library of amphiphilic molecules is carried out by separately contacting at least one peptide or salt thereof with at least one hydrophobic tail precursor. For example, in a method for obtaining a library comprising at least two different amphiphilic molecules according to the present invention, at least two peptides or salts thereof as defined in the present invention are contacted with at least six hydrophobic tail precursors in an organic solvent as described above.

[0016] Furthermore, the present invention relates to a library comprising at least two different amphiphilic molecules, each amphiphilic molecule comprising (i) a peptide or salt thereof according to the present invention, and (ii) three hydrophobic tails and the hydrophobic tails being connected to the peptide by a bond formed by the reaction of a reactive group of the side chain of a reactive basic amino acid residue of the peptide or salt thereof with a precursor of the hydrophobic tail, each precursor of the hydrophobic tail comprising a hydrophobic tail and a second reactive group capable of reacting with a reactive group of the side chain of a reactive basic amino acid residue of the peptide or salt thereof, and one amphiphilic molecule being different from at least the peptide and / or other amphiphilic molecules of the hydrophobic tail.

[0017] Furthermore, the present invention relates to a method for identifying an amphiphilic molecule suitable for delivering a biologically important molecule to a cell, the method comprising (i) contacting a biologically important molecule with the library of the present invention under conditions sufficient for the binding of an amphiphilic molecule and a biologically important molecule; (ii) optionally, selecting an amphiphilic molecule capable of binding to a biologically important molecule from amphiphilic molecules that do not bind to the biologically important molecule; and (iii) screening for amphiphilic molecules suitable for the delivery of a biologically important molecule into cells comprising.

[0018] Finally, the present invention relates to formula (III) or formula (IV):

Chemical formula

Chemical formula

Brief Description of the Drawings

[0019]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31

Figure 32

Mode for Carrying Out the Invention

[0020] Detailed Description of the Invention The present inventors have found a peptide that can be modified with an appropriate hydrophobic tail to produce an amphiphilic compound useful for intracellular delivery of biologically important molecules.

[0021] Peptide In a first aspect, the present invention relates to a peptide or a salt thereof, · The peptide or its salt has a length of 7 - 21 amino acids, · The peptide or a salt thereof contains a basic amino acid selected from the group consisting of arginine (R), histidine (H), and a reactive basic amino acid residue containing a reactive group in its side chain. · The peptide or a salt thereof optionally contains a hydrophobic amino acid selected from the group consisting of alanine (A), valine (V), leucine (L), and isoleucine (I). When present, the hydrophobic amino acid is less than 50% of the total number of amino acids of the peptide or a salt thereof. · The number of arginines in the peptide is 2 to 10. · The number of histidines in the peptide is 0 to 3. · The number of reactive basic amino acid residues containing a reactive group in its side chain of the peptide or a salt thereof is 3. · The number of hydrophobic amino acids of the peptide or a salt thereof is 0 to 8. · There are 2 or fewer consecutive amino acids of the same residue in the amino acid sequence of the peptide, provided that this does not apply to the reactive basic amino acid residue and amino acid arginine containing a reactive group in its side chain. In that case, there may be a maximum of 3 consecutive arginines and / or a maximum of 3 consecutive reactive basic amino acid residues containing a reactive group in its side chain. · The amino acids contained in the peptide or a salt thereof are L-amino acids and / or D-amino acids. Preferably, all the amino acids contained in the peptide or a salt thereof are L-amino acids, or all the amino acids contained in the peptide or a salt thereof are D-amino acids.

[0022] Preferably, the peptide or a salt thereof of the present invention is a cationic peptide. Preferably, the amino acid at the N-terminus of the peptide or a salt thereof of the present invention is arginine.

[0023] Preferably, there are 2 or fewer consecutive hydrophobic amino acids in the amino acid sequence of the peptide.

[0024] The peptide or a salt thereof of the present invention is suitable for forming the amphiphilic molecule of the present invention as described below.

[0025] As used herein, the term "peptide" refers to a sequence of amino acids, analogs, or mimetics having substantially similar or identical functions, wherein one or more amino acids, analogs, or mimetics are linked to each other by peptide bonds. The term "peptide" also includes analogs having synthetic and natural amino acids linked by peptide bonds. As used herein and in the claims, a peptide is also intended to include its analogs, derivatives, salts, retro-inverso isomers, mimetics, mimics, or peptidomimetics. For example, the peptide structure of the modulators of the invention may be further modified to enhance its stability, bioavailability, solubility, etc. "Analogs," "derivatives," and "mimetics" include molecules that mimic the chemical structure of a peptide structure and retain the functional characteristics of the peptide structure. Approaches for designing peptide analogs, derivatives, and mimetics are known in the art. See, for example, Farmer, P. S. in Drug Design (E. J. Ariens, ed.) Academic Press, New York, 1980, vol. 10, pp. 119-143; Ball, J. B. and Alewood, P. F. (1990) J. Mol. Recognition 3:55; Morgan, B. A. and Gainor, J. A. (1989) Ann. Rep. Med. Chem. 24:243; and Freidinger, R. M. (1989) Trends Pharmacol. Sci. 10:270.See also Sawyer, T.K. (1995) Peptidomimetic Design and Chemical Approaches to Peptide Metabolism in Taylor, M.D. and Amidon, G.L. (eds.) Peptide - Based Drug Design: Controlling Transport and Metabolism, Chapter 17, Smith, A.B. 3rd, et al. (1995) J. Am. Chem. Soc. 117:11113 - 11123, Smith, A.B. 3rd, et al. (1994) J. Am. Chem Soc. 116:9947 - 9962, and Hirschmann, R., et al. (1993) J. Am. Chem. Soc. 115:12550 - 12568. A "derivative" (e.g., a peptide or an amino acid) includes a form in which one or more reactive groups on the compound are derivatized with substituents. Examples of peptide derivatives include peptides in which the amino acid side chains, the peptide backbone, or the amino - terminal or carboxy - terminal are derivatized (e.g., peptide - like compounds having methylated amide bonds). An "analog" of a compound includes a compound that retains the chemical structure necessary for functional activity but also includes different specific chemical structures. An example of an analog of a naturally - occurring peptide is a peptide that contains one or more non - naturally - occurring amino acids. A "mimetic" of a compound includes a compound in which the chemical structure of the compound necessary for functional activity is replaced by another chemical structure that mimics the three - dimensional structure of the compound. Examples of peptidomimetics include peptide - like compounds in which the peptide backbone is replaced by one or more benzodiazepine molecules (see, e.g., James, G.L. et al. (1993) Science 260:1937 - 1942). In certain embodiments, the N - terminus of the peptide ends with an acyl group and the C - terminus of the peptide ends with an amine group. In another specific embodiment, the acyl group is an acetyl group and the amine group is a primary amine group.

[0026] The salts of the peptides of the present invention include salts with physiologically acceptable acid addition salts. Examples of such salts are peptide salts with inorganic acids (such as hydrochloric acid, phosphoric acid, hydrobromic acid or sulfuric acid, etc.) and peptide salts with organic acids (such as acetic acid, trifluoroacetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid or benzenesulfonic acid, etc.).

[0027] Amino acids, together with the side chain (R group) specific to each amino acid, have an amino (-NH3 + ) and a carboxylate (-CO2 -) It is an organic compound containing a functional group. Therefore, strictly speaking, any organic compound having an amine (-NH2) functional group and a carboxylic acid (-COOH) functional group is an amino acid. The term "amino acid" refers to naturally occurring amino acids and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in the same way as naturally occurring amino acids. Amino acids may be referred to herein by either the generally known three-letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be referred to by the generally accepted one-letter code. The term "amino acid" refers to amino acids that make up proteins (i.e., amino acids that are biosynthetically incorporated into proteins during translation) and amino acids that do not make up proteins (e.g., ornithine (Orn, O) having two basic groups). The genetic code encodes 20 standard amino acids for incorporation into proteins during translation. Additionally, there are selenocysteine and pyrrolysine, which are two extra amino acids that make proteins. The term "amino acid" includes naturally occurring amino acids (Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val), and non-natural or abnormal amino acids. Amino acids are preferably in the L configuration, but can also be in the D configuration, or a mixture of D- and L-configured amino acids. The term "natural amino acid" includes aliphatic amino acids (e.g., glycine, alanine, valine, leucine, and isoleucine), hydroxylated amino acids (e.g., serine and threonine), sulfur-containing amino acids (e.g., cysteine and methionine), dicarboxyl amino acids and their amides (e.g., aspartic acid, asparagine, glutamic acid, and glutamine), amino acids having two basic groups (e.g., lysine, arginine, and histidine), aromatic amino acids (e.g., phenylalanine, tyrosine, and tryptophan), and cyclic amino acids (e.g., proline).

[0028] As used herein, the term "non-natural or unnatural amino acid" refers to an amino acid that is not naturally encoded, i.e., an amino acid that may not naturally exist in a plant or bacterium after translation or that does not make a protein that is chemically synthesized. Exemplary non-limiting examples of modified amino acids or uncommon amino acids include 2-aminoadipic acid, 3-aminoadipic acid, beta-alanine, 2-aminobutyric acid, 4-aminobutyric acid, 6-aminocaproic acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisobutyric acid, 2-aminopimelic acid, 2,4-diaminobutyric acid (Dab), desmosine, 2,2'-diaminopimelic acid, 2,3-diaminopropionic acid (Dap), N-ethylglycine, N-ethylasparagine, hydroxylysine, allohydroxylysine, 3-hydroxyproline, 4-hydroxyproline, isodesmosine, alloisoleucine, N-methylglycine, N-methylisoleucine, 6-N-methyllysine, N-methylvaline, norvaline, norleucine, ornithine, and the like.

[0029] The peptide of the present invention or a salt thereof contains a basic amino acid selected from the group consisting of arginine (R), histidine (H), and three reactive basic amino acid residues containing a reactive group in its side chain.

[0030] In the context of the present application, the "reactive basic amino acid residue containing a reactive group in its side chain" refers to any basic amino acid (e.g., Lys, Orn, Dab, Dap) containing a group capable of forming a covalent bond in its side chain (see below).

[0031] "Reactive basic amino acid residue" preferably refers to a basic amino acid residue containing a primary amine in its side chain, such as lysine, ornithine, 2,4-diaminobutyric acid, 2,3-diaminopropionic acid, or any other basic amino acid having a primary amine in its side chain. A primary amine is an amine in which the amino group (-NH2 moiety) is directly bonded to only one carbon and cannot be a carbonyl group carbon. In these cases, the reactive basic amino acid residue originally has a positive net charge at neutral pH because the reactive group in its side chain is the primary amine of the amino acid.

[0032] The primary amine is a reactive group, and thus a basic amino acid containing a primary amine in its side chain is a reactive basic amino acid containing a reactive group in its side chain.

[0033] Therefore, a reactive basic amino acid residue containing a reactive group in its side chain may be a basic amino acid residue containing a primary amine in its side chain, and the primary amine is the reactive group in its side chain. This is the case, for example, for the above-mentioned natural (or unmodified) Lys or natural (or unmodified) Orn or natural (or unmodified) Dab, and the reactive basic amino acid residue containing a reactive group in its side chain is positively charged at neutral pH. Also, the reactive group in the side chain may be different from the primary amine. In this case, the reactive group may be covalently bonded (directly or through a spacer) to, for example, the primary amine preferably present in the reactive basic amino acid residue. This is the case, for example, for modified Lys or modified Orn or modified Dab, that is, Lys or Orn or Dab in which the reactive group is covalently bonded (directly or through a spacer) to their primary amine. This is a preferred embodiment.

[0034] Preferably, the spacer is a straight-chain carbon chain containing 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, and even more preferably 4 carbon atoms. In a preferred embodiment, the spacer contains, on one side, for example, a carboxylic acid suitable for forming an amide bond with the primary amine of the side chain of a basic reactive amino acid. Further, on the other side, the spacer is linked to a reactive group (the "first reactive group") as described herein. In a preferred embodiment, the spacer is linked to a reactive group selected from a hydrazide group, an amino group, a carboxylic acid or an aminooxy-carboxylic acid group as described herein.

[0035] Thus, the spacer (linked to the first reactive group) reacts with the side chain of a reactive basic amino acid residue (preferably containing a primary amine), for example, by forming an amide bond. Thus, in this case, the reactive basic amino acid contains a reactive group, preferably a hydrazide or an aminooxy-carboxylic acid, as described herein, which is bound to its side chain via the spacer. In this scenario, the original positive charge of the reactive basic amino acid (e.g., Lys or Orn or Dab) at neutral pH may be lost due to the reaction with the spacer. Nevertheless, in the context of the present invention, and as described above, such a modified amino acid was originally (before the reaction with the spacer linked to the reactive group) a basic amino acid and has a reactive group on its side chain, and is thus also referred to as a "reactive basic amino acid".

[0036] In the present application, when one amino acid of the peptide or a salt thereof of the present invention contains a reactive group on its side chain, that amino acid can be referred to by its three-letter or one-letter symbol and an asterisk (*) (e.g., unmodified or modified lysine, i.e., unmodified lysine, or lysine having a reactive group other than the primary amine of lysine is K*).

[0037] Thus, as described above, in a preferred embodiment, the reactive group covalently bonded (directly or via a spacer) to the primary amine of the basic amino acid may not necessarily be an amine, and may be any reactive group suitable for forming a covalent bond with other reactive groups such as other reactive groups present in the precursor of the hydrophobic tail, as defined in detail below.

[0038] In certain embodiments, the reactive group present in the side chain of the reactive basic amino acid is selected from the group consisting of a hydrazide group, an amino group, a carboxylic acid, and an aminooxy-carboxylic acid group. Preferably, the reactive group present in the side chain of the reactive basic amino acid is a hydrazide group or an aminooxycarboxylic acid group. More preferably, the reactive group present in the side chain of the reactive basic amino acid is a hydrazide group.

[0039] In a preferred embodiment, the reactive basic amino acid residue containing a reactive group in its side chain has the formula (I):

Chemical formula

[0040] When formula (II) is part of the amino acid sequence of the peptide of the present invention, it represents a reactive basic amino acid residue containing a reactive group in its side chain,

Chemical formula

[0041] In a preferred embodiment, when B is absent, A is a primary amine.

[0042] In a preferred embodiment, B is present and it is preferably a spacer linked to a hydrazide group, amino group, carboxylic acid or aminooxy-carboxylic acid group as described herein. More preferably, B is present and it is a spacer linked to a hydrazide group or an aminooxy-carboxylic acid group. Even more preferably, B is present and it is a spacer linked to a hydrazide group. In a preferred embodiment, B is present and it is a spacer having 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, for example 2, 3, 4, 5 or 6 carbon atoms, even more preferably 4 carbon atoms, bonded to a hydrazide group, amino group, carboxylic acid or aminooxy-carboxylic acid group, more preferably bonded to a hydrazide group or an aminooxy-carboxylic acid group, even more preferably bonded to a hydrazide group, even more preferably bonded to a hydrazide group. In a preferred embodiment, B is a spacer having 2 to 6 carbon atoms bonded to a hydrazide group or an aminooxycarboxylic acid group. More preferably, B is a spacer having 4 carbon atoms linked to a hydrazide group.

[0043] In a preferred embodiment, B is present and A is an amide bond.

[0044] Preferably, the spacer is a straight-chain carbon chain containing 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, such as 2, 3, 4, 5 or 6 carbon atoms, and even more preferably 4 carbon atoms, as described herein. In a preferred embodiment, the spacer has, on one side, a carboxylic acid suitable for forming a primary amine and an amide bond with the side chain of a basic reactive amino acid (A), for example. Further, on the other side, the spacer is linked to a reactive group (the "first reactive group") as described herein. In a preferred embodiment, the spacer is linked to a reactive group selected from a hydrazide group, an amino group, a carboxylic acid or an aminooxy-carboxylic acid group as described herein. Thus, in a preferred embodiment, B is present, which is a spacer containing 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, such as 2, 3, 4, 5 or 6 carbon atoms, and even more preferably 4 carbon atoms, and linked to the reactive group (the "first reactive group") described herein, which is preferably a hydrazide group, an amino group, a carboxylic acid or an aminooxy-carboxylic acid group.

[0045] In a more preferred embodiment, the three reactive basic amino acid residues containing a reactive group in their side chains are reactive lysine (K*), or reactive ornithine (O*), or reactive Dab (Dab*), or a mixture thereof, more preferably reactive lysine (K*) or reactive ornithine (O*), or a mixture thereof.

[0046] The term "reactive lysine", "K*" or "chemically available lysine" refers to the amino acid lysine having a free side-chain amino group (primary amine), C6H 14Refers to N2O2. In the context of the present invention, as described in detail above, the primary amine of the side chain of natural lysine can be a reactive group (the "first reactive group") present in reactive lysine. Further, in the context of the present invention, as described in detail above, the reactive group may be covalently linked (directly or via a spacer) to the side chain of natural lysine (i.e., to the ε-amino group present in lysine), and this reactive group is preferably a hydrazide group or an aminooxycarboxylic acid group.

[0047] The term "reactive ornithine" or "O*" refers to an amino acid having a free side chain amino group (primary amine) with the molecular formula C5H 12 Refers to an amino acid that does not produce a protein having N2O2. In the context of the present invention, as described in detail above, the primary amine of natural ornithine can be a reactive group (the "first reactive group") present in reactive ornithine. Further, in the context of the present invention, as described in detail above, the reactive group may be covalently linked (directly or via a spacer) to the side chain of natural ornithine (i.e., to the ε-amino group present in ornithine), and this reactive group is preferably a hydrazide group or an aminooxycarboxylic acid group.

[0048] The terms "reactive Dab", "Dab*" or "chemically available Dab" refer to the amino acid 2,4-diaminobutyric acid (Dab) having a free side chain amino group (primary amine), C4H 10 Refers to N2O2. In the context of the present invention, as described in detail above, the primary amine of the side chain of natural Dab can be a reactive group (the "first reactive group") present in reactive Dab. Further, in the context of the present invention, as described in detail above, the reactive group may be covalently linked (directly or via a spacer) to the side chain of natural Dab (i.e., to the γ-amino group present in Dab), and this reactive group is preferably a hydrazide group or an aminooxycarboxylic acid group.

[0049] Therefore, the reactive lysine K* of the peptide or a salt thereof of the present invention can be natural lysine or modified lysine, and the modified lysine is characterized in that a first reactive group is bonded to the ε-amino group of lysine by an amide bond, and the first reactive group and the amide bond are preferably bonded by a spacer. Preferably, the reactive lysine K* of the peptide of the present invention is modified lysine as described above.

[0050] Therefore, the reactive ornithine O* may be natural ornithine or modified ornithine, and the modified ornithine is characterized in that a first reactive group is bonded to the δ-amino group of ornithine by an amide bond, and the first reactive group and the amide bond are preferably bonded by a spacer. Preferably, the reactive ornithine O* of the peptide of the present invention is modified ornithine as described above.

[0051] Therefore, the reactive Dab (Dab*) may be natural Dab or modified Dab, and the modified Dab is characterized in that a first reactive group is bonded to the γ-amino group of Dab by an amide bond, and the first reactive group and the amide bond are preferably bonded by a spacer. Preferably, the reactive Dab (Dab*) of the peptide of the present invention is modified Dab as described above.

[0052] Preferably, the reactive group (i.e., the first reactive group) present in the side chain of the reactive basic amino acid is a hydrazide, which is bonded by an amide bond to the ε-amino group of lysine and / or the δ-amino group of ornithine and / or the γ-amino group of Dab, and the hydrazide group and the amide bond are preferably a carbon chain containing 1 to 10 carbon atoms, for example 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, and even more preferably 4 carbon atoms, and are bonded by a spacer. For example, as described in the following examples, lysine and / or ornithine and / or Dab of the peptide of the present invention can preferably be modified with glutaric acid monohydrazide, but can also be modified with aminooxyacetic acid or succinic acid monohydrazide. As a result, when the amino acid is lysine of lysine / ornithine / Dab, the ε-amino group (or, when the amino acid is ornithine, the δ-amino group, or when the amino acid is Dab, the γ-amino group) and the carboxylic acid of glutaric acid monohydrazide, aminooxyacetic acid or succinic acid monohydrazide form an amide bond. Therefore, when the carboxylic acid is glutaric acid, the hydrazide group is bonded to lysine and / or ornithine and / or Dab of the peptide of the present invention via an acyl spacer containing 4 C atoms.

[0053] In certain embodiments, the reactive group present on the side chain of the reactive basic amino acid (the "first reactive group"), which may be linked to the spacer as described above, is any group that enables bioconjugation by click chemistry. In certain embodiments, the reactive group present on the side chain of the reactive basic amino acid is any group suitable for undergoing a specific and controllable bioorthogonal reaction. The terms "click chemistry" or "click reaction" are used interchangeably herein and are intended to be consistent with their use in the art. They refer to a class of reactions that are very efficient and selective and can be used to stitch molecules together in high yields, as first described by Sharpless et al. in 2001 (Kolb, H.C., Finn, M.G., & Sharpless, K.B. (2001), Angewandte Chemie International Edition, 40(11), 2004-2021). In the context of the present invention, a bioorthogonal reaction refers to any chemical reaction that can occur within a living system without interfering with natural biochemical processes. Several chemical ligation strategies that meet the requirements of bioorthogonality have been developed, including, but not limited to, the 1,3-dipolar cycloaddition between azide and cyclooctyne (also called copper-free click chemistry), oxime / hydrazone formation between nitrone and cyclooctyne, tetrazine ligation, isocyanide-based click reactions, and quadricyclane ligation.

[0054] In certain embodiments, the reactive group present in the side chain of the reactive basic amino acid is selected from the group consisting of hydrazide, linear alkyl amino acid, carboxylic acid, and aminooxy-carboxylic acid. Preferably, the reactive group present in the side chain of the reactive basic amino acid is selected from hydrazide and aminooxy carboxylic acid. More preferably, the reactive group present in the side chain of the reactive basic amino acid is hydrazide. In another particular embodiment, the reactive group is preferably linked to a spacer that is a carbon chain containing 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, such as 2, 3, 4, 5, or 6 carbon atoms, and even more preferably 4 carbon atoms. In this embodiment, the spacer has, on one side, a carboxylic acid suitable for forming an amide bond, for example, between the ε-amino group when the amino acid is lysine, or the δ-amino group when the amino acid is ornithine, or the γ-amino group when the amino acid is Dab. Further, on the other side, the spacer is linked to a reactive group selected from the group consisting of hydrazide, linear alkyl amino acid, carboxylic acid, and aminooxy-carboxylic acid. Preferably, the reactive group present in the side chain of the reactive basic amino acid is selected from hydrazide and aminooxy carboxylic acid. Even more preferably, the reactive group is hydrazide.

[0055] Thus, in a preferred embodiment, the first reactive group (preferably a hydrazide) is linked to a spacer containing 5 carbon atoms. In another embodiment, the reactive group is linked to a spacer containing 4 carbon atoms. For example, when the reactive group is a carboxylic acid, the reactive group is present as glutaric acid linked to the spacer. In another embodiment, when the reactive group is a carboxylic acid, the reactive group is present as succinic acid linked to the spacer. In a further embodiment, when the reactive group is an aminooxy-carboxylic acid, the reactive group is present as aminooxyacetic acid linked to the spacer. Preferably, the reactive group is a hydrazide, which is present as glutaric acid monohydrazide linked to the spacer. Thus, the spacer linked to the reactive group is preferably in the form of glutaric acid monohydrazide, glutaric acid, aminooxyacetic acid or succinic acid monohydrazide, more preferably in the form of glutaric acid monohydrazide, aminooxyacetic acid or succinic acid monohydrazide, and even more preferably in the form of glutaric acid monohydrazide.

[0056] In one embodiment, a modified lysine or modified ornithine or modified Dab is obtained by reacting a peptide with a hydrazide carboxylic acid, such as glutaric acid monohydrazide or succinic acid monohydrazide, preferably glutaric acid monohydrazide, or an aminooxy-carboxylic acid, preferably aminooxyacetic acid, whereby a modified lysine or modified ornithine, or modified Dab is obtained and the reactive groups are a hydrazide and an aminooxy-carboxylic acid group, respectively. For further details, see "Hydrazone-modulated peptides for efficient gene transfection" (J. Mater. Chem. B (2017), 5: 4426 - 4434). In a more preferred embodiment, a modified lysine or modified ornithine is obtained by reacting a peptide with a hydrazide carboxylic acid, preferably glutaric acid monohydrazide, whereby a modified lysine or modified ornithine is obtained and the reactive group is a hydrazide.

[0057] The peptide of the present invention or a salt thereof optionally further contains at least one hydrophobic amino acid selected from the group consisting of alanine (A), valine (V), leucine (L) and isoleucine (I), preferably leucine (L). When a hydrophobic amino acid is present in the peptide of the present invention, the hydrophobic amino acid is less than 50%, less than 40%, less than 30%, less than 20%, or less than 10% of the total number of amino acids of the peptide or a salt thereof.

[0058] In a preferred embodiment, the peptide of the present invention or a salt thereof has a minimum length of 7 amino acids and a maximum length of 21 amino acids. For example, the peptide of the present invention or a salt thereof has a length of 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 amino acids. More preferably, the peptide of the present invention or a salt thereof has 7 to 17 amino acids, even more preferably 7 to 13 amino acids, such as 7, 9 or 13 amino acids, or 7 to 9 amino acids. In a preferred embodiment, the peptide of the present invention or a salt thereof has 7, 9, 13, 17 or 21 amino acids.

[0059] The number of R amino acids (arginine) of the peptide or a salt thereof is preferably 2 to 10. Therefore, the number of arginine of the peptide or a salt thereof is preferably 2, 3, 4, 5, 6, 7, 8, 9 or 10. Preferably, the number of arginine is 2 to 4.

[0060] The number of H amino acids (histidine) of the peptide or a salt thereof is preferably 0 to 3, even more preferably 0 to 2. Therefore, the number of histidine of the peptide or a salt thereof is preferably 0, 1, 2 or 3, more preferably 0, 1 or 2.

[0061] The number of reactive basic amino acid residues containing a reactive group in the side chain of the peptide or a salt thereof (preferably lysine and / or ornithine and / or Dab, preferably modified lysine and / or modified ornithine and / or modified Dab, also called K* and / or O* and / or Dab* as described above) is 3.

[0062] The number of hydrophobic amino acids in the peptide or its salt is preferably from 0 to 8. Therefore, the number of hydrophobic amino acids in the peptide or its salt is preferably 0, 1, 2, 3, 4, 5, 6, 7 or 8. In one embodiment, the hydrophobic amino acid is alanine (A). In another embodiment, the hydrophobic amino acid is valine (V). Preferably, the hydrophobic amino acid is leucine (L). In another embodiment, the hydrophobic amino acid is isoleucine (I). In another embodiment, the hydrophobic amino acids present in the peptide or its salt are any combination of two or more alanines (A), valines (V), leucines (L) and / or isoleucines (I).

[0063] The amino acids contained in the peptide or its salt of the present invention can be L-amino acids or D-amino acids, or a combination thereof. Preferably, all of the amino acids contained in the peptide or its salt of the present invention are L-amino acids, or alternatively, all of the amino acids contained in the peptide or its salt of the present invention are D-amino acids. In a more preferred embodiment, all of the amino acids contained in the peptide or its salt of the present invention are L-amino acids.

[0064] In the peptide or its salt of the present invention, there are no more than two consecutive amino acids of the same residue, provided that reactive basic amino acid residues containing a reactive group in their side chains (e.g., K* or O* or Dab*) and in the case of the amino acid arginine are excluded, in which case there can be up to three consecutive arginines and / or up to three consecutive reactive basic amino acid residues containing a reactive group in their side chains (e.g., up to three consecutive Arg, RRR and / or up to three consecutive reactive basic amino acid residues containing a reactive group in their side chains, such as K*K*K*, K*O*O*, O*O*O*, O*K*O*, K*O*K*, O*O*K*, O*K*K*, Dab*K*K*, K*Dab*K*, O*K*Dab*, O*O*Dab*, K*O*Dab*, K*K*Dab*, Dab*Dab*K*, Dab*Dab*Dab*, etc. can exist).

[0065] In a preferred embodiment, the peptide of the present invention or a salt thereof has two or fewer consecutive hydrophobic amino acids, that is, a maximum of two consecutive hydrophobic amino acids, for example, AA, VV, AV, VA, LL, LA, VL, II, IL, LI, IA, VI, AI, etc.

[0066] Therefore, the peptide of the present invention or a salt thereof may have three or fewer adjacent R residues, two or fewer adjacent H residues, two or fewer adjacent hydrophobic residues, and three or fewer adjacent reactive basic amino acid residues containing a reactive group in their side chains (for example, K* or O* or Dab*).

[0067] In a specific embodiment, the peptide of the present invention or a salt thereof has a length of 7 amino acids and contains only basic amino acids selected from the group consisting of R, H, and reactive basic amino acid residues containing a reactive group (that is, the peptide does not contain hydrophobic amino acids). The number of R amino acids in the peptide is at least 2, the number of H amino acids in the peptide is 1 or 2, preferably 2, and the number of reactive basic amino acid residues containing a reactive group (preferably K* and / or O* and / or Dab*) in the peptide is 3. In a preferred embodiment, the basic amino acid containing a reactive group is selected from K*, Dab*, and O*, preferably selected from K* and O*, and even more preferably selected from K*.

[0068] In a specific embodiment, the peptide sequence is selected from the group consisting of Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1), Ac-RHK*K*K*HR-NH2 (SEQ ID NO: 2), and Ac-RK*HHK*K*R-NH2 (SEQ ID NO: 3), Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53), Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58), and Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59).

[0069] In another embodiment, the peptide of the present invention or a salt thereof has a length of at least 7 amino acids, contains the core sequence RX1X2R (SEQ ID NO: 9), and any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I. In a preferred embodiment, the hydrophobic amino acid is L. In the context of the present invention, "core sequence" means a sequence to which additional amino acids can be added to the C-terminus and / or the N-terminus of the sequence. For example, in this embodiment, the peptide of the present invention or a salt thereof has a core sequence defined by RX1X2R (SEQ ID NO: 9) and has a length of at least 7 amino acids. This means that the peptide or a salt thereof of this embodiment may have a sequence of RX1X2R and, as defined above, at least 3 additional amino acids at the C-terminus and / or 3 amino acids at the N-terminus, or may have a combination of amino acids at both the C-terminus and the N-terminus of the peptide.

[0070] In another embodiment, the peptide of the present invention or a salt thereof has a length of 7 to 21 amino acids, preferably 7 to 17 amino acids, more preferably 7 to 13 amino acids, even more preferably 7 to 9 amino acids, for example, a length of 7 amino acids, contains the core sequence RX1X2R (SEQ ID NO: 9), and any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I. In a preferred embodiment, the hydrophobic amino acid is L.

[0071] In another embodiment, the peptide of the present invention or a salt thereof has at least 7 amino acids in length, at least 8 amino acids in length, or at least 9 amino acids in length, contains the core sequence RX1X2RRX3X4 (SEQ ID NO: 4), and any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I. In a preferred embodiment, the hydrophobic amino acid is L. In another embodiment, the peptide has at least 9 amino acids in length, for example 9, 13, or 21 amino acids in length. As described above, when the peptide or a salt thereof of this embodiment has more than 7 amino acids, additional amino acids are added to the C-terminus and / or N-terminus of the core sequence defined by SEQ ID NO: 4. Preferably, when the peptide according to this embodiment has more than 7 amino acids, the additional amino acids are added to the C-terminus of the core sequence defined by SEQ ID NO: 4.

[0072] In another embodiment, the peptide of the present invention or a salt thereof has a length of 7 to 21 amino acids, for example 9 to 21 amino acids in length, preferably 9 to 17 amino acids in length, more preferably 9 to 13 amino acids in length, for example 9 amino acids in length, contains the core sequence RX1X2RRX3X4 (SEQ ID NO: 4), and any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I. In a preferred embodiment, the hydrophobic amino acid is L.

[0073] In certain embodiments, the peptide of the present invention or a salt thereof is a peptide of the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), wherein any one of X1 to X5 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I. In a preferred embodiment, the hydrophobic amino acid is L. In certain embodiments, the peptide of the present invention is a peptide of the sequence RRX1X2RX3X4RX5X6RX7 (SEQ ID NO: 6), wherein any one of X1 to X7 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I. In a preferred embodiment, the hydrophobic amino acid is L. In certain embodiments, the peptide of the present invention is a peptide of the sequence RX1X2X3RX4X5RX6X7RX8 (SEQ ID NO: 10), wherein any one of X1 to X8 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I. In a preferred embodiment, the hydrophobic amino acid is L. In certain embodiments, the peptide of the present invention is a peptide of the sequence RRX1X2RX3X4RX5X6RX7X8RX9 (SEQ ID NO: 7), wherein any one of X1 to X9 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I. In a preferred embodiment, the hydrophobic amino acid is L.In certain embodiments, the peptide of the present invention is a peptide of the sequence RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL (SEQ ID NO: 8), wherein any one of X1 to X9 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I. In a preferred embodiment, the hydrophobic amino acid is L.

[0074] In one embodiment, the peptide or a salt thereof of the present invention is a peptide of the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), RRX1X2RX3X4RRX5X6RX7X8RRX9 (SEQ ID NO: 7) or RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL (SEQ ID NO: 8), wherein any one of X1 to X9 is an amino acid selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*) and a hydrophobic amino acid, and wherein the hydrophobic amino acid is selected from the group consisting of A, V, L, and I. In a preferred embodiment, the hydrophobic amino acid is L.

[0075] In certain embodiments, the peptide or a salt thereof is selected from the group consisting of Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11), Ac-RK*RRK*K*R-NH2 (SEQ ID NO: 12), Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13), Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14), Ac-RRLK*RK*LRRLK*RL-NH2 (SEQ ID NO: 15), Ac-RRK*K*RK*LRRLLRL-NH2 (SEQ ID NO: 16), Ac-RRHK*RLK*RRLK*RL-NH2 (SEQ ID NO: 17), Ac-RHLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 18), Ac-RHLK*RHK*RRLK*RH-NH2 (SEQ ID NO: 19), Ac-RRLK*RLLRRLK*RLK*RRL-NH2 (SEQ ID NO: 21) and Ac-RRLK*RLLRRLK*RLK*RRLRRLL-NH2 (SEQ ID NO: 23).

[0076] In a preferred embodiment, the peptide or a salt thereof is selected from the group consisting of Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14), Ac-RRLK*RK*LRRLK*RL-NH2 (SEQ ID NO: 15), Ac-RRRK*K*RK*LRRLLRL-NH2 (SEQ ID NO: 16), Ac-RRHK*RLK*RRLK*RL-NH2 (SEQ ID NO: 17), Ac-RHLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 18), Ac-RHLK*RHK*RRLK*RH-NH2 (SEQ ID NO: 19), Ac-RRLK*RLLRRLK*RLK*RRL-NH2 (SEQ ID NO: 21), Ac-RRLK*RLLRRLK*RLK*RRLRRLL-NH2 (SEQ ID NO: 23).

[0077] In another preferred embodiment, the peptide or a salt thereof is selected from the group consisting of Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11), Ac-RK*RRK*K*R-NH2 (SEQ ID NO: 12), Ac-RK*HK*HK*R-NH2 (SEQ ID NO: 49), Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13), Ac-RRK*HRK*K*H (SEQ ID NO: 54), RRK*LRK*K* (SEQ ID NO: 55), RRK*LRK*K*L (SEQ ID NO: 56), and RRRK*LRK*K*L (SEQ ID NO: 57).

[0078] In another preferred embodiment, the peptide or a salt thereof is selected from the group consisting of Ac-RK*IRK*K*H-NH2 (SEQ ID NO: 65), Ac-RK*VRK*K*H-NH2 (SEQ ID NO: 66), Ac-RK*HRK*K*H-OH (SEQ ID NO: 68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO: 69), Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO: 70), Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO: 71), and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQ ID NO: 72).

[0079] In another preferred embodiment, the peptide or a salt thereof is selected from the group consisting of NH2-RK*HRK*K*H-NH2 (SEQ ID NO: 69), Ac-RK*VRK*K*H-NH2 (SEQ ID NO: 66), and Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO: 71).

[0080] Preferably, the peptide or a salt thereof of the present invention is N-acylated and / or C-amidated. Even more preferably, the peptide or a salt thereof of the present invention is N-acylated and C-amidated.

[0081] The term "N-acylated peptide" according to the present invention refers to a peptide in which the N-terminal residue of the amino acid is acylated, preferably acetylated with acetyl.

[0082] The term "C-amidated" refers to a peptide in which the terminal carboxyl group is in the form of an amide group (-CO-NH2) instead of a carboxyl group (-COOH).

[0083] As described above, the peptide or a salt thereof of the present invention may contain L-amino acids and / or D-amino acids. Preferably, all of the amino acids contained in the peptide or a salt thereof of the present invention are L-amino acids. However, all of the amino acids contained in the peptide or a salt thereof of the present invention may be D-amino acids.

[0084] All terms and embodiments described elsewhere in this specification are equally applicable to these aspects of the present invention.

[0085] Amphiphilic molecule In a second aspect, the present invention relates to an amphiphilic molecule (also referred to as an "amphiphilic substance" in the present invention), a) a peptide or a salt thereof defined in the first aspect of the present invention, preferably the above-mentioned cationic peptide, and b) Three hydrophobic tails, wherein the three hydrophobic tails are connected to the peptide by a bond formed by the reaction of the reactive groups of the side chains of three basic amino acid residues of the peptide (the "first reactive group") with one or more precursors of the three hydrophobic tails, each precursor comprising a hydrophobic tail and a "second reactive group", and the second reactive group being capable of reacting with the reactive groups of the side chains of the three reactive basic amino acid residues of the peptide (the "first reactive group") as described above, the three hydrophobic tails relating to an amphiphilic molecule comprising or alternatively consisting of these.

[0086] As used herein, an "amphiphilic molecule" is a molecule composed of a hydrophilic group and a hydrophobic group.

[0087] The term "peptide" has been described in detail above and is equally applicable to the amphiphilic molecules according to the invention. All embodiments and preferred forms described above are equally applicable to the amphiphilic molecules defined herein.

[0088] As used herein, the term "hydrophobic moiety" or "hydrophobic tail" refers to a group or molecule that is not attracted to water and has a significant nonpolar surface area under physiological pH and / or salt conditions. This phase separation can be observed by a combination of dynamic light scattering and aqueous NMR measurements. Typically, the hydrophobic moiety is lipophilic, which means it is soluble or miscible in fats, oils, lipids, and lipophilic nonpolar solvents such as hexane or toluene. Suitable hydrophobic tails or hydrophobic moieties for use in the present invention include any hydrophobic group. It is preferably an alkyl group or an alkenyl group, most preferably an alkenyl group. The alkyl group may be substituted and functionalized, for example, to improve hydrophobicity. The alkyl group may be straight-chain or branched-chain, cyclic or acyclic. The carbon chain may contain one or more oxygen atoms at one or more positions of the main chain.

[0089] In some embodiments, the hydrophobic moiety or hydrophobic tail is an aliphatic carbon chain. As used herein, the term "aliphatic carbon chain" refers to a hydrocarbon based on a chain of carbon atoms. There are three types of aliphatic hydrocarbons. An alkane is an aliphatic hydrocarbon having only single covalent bonds. An alkene is a hydrocarbon containing at least one C-C double bond, and an alkyne is a hydrocarbon containing a C-C triple bond. In a preferred embodiment of the amphiphilic substance of the present invention, the hydrophobic moiety comprises an alkane. Suitable aliphatic carbon chains that can be incorporated into the amphiphilic moiety according to the present invention are at least 2 carbon atoms (C2), at least 3 carbon atoms (C3), at least 4 carbon atoms (C4), at least 5 carbon atoms (C5), at least 6 carbon atoms (C6), at least 7 carbon atoms (C7), at least 8 carbon atoms (C8), at least 9 carbon atoms (C9), at least 10 carbon atoms (C10), at least 12 carbon atoms (C12), at least 14 carbon atoms (C14), at least 16 carbon atoms (C16), at least 18 carbon atoms (C18), at least 20 carbon atoms (C20), at least 22 carbon atoms (C22), at least 24 carbon atoms (C24) or more.

[0090] The term "hydrophobic tail precursor" refers to a molecule comprising the previously defined hydrophobic tail and a reactive group (the "second reactive group" according to the present disclosure) capable of reacting with a reactive group (the "first reactive group" according to the present disclosure) of the side chains of the three reactive basic amino acid residues of the peptide of the present invention to form a covalent bond. In certain embodiments, the second reactive group present in the hydrophobic tail precursor refers to any entity capable of forming a covalent bond as described in relation to the first reactive group. Thus, the amphiphilic molecule is obtained by conjugating the peptide of the present invention with three hydrophobic tail precursors via a reactive group (the "first reactive group") present in the side chains of the three reactive basic amino acid residues of the peptide and a reactive group (the "second reactive group") of the three hydrophobic tail precursors.

[0091] In a preferred embodiment, the three hydrophobic moieties or hydrophobic tails are selected from a C6 aliphatic chain, a C8 aliphatic chain, a C10 aliphatic chain, a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group, a petroselinyl group, an oleyl group, a linoleoyl group, an eicosynoyl group, and a tetracosenoleyl group, or a mixture thereof.

[0092] More preferably, the three hydrophobic moieties or hydrophobic tails are selected from a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group, and a petroselinyl group, or a mixture thereof. Even more preferably, the three hydrophobic moieties or hydrophobic tails are selected from a myristoleyl group, a palmitoleyl group, and a petroselinyl group, or a mixture thereof.

[0093] In certain embodiments, the second reactive group present in the hydrophobic tail precursor is selected from the group consisting of an aldehyde, a carboxylic acid, and an alcohol.

[0094] In some embodiments where the second reactive group is an aldehyde, the hydrophobic tail precursor is selected from the group consisting of hexanal, octanal, decanal, dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde, petroselinyl aldehyde, oleyl aldehyde, linoleoyl aldehyde, eicosynoyl aldehyde, and tetracosenoleyl aldehyde, or a mixture thereof. These precursors result in amphiphilic peptides where the hydrophobic tail is a C6 aliphatic chain, a C8 aliphatic chain, a C10 aliphatic chain, a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group, a petroselinyl group, an oleyl group, a linoleoyl group, an eicosynoyl group, and a tetracosenoleyl group, respectively, or a mixture thereof.

[0095] In some embodiments, when the second reactive group is a carboxylic acid, the hydrophobic tail precursor is selected from the group consisting of hexanoic acid, octanoic acid, decanoic acid, dodecanoic acid, myristoleic acid, palmitoleic acid, petroselinic acid, oleic acid, linoleic acid, eicosenoic acid, tetracosenoic acid, or a mixture thereof. These precursors result in an amphiphilic peptide where the three hydrophobic tails are a C6 aliphatic chain, a C8 aliphatic chain, a C10 aliphatic chain, a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group, a petroselinyl group, an oleyl group, a linoleoyl group, an eicosenoyl group, a tetracosenoleyl group, respectively, or a mixture thereof.

[0096] In some embodiments, when the second reactive group is an alcohol, the hydrophobic tail precursor is selected from the group consisting of hexanol, octanol, decanol, dodecanol, myristoleyl alcohol, palmitoleyl alcohol, petroselinyl alcohol, oleyl alcohol, linoleoyl alcohol, gondoil alcohol, tetracosenoleyl alcohol, or a mixture thereof. These precursors result in an amphiphilic peptide where the hydrophobic tails are a C6 aliphatic chain, a C8 aliphatic chain, a C10 aliphatic chain, a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group, a petroselinyl group, an oleyl group, a linoleoyl group, an eicosenoyl group, a tetracosenoleyl group, respectively, or a mixture thereof.

[0097] Preferably, the second reactive group is an aldehyde, and the hydrophobic tail precursor is selected from the group consisting of hexanal, octanal, decanal, dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde, petroselinyl aldehyde, oleyl aldehyde, linoleoyl aldehyde, eicosenoyl aldehyde, and tetracosenoleyl aldehyde, or a mixture thereof; more preferably selected from dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde, and petroselinyl aldehyde, or a mixture thereof; even more preferably selected from myristoleyl aldehyde, palmitoleyl aldehyde, and petroselinyl aldehyde, or a mixture thereof.

[0098] Thus, in a preferred embodiment, the amphiphilic molecule of the present invention is (i) a peptide according to the present invention or a salt thereof, preferably a cationic peptide, having a length of 7 amino acids, containing only basic amino acids selected from the group consisting of reactive basic amino acid residues containing R and H and a reactive group (i.e., the peptide does not contain hydrophobic amino acids), the number of R amino acids of the peptide is at least 2, the number of H amino acids of the peptide is 1 or 2, preferably 2, and the number of reactive basic amino acid residues containing the reactive group of the peptide is 3, preferably the basic amino acid containing the reactive group is selected from K*, Dab* and O*, preferably selected from K*, a peptide or a salt thereof, and (ii) three hydrophobic moieties selected from a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoleyl group, a palmitoleyl group and a petroselinyl group and containing.

[0099] In another embodiment, the amphiphilic molecule of the present invention is (i) a peptide according to the present invention or a salt thereof, preferably a cationic peptide, selected from the group consisting of Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1), Ac-RHK*K*K*HR-NH2 (SEQ ID NO: 2), Ac-RK*HHK*K*R-NH2 (SEQ ID NO: 3), Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53), Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58) and Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59), a peptide or a salt thereof, and (ii) three hydrophobic moieties selected from a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoleyl group, a palmitoleyl group and a petroselinyl group and containing.

[0100] In another embodiment, the amphiphilic molecule of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, selected from the group consisting of Ac-RK*IRK*K*H-NH2 (SEQ ID NO: 65), Ac-RK*VRK*K*H-NH2 (SEQ ID NO: 66), Ac-RK*HRK*K*H-OH (SEQ ID NO: 68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO: 69), Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO: 70), Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO: 71) and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQ ID NO: 72), a peptide or a salt thereof, and (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group and a petroselinyl group, more preferably selected from a myristoyl group, a palmitoleyl group and a petroselinyl group, and even more preferably selected from a myristoyl group and

[0101] In another embodiment, the amphiphilic molecule of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having at least 7 amino acids in length, containing a core sequence RX1X2R (SEQ ID NO: 9), wherein any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L and I, and preferably the hydrophobic amino acid is L, a peptide or a salt thereof, and (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group and a petroselinyl group and

[0102] In another embodiment, the amphiphilic molecule of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having a length of 7 to 21 amino acids, preferably 7 to 17 amino acids, more preferably 7 to 13 amino acids, even more preferably 7 to 9 amino acids, for example, having a length of 7 amino acids, containing the core sequence RX1X2R (SEQ ID NO: 9), wherein any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, preferably the hydrophobic amino acid is L, a peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group, and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoleyl group, a palmitoleyl group, and a petroselinyl group and comprising.

[0103] In another embodiment, the amphiphilic molecule of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having a length of at least 7 amino acids, at least 8 amino acids or at least 9 amino acids, containing the core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, preferably the hydrophobic amino acid is L, preferably the peptide has a length of at least 9 amino acids, for example, 9, 13 or 21 amino acids, a peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group, and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoleyl group, a palmitoleyl group, and a petroselinyl group and comprising.

[0104] In another embodiment, the amphiphilic molecule of the present invention is (i) a peptide according to the present invention or a salt thereof, preferably a cationic peptide, having a length of 7 to 21 amino acids, for example 9 to 21 amino acids, preferably 9 to 17 amino acids, more preferably 9 to 13 amino acids, for example 9 amino acids, and containing the core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, a peptide or a salt thereof, and (ii) three hydrophobic moieties selected from a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group, and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoleyl group, a palmitoleyl group, and a petroselinyl group and comprising.

[0105] In a further embodiment, the amphiphilic molecule of the present invention is (i) a peptide according to the present invention or a salt thereof, preferably a cationic peptide, consisting of the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), wherein any one of X1 to X5 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, a peptide or a salt thereof, and (ii) three hydrophobic moieties selected from a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group, and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoleyl group, a palmitoleyl group, and a petroselinyl group and comprising.

[0106] In a further embodiment, the amphiphilic molecule of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having the sequence RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), wherein any one of X1 to X7 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, and the peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, and.

[0107] In a further embodiment, the amphiphilic molecule of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having the sequence RX1X2X3RX4X5RRX6X7RX8 (SEQ ID NO: 10), wherein any one of X1 to X8 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, and the peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, and.

[0108] In a further embodiment, the amphiphilic molecule of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, consisting of the sequence RRX1X2RX3X4RRX5X6RX7X8RRX9 (SEQ ID NO: 7), wherein any one of X1 to X9 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, and the peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, and comprises.

[0109] In a further embodiment, the amphiphilic molecule of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, consisting of the sequence RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL (SEQ ID NO: 8), wherein any one of X1 to X9 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, and the peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, and comprises.

[0110] In a further embodiment, the amphiphilic molecule of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), RRX1X2RX3X4RRX5X6RX7X8RRX9 (SEQ ID NO: 7) or RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL (SEQ ID NO: 8), wherein any one of X1 to X9 is an amino acid selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is selected from the group consisting of A, V, L and I, preferably L, and the peptide or a salt thereof, (ii) three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group and a petroselinyl group, and comprises.

[0111] Two representative examples of the reaction between the reactive groups of the peptide or a salt thereof are shown in Table A below. The groups within modified lysine and / or ornithine, and the hydrophobic tail precursors (having an aldehyde as the second reactive group in these examples) are shown below. TIFF2025522522000006.tif113170Table A. Tail attachment to lysine residue. The tail is represented by a three-dimensional sphere attached to the reactive group. The reactive group is specified in each case.

[0112] In one embodiment, the three hydrophobic tail precursors are hexanal, resulting in a hydrophobic tail containing a C6 aliphatic chain. In one embodiment, the three hydrophobic tail precursors are octanal, resulting in a hydrophobic tail containing a C8 aliphatic chain. In one embodiment, the three hydrophobic tail precursors are decanal, resulting in a hydrophobic tail containing a C10 aliphatic chain. In one embodiment, the three hydrophobic tail precursors are dodecanal, resulting in a hydrophobic tail containing a C12 aliphatic chain. In one embodiment, the three hydrophobic tail precursors are myristoleyl aldehyde, resulting in a hydrophobic tail consisting of an unsaturated C14 aliphatic chain. In one embodiment, the three hydrophobic tail precursors are palmitoleyl aldehyde, resulting in a hydrophobic tail consisting of an unsaturated C16 aliphatic chain. In one embodiment, the three hydrophobic tail precursors are petroselinyl aldehyde, resulting in a hydrophobic tail consisting of an unsaturated C18 aliphatic chain. In one embodiment, the three hydrophobic tail precursors are oleyl aldehyde, resulting in a hydrophobic tail consisting of a C18 aliphatic chain containing a single unsaturation. In one embodiment, the three hydrophobic tail precursors are linoleoyl aldehyde, resulting in a hydrophobic tail consisting of a C18 aliphatic chain containing two unsaturations. In some embodiments, the three hydrophobic tail precursors are eicosenoyl aldehyde, resulting in a hydrophobic tail consisting of a C20 aliphatic chain containing a single unsaturation. In one embodiment, the three hydrophobic tail precursors are tetracosenoleyl aldehyde, resulting in a hydrophobic tail consisting of a C24 aliphatic chain containing a single unsaturation. In certain embodiments, the tail is a hydrophobic aldehyde precursor selected from the group consisting of myristoleyl aldehyde, palmitoleyl aldehyde, and petroselinyl aldehyde, or mixtures thereof.

[0113] In a preferred embodiment, the amphiphilic molecule of the present invention is any one of the following specific combinations. -[7.3(Leu-His)] The cationic peptide is Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1) or a salt thereof, the spacer containing a reactive group is glutamic acid monohydrazide, and the tail is selected from dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde or petroselinyl aldehyde, preferably selected from myristoleyl aldehyde, palmitoleyl aldehyde or petroselinyl aldehyde, and even more preferably selected from myristoleyl aldehyde, and is produced by conjugation with a hydrophobic tail precursor. -[V1-7.3(Leu-His)] The cationic peptide is Ac-RHK*K*K*HR-NH2 (SEQ ID NO: 2) or a salt thereof, the spacer containing a reactive group is glutamic acid monohydrazide, and the tail is selected from dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde or petroselinyl aldehyde, preferably selected from myristoleyl aldehyde, palmitoleyl aldehyde or petroselinyl aldehyde, and even more preferably selected from myristoleyl aldehyde, and is produced by conjugation with a hydrophobic tail precursor. -[V2-7.3(Leu-His)] The cationic peptide is Ac-RK*HHK*K*R-NH2 (SEQ ID NO: 3) or a salt thereof, the spacer containing a reactive group is glutamic acid monohydrazide, and the tail is selected from dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde or petroselinyl aldehyde, preferably selected from myristoleyl aldehyde, palmitoleyl aldehyde or petroselinyl aldehyde, and even more preferably selected from myristoleyl aldehyde, and is produced by conjugation with a hydrophobic tail precursor. -[7.3] The cationic peptide is Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is selected from dodecanal, myristoleyl aldehyde, palmityleyl aldehyde, petroselinyl aldehyde, or oleyl aldehyde, preferably selected from myristoleyl aldehyde, palmityleyl aldehyde or petroselinyl aldehyde, and more preferably selected from myristoleyl aldehyde, and is generated by conjugation with a hydrophobic tail precursor. -[7.3(Leu-Arg)] The cationic peptide is Ac-RK*RRK*K*R-NH2 (SEQ ID NO: 12) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is selected from palmityleyl aldehyde or petroselinyl aldehyde, preferably selected from myristoleyl aldehyde, palmityleyl aldehyde or petroselinyl aldehyde, and more preferably selected from myristoleyl aldehyde, and is generated by conjugation with a hydrophobic tail precursor. -[7.3(L-H)(K-O)] The cationic peptide is Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is selected from myristoleyl aldehyde, palmityleyl aldehyde or petroselinyl aldehyde, preferably selected from myristoleyl aldehyde, and is generated by conjugation with a hydrophobic tail precursor. -[9.3] The cationic peptide is Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is selected from dodecanal, myristoleyl aldehyde, palmityleyl aldehyde, petroselinyl aldehyde, or oleyl aldehyde, preferably selected from myristoleyl aldehyde, palmityleyl aldehyde or petroselinyl aldehyde, or selected from dodecanal or palmityleyl aldehyde, and is generated by conjugation with a hydrophobic tail precursor. -[13.3] The cationic peptide is Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from dodecanal, myristoleyl aldehyde, palmoleyl aldehyde, petroselinyl aldehyde, or oleyl aldehyde. -[13.3(2+1)] The cationic peptide is Ac-RRLK*RK*LRRLK*RL-NH2 (SEQ ID NO: 15) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from dodecanal, palmoleyl aldehyde, or petroselinyl aldehyde. -[13.3(3b)] The cationic peptide is Ac-RRK*K*RK*LRRLLRL-NH2 (SEQ ID NO: 16) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from dodecanal, myristoleyl aldehyde, or petroselinyl aldehyde. -[13.3(Leu-His)] The cationic peptide is Ac-RRHK*RLK*RRLK*RL-NH2 (SEQ ID NO: 17) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from dodecanal, myristoleyl aldehyde, palmoleyl aldehyde, petroselinyl aldehyde, oleyl aldehyde, or tetracosenoleyl aldehyde. -[13.3(Arg-His)] The cationic peptide is Ac-RHLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 18) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from dodecanal, myristoleyl aldehyde, palmoleyl aldehyde, petroselinyl aldehyde, oleyl aldehyde, eicosenoyl aldehyde, or tetracosenoleyl aldehyde. -[13.3(3His)] The cationic peptide is Ac-RHLK*RHK*RRLK*RH-NH2 (SEQ ID NO: 19) or a salt thereof, the spacer containing a reactive group is glutamic acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde, petroselinyl aldehyde, or oleyl aldehyde. -[17.3] The cationic peptide is Ac-RRLK*RLLRRLK*RLK*RRL-NH2 (SEQ ID NO: 21) or a salt thereof, the spacer containing a reactive group is glutamic acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde, or petroselinyl aldehyde. -[21.3] The cationic peptide is Ac-RRLK*RLLRRLK*RLK*RRLRRLL-NH2 (SEQ ID NO: 23) or a salt thereof, the spacer containing a reactive group is glutamic acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor which is palmitoleyl aldehyde. -[R+7.3(L-H)-H] The cationic peptide is Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53) or a salt thereof, the spacer containing a reactive group is glutamic acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor which is myristoleyl aldehyde. -[R+7.3(L-H)] The cationic peptide is Ac-RRK*HRK*K*H-NH2 (SEQ ID NO: 54) or a salt thereof, the spacer containing a reactive group is glutamic acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor which is myristoleyl aldehyde. -[R+7.3-L] The cationic peptide is Ac-RRK*LRK*K*-NH2 (SEQ ID NO: 55) or a salt thereof, the spacer containing a reactive group is glutamic acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. -[R+7.3] The cationic peptide is Ac-RRK*LRK*K*L-NH2 (SEQ ID NO: 56) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. -[RR+7.3] The cationic peptide is Ac-RRRK*LRK*K*L-NH2 (SEQ ID NO: 57) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. -[V3-7.3(L-H)] The cationic peptide is Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. -[V4-7.3(L-H)] The cationic peptide is Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. -[7.3(H, I)] The cationic peptide is Ac-RK*IRK*K*H-NH2 (SEQ ID NO: 65) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. -[7.3(H, V)] The cationic peptide is Ac-RK*VRK*K*H-NH2 (SEQ ID NO: 66) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. The -[7.3(L-H)-OH] cationic peptide is Ac-RK*HRK*K*H-OH (SEQ ID NO: 68) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. The -[NH2-7.3(L-H)] cationic peptide is NH2-RK*HRK*K*H-NH2 (SEQ ID NO: 69) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. The -[7.3(L-H, K-Dab)] cationic peptide is Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO: 70) or a salt thereof, the spacer containing a reactive group is glutaric acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. The -[7.3(L-H, ONH2)] cationic peptide is Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO: 71) or a salt thereof, the spacer containing a reactive group is aminooxyacetic acid, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde. The -[7.3(L-H, C4Hyd)] cationic peptide is Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQ ID NO: 72) or a salt thereof, the spacer containing a reactive group is succinic acid monohydrazide, and the tail is produced by conjugation with a hydrophobic tail precursor selected from myristoleyl aldehyde.

[0114] In certain embodiments, the amphiphilic molecule of the invention is obtained by reacting a cationic peptide or a salt thereof with three precursors of a hydrophobic tail, the three precursors containing a second reactive group that reacts with the reactive groups of the three reactive basic amino acid residues that form the covalent bond as described above.

[0115] In another preferred embodiment, the bond formed by the reaction of the reactive groups of the side chains of the three reactive basic amino acid residues with the three precursors of the hydrophobic tail containing a second reactive group capable of reacting with the reactive groups of the side chains of the reactive basic amino acid residues of the hydrophobic tail and the cationic peptide is an amide bond, and an ester bond, a hydrazone bond or an oxime bond.

[0116] In another embodiment, the reactive basic amino acid residue containing a primary amine in its side chain is reactive lysine (K*), reactive ornithine (O*), or reactive Dab (Dab*), and the covalent bond is formed, as described above, (i) between the hydrophobic tail precursor and natural lysine, natural ornithine, or natural Dab, or (ii) between the hydrophobic tail precursor and modified lysine, modified ornithine, or modified Dab.

[0117] In a preferred embodiment, the second reactive group is an aldehyde, and the aldehyde is selected from the group consisting of myristoleyl aldehyde, palmitoleyl aldehyde, and petroselinyl aldehyde.

[0118] In other embodiments, (i) The peptide of the present invention or a salt thereof, which is preferably a cationic peptide of the amphiphilic molecule of the present invention, is Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1) or Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11) or a salt thereof, and the spacer connecting each reactive group of the side chain of the peptide and each ε-amino group of the lysine residue is obtained by reacting the peptide or a salt thereof with glutaric acid monohydrazide (i.e., at least 3 molecules of glutaric acid monohydrazide per molecule of the peptide), thereby obtaining a hydrazide-activated peptide (i.e., a polyhydrazide-activated peptide because the peptide has three hydrazide-reactive groups as described above), and then contacting the polyhydrazide-activated peptide or a salt thereof with myristoleyl aldehyde or palmitoleyl aldehyde, which is a hydrophobic tail precursor. (ii) The peptide or a salt thereof according to the present invention, which is preferably a cationic peptide, is Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14) or a salt thereof. The spacer that connects each reactive group in the side chain of the peptide and each ε-amino group of the lysine residue is formed by reacting the peptide or a salt thereof with glutaric acid monohydrazide (i.e., at least 3 molecules of glutaric acid monohydrazide per molecule of the peptide), thereby obtaining a hydrazide-activated peptide (i.e., a polyhydrazide-activated peptide because the peptide has 3 hydrazide-reactive groups as described above), and then contacting the polyhydrazide-activated peptide or a salt thereof with palmitroleyl aldehyde or petroselinyl aldehyde, which is a hydrophobic tail precursor. (iii) The peptide or a salt thereof according to the present invention, which is preferably a cationic peptide, is selected from the group consisting of Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53), Ac-RRK*HRK*K*H-NH2 (SEQ ID NO: 54), Ac-RRK*LRK*K*-NH2 (SEQ ID NO: 55), Ac-RRK*LRK*K*L-NH2 (SEQ ID NO: 56), Ac-RRRK*LRK*K*L-NH2 (SEQ ID NO: 57), Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58), and Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59). The spacer that connects each reactive group in the side chain of the peptide and each ε-amino group of the lysine residue or each δ-amino group of the ornithine residue is formed by reacting the peptide or a salt thereof with glutaric acid monohydrazide (i.e., at least 3 molecules of glutaric acid monohydrazide per molecule of the peptide), thereby obtaining a hydrazide-activated peptide (i.e., a polyhydrazide-activated peptide because the peptide has 3 hydrazide-reactive groups as described above), and then contacting the polyhydrazide-activated peptide or a salt thereof with myristoleyl aldehyde, which is a hydrophobic tail precursor. (iv) The peptide or a salt thereof according to the present invention, which is preferably a cationic peptide, is selected from the group consisting of Ac-RK*IRK*K*H-NH2 (SEQ ID NO: 65), Ac-RK*VRK*K*H-NH2 (SEQ ID NO: 66), Ac-RK*HRK*K*H-OH (SEQ ID NO: 68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO: 69) and Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO: 70), or a salt thereof, and a spacer connecting each reactive group of the side chain of the peptide to each ε-amino group of the lysine residue or each γ-amino group of the Dab residue is formed by reacting the peptide or a salt thereof with glutaric acid monohydrazide (i.e., at least 3 molecules of glutaric acid monohydrazide per molecule of the peptide), thereby obtaining a hydrazide-activated peptide (i.e., a polyhydrazide-activated peptide since the peptide has 3 hydrazide-reactive groups as described above), and then contacting the polyhydrazide-activated peptide or a salt thereof with myristoyl aldehyde which is a hydrophobic tail precursor. (v) The peptide or a salt thereof according to the present invention, which is preferably a cationic peptide, is selected from the group consisting of Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO: 71) and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQ ID NO: 72) or salts thereof, and a spacer connecting each reactive group of the side chain of the peptide to each ε-amino group of the lysine residue is formed by reacting the peptide or a salt thereof with 3 molecules of aminooxyacetic acid or succinic acid monohydrazide per molecule of the peptide, thereby obtaining a (poly)aminooxy-activated peptide or a (poly)hydrazide-activated peptide, and then contacting the (poly)aminooxy-activated peptide or the (poly)hydrazide-activated peptide with myristoyl aldehyde which is a hydrophobic tail precursor.

[0119] All terms and embodiments described elsewhere in this specification are equally applicable to these aspects of the present invention.

[0120] Complex containing amphiphilic molecules and biologically important molecules In a third aspect, the invention relates to a) at least one amphiphilic molecule according to the second aspect of the invention, and b) at least one molecule that is biologically important in a complex.

[0121] In a preferred embodiment, the biologically important molecule is any molecule that forms a complex with the amphiphilic molecule of the invention when contacted under suitable conditions, such as physiological pH. In certain embodiments, the pH is any of those specified below, preferably 7.4.

[0122] In the context of the present invention, "physiological pH" refers to the pH of a body fluid, which is preferably blood. In certain embodiments, the physiological pH is 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.35, 7.4, 7.45, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, preferably 7.4. Methods for determining the pH of a body fluid are well known to those skilled in the art. Non-limiting examples of such methods include extracting a sample of the body fluid of interest, preferably blood, and measuring its pH with a pH meter. Further, methods for determining whether a solution is at a specific pH, such as physiological pH, are well known to those skilled in the art and may simply consist of isolating a sample of the above solution (rinsing beforehand with milliQ water and using autoclaved materials), and determining the pH of the sample corresponding to the pH of the solution using a pH meter. Methods for adjusting the pH of a solution to physiological pH or the like are also well known to those skilled in the art. The above methods include gradually adding a hydroxide solution if the pH is too low or hydrochloric acid if the pH is too high until the desired pH is reached. As used herein, the expression "contacting at physiological pH" refers to any process that allows biologically important molecules to occupy the same space as the amphiphilic molecules of the present invention in the same space simultaneously within a solution of physiological pH. Non-limiting examples of such methods can consist of combining a solution of the amphiphilic molecules of the present invention and a solution of biologically important molecules in a single recipient, and adjusting the pH to physiological pH. Another non-limiting example of such a method can consist of contacting the amphiphilic molecules and biologically important molecules of the present invention with a buffer solution of physiological pH. Thus, preferably, the amphiphilic molecules of the present invention can form a complex with one or more biologically important molecules, preferably when the contact between the biologically important molecules and the amphiphilic molecules of the present invention occurs under conditions suitable for the binding of the amphiphilic molecules and the biologically important molecules. In the context of the present invention, the formation of a complex between an amphiphilic molecule and a biologically important molecule may be referred to as "binding or complexation of an amphiphilic molecule and a biologically important molecule". This binding may also be referred to as supramolecular complexation, electrostatic interaction or packaging.This binding can occur via electrostatic and / or hydrophobic interactions. Methods for examining whether a complex is formed between an amphiphilic molecule and a biologically important molecule at a specific pH are well known to those skilled in the art. For example, electrophoretic mobility shift assay (EMSA) or dynamic light scattering (DLS) can be used for this purpose.

[0123] In a preferred embodiment, the biologically important molecule has a negative net charge. References herein to "positive," "negative," or "neutral" charges refer to the overall charge state of the biologically important molecule moiety under specific conditions. Also, under some conditions, for example, under specific pH conditions, a moiety may be referred to as "partially deprotonated" or "partially protonated" or "partially charged," which means that a specific percentage of the total moieties of the composition are charged. The zeta potential may be useful, for example, in determining the net charge measured using laser Doppler microelectrophoresis techniques for measuring zeta potential (e.g., using a Zetasizer Nano ZS from Malvern Panalytical).

[0124] Preferably, the biologically important molecule is selected from the group consisting of proteins, nucleic acids, nucleoproteins, and small molecules. More preferably, the biologically important molecule is selected from the group consisting of proteins, nucleic acids, and nucleoproteins.

[0125] In a preferred embodiment, the biologically important molecule is a nucleic acid. As used herein, the term "nucleic acid" or "polynucleotide" refers to a polymer of two or more deoxyribonucleotides, ribonucleotides, nucleotide analog molecules, and / or molecules that are structurally similar to natural nucleic acids but have a molecule that is different from natural nucleic acids in one or more of the nucleic acid backbone (e.g., the phosphate of natural nucleic acids), nucleic acid sugar (e.g., deoxyribose of natural DNA and ribose of natural RNA), and / or nucleic acid base (e.g., adenine, cytosine, guanine, thymine, or uracil of natural nucleic acids), e.g., through chemical modification.

[0126] As used herein, the term "nucleic acid" or "polynucleotide" also refers to modified nucleic acids, i.e., synthetic gene polymers, such as chemically modified nucleic acids or xeno nucleic acids (modified backbone, sugar, or nucleic acid base, and further XNA indicating novel bases or base pairs, e.g., see Pardi, N., Hogan, M. J., Porter, F. W., & Weissman, D. (2018) mRNA vaccines - a new era in vaccinology, Nat. Rev. Drug Discov., 17(4), 261 - 279, Khvorova, A., & Watts, J. K. (2017) The chemical evolution of oligonucleotide therapies of clinical utility. Nat. Biotechnol., 35(3), 238 - 248, and Duffy, K., Arangundy - Franklin, S. & Holliger, P. (2020) Modified nucleic acids: replication, evolution, and next - generation therapeutics BMC Biol. 18, 112). Examples of chemically modified nucleic acids include those containing methoxyuridine, N1 - methylpseudouridine, phosphorothioate, PNA, or LNA.

[0127] The nucleic acids of the present invention can be double-stranded or single-stranded oligonucleotides such as, but not limited to, plasmid DNA (pDNA), messenger RNA (mRNA), small interfering RNA (siRNA), small hairpin RNA (shRNA), microRNA (miRNA), antisense oligonucleotide (ASO), aptamer, gene editing guide, self-amplifying RNA (saRNA, see, for example, Bloom, K., van den Berg, F. & Arbuthnot, P. (2021) Self-amplifying RNA vaccines for infectious diseases. Gene Ther 28, 117-129), or ribozyme. In a preferred embodiment, the nucleic acid is pDNA, siRNA, or mRNA. The polynucleotide can also be minicircle DNA. A minicircle is a small (about 4 kb) circular plasmid derivative that does not have any bacterial plasmid DNA backbone.

[0128] As described above, the nucleic acids of the present invention can contain two or more deoxyribonucleotides, ribonucleotides, nucleotide analog molecules and / or modified nucleotides. In certain embodiments, the transcription and translation of the above nucleic acids are carried out by the transcription and translation mechanisms inside the cells into which the complex of the present invention has been introduced / delivered. Furthermore, the transcription of the nucleic acids of the present invention can result in functional nucleic acids such as aptamers, ribozymes, and / or shRNA inside the cells into which the complex of the present invention has been introduced / delivered.

[0129]

[0130] ​As used herein, "shRNA" or "short hairpin RNA" or "small hairpin RNA" is an artificial RNA molecule having a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). shRNAs typically contain a double-stranded region and a loop region at one end that forms the hairpin loop. The double-stranded region is typically about 19 to about 29 nucleotides in length on both sides of the stem, and the loop region is typically about 3 to about 10 nucleotides in length.

[0131] The term "aptamer" refers, in the context of the present invention, to a single-stranded nucleic acid strand that adopts a specific tertiary structure that enables it to bind to a molecular target with high specificity and affinity comparable to that of a monoclonal antibody, via interactions other than conventional Watson-Crick base pairing.

[0132] The term "antisense" refers to the use of nucleic acids that are complementary to the coding (i.e., "sense") base sequence of a target gene. When nucleic acids that are essentially antisense are introduced into cells, they can hybridize to the complementary "sense" mRNA via normal Watson-Crick base pairing. Short synthetic antisense DNA strands about 15 to 17 nucleotides in length can be used to specifically block gene expression by physically blocking the translation of the target mRNA or by causing its degradation.

[0133] In some embodiments, the nucleic acids of the present invention are mRNAs or pDNAs that, when delivered to cells (or transcribed in the case of pDNA), are translated into a protein of interest that can be directed to the cytoplasm or nucleus of the cell. It will be understood that the present invention contemplates that the complexes of the present invention may contain an mRNA encoding any of the proteins recited below, including any of the immunogenic proteins recited below. In some embodiments, one or more uridine residues in the mRNA are replaced by 5-methoxyuridine (5-moU) or N1-methylpseudouridine.

[0134] In one embodiment, the nucleic acid forming part of the complex of the present invention comprises an mRNA sequence encoding the prefusion-stabilized spike protein of coronavirus SARS-CoV-2 (protein S of SEQ ID NO: 27). In certain embodiments, the nucleic acid of the present invention is a polymer having ribonucleotides and / or nucleotide analogs and comprises an mRNA sequence encoding the prefusion-stabilized spike protein of SARS-CoV-2 (protein S). In a preferred embodiment, the mRNA sequence (open reading frame, ORF) encoding the prefusion-stabilized protein S of SARS-CoV-2 is the sequence of SEQ ID NO: 27.

[0135] In another embodiment, the nucleic acid forming part of the complex of the present invention comprises an mRNA sequence encoding ovalbumin (OVA). In certain embodiments, the nucleic acid of the present invention is a polymer having ribonucleotides and / or nucleotide analogs and comprises an mRNA sequence encoding ovalbumin. For example, the mRNA sequence encoding OVA can be obtained from TriLink (e.g., CleanCap® OVA mRNA (5moU)-(L-7210) or CleanCap® OVA mRNA-(L-7610)).

[0136] In another embodiment, the nucleic acid forming part of the complex of the present invention comprises an mRNA sequence encoding a detectable marker. Useful detectable marker proteins that can be encoded by the mRNA and / or pDNA forming part of the complex of the present invention include luciferase, green fluorescent protein (GFP), DsRed, lacZ, thymidine kinase, and the like.

[0137] In another embodiment, the nucleic acid forming part of the complex of the present invention comprises an mRNA sequence encoding Cre recombinase (Cre). In certain embodiments, the nucleic acid of the present invention is a polymer having ribonucleotides and / or nucleotide analogs comprising an RNA sequence encoding Cre recombinase. For example, the mRNA sequence encoding Cre recombinase can be obtained from TriLink (e.g., L-7211, CleanCap® Cre mRNA (5moU)).

[0138] In a preferred embodiment, the detectable marker is a luciferase protein, preferably firefly luciferase. The mRNA sequence (ORF) encoding the luciferase protein can be obtained from TriLink (e.g., Cleancap® FLuc (5-moU), L-7202). The mRNA sequence encoding the GFP protein (ORF) can be obtained from TriLink (e.g., CleanCap® EGFP mRNA (5moU), L-7201).

[0139] In certain aspects, the nucleic acid is a ribozyme. A ribozyme (ribonucleic acid enzyme) is an RNA molecule that has the ability to catalyze specific biochemical reactions such as RNA splicing in gene expression, similar to the action of protein enzymes. Ribozyme has been proposed and developed for the treatment of diseases. For example, ribozymes have been proposed for the inhibition of RNA-based viruses, for example, ribozymes against HIV infection, or ribozymes against hepatitis C virus RNA, SARS coronavirus (SARS-CoV), adenovirus, and influenza virus A and B RNA.

[0140] Thus, in one embodiment, the complex of the present invention is a) at least one amphiphilic molecule according to a second aspect of the present invention, and b) at least one biologically important molecule, which is a nucleic acid molecule, preferably pDNA, mRNA or siRNA, at least one biologically important molecule comprises.

[0141] For example, the complex of the present invention is (i) a peptide according to the present invention or a salt thereof, preferably a cationic peptide, having a length of 7 amino acids, containing only basic amino acids selected from the group consisting of reactive basic amino acid residues containing R and H and a reactive group (i.e., the peptide or its salt does not contain hydrophobic amino acids), the number of R amino acids in the peptide is at least 2, the number of H amino acids in the peptide or its salt is 1 or 2, preferably 2, and the number of reactive basic amino acid residues containing a reactive group in the peptide or its salt is 3, preferably the basic amino acid containing a reactive group is selected from K*, Dab* and O*, preferably selected from K* and O*, and even more preferably selected from K*, a peptide or a salt thereof, and (ii) three hydrophobic moieties selected from a C12 aliphatic chain, a myristoleyl group, a palmitoleyl group and a petroselinyl group, preferably three hydrophobic moieties selected from a myristoleyl group, a palmitoleyl group and a petroselinyl group, and (iii) at least one biologically important molecule, at least one biologically important molecule which is a nucleic acid molecule, preferably pDNA, mRNA or siRNA, more preferably pDNA or mRNA comprises.

[0142] In another embodiment, the complex of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having a length of 7 to 21 amino acids, preferably 7 to 17 amino acids, more preferably 7 to 13 amino acids, even more preferably 7 to 9 amino acids, for example a length of 7 amino acids, containing the core sequence RX1X2R (SEQ ID NO: 9), wherein any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, preferably the hydrophobic amino acid is L, a peptide or a salt thereof, and (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, more preferably selected from a myristoyl group and a petroselinyl group, and (iii) At least one biologically important molecule, at least one biologically important molecule which is a nucleic acid molecule, preferably pDNA, mRNA or siRNA, more preferably pDNA or mRNA, and comprises.

[0143] In another embodiment, the complex of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having a length of at least 7 amino acids, at least 8 amino acids or at least 9 amino acids, containing the core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, preferably the hydrophobic amino acid is L, preferably the peptide or a salt thereof has a length of at least 9 amino acids, for example 9, 13 or 21 amino acids, a peptide or a salt thereof, and (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, and (iii) At least one biologically important molecule, which is a nucleic acid molecule, preferably pDNA, mRNA, or siRNA, and at least one biologically important molecule comprises.

[0144] In another embodiment, the complex of the present invention is (i) A peptide according to the present invention or a salt thereof, preferably a cationic peptide, having a length of 7 to 21 amino acids, for example a length of 9 to 21 amino acids, preferably a length of 9 to 17 amino acids, more preferably a length of 9 to 13 amino acids, for example a length of 9 amino acids, and containing a core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, a peptide or a salt thereof, and (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, and (iii) At least one biologically important molecule, which is a nucleic acid molecule, preferably pDNA, mRNA, or siRNA, and at least one biologically important molecule comprises.

[0145] In a further embodiment, the complex of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), wherein any one of X1 to X5 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, and the peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, (iii) At least one biologically important molecule, which is a nucleic acid molecule, preferably pDNA, mRNA, or siRNA, and at least one biologically important molecule comprising.

[0146] In a further embodiment, the complex of the present invention (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having the sequence RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), wherein any one of X1 to X7 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, and the peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, (iii) At least one biologically important molecule, which is a nucleic acid molecule, preferably pDNA, mRNA, or siRNA, more preferably pDNA or siRNA, and at least one biologically important molecule comprising.

[0147] In a further embodiment, the complex of the present invention is (i) a peptide according to the present invention or a salt thereof, preferably a cationic peptide, consisting of the sequence RX1X2X3RX4X5RRX6X7RX8 (SEQ ID NO: 10), wherein any one of X1 to X8 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, preferably the hydrophobic amino acid is L, a peptide or a salt thereof, and (ii) three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, and (iii) at least one biologically important molecule, at least one biologically important molecule which is a nucleic acid molecule, preferably pDNA, mRNA or siRNA, more preferably pDNA or siRNA and.

[0148] In a preferred embodiment, the complex of the present invention is (i) cationic peptide 7.3 (L-H)-SEQ ID NO: 1, or a salt thereof, and (ii) three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, and (iii) at least one biologically important molecule, at least one biologically important molecule which is pDNA, siRNA or mRNA, preferably pDNA or mRNA and.

[0149] In another preferred embodiment, the complex of the present invention is (i) cationic peptide 13.3 (R-H)-SEQ ID NO: 18, or a salt thereof, and (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, a petroselinyl group, and an oleyl group, and (iii) At least one biologically important molecule, being at least one biologically important molecule which is mRNA, siRNA or pDNA, preferably pDNA, and comprises.

[0150] In another preferred embodiment, the complex of the present invention (i) A cationic peptide 9.3 - SEQ ID NO: 13, or a salt thereof, and (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, and (iii) At least one biologically important molecule, being at least one biologically important molecule which is siRNA, mRNA or DNA, preferably siRNA, and comprises.

[0151] In another preferred embodiment, the complex of the present invention (i) A cationic peptide 13.3 - SEQ ID NO: 14, or a salt thereof, and (ii) Three hydrophobic moieties selected from a C12 aliphatic chain and a palmitoyl group, and (iii) At least one biologically important molecule, being at least one biologically important molecule which is siRNA, mRNA or DNA, preferably siRNA, and comprises.

[0152] In another preferred embodiment, the complex of the present invention (i) A cationic peptide 13.3(Leu - His) - SEQ ID NO: 17, or a salt thereof, and (ii) Three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, and (iii) At least one biologically important molecule, being at least one biologically important molecule wherein the at least one biologically important molecule is siRNA, and comprises.

[0153] In another preferred embodiment, the complex of the present invention is (i) a cationic peptide NH2-7.3(L-H)-SEQ ID NO: 69, or a salt thereof, and (ii) three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably a myristoyl group, and (iii) at least one biologically important molecule, wherein the at least one biologically important molecule is DNA, preferably pDNA and comprises.

[0154] In another preferred embodiment, the complex of the present invention is (i) a cationic peptide 7.3(H, V)-SEQ ID NO: 66, or a salt thereof, and (ii) three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably a myristoyl group, and (iii) at least one biologically important molecule, wherein the at least one biologically important molecule is RNA, preferably mRNA and comprises.

[0155] In another preferred embodiment, the complex of the present invention is (i) a cationic peptide 7.3(L-H, ONH2)-SEQ ID NO: 71, or a salt thereof, and (ii) three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably a myristoyl group, and (iii) at least one biologically important molecule, wherein the at least one biologically important molecule is RNA, preferably mRNA and comprises.

[0156] In another embodiment, the biologically important molecule is a polypeptide or a protein. In certain embodiments, the biologically important molecule is a protein such as a protein that is negatively charged at physiological pH, or a protein that is positively charged at physiological pH, or a protein that is uncharged at physiological pH.

[0157] As used herein, the term "protein negatively charged at physiological pH" refers to a protein having an isoelectric point (pI) below physiological pH. Similarly, as used herein, the term "protein positively charged at physiological pH" refers to a protein having an isoelectric point (pI) above physiological pH. As used herein, the term "uncharged protein" at physiological pH refers to a protein that does not exhibit a net charge at physiological pH. Methods for determining the pI of a protein are well known to those skilled in the art. Non-limiting examples of such methods include isoelectric focusing (IEF), free-flow electrophoresis (FFE), capillary electrophoresis, or in-gel electrophoresis experiments using IPG strips, or the methods described in Audain E., et al. (2014) Curr. Top. Med. Chem., 14:388-397 or Ramos Y., et al. (2008) J. Proteome Res., 7:2427-2434.

[0158] The term "protein" is equivalent to the term "peptide" as previously defined earlier in this application. Typically, a protein has more amino acids compared to a peptide.

[0159] Therapeutic peptides generally act as hormones, growth factors, neurotransmitters, ion channel ligands, or anti-infective agents. Lei Wang et al. (Wang, L., Wang, N., Zhang, W. et al. (2022) Therapeutic peptides: current applications and future directions. Signal Transduct. Target Ther., 7:48) provide a review of therapeutic peptides and their prospects. Peptides such as those described in this review can benefit from delivery by the amphiphilic molecules of the present invention. Peptides such as protein-protein interaction inhibitors, anti-apoptotic peptides such as the BH4 domain of the Bcl-xL protein, apoptosis-promoting peptides such as KLAK, peptide probes such as cyclic peptide phalloidin labeled with a fluorophore, or hormones such as insulin or insulin labeled with a fluorophore can also benefit from delivery by the amphiphilic molecules of the present invention.

[0160] Thus, in one embodiment, the complex of the present invention a) at least one amphiphilic molecule according to a second aspect of the present invention, and b) at least one biologically important molecule, which is a peptide, preferably a therapeutic peptide comprises.

[0161] Therapeutic proteins are widely used in the treatment of diseases such as cancer, infectious diseases, autoimmune diseases, and many other diseases. Antibodies, IFN, enzymes, and cytokines are examples of therapeutic proteins. Preferred proteins for incorporation into the complex of the present invention include, but are not limited to, hormones, antibodies such as monoclonal antibodies, antibody fragments and antibody mimetics, and enzymes.

[0162] In another embodiment, the complex of the present invention a) at least one amphiphilic molecule according to a second aspect of the present invention, and b) at least one biologically important molecule, which is at least one biologically important molecule that is a protein, preferably a therapeutic protein, and comprises.

[0163] In some embodiments, the protein is an antibody and / or a functional fragment (characteristic part) thereof. In some embodiments, the antibody is a polyclonal antibody, a monoclonal antibody, a chimeric (i.e., "humanized") antibody, a single-chain (recombinant) antibody, or a bispecific antibody. In some embodiments, the antibody may have reduced effector function and / or be a bispecific molecule. In some embodiments, the antibody may comprise Fab fragments and / or fragments produced by a Fab expression library (e.g., Fab, Fab', F(ab')2, scFv, Fv, dsFv diabody, and Fd fragments).

[0164] The term "antibody" means an immunoglobulin molecule that specifically binds to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combination of the foregoing, via at least one antigen recognition site within the variable region of the immunoglobulin molecule. As used herein, the term "antibody" includes intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (e.g., Fab, Fab', F(ab')2 and Fv fragments, bispecific affinity retargeted antibodies (DART)), single-chain Fv (scFv) variants, multispecific antibodies such as bispecific and trispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising antigenic determinants of antibodies, and any other modified immunoglobulin molecule that contains an antigen recognition site as long as the antibody exhibits the desired biological activity. Since the first therapeutic antibody was marketed in 1986, various antibodies against various targets have been developed and more than 60 antibody therapeutics have been approved (Carter, P.J. and Lazar, G.A. (2018) Nat. Rev. Drug Discov. 17:197-223).

[0165] In some embodiments, the antibody can belong to any of the five major classes of immunoglobulins, IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), based on the identity of their heavy chain constant domains, which are called alpha, delta, epsilon, gamma, and mu, respectively. For example, the antibody can be IgG or labeled IgG.

[0166] The term "antigen-binding fragment" or "antibody fragment" refers to a part of an intact antibody and includes the antigen-determining variable regions of the intact antibody. Examples of antigen-binding fragments include, but are not limited to, Fab, Fab’, F(ab’)2, and Fv fragments, linear antibodies, single-chain antibodies, and multispecific antibodies formed from antibody fragments. In one embodiment, the antibody is an antibody fragment such as Fab or scFv, e.g., labeled Fab or scFv.

[0167] "Monoclonal antibody" refers to a homogeneous population of antibodies that are involved in the highly specific recognition and binding of a single antigen determinant or epitope. This is typically in contrast to polyclonal antibodies, which contain different antibodies against different antigen determinants. The term "monoclonal antibody" encompasses both intact monoclonal antibodies and full-length monoclonal antibodies, as well as antibody fragments (e.g., Fab, Fab’, F(ab’)2, Fv), single-chain (scFv) variants, fusion proteins containing antibody portions, and any other modified immunoglobulin molecule containing an antigen recognition site. Further, "monoclonal antibody" refers to such antibodies made by any number of methods, including but not limited to, hybridomas, phage selection, recombinant expression, and transgenic animals. For example, the monoclonal antibody can be an anti-nuclear pore complex protein monoclonal antibody (MAb414).

[0168] The term "humanized antibody" refers to a form of a non-human (e.g., mouse) antibody that is a specific immunoglobulin chain, chimeric immunoglobulin, or fragment thereof that contains a minimal non-human (e.g., mouse) sequence. Typically, a humanized antibody is a human immunoglobulin in which residues from the complementarity determining regions (CDRs) have been replaced with residues from the CDRs of a non-human species (e.g., mouse, rat, rabbit, hamster) that have the desired specificity, affinity, and capacity (Jones et al., 1986, Nature, 321:522-525; Riechmann et al. (1988), Nature, 332:323-327; Verhoeyen et al. (1988), Science, 239:1534-1536).

[0169] In another embodiment, the antibody is an antibody mimetic. Antibody mimetics are organic compounds that can specifically bind to an antigen, similar to an antibody, but are not structurally related to an antibody. They are typically artificial peptides or proteins having a molar mass of about 3 to 20 kDa. They can also be nucleic acids and small molecules. Some examples of antibody mimetics are affibodies (based on the Z domain of protein A), affilins, ubiquitin, affimers, affitins, alphabodies, anticalins (artificial lipocalins), avimers, finomers, somatoids, knotted domain peptides, DARPins (designed ankyrin repeats), nanobodies, monobodies, nanoclamps, optimizers, lipobodies, Pronectin™, centyrins, or ovobodies.

[0170] In other embodiments, the protein is an enzyme. Enzymes include, but are not limited to, therapeutic enzymes and enzymes such as β-galactosidase, saporin, lysozyme, BSA, Cre-recombinase, ZFN, TALEN, etc.

[0171] Therapeutic enzymes can be broadly classified into four categories: enzymes involved in fibrinolytic, cancer treatment, enzyme replacement therapy, and treatment of other rare and common diseases (Siddhi Tandon et al., Therapeutic enzymes: Discoveries, production and applications, Journal of Drug Delivery Science and Technology, Volume 63, 2021).

[0172] In another embodiment, the biologically important molecule is a nucleoprotein (NP). A nucleoprotein is any protein that is structurally associated with a nucleic acid, either DNA or RNA or any other modified nucleic acid. Deoxyribonucleoprotein (DNP) is a complex of DNA and protein. Ribonucleoprotein (RNP) is a complex of ribonucleic acid and an RNA-binding protein. In a preferred embodiment, the nucleoprotein is a ribonucleoprotein. In a preferred embodiment, the nucleoprotein is Cas9-RNP, and this protein is provided in association with a guide RNA (gRNA) that can be in the form of a single molecule (sgRNA) or a double-stranded form consisting of crRNA:tracrRNA.

[0173] Cas9 is a double-stranded RNA-guided DNA endonuclease enzyme associated with the clustered regularly interspaced short palindromic repeats (CRISPR) adaptive immune system in Streptococcus pyogenes. The Cas9 protein has been widely used as a genome engineering tool in CRISPR for inducing site-specific double-strand breaks in DNA. Cas9 can cleave almost any sequence complementary to the guide RNA. Nidhi S. et al. (2021) Int. J. Mol. Sci., 22:3327 provides a review of the CRISPR-Cas systems (including their applications in therapy).

[0174] Thus, in a further embodiment, the complex of the present invention is a) at least one amphiphilic molecule according to the second aspect of the present invention, and b) at least one biologically important molecule which is a protein, preferably a nuclear protein, more preferably Cas9-RNP, and comprises.

[0175] For example, the complex of the present invention is (i) a peptide according to the present invention or a salt thereof, preferably a cationic peptide, having a length of 7 amino acids, containing only basic amino acids selected from the group consisting of reactive basic amino acid residues containing R and H and a reactive group (i.e., the peptide or its salt does not contain hydrophobic amino acids), the number of R amino acids in the peptide or its salt is at least 2, the number of H amino acids in the peptide or its salt is 1 or 2, preferably 2, the number of reactive basic amino acid residues containing the reactive group in the peptide or its salt is 3, preferably the basic amino acid containing the reactive group is selected from K*, Dab* and O*, preferably selected from K* and O*, more preferably selected from K*, a peptide or a salt thereof, and (ii) three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group and a petroselinyl group, more preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group and a petroselinyl group, and (iii) at least one biologically important molecule which is a protein, preferably a nuclear protein, more preferably Cas9-RNP, and comprises.

[0176] In another embodiment, the complex of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having a length of 7 to 21 amino acids, preferably a length of 7 to 17 amino acids, more preferably a length of 7 to 13 amino acids, even more preferably a length of 7 to 9 amino acids, for example, having a length of 7 amino acids, containing the core sequence RX1X2R (SEQ ID NO: 9), wherein any one of X1 to X2 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, preferably the hydrophobic amino acid is L, a peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably three hydrophobic moieties selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, (iii) At least one biologically important molecule, which is a protein, preferably a nuclear protein, more preferably a Cas9-RNP, at least one biologically important molecule comprising.

[0177] In another embodiment, the complex of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having a length of at least 7 amino acids, at least 8 amino acids, or at least 9 amino acids, containing the core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, preferably the hydrophobic amino acid is L, preferably the cationic peptide has a length of at least 9 amino acids, for example, a length of 9, 13, or 21 amino acids, a peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably selectable from a myristoyl group, a palmitoleyl group, and a petroselinyl group, or selected from a C12 aliphatic chain and a palmitoleyl group, and (iii) At least one biologically important molecule, which is a protein, preferably a nuclear protein, more preferably a Cas9-RNP, and at least one biologically important molecule comprises.

[0178] In another embodiment, the complex of the present invention is (i) A peptide according to the present invention or a salt thereof, preferably a cationic peptide, having a length of 7 to 21 amino acids, for example a length of 9 to 21 amino acids, preferably a length of 9 to 17 amino acids, more preferably a length of 9 to 13 amino acids, for example a length of 9 amino acids, and containing a core sequence RX1X2RRX3X4 (SEQ ID NO: 4), wherein any one of X1 to X4 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, and the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, preferably the hydrophobic amino acid is L, a peptide or a salt thereof, and (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably selectable from a myristoyl group, a palmitoleyl group, and a petroselinyl group, or selected from a C12 aliphatic chain and a palmitoleyl group, and (iii) At least one biologically important molecule, which is a protein, preferably a nuclear protein, more preferably a Cas9-RNP, and at least one biologically important molecule comprises.

[0179] In a further embodiment, the complex of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having the sequence RX1X2RRX3X4RX5 (SEQ ID NO: 5), wherein any one of X1 to X5 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, and a peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, or selected from a C12 aliphatic chain and a palmitoleyl group, (iii) At least one biologically important molecule, which is a protein, preferably a nuclear protein, more preferably a Cas9-RNP, and at least one biologically important molecule comprising.

[0180] In a further embodiment, the complex of the present invention is (i) A peptide or a salt thereof according to the present invention, preferably a cationic peptide, having the sequence RRX1X2RX3X4RRX5X6RX7 (SEQ ID NO: 6), wherein any one of X1 to X7 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, and preferably the hydrophobic amino acid is L, and a peptide or a salt thereof, (ii) Three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, more preferably selected from a palmitoleyl group and a petroselinyl group, (iii) at least one biologically important molecule, which is a protein, preferably a nuclear protein, more preferably Cas9-RNP, and at least one biologically important molecule comprises.

[0181] In a further embodiment, the complex of the present invention (i) a peptide according to the present invention or a salt thereof, preferably a cationic peptide, consisting of the sequence RX1X2X3RX4X5RRX6X7RX8 (SEQ ID NO: 10), wherein any one of X1 to X8 is an amino acid independently selected from the group consisting of H, a reactive basic amino acid residue containing a reactive group (preferably K* and / or O* and / or Dab*), and a hydrophobic amino acid, the hydrophobic amino acid is independently selected from the group consisting of A, V, L, and I, preferably the hydrophobic amino acid is L, a peptide or a salt thereof, and (ii) three hydrophobic moieties selected from a C12 aliphatic chain, a myristoyl group, a palmitoleyl group, and a petroselinyl group, preferably selected from a myristoyl group, a palmitoleyl group, and a petroselinyl group, more preferably selected from a palmitoleyl group and a petroselinyl group, and (iii) at least one biologically important molecule, which is a protein, preferably a nuclear protein, more preferably Cas9-RNP, and at least one biologically important molecule comprises.

[0182] In a preferred embodiment, the complex of the present invention (i) a cationic peptide 7.3 - SEQ ID NO: 11, or a salt thereof, and (ii) three hydrophobic moieties selected from a palmitoleyl group and a petroselinyl group, and (iii) at least one biologically important molecule, which is Cas9-RNP, and at least one biologically important molecule comprises.

[0183] In another preferred embodiment, the complex of the present invention (i) Cationic peptide 7.3 (Leu-His) - SEQ ID NO: 1, or a salt thereof, and (ii) three palmitoleyl groups, and (iii) at least one biologically important molecule, which is Cas9-RNP, and at least one biologically important molecule comprising.

[0184] In another preferred embodiment, the complex of the present invention is (i) Cationic peptide 13.3 - SEQ ID NO: 14, or a salt thereof, and (ii) three myristoleyl groups, and (iii) at least one biologically important molecule, which is Cas9-RNP, and at least one biologically important molecule comprising.

[0185] In another embodiment, the biologically important molecule is an antigen or an immunogen.

[0186] The terms "antigen" or "immunogen" are used interchangeably to refer to a substance, typically a protein, that can induce an immune response in a subject. The term also refers to an immunologically active protein in the sense that (when administered to a subject, either directly in the form of a peptide or protein, or by administering a nucleotide sequence or vector encoding the peptide or protein) it can induce a humoral and / or cellular immune response against that protein.

[0187] An immunogen can be derived from pathogenic or non-pathogenic organisms such as bacteria, viruses, fungi, yeasts, protozoa, parasites, etc. In another embodiment, the immunogen can be a tumor-associated antigen, a tumor-specific antigen, a cell-associated antigen, or an allergen.

[0188] The immunogen can be in the form of, for example, a lipid, polysaccharide, peptide, protein, or a nucleotide sequence encoding a peptide or protein. Preferably, the immunogen is in the form of a peptide, protein, or a nucleotide sequence encoding a peptide or protein. More preferably, the immunogen is a nucleotide sequence encoding a peptide or protein, and even more preferably, it is mRNA encoding a peptide or protein. Suitable nucleotide sequences encoding the peptide or protein of interest include, but are not limited to, plasmid DNA, minicircles, mRNA, and saRNA. In some embodiments, the nucleotide sequence encoding the peptide or protein is chemically modified or is a heterologous nucleic acid. In other embodiments, the nucleotide sequence is not chemically modified and contains standard deoxyribonucleotides (i.e., deoxyadenosine, deoxyguanosine, deoxycytidine, deoxythymidine) in the case of DNA and standard ribonucleotides (i.e., adenosine, guanosine, cytidine, uridine) in the case of RNA. In one embodiment, the immunogen is a modified mRNA encoding a prefusion-stabilized spike protein derived from SARS-CoV-2 (SEQ ID NO: 27). In another embodiment, the immunogen is a modified mRNA encoding chicken ovalbumin (OVA).

[0189] Immunogenic synthetic peptides that mimic antigenic peptide sequences are also useful. Such immunogens can be synthesized, for example, using solid-phase methods as described in Merrifield R.B. (1963) J. Am. Chem. Soc. 85:2149-2154. In one embodiment, the synthetic peptide that mimics the antigenic peptide sequence is an immunogenic fragment derived from OVA having the SIINFEKL sequence (SEQ ID NO: 64).

[0190] Other immunogens include purified and secreted antigenic pathogenic factors such as toxins or cytotoxins. Examples of toxins that can be used as immunogens include bacterial endotoxins, exotoxins, and enterotoxins.

[0191] Method for preparing amphiphilic molecules In another aspect, the present invention relates to a method for preparing an amphiphilic molecule according to the present invention, the method comprising contacting a solution of the peptide of the present invention, preferably a cationic peptide or a salt thereof, dissolved in an organic solvent, with a solution of at least three precursors of a hydrophobic tail containing a reactive group that reacts with the reactive group of the side chain of the reactive basic amino acid of the peptide, under conditions sufficient for the formation of a covalent bond between the hydrophobic tail precursor and the reactive group within the peptide.

[0192] The terms "amphiphilic molecule", "peptide", "hydrophobic tail", "hydrophobic tail precursor", "reactive group of the side chain of the peptide" and "reactive group of the hydrophobic tail precursor" have been described in detail in the previous aspects of the present invention and are equally applicable to the present method.

[0193] Suitable conditions for the formation of a bond between the reactive group of the basic amino acid and the second reactive group within the hydrophobic tail precursor are - when the reactive group of the hydrophobic tail precursor is an aldehyde, an acidic medium, or - when the reactive group of the hydrophobic tail precursor is an alcohol or a carboxylic acid, a basic medium and in the presence of a carboxylic acid activating reagent, which is referred to as a method.

[0194] Preferably, suitable conditions for the formation of a bond between the reactive group of the basic amino acid and the second reactive group within the hydrophobic tail precursor include an acidic medium when the reactive group within the hydrophobic tail precursor is an aldehyde.

[0195] In certain embodiments, the organic solvent is selected from dimethyl sulfoxide (DMSO), dimethyl sulfoxide / acetic acid mixture (DMSO / AcOH), methanol, ethanol, and dimethylformamide (DMF). In a preferred embodiment, the organic solvent is 5% AcOH in DMSO.

[0196] The expression "carboxylic acid activating agent reagent" refers to a chemical entity that can react with a substrate having an equimolar amount of carboxylic acid (which means that 1 mole of coupling reagent is required per 1 mole of acid) under mild reaction conditions to produce a so-called "activated ester" intermediate. The resulting activated ester has a higher tendency to react with a nucleophile due to the electron-withdrawing effect incorporated from the activating agent reagent. Thus, this transient intermediate can subsequently undergo nucleophilic attack by an amino group or an alcohol group to yield an amide bond or an ester bond. Typical carboxylic acid activating agent reagents for forming an amide bond are ammonium / uronium salts (N-HBTU, N-HATU, N-TBTU) or carbodiimide reagents, such as EDC, DIC, DCC, which are also suitable for forming an ester bond. A more comprehensive list of suitable coupling reagents can be found in El-Faham A. Albericio F. (2011) Chem. Rev., 111:6557-6602, with respect to examples having various nucleophiles that can be incorporated into the carboxyl group moiety.

[0197] In one embodiment, the contacting step between a solution of the peptide of the present invention, preferably a cationic peptide or a salt thereof, dissolved in an organic solvent and a solution of at least three precursors of a hydrophobic tail containing a reactive group in an organic solvent is carried out by contacting "n" reactive groups of the peptide or a salt thereof in the organic solvent with at least "1n" hydrophobic tail precursors, for example, at least "1.5n" hydrophobic tail precursors, or at least "2n" hydrophobic tail precursors, or at least "3n" hydrophobic tail precursors, or at least "4n" hydrophobic tail precursors, or at least "5n" hydrophobic tail precursors, wherein the precursor includes a hydrophobic tail and a second reactive group that reacts with the reactive group of the side chain of a reactive basic amino acid of the peptide or a salt thereof, and the contacting is carried out under conditions sufficient to form a covalent bond between the hydrophobic tail precursor and the reactive group of the peptide or a salt thereof. For example, the contacting step may involve - contacting 1 equivalent of the reactive groups of the peptide or a salt thereof of the present invention with 5 equivalents of the precursors of the hydrophobic tail, - Contacting one equivalent of the reactive group of the peptide or a salt thereof of the present invention with 4 equivalents of the precursor of the hydrophobic tail, - Contacting one equivalent of the reactive group of the peptide or a salt thereof of the present invention with 3 equivalents of the precursor of the hydrophobic tail, - Contacting one equivalent of the reactive group of the peptide or a salt thereof of the present invention with 2 equivalents of the precursor of the hydrophobic tail, - Contacting one equivalent of the reactive group of the peptide or a salt thereof of the present invention with 1.5 equivalents of the precursor of the hydrophobic tail, - Contacting one equivalent of the reactive group of the peptide or a salt thereof of the present invention with 1 equivalent of the precursor of the hydrophobic tail, is carried out by

[0198] In a preferred embodiment, the contacting step between a solution of the peptide of the present invention, preferably a cationic peptide or a salt thereof, dissolved in an organic solvent and a solution of at least three precursors of the hydrophobic tail containing a reactive group in an organic solvent is such that "n" reactive groups of the peptide or a salt thereof in the organic solvent are contacted with at least "1n" precursors of the hydrophobic tail, for example, at least "1.5n" precursors of the hydrophobic tail, or at least "2n" precursors of the hydrophobic tail, or at least "3n" precursors of the hydrophobic tail, or at least "4n" precursors of the hydrophobic tail, for example, at least "5n" precursors of the hydrophobic tail, preferably by contacting with "1n" precursors of the hydrophobic tail or "5n" precursors of the hydrophobic tail.

[0199] Method for preparing a complex In another aspect, the present invention refers to a method for preparing a complex according to the present invention, which comprises contacting a solution of at least one amphiphilic molecule according to the present invention with a solution of at least one biologically important molecule dissolved in a suitable medium under conditions sufficient to form a complex between the at least one amphiphilic molecule and the at least one biologically important molecule.

[0200] In certain embodiments, the amphiphilic molecule is freshly prepared prior to the preparation of the complex for intracellular delivery of at least one biologically important molecule. In another particular embodiment, the amphiphilic molecule is provided as a lyophilized powder and then preferably dissolved in an organic solvent, and then the complex is prepared.

[0201] In certain embodiments, the organic solvent is dimethyl sulfoxide (DMSO).

[0202] In certain embodiments, as used herein, the expression "solution of at least one molecule x" refers to a solution containing at least one molecule x.

[0203] In another particular embodiment, the solution of at least one amphiphilic molecule contains, in addition to the at least one amphiphilic molecule, at least one hydrophobic tail precursor as defined in the present invention that is not linked to a peptide or a salt thereof. In another particular embodiment, the solution of at least one amphiphilic molecule contains, in addition to the at least one amphiphilic molecule, a hydrophobic tail precursor, preferably at least one peptide of the present invention or a salt thereof that is not linked to the hydrophobic tail precursor as defined in the present invention. In another particular embodiment, the solution of at least one amphiphilic molecule contains, in addition to the at least one amphiphilic molecule, at least one hydrophobic tail precursor as defined in the present invention that is not linked to a peptide, preferably a peptide of the present invention, and a hydrophobic tail precursor, preferably at least one peptide of the present invention or a salt thereof that is not linked to the hydrophobic tail precursor as defined in the present invention.

[0204] In one embodiment, the biologically important molecule of the method for preparing the complex has a negative net charge.

[0205] Method for in vitro delivery of a biologically important molecule to a cell population Furthermore, the present invention is a method for in vitro delivery of a biologically important molecule to a cell population, comprising (i) A step of contacting a first solution in which at least one amphiphilic molecule of the present invention is dissolved in a suitable solvent with a second solution containing a biologically important molecule in a suitable solvent under conditions sufficient for the formation of a complex between at least one amphiphilic molecule and at least one biologically important molecule; (ii) A step of adding the complex obtained in step (i) to a cell population under conditions suitable for the delivery of the biologically important molecule to the cell population; relates to a method comprising.

[0206] Preferably, the contacting step (i) is carried out in the same medium in which the cells are cultured, and the amphiphilic molecule is provided from a stock solution in an organic solvent. In another preferred embodiment, the biologically important molecule has a negative net charge at the pH at which the contacting step (i) is carried out. In another embodiment, the biologically important molecule for the in vitro delivery of the method to a cell population of the above-mentioned biologically important molecule has a neutral or positive net charge at physiological pH as described above.

[0207] Use as a transfection reagent and method for in vitro delivery In a further aspect, the present invention relates to the use of a peptide according to the present invention, preferably a cationic peptide, or a salt thereof, an amphiphilic molecule according to the present invention, or a complex according to the present invention for the intracellular delivery (in vitro) of a biologically important molecule.

[0208] In the context of the present invention, the term "transfection" refers to the process of intentionally introducing a biologically important molecule into a cell. This may also be referred to as "delivery" or "intracellular delivery". The cell can be of any origin. In certain embodiments, the cell is a eukaryotic cell. In more specific embodiments, the cell is a mammalian cell. In even more specific embodiments, the cell is a human cell. Biologically important molecules have been described in detail above. In particular, the molecule of interest can be selected from the group consisting of proteins, nucleic acids, nucleoproteins, immunogens, and small molecules, as described in detail above. In preferred embodiments, as described in detail above, the nucleic acid is pDNA, siRNA or mRNA, and the nucleoprotein is a ribonucleoprotein. In a preferred embodiment, the nucleic acid is mRNA. In certain embodiments, the transfection is a transient transfection. In certain embodiments, the transfection is a stable transfection. When stable transfection is desired, i.e., when the transfected gene actually remains in the cell's genome and is passed on to its daughter cells, a marker gene can be co-transfected. The marker gene can be a gene detectable by fluorescence or can confer resistance to a particular toxin.

[0209] The use of the molecule of the present invention as a transfection reagent and / or delivery vector enables in vitro delivery of the molecule of interest to the target cell population for the above purposes.

[0210] Library and method for obtaining a library The present invention further provides a method for obtaining a library of amphiphilic molecules as defined in the present invention, the method comprising contacting, in an organic solvent, "n" peptides according to the present invention, preferably cationic peptides or salts thereof, with at least "3n" hydrophobic tail precursors, said precursors comprising a hydrophobic tail and a second reactive group that reacts with a reactive group of the side chain of a reactive basic amino acid of the peptide or its salt, and the contacting being carried out under conditions sufficient for the formation of a covalent bond between the hydrophobic tail precursor and the reactive group in the peptide or its salt. "n" corresponds to a natural number such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc. For example, in a method for obtaining a library comprising at least two different amphiphilic molecules according to the present invention, at least two peptides or salts thereof as defined in the present invention are contacted with at least six hydrophobic tail precursors in an organic solvent as described above. Preferably, the peptide is selected from any one of SEQ ID NOs: 1 to 19, 21, 23, 49, 52 to 59, 65 to 66, 68 to 72.

[0211] In a more preferred embodiment, the hydrophobic tails contained in at least "3n" hydrophobic tail precursors are selected from aldehydes, carboxylic acids or alcohols, preferably aldehydes, and the aldehydes are selected from the group consisting of hexanal, octanal, decanal, dodecanal, myristraldehyde, palmitaldehyde, petroselinyl aldehyde, oleyl aldehyde, linoleoyl aldehyde, eicosynoyl aldehyde and tetracosenoleyl aldehyde, the carboxylic acids are selected from the group consisting of hexanoic acid, octanoic acid, decanoic acid, dodecanoic acid, myristoleic acid, palmitoleic acid, petroselic acid, oleic acid, linoleic acid, eicosynic acid and tetracosenoic acid, and the alcohols are selected from the group consisting of hexanol, octanol, decanol, dodecanol, myristral alcohol, palmital alcohol, petroselinyl alcohol, oleyl alcohol, linoleoyl alcohol, gondoil alcohol and tetracosenoleyl alcohol. More preferably, the hydrophobic tails contained in at least "3n" hydrophobic tail precursors are selected from dodecanal, myristral, palmital, petroselinyl, oleyl, eicosynoyl and tetracosenoleyl aldehydes.

[0212] In a more preferred embodiment, the reactive group of the peptide or a salt thereof of the present invention is a hydrazide group or a hydroxylamine group, and the reactive groups of at least three hydrophobic tail precursors are aldehyde groups.

[0213] Preferably, the contacting step of the method for obtaining a library of amphiphilic molecules is carried out by contacting one kind of peptide or a salt thereof with one kind of hydrophobic tail precursor separately as described herein.

[0214] The present invention further provides a library comprising at least two different amphiphilic molecules, and each amphiphilic molecule (i) a peptide or a salt thereof according to the present invention, preferably a cationic peptide, and (ii) three hydrophobic tails and The hydrophobic tail is linked to the peptide or its salt by a bond formed by the reaction between the reactive group of the side chain of the reactive basic amino acid residue of the peptide or its salt and the precursor of the hydrophobic tail, and each precursor of the hydrophobic tail contains the hydrophobic tail and a second reactive group capable of reacting with the reactive group of the side chain of the reactive basic amino acid residue of the peptide or its salt. Here, one amphiphilic molecule is different from another amphiphilic molecule at least in the peptide or its salt and / or the hydrophobic tail.

[0215] Preferably, the bond formed by the reaction between the reactive group of the side chain of the reactive basic amino acid residue of the peptide or its salt and the precursor of the hydrophobic tail containing a second reactive group capable of reacting with the reactive group of the side chain of the reactive basic amino acid residue of the hydrophobic tail and the peptide or its salt is an amide bond, an ester bond, a hydrazone bond or an oxime bond.

[0216] In a more preferred embodiment, each amphiphilic molecule of the library is obtained by reacting "n" peptides or their salts with at least "3n" precursors of the hydrophobic tail, and the precursors contain a second reactive group that reacts with the reactive group of the reactive basic amino acid residue to thereby form a covalent bond. Preferably, one type of peptide or its salt is contacted and reacted with one type of hydrophobic tail precursor, that is, each peptide in the amphiphilic molecule contains one type of hydrophobic tail.

[0217] Method for identifying amphiphilic molecules The present invention further provides a method for identifying an amphiphilic molecule suitable for delivering a biologically important molecule to a cell, and the method includes (i) contacting the biologically important molecule with the library according to the present invention under conditions sufficient for binding / complexing the amphiphilic molecule and the biologically important molecule, (ii) optionally, selecting an amphiphilic molecule capable of binding / complexing with the biologically important molecule from amphiphilic molecules that do not bind / complex with the biologically important molecule, and / or (iii) Screening of amphiphilic molecules suitable for delivery of biologically important molecules into cells comprises or alternatively consists of these.

[0218] Preferably, the biologically important molecule is selected from the group consisting of proteins, nucleic acids, nucleoproteins and small molecules, as described in detail above in this specification.

[0219] All terms and embodiments described elsewhere with respect to the foregoing aspects of the invention are equally applicable to this aspect of the invention.

[0220] Use in medicine In yet a further aspect, the invention refers to a peptide according to the invention or a salt thereof, an amphiphilic molecule according to the invention, or a complex according to the invention for use in medicine / drug. Accordingly, the invention also refers to the use of a peptide according to the invention or a salt thereof, an amphiphilic molecule according to the invention or a complex according to the invention for the manufacture of a medicine and / or a drug.

[0221] In yet a further aspect, the invention refers to a peptide according to the invention or a salt thereof, an amphiphilic molecule according to the invention, or a complex according to the invention for use as a vaccine or immunogenic composition. Accordingly, the invention also refers to the use of a peptide according to the invention, preferably a cationic peptide or a salt thereof, an amphiphilic molecule according to the invention or a complex according to the invention for the manufacture of a vaccine. Accordingly, the invention provides a vaccine comprising a peptide according to the invention or a salt thereof, an amphiphilic molecule according to the invention or a complex according to the invention.

[0222] As used herein, the term "vaccine" refers to a substance or composition that establishes or improves immunity against a particular disease by inducing an adaptive immune response that includes immunological memory. Non-limiting examples of such particular diseases include infectious diseases and cancer. Non-limiting examples of infectious diseases include those caused by HIV, HIV-1, SAR-CoV-1, SARS-CoV-2, rabies virus, cytomegalovirus, Zika virus, hepatitis C virus, human papillomavirus, respiratory syncytial virus, Streptococcus species, Moloney murine leukemia virus, Ebola virus, Toxoplasma protozoa or influenza virus. Non-limiting examples of cancers treated with the products of the present invention include acute myeloid leukemia, chronic myeloid leukemia, multiple solid tumors, mesothelioma, glioblastoma, renal cell carcinoma, pancreatic cancer, breast cancer, non-small cell lung cancer, prostate cancer, metastatic prostate cancer, malignant glioma, brain cancer, brain metastasis, ovarian cancer, colorectal cancer, myelodysplastic syndrome, metastatic lung cancer, renal cell carcinoma, or melanoma. In certain embodiments, the infectious disease or cancer is any of those described in Pardi N. et al. (2018), Nature Reviews, 17:261-279. A vaccine typically contains an agent similar to the microorganism that causes the disease or a part thereof (e.g., a polypeptide or a nucleic acid encoding a polypeptide). A vaccine can be prophylactic or therapeutic. In another aspect, the present invention relates to a vaccine comprising a peptide of the present invention or a salt thereof, an amphiphilic molecule according to the present invention, or a complex according to the present invention. As used herein, the term "adjuvant" refers to a substance that, when added to an immunogenic agent, nonspecifically enhances or potentiates the immune response to that agent in a recipient host upon exposure to the mixture. As used herein, the term "immunogenic agent" or "immunogen" refers to an antigen that can induce an adaptive immune response when injected by itself. All immunogens are antigens, but not all antigens are immunogens.

[0223] The vaccine of the present invention can be a tolerogenic vaccine. Tolerogenic vaccines are used to re-establish immune tolerance, restore immune homeostasis, and thereby improve autoimmune diseases and / or allergies. Tolerogenic vaccines induce long-term antigen-specific inhibitory memory that blocks pathogenic T cell responses through the loss of effector T cells and the acquisition of regulatory T cell function (see, for example, Mannie, M.D., Curtis II, A.D., (2013). ‘‘Tolerogenic vaccines for Multiple sclerosis.’’ Human vaccines&immunotherapeutics 9, 1032-1038).

[0224] The peptide according to the present invention, preferably a cationic peptide, or a salt thereof, the amphiphilic molecule according to the present invention, or the complex according to the present invention is also assumed to be suitable for use as a nucleic acid vaccine (NAV), particularly an mRNA vaccine. Nucleic acid vaccines (NAV) are described in detail, for example, in US Patent No. 9,872,900.

[0225] As used herein, the terms "treatment" or "therapy" refer to any type of treatment aimed at terminating, preventing, ameliorating, or reducing susceptibility to the clinical conditions described herein. In preferred embodiments, the term "therapy" relates to prophylactic therapy of a disorder or condition as defined herein (i.e., treatment to reduce susceptibility to a clinical condition). Accordingly, "treatment", "treating", and their equivalent terms refer to obtaining the desired pharmacological or physiological effect, and include any treatment of a pathological condition or disorder in a mammal, including a human. This effect can be prophylactic in terms of completely or partially preventing the disorder or its symptoms, and / or therapeutic in terms of partial or complete cure of the disorder and / or the adverse effects resulting from the disorder. That is, "treatment" includes (1) preventing the occurrence or recurrence of a disorder in a subject, (2) inhibiting a disorder, e.g., preventing the development of a disorder, (3) arresting or terminating a disorder or at least the symptoms associated therewith such that the host is no longer afflicted with the disorder or its symptoms, e.g., restoring or repairing a lost, missing, or defective function, or causing regression of a disorder or its symptoms by stimulating an inefficient process, or (4) alleviating, mitigating, or improving a disorder or the symptoms associated therewith (wherein improving is used broadly to mean at least reducing the magnitude of a parameter such as inflammation, pain, or immunodeficiency).

[0226] The peptide of the invention, preferably a cationic peptide, or a salt thereof, the amphiphilic molecule of the invention, or the complex of the invention can be provided as a pharmaceutical composition comprising the peptide, amphiphilic molecule, or complex and a pharmaceutically acceptable carrier.

[0227] As used herein, the term "pharmaceutical composition" refers to a composition comprising a therapeutically effective amount of a peptide or a salt thereof, an amphiphilic molecule, or a complex, and at least one pharmaceutically acceptable excipient. The pharmaceutical compositions according to the present invention can be prepared, for example, as injections such as solutions, suspensions, and emulsions. The terms "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier", "pharmaceutically acceptable diluent" or "pharmaceutically acceptable vehicle", which are used interchangeably herein, refer to any conventional non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation adjuvant. The pharmaceutically acceptable carrier is essentially non-toxic to the recipient at the dosages and concentrations employed and is compatible with the other components of the formulation. Suitable carriers include, but are not limited to, water, dextrose, glycerol, physiological saline, ethanol, and combinations thereof. The carrier can contain additional agents such as wetting or emulsifying agents, pH buffering agents, or adjuvants that enhance the effectiveness of the formulation. Water or physiological saline and aqueous dextrose and glycerol solutions, especially solutions for injection, are preferably used as vehicles. Suitable pharmaceutical vehicles are described in "Remington: the science and practice of pharmacy" (21st edition, Lippincott Williams & Wilkins, 2006).

[0228] The term "therapeutically effective amount", as used herein with respect to the peptides, amphiphilic molecules or complexes contained in the pharmaceutical compositions of the present invention, is an amount of the peptide or its salt, amphiphilic molecule or complex sufficient to provide the desired effect, i.e., to achieve a significant prevention, cure, delay, reduction in severity or improvement of one or more symptoms resulting from the disease, and is generally determined by, among other things, the characteristics of the agent itself and the therapeutic effect to be achieved. It also depends on the subject being treated, the severity of the disease the subject is suffering from, the dosage form selected, etc. For this reason, the dosages recited in the present invention are to be considered only as a guide for those skilled in the art, who must adjust the dosages according to the aforementioned variables. In one embodiment, the effective amount results in an improvement of one or more symptoms of the disease being treated. Those skilled in the art are familiar with the principles and procedures discussed in available sources of information widely known as Remington’s Pharmaceutical Science (17th Ed., Mack Publishing Co., Easton, Pa., 1985) and Goodman and Gilman’s The Pharmaceutical Basis of Therapeutics (8th Ed., Pergamon Press, Elmsford, N.Y., 1990).

[0229] The compounds or pharmaceutical compositions for use according to the present invention can be administered to a subject by any suitable route of administration, such as parenterally (e.g., intramuscularly, intravenously, subcutaneously, nasally, etc.), enterally (i.e., orally, rectally, etc.), topically, etc. In certain embodiments, the compositions for use according to the present invention are administered via the intraperitoneal, intracaecal, intravesical, intrapleural, intravenous, intramuscular, subcutaneous, nasal, or topical routes. In the case of solid tumours, the compounds or pharmaceutical compositions for use according to the present invention can be administered directly to the tumour. In another specific embodiment, the compounds or pharmaceutical compositions for use according to the present invention are administered parenterally, preferably by the intravenous or intramuscular routes. In a preferred embodiment, the compounds or pharmaceutical compositions for use according to the present invention are administered by the intravenous route. The compounds or pharmaceutical compositions for use according to the present invention can be administered directly to a subject by conventional methods. Alternatively, the above pharmaceutical compositions for use according to the present invention can be used to transfect cells, e.g., mammalian cells including human cells, ex vivo, which are then transplanted into a human or animal in order to obtain the desired therapeutic effect. For administration to a human or animal, the above cells are formulated in a suitable medium that does not adversely affect cell viability. The terms "subject", "patient" or "individual" are used interchangeably herein to refer to any member of the animal kingdom and can be vertebrates, such as fish, birds, reptiles, amphibians, or mammals such as humans, non-human primates, horses, pigs, rabbits, dogs, sheep, goats, cows, birds, cats, guinea pigs or rodents. Preferably, the subject is a mammal, more preferably a human.

[0230] All terms and embodiments described elsewhere in this specification are equally applicable to these aspects of the present invention.

[0231] The pharmacological composition of the present invention In a further aspect, the present invention relates to a pharmaceutical composition comprising a therapeutically effective amount of a peptide of the present invention, preferably a cationic peptide or a salt thereof, an amphiphilic molecule of the present invention or a complex of the present invention, together with at least one pharmaceutically acceptable excipient. Accordingly, the present invention further provides a pharmaceutical composition comprising a peptide according to the present invention, an amphiphilic molecule according to the present invention or a complex according to the present invention, and a pharmaceutically acceptable carrier and / or a pharmaceutically acceptable excipient. The present invention further provides a pharmaceutical composition according to the present invention for use in therapy / for use as a medicament.

[0232] All terms and embodiments described elsewhere in this specification are equally applicable to these aspects of the present invention.

[0233] Method for in vivo delivery In a further aspect, the present invention relates to a method for the delivery of a biologically important molecule to a subject, the method comprising administering the complex according to the present invention to the subject.

[0234] Amino acids of the present invention In a further aspect, the present invention provides amino acids suitable for the synthesis of the peptides and amphiphilic substances of the present invention. The amino acids of the present invention have the following formula (Formula III) or Formula (IV).

Chemical formula

Chemical formula

[0235] Preferably, the amino acid is selected from lysine (Lys, K, n = 4), ornithine (Orn, O, n = 3), or 2,4-diaminobutyric acid (Dab, n = 2).

[0236] Furthermore, as shown in the above formulas (III) and (IV), the amino acid contains a reactive group bonded to the side chain of the amino acid, and the reactive group is selected from hydrazide (Hyd) (Formula III) or aminooxy (Formula IV). The reactive group is bonded to the side chain of the amino acid directly or via a linker. The linker may contain 1 to 10 carbon atoms (m is a natural number selected from 1 to 10, for example, it can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10). In a preferred embodiment, m is a natural number selected from 1 to 5, for example, 1, 2, 3, 4, or 5. More preferably, m is selected from 1 to 3, for example 1, 2, or 3.

[0237] In a preferred embodiment, the amino acid of the present invention is selected from Lys(Hyd)-OH, Orn(Hyd)-OH, and Dab(Hyd)-OH, and "Hyd" refers to hydrazide. Therefore, the amino acid of the present invention may contain lysine (Lys, K), ornithine (Orn, O), or 2,4-diaminobutyric acid (Dab) and hydrazide bonded to the side chain of K, O, or Dab. As described above, the hydrazide group may be bonded to the side chain of K, O, or Dab directly or via a linker. For example, when the reactive group is hydrazide, the linker may be a carboxylic acid such as glutaric acid or succinic acid.

[0238] In one embodiment, K, O, or Dab of the present invention is a modified K, O, or Dab containing hydrazide carboxylic acid, preferably glutaric acid monohydrazide, succinic acid monohydrazide (J.Mater.Chem.B(2017),5:4426 - 4434).

[0239] The amino acids of the present invention contain two protecting groups, X and Y, in formulas III and IV. Amino acid protecting groups are described, for example, in Isidro-Llobet et al., ‘‘Amino acid-protecting groups’’, Chem. Rev., 2009, 109:2455-2504. For example, the N α -amino group (NH3) of the amino acids of the present invention is blocked with a suitable protecting group, X, an N-terminal protecting group, for example, 9-fluorenylmethoxycarbonyl (Fmoc) or tert-butyloxycarbonyl (Boc). In a preferred embodiment, X is Fmoc. For example, the terminal amine of a reactive group (e.g., hydrazide or aminooxy), Y in formula (III) or (IV), is blocked with a suitable protecting group such as 2-chlorobenzyloxycarbonyl (Cl-Z), tert-butyloxycarbonyl (Boc), and 4-methyltrityl (Mtt). In a preferred embodiment, Y is Boc.

[0240] In a preferred embodiment, the amino acids of the present invention have the following formula V. [Chemical formula] (Also referred to as Fmoc-Lys(Boc-glutamic acid monohydrazide)-OH)

[0241] As shown in the Examples (Example 1), the use of the amino acids of the present invention in the synthesis of the peptides and amphiphilic substances of the present invention provides advantages for their synthesis. The synthesis is simplified, and for example, when using the amino acids of the present invention, the synthesis time can be significantly shortened compared to standard synthesis protocols (see Example 1).

[0242] All terms and embodiments described elsewhere with respect to the foregoing aspects of the present invention are equally applicable to the present aspect of the present invention.

[0243] As used herein, the terms ‘‘comprising’’ or ‘‘including’’ disclose ‘‘consisting of’’ as well, in accordance with generally accepted patent practice. [Examples]

[0244] The following invention is described in this specification by the following examples, which should be construed as merely illustrative and not limiting of the scope of the invention.

[0245] Example 1: Materials and Methods Peptide Synthesis Figure 1 shows a schematic diagram of the synthesis procedure. Briefly, all peptides were synthesized by manual Fmoc solid-phase peptide synthesis using Rink Amide (LL) ProTide resin (loading 0.2 mmol / g). Prior to synthesis, the resin (0.1 mmol) was swollen in DMF (peptide synthesis grade, 2 mL) in a peptide synthesis vessel for 10 minutes. The coupling cycle consisted of a 10-minute removal of the Fmoc protecting group with a DMF solution of piperidine (20%, 2 mL), followed by filtration of the mixture and washing of the resin with DMF (3 × 2 mL, 1 minute). Amino acid coupling was carried out by treating with a solution of α-amino acid (3 equivalents) and N-HBTU (2.95 equivalents) dissolved in DMF (2 mL), which was added 1 minute after mixing with DIEA (0.195 M solution in DMF, 1.2 equivalents), and the resulting mixture was shaken for 15 minutes by bubbling N2 through it. Finally, the resin was washed with DMF (3 × 2 mL, 1 minute). The protected amino acids used (in their L- or D-forms depending on the peptide) were as follows. Fmoc-Arg(Pbf)-OH, Fmoc-Leu-OH, Fmoc-His(Trt)-OH, Fmoc-Lys(Mtt)-OH, and Fmoc-Orn(Mtt)-OH.

[0246] Once the linear peptide was completed, acetylation of the N-terminal group was carried out under standard Fmoc removal conditions (20% piperidine in DMF), followed by treatment with a solution of acetic anhydride and 2,6-lutidine (1:1, 1 mL) for 20 minutes. The resin was washed with DCM (2 × 2 mL, 5 minutes), and the Mtt protecting group was selectively removed by mechanically shaking the resin with a mixture of DCM / HFIP / TFE / TIS (6.5:2:1:0.5, 3 × 2 mL, 2 hours). Finally, the mixture was filtered, and the resin was washed with DCM (2 × 2 mL, 2 minutes) and DMF (2 mL, 10 minutes). To DMF (1 mL), a solution dissolved with either Boc-aminooxyacetic acid (Figure 1, linker C), Boc-protected succinic acid monohydrazide (Figure 1, linker B) or Boc-protected glutaric acid monohydrazide (Figure 1, linker A) (2.5 equivalents / free amine) and N-HATU (2.5 equivalents / free amine) was added to the resin, and then a solution of DIEA (10 equivalents) was added dropwise. The resin was shaken for 30 minutes by bubbling N2, and finally washed with DMF (3 × 2 mL, 2 minutes) and DCM (3 × 2 mL, 2 minutes). TIFF2025522522000010.tif225170

[0247] Finally, the peptide was deprotected and cleaved from the resin by standard TFA cleavage procedure at room temperature using TFA / DCM / H2O / TIS (90:5:2.5:2.5, 1 mL per 70 mg of resin) for 2 hours. Then, the mixture was filtered, washed with TFA (1 mL), and the peptide was precipitated with ice-cold Et2O (25 mL). The precipitate was centrifuged and dissolved in H2O (4 mL). Purification was performed by C18 RP-HPLC [Phenomenex Luna C18(2) 100A column, H2O(0.1% TFA) / CH3CN(0.1% TFA) 95:5 → 5:95 (0 → 5 minutes), 95:5 → 5:95 (5 → 35 minutes)] using a two-component gradient of solvent A and solvent B, and the collected fractions were lyophilized and stored at -20 °C. Purity and identity were confirmed by analytical HPLC-MS and 1 H-NMR.

[0248] Furthermore, peptide 7.3 (Leu-His) (Ac-RK*HRK*K*H-NH2, SEQ ID NO: 1) was synthesized with D-amino acids.

[0249] Notably, all synthesized peptides are N-acetylated and C-amidated unless otherwise indicated. For example, peptide 7.3 (L-H)-OH (SEQ ID NO: 68) is not C-amidated. For example, peptide NH2-7.3 (L-H) (SEQ ID NO: 69) is not N-acetylated.

[0250] Preparation of Amphiphilic Molecules A solution of the pure peptide dissolved in DMSO (10 mM) was mixed with a solution of the hydrophobic aldehyde tail dissolved in 15% AcOH / DMSO (1 - 5 equivalents per reactive basic amino acid residue containing a reactive group in the side chain, 5 equivalents per reactive basic amino acid residue were used unless otherwise indicated, see FIG. 30 for using different stoichiometric conditions). The mixture was stirred at 60 °C for 2 hours, the resulting library of amphiphilic substances was tested, and without the need for further purification steps, robot screening was performed in combination with the corresponding cargo, thus minimizing the synthetic effort and the time required to identify new candidates for polynucleotide delivery.

[0251] The hydrophobic aldehyde tails are as follows (chemical structures are shown below): TIFF2025522522000011.tif70170

Chemical Structure

[0252] Measurement of DLS and ζ Potential DLS and ζ potential measurements were performed on a Malvern Zetasizer NanoZS using standard disposable cuvettes. All experiments were performed in triplicate at 25 °C. The freshly prepared solution of amphiphilic substance in AcOH / DMSO was diluted with MQ water, complexed with pDNA or mRNA, and after the complexation step, the pH was adjusted with diluted NaOH (initial pH value = 4).

[0253] NMR Characterization According to the protocol described in Example 1 (Preparation of Amphiphilic Molecules), 7.3 (L-H) M of an amphiphilic substance was prepared and then washed with Et2O to remove the excess aldehyde tail used in the reaction. Subsequently, the resulting gel was dissolved in DMSO-d6 at a final concentration of 6.6 mM, and the NMR spectrum was recorded with a Varian Inova 500 MHz spectrometer. Figure 22 shows 1 the 1H NMR spectrum. The presence of a set of singlet signals above 10 ppm and the corresponding integral signal ratio confirm the successful attachment of three hydrophobic tails onto the peptide scaffold.

[0254] Synthesis of an SPPS-Compatible Artificial Amino Acid [Fmoc-Lys(Boc-Hyd)-OH] Containing a Glutaric Acid Monohydrazide Linker A solution of Boc-protected glutaric acid monohydrazide (0.88 g) dissolved in anhydrous CH2Cl2 (40 mL) was treated with diisobutylethylamine (2.44 mL, 4 equivalents) and N-HATU (2.04 g, 1.5 equivalents). Subsequently, Fmoc-Lys(HCl)-OMe (1.5 g, 1 equivalent) was added, and the mixture was stirred at room temperature for 2 hours under an inert gas. Thereafter, the resulting organic phase was washed with dilute HCl (2 × 25 mL) and saturated NaHCO3 solution (2 × 25 mL). The organic phase was dried over anhydrous MgSO4 and concentrated under vacuum. The crude mixture was purified by flash chromatography (0 - 6% MeOH / CH2Cl2) to obtain the desired compound as a clear oil, which was foamed under high vacuum (1.81 g, yield 82%). Purity and identity were confirmed by analytical HPLC-MS and 1 1H-NMR.

[0255] Fmoc-Lys(Boc-Hyd)-OHFmoc-Lys(Boc-Hyd)-OMe (1.5 g) was dissolved in a 0.8 M CaCl2 iPrOH / H2O solution (7:3 ratio; total volume 27 mL). Then, NaOH was added (0.12 g, 1.2 equivalents), and the mixture was stirred for 6 hours. 20 mL of H2O was added to the reaction vessel, and the iPrOH was concentrated under vacuum. The resulting aqueous phase was acidified to pH 2 with 5% aqueous HCl and extracted with CH2Cl2 (4 × 15 mL). The combined organic phases were dried over anhydrous MgSO4 and concentrated under vacuum to give the desired compound as a highly dense transparent oil (1.1 g, 78% yield). The purity and identity were confirmed by analytical HPLC-MS and 1 1H-NMR.

[0256] Peptide synthesis using Fmoc-Lys(Boc-Hyd)-OH Figure 28 shows a schematic diagram of the peptide synthesis procedure. Briefly, the 7.3 (L-H) peptide was synthesized by manual or robot-assisted Fmoc solid-phase peptide synthesis using Rink Amide (LL) ProTide resin (loading 0.2 mmol / g). Prior to synthesis, the resin (0.05 mmol) was swollen in DMF (peptide synthesis grade, 2 mL) for 10 minutes in a peptide synthesis vessel. The coupling cycle consisted of a 10-minute removal of the Fmoc protecting group with a DMF solution of piperidine (20%, 2 mL), followed by filtration of the mixture and washing of the resin with DMF (3 × 2 mL, 1 minute). Amino acid coupling was carried out by treating with a solution of α-amino acids (3 equivalents for Fmoc-Arg(Pbf)-OH and Fmoc-His(Trt)-OH, 2 equivalents for Fmoc-Lys(Boc-Hyd)-OH) and N-HBTU (2.95 equivalents for Fmoc-Arg(Pbf)-OH and Fmoc-His(Trt)-OH, 1.95 equivalents for Fmoc-Lys(Boc-Hyd)-OH) dissolved in DMF (2 mL), which was mixed with DIEA (0.195 M solution in DMF, 3 equivalents for Fmoc-Arg(Pbf)-OH and Fmoc-His(Trt)-OH, 2 equivalents for Fmoc-Lys(Boc-Hyd)-OH), and the resulting mixture was shaken for 15 minutes by bubbling N2 through it. Finally, the resin was washed with DMF (3 × 2 mL, 1 minute).

[0257] When the linear peptide was complete, acetylation of the N-terminal group was carried out under standard Fmoc removal conditions (20% piperidine in DMF), followed by treatment with a solution of acetic anhydride and 2,6-lutidine (1:1, 1 mL) for 20 minutes. The resin was washed with DCM (2 × 2 mL, 5 minutes).

[0258] Finally, the peptide was deprotected and cleaved from the resin by standard TFA cleavage procedure at room temperature using TFA / DCM / H2O / TIS (90:5:2.5:2.5, 1 mL per 70 mg of resin) for 2 h. The mixture was then filtered, washed with TFA (1 mL), and the peptide was precipitated with ice-cold Et2O (25 mL). The precipitate was centrifuged and dissolved in H2O (4 mL). Purification was performed by C18 RP-HPLC using a binary gradient of solvent A and solvent B [Phenomenex Luna C18(2) 100A column, H2O (0.1% TFA) / CH3CN (0.1% TFA) 95:5 → 5:95 (0 → 5 min), 95:5 → 5:95 (5 → 35 min)], and the collected fractions were lyophilized and stored at -20 °C. Purity and identity were confirmed by analytical HPLC-MS and 1 H-NMR.

[0259] Notably, attempts at synthesis using this protocol enable saving the operator's time by up to 8 h (about 35% of the total synthesis time), in contrast to the aforementioned “peptide synthesis” protocol (the first entry in the “Materials and Methods” section) where Fmoc-Lys(Mtt)-OH is used in the peptide elongation step. Furthermore, the purity of the crude compound can be increased using this method, thereby improving the overall yield and facilitating the purification process.

[0260] Example 2: Protocol for in vitro transfection EGFP-expressing cells To generate a HeLa cell line expressing EGFP, HeLa cells were transfected with EGFP pDNA (pEGFP-C1, Clontech), and stable transfectants were selected with 400 μg / mL G-418 (Millipore). Green clones were selected by epifluorescence microscopy and tested for EGFP expression stability through several passages. Clones with very stable EGFP expression (approx. 90% EGFP-positive cells) were selected for further experiments. For further details, see I. Lostale-Seijo et al. (Peptide / Cas9 nanostructures for ribonucleoprotein cell membrane transport and gene edition, Chem. Sci., 2017). All other EGFP-expressing cell lines were obtained in a similar manner from the parental non-EGFP-expressing cell line.

[0261] The following cell lines were used in the examples. HeLa, corresponding to ATCC number CCL-2 (https: / / www.atcc.org / products / ccl-2), A549, corresponding to ATCC number CCL-185 (https: / / www.atcc.org / products / ccl-185), HepG2, corresponding to ATCC number HB-8065 (https: / / www.atcc.org / products / hb-8065), HCT116, corresponding to ATCC number CCL-247 (https: / / www.atcc.org / products / ccl-247), ARPE19, corresponding to ATCC number CRL-2302 (https: / / www.atcc.org / products / crl-2302), and Hek293, corresponding to ATCC number CRL-1573 (https: / / www.atcc.org / products / crl-1573)

[0262] siRNA Cells expressing EGFP were seeded into 96-well plates at a density of 50,000 cells / mL (100 μL / well) in DMEM + 10% FBS + 1% Gln-Abt the day before the experiment. For robotic library screening, delivery of EGFP-targeting siRNA (EGFP: enhanced green fluorescent protein, Ambion® Silencer® GFP Positive Control siRNA (siGFP) (AM4626)) was performed in six different cell lines expressing EGFP. The amphiphilic molecule stock solution in DMSO was diluted with DMEM and freshly mixed with the siRNA stock solution in DMEM before the transfection experiment to obtain several complexes at different amphiphilic substance concentrations (2 - 10 μM) while maintaining a constant final siRNA concentration of 30 nM. The mixture was shaken at room temperature (rt) for 30 minutes and then added to the cells. The cell medium was aspirated and the cells were washed twice with PBS. Finally, 50 μL of the siRNA / amphiphilic complex solution was added to the cells and incubated for 4 hours. After transfection, the medium was replaced with 100 μL of fresh DMEM supplemented with 10% FBS. Fluorescence knockdown was quantified 72 hours later with a plate reader by comparing with cells transfected with a non-targeting siRNA control (siMOCK, Silencer® Negative Control No.1 siRNA (siMOCK) (AM4611)). EGFP knockdown was compared with the silencing efficiency of Lipofectamine® RNAiMAX (30 - 60% depending on the cell line, defined numerically in the table below). All experiments were performed in triplicate.

[0263] As shown in Tables 1-5 and Table 7, the amphiphilic substances tested were able to deliver siRNA into cells and were superior to the gold standard Lipofectamine®. Furthermore, as shown in Tables 20-25, amphiphilic substances incorporating three hydrophobic tails into their structure exhibited improved delivery performance (decrease in EGFP fluorescence as a percentage relative to siMOCK transfection) compared to amphiphilic substances containing less than three hydrophobic tails. Amphiphilic molecules containing peptides having 9 or 13 amino acids functioned particularly well for siRNA delivery, especially when combined with DO, M, PA or PE hydrophobic tails, particularly the PE hydrophobic tail. For example, Peptide 13.3 combined with a DO or PA hydrophobic tail, or 13.3(L-H) combined with a PE, PA or M hydrophobic tail, functioned particularly well for the delivery of siRNA into the cell lines tested.

[0264] For the cytometry-based assay, delivery of siRNA (siGFP) into A549-GFP cells was performed. The amphiphilic molecule stock solution in DMSO was diluted with DMEM and freshly mixed with the siRNA stock solution in DMEM prior to the transfection experiment to obtain several complexes at different amphiphilic substance concentrations (5-10 μM) while maintaining a constant final siRNA concentration of 100 nM. After shaking the mixture at room temperature for 30 minutes, it was added to the cells. The cell medium was aspirated, 50 μL of the complex solution was added to the cells, and the cells were incubated for 4 hours. After incubation, the medium was replaced with 100 μL of fresh DMEM supplemented with 10% FBS. 72 hours after transfection, the DMEM was removed and the cells were cultured with 100 μL of trypsin for 5 minutes. Then, 100 μL of PBS (2% FBS and 1% EDTA 0.5 M) was added. Finally, GFP fluorescence was measured with a flow cytometer and the GFP positive rate was quantified. The amphiphilic transfection efficiency (i.e., GFP silencing) was compared to the control (untreated cells, normalized as 100% GFP expression) and siMOCK transfected cells (gray bars in Figure 29). All experiments were performed in triplicate. Quantification of the GFP positive rate is shown in Figure 29.

[0265] pDNA Cells were seeded at a concentration of 60,000 cells / mL (100 μL / w) in DMEM + 10% FBS + 1% Gln-Abt into 96-well plates the day before the experiment. For robotic library screening, delivery of pDNA encoding the expression of the Renilla luciferase gene (Rluc, pRL-CMV (Promega, No. E2261)) in six different cell lines was performed. The amphiphilic molecule stock solution in DMSO was diluted with DMEM and freshly mixed with the pDNA stock solution in DMEM before the transfection experiment to obtain several complexes at different amphiphilic substance concentrations (2 - 10 μM) while maintaining a constant final pDNA concentration of 2 ng / μL. After shaking the mixture at room temperature for 30 minutes, it was added to the cells. The cell medium was aspirated and the cells were washed twice with PBS. Finally, 50 μL of the complex solution was added to the cells and incubated for 4 hours. After incubation, the medium was replaced with 100 μL of fresh DMEM supplemented with 10% FBS. 72 hours after transfection, the DMEM was removed, the cells were washed once with HBSS, and 90 μl of HBSS was added to each well. The cells were incubated at 37 °C for 30 minutes. Subsequently, the basal luminescence level was read with a plate reader. Immediately, 10 μl of coelenterazine h in HBSS was added to each well (final concentration 5 μM) and the cells were incubated at 37 °C for 10 minutes. Finally, total luminescence measurements of the plates were performed. The amphiphilic transfection efficiencies were compared and normalized to the Lipofectamine® 2000 efficiency (values in Table 1 - 5, Table 7, 1, bold). All experiments were performed in triplicate.

[0266] As shown in Tables 1 to 5 and Table 7, the amphiphilic substances tested were able to deliver pDNA into cells and were superior to Lipofectamine® 2000, which is the gold standard. Furthermore, amphiphilic substances containing three hydrophobic tails in their structure showed improved delivery performance compared to amphiphilic substances containing two hydrophobic tails. This example is shown in Tables 8 to 13, particularly for cell lines A549, ARPE19, HCT116, HEK293, HeLa, and HepG2, where various three-tailed amphiphilic molecules are superior to their two-tailed counterparts with various hydrophobic tails. The best candidates were amphiphilic substances containing a cationic peptide having an amino acid number in the range of 7 to 17. The most common hydrophobic tails are M and PE, but not limited to these. Particularly good candidates are Peptide 7.3 (L-H) (Ac-RK*HRK*K*H-NH2, SEQ ID NO: 1), combined with M, PA, or PE tails, which shows the best transfection results for pDNA delivery through all cell lines tested, or Peptide 13.3 (R-H) (Ac-RHLK*RLK*RRLK*RL-NH2, SEQ ID NO: 18) having various aldehyde tails (DO, M, PA, PE, O) that are very effective in many cell lines. Furthermore, Peptide 9.3 (Ac-RK*LRRK*LRK*-NH2, SEQ ID NO: 13) provides diffuse effectiveness for pDNA delivery.

[0267] For the cytometry-based assay, delivery of pDNA encoding the expression of the eGFP gene (GFP) in HeLa and A549 cells was performed. The stock solution of the amphiphilic molecule in DMSO was diluted with DMEM and freshly mixed with the mRNA stock solution in DMEM before the transfection experiment to obtain several complexes at different amphiphilic substance concentrations (2.5 - 10 μM) while maintaining a constant final mRNA concentration of 2 ng / μL. The mixture was shaken at room temperature for 30 minutes and then added to the cells. The cell medium was aspirated and the cells were washed twice with PBS. Finally, 50 μL of the complex solution was added to the cells and incubated for 4 hours. After incubation, the medium was replaced with 100 μL of fresh DMEM supplemented with 10% FBS. 72 hours after transfection, the DMEM was removed and the cells were cultured with 100 uL of trypsin for 5 minutes. Then, 100 μL of PBS (supplemented with 2% FBS and 1% EDTA 0.5 M) was added. Finally, GFP fluorescence measurement was performed with a flow cytometer to quantify the percentage of GFP-positive (i.e., transfected) cells. The amphiphilic transfection efficiency was compared with control, non-treated cells and all experiments were performed in triplicate. Quantification of the percentage of GFP-positive cells is shown in FIGS. 24, 25 and 26.

[0268] mRNA Cells were seeded into 96-well plates at a density of 50,000 cells / mL (100 μL / w) in DMEM + 10% FBS + 1% Gln-Abt the day before the experiment. For robotic library screening, delivery of EGFP-mRNA (manufactured by TriLink, completely substituted with 5-methoxyuridine, capped, polyadenylated, TriLink, CleanCap® EGFP mRNA (5moU) reference L-7201) in six different cell lines was performed. Stock solutions of amphiphilic molecules were prepared in DMSO as described above and diluted in DMEM to obtain a range of concentrations. Solutions of EGFP-mRNA / amphiphilic molecule complexes were freshly prepared before transfection experiments. 35 μL of the corresponding amphiphilic substance was added to 10 μL of a solution containing 10 ng / μL of EGFP-mRNA in DMEM. The mixture was shaken at room temperature for 30 minutes and then added to the cells. The cell medium was aspirated and the cells were washed twice with PBS. The cells were covered with 39 μL of DMEM, 11 μL of the complex solution was added to the cells, and they were incubated for 4 hours (final concentration of peptide = 2.5, 5, and 10 μM, final concentration of EGFP-mRNA = 25 ng / well). After incubation, the medium was replaced with 100 μL of fresh DMEM supplemented with 10% FBS. Total EGFP fluorescence was quantified with a well plate reader 72 hours later. Amphiphilic transfection efficiencies were compared and normalized to Lipofectamine® MessengerMax efficiency (Table 1-5, values in Table 7, 1, double-underlined numbers). All experiments were performed in triplicate.

[0269] As shown in Tables 1 to 5 and Table 7, the amphiphilic substances tested were able to deliver mRNA into cells and were superior to the reagent Lipofectamine (registered trademark) MessengerMax. Furthermore, the amphiphilic substances incorporating three hydrophobic tails in their structure were superior to the amphiphilic substances incorporating two hydrophobic tails in their structure (see Tables 14 to 19). The amphiphilic substance containing a peptide consisting of seven amino acids and three hydrophobic tails functioned best in mRNA delivery. For example, Peptide 7.3 showed good mRNA delivery results with various hydrophobic tails. In particular, Peptide 7.3 (L-H) combined with M, PA or PE tails showed the best transfection results for mRNA delivery throughout all the cell lines tested. The amphiphilic substance containing a peptide consisting of thirteen amino acids and three hydrophobic tails also had very good performance in mRNA delivery.

[0270] For site - metric - based assays, delivery of mRNA encoding the expression of the eGFP gene (GFP, TriLink, refer to CleanCap® EGFP mRNA (5moU) L - 7201) in HeLa and A549 cells was performed. The amphiphilic molecule stock solution in DMSO was diluted with DMEM and freshly mixed with the mRNA stock solution in DMEM before the transfection experiment to obtain several complexes at different amphiphilic substance concentrations (2.5 - 10 μM) while maintaining a constant final mRNA concentration of 1 ng / μL. The mixture was shaken at room temperature for 30 minutes and then added to the cells. The cell medium was aspirated, and the cells were washed twice with PBS. Finally, 50 μL of the complex solution was added to the cells and incubated for 4 hours. After incubation, the medium was replaced with 100 μL of fresh DMEM supplemented with 10% FBS. 72 hours after transfection, the DMEM was removed, and the cells were cultured with 100 μL of trypsin for 5 minutes. Then, 100 μL of PBS (supplemented with 2% FBS and 1% EDTA 0.5 M) was added. Finally, GFP fluorescence measurement was performed with a flow cytometer, and the proportion of GFP - positive (i.e., transfected cells) was quantified. The amphiphilic transfection efficiency was compared with that of control, non - treated cells, and all experiments were performed in triplicate. Quantification of the proportion of GFP - positive cells is shown in Figures 23 and 27.

[0271] Cas9 - RNP (ribonucleoprotein) Cells expressing EGFP were seeded into 96-well plates at a density of 50,000 cells / mL (100 μL / w) in DMEM + 10% FBS + 1% Gln-Abt the day before the experiment. For robotic library screening, delivery of Cas9-RNP (ribonucleoprotein designed to knockout the gene encoding enhanced green fluorescent protein (EGFP)) against EGFP was performed. For RNP assembly, 9.2 μL of crRNA and 9.2 μL of tracrRNA were mixed in 211.6 μL of nuclease-free duplex buffer (IDT), incubated at 95 °C for 5 minutes, and slowly cooled to room temperature (see I. Lostale-Seijo, et al. Peptide / Cas9 nanostructures for ribonucleoprotein cell membrane transport and gene edition, Chem. Sci., 2017). Cas9 protein was dissolved in DMEM at a final concentration of 4 μM, an equal volume of the RNA complex and Cas9 were mixed, and incubated at room temperature for 5 minutes. 75 μL of the corresponding amphiphilic substance concentration was added to 5 μL of 2 μM RNP. After the mixture was shaken at room temperature for 30 minutes, it was added to the cells. The cell medium was aspirated, and the cells were washed twice with PBS. The cells were covered with 30 μL of DMEM, 20 μL of RNP / amphiphilic complex was added to the cells (final peptide concentrations = 2.5, 5, and 10 μM, final Cas9-RNP concentration = 50 nM), and incubated for 4 hours. After incubation, the medium was replaced with 100 μL of fresh DMEM supplemented with 10% FBS. Total EGFP fluorescence was quantified with a plate reader 72 hours later (Figure 2, Table 1 (right), and Table 6). All experiments were performed in triplicate.

[0272] As shown in Tables 1 and 6, the amphiphilic substances tested were able to deliver Cas9-RNP into cells and were superior to Lipofectamine® CRISPRMAX. Tables 26-31 show that amphiphilic substances incorporating three hydrophobic tails in their structure were superior to amphiphilic substances incorporating two hydrophobic tails in their structure.

[0273] The following table shows the transfection results for the above cargos in several cell lines compared to the gold standard Lipofectamine® series.

[0274] Tables 1 - 7: RLuc (pDNA) or EGFP (mRNA) expression levels were normalized to the Lipofectamine reagent (value = 1) and represented as fold increase in signal. For siRNA, the fluorescence of siRNA-treated cells was compared to siMOCK control fluorescence, and Cas9-RNP-mediated knockout was measured against the fluorescence of untreated cells. For both siRNA and Cas9-RNP, the values are represented as % decrease in fluorescence. The concentration of the amphiphilic substance was 5 μM in all cases. All experiments were performed in triplicate.

[0275] Table 1. Delivery of pDNA, mRNA, siRNA (left part of the table) and Cas9-RNP (right part of the table) in A549 cells. For siRNA delivery, the value of Lipofectamine® corresponded to 50% of fluorescence knockdown, and for Cas9-RNP, the % decrease of Lipofectamine CRISPRMax was 50%. TIFF2025522522000013.tif54170

[0276] For the three nucleic acid cargos (pDNA, mRNA and siRNA) tested, the peptides with three tails were able to efficiently deliver the nucleic acids. See also Tables 8 - 31.

[0277] For pDNA delivery, among all the hydrophobic tails tested, the amphiphilic substances containing dodecanal, myristoleyl, palmitoleyl, petroselinyl and oleyl aldehyde in their structure were able to transfect pDNA with good efficiency. The amphiphilic substance containing peptide 7.3 (Leu-His) with palmitoleyl or petroselinyl aldehyde is the best candidate for pDNA delivery to this cell line and functions 30-fold better than Lipofectamine 2000.

[0278] In the case of mRNA delivery, the amphiphilic substance containing peptide 7.3 (Leu-His) with palmitoleyl aldehyde was superior to Lipofectamine® MessengerMAX in this cell line and was 2-fold better.

[0279] In the case of siRNA delivery, the amphiphilic substance containing peptides with 9 and 13 amino acids brought about a GFP silencing level of 60 - 75%, while the Lipofectamine RNAiMAX silencing level was approximately 50%.

[0280] In the case of Cas9-RNP delivery, the efficiency for GFP silencing was approximately 60 - 70% when the amphiphilic substance containing 7.3 (Leu-His) and myristoleyl, palmitoleyl or petroselinyl aldehyde was complexed with the protein. The cells transfected with the above complex showed a cell viability of over 80%. A viability assay was performed using the CellTiter96® Aqueous Non-Radioactive Cell Proliferation Assay (MTS) according to the manufacturer's instructions. Briefly, 20 μL of the MTS / PMS mixed solution was added to each well of a 96-well assay plate containing cells in culture medium (100 μl). The plate was incubated at 37 °C and 5% CO2 for 4 hours in a humidified atmosphere. Then, the absorbance (490 nM) was recorded on an INFINITE M1000 PRO (TECAN).

[0281] Table 2. Delivery of pDNA, mRNA, siRNA in ARPE19 cells. In the case of siRNA delivery, the value of Lipofectamine® corresponds to 40% of the fluorescence knockdown. TIFF2025522522000014.tif50170

[0282] For the three cargos tested, the peptide with three tails was able to efficiently deliver the nucleic acid. See also Tables 8 - 31.

[0283] In the case of pDNA delivery, among all the hydrophobic tails tested, amphiphilic molecules containing dodecanal, myristyl, palmityl or petroselinyl aldehyde deliver pDNA to this cell line with higher efficiency than the gold standard Lipofectamine® 2000. In particular, the complex containing the amphiphilic substance formed by the cationic peptide 7.3 (Leu-His) with palmityl or petroselinyl aldehyde is the best candidate for pDNA delivery to this cell line, being 10-fold and 7-fold superior to Lipofectamine® 2000 respectively.

[0284] In the case of mRNA delivery, the complex containing the amphiphilic substance formed by the peptide with 7 amino acids can deliver mRNA better than Lipofectamine® MessengerMAX, which is an amphiphilic substance containing myristyl, palmityl and petroselinyl aldehyde and is up to 6-fold superior to Lipofectamine® MessengerMAX.

[0285] In the case of siRNA delivery, the amphiphilic substances containing peptides with 7, 9 and 13 amino acids achieve a GFP silencing level of 50 - 65%, while the silencing efficiency of Lipofectamine® RNAiMAX is approximately 40%.

[0286] Table 3. Delivery of pDNA, mRNA, siRNA in HCT116 cells. In the case of siRNA delivery, the value of Lipofectamine® corresponds to 40% of the fluorescence knockdown. TIFF2025522522000015.tif67170

[0287] For the three cargos tested, the amphiphilic substances containing peptides with three hydrophobic tails can efficiently deliver nucleic acids. See also Tables 8 - 31.

[0288] In the case of pDNA delivery to HCT116 cells, among all the hydrophobic tails tested, amphiphilic substances containing dodecanal, myristoyl, palmitoyl petroselinyl, oleyl, and eicosenoyl aldehyde deliver pDNA with higher efficiency than the gold standard Lipofectamine® 2000. In particular, amphiphilic substances containing the 7.3 (Leu-His) peptide with palmitoyl aldehyde and amphiphilic substances containing 13-amino acid peptides with histidine (13.3 (Leu-His), 13.3 (Arg-His), or 13.3 (3His)) and palmitoyl aldehyde are the best candidates for pDNA delivery in these cells, being up to 10-fold and 9-fold superior to Lipofectamine® 2000, respectively.

[0289] In the case of mRNA delivery, amphiphilic substances containing peptides with 7 amino acids can deliver mRNA better than Lipofectamine® MessengerMAX, which is an amphiphilic substance containing a peptide with myristoyl aldehyde or palmitoyl aldehyde and is 3 - 6 times superior to Lipofectamine® MessengerMAX.

[0290] In the case of siRNA delivery, amphiphilic substances containing peptides with 7, 9, and 13 amino acids achieve GFP silencing levels of 51 - 63%, while the silencing activity of Lipofectamine® RNAiMAX is approximately 40%. Amphiphilic substances containing peptides with 13 amino acids are the most efficient when delivering siRNA to HCT116 cells.

[0291] Table 4. Delivery of pDNA, mRNA, and siRNA in Hek293 cells. In the case of siRNA delivery, the value of Lipofectamine® corresponds to 30% of the fluorescence knockdown. TIFF2025522522000016.tif75170

[0292] In this cell line, a variety of peptides combined with a variety of hydrophobic tails act efficiently in the delivery of the three cargos tested. See also Tables 8 - 31.

[0293] In the case of pDNA delivery, among all the hydrophobic tails tested, myristoyl aldehyde is the most performant hydrophobic tail for the delivery of pDNA with various peptide lengths, achieving a delivery efficiency up to 7 - fold better than the gold standard Lipofectamine® 2000.

[0294] In the case of mRNA delivery, amphiphilic substances containing peptides with 7 amino acids can deliver mRNA better than Lipofectamine® MessengerMAX, which are amphiphilic substances containing peptides with myristoyl aldehyde or petroselinic aldehyde, being 2 - 3 times better than Lipofectamine® MessengerMAX.

[0295] In the case of siRNA delivery, amphiphilic substances containing peptides with 9, 13, and 17 amino acids achieve GFP silencing levels of 40 - 62%, while the silencing activity of Lipofectamine® RNAiMAX is approximately 30%.

[0296] Table 5. Delivery of pDNA, mRNA, and siRNA in HeLa cells. In the case of siRNA delivery, the Lipofectamine® value corresponds to 60% of the fluorescence knockdown. TIFF2025522522000017.tif81170

[0297] A variety of peptides combined with a variety of hydrophobic tails act efficiently in the delivery of the three cargos tested. See also Tables 8 - 31.

[0298] In the case of pDNA delivery, among all the hydrophobic tails tested, palmitroleyl and petroselinyl aldehyde are the hydrophobic tails that function best for pDNA delivery to HeLa cells when present with peptides of different lengths in the amphiphilic molecule. With these hydrophobic tails, the amphiphilic substances achieve an efficiency up to 25 times better than the gold standard Lipofectamine® 2000. Amphiphilic substances containing peptides consisting of 9 and 13 amino acids and dodecanal as the hydrophobic tail can also efficiently deliver pDNA to HeLa cells.

[0299] In the case of mRNA delivery, amphiphilic substances containing the 7.3 (Leu-His) peptide can deliver mRNA better than Lipofectamine® MessengerMAX, which is an amphiphilic substance with myristoleyl aldehyde, palmitroleyl aldehyde, or petroselinyl aldehyde, and is 2 - 3 times better than Lipofectamine® MessengerMAX.

[0300] In the case of siRNA delivery, amphiphilic substances containing a peptide with 13 amino acids achieve the best level of GFP silencing, sometimes reaching over 80% of the silencing activity, while the silencing activity of Lipofectamine® RNAiMAX is approximately 60%.

[0301] In the case of Cas9 delivery (see Table 6 below), the efficiency for GFP silencing was approximately 80% for amphiphilic substances containing a 9 - amino acid peptide with three hydrophobic tails and dodecanal or palmitroleyl aldehyde. Amphiphilic substances containing a 13 - amino acid peptide with three hydrophobic tails are also very efficient for intracellular delivery of Cas9 in HeLa cells. All the tested amphiphilic substances showed a cell viability of over 80% when used at a concentration of 5 μM in the transfection experiment.

[0302] Table 6. Cas9-RNP delivery in HeLa cells. The table shows the % GFP silencing by gene editing. In this case, Lipofectamine CRISPRMax silenced up to 70%. TIFF2025522522000018.tif34170

[0303] Table 7. Delivery of pDNA, mRNA, and siRNA in HepG2 cells. For siRNA delivery, the value of Lipofectamine® corresponds to 30% of the fluorescent knockdown. TIFF2025522522000019.tif47170

[0304] For the three cargos tested, the amphiphilic molecules containing the peptide with three tails were able to efficiently deliver nucleic acids. See also Tables 8 - 31.

[0305] For pDNA delivery, among all the hydrophobic tails tested with the amphiphilic molecules described in the table, myristoleyl aldehyde is the hydrophobic tail that functions best when delivering pDNA in HepG2 cells in combination with a peptide consisting of 7 amino acids, and its transfection efficiency is 6-fold better than that of Lipofectamine® 2000.

[0306] For mRNA delivery, the amphiphilic substances containing the 7.3 (Leu-His) peptide with myristoleyl or petroselinyl aldehyde were able to outperform the activity of Lipofectamine® MessengerMAX.

[0307] For siRNA delivery, the amphiphilic substances containing a peptide consisting of 13 amino acids and palmitoleyl or petroselinyl aldehyde achieved GFP silencing levels of 41 - 46%, while the silencing activity of Lipofectamine® RNAiMAX was approximately 30%.

[0308] Example 3: Results of in vitro transfection Tables 8 to 31 show the results of pDNA, mRNA, siRNA, and Cas9 delivery at the indicated concentrations using the indicated amphiphilic substances in different cell lines. The details of all experiments are the same as those described in Example 2.

[0309] pDNA delivery Tables 8 to 13 show the average (triplicate) luminescence intensities (RLU) measured after transfection of RLuc pDNA with different amphiphilic substances at different concentrations in various cell lines. The background luminescence values accounted for by untransfected control cells were subtracted for processing.

[0310] Table 8. pDNA delivery in A549 cells TIFF2025522522000020.tif226170

[0311] Table 9. pDNA delivery in ARPE19 cells TIFF2025522522000021.tif211170

[0312] Table 10. pDNA delivery in HCT116 cells TIFF2025522522000022.tif208170

[0313] Table 11. pDNA delivery in Hek293 cells TIFF2025522522000023.tif232170

[0314] Table 12. pDNA delivery in HeLa cells TIFF2025522522000024.tif234170

[0315] Table 13. pDNA delivery in HepG2 cells TIFF2025522522000025.tif225170

[0316] mRNA delivery Tables 14 - 19 show the average (triplicate) fluorescence intensities measured after transfection of EGFP mRNA with different amphiphilic substances at different concentrations in various cell lines. The background fluorescence values accounted for by untreated control cells were subtracted for the treatment.

[0317] Table 14. mRNA Delivery in A549 Cells TIFF2025522522000026.tif233170

[0318] Table 15. mRNA Delivery in ARPE19 Cells TIFF2025522522000027.tif239170

[0319] Table 16. mRNA Delivery in HCT116 Cells TIFF2025522522000028.tif236170

[0320] Table 17. mRNA Delivery in Hek293 Cells TIFF2025522522000029.tif232170

[0321] Table 18. mRNA Delivery in HeLa Cells TIFF2025522522000030.tif238170

[0322] Table 19. mRNA Delivery in HepG2 Cells TIFF2025522522000031.tif238170

[0323] siRNA Delivery Tables 20 - 25 show the average (triplicate) percentage of GFP silencing accounted for by the decrease in fluorescence intensity measured after transfection of siRNA with different amphiphilic substances at different concentrations in various cell lines, compared to the non - targeted siRNA (siMOCK) control. The background values accounted for by untreated control cells were subtracted for the treatment.

[0324] Table 20. siRNA delivery in A549 cells TIFF2025522522000032.tif74170

[0325] Table 21. siRNA delivery in ARPE19 cells TIFF2025522522000033.tif74170

[0326] Table 22. siRNA delivery in HCT116 cells TIFF2025522522000034.tif78170

[0327] Table 23. siRNA delivery in Hek293 cells TIFF2025522522000035.tif74170

[0328] Table 24. siRNA delivery in HeLa cells TIFF2025522522000036.tif74170

[0329] Table 25. siRNA delivery in HepG2 cells TIFF2025522522000037.tif74170

[0330] Cas9 delivery Tables 26 - 31 show the average (triplicate) percentage of gene editing, as explained by the decrease in GFP fluorescence intensity (percentage decrease), measured after transfection of Cas9 - RNP with different amphiphilic substances at different concentrations in various cell lines. The background value, as explained by untreated control cells, was subtracted for the treatment.

[0331] Table 26. Cas9 delivery in A549 cells TIFF2025522522000038.tif74170

[0332] Table 27. Cas9 delivery in ARPE19 cells TIFF2025522522000039.tif78170

[0333] Table 28. Cas9 delivery in HCT116 cells TIFF2025522522000040.tif78170

[0334] Table 29. Cas9 delivery in Hek293 cells TIFF2025522522000041.tif74170

[0335] Table 30. Cas9 delivery in HeLa cells TIFF2025522522000042.tif73170

[0336] Table 31. Cas9 delivery in HepG2 cells TIFF2025522522000043.tif72170

[0337] Example 4: Intracellular delivery of Cas9 ribonucleoprotein The inventors evaluated the intracellular delivery of Cas9 ribonucleoprotein with a gRNA targeting EGFP into HeLa-EGFP cells using an amphiphilic molecule containing peptide 7.3 (Leu-His) combined with myristoyl, palmitoyl or petroselinyl aldehyde. Three days later, EGFP-negative cells were quantified by flow cytometry.

[0338] Figure 2 shows that amphiphilic molecules containing peptide 7.3 (Leu-His) and myristoyl aldehyde or palmitoyl aldehyde reached 70% editing compared to 30% editing achieved by the control using Lipofectamine® CRISPRMAX. Furthermore, the concentration of cells obtained with both amphiphilic substances was on average three times the concentration of cells obtained with Lipofectamine®, indicating that both amphiphilic substances achieved an improved level of cell viability compared to Lipofectamine®.

[0339] Example 5: Transfection Experiment Using D-Peptides A 7.3 (Leu-His) peptide having D-amino acids was synthesized. This peptide would be more resistant to degradation by proteases. The inventors observed the delivery of EGFP pDNA using an amphiphilic substance containing either enantiomer (either a 7.3 (Leu-His) peptide having D-amino acids or L-amino acids) and myristoyl aldehyde, and compared their transfection activities in HeLa cells. The number of EGFP-expressing cells was measured by flow cytometry. Figure 3 shows that both peptides function equally efficiently.

[0340] Example 6: Transfection Experiment in Confluent Cells To confirm the effect of this parameter on the activity of the amphiphilic substance 7.3(Leu-His)M, experiments were conducted in cultured cells at different confluence levels. As described above, transfection experiments are usually performed on cells seeded at a cell density of 60,000 cells / mL (100 μL / well) the day before. In this example, transfection experiments using EGFP pDNA were conducted in HeLa cells concentrated 2-fold and 4-fold (120,000 and 240,000 cells / mL, respectively). Figure 4 shows that the above-mentioned amphiphilic substance functions equally well at all cell concentrations tested. However, in this experiment, as the cell concentration increased, a larger volume of the composite amphiphilic substance / pDNA was required (50, 100, and 200 μL of the complex were used for 60,000, 120,000, and 240,000 cells / mL, respectively).

[0341] Example 7: Transfection Experiment in Chicken Embryo Fibroblasts Using the amphiphilic substance obtained by combining peptide 7.3 (Leu-His) with myristoyl aldehyde (7.3(Leu-His)M), EGFP pDNA was delivered to primary chicken embryo fibroblasts (CEF), non-immortalized cells that are difficult to transfect, obtained from 9- to 10-day-old chicken embryos. The transfection efficiency of the amphiphilic substance 7.3(Leu-His)M was compared with the transfection efficiencies of Lipofectamine® 2000 (LF) and TransIT-LT1 transfection reagent (Mirus). Figure 5 shows that the transfection efficiency of the amphiphilic substance 7.3(Leu-His)M is better than the transfection efficiencies of both controls (LF and Mirus), and the amphiphilic substance of the present invention is 2-fold superior to Lipofectamine® 2000 (LF) and up to 5-fold superior to the TransIT-LT1 transfection reagent (Mirus).

[0342] Example 8: Cell viability of the amphiphilic substance 7.3(Leu-His)M An MTT assay was performed to determine the IC50 of the amphiphilic substance containing the 7.3(Leu-His) peptide with myristoyl aldehyde (7.3(Leu-His)M) in six cell lines. As shown in Figure 18, for all cell lines except HepG2, where the IC50 is approximately 60 μM, the IC50 is 13 - 24 μM.

[0343] Example 9: Short peptides Several structural modifications were made to peptide 7.3 (Leu-His). The delivery of EGFP pDNA in HeLa cells using these peptides and amphiphilic substances containing myristoyl aldehyde was tested. The modifications consisted of changes in the amino acid sequence, substitution of 1 - 3 K* residues for O* residues, and addition of 1 or 2 R residues to the N-terminus. In SEQ ID NO: 53 and SEQ ID NO: 55, the final residue, either H or L, was removed respectively. All peptides have the same number of hydrazide-modification reactive basic amino acids (K* or O*). Some of the structures can be seen in Table 32 below. The synthesized short peptides with L-amino acids are as follows. TIFF2025522522000044.tif77170

[0344] Table 32. Peptide sequence modifications derived from 7.3 (Leu-His) (K* = hydrazide-modified lysine, see general synthetic scheme, O* = hydrazide-modified ornithine) TIFF2025522522000045.tif64170

[0345] The amphiphilic substances containing peptide V1-7.3 (Leu-His) and myristoyl aldehyde generally show the same transfection efficiency compared to amphiphilic substance 7.3(Leu-His)M, except for the A549 cell line which generally has an efficiency of about half (see Figure 6). The amphiphilic substances containing peptide V2-7.3 (Leu-His) and myristoyl aldehyde show a transfection efficiency of about 50% for amphiphilic substance V1-7.3(Leu-His)M or 7.3(Leu-His)M, except that in the A549 cell line, V2-7.3(Leu-His)M shows an improved efficiency that matches the transfection efficiency of V1-7.3(Leu-His)M. In all these cases, myristoyl aldehyde was used as the hydrophobic tail as described above.

[0346] Example 10: Protocol for in vivo transfection In vivo bioluminescence imaging (BLI) enables the localization and quantification of expression after mRNA delivery in living animals.

[0347] Pre-diluted formulation The inventors evaluated the mRNA delivery efficiency of amphiphilic substances by i.m. injection of amphiphilic complexed FLuc mRNA into anesthetized mice using BLI. A stock solution of the amphiphilic molecule was prepared in DMSO as described above and diluted with an appropriate buffer such as PBS or a phosphate buffer concentrated with inorganic salts. The mRNA / amphiphilic complex solution was freshly prepared before the in vivo experiment. The amphiphilic solution in an appropriate buffer such as PBS or a phosphate buffer concentrated with inorganic salts was mixed with the mRNA solution in an appropriate buffer such as PBS or a phosphate buffer concentrated with inorganic salts (1:1 volume ratio, final amount of mRNA per mouse = 5 μg / mouse). The mixture was shaken at room temperature for 30 minutes and then injected. For each mouse, 5 μg of mRNA was complexed with the best candidates obtained from in vitro experiments, 7.3(Leu-His) with myristoleic aldehyde (7.3(Leu-His)M) (Figure 7) or 7.3(Leu-His) with palmitoleic aldehyde (7.3(Leu-His)PA) (Figure 8), and administered by i.m. injection into the right flank in 50 μL of an appropriate buffer such as PBS or a phosphate buffer concentrated with inorganic salts. As a control, 5 μg of naked mRNA was injected into three mice. Luciferase expression was evaluated starting 1 hour after administration of the mRNA complex over 48 hours. High levels of luciferase activity were observed at the injection site for both amphiphilic compounds. This expression reached a peak at 7 hours at all concentrations tested for 7.3(Leu-His)M (Figure 7), while 7.3(Leu-His)PA showed temporal variation at the concentration of the most functional amphiphilic substance, and the formulation was more efficient than 2.5 μM at shorter times after injection and more efficient than 10 μM at longer observation times (Figure 8). In contrast, i.m. injection of naked mRNA resulted in low levels of luciferase expression in all mice when measured by photon flux. The experiments were performed in at least triplicate (3 mice per condition).

[0348] After obtaining the conditions that provided the highest expression, a second i.m. delivery of FLuc mRNA was performed to further optimize the formulation of the complex. Under fully similar experimental conditions, the best concentration (2.5 μM) of the amphiphile 7.3(Leu-His)M that was observed was fixed, and complexes with increasing amounts of FLuc mRNA (1.25, 3, or 5 μg / mouse) were prepared and administered i.m. as described above. (Figure 9). This experiment revealed that the highest bioluminescence, i.e., the highest level of FLuc expression, was achieved using the complex formed by 2.5 μM of the amphiphile and 5 μg / mouse of FLuc mRNA.

[0349] Furthermore, these optimized conditions were further screened for the delivery of FLuc mRNA using other routes of administration, such as intradermal (i.d.) and subcutaneous (s.c.) (Figure 14, both using 5 μg of FLuc mRNA) or intravenous (i.v.) (Figure 10). For i.d. and s.c. injections, the previously optimized conditions did not function more efficiently than i.m. delivery (Figure 14).

[0350] In the case of i.v. administration (tail vein), luciferase expression was initiated 1 hour after administration of the mRNA complex and evaluated over 24 hours. Subsequently, the specimens were sacrificed and each organ was analyzed individually using BLI for quantification of expression. In this case, the preferred conditions included injection of 50 μL of the complex solution in an appropriate buffer such as PBS or a phosphate buffer concentrated with inorganic salts, containing 2.5 μM of 7.3(Leu-His)M and 1.3 μg / mouse of FLuc mRNA. Under all conditions tested, a preferred in vivo distribution of bioluminescence in the spleen was observed, followed by liver expression and to a lesser extent in the lungs (Figure 10).

[0351] Concentrated formulation The stock solution of the amphiphilic substance was prepared with DMSO as described above. In this case, the amphiphilic substance was directly contacted with a solution of the nucleic acid cargo in an appropriate buffer such as PBS, or a phosphate buffer in which inorganic salts were concentrated, without a preliminary dilution step of the DMSO solution of the amphiphilic substance in an appropriate aqueous buffer. The delivery efficiency of mRNA by the i.v. administration route was determined by bioluminescence imaging (BLI). Fluc mRNA (5 μg / mouse) was contacted with a concentrated 7.3 (L-H) M amphiphilic substance-DMSO solution at various water-organic volume ratios (Figure 16, amphiphilic substance concentration of 125 μM) for 30 minutes and administered intravenously at 200 μL (5 μg mRNA / mouse). Luciferase expression was evaluated over 24 hours starting 1 hour after administration of the mRNA complex. Thereafter, the mice were sacrificed and each organ was individually analyzed using bioluminescence imaging (BLI) for quantification of expression. Under all conditions tested, a favorable in vivo distribution of bioluminescence in the spleen was observed. From all volume ratios tested, the complex prepared using a 1:100 (DMSO:aqueous) ratio showed the highest bioluminescence value with up to an order of magnitude increase in luminescence compared to the 1:200 ratio. The results of transfection using the optimal volume ratios (final amphiphilic substance concentrations of 125 or 250 μM) for the candidates 7.2DO, 7.2M, 9.2DO, and 9.2M and the quantification of expression in the organs are shown in Figures 12, 11, 13, and 20, respectively.

[0352] Figure 19 shows an in vivo transfection experiment in mice using an amphiphilic substance containing peptide 13.2 with oleyl aldehyde (13.2 O). This figure shows representative bioluminescence images of mice and excised organs after i.v. (intravenous) injection of the FLuc mRNA / amphiphilic substance 13.2 O complex (as shown, 125 and 250 μM of 13.2 O were used) at different times (1 hour, 4 hours, 7 hours, and 24 hours). Quantification of organ bioluminescence is shown in Figure 19B. Complexes were formed as described above using 5 μg of FLuc mRNA. As seen in Figure 19, the amphiphilic substance containing peptide 13.2, i.e., having two hydrophobic tails, shows very limited in vivo delivery compared to the same amount of mRNA delivered with amphiphilic substance 7.3 (Leu-His)M (Figure 16).

[0353] Figure 30 is a diagram showing the effect of using stock solutions of amphiphilic substances prepared at different peptide to hydrophobic tail aldehyde ratios. In particular, a DMSO solution of peptide 7.3 (L-H) was reacted independently at 60 °C for 2 hours with a solution of 0, 1, 2, 3, 4, or 5 equivalents of myristoleyl aldehyde dissolved in 15% AcOH / DMSO, and then the FLuc mRNA / amphiphilic substance concentration formulation protocol was carried out prior to in vivo administration. Figure 30 shows similar in vivo amphiphilic substance delivery efficiencies over the range of 1 to 5 equivalents of the hydrophobic tail in the amphiphilic substance formation step.

[0354] Example 11: DLS measurement of complexes containing 7.3M or 7.3 (L-H)M and pDNA (100 ng, in vitro conditions) or mRNA (50 ng, in vitro conditions) Complexes formed after mixing EGFP pDNA (100 ng) or mRNA (50 ng) with 7.3M or 7.3 (L-H)M amphiphilic substances in a concentration range (2.5 - 10 μM) and a pH value range (4 - 10) were characterized by DLS to describe their size (average diameter) and surface charge (ζ potential) as shown in Figure 15. In particular, Figure 15 shows the following.

[0355] Panel A: The 7.3M + pDNA complexes showed an average diameter of 70 - 200 nM, and the results for amphiphile concentrations of 2.5 and 10 μM were very similar (70 - 100 nM) and invariant across the entire pH range. The results for 5 μM showed larger particles, with their diameter peaking at neutral pH (200 nM). These results demonstrate an optimal size for cell delivery. Panel B: At 2.5 and 5 μM, an increase in pH resulted in a decrease in the surface charge of the particles (from -5 to -40 mV and +35 to -30 mV, respectively), while the ζ - potential results for 10 μM remained positive (+20 to +30) independent of the pH value. Thus, the concentration of the cationic amphiphile present in the formulation is an important factor in the correct surface charge balance of the formulated pDNA / amphiphile complexes.

[0356] Panel A: The 7.3(L - H)M + pDNA complexes increased their average diameter upon increasing pH at all concentrations tested, almost doubling their size from pH 4 to pH 10 values. Panel B: Increasing pH at all concentrations tested led to a decrease in the surface potential of the complex formulation. The higher the concentration of the amphiphile, the greater the observed decrease in ζ - potential, which went from +60 to -45 mV at 10 μM, at pH 4 and pH 10, respectively.

[0357] Panel C: The 7.3M + mRNA complexes showed very low variability in their average diameter across the entire range of concentrations and pH values tested. All recorded values of 50 - 100 nM make them optimal candidates for intracellular delivery. Panel B: The surface potential results were positive in all cases (+5 - +30 mV), facilitating interaction with the negatively charged cell membrane environment. There was a tendency for the ζ - potential to increase with the concentration of the amphiphile and the pH value.

[0358] Panel D: The 7.3 (L-H) M+mRNA complex shows a very small variation in mean diameter (100 - 150 nm) across the entire range of tested concentrations and pH values, with the only exception being particles formulated at pH 7 and lower amphiphile concentrations, where the mean diameter grows to a significant extent, namely up to 500 nM. Lower panel: As expected, increasing the amphiphile concentration improves the cationic character of the particle surface potential, and a similar trend is also observed when the pH of the medium is increased.

[0359] Example 12: SARS-CoV-2 Immunity The prefusion-stabilized form of the coronavirus SARS-CoV-2 spike protein (Protein S, residues 986 KV 987 of 986 PP 987 substituted by, and 682 GSAS 685 substituted frin cleavage site by 682 RRAR 685 removed, encoding the ORF sequence of SEQ ID NO: 27) (based on the previously described sequence) Codon-optimized mRNA (custom RNA synthesized, capped, polyadenylated, and fully substituted with N1-methylpseudouridine by TriLink) (concentrated formulation, Example 10) was administered i.v. A stock solution of the amphiphilic molecule was prepared in DMSO as described above for the concentrated formulation. Mice were injected with 2 μL of the amphiphilic substance (50 mM) and 5 μg of formulated mRNA or 2.8 μL of the amphiphilic substance (50 mM) and 5 μg of formulated mRNA + 2 μg of CpG. Mice were vaccinated by i.v. injection and boost immunized 21 days after the first injection (with the same formulation). For i.v. administration, 200 μL of the formulated mRNA / amphiphilic substance was administered by tail vein injection. At 14 and 35 days after injection, blood was collected into Eppendorf tubes and allowed to stand at room temperature for 3 - 4 hours. After centrifugation at 10,000 g for 10 minutes, the supernatant was recovered and frozen at -80 °C until quantification of IgG by ELISA was performed.

[0360] ELISA: Nunc-Immuno 96-well ELISA plates were coated overnight with 1 μg / mL SARS-CoV-2 Spike S1-His recombinant protein (Sinobiological) at 100 μL / well in PBS buffer pH 7.2. After washing three times with ELISA wash buffer (PBS containing 0.05% Tween-20, PBS-T), the wells were blocked with 200 μL of 3% non-fat dry milk diluted in PBS-T at room temperature for 1 hour. Serum dilutions (1:50 and 1:250) were prepared in PBS-T containing 1% non-fat dry milk. The blocking solution was removed and the wells were washed twice with 200 μL of PBS-T. Then, 100 μL of each serum dilution was added to the plate and incubated for 2 hours at room temperature with shaking (70 rpm). The wells were washed three times with 200 μL of PBS-T and incubated with goat anti-mouse IgG Fc, human / bovine / horse SP ads-HRP (Southern Biotech) (1:2,000) in 1% non-fat dry milk at room temperature for 1 hour with shaking (70 rpm). The wells were washed three times with PBS-T and 100 μL of SureBlue TMB microwell peroxidase substrate was added to each well. After developing color for 30 minutes, the reaction was stopped with 100 μL of 1 M HCl. The optical density (OD450) at 450 nM was measured using a Tecan Infinite F200Pro microplate reader (Figure 17). The OD450 of serum samples collected 14 days after injection showed values exceeding the background (3 times the blank) only for the formulation containing the CpG adjuvant at the lowest serum dilution factor. Samples 35 days after injection showed positive results for both formulations with and without the CpG adjuvant at both serum dilution factors.

[0361] Example 13: OVA Immunization OVA (ovalbumin), a well-known adjuvant TLR9 agonist CpG (Invivogen ODN2395, 5’TCGTCGTTTTCGGCGCGCGCCG3’ (SEQ ID NO: 60), bases are phosphorothioate), with or without, was formulated with the amphiphilic substance 7.3 (L-H)M, and mRNA encoding it (concentrated formulation, Example 10) (OVA; manufactured by TriLink, capped, polyadenylated, completely substituted with 5-methoxyuridine, CleanCap® OVA mRNA(5moU)-(L-7210)) was administered i.v. The stock solution of the amphiphilic molecule was prepared with DMSO as described above for the concentrated formulation. Mice were injected with 5 μg of mRNA (125 μM) formulated with the amphiphilic substance or 5 μg of mRNA + 2 μg of CpG (175 μM) formulated with the amphiphilic substance. Mice were vaccinated by i.v. injection and boostered 21 days after the first injection (with the same formulation). For i.v. administration, 200 μL of the formulated mRNA / amphiphilic substance was administered by tail vein injection. At 14 and 35 days after injection, blood was collected into Eppendorf tubes and allowed to stand at room temperature for 3 - 4 hours. After centrifugation at 10,000 g for 10 minutes, the supernatant was collected and frozen at -80 °C until quantification of IgG by ELISA was performed.

[0362] ELISA: Nunc-Immuno 96-well ELISA plates were coated overnight with 100 μL / well of 1 μg / mL OVA (Sigma-Aldrich, CAS: 9006-59-1) in PBS buffer pH 7.2. After washing three times with ELISA wash buffer (PBS containing 0.05% Tween-20, PBS-T), the wells were blocked with 200 μL of 3% non-fat dry milk diluted in PBS-T for 1 hour at room temperature. Serum dilutions (1:50 and 1:250) were prepared in PBS-T containing 1% non-fat dry milk. The blocking solution was removed and the wells were washed twice with 200 μL of PBS-T. Then, 100 μL of each serum dilution was added to the plate and incubated for 2 hours at room temperature with shaking (70 rpm). The wells were washed three times with 200 μL of PBS-T and incubated for 1 hour at room temperature with shaking (70 rpm) in 1% non-fat dry milk with goat anti-mouse IgG Fc, human / bovine / horse SP ads-HRP (Southern Biotech) (1:2,000). The wells were washed three times with PBS-T and 100 μL of SureBlue TMB microwell peroxidase substrate was added to each well. After developing the color for 10 minutes, the reaction was stopped with 100 μL of 1 M HCl. The optical density (OD450) at 450 nM was measured using a Tecan Infinite F200Pro microplate reader (Figure 21A).

[0363] Furthermore, serial dilutions (10 2 to 10 9 ) of the sera obtained on day 35 were analyzed by ELISA using secondary goat anti-mouse IgG1 or IgG2c human / bovine / horse SP ads-HRP antibodies (1:2,000, Southern Biotech) to examine the titers of different isotypes and the type of immune response (Figure 21B).

[0364] The long-term titer quantification experiment (Figure 31) was performed in mice that were boost immunized (with the same formulation) 21 days after the first injection, with 5 μg of mRNA encoding ovalbumin (OVA, manufactured by TriLink, capped, polyadenylated, unmodified, Trilink, CleanCap® OVA mRNA-(L-7610)) formulated with an amphiphilic substance (125 μM) by i.m. administration and i.v. administration. Serum was withdrawn monthly (the first month refers to 35 days after the first administration, and the interval between each serum collection was 30 days). Both administration routes yielded similar IgG levels, and in both cases, the maximum titer appeared at the 3-month readout.

[0365] The type of immune response induced after immunization can be classified as a Th1 response, Th2 response, or mixed response, which differ in the CD4+ T cell subsets involved, the cytokines secreted, and the antibody classes induced. Th1 responses are typically associated with delayed-type hypersensitivity reactions and cellular immunity, while Th2 is associated with the induction of humoral responses and antibody production.

[0366] A high titer of IgG2c relative to IgG1 indicates a Th1-biased immune response, which is generally favorable for cancer treatment and most viral infections.

[0367] Example 14: In Vivo Gene Editing (Cre mRNA) in Ai14 Mice (Cre Reporter Model) In vivo gene editing enables the localization and quantification of expression after delivery of Cre recombinase mRNA in Ai14 mice, a reporter strain that expresses tdTomato fluorescence after Cre-mediated recombination.

[0368] The inventors evaluated the mRNA delivery efficiency of amphiphilic substances by i.v. injection of amphiphilic complex Cre recombinase mRNA (CleanCap® Cre mRNA (5moU), TriLink, L-7211) in Ai14 mice. The stock solution of the amphiphilic molecule was prepared with DMSO as described above. The mRNA / amphiphilic complex solution was freshly prepared before the in vivo experiment. The solution of the amphiphilic substance in DMSO was mixed with the mRNA solution in an appropriate buffer such as PBS or phosphate buffer concentrated with inorganic salts (mass ratios of 1:1 and 5:1, final amount of mRNA per mouse = 7 μg / mouse). The mixture was shaken at room temperature for 30 minutes and then injected. For each mouse, 7 μg of mRNA was complexed with 7.3(Leu-His) (7.3(Leu-His)M) having myristoyl aldehyde and administered by intravenous injection into 100 μL of an appropriate buffer such as PBS or phosphate buffer concentrated with inorganic salts. As a control, 7 μg of naked mRNA was injected into three mice. Two days later, the mice were sacrificed and imaged to confirm tdTomato expression. Under all conditions, tdTomato protein expression was preferably observed in the spleen and lung and was stronger when using an amphiphilic substance:mRNA mass ratio of 5:1 (Figure 32, bright gray bars).

[0369] The present invention provides the following. 1. A peptide or a salt thereof, preferably a cationic peptide, wherein · the peptide or its salt has a length of 7 to 21 amino acids, · the peptide or its salt contains a basic amino acid residue selected from the group consisting of arginine (R), histidine (H), and a reactive basic amino acid residue containing a reactive group in its side chain, · the peptide or its salt optionally contains one or more hydrophobic amino acids selected from the group consisting of alanine (A), valine (V), leucine (L), and isoleucine (I), and when present, the hydrophobic amino acids account for less than 50% of the total number of amino acids of the peptide, · the number of arginines in the peptide or its salt is 2 to 10, · The number of histidines in the peptide or its salt is 0 to 3, · The number of reactive basic amino acid residues containing a reactive group in the side chain of the peptide or its salt is 3, · The number of hydrophobic amino acids in the peptide or its salt is 0 to 8, · In the amino acid sequence of the peptide, there are 2 or fewer consecutive amino acids of the same residue, provided that this does not apply to reactive basic amino acid residues and the amino acid arginine that contain a reactive group in their side chains. In this case, up to 3 consecutive arginines and / or up to 3 consecutive reactive basic amino acid residues that contain a reactive group in their side chains may be present, · The amino acids contained in the peptide or its salt are L-amino acids and / or D-amino acids, preferably all amino acids contained in the peptide or its salt are L-amino acids, or all amino acids contained in the peptide or its salt are D-amino acids, A peptide or its salt.

[0370] 2. The three reactive basic amino acid residues containing a reactive group in their side chains are reactive lysine (K*), reactive ornithine (O*), reactive 2,4-diaminobutyric acid (Dab*), or a mixture thereof, and / or the amino acid at the N-terminus of the peptide is R. The peptide or its salt according to item 1.

[0371] 3. The reactive lysine (K*) is natural lysine or modified lysine, and the modified lysine has a reactive group bonded to the ε-amino group of the reactive lysine by an amide bond, and the reactive group and the amide bond are bonded by a spacer. Preferably, the spacer has 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, preferably 2 to 6 carbon atoms, more preferably 4 carbon atoms. The peptide or its salt according to item 2.

[0372] 4. The reactive ornithine (O*) is natural ornithine or modified ornithine, and the modified ornithine has a reactive group bonded to the δ-amino group of ornithine by an amide bond, and the reactive group and the amide bond are bonded by a spacer. Preferably, the spacer has 1 to 10 carbon atoms, such as 2 to 10 carbon atoms, preferably 2 to 6 carbon atoms, more preferably 4 carbon atoms. The peptide or a salt thereof according to item 2.

[0373] 5. The reactive group is selected from the group consisting of a hydrazide group, an amino group, a carboxylic acid, and an aminooxy-carboxylic acid group, and is preferably a hydrazide group. The peptide or a salt thereof according to any one of items 3 or 4.

[0374] 6. The modified lysine or modified ornithine or modified Dab is obtained by reacting the peptide with a hydrazide carboxylic acid or an aminooxy carboxylic acid, preferably glutaric acid monohydrazide or succinic acid monohydrazide or aminooxyacetic acid, whereby the modified lysine or modified ornithine or modified Dab is obtained, and the reactive group is a hydrazide group or an aminooxy group, preferably a hydrazide group. The peptide or a salt thereof according to any one of items 3 to 5.

[0375] 7. The peptide has a length of 7 amino acids and consists of basic amino acids selected from arginine, histidine, and reactive basic amino acid residues containing a reactive group. The number of arginines in the peptide is at least 2, the number of histidines in the peptide is 2 or less, and the number of reactive basic amino acid residues containing a reactive group in the side chain of the peptide is 3. The peptide or a salt thereof according to any one of items 1 to 6.

[0376] 8. The peptide or a salt thereof according to item 7, wherein the peptide sequence is selected from the group consisting of Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1), Ac-RHK*K*K*HR-NH2 (SEQ ID NO: 2), Ac-RK*HHK*K*R-NH2 (SEQ ID NO: 3), Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53), Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58), and Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59).

[0377] 9. The peptide or a salt thereof according to any one of items 1 to 6, wherein the peptide has a length of at least 9 amino acids, the peptide contains the core sequence RX1X2R (SEQ ID NO: 9) or RX1X2RRX3X4 (SEQ ID NO: 4), and any one of X1 to X4 is an amino acid selected from the group consisting of H, K*, O*, and hydrophobic amino acids, and the hydrophobic amino acids are selected from the group consisting of A, V, L, and I.

[0378] 10. The peptide or a salt thereof according to item 9, wherein the peptide is a peptide of SEQ ID NO: 5 (RX1X2RRX3X4RX5), SEQ ID NO: 6 (RRX1X2RX3X4RRX5X6RX7), SEQ ID NO: 7 (RRX1X2RX3X4RRX5X6RX7X8RRX9), SEQ ID NO: 8 (RRX1X2RX3X4RRX5X6RX7X8RRX9RRLL), or SEQ ID NO: 10 (RX1X2X3RX4X5RRX6X7RX8), and any one of X1 to X9 is an amino acid selected from the group consisting of H, K*, O*, and hydrophobic amino acids, and the hydrophobic amino acids are selected from the group consisting of A, V, L, and I.

[0379] 11. The peptide or a salt thereof according to claim 10, wherein the peptide sequence is selected from the group consisting of Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13), Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14), Ac-RRLK*RK*LRRLK*RL-NH2 (SEQ ID NO: 15), Ac-RRK*K*RK*LRRLLRL-NH2 (SEQ ID NO: 16), Ac-RRHK*RLK*RRLK*RL-NH2 (SEQ ID NO: 17), Ac-RHLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 18), Ac-RHLK*RHK*RRLK*RH-NH2 (SEQ ID NO: 19), Ac-RRLK*RLLRRLK*RLK*RRL-NH2 (SEQ ID NO: 21), Ac-RRLK*RLLRRLK*RLK*RRLRRLL-NH2 (SEQ ID NO: 23).

[0380] 12. The peptide or a salt thereof according to any one of claims 1 to 6, wherein the peptide sequence is selected from the group consisting of Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11), Ac-RK*RRK*K*R-NH2 (SEQ ID NO: 12), Ac-RK*HK*HK*R-NH2 (SEQ ID NO: 49), Ac-RK*LRRK*LRK*-NH2 (SEQ ID NO: 13), Ac-RRK*HRK*K*H-NH2 (SEQ ID NO: 54), Ac-RRK*LRK*K* (SEQ ID NO: 55), Ac-RRK*LRK*K*L-NH2 (SEQ ID NO: 56), Ac-RRRK*LRK*K*L-NH2 (SEQ ID NO: 57), Ac-RK*IRK*K*H-NH2 (SEQ ID NO: 65), Ac-RK*VRK*H-NH2 (SEQ ID NO: 66), Ac-RK*HRK*K*H-OH (SEQ ID NO: 68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO: 69), Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO: 70), Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO: 71), and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQ ID NO: 72).

[0381] 13. The peptide or a salt thereof according to any one of claims 1 to 12, wherein the peptide is N-acylated and / or C-amidated.

[0382] 14. a) A peptide or a salt thereof as defined in any one of Items 1 to 13, and b) three hydrophobic tails, and comprising or alternatively consisting of these, each hydrophobic tail being linked to the peptide by a bond formed by the reaction between (i) a reactive group of the side chain of a reactive basic amino acid residue and (ii) a precursor of the hydrophobic tail, the precursor of the hydrophobic tail comprising the hydrophobic tail and a second reactive group capable of reacting with the reactive group of the side chain of the reactive basic amino acid residue of the peptide, an amphiphilic molecule.

[0383] 15. The amphiphilic molecule according to Item 14, wherein the amphiphilic molecule is obtained by reacting a peptide or a salt thereof with a precursor of the hydrophobic tail, and the precursor comprises a second reactive group that reacts with the reactive group of the reactive basic amino acid residue to form a covalent bond.

[0384] 16. The amphiphilic molecule according to Item 14 or 15, wherein the bond formed by the reaction between the reactive group of the side chain of the reactive basic amino acid residue and the second reactive group of the precursor of the hydrophobic tail is an amide bond, an ester bond, a hydrazone bond or an oxime bond, preferably a hydrazone bond.

[0385] 17. The amphiphilic molecule according to Item 16, wherein the second reactive group of the precursor of the hydrophobic tail is an aldehyde, a carboxylic acid or an alcohol, preferably an aldehyde, and the aldehyde is selected from the group consisting of hexanal, octanal, decanal, dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde, petroselinyl aldehyde, oleyl aldehyde, linoleoyl aldehyde, eicosynoyl aldehyde and tetracosenoyl aldehyde, preferably selected from myristoleyl aldehyde, palmitoleyl aldehyde and petroselinyl aldehyde.

[0386] 18. A reactive basic amino acid residue containing a primary amine in its side chain is a reactive lysine (K*), or a reactive ornithine (O*), or a reactive 2,4-diaminobutyric acid (Dab*), and the covalent bond is formed between the second reactive group of the hydrophobic tail precursor and a natural lysine, or a natural ornithine, or a natural Dab (i.e., the primary amine in the side chain of natural lysine, or natural ornithine, or natural Dab), or between the second reactive group of the hydrophobic tail precursor and the (first) reactive group of a modified lysine, or a modified ornithine, or a modified Dab. The amphiphilic molecule according to any one of claims 14 to 17.

[0387] 19. The second reactive group of the hydrophobic tail precursor is an aldehyde, and the aldehyde is selected from the group consisting of myristoleyl aldehyde, palmitoleyl aldehyde, and petroselinyl aldehyde. The amphiphilic molecule according to claim 17 or 18.

[0388] 20. The -peptide is Ac-RK*HRK*K*H-NH2 (SEQ ID NO: 1), or Ac-RK*LRK*K*L-NH2 (SEQ ID NO: 11), or a salt thereof, and the spacer connecting each reactive group in the side chain of the peptide to each ε-amino group of the lysine residue is formed by reacting the peptide with at least 3 molecules of glutaric acid monohydrazide per molecule of the peptide to obtain a (poly)hydrazide-activated peptide, and then contacting the (poly)hydrazide-activated peptide with myristoleyl aldehyde or palmitoleyl aldehyde, which is a hydrophobic tail precursor, or - The peptide is Ac-RRLK*RLK*RRLK*RL-NH2 (SEQ ID NO: 14), or a salt thereof, and the spacer connecting each reactive group in the side chain of the peptide to each ε-amino group of the lysine residue is formed by reacting the peptide with at least 3 molecules of glutaric acid monohydrazide per molecule of the peptide to obtain a (poly)hydrazide-activated peptide, and then contacting the (poly)hydrazide-activated peptide with myristoleyl aldehyde, palmitoleyl aldehyde, or petroselinyl aldehyde, which is a hydrophobic tail precursor, or - The peptide is selected from the group consisting of Ac-RO*HRO*O*H-NH2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH2 (SEQ ID NO: 53), Ac-RRK*HRK*K*H-NH2 (SEQ ID NO: 54), Ac-RRK*LRK*K*-NH2 (SEQ ID NO: 55), Ac-RRK*LRK*K*L-NH2 (SEQ ID NO: 56), Ac-RRRK*LRK*K*L-NH2 (SEQ ID NO: 57), Ac-RO*HRK*K*H-NH2 (SEQ ID NO: 58), and Ac-RK*HRK*O*H-NH2 (SEQ ID NO: 59), or a salt thereof, and a spacer that connects each reactive group in the side chain of the peptide to each ε-amino group of a lysine residue or each δ-amino group of an ornithine residue is formed by reacting the peptide with at least 3 molecules of glutaric acid monohydrazide per molecule of the peptide to obtain a (poly)hydrazide-activated peptide, and then contacting the (poly)hydrazide-activated peptide with myristoyl aldehyde, which is a hydrophobic tail precursor, or - The peptide is selected from the group consisting of Ac-RK*IRK*K*H-NH2 (SEQ ID NO: 65), Ac-RK*VRK*K*H-NH2 (SEQ ID NO: 66), Ac-RK*HRK*K*H-OH (SEQ ID NO: 68), NH2-RK*HRK*K*H-NH2 (SEQ ID NO: 69), and Ac-RDab*HRDab*Dab*H-NH2 (SEQ ID NO: 70), or a salt thereof, and a spacer that connects each reactive group in the side chain of the peptide to each ε-amino group of a lysine residue, each δ-amino group of an ornithine residue, or each γ-amino group of a Dab residue is formed by reacting the peptide with at least 3 molecules of glutaric acid monohydrazide per molecule of the peptide to obtain a (poly)hydrazide-activated peptide, and then contacting the (poly)hydrazide-activated peptide with myristoyl aldehyde, which is a hydrophobic tail aldehyde, or - The peptide is selected from the group consisting of Ac-RK*(ONH2)HRK*(ONH2)K*(ONH2)H-NH2 (SEQ ID NO: 71) and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH2 (SEQ ID NO: 72), or a salt thereof, and a spacer connecting each reactive group of the side chain of the peptide and each ε-amino group of the lysine residue reacts the peptide with at least 3 molecules of aminooxyacetic acid or 3 molecules of succinic acid monohydrazide per molecule of the peptide, thereby obtaining a (poly)aminooxy-activated peptide or a (poly)hydrazide-activated peptide, and then the (poly)aminooxy-activated peptide or the (poly)hydrazide-activated peptide is formed by contacting it with myristoyl aldehyde which is a hydrophobic tail precursor. The amphiphilic molecule according to claim 19.

[0389] 21. a) At least one amphiphilic molecule defined in any one of claims 14 to 20, and b) At least one biologically important molecule A complex comprising.

[0390] 22. The complex according to claim 21, wherein the biologically important molecule is selected from the group consisting of proteins, nucleic acids, nucleoproteins, small molecules, and immunogens.

[0391] 23. The complex according to claim 21 or 22, wherein the biologically important molecule has a negative net charge.

[0392] 24. The complex according to claim 22, wherein the nucleic acid is pDNA, siRNA, or mRNA, and the nucleoprotein is a ribonucleoprotein.

[0393] 25. Use of a peptide or a salt thereof defined in any one of claims 1 to 13, an amphiphilic molecule defined in any one of claims 14 to 20, or a complex defined in any one of claims 21 to 24 for in vitro delivery of a biologically important molecule to cells.

[0394] 26. Use according to item 25, wherein the biologically important molecule is selected from the group consisting of proteins, nucleic acids, nucleoproteins and small molecules.

[0395] 27. Use according to item 25 or 26, wherein the nucleic acid is pDNA, siRNA or mRNA, and the nucleoprotein is a ribonucleoprotein.

[0396] 28. A peptide or a salt thereof defined in any one of items 1 to 13, an amphiphilic molecule defined in any one of items 14 to 20, and / or a complex defined in any one of items 21 to 24 for use as a medicament.

[0397] 29. A vaccine comprising a peptide or a salt thereof defined in any one of items 1 to 13, an amphiphilic molecule defined in any one of items 14 to 20 and / or a complex defined in any one of items 21 to 24.

[0398] 30. A method for preparing an amphiphilic molecule defined in any one of items 14 to 20, comprising contacting a solution in which a peptide or a salt thereof defined in any one of items 1 to 13 is dissolved in an organic solvent with a solution of a precursor of a hydrophobic tail containing a second reactive group that reacts with a reactive group of the side chain of the peptide under conditions sufficient for the formation of a covalent bond between the second reactive group of the precursor of the hydrophobic tail and the reactive group of the peptide, wherein the conditions are as follows (i) when the reactive group of the hydrophobic tail precursor is an aldehyde, an acidic medium, or (ii) when the reactive group of the hydrophobic tail precursor is an alcohol or a carboxylic acid, in the presence of a basic medium and a carboxylic acid activating reagent. Method.

[0399] 31. A method for preparing a complex defined in any one of claims 21 to 24, comprising contacting a solution of at least one amphiphilic molecule defined in any one of claims 14 to 20 with a solution of at least one biologically important molecule in a suitable medium under conditions suitable for the formation of a complex between the at least one amphiphilic molecule and the at least one biologically important molecule.

[0400] 32. A method for the in vitro delivery of a biologically important molecule to a cell population, comprising: (i) contacting a first solution in which at least one amphiphilic molecule defined in any one of claims 14 to 20 is dissolved in a suitable solvent with a second solution containing a biologically important molecule in a suitable solvent under conditions sufficient for the formation of a complex between the at least one amphiphilic molecule and the at least one biologically important molecule; (ii) adding the complex obtained in step (i) to the cell population under conditions suitable for the delivery of the biologically important molecule to the cell population.

[0401] 33. The method according to claim 32, wherein the contacting step (i) is carried out in the same medium in which the cells are cultured and the amphiphilic molecule is provided from a stock solution in an organic solvent.

[0402] 34. The method according to any one of claims 31 to 33, wherein the biologically important molecule has a negative net charge at the pH at which the contacting step (i) is carried out.

[0403] 35. A method for obtaining a library of amphiphilic molecules defined in any one of claims 14 to 20, comprising contacting, in an organic solvent, the "n" peptides or salts thereof defined in claims 1 to 13 with at least "3n" hydrophobic tail precursors, said precursors comprising a hydrophobic tail and a second reactive group that reacts with a reactive group of the side chain of a reactive basic amino acid of the peptide or salt thereof, and the contacting being carried out under conditions sufficient for the formation of a covalent bond between the hydrophobic tail precursor and the reactive group in the peptide or salt thereof.

[0404] 36. The method according to item 35, wherein at least two peptides or salts thereof are independently selected from any one of SEQ ID NO: 1 to 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 49, SEQ ID NO: 52 to 59, SEQ ID NO: 65 to 66, and SEQ ID NO: 68 to 72.

[0405] 37. The hydrophobic tails contained in at least "3n" hydrophobic tail precursors are selected from aldehydes, carboxylic acids or alcohols, or mixtures thereof, preferably aldehydes. The aldehydes are selected from the group consisting of hexanal, octanal, decanal, dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde, petroselinyl aldehyde, oleyl aldehyde, linoleoyl aldehyde, eicosenoyl aldehyde, tetracosenoleyl aldehyde, or mixtures thereof. The carboxylic acids are selected from the group consisting of hexanoic acid, octanoic acid, decanoic acid, dodecanoic acid, myristoleic acid, palmitoleic acid, petroselic acid, oleic acid, linoleic acid, eicosenic acid, tetracosenoic acid, or mixtures thereof. The alcohols are selected from the group consisting of hexanol, octanol, decanol, dodecanol, myristoleyl alcohol, palmitoleyl alcohol, petroselinyl alcohol, oleyl alcohol, linoleoyl alcohol, gondoil alcohol, tetracosenoleyl alcohol, or mixtures thereof. Preferably, the hydrophobic tails contained in at least "3n" hydrophobic tail precursors are selected from dodecanal, myristoleyl, palmitoleyl, petroselinyl, oleyl, eicosenoyl, tetracosenoleyl aldehyde, or mixtures thereof. The method according to item 35 or 36.

[0406] 38. The method according to any one of items 35 to 37, wherein the reactive group of the peptide defined in items 1 to 13 is a hydrazide group or an aminooxycarboxylic acid group, and the reactive group of the hydrophobic tail precursor is an aldehyde group.

[0407] 39. A library comprising at least two different amphiphilic molecules, each amphiphilic molecule comprising: (i) a peptide as defined in any one of claims 1 to 13 or a salt thereof, and (ii) three hydrophobic tails, wherein the hydrophobic tails are connected to the peptide by a bond formed by the reaction of a reactive group of the side chain of a reactive basic amino acid residue of the peptide with a precursor of the hydrophobic tail, each precursor of the hydrophobic tail comprising a hydrophobic tail and a second reactive group capable of reacting with the reactive group of the side chain of a reactive basic amino acid residue of the peptide, and wherein one amphiphilic molecule is different from at least another amphiphilic molecule in terms of at least the peptide and / or the hydrophobic tail.

[0408] 40. The library according to claim 39, wherein each amphiphilic molecule is obtained by reacting a peptide or a salt thereof with at least three precursors of hydrophobic tails, said precursors comprising a second reactive group that reacts with the reactive group of a reactive basic amino acid residue to thereby form a covalent bond.

[0409] 41. The library according to claim 39 or 40, wherein the bond formed by the reaction of a reactive group of the side chain of a reactive basic amino acid residue of the peptide or a salt thereof with a precursor of the hydrophobic tail containing a second reactive group capable of reacting with the reactive group of the side chain of a reactive basic amino acid residue of the hydrophobic tail and the peptide or a salt thereof is an amide bond, an ester bond, a hydrazone bond or an oxime bond.

[0410] 42. A method for identifying an amphiphilic molecule suitable for delivering a biologically important molecule to a cell, comprising: (i) contacting a biologically important molecule with a library as defined in any one of claims 39 to 41 under conditions sufficient for the binding of the amphiphilic molecule to the biologically important molecule; (ii) optionally, selecting an amphiphilic molecule capable of binding to a biologically important molecule from amphiphilic molecules that do not bind to the biologically important molecule, and / or (iii) screening amphiphilic molecules suitable for delivering biologically important molecules into cells A method comprising.

[0411] 43. The method according to item 42, wherein the biologically important molecule is selected from the group consisting of proteins, nucleic acids, nucleoproteins and small molecules.

[0412] 44. Formula (III) or formula (IV):

Chemical formula

Chemical formula

[0413] 45. The amino acid according to item 44, selected from lysine (Lys, K), ornithine (Orn, O) or 2,4-diaminobutyric acid (Dab).

[0414] 46. The amino acid according to any one of items 44 to 45, wherein m is a natural number selected from 1 to 10, preferably 1 to 5, and even more preferably 1 to 3.

[0415] 47. The amino acid according to any one of items 44 to 46, comprising glutaric acid monohydrazide, succinic acid monohydrazide or aminooxyacetic acid bonded to the side chain of the amino acid.

[0416] 48. The amino acid according to any one of items 44 to 47, wherein X is selected from 9-fluorenylmethoxycarbonyl (Fmoc) and tert-butyloxycarbonyl (Boc), preferably selected from Fmoc.

[0417] 49. The amino acid according to any one of items 44 to 48, wherein Y is selected from 2-chlorobenzyloxycarbonyl (Cl-Z), tert-butyloxycarbonyl (Boc) and 4-methyltrityl (Mtt), preferably selected from Boc.

[0418] 50. The amino acid according to any one of items 44 to 49, having the following formula (V) [Chemical formula] ​

Claims

1. a) A peptide or a salt thereof, wherein the peptide or the salt thereof has a length of 7 to 21 amino acids, wherein the peptide or the salt thereof contains a basic amino acid residue selected from the group consisting of arginine (R), histidine (H) and a reactive basic amino acid residue containing a reactive group in its side chain, wherein the peptide or the salt thereof optionally contains one or more hydrophobic amino acid residues selected from the group consisting of alanine (A), valine (V), leucine (L) and isoleucine (I), and when present, the hydrophobic amino acid residue corresponds to less than 50% of the total number of amino acids of the peptide, wherein the number of arginines in the peptide or the salt thereof is 2 to 10, wherein the number of histidines in the peptide or the salt thereof is 0 to 3, wherein the number of reactive basic amino acid residues containing a reactive group in the side chain of the peptide or the salt thereof is 3, wherein the number of hydrophobic amino acids in the peptide or the salt thereof is 0 to 8, wherein there are no more than two consecutive amino acids of the same residue in the amino acid sequence of the peptide, provided that this does not apply to the reactive basic amino acid residue and the amino acid arginine containing a reactive group in its side chain, in which case there may be up to three consecutive arginines and / or up to three consecutive reactive basic amino acid residues containing a reactive group in their side chains, wherein the amino acids contained in the peptide or the salt thereof are L-amino acids and / or D-amino acids, preferably all amino acids contained in the peptide are L-amino acids or all amino acids contained in the peptide are D-amino acids, wherein the reactive basic amino acid residue containing a reactive group in its side chain is of formula (I): 【Chemical 1】 as defined, wherein in the formula, B may or may not be present. When B is not present, A is a reactive group, preferably a primary amine. When B is present, A is selected from an amide bond, a secondary amine or any other functional group, and B is a spacer linked to the reactive group, n is 1, 2, 3, 4, 5, 6, 7, 8 or more, preferably 1, 2, 3 or 4, a peptide or a salt thereof, and b) three hydrophobic tails, Each hydrophobic tail is connected to the peptide or a salt thereof by a bond formed by the reaction of (i) the reactive group of the side chain of the reactive basic amino acid residue of the peptide and (ii) a precursor of the hydrophobic tail, and the precursor of the hydrophobic tail includes the hydrophobic tail and a second reactive group capable of reacting with the reactive group of the side chain of the reactive basic amino acid residue of the peptide, and three hydrophobic tails comprising an amphiphilic molecule. **Claim 2** The three reactive basic amino acid residues containing a reactive group in their side chains included in the peptide or a salt thereof are reactive lysine (K*), reactive ornithine (O*), reactive 2,4-diaminobutyric acid (Dab*) or a mixture thereof. The amphiphilic molecule according to claim 1. **Claim 3** (i) The reactive lysine (K*) contained in the peptide or a salt thereof is natural lysine or modified lysine, and in the modified lysine, the reactive group is bonded to the ε-amino group of the reactive lysine by an amide bond, and the reactive group and the amide bond are bonded by a spacer, characterized in that, (ii) The reactive ornithine (O*) contained in the peptide or a salt thereof is natural ornithine or modified ornithine, and in the modified ornithine, the reactive group is bonded to the δ-amino group of the ornithine by an amide bond, and the reactive group and the amide bond are bonded by a spacer, characterized in that, (iii) The reactive 2,4-diaminobutyric acid (Dab*) contained in the peptide or a salt thereof is natural Dab or modified Dab, and in the modified Dab, the reactive group is bonded to the γ-amino group of the Dab by an amide bond, and the reactive group and the amide bond are bonded by a spacer, characterized in that, The amphiphilic molecule according to claim 2. **Claim 4** The reactive group of the side chain of the reactive basic amino acid residue contained in the peptide or a salt thereof is a hydrazide or an aminooxy-carboxylic acid group. The amphiphilic molecule according to any one of claims 1 to 3. **Claim 5** The peptide or a salt thereof has a length of 7 amino acids, the peptide or a salt thereof consists of basic amino acids selected from arginine, histidine, and a reactive basic amino acid residue containing a reactive group, the number of arginines in the peptide or a salt thereof is at least 2, and the number of histidines in the peptide or a salt thereof is 2 or less. The amphiphilic molecule according to any one of claims 1 to 4.

6. The peptide sequence is Ac-RK*HRK*K*H-NH 2 (SEQ ID NO: 1), Ac-RHK*K*K*HR-NH 2 (SEQ ID NO: 2), Ac-RK*HHK*K*R-NH 2 (SEQ ID NO: 3), Ac-RO*HRO*O*H-NH 2 (SEQ ID NO: 52), Ac-RRK*HRK*K*-NH 2 (SEQ ID NO: 53), Ac-RO*HRK*K*H-NH 2 (SEQ ID NO: 58), Ac-RK*HRK*O*H-NH 2 (SEQ ID NO: 59), Ac-RK*IRK*K*H-NH 2 (SEQ ID NO: 65), Ac-RK*VRK*H-NH 2 (SEQ ID NO: 66), Ac-RK*HRK*K*H-OH (SEQ ID NO: 68), NH 2 -RK*HRK*K*H-NH 2 (SEQ ID NO: 69), Ac-RDab*HRDab*Dab*H-NH 2 (SEQ ID NO: 70), Ac-RK*(ONH 2 )HRK*(ONH 2 )K*(ONH 2 )H-NH 2 (SEQ ID NO: 71) and Ac-RK*(C4Hyd)HRK*(C4Hyd)K*(C4Hyd)H-NH 2 The amphiphilic molecule according to claim 5, selected from the group consisting of (SEQ ID NO: 72) or salts thereof.

7. The peptide or a salt thereof contained therein has at least 9 amino acids in length, and the peptide or a salt thereof has a core sequence RX 1 X 2 R (SEQ ID NO: 9) or RX 1 X 2 RRX 3 X 4 (SEQ ID NO: 4), and any one of X 1 ~X 4 is an amino acid selected from the group consisting of H, K*, O*, and hydrophobic amino acids, and the hydrophobic amino acid is selected from the group consisting of A, V, L, and I. The amphiphilic molecule according to any one of claims 1 to 4.

8. The peptide or a salt thereof contained therein has the sequence RX 1 X 2 RRX 3 X 4 RX 5 (SEQ ID NO: 5), RRX 1 X 2 RX 3 X 4 RRX 5 X 6 RX 7 (SEQ ID NO: 6), RRX 1 X 2 RX 3 X 4 RRX 5 X 6 RX 7 X 8 RRX 9 (SEQ ID NO: 7), RRX 1 X 2 RX 3 X 4 RRX 5 X 6 RX 7 X 8 RRX 9 RRLL (SEQ ID NO: 8) or RX 1 X 2 X 3 RX 4 X 5 RRX 6 X 7 RX 8 (SEQ ID NO: 10), and any one of X 1 ~X 9 is an amino acid selected from the group consisting of H, K*, O*, and hydrophobic amino acids, and the hydrophobic amino acid is selected from the group consisting of A, V, L, and I. The amphiphilic molecule according to claim 7.

9. The peptide sequence is Ac-RK*LRRK*LRK*-NH 2 (SEQ ID NO: 13), Ac-RRLK*RLK*RRLK*RL-NH 2 (SEQ ID NO: 14), Ac-RRLK*RK*LRRLK*RL-NH 2 (SEQ ID NO: 15), Ac-RRRK*K*RK*LRRLLRL-NH 2 (SEQ ID NO: 16), Ac-RRHK*RLK*RRLK*RL-NH 2 (SEQ ID NO: 17), Ac-RHLK*RLK*RRLK*RL-NH 2 (SEQ ID NO: 18), Ac-RHLK*RHK*RRLK*RH-NH 2 (SEQ ID NO: 19), Ac-RRLK*RLLRRRLK*RLK*RRL-NH 2 (SEQ ID NO: 21), and Ac-RRLK*RLLRRRLK*RLK*RRRLRRLL-NH 2 The amphiphilic molecule according to claim 8, which is selected from the group consisting of (SEQ ID NO: 23), or salts thereof.

10. The peptide sequence is Ac-RK*LRK*K*L-NH 2 (SEQ ID NO: 11), Ac-RK*RRK*K*R-NH 2 (SEQ ID NO: 12), Ac-RK*HK*HK*R-NH 2 (SEQ ID NO: 49), Ac-RK*LRRK*LRK*-NH 2 (SEQ ID NO: 13), Ac-RRK*HRK*K*H-NH 2 (SEQ ID NO: 54), Ac-RRK*LRK*K*-NH 2 (SEQ ID NO: 55), Ac-RRK*LRK*K*L-NH 2 (SEQ ID NO: 56) and Ac-RRRK*LRK*K*L-NH 2 The amphiphilic molecule according to any one of claims 1 to 4, selected from the group consisting of (SEQ ID NO: 57) or a salt thereof.

11. The amphiphilic molecule according to any one of claims 1 to 10, wherein the peptide contained therein is N-acylated and / or C-amidated.

12. The amphiphilic molecule according to any one of claims 1 to 11, wherein the bond formed by the reaction between the reactive group of the side chain of the reactive basic amino acid residue and the second reactive group of the precursor of the hydrophobic tail is a hydrazone bond.

13. The second reactive group of the hydrophobic tail precursor is an aldehyde, and the aldehyde is selected from hexanal, octanal, decanal, dodecanal, myristoleyl aldehyde, palmitoleyl aldehyde, petroselinyl aldehyde, oleyl aldehyde, linoleoyl aldehyde, eicosenoyl aldehyde, and tetracosenoyl aldehyde, preferably selected from myristoleyl aldehyde, palmitoleyl aldehyde, and petroselinyl aldehyde. The amphiphilic molecule according to any one of claims 1 to 12.

14. - the peptide is Ac-RK*HRK*K*H-NH 2 (SEQ ID NO: 1) or Ac-RK*LRK*K*L-NH 2 (SEQ ID NO: 11) or a salt thereof, and the spacer that connects each of the reactive groups of the side chain of the peptide and each of the ε-amino groups of the lysine residues is formed by reacting the peptide with glutaric acid monohydrazide to thereby obtain a hydrazide-activated peptide, and then reacting with palmitoleyl aldehyde or myristoleyl aldehyde, which is a hydrophobic tail precursor, or - The peptide is Ac-RRLK*RLK*RRLK*RL-NH 2 (SEQ ID NO: 14) or a salt thereof, and the spacer that connects each of the reactive groups of the side chain of the peptide and each of the ε-amino groups of the lysine residues is formed by reacting the peptide with glutamic acid monohydrazide to thereby obtain a hydrazide-activated peptide, and then reacting it with palmitoleyl aldehyde or petroselinyl aldehyde, which is a hydrophobic tail precursor, or - wherein the peptide is Ac - RO*HRO*O*H - NH 2 (SEQ ID NO: 52), Ac - RRK*HRK*K* - NH 2 (SEQ ID NO: 53), Ac - RRK*HRK*K*H - NH 2 (SEQ ID NO: 54), Ac - RRK*LRK*K* - NH 2 (SEQ ID NO: 55), Ac - RRK*LRK*K*L - NH 2 (SEQ ID NO: 56), Ac - RRRK*LRK*K*L - NH 2 (SEQ ID NO: 57), Ac - RO*HRK*K*H - NH 2 (SEQ ID NO: 58) and Ac - RK*HRK*O*H - NH 2 (SEQ ID NO: 59) or a salt thereof, and the spacer connecting each of the reactive groups in the side chain of the peptide and each of the ε - amino groups of the lysine residues or each of the δ - amino groups of the ornithine residues is formed by reacting the peptide with glutaric acid monohydrazide to obtain a hydrazide - activated peptide, and then reacting it with myristoyl aldehyde, which is a hydrophobic tail precursor. The amphiphilic molecule according to any one of claims 1 to 13.

15. (i) at least one amphiphilic molecule defined in any one of claims 1 to 14, (ii) at least one biologically important molecule and Preferably, the biologically important molecule is selected from proteins, nucleic acids, nucleoproteins, immunogens, and small molecules. Preferably, the nucleic acid is pDNA, siRNA, or mRNA, and the nucleoprotein is a ribonucleoprotein. A complex.

16. A peptide or a salt thereof suitable for forming the amphiphilic molecule defined in any one of claims 1 to 14, - The peptide or a salt thereof has a length of 7 to 21 amino acids, - The peptide or a salt thereof contains a basic amino acid residue selected from the group consisting of arginine (R), histidine (H), and a reactive basic amino acid residue containing a reactive group in its side chain, - The peptide or a salt thereof optionally contains one or more hydrophobic amino acids selected from the group consisting of alanine (A), valine (V), leucine (L), and isoleucine (I), and when present, the hydrophobic amino acids account for less than 50% of the total number of amino acids of the peptide, - The number of arginines in the peptide or a salt thereof is 2 to 10, - The number of histidines in the peptide or a salt thereof is 0 to 3, - The number of reactive basic amino acid residues containing a reactive group in the side chain of the peptide or a salt thereof is 3, - The number of hydrophobic amino acids in the peptide or a salt thereof is 0 to 8, - In the amino acid sequence of the peptide, there are two or fewer consecutive amino acids of the same residue, except in the case of the reactive basic amino acid residue and amino acid arginine containing a reactive group in its side chain, in which case, there may be up to three consecutive arginines and / or up to three consecutive reactive basic amino acid residues containing a reactive group in their side chains, - The amino acids contained in the peptide or a salt thereof are L - amino acids and / or D - amino acids, preferably all amino acids contained in the peptide are L - amino acids, or all amino acids contained in the peptide are D - amino acids, - The reactive basic amino acid residue containing a reactive group in its side chain is of formula (I): 【Chemical 2】 as defined, In the formula, B may or may not be present. When B is absent, A is a reactive group, preferably a primary amine. When B is present, A is selected from an amide bond, a secondary amine, or any other functional group, and B is a spacer linked to the reactive group, n is 1, 2, 3, 4, 5, 6, 7, or 8, preferably 1, 2, 3, or 4, Peptide or a salt thereof.

17. An amphiphilic molecule according to any one of claims 1 to 14, a complex according to claim 15, and / or a peptide according to claim 16 for use as a medicament.

18. A vaccine comprising an amphiphilic molecule according to any one of claims 1 to 14, a complex according to claim 15, and / or a peptide according to claim 16.

19. Formula (III): 【Chemical Formula 3】 Formula (III), X - Aa(Hyd - Y) - OH An amino acid having, wherein, -X is an N-terminal protecting group, -Y is a hydrazide-reactive group protecting group, -n is the length of the side chain of the amino acid, n is selected from 2 to 4, -m is the length of the linker containing the reactive group, m is selected from 1 to 10, preferably 1 to 5, more preferably 1 to 3, amino acid.