Improved Enzymatic Modification of Phospholipids in Food
An isolated polypeptide with phospholipase A1 activity, combined with additional enzymes, addresses the issue of contradictory lipase activities and proteolysis in dough production, enhancing dough stability and baked product quality.
Patent Information
- Application Number
- JP2025501315
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-07-15
- Filing Date
- 2023-07-14
- Publication Date
- 2025-07-17
AI Technical Summary
Conventional lipases used in dough and baked products exhibit multiple activities that are contradictory, leading to a need for lipases with more specific activities for improved baking results, and there is a challenge in minimizing proteolysis of heterologous proteins during production in host cells.
The use of an isolated polypeptide with phospholipase A1 activity, having specific sequence identities, is mixed with dough components, and optionally combined with additional enzymes to improve dough and baked product properties, while a recombinant expression vector and host cells are employed to reduce proteolysis.
The solution results in improved dough extensibility and stability, enhanced baked product properties such as increased volume, uniform bubble formation, and reduced separation between skin and crumb, with increased crispness and oven spring.
Smart Images

Figure 2025523004000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to phospholipases and their use in the manufacture of foods. The present invention further relates to methods for producing doughs and baked products using phospholipases.
[0002] Cross - reference to related applications This application claims the benefit of U.S. Provisional Application No. 63 / 368,530, filed Jul. 15, 2022, which is hereby incorporated by reference in its entirety.
[0003] Reference to Sequence Listing The content of the electronic submission of the text file of the sequence listing named "NB42091WOPCT_SequenceListing.xml", created on Jul. 15, 2022, and having a size of 151 KB, is hereby incorporated by reference in its entirety.
Background Art
[0004] The use of lipases in bread dough is well - known. For example, European Patent No. 0585988 shows that adding lipase to the dough gives an anti - staling effect. International Publication No. 94 / 04035 pamphlet teaches that improved softness can be obtained by adding lipase to the dough. It has also been shown that exogenous lipase can modify the volume of bread.
[0005] Lipases including phospholipases have been described for their positive properties in the preparation of doughs and baked products, but conventional lipases can have multiple activities that are contradictory to each other. Thus, even today, there is still a need for improved lipases with more specific activities for some food applications, particularly in baking.
[0006] Microorganisms such as filamentous fungi are widely used as hosts for the production of heterologous proteins including lipase. However, microorganisms always express endogenous proteases. In the case of heterologous proteins that are susceptible to enzymatic proteolysis, the endogenous proteases can degrade the heterologous proteins. Depending on the susceptibility of the heterologous protein to proteolysis, there are studies to minimize the degradation of the heterologous protein.
[0007] Heterologous proteins can be purified from endogenous proteases, for example, by chromatography. However, proteolysis is too fast and there is a possibility of degrading a significant amount of heterologous protein before chromatography can be carried out.
[0008] The host can also be genetically engineered to eliminate one or more proteases to reduce or eliminate the proteolysis of heterologous proteins. However, typical hosts such as Trichoderma have many endogenous proteases, and knowledge of which protease is responsible for the degradation of a specific heterologous protein is required to reduce proteolysis. Furthermore, there are limitations to the methods that can maintain healthy host cells even after deleting many genes.
Summary of the Invention
Problems to be Solved by the Invention
[0009] Technologies to overcome the problem of proteolysis in host cells are still needed. Ideally, these improved technologies will result in higher yields of proteins.
[0010] The subject matter disclosed herein addresses these needs and provides additional advantages.
Means for Solving the Problems
[0011] According to one aspect of the present invention, there is provided an isolated polypeptide having phospholipase A1 activity and having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0012] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0013] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0014] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0015] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0016] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0017] Optionally, the isolated polypeptide has a protein sequence with 100% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0018] Optionally, the isolated polypeptide is a protein sequence with 100% sequence identity to SEQ ID NO: 27.
[0019] In another aspect of the present invention, there is provided a method for producing dough, which includes mixing a dough component selected from the group consisting of wheat flour, salt, water, sugar, fat, lecithin, oil emulsifier and yeast with an isolated polypeptide having phospholipase A1 activity and having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0020] Optionally, the isolated polypeptide is a protein sequence with at least 80% sequence identity to SEQ ID NO: 27.
[0021] Optionally, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0022] Optionally, the isolated polypeptide is a protein sequence with at least 90% sequence identity to SEQ ID NO: 27.
[0023] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0024] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0025] Optionally, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0026] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0027] Optionally, the method for producing a fabric has a further step of adding at least one additional enzyme useful for improving the fabric and / or the baked product made therefrom.
[0028] Optionally, the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from the phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
[0029] In some cases, the amylase is an exoamylase.
[0030] In some cases, the exoamylase is a maltose-forming amylase.
[0031] In some cases, the exoamylase is a non-maltose-forming amylase. In some cases, the non-maltose-forming amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 to 8 D-glucopyranosyl units from the non-reducing ends of the side chains of amylopectin.
[0032] In some cases, the additional enzyme is a phospholipase. In some cases, the phospholipase has galactolipase activity.
[0033] In some cases, the phospholipase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.
[0034] In some cases, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.
[0035] In some cases, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 118. The glucose oxidase may be a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 117.
[0036] In some cases, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 116.
[0037] In another aspect of the present invention, there is provided a fabric having an isolated polypeptide with phospholipase A1 activity having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0038] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0039] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0040] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0041] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0042] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0043] Optionally, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0044] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0045] Optionally, the fabric has improved fabric extensibility and / or stability.
[0046] In another aspect of the present invention, the fabric has at least one additional enzyme useful for improving the fabric and / or the baked product made therefrom.
[0047] Optionally, the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from said phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
[0048] Optionally, the amylase is an exoamylase.
[0049] Optionally, the exoamylase is a maltose-producing amylase.
[0050] Optionally, the exoamylase is a non - maltose - producing amylase. Optionally, the non - maltose - producing amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 - 8 D - glucopyranosyl units from the non - reducing ends of the side chains of amylopectin.
[0051] Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity. Optionally, the phospholipase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.
[0052] Optionally, the amylase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.
[0053] Optionally, the xylanase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 118.
[0054] Glucose oxidase may be a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 117.
[0055] Optionally, the hexose oxidase is a protein having at least 80%, 90%, 95%, 99% or 100% sequence identity with SEQ ID NO: 116.
[0056] In another aspect of the present invention, a method for preparing a baked product comprising baking the dough as described above is presented.
[0057] In another aspect of the present invention, there is provided a fired product obtained by the above method. Preferably, it has at least one improved property selected from the group consisting of improvement of the ram pore diameter, improvement of the uniformity of the bubbles, absence of separation between the skin and the crumb, increase in bulk, increase in the crispness of the skin, and improvement of the oven spring.
[0058] Optionally, the improved property is the crispness of the skin.
[0059] In another aspect of the present invention, there is provided a baking premix having flour and an isolated polypeptide having phospholipase A1 activity and having a protein sequence having at least 80% sequence identity with the protein sequence of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0060] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0061] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0062] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0063] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0064] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0065] Optionally, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0066] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0067] Optionally, the premix has at least one additional enzyme useful for improving the dough and / or the baked product made therefrom.
[0068] Optionally, the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from said phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
[0069] Optionally, the amylase is an exoamylase.
[0070] Optionally, the exoamylase is a maltose-producing amylase.
[0071] Optionally, the exoamylase is a non-maltose-producing amylase. Optionally, the non-maltose-producing amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 to 8 D-glucopyranosyl units from the non-reducing ends of the side chains of amylopectin.
[0072] Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity. Optionally, the phospholipase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.
[0073] Optionally, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.
[0074] Optionally, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 118.
[0075] Glucose oxidase may be a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 117.
[0076] Optionally, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 116.
[0077] In another aspect of the present invention, there is provided a firing improver having particulate matter or agglomerated powder and an isolated polypeptide having phospholipase A1 activity having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0078] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0079] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0080] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0081] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0082] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0083] Optionally, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0084] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0085] Optionally, the baking improver has at least one additional enzyme useful for improving the dough and / or the baked product made therefrom.
[0086] Optionally, the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from the phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
[0087] Optionally, the amylase is an exoamylase.
[0088] Optionally, the exoamylase is a maltose-producing amylase.
[0089] Optionally, the exoamylase is a non-maltose-producing amylase. Optionally, the non-maltose-producing amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 to 8 D-glucopyranosyl units from the non-reducing ends of the side chains of amylopectin.
[0090] Optionally, the additional enzyme is a phospholipase. Optionally, the phospholipase has galactolipase activity. Optionally, the phospholipase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.
[0091] Optionally, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.
[0092] Optionally, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 118.
[0093] Glucose oxidase may be a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 117.
[0094] Optionally, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 116.
[0095] In another aspect of the invention, there is provided an isolated polynucleotide having a nucleic acid sequence encoding an isolated polypeptide having phospholipase A1 activity and having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO:, SEQ ID NO:, SEQ ID NO: 44 or SEQ ID NO: 45.
[0096] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0097] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0098] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0099] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0100] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0101] Optionally, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0102] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0103] In another aspect of the present invention, a recombinant expression vector having a polynucleotide as described above is provided.
[0104] In another aspect of the present invention, a host cell having the above-described recombinant expression vector is presented. In another aspect of the present invention, a method for modifying a phospholipid emulsifier is presented, which comprises a step of treating an emulsifier with an isolated polypeptide having phospholipase A1 activity and having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO:, SEQ ID NO:, SEQ ID NO:, SEQ ID NO:, SEQ ID NO: 43, SEQ ID NO:, SEQ ID NO:, SEQ ID NO: 44 or SEQ ID NO: 45.
[0105] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0106] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0107] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0108] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0109] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0110] Optionally, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0111] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0112] The phospholipid emulsifier may be lecithin or lysolecithin.
[0113] In another aspect of the present invention, there is provided a method for producing lysophospholipids in a lipid-containing food matrix, which comprises the step of adding an isolated polypeptide having phospholipase A1 activity and having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45 to the lipid-containing food matrix.
[0114] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0115] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0116] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0117] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0118] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0119] Optionally, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0120] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0121] Optionally, the lipid-containing food matrix is selected from the group consisting of eggs, egg-containing foods, sweet bakery doughs, processed meats, milk-based products, and vegetable oils.
[0122] In another aspect of the present invention, there is provided a recombinant cell having a) a heterologously expressed barley α - amylase / subtilisin inhibitor (BASI) polypeptide and b) a heterologous protein.
[0123] Optionally, the heterologous protein is an aminopeptidase, α - amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α - galactosidase, beta - galactosidase, glucose oxidase (GOX), alpha - glucosidase, β - glucosidase, glucuronidase, glycosyltransferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenol oxidase, polyphenol oxidase, protein disulfide isomerase, protease, ribonuclease, α - 1,6 - transglucosidase, transglutaminase, urokinase, xylanase, or β - xylosidase.
[0124] Optionally, the heterologous protein is a phospholipase.
[0125] Optionally, the phospholipase is an isolated polypeptide having phospholipase A1 activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0126] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0127] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0128] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0129] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0130] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0131] Optionally, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0132] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0133] Optionally, the recombinant cell is a bacterial, fungal, yeast, plant, or mammalian cell.
[0134] Optionally, the recombinant cell is Trichoderma, Aspergillus, Bacillus, or Myceliophthora.
[0135] Optionally, the recombinant cell is Trichoderma reesei.
[0136] In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus oryzae.
[0137] In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthora thermophila, or Bacillus licheniformis.
[0138] Optionally, the BASI polypeptide is a protein having at least 80%, 90%, 95%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.
[0139] In another aspect of the present invention, there is provided a fermentation broth having the above recombinant cells.
[0140] In another aspect of the present invention, there is provided a method for reducing proteolysis of a heterologously expressed protein, comprising the steps of culturing a recombinant cell comprising a) a heterologously expressed barley α-amylase subtilisin inhibitor (BASI) polypeptide and b) a heterologously expressed protein under conditions suitable for the production of the heterologously expressed protein and the BASI polypeptide.
[0141] Optionally, the method includes a step of isolating a heterologous protein.
[0142] Optionally, the heterologous expressed protein is aminopeptidase, α - amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α - galactosidase, beta - galactosidase, glucose oxidase (GOX), alpha - glucosidase, β - glucosidase, glucuronidase, glycosyltransferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenol oxidase, polyphenol oxidase, protein disulfide isomerase, protease, ribonuclease, α - 1,6 - transglucosidase, transglutaminase, urokinase, xylanase, or β - xylosidase.
[0143] Optionally, the heterologous expressed protein is phospholipase.
[0144] Optionally, the phospholipase is an isolated polypeptide having phospholipase A1 activity having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0145] Optionally, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO: 27.
[0146] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0147] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0148] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0149] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0150] Optionally, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0151] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0152] Optionally, the recombinant cell is a bacterial, fungal, yeast, plant or mammalian cell.
[0153] Optionally, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthora.
[0154] Optionally, the recombinant cell is Trichoderma reesei.
[0155] Optionally, the recombinant cell is Aspergillus niger or Aspergillus oryzae.
[0156] Optionally, the recombinant cell is Bacillus subtilis, Myceliophthora thermophila or Bacillus licheniformis.
[0157] Optionally, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.
[0158] In another aspect of the present invention, there is provided a method for reducing proteolysis of a recombinantly expressed protein, the method comprising isolating the recombinantly expressed protein in the presence of an exogenously added barley α -amylase subtilisin inhibitor (BASI) polypeptide.
[0159] Optionally, the method includes isolating a heterologous protein.
[0160] In some cases, the heterologous expressed protein is aminopeptidase, α - amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α - galactosidase, beta - galactosidase, glucose oxidase (GOX), alpha - glucosidase, β - glucosidase, glucuronidase, glycosyltransferase hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenol oxidase, polyphenol oxidase, protein disulfide isomerase, protease, ribonuclease, α - 1,6 - transglucosidase, transglutaminase, urokinase, xylanase, or β - xylosidase.
[0161] In some cases, the heterologous expressed protein is phospholipase.
[0162] In some cases, the phospholipase is an isolated polypeptide having phospholipase A1 activity and having a protein sequence with at least 80% sequence identity to the protein sequences of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0163] In some cases, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO: 27.
[0164] Optionally, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0165] Optionally, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0166] Optionally, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0167] Optionally, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0168] Optionally, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0169] Optionally, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0170] Optionally, the recombinant cell is a bacterial, fungal, yeast, plant or mammalian cell.
[0171] Optionally, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthora.
[0172] Optionally, the recombinant cell is Trichoderma reesei.
[0173] Optionally, the recombinant cell is Aspergillus niger or Aspergillus oryzae.
[0174] Optionally, the recombinant cell is Bacillus subtilis, Myceliophthora thermophila or Bacillus licheniformis.
[0175] Optionally, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.
[0176] Brief Description of Biological Sequences SEQ ID NO: 1 shows the full-length amino acid sequence of the CRC08310 phospholipase variant derived from Trichoderma harzianum.
[0177] SEQ ID NO: 2 shows the proprotein sequence of the CRC08310 phospholipase variant derived from Trichoderma harzianum.
[0178] SEQ ID NO: 3 shows the full-length amino acid sequence of the CRC08316 phospholipase variant derived from Pestalotiopsis fici.
[0179] Shows the protein amino acid sequence of the CRC08316 phospholipase variant derived from Pestalotiopsis fici, Accession No. 4.
[0180] Shows the full-length amino acid sequence of the CRC08319 phospholipase variant (also known as Metarhizium anisopliae) derived from Metarhizium guizhouense, Accession No. 5.
[0181] Shows the protein amino acid sequence of the CRC08319 phospholipase, Accession No. 6. Variant of Metarhizium guizhouense (also known as Metarhizium anisopliae).
[0182] Shows the full-length amino acid sequence of the CRC08405 phospholipase variant derived from Diaporthe ampelina, Accession No. 7.
[0183] Shows the protein amino acid sequence of the CRC08405 phospholipase variant derived from Diaporthe ampelina, Accession No. 8.
[0184] Shows the full-length amino acid sequence of the CRC08418 phospholipase variant derived from Magnaporthe oryzae, Accession No. 9.
[0185] Shows the protein amino acid sequence of the CRC08418 phospholipase variant derived from Magnaporthe oryzae, Accession No. 10.
[0186] Shows the full-length amino acid sequence of the CRC08826 phospholipase variant derived from Neonectria ditissima, SEQ ID NO: 11.
[0187] Shows the protein amino acid sequence of the CRC08826 phospholipase variant derived from Neonectria ditissima, SEQ ID NO: 12.
[0188] Shows the full-length amino acid sequence of the CRC08833 phospholipase variant derived from Trichoderma gamsii, SEQ ID NO: 13.
[0189] Shows the protein amino acid sequence of the CRC08833 phospholipase variant derived from Trichoderma gamsii, SEQ ID NO: 14.
[0190] Shows the full-length amino acid sequence of the CRC08845 phospholipase variant derived from Metarhizium anisopliae, SEQ ID NO: 15.
[0191] SEQ ID NO: 16 shows the protein amino acid sequence of the CRC08845 phospholipase variant derived from Metarhizium anisopliae.
[0192] Shows the amino acid sequence of phospholipase A1 used in the commercial product Powerbake 4080, SEQ ID NO: 17.
[0193] Shows the amino acid sequence of phospholipase A1 used in the commercial product Lipopan F, SEQ ID NO: 18.
[0194] Shows the codon-optimized synthetic nucleic acid sequence of full-length CRC08310, SEQ ID NO: 19.
[0195] Shows the codon-optimized synthetic nucleic acid sequence of full-length CRC08316, SEQ ID NO: 20.
[0196] SEQ ID NO: 21 shows the codon-optimized synthetic nucleic acid sequence of full-length CRC08319.
[0197] SEQ ID NO: 22 shows the codon-optimized synthetic nucleic acid sequence of full-length CRC08405.
[0198] SEQ ID NO: 23 shows the codon-optimized synthetic nucleic acid sequence of full-length CRC08418.
[0199] SEQ ID NO: 24 shows the codon-optimized synthetic nucleic acid sequence of full-length CRC08826.
[0200] SEQ ID NO: 25 shows the codon-optimized synthetic nucleic acid sequence of full-length CRC08833.
[0201] SEQ ID NO: 26 shows the codon-optimized synthetic nucleic acid sequence of full-length CRC08845.
[0202] SEQ ID NO: 27 shows CRC08319 mature Q28-K147.
[0203] SEQ ID NO: 28 shows CRC08319 mature Q28-T146.
[0204] SEQ ID NO: 29 shows CRC08319 mature Q28-T140.
[0205] SEQ ID NO: 30 shows CRC08310 mature Q28-K150.
[0206] SEQ ID NO: 31 shows CRC08310 mature Q28-G149.
[0207] SEQ ID NO: 32 shows CRC08316 mature Q26-R150.
[0208] SEQ ID NO: 33 shows CRC08316 mature Q26-K149.
[0209] SEQ ID NO: 34 shows CRC08405 mature Q28-K147.
[0210] It shows SEQ ID NO: 35 - CRC08405 mature Q28 - T146.
[0211] It shows SEQ ID NO: 36 - CRC08418 mature Q34 - G150.
[0212] It shows SEQ ID NO: 37 - CRC08418 mature Q34 - G157.
[0213] It shows SEQ ID NO: 38 - CRC08826 mature A30 - K152.
[0214] It shows SEQ ID NO: 39 - CRC08826 mature A30 - D146.
[0215] It shows SEQ ID NO: 40 - CRC08826 mature A30 - K151.
[0216] It shows SEQ ID NO: 41 - CRC08833 mature Q28 - R150.
[0217] It shows SEQ ID NO: 42 - CRC08833 mature Q28 - Q124.
[0218] It shows SEQ ID NO: 43 - CRC08833 mature Q28 - F141.
[0219] It shows SEQ ID NO: 44 - CRC08833 mature Q28 - D145.
[0220] It shows SEQ ID NO: 45 - CRC08833 mature Q28 - G149.
[0221] It shows SEQ ID NO: 46 - cbh1 promoter sequence.
[0222] It shows the pep1 signal having SEQ ID NO: 47 - gla1 intron.
[0223] It shows SEQ ID NO: 48 - CRC08319 proenzyme DNA sequence.
[0224] Set the SEQ ID NO: 49 - cbh1 terminator DNA sequence.
[0225] Shows the SEQ ID NO: 50 - py2 DNA sequence.
[0226] Shows the SEQ ID NO: 51 - amds DNA sequence.
[0227] Sets the DNA sequence of the SEQ ID NO: 52 - yhdN region.
[0228] Set of the SEQ ID NO: 53 - engineered rrnI promoter DNA sequences.
[0229] Shows the SEQ ID NO: 54 - aprE signal peptide DNA sequence.
[0230] Shows the codon - optimized BASI for expression in Bacillus DNA sequences of the SEQ ID NO: 55.
[0231] Shows the SEQ ID NO: 56 - BPN’ terminator DNA sequence.
[0232] Shows the SEQ ID NO: 57 - alrA gene DNA sequence.
[0233] Shows the SEQ ID NO: 58 - mature BASI.
[0234] Shows the SEQ ID NO: 59 - CF17 - 79.
[0235] Shows the SEQ ID NO: 60 - CF19 - 20.
[0236] Shows the SEQ ID NO: 61 - CF19 - 19.
[0237] Shows the SEQ ID NO: 62 - CF19 - 22.
[0238] Shows the SEQ ID NO: 63 - CF19 - 21.
[0239] Shows the SEQ ID NO: 64 - CF17 - 80.
[0240] Shows the SEQ ID NO: 65 - sgRNAcpa5.
[0241] Shows SEQ ID NO: 66 - sgRNAcpa5.
[0242] Shows SEQ ID NO: 67 - upstream homology region (UHR) of locus A.
[0243] Shows SEQ ID NO: 68 - downstream homology region (DHR) of locus A.
[0244] Shows SEQ ID NO: 69 - cbh2 promoter.
[0245] Sets SEQ ID NO: 70 - cbh1 catalytic core (E229Q) and linker.
[0246] Shows SEQ ID NO: 71 - chitinase site.
[0247] Shows SEQ ID NO: 72 - trpC terminator.
[0248] Shows SEQ ID NO: 73 - sgRNA locus A.
[0249] Shows SEQ ID NO: 74 - cpa5 right flank.
[0250] Shows SEQ ID NO: 75 - sdi1 marker.
[0251] Shows SEQ ID NO: 76 - cpa5 left flank.
[0252] Shows SEQ ID NO: 77 - RPG2641.
[0253] Shows SEQ ID NO: 78 - RPG2594.
[0254] Shows SEQ ID NO: 79 - RPG2642.
[0255] Shows SEQ ID NO: 80 - RPG2537.
[0256] Shows SEQ ID NO: 81 - als marker.
[0257] Shows SEQ ID NO: 82-TR0004946_slp6.
[0258] Shows SEQ ID NO: 83-TR0004988_slp6.
[0259] Shows SEQ ID NO: 84-TR0491140_amp1.
[0260] Shows SEQ ID NO: 85-TR0491227_amp1.
[0261] Shows SEQ ID NO: 86-TR0839906_Tr22210.
[0262] Shows SEQ ID NO: 87-TR0839982_Tr22210.
[0263] Shows SEQ ID NO: 88-TR2093782_slp3.
[0264] Shows SEQ ID NO: 89-TR2093819_slp3.
[0265] Shows SEQ ID NO: 90-RPG2732.
[0266] Shows SEQ ID NO: 91-RPG2733.
[0267] Shows SEQ ID NO: 92-RPG2736.
[0268] Shows SEQ ID NO: 93-RPG2737.
[0269] Shows SEQ ID NO: 94-RPG2738.
[0270] Shows SEQ ID NO: 95-RPG2739.
[0271] Shows SEQ ID NO: 96-RPG2740.
[0272] Shows SEQ ID NO: 97-RPG2741.
[0273] Shows SEQ ID NO: 98-sucA marker.
[0274] Shows SEQ ID NO: 99 - gSK96_pep2.
[0275] Shows SEQ ID NO: 100 - gSK97_pep2.
[0276] Shows SEQ ID NO: 101 - TR1266711_sed2.
[0277] Set SEQ ID NO: 102 - Frost TR1266752_sed2.
[0278] Shows SEQ ID NO: 103 - TR3505404_cpa5.
[0279] Shows SEQ ID NO: 104 - TR3505523_cpa5.
[0280] Shows SEQ ID NO: 105 - cbh1 catalyst core and linker
[0281] Shows SEQ ID NO: 106 - sdi1 marker.
[0282] Shows SEQ ID NO: 107 - TR3881664_gef1.
[0283] Shows SEQ ID NO: 108 - TR3882135_gef1.
[0284] Shows SEQ ID NO: 109 - RPG2752.
[0285] Shows SEQ ID NO: 110 - RPG2618.
[0286] Shows SEQ ID NO: 111 - RPG2734.
[0287] Shows SEQ ID NO: 112 - RPG2735.
[0288] Shows SEQ ID NO: 113 - RPG2742.
[0289] Shows SEQ ID NO: 114 - RPG2743.
[0290] It shows SEQ ID NO: 115-HOX full length.
[0291] It shows SEQ ID NO: 116-HOX mature form.
[0292] It shows SEQ ID NO: 117-GOX mature form.
[0293] It shows SEQ ID NO: 118-BS3 maturation.
[0294] It shows SEQ ID NO: 119-WAAA249 mature form.
[0295] It shows SEQ ID NO: 120-NBA maturation.
[0296] It shows SEQ ID NO: 121-SAS3 maturation.
[0297] It shows SEQ ID NO: 122-maltose-producing amylase variant VERONMAXIMA mature form.
[0298] It shows SEQ ID NO: 123-WAAA245 mature form.
[0299] It shows SEQ ID NO: 124-BASI codon-optimized DNA.
Brief Description of the Drawings
[0300]
Figure 1A
Figure 1B
Figure 2A
Figure 2B
Figure 3
Figure 4A-4B
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14
Figure 15
Figure 16
Figure 17
Mode for Carrying Out the Invention
[0301] Abbreviations NAPE - N-acyl phosphatidylethanolamine NALPE - N-acyl lysophosphatidylethanolamine NAGPE - N-acyl glycerophosphoethanolamine DGDG - digalactosyl diglyceride DGMG - digalactosyl monoglyceride MGDG - monogalactosyl diglyceride MGMG - monogalactosyl monoglyceride PC - phosphatidylcholine LPC - lysophosphatidylcholine PLA - phospholipase A DATEM - diacetyl tartaric acid esters of mono - and diglycerides
[0302] Definition The term "amino acid sequence" is synonymous with the terms "polypeptide", "protein", and "peptide" and is used interchangeably. Such an amino acid sequence, when exhibiting activity, may be referred to as an "enzyme". The conventional one-letter code or three-letter code is used for amino acid residues, and the amino acid sequence is represented in the direction from the standard amino to the carboxy terminus (i.e., N→C).
[0303] The term "nucleic acid" encompasses DNA, RNA, heteroduplexes, and synthetic molecules that can encode a polypeptide. The nucleic acid can be single-stranded or double-stranded. The terms "nucleic acid" and "polynucleotide" are used interchangeably. Because the genetic code is degenerate, two or more codons can be used to encode a particular amino acid, and the compositions and methods of the present invention encompass nucleotide sequences that encode a particular amino acid sequence. Unless otherwise indicated, nucleic acid sequences are presented in the 5' to 3' orientation.
[0304] "Vector" refers to a polynucleotide sequence designed to introduce nucleic acid into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, cassettes, and the like.
[0305] "Expression vector" refers to a DNA construct that contains a DNA sequence encoding a polypeptide of interest, and the coding sequence is operably linked to suitable control sequences capable of expressing the DNA in a suitable host. Such control sequences can include a promoter that causes transcription, an optional operator sequence that controls transcription, a sequence that encodes a suitable ribosome binding site on the mRNA, an enhancer, and sequences that control the termination of transcription and translation.
[0306] The term "barley α-amylase / subtilisin inhibitor" or "BASI" refers to an inhibitor of α-amylase derived from barley and serine proteases of the subtilisin family. In some embodiments, BASI comprises the amino acid sequence of SEQ ID NO: 58. In other embodiments, BASI may have at least about 50% sequence identity with SEQ ID NO: 58, or may comprise a sequence having at least about 50% sequence identity with residues 67-96 of SEQ ID NO: 58. The identity can in particular be at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 98% identical with residues 67-96 of SEQ ID NO: 58.
[0307] In addition to the specific amino acid sequences and polynucleotides referred to herein, the invention encompasses variants, homologs, derivatives and fragments thereof. The term "variant" is used to mean a nucleotide sequence or amino acid sequence that differs from the wild-type sequence.
[0308] For example, a variant can include substitutions, insertions, deletions, truncations, conversions and / or inversions at one or more positions as compared to the wild-type sequence. Variants can be made using methods known in the art, such as site-directed mutagenesis, insertional mutagenesis, random mutagenesis, site-specific mutagenesis and directed evolution, and using recombinant methods well known in the art. Polynucleotide sequences encoding variant amino acid sequences can be readily synthesized using methods known in the art.
[0309] In some aspects, a variant is a naturally occurring nucleotide sequence or amino acid sequence that differs from the wild-type sequence. For example, a variant can be a natural genetic variant.
[0310] In some aspects, a variant is an engineered variant. For example, a variant can be engineered by recombinant methods.
[0311] The protein sequences of the present invention may also have deletions, insertions or substitutions of amino acid residues that produce silent changes and result in functionally equivalent substances. Intentional amino acid substitutions can be made based on the similarity of the properties of the residues such as polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathicity, as long as the secondary binding activity of the substance is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine and tyrosine.
[0312] Conservative substitutions can be made, for example, according to the following table. As shown in Table 3, amino acids in the same block in the second column, preferably in the same row in the third column, can be substituted for each other.
[0313]
Table 1
[0314] The present invention also encompasses possible homologous substitutions (substitutions and replacements are both used herein to mean replacing an existing amino acid residue with an alternative residue), i.e., substitutions of the same kind such as basic with basic, acidic with acidic, polar with polar, etc. Non-homologous substitutions can occur, i.e., from one class of residues to another class of residues, or alternatively involve the inclusion of non-natural amino acids such as ornithine (hereinafter referred to as Z), ornithine diaminobutyrate (hereinafter referred to as B), ornithine norleucine (hereinafter referred to as O), pyridylalanine, thienylalanine, naphthylalanine and phenylglycine.
[0315] The substitution can also be made with synthetic amino acids (e.g., non-natural amino acids), including alpha- and alpha,alpha-disubstituted amino acids, N-alkyl amino acids, lactic acid, halide derivatives of natural amino acids, such as trifluorotyrosine, p-Cl-phenylalanine, p-Br-phenylalanine, p-I-phenylalanine, L-allyl-glycine, beta-alanine, L-alpha-amino butyric acid, L-gamma-amino butyric acid, L-alpha-aminoisobutyric acid, L-epsilon-aminocaproic acid # , 7-aminoheptanoic acid * , L-methionine sulfone, L-norleucine, L-norvaline, p-nitro-L-phenylalanine, L-hydroxyproline # , L-thioproline, methyl derivatives of phenylalanine (Phe), such as 4-methyl-Phe, pentamethyl-Phe, L-Phe(4-amino) # , L-Tyr(methyl), L-Phe(4-isopropyl), L-Tic(1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid), L-diaminopropionic acid # and L-Phe(4-benzyl).
[0316] The symbol * is used for the purposes of the above considerations (regarding homo- or hetero-substitution) to indicate the hydrophobicity of the derivative, while # is used to indicate the hydrophilicity of the derivative, and #* indicates amphiphilic characteristics.
[0317] Variant amino acid sequences may include appropriate spacer groups that can be inserted between any two amino acid residues of the sequence. By way of example, in addition to amino acid spacers such as glycine or b-alanine residues, alkyl groups such as methyl, ethyl or propyl groups may be mentioned. Further forms of variation include the presence of one or more amino acid residues in peptoid form, which will be well understood by those skilled in the art. To avoid doubt, the term "peptoid form" is used to refer to variant amino acid residues in which the a-carbon substituent is present on the nitrogen atom of the residue rather than on the a-carbon. Methods for preparing peptoid form peptides are known in the art, for example, Simon RJ et al., PNAS (1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134.
[0318] The nucleotide sequences used in the present invention may include synthetic or modified nucleotides within their scope. A number of different types of modifications to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones and / or the addition of acridine or polylysine chains at the 3' and / or 5' ends of the molecule. For the purposes of the present invention, it should be understood that the nucleotide sequences described herein may be modified by any method available in the art. Such modifications can be carried out so as to improve the in vivo activity or lifespan of the nucleotide sequences of the present invention.
[0319] The present invention also encompasses the use of nucleotide sequences complementary to the sequences presented herein.
[0320] Other variants of the sequences described herein can be obtained, for example, by probing a DNA library made from a series of individuals, for example, individuals from different populations. Further, other homologs can be obtained, and such homologs and fragments thereof can generally hybridize selectively to the sequences shown in the sequence listing herein. Such sequences can be obtained by probing a cDNA library or genomic DNA library made from other animal species, and such a library is probed with a probe containing all or part of any one of the sequences in the attached sequence listing under medium to high stringency conditions. Similar considerations also apply to obtaining species homologs and allelic variants of the polypeptide or nucleotide sequences of the present invention.
[0321] Variants and strain / species homologs can also be obtained using degenerate PCR using primers designed to target sequences within the conserved amino acid sequences within the sequences of the present invention. Conserved sequences can be predicted, for example, by aligning amino acid sequences from several variants / homologs. Sequence alignment can be performed using computer software known in the art. For example, the GCG Wisconsin PileUp program is widely used.
[0322] The primers used in degenerate PCR contain one or more degenerate positions and are used under less stringent conditions than those used for cloning sequences using single sequence primers for known sequences.
[0323] Alternatively, such polynucleotides can be obtained by site-directed mutagenesis of a characterized sequence. This can be useful, for example, when silent codon sequence changes are required to optimize the codon preference for a particular host cell in which the polynucleotide sequence is expressed. Other sequence changes may be desirable to introduce restriction enzyme recognition sites or to alter the properties or functions of the polypeptide encoded by the polynucleotide.
[0324] Unless otherwise indicated, the present invention uses conventional techniques of biochemistry, molecular biology, microbiology, and recombinant DNA that are within the ability of those of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, Irl Press; and D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press. The entirety of these texts is hereby incorporated by reference.
[0325] As used herein, "percent sequence identity" means that a particular sequence has at least a certain percentage of amino acid residues identical to those within a particular reference sequence when the particular sequence is aligned using the CLUSTAL W algorithm with its default parameters. See Thompson et al. (1994) Nucleic Acids Res. 22:4673-4680. The default parameters of the CLUSTAL W algorithm are as follows: Gap opening penalty: 10.0 Gap extension penalty: 0.05 Protein weight matrix: BLOSUM series DNA weight matrix: IUB Percent of delayed divergent sequences: 40 Gap separation distance: 8 DNA transition weight: 0.50 List of hydrophilic residues: GPSNDQEKR Use of negative matrix: OFF Toggle residue-specific penalty: ON Toggle hydrophilic penalty: ON Toggle end-gap separation penalty OFF
[0326] Deletions are counted as non-identical residues compared to the reference sequence. Deletions occurring at either end are included. For example, a variant having a 5-amino acid deletion at the C-terminus of a mature 617-residue polypeptide will have a sequence identity rate of 99% (612 / 617 identical residues x 100, rounded to the nearest integer) relative to the mature polypeptide. Such a variant would be included within the variants having "at least 99% sequence identity" relative to the mature polypeptide.
[0327] As used herein, the term "lipase" refers to triacylglycerol lipase as defined by enzyme entry EC3.1.1.3. Lipase catalyzes the hydrolysis of triacylglycerol to give free fatty acids (saturated or unsaturated), diacylglycerol, monoacylglycerol and glycerol.
[0328] As used herein, the term "phospholipase" refers to an enzyme that hydrolyzes phospholipids into fatty acids (saturated or unsaturated), lysophospholipids, diacylglycerol, choline phosphate and phosphate according to the hydrolysis site. Phospholipases are further classified into types A, B, C and D.
[0329] According to the present invention, the proteins containing the enzyme of the present invention exist in multiple forms. The proteins of the present invention can be truncated or trimmed (i.e., amino acids removed) from the N-terminus and / or C-terminus, resulting in shorter proteins. The proteins of the present invention can also have internal deletions. The shorter proteins described herein can have higher or lower activity than their longer counterparts. Without being bound by theory, as used herein, the term "pre-proprotein" refers to a protein (including an enzyme) having an N-terminal signal peptide that targets the protein for secretion. The pre-proprotein is sometimes referred to herein as the "full-length" or "full-length protein". The N-terminal signal peptide is cleaved in the endoplasmic reticulum to yield the "proprotein". The proprotein, as used herein, is shorter in length than the full-length protein (lacking the signal peptide) but longer than the mature protein. Generally, the proprotein is inactive or less active than the mature protein. The proprotein can be activated by post-translational modifications such as N-terminal or C-terminal clipping or converted to a more active mature form. A proprotein that is an enzyme may be referred to as a "proenzyme" or "zymogen". The clipped active protein (derived from the proprotein) is also referred to herein as the mature protein. It should be noted that the above terms are used for convenience and are not intended to either invalidate or determine the activity of the proteins of the present invention. It should also be noted that any particular protein of the present invention can have two or more variants described by the same terms.
[0330] As used herein, the term "phospholipase A" refers to an enzyme that catalyzes the hydrolysis of the ester bond of the fatty acid component of a phospholipid. There are two distinct types of phospholipase A activities that can be distinguished. Phospholipase A1, defined by enzyme entry EC3.1.1.32, and phospholipase A2, defined by enzyme entry EC3.1.1.4, catalyze the deacylation of one aliphatic acyl group at the sn1 and sn2 positions, respectively, from a diacylglycerol phospholipid to produce a lysophospholipid. Phospholipase A1 and A2 catalyze the deacylation of one fatty acid group at the sn1 and sn2 positions, respectively. Thus, phospholipase A1 (also referred to herein as PLA1) hydrolyzes the 1-acyl group of a phospholipid and hydrolyzes the bond between the fatty acid and the glycerol residue at that position. Phospholipase A2 (which may also be referred to herein as PLA2) catalyzes the hydrolysis of the 2-acyl group.
[0331] Hydrolysis of a phospholipid by a phospholipase produces a compound called a lysophospholipid. Thus, selective hydrolysis of a phospholipid by phospholipase A1 produces a 2-acyl lysophospholipid. Hydrolysis of a phospholipid by phospholipase A2 produces a 1-acyl lysophospholipid. Another phospholipase is "lysophospholipase" which catalyzes the hydrolysis of the remaining fatty acyl group of the lysophospholipid.
[0332] As used herein, the phrase "sn1 / sn2 specificity ratio" is defined herein as the relative PLA1 activity divided by the relative PLA2 activity, which is more fully described below.
[0333] As used herein, the "lysophospholipase / phospholipase activity ratio" is (LPC-U / mg protein) / (PC-U / mg protein), as more fully described below.
[0334] As used herein, the phrase "NALPE / NAPE activity ratio" is (NALPE - U / mg protein) / (NAPE - U / mg protein).
[0335] All references cited herein are hereby incorporated by reference in their entirety. In particular, the teachings of all references specifically mentioned herein are incorporated by reference.
[0336] Unless defined otherwise, all terms used in the disclosure of the present invention, including technical and scientific terms, have the meanings commonly understood by one of ordinary skill in the art to which this invention belongs. Definitions of terms are included to provide a better understanding of the teachings of the present invention with further guidance.
[0337] Other definitions are provided below.
[0338] Enzyme Production The enzymes of the present invention can be produced in host cells, for example, by secretion or intracellular expression. After the enzyme is secreted into the cell culture medium, cultured cell material having the enzyme (e.g., whole cell broth) can be obtained. Optionally, the enzyme can be isolated from the host cells or even from the cell broth depending on the desired purity of the final enzyme. Suitable host cells include bacteria, fungi (including yeast and filamentous fungi), and plant cells (including algae). Particularly useful host cells include Aspergillus niger, Aspergillus oryzae, or Trichoderma reesei. Other host cells include bacterial cells such as Bacillus subtilis or B. licheniformis, and Streptomyces, Escherichia coli.
[0339] Vector A DNA construct containing a nucleic acid encoding an enzyme can be constructed to be expressed in a host cell. Due to the known degeneracy of the genetic code, variant polynucleotides encoding the same amino acid sequence can be designed and produced using conventional techniques. Optimizing codon usage for a particular host cell is well known in the art. A nucleic acid encoding a phospholipase can be incorporated into a vector. The vector can be introduced into a host cell using known transformation techniques, such as the techniques disclosed below, etc.
[0340] The vector can be any vector that can be transformed into a host cell and replicated within the host cell. For example, a vector containing a nucleic acid encoding an enzyme can be transformed and replicated in a bacterial host cell as a means of growing and amplifying the vector. The vector can also be transformed into an expression host such that the encoded nucleic acid can be expressed as a functional phospholipase. Host cells serving as expression hosts can include, for example, filamentous fungi. The Fungal Genetics Stock Center (FGSC) Catalogue of Strains lists vectors suitable for expression in fungal host cells. See FGSC, Catalogue of Strains, University of Missouri, www.fgsc.net (last modified January 17, 2007). A representative vector is pJG153, which is a promoterless Cre expression vector that can replicate in a bacterial host. See Harrison et al. (June 2011) Applied Environ. Microbiol. 77:3916 - 22. pJG153 contains a nucleic acid encoding a phospholipase and can be modified with routine skills to express it.
[0341] The nucleic acid encoding the enzyme can be operably linked to a suitable promoter that enables transcription in the host cell. The promoter can be any DNA sequence that exhibits transcriptional activity in the selected host cell and can be derived from a gene encoding a protein that is either homologous or heterologous to the host cell. Particularly in bacterial hosts, exemplary promoters that direct the transcription of DNA sequences encoding phospholipases are the promoter of the lac operon of Escherichia coli (E. coli), the promoter of the agarase gene dagA or celA of Streptomyces coelicolor, the promoter of the α-amylase gene (amyL) of Bacillus licheniformis, the promoter of the maltogenic amylase gene (amyM) of Bacillus stearothermophilus, the promoter of α-amylase (amyQ) of Bacillus amyloliquefaciens, the promoters of the xylA and xylB genes of Bacillus subtilis, etc. For transcription in fungal hosts, examples of useful promoters are the promoters derived from genes encoding TAKA amylase of Aspergillus oryzae, aspartic proteinase of Rhizomucor miehei, native α-amylase of Aspergillus niger, acid-stable α-amylase of A. niger, glucoamylase of A. niger, lipase of Rhizomucor miehei, alkaline protease of A. oryzae, triosephosphate isomerase of A. oryzae, or acetamidase of Aspergillus nidulans. When the gene encoding the enzyme is expressed in a bacterial species such as E. coli, a suitable promoter can be selected, for example, from bacteriophage promoters such as the T7 promoter and the phage lambda promoter.Examples of promoters suitable for expression within yeast species include, but are not limited to, the Gal1 and Gal10 promoters of Saccharomyces cerevisiae, and the AOX1 or AOX2 promoters of Pichia pastoris. cbh1 is an endogenous inducible promoter from Trichoderma reesei. See Liu et al. (2008) Improved heterologous gene expression in Trichoderma reesei by cellobiohydrolase I gene (cbh1) promoter optimization, Acta Biochim. Biophys. Sin (Shanghai) 40(2):158-65.
[0342] The coding sequence can be operably linked to a signal sequence. The DNA encoding the signal sequence can be naturally associated with the phospholipase gene being expressed, or can be a DNA sequence from a different genus or species. The signal sequence and promoter sequence, including the DNA construct or vector, can be introduced into a fungal host cell and can be derived from the same origin. For example, the signal sequence is the cbh1 signal sequence operably linked to the cbh1 promoter.
[0343] The expression vector can also include an appropriate transcription terminator and, in eukaryotes, can include a polyadenylation sequence operably linked to the DNA sequence encoding the mutant phospholipase. The termination sequence and polyadenylation sequence can appropriately be derived from the same source as the promoter.
[0344] The vector can further include a DNA sequence that enables replication of the vector within the host cell. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUB110, pE194, pAMB1, and pIJ702.
[0345] The vector may also contain a selectable marker, for example, it may also contain a gene that complements a defect in the isolated host cell, for example, the dal gene derived from B. subtilis or B. licheniformis, or a gene that confers antibiotic resistance (for example, ampicillin resistance, kanamycin resistance, chloramphenicol resistance, or tetracycline resistance). Furthermore, the vector may contain an Aspergillus selection marker (for example, amdS, argB, niaD and xxsC), a marker that confers hygromycin resistance, or selection may be achieved by co-transformation known in the art. See, for example, WO 91 / 17243 pamphlet.
[0346] From some perspectives, for example, for subsequent enrichment or purification, intracellular expression may be advantageous when certain bacteria or fungi are used as host cells to produce large amounts of phospholipase. It is also possible to prepare cultured cell material containing isolated phospholipase by using extracellular secretion of phospholipase into the medium.
[0347] An expression vector typically contains the components of a cloning vector, for example, elements that permit self-replication of the vector within the selected host organism, and one or more markers detectable by a selectable phenotype, etc. An expression vector usually contains regulatory nucleotide sequences, for example, a promoter, an operator, a ribosome binding site, a translation initiation signal and optionally, a repressor gene or one or more activator genes. Furthermore, the expression vector may contain a sequence encoding an amino acid sequence that can target the phospholipase to a host cell organelle such as a peroxisome, or a specific cell compartment. Such a targeting sequence includes, but is not limited to, the sequence SKL. For expression under the direction of the control sequence, the nucleic acid sequence of the phospholipase is operably linked to the control sequence in a manner appropriate for expression.
[0348] The procedures used to ligate DNA constructs encoding phospholipase, promoter, terminator, and other elements respectively and insert them into an appropriate vector containing information necessary for replication are well known to those skilled in the art (see, for example, Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2 nd nd ed., Cold Spring Harbor, 1989, and 3 rd rd ed., 2001).
[0349] Transformation and culture of host cells Isolated cells containing either a DNA construct or an expression vector are advantageously used as host cells in the recombinant production of the enzyme according to the present invention. This cell can be transformed with a DNA construct encoding this enzyme, and conveniently by integrating this DNA construct (in one or more copy numbers) into the host chromosome. This integration is generally considered advantageous because this DNA sequence is likely to be stably maintained in the cell. Integration of the DNA construct into the host chromosome can be carried out according to conventional methods, for example, by homologous recombination or non-homologous recombination. As an alternative method, the cell can be transformed using the above-described expression vector associated with a different type of host cell.
[0350] Examples of suitable bacterial host organisms include Gram-positive bacterial species such as Bacillaceae including Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Geobacillus (formerly Bacillus) stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus lautus, Bacillus megaterium, and Bacillus thuringiensis; Streptomyces species such as Streptomyces murinus; lactic acid bacterial species including Lactococcus sp. such as Lactococcus lactis; Lactobacillus sp. including Lactobacillus reuteri; Leuconostoc sp.; Pediococcus sp.; and Streptococcus sp. Alternatively, strains of Gram-negative bacterial species belonging to Enterobacteriaceae including E. coli or Pseudomonadaceae can be selected as the host organism.
[0351] Suitable yeast host organisms can be selected from biotechnology-related yeast species, which include, but are not limited to, yeast species such as Pichia sp., Hansenula sp., or species of the genus Kluyveromyces, Yarrowinia, Schizosaccharomyces, or the genus Saccharomyces including Saccharomyces cerevisiae, or species belonging to the genus Schizosaccharomyces such as the S. pombe species, etc. As the host organism, a strain of Pichia pastoris, which is a methylotrophic yeast species, can be used as the host organism. Alternatively, the host organism can be Hansenula sp. Suitable host organisms among filamentous fungi include species of the genus Aspergillus, such as Aspergillus niger, Aspergillus oryzae, Aspergillus tubigensis, Aspergillus awamori, or Aspergillus nidulans. Alternatively, as the host organism, a strain of a species of Fusarium such as Fusarium oxysporum, or a strain of a species of Rhizomucor such as Rhizomucor miehei can be used. Other suitable strains include species of the genus Thermomyces and Mucor. In addition, Trichoderma sp. can be used as the host. Suitable procedures for the transformation of host cells of the genus Aspergillus include, for example, those described in European Patent No. 238023. Enzymes expressed by fungal host cells can be glycosylated, i.e., they will contain glycosyl moieties.The glycosylation pattern may be the same as or different from that present in the wild-type phospholipase. Depending on the type and / or degree of glycosylation, changes in enzymatic and / or biochemical properties can be imparted.
[0352] It may be advantageous to delete a gene from an expression host in which gene deficiency can be restored by the transformed expression vector. Using known methods, fungal host cells having one or more inactivated genes can be obtained. Inactivation of the gene can be carried out by complete or partial deletion, by insertional inactivation or by any other means that renders the gene non-functional so as to prevent the expression of the functional protein. Any gene (e.g., cbh1 gene, cbh2 gene, egl1 gene and egl2 gene) from a cloned Trichoderma sp. or other filamentous fungal host can be deleted. Gene deletion can be achieved by inserting a form of the gene to be inactivated into a plasmid by methods known in the art.
[0353] Examples of introducing a DNA construct or vector into a host cell include transformation, electroporation, nuclear microinjection, transduction, gene transfer such as lipofection-mediated and DEAE-dextran-mediated gene transfer, incubation with calcium phosphate DNA precipitate, high-speed collision with DNA-coated microparticles, and techniques such as protoplast fusion. General transformation techniques are known in the art. See, for example, Sambrook et al. (2001), supra. Expression of heterologous proteins in Trichoderma is described, for example, in U.S. Patent No. 6,022,725. For transformation of strains of the genus Aspergillus, see also Cao et al. (2000) Science 9:991-1001. Genetically stable transformants can be constructed using a vector system in which a nucleic acid encoding an enzyme is stably integrated into the chromosome of the host cell. The transformants are then selected and purified by known techniques.
[0354] The preparation of Trichoderma sp. for transformation can include, for example, the preparation of protoplasts from fungal mycelia. See Campbell et al. (1989) Curr. Genet. 16:53-56. Mycelia can be obtained from germinated vegetative spores. Protoplasts are produced by treating the mycelia with an enzyme that digests the cell wall. The protoplasts are protected by the presence of an osmotic stabilizer in the suspension medium. Examples of these stabilizers include sorbitol, mannitol, potassium chloride, magnesium sulfate, etc. Usually, the concentration of these stabilizers varies from 0.8 M to 1.2 M, and for example, a 1.2 M sorbitol solution can be used in the suspension medium.
[0355] The uptake of DNA into a strain of a host Trichoderma sp. is affected by the calcium ion concentration. Generally, about 10 - 50 mM of CaCl2 is used in the uptake solution. Additional suitable compounds include buffer systems such as TE buffer (10 mM Tris, pH 7.4; 1 mM EDTA) or 10 mM MOPS, pH 6.0 and polyethylene glycol. Polyethylene glycol is thought to fuse cell membranes and thus deliver the contents of the medium into the cytoplasm of Trichoderma sp. strains. This fusion often leaves multiple copies of plasmid DNA integrated into the host chromosome as they are.
[0356] Normally, the transformation of Trichoderma sp. typically uses protoplasts or cells that have been subjected to permeabilization treatment at a density of 10 5 ~10 7 / mL, especially 2x10 6 / mL. 100 μL in volume of these protoplasts or cells in a suitable solution (e.g., 1.2 M sorbitol and 50 mM CaCl2) can be mixed with the desired DNA. Generally, a high concentration of PEG is added to the uptake solution. 0.1 - 1 volume of 25% PEG 4000 can be added to the protoplast suspension; however, it is useful to add about 0.25 volume to the protoplast suspension. Additives such as dimethyl sulfoxide, heparin, spermidine, potassium chloride, etc. can also be added to the uptake solution to facilitate transformation. Similar procedures are also available for other fungal host cells. See, for example, U.S. Patent No. 6,022,725.
[0357] As used herein, the protein identification ("JGIPID") numbers for native Trichoderma genes refer to version 2 of the Trichoderma reesei QM6a genome sequence assembly generated by the Joint Genome Institute of the Department of Energy (The Genome Portal of the Department of Energy Joint Genome Institute, Grigoriev et al., Nucleic Acids Res 2012 Jan;40(Database issue):D26-32.doi:10.1093 / nar / gkr947). The scaffold sequences and annotated genes assembled by JGI are also deposited in GeneBank (The National Center for Biotechnology) under nucleotide accession numbers GL985056.1 to GL985132.1.
[0358] Expression The method for producing the enzyme of the present invention may include culturing the above-described host cell under conditions conducive to the production of the enzyme and recovering the enzyme from the cells and / or the medium.
[0359] The medium used for culturing the cells can be any conventional medium suitable for growing the host cell in question and obtaining the expression of the phospholipase. Suitable media and medium components are available from commercial suppliers or can be prepared according to published recipes (e.g., as described in the catalog of the American Type Culture Collection).
[0360] The enzyme secreted from the host cell can be used in the whole broth preparation. In the method of the present invention, the preparation of the spent whole fermentation broth of the recombinant microorganism can be achieved using any culture method known in the art, and the phospholipase is expressed. Thus, fermentation can be understood to include shake flask culture, small-scale or large-scale fermentation (including continuous, batch, fed-batch or solid state fermentation) in a suitable medium and under conditions enabling the expression or isolation of the phospholipase, in a laboratory or industrial fermenter. The term "conditioned whole fermentation broth" is defined herein as the unfractionated content of the fermentation material containing the culture medium, extracellular proteins (e.g., enzymes) and cell biomass. The term "spent whole fermentation broth" is understood to also include cell biomass that has been lysed or permeabilized using methods well known in the art.
[0361] The enzyme secreted from the host cell can be conveniently recovered from the medium by well-known procedures including separation of the cells from the medium by centrifugation or filtration, precipitation of the proteinaceous components of the medium with salts such as ammonium sulfate, and then chromatographic procedures such as ion exchange chromatography, affinity chromatography, etc. The polynucleotide encoding the enzyme in the vector can be operably linked to a control sequence that can provide for the expression of the coding sequence by the host cell, i.e., the vector is an expression vector. The control sequence can be modified, for example, by adding additional transcriptional regulatory factors, to make the level of transcription directed by the control sequence more responsive to transcriptional modifiers. The control sequence can in particular include a promoter.
[0362] The host cell can be cultured under conditions suitable for enabling the expression of phospholipase. The expression of the enzyme may be constitutive so that the enzyme is continuously produced, or it may be inducible and require a stimulus to initiate the expression. In the case of inducible expression, protein production can be initiated, if required, by, for example, the addition of an inducer (such as dexamethasone or IPTG or sophorose) to the culture medium. The polypeptide can also be produced by recombinant techniques within an in vitro cell-free system such as, for example, the TNT™ (Promega) rabbit reticulocyte system.
[0363] The expression host can also be cultured under aerobic conditions in a medium appropriate for that host. Depending on the needs of the host and the production of the desired phospholipase, for example, a combination of shaking or stirring and aeration can be provided in a situation where production is carried out at a temperature appropriate for that host, such as from about 25 °C to about 75 °C (for example, 30 °C to 45 °C). The culture can be carried out over about 12 to about 100 hours or more (and any time value in between, such as 24 to 72 hours, for example). Typically, the culture broth has a pH of about 4.0 to about 8.0, again depending on the culture conditions required for the host for the production of phospholipase.
[0364] Methods for concentrating and purifying the enzyme Fermentation, separation, and concentration techniques are well known in the art, and conventional methods can be used to prepare a solution containing the enzyme polypeptide.
[0365] After fermentation, a fermentation broth is obtained, and various suspended solids, including microbial cells and residual fermentation raw materials, are removed by conventional separation techniques to obtain an enzyme solution. Filtration, centrifugation, microfiltration, rotary vacuum drum filtration, ultrafiltration, ultrafiltration performed after centrifugation, extraction, or chromatography, etc. are generally used.
[0366] To optimize the recovery rate, it is desirable to concentrate the solution containing the enzyme polypeptide. The use of an unconcentrated solution typically requires an increase in the culture time to collect the concentrated or purified enzyme precipitate.
[0367] The enzyme-containing solution is concentrated using conventional concentration techniques until the desired enzyme level is obtained. Concentration of the enzyme-containing solution can be achieved by any of the techniques discussed herein. Typical methods of concentration and purification include, but are not limited to, rotary vacuum filtration and / or ultrafiltration.
[0368] The enzyme solution is concentrated into a concentrated enzyme solution and concentrated until the enzyme activity of the concentrated phospholipase polypeptide-containing solution reaches the desired level.
[0369] Concentration can be carried out using a precipitating agent such as a metal halide precipitating agent. Metal halide precipitating agents include, but are not limited to, alkali metal chlorides, alkali metal bromides, and blends of two or more of these metal halides. Typical metal halides include sodium chloride, potassium chloride, sodium bromide, potassium bromide, and blends of two or more of these metal halides. Sodium chloride, a metal halide precipitating agent, can also be used as a preservative.
[0370] The metal halide precipitating agent is used in an effective amount to precipitate the phospholipase. Selection of the minimum effective amount and the optimal effective amount of the metal halide to induce precipitation of the enzyme, as well as selection of the precipitation conditions for maximum recovery including incubation time, pH, temperature, and concentration of the enzyme, will be readily apparent to one of ordinary skill in the art after performing routine tests.
[0371] Generally, at least about 5 weight / volume % (% w / v) to about 25 weight / volume %, usually at least 8 weight / volume % of the metal halide is added to the concentrated enzyme solution. Generally, 25 weight / volume % or less, usually 20 weight / volume % or less of the metal halide is added to the concentrated enzyme solution. The optimal concentration of the metal halide precipitating agent will depend, in particular, on the nature of the specific phospholipase polypeptide and the concentration of the specific phospholipase polypeptide in the concentrated enzyme solution.
[0372] Another alternative for precipitating the enzyme is to use an organic compound. Typical organic compound precipitants include 4-hydroxybenzoic acid, alkali metal salts of 4-hydroxybenzoic acid, alkyl esters of 4-hydroxybenzoic acid, and blends of two or more of these organic compounds. The addition of the organic compound precipitant can be carried out before, simultaneously with, or subsequent to the addition of the metal halide precipitant, and the addition of both the organic compound and the metal halide, which are both precipitants, can be carried out continuously or simultaneously.
[0373] Generally, the organic precipitant is selected from the group consisting of alkali metal salts of 4-hydroxybenzoic acid, such as the sodium or potassium salt, and linear or branched alkyl esters of 4-hydroxybenzoic acid (where the alkyl group contains 1 to 12 carbon atoms), and blends of two or more of these organic compounds. The organic compound precipitant can be, for example, a linear or branched alkyl ester of 4-hydroxybenzoic acid (where the alkyl group contains 1 to 10 carbon atoms) and blends of two or more of these organic compounds. Typical organic compounds are linear alkyl esters of 4-hydroxybenzoic acid (where the alkyl group contains 1 to 6 carbon atoms) and blends of two or more of these organic compounds. Methyl esters of 4-hydroxybenzoic acid, propyl esters of 4-hydroxybenzoic acid, butyl esters of 4-hydroxybenzoic acid, ethyl esters of 4-hydroxybenzoic acid, and blends of two or more of these organic compounds can also be used. Additional organic compounds include, but are not limited to, methyl 4-hydroxybenzoate (referred to as methyl paraben) and propyl 4-hydroxybenzoate (referred to as propyl paraben), both of which are also preservatives. For a detailed description, see, for example, U.S. Patent No. 5,281,526.
[0374] The addition of the organic compound precipitant offers the advantage of high flexibility in precipitation conditions with respect to pH, temperature, phospholipase concentration, precipitant concentration, and incubation time.
[0375] The organic compound precipitant is used in an effective amount to improve the precipitation of the enzyme by the metal halide precipitant. The selection of the minimum effective amount and the optimum effective amount of the organic compound precipitant, as well as the selection of precipitation conditions for maximum recovery including incubation time, pH, temperature, and enzyme concentration, will be readily apparent to those skilled in the art in light of the present disclosure after routine testing has been carried out.
[0376] Generally, at least about 0.01 weight / volume % of the organic compound precipitant, usually at least 0.02 weight / volume %, is added to the concentrated enzyme solution. Generally, up to about 0.3 weight / volume % of the organic compound precipitant, usually up to about 0.2 weight / volume %, is added to the concentrated enzyme solution.
[0377] The concentrated polypeptide solution containing the metal halide precipitant and the organic compound precipitant can necessarily be adjusted to a pH that depends on the enzyme to be concentrated or purified. Generally, the pH is adjusted to a level close to the isoelectric point of the phospholipase. The pH can be adjusted to a pH within the range from about 2.5 pH units below the isoelectric point (pI) to about 2.5 pH units above the isoelectric point.
[0378] The incubation time required to obtain a concentrated or purified enzyme precipitate depends on the nature of the specific enzyme, the concentration of the enzyme, and the specific precipitant and its concentration. Generally, the effective time for precipitating the enzyme is from about 1 to about 30 hours, and usually this time does not exceed about 25 hours. In the presence of the organic compound precipitant, the incubation time can be shortened to less than about 10 hours and, in most cases, even to about 6 hours.
[0379] Generally, the temperature during incubation is from about 4 °C to about 50 °C. Usually, the method is carried out at a temperature from about 10 °C to about 45 °C (e.g., from about 20 °C to about 40 °C). The optimum temperature for inducing precipitation varies according to the solution conditions and the enzyme or precipitant used.
[0380] The overall recovery rate of the concentrated or purified enzyme precipitate and the efficiency with which the process is carried out are improved by agitating a solution containing the enzyme, the added metal halide and the added organic compound. The agitation step is carried out both during the addition of the metal halide and organic compound and during the subsequent incubation period. Suitable agitation methods include mechanical stirring or shaking, strong aeration or any similar technique.
[0381] After the incubation period, the concentrated or purified enzyme is then separated from the separable pigment and other impurities and collected by conventional separation techniques such as filtration, centrifugation, microfiltration, rotary vacuum filtration, ultrafiltration, compression filtration, cross-flow microfiltration, etc. Another concentration or purification of the enzyme precipitate can be obtained by washing the precipitate with water. For example, the concentrated or purified enzyme precipitate is washed with water containing a metal halide precipitant or water containing a metal halide and an organic compound precipitant.
[0382] During fermentation, the enzyme polypeptide accumulates in the culture broth. To isolate, concentrate or purify the desired phospholipase, the culture broth is centrifuged or filtered to remove cells and the resulting cell-free liquid is used for concentration or purification of the enzyme. In one embodiment, the cell-free broth is salted out using ammonium sulfate at about 70% saturation. The 70% saturation - precipitate fraction is then dissolved in a buffer and applied to a column such as a Sephadex G-100 column and eluted to recover the enzyme-active fraction. Conventional techniques such as ion-exchange chromatography can be used for further concentration or purification.
[0383] The concentrated or purified enzyme can be made into a final product that is either a liquid (solution, slurry) or a solid (granular, powder).
[0384] Description of the Preferred Embodiment According to one aspect of the present invention, there is provided an isolated polypeptide having phospholipase A1 activity and having a protein sequence with at least 80% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0385] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to SEQ ID NO: 27.
[0386] Preferably, the isolated polypeptide has a protein sequence with at least 90% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0387] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity to SEQ ID NO: 27.
[0388] Preferably, the isolated polypeptide has a protein sequence with at least 95% sequence identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0389] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity to SEQ ID NO: 27.
[0390] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0391] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0392] In another aspect of the present invention, there is provided a method for producing dough, comprising mixing a dough component selected from the group consisting of flour, salt, water, sugar, fat, lecithin, oil emulsifier and yeast with an isolated polypeptide having phospholipase A1 activity having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0393] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0394] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0395] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0396] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0397] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0398] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0399] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0400] Preferably, the method for producing a fabric has a further step of adding at least one additional enzyme useful for improving at least the fabric and / or the baked product made therefrom.
[0401] Preferably, the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from said phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
[0402] Preferably, the amylase is an exoamylase.
[0403] Preferably, the exoamylase is a maltose-forming amylase.
[0404] In other preferred embodiments of the present invention, the exoamylase is a non-maltose-forming amylase. Preferably, the non-maltose-forming amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 to 8 D-glucopyranosyl units from the non-reducing end of the side chain of amylopectin.
[0405] In other preferred embodiments, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity.
[0406] Preferably, the phospholipase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.
[0407] In other preferred embodiments, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.
[0408] Preferably, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 118.
[0409] Preferably, the glucose oxidase may be a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 117.
[0410] Preferably, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 116.
[0411] In another aspect of the present invention, there is provided a fabric having an isolated polypeptide having phospholipase A1 activity and having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0412] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0413] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0414] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0415] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0416] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0417] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0418] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0419] Preferably, the fabric has improved fabric extensibility and / or stability.
[0420] In another aspect of the invention, the fabric has at least one additional enzyme useful for improving the fabric and / or the baked product made therefrom.
[0421] Preferably, the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from the phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
[0422] Preferably, the amylase is an exoamylase.
[0423] Preferably, the exoamylase is a maltose-producing amylase.
[0424] In another preferred embodiment of the present invention, the exoamylase is a non-maltose-producing amylase. Preferably, the non-maltose-producing amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 to 8 D-glucopyranosyl units from the non-reducing ends of the side chains of amylopectin.
[0425] In another preferred embodiment, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity. Preferably, the phospholipase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.
[0426] In another preferred embodiment, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.
[0427] Preferably, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 118.
[0428] Preferably, the glucose oxidase may be a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 117.
[0429] Preferably, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 116.
[0430] In another aspect of the present invention, there is provided a method for preparing a baked product comprising baking the dough as described above.
[0431] In another aspect of the present invention, there is provided a fired product obtained by the above method. Preferably, it has at least one improved property selected from the group consisting of improvement in the pore diameter of the crumb, improvement in the uniformity of the bubbles, absence of separation between the skin and the crumb, increase in bulk, increase in the crispness of the skin, and improvement in oven spring.
[0432] Preferably, the improved property is the crispness of the skin.
[0433] In another aspect of the present invention, there is provided a baking premix comprising flour and an isolated polypeptide having phospholipase A1 activity and having a protein sequence having at least 80% sequence identity with the protein sequence of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0434] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0435] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0436] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0437] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0438] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0439] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0440] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0441] Preferably, the premix has at least one additional enzyme useful for improving the dough and / or the baked product made therefrom.
[0442] Preferably, the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from said phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
[0443] Preferably, the amylase is an exoamylase.
[0444] Preferably, the exoamylase is a maltose-producing amylase.
[0445] In another preferred embodiment of the present invention, the exoamylase is a non-maltose-producing amylase. Preferably, the non-maltose-producing amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 to 8 D-glucopyranosyl units from the non-reducing ends of the side chains of amylopectin.
[0446] In another preferred embodiment, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity. Preferably, the phospholipase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.
[0447] In another preferred embodiment, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.
[0448] Preferably, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 118.
[0449] Preferably, the glucose oxidase may be a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 117.
[0450] Preferably, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 116.
[0451] In another aspect of the present invention, there is provided a firing improver having particulate matter or agglomerated powder and an isolated polypeptide having phospholipase A1 activity having a protein sequence having at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0452] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0453] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0454] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0455] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0456] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0457] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0458] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0459] Preferably, the baking improver has at least one additional enzyme useful for improving the dough and / or the baked product made therefrom.
[0460] Preferably, the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from the phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
[0461] Preferably, the amylase is an exoamylase.
[0462] Preferably, the exoamylase is a maltose-forming amylase.
[0463] In another preferred embodiment of the present invention, the exoamylase is a non-maltose-forming amylase. Preferably, the non-maltose-forming amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides mainly containing 4 to 8 D-glucopyranosyl units from the non-reducing end of the side chain of amylopectin.
[0464] In other preferred embodiments, the additional enzyme is a phospholipase. Preferably, the phospholipase has galactolipase activity. Preferably, the phospholipase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO: 18.
[0465] In other preferred embodiments, the amylase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO: 123.
[0466] Preferably, the xylanase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 118.
[0467] Preferably, the glucose oxidase may be a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 117.
[0468] Preferably, the hexose oxidase is a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 116.
[0469] In another aspect of the invention, there is provided an isolated polynucleotide having a nucleic acid sequence encoding an isolated polypeptide having phospholipase A1 activity and having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO:, SEQ ID NO:, SEQ ID NO: 44 or SEQ ID NO: 45.
[0470] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0471] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0472] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0473] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0474] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0475] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0476] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0477] In another aspect of the present invention, a recombinant expression vector having a polynucleotide as described above is provided.
[0478] In another aspect of the present invention, there is provided a host cell having the above recombinant expression vector.
[0479] In another aspect of the present invention, there is provided a method for modifying a phospholipid emulsifier, the method comprising the step of treating an emulsifier with an isolated polypeptide having phospholipase A1 activity and having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO:, SEQ ID NO:, SEQ ID NO:, SEQ ID NO:, SEQ ID NO: 43, SEQ ID NO:, SEQ ID NO:, SEQ ID NO: 44 or SEQ ID NO: 45.
[0480] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0481] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0482] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0483] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0484] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0485] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0486] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0487] Preferably, the phospholipid emulsifier is lecithin or lysophosphatidylcholine.
[0488] In another aspect of the present invention, there is provided a method for producing lysophospholipids in a lipid-containing food matrix, which comprises the step of adding an isolated polypeptide having phospholipase A1 activity and having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45 to the lipid-containing food matrix.
[0489] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0490] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0491] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0492] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0493] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0494] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0495] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0496] Preferably, the lipid-containing food matrix is selected from the group consisting of eggs, egg-containing foods, sweet bakery doughs, processed meats, milk-based products, and vegetable oils.
[0497] In another aspect of the present invention, there is provided a recombinant cell having a) a heterologously expressed barley α-amylase / subtilisin inhibitor (BASI) polypeptide and b) a heterologously expressed protein.
[0498] Preferably, the heterologously expressed protein is an aminopeptidase, α-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α-galactosidase, beta-galactosidase, glucose oxidase (GOX), alpha-glucosidase, β-glucosidase, glucuronidase, glycosyltransferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenol oxidase, polyphenol oxidase, protein disulfide isomerase, protease, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase, or β-xylosidase. More preferably, the heterologously expressed protein is a phospholipase.
[0499] Even more preferably, the phospholipase is an isolated polypeptide having phospholipase A1 activity having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0500] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0501] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0502] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0503] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0504] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0505] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0506] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0507] Preferably, the recombinant cell is a bacterium, fungus, yeast, plant, or mammalian cell.
[0508] Preferably, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthora.
[0509] More preferably, the recombinant cell is Trichoderma reesei.
[0510] In another preferred embodiment, the recombinant cell is Aspergillus niger or Aspergillus oryzae.
[0511] In yet another preferred embodiment, the recombinant cell is Bacillus subtilis, Myceliophthora thermophila or Bacillus licheniformis.
[0512] Preferably, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.
[0513] In another aspect of the invention, there is provided a fermentation broth having the above recombinant cells.
[0514] In another aspect of the invention, there is provided a method for reducing proteolysis of a heterologously expressed protein, comprising the steps of: a) heterologously expressing a barley α-amylase subtilisin inhibitor (BASI) polypeptide and b) culturing a recombinant cell containing the heterologously expressed protein under conditions suitable for the production of the heterologously expressed protein and the BASI polypeptide.
[0515] Preferably, the method includes a step of isolating a heterologous protein.
[0516] Preferably, the heterologous expressed protein is aminopeptidase, α - amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α - galactosidase, beta - galactosidase, glucose oxidase (GOX), alpha - glucosidase, β - glucosidase, glucuronidase, glycosyltransferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenol oxidase, polyphenol oxidase, protein disulfide isomerase, protease, ribonuclease, α - 1,6 - transglucosidase, transglutaminase, urokinase, xylanase, or β - xylosidase.
[0517] More preferably, the heterologous expressed protein is a phospholipase. Even more preferably, the phospholipase is an isolated polypeptide having phospholipase A1 activity with a protein sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0518] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity to the sequence of SEQ ID NO: 27.
[0519] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0520] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0521] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0522] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0523] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0524] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0525] Preferably, the recombinant cell is a bacterial, fungal, yeast, plant, or mammalian cell.
[0526] Preferably, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthora.
[0527] More preferably, the recombinant cell is Trichoderma reesei.
[0528] In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus oryzae.
[0529] In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthora thermophila or Bacillus licheniformis.
[0530] Preferably, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.
[0531] In another aspect of the present invention, there is provided a method for reducing proteolysis of a recombinantly expressed protein, the method comprising isolating the recombinantly expressed protein in the presence of an exogenously added barley α -amylase subtilisin inhibitor (BASI) polypeptide.
[0532] Preferably, the method includes isolating a heterologous protein.
[0533] Preferably, the heterologous expression protein is aminopeptidase, α-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α-galactosidase, beta-galactosidase, glucose oxidase (GOX), alpha-glucosidase, β-glucosidase, glucuronidase, glycosyltransferase hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenol oxidase, polyphenol oxidase, protein disulfide isomerase, protease, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase, or β-xylosidase.
[0534] More preferably, the heterologous expression protein is phospholipase. More preferably, the phospholipase is an isolated polypeptide having phospholipase A1 activity having a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0535] More preferably, the isolated polypeptide is a protein sequence having at least 80% sequence identity with SEQ ID NO: 27.
[0536] Preferably, the isolated polypeptide has a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0537] More preferably, the isolated polypeptide is a protein sequence having at least 90% sequence identity with SEQ ID NO: 27.
[0538] Preferably, the isolated polypeptide has a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0539] More preferably, the isolated polypeptide is a protein sequence having at least 95% sequence identity with SEQ ID NO: 27.
[0540] Preferably, the isolated polypeptide has a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO: 45.
[0541] More preferably, the isolated polypeptide is a protein sequence having 100% sequence identity with SEQ ID NO: 27.
[0542] Preferably, the recombinant cell is a bacterium, fungus, yeast, plant, or mammalian cell.
[0543] Preferably, the recombinant cell is Trichoderma, Aspergillus, Bacillus or Myceliophthora.
[0544] More preferably, the recombinant cell is Trichoderma reesei.
[0545] In other preferred embodiments, the recombinant cell is Aspergillus niger or Aspergillus oryzae.
[0546] In still other preferred embodiments, the recombinant cell is Bacillus subtilis, Myceliophthora thermophila or Bacillus licheniformis.
[0547] Preferably, the BASI polypeptide is a protein having at least 80, 90, 95, 99 or 100% sequence identity to the amino acid sequence of SEQ ID NO: 58.
[0548] Assays and Methods Enzyme Characterization Assays - Activity Assays and Assays for Determining Phospholipase Positional Specificity PC-P Assay: Phospholipase activity (PC-U) can be determined using the following assay. Substrate: 1.71% L-α-phosphatidylcholine Soy (95%) (Avanti 441601G, Avanti Polare Lipids, USA), 6.25% TRITON™-X100 (Sigma X-100) and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer pH 7.
[0549] Assay Procedure: The sample, calibration sample, and control sample were diluted with 10 mM HEPES pH 7.0 containing 0.1% TRITON™ X-100. Analysis was performed using a 96-well microtiter plate and a ThermoMixcer C (Eppendorf, Germany). The assay was run at 30 °C. After thermoregulating 200 μL of the substrate at 30 °C for 180 seconds, 50 μL of the enzyme sample was added. Enzymation continued for 600 seconds. The amount of free fatty acid released during enzymation was measured using a NEFA kit obtained from Wako Chemicals GmbH, Germany.
[0550] This assay kit consists of two reagents. NEFA-HR(1): 50 mM phosphate buffer pH 7.0, containing 0.53 U / mL acyl-CoA synthetase (ACS) 0.31 mM coenzyme A (CoA) 4.3 mM adenosine 5-diphosphate disodium salt (ATP) 1.5 mM 4-amino-antipyrine (4-AA) 2.6 U / mL ascorbate oxidase (AOD) 0.062% sodium azide NEFA-HR(2): 2.4 mM 3-methyl-N-ethyl-N-(E-hydroxyethyl)-aniline (MEHA) 12 U / mL acyl-CoA oxidase (ACOD) 14 U / mL peroxidase (POD)
[0551] After incubation, 10 μL of the enzyme mixture was transferred to a new microtiter plate containing 150 μL of NEFA-HR(1) and incubated at 30 °C for 240 seconds. Then, 75 μL of NEFA-HR(2) was added and the mixture was incubated at 30 °C for 240 seconds. Next, OD540 nm was measured.
[0552] The enzyme activity (μmol FFA / (min x mL)) was calculated based on the calibration curve prepared from oleic acid. The enzyme activity PC-U was calculated as the micromoles of fatty acid produced per milliliter volume of the enzyme sample per minute under the assay conditions. Enzyme activity (μmol / (min × mL)) =
Number
[0553] LC-MC: The sample was analyzed as intact protein by CapLC-MS. The only sample preparation was a 10-fold dilution in 6 M guanidinium hydrochloride, 50 mM ammonium bicarbonate pH 7.0. The masses corresponding to the major components were deconvoluted (the mass of the protein molecule calculated using the complete envelope of the protein was detected in several charge states. The Xtract function of the Thermo Xcalibur Qual Browser was used for deconvolution) and extracted from the MS spectrum and used to calculate the relative ratios between the major components.
[0554] CapLC-ESI-MS apparatus: · Agilent CapLC system: · Solvent A: H2O 99.9% / formic acid 1% · Solvent B: ACN 99.9% / formic acid 1% · Column: 10 cm, ID 75 μm ~ 3 μm C18-A2 · MS instrument: LTQ Orbitrap, high-resolution mass spectrometer (Thermo Finnigan)
[0555]
Table 2
[0556]
Table 3
[0557] LPC-P assay: The lysophospholipase activity (LPC-U) can be determined using the following assay. Substrate: 1.18% 1-oleoyl-2-hydroxy-sn-glycero-3-phosphocholine (Avanti 845875P, Avanti Polar lipid, USA), 6.25% TRITON™-X100 (Sigma X-100), and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer pH 7.
[0558] Assay procedure: Samples, calibration samples, and control samples were diluted with 10 mM HEPES pH 7.0 containing 0.1% TRITON™ X-100. Analyses were performed using a 96-well microtiter plate and a ThermoMixcer C (Eppendorf, Germany). The assay was run at 30 °C. After thermoregulating 200 μL of substrate at 30 °C for 180 seconds, 50 μL of the enzyme sample was added. Enzymatization continued for 600 seconds. The amount of free fatty acid released during enzymatization was measured using a NEFA kit obtained from Wako Chemicals GmbH, Germany.
[0559] This assay kit consists of two reagents. NEFA-HR(1): 50 mM phosphate buffer pH 7.0, containing the following 0.53 U / mL acyl-CoA synthetase (ACS) 0.31 mM coenzyme A (CoA) 4.3 mM adenosine 5-disodium triphosphate salt (ATP) 1.5 mM 4-amino-antipyrine (4-AA) 2.6 U / mL ascorbic acid oxidase (AOD) 0.062% sodium azide NEFA-HR(2): 2.4 mM 3-methyl-N-ethyl-N-(E-hydroxyethyl)-aniline (MEHA) 12 U / mL acyl-CoA oxidase (ACOD) 14 U / mL peroxidase (POD)
[0560] After incubation, 10 μL of the enzyme mixture was transferred to a new microtiter plate containing 150 μL of NEFA-HR(1) and incubated at 30 °C for 240 seconds. Then, 75 μL of NEFA-HR(2) was added and the mixture was incubated at 30 °C for 240 seconds. Subsequently, OD540nm was measured.
[0561] Enzyme activity (μmol FFA / (min x mL)) was calculated based on a calibration curve prepared from oleic acid. Enzyme activity LPC-U was calculated as the micromoles of fatty acid produced per milliliter volume of enzyme sample per minute under the assay conditions. Enzyme activity (μmol / (min × mL)) =
Number
[0562] NAPE-P assay: NAPE phospholipase activity (NAPE-U) can be determined using the following assay. Substrate: 2.25% palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine-N-linoleoyl (16:0~18:2PE-N18:2) (Avanti 792003, Avanti Polar lipid, USA), 6.25% TRITON™-X100 (Sigma X-100), and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer pH 7.
[0563] Assay procedure: Samples, calibration samples, and control samples were diluted with 10 mM HEPES pH 7.0 containing 0.1% TRITON™ X-100. Analyses were performed using a 96-well microtiter plate and a ThermoMixcer C (Eppendorf, Germany). The assay was carried out at 30 °C. After thermoregulating 200 μL of the substrate at 30 °C for 180 seconds, 50 μL of the enzyme sample was added. Enzymatic reaction continued for 600 seconds. The amount of free fatty acid released during the enzymatic reaction was measured using a NEFA kit obtained from Wako Chemicals GmbH, Germany.
[0564] This assay kit consists of two reagents. NEFA-HR(1): 50 mM phosphate buffer pH 7.0, containing the following 0.53 U / mL acyl-CoA synthetase (ACS) 0.31 mM coenzyme A (CoA) 4.3 mM adenosine 5-diphosphate disodium salt (ATP) 1.5 mM 4-amino-antipyrine (4-AA) 2.6 U / mL ascorbic acid oxidase (AOD) 0.062% sodium azide NEFA-HR(2): 2.4 mM 3-methyl-N-ethyl-N-(E-hydroxyethyl)-aniline (MEHA) 12 U / mL acyl-CoA oxidase (ACOD) 14 U / mL peroxidase (POD)
[0565] After incubation, 10 μL of the enzyme mixture was transferred to a new microtiter plate containing 150 μL of NEFA-HR(1) and incubated at 30 °C for 240 seconds. Then, 75 μL of NEFA-HR(2) was added and the mixture was incubated at 30 °C for 240 seconds. Subsequently, OD540nm was measured.
[0566] The enzyme activity (μmol FFA / minxmL) was calculated based on the calibration curve prepared from oleic acid. The enzyme activity NAPE-UpH7 was calculated as the micromoles of fatty acid produced per minute under the assay conditions.
[0567] The enzyme activity (μmol FFA / (minxmL)) was calculated based on the calibration curve prepared from oleic acid. The enzyme activity NAPE-U was calculated as the micromoles of fatty acid produced per minute per milliliter volume of the enzyme sample under the assay conditions. Enzyme activity (μmol / (min × mL)) =
Number
[0568] NALPE-P assay: The NALPE phospholipase activity (NALPE-U) can be determined using the following assay. Substrate: 1.68% 1-palmitoyl-sn-glycero-3-phosphoethanolamine-N-linoleoyl (16:0-NALPE-N18:2), (Avanti 791759, Avanti Polar Lipids, USA), 6.25% TRITON™-X100 (Sigma X-100), and 5 mM CaCl2 were dissolved in 0.05 M HEPES buffer pH 7.
[0569] Assay procedure: Samples, calibration samples, and control samples were diluted with 10 mM HEPES pH 7.0 containing 0.1% TRITON™ X-100. Analyses were performed using a 96-well microtiter plate and a ThermoMixcer C (Eppendorf, Germany). The assay was run at 30 °C. After thermoregulating 200 μL of substrate at 30 °C for 180 seconds, 50 μL of enzyme sample was added. Enzymation continued for 600 seconds. The amount of free fatty acid released during enzymation was measured using a NEFA kit obtained from Wako Chemicals GmbH, Germany.
[0570] This assay kit is composed of two reagents. NEFA-HR(1): 50 mM phosphate buffer pH 7.0, containing the following 0.53 U / mL acyl-CoA synthetase (ACS) 0.31 mM coenzyme A (CoA) 4.3 mM adenosine 5-triphosphate disodium salt (ATP) 1.5 mM 4-amino-antipyrine (4-AA) 2.6 U / mL ascorbate oxidase (AOD) 0.062% sodium azide NEFA-HR(2): 2.4 mM 3-methyl-N-ethyl-N-(E-hydroxyethyl)-aniline (MEHA) 12 U / mL acyl-CoA oxidase (ACOD) 14 U / mL peroxidase (POD)
[0571] After incubation, 10 μl of the enzyme mixture was transferred to a new microtiter plate containing 150 μL of NEFA-HR(1) and incubated at 30 °C for 240 seconds. Then, 75 μL of NEFA-HR(2) was added and the mixture was incubated at 30 °C for 240 seconds. Next, OD540nm was measured.
[0572] The enzyme activity (μmol FFA / (min x mL)) was calculated based on a calibration curve prepared from oleic acid. The enzyme activity NALPE-U was calculated as the micromoles of fatty acid produced per milliliter volume of the enzyme sample per minute under the assay conditions. Enzyme activity (μmol / (min × mL)) =
Number
[0573] Assay for determining phospholipase activity and positional specificity of sn1 and sn2 to PC (phosphatidylcholine) Substrate: 0.6% 16:0~18:1 PC, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (Avanti 850457, Avanti Polar Lipids, USA), 0.4% TRITON (trademark)-X100 (Sigma, X-100), and 5 mM of CaCl2 were dissolved in 0.05 M HEPES buffer pH 7.
[0574] Assay procedure: 2 mL of the substrate was incubated at 30 °C and 0.1 ml of the enzyme dilution corresponding to 2~10% of the substrate consumed after a 10-minute reaction in 0.05 M HEPES buffer was added (magnetic stirring).
[0575] The reaction was stopped by adding 40 μL of 4 M HCl to protonate the free fatty acids. 1 mL of 99% ethanol was added and mixed with a vortex mixer. 5 mL of MTBE (methyl tert-butyl ether) containing 0.5 mg of C17:0 fatty acid (margaric acid) was added. The sample was mixed again with a vortex mixer for 5 seconds and extracted at 25 rpm for 30 minutes using a rotamixer (Stuart Rotartor SB2). The sample was centrifuged at 1520 g for 10 minutes.
[0576] One 500 mg amine (NH2)-Bond Elut SPE column (Agilent) was placed on a Bond Elut vacuum system. The column was conditioned with 8 mL of petroleum ether. The MTBE phase from the extraction was applied to the column and eluted as follows. 1. Fraction 8 mL of Solvent A: MTBE: 2-propanol (2:1) 2. Fraction 8 mL of Solvent B: Acetone: Formic acid (100:2)
[0577] The solvents were extracted at approximately 0.25 mL / min.
[0578] The recovered fatty acid fraction (fraction 2) was evaporated to dryness and the fatty acids were analyzed by GLC. Based on the internal standard fatty acid C17:0, the amounts of C16:0 and C18:1 fatty acids were determined.
[0579] The enzyme activity was calculated as μmol of fatty acid produced per minute under assay conditions. Enzyme activity =
Number
[0580] The relative PLA1 enzyme activity was calculated as follows: Relative PLA1 activity =
Number
[0581] The relative PLA2 enzyme activity was calculated as follows: Relative PLA2 activity =
Number
[0582] The sn1 / sn2 specificity ratio is expressed as follows. Sn1 / sn2 specificity ratio = Relative PLA1 activity / Relative PLA2 activity
[0583] Assay for determination of phospholipase activity against NAPE (N-acyl phosphatidylethanolamine) and positional specificity of sn1 and sn2 Substrate: 0.79% 16:0~18:2 (PE-N18:2) NAPE palmitoyl-2-linoleoyl-sn-glycero-3- Phosphoethanolamine-N-linoleoyl (Avanti 792003, Avanti Polar lipid, USA), 0.4% TRITON (trademark)-X100 (Sigma, X-100) and 5 mM of CaCl2 were dissolved in 0.05 M HEPES buffer pH 7.
[0584] Assay procedure: 2 mL of the substrate was incubated at 30 °C, and 0.1 mL of the enzyme dilution corresponding to 2 - 10% of the substrate consumed after a 10-minute reaction (magnetic stirring) in 0.05 M HEPES buffer was added.
[0585] 40 μL of 4 M HCl was added to stop the reaction and protonate the free fatty acids. 1 mL of 99% ethanol was added and mixed with a vortex mixer. 5 mL of MTBE (methyl tert-butyl ether) containing 0.5 mg of C17:0 fatty acid (margaric acid) was added. The sample was mixed again with a vortex mixer for 5 seconds and extracted at 25 rpm for 30 minutes (Stuart Rotartor SB2) using a rotary mixer. The sample was centrifuged at 1520 g for 10 minutes.
[0586] A 500 mg amine (NH2)-Bond Elut SPE column (Agilent) was placed on a Bond Elut vacuum system. The column was conditioned with 8 mL of petroleum ether. The MTBE phase from the extraction was applied to the column and eluted as follows. 1. Fraction 8 mL of Solvent A: MTBE: 2-propanol (2:1) 2. Fraction 8 mL of Solvent B: Acetone: Formic acid (100:2)
[0587] The solvents were extracted at approximately 0.25 mL / min.
[0588] The recovered fatty acid fraction (fraction 2) was evaporated to dryness and the fatty acids were analyzed by GLC. Based on the internal standard fatty acid C17:0, the amounts of C16:0 and C18:2 fatty acids were determined.
[0589] Enzyme activity was calculated as μmol of fatty acid produced per minute under assay conditions. Enzyme activity =
Number
[0590] The relative PLA1 enzyme activity was calculated as follows: Relative PLA1 activity =
Number
[0591] The relative PLA2 enzyme activity was calculated as follows: Relative PLA2 activity =
Number
[0592] The sn1 / sn2 specificity ratio is expressed as follows. Sn1 / sn2 specificity ratio = Relative PLA1 activity / Relative PLA2 activity
[0593] Gas chromatograph (GLC): Free fatty acids were analyzed by GLC as trimethylsilyl derivatives (TMS). Equipment: · Perkin Elmer Clarus600 capillary gas chromatograph equipped with a WCOT fused silica column 12.5 m x 0.25 mm x ID x 0.1 μm film thickness 5% phenyl-methyl-silicone (CP Sil8 CB manufactured by Chrompack). · Carrier gas: Helium · Injector: PSSI cryogenic split injection (initial temperature 90 °C heated to 395 °C), volume 1.0 μl · Detector FID: 395 °C
[0594]
Table 4
[0595] Sample preparation: Dissolve the evaporated sample in 1.5 ml of heptane:pyridine, 2:1. Transfer 500 μL of the sample solution to a crimp vial, add 100 μL of MSTFA (N-methyl-N-trimethylsilyl-trifluoroacetamide), and react at 60 °C for 15 minutes.
[0596] Firing applications
[0597]
Table 5
[0598] Kneading on a Diosna spiral mixer. Water absorption of flour by analysis: 400 BU - 2%
[0599] Procedure Mix all ingredients in the bowl for 1 minute at a slow speed - add water and knead slowly for 2 minutes and then at high speed for 6.5 minutes. The dough temperature should be approximately 26 °C. Weigh 1350 g of the dough and shape it into a ball by hand. Let the dough stand in a heating cabinet at 30 °C for 10 minutes.
[0600] The dough is shaped into 30 dough balls on a "GLIMIK (trademark) rounder" set according to the machine's table.
[0601] Ferment the dough at 34 °C and 85% relative humidity for 45 minutes and bake it with 200 °C / 2 L of steam for 13 minutes + open the damper for 5 minutes (MIWE oven program 1). After baking, cool the roll pan at ambient temperature for 25 minutes and then weigh and measure the volume.
[0602] The characteristics of the dough and the bread are evaluated by those skilled in the art
[0603]
Table 6
[0604] Kneading with a Hobart mixer. Procedure Sponge: Mix all ingredients in a bowl at a first speed for 1 minute - at a second speed for 3 minutes. The sponge temperature must be about 25.5 °C. Ferment the sponge at 30 °C, 85% RH for 3 hours in an uncovered bowl. Dough: Mix all remaining ingredients except the sponge and salt at low speed for 2 minutes, then at medium speed for 3 minutes (using ice water). Add the salt and mix at medium speed for 3 minutes. Weigh 450 g of dough pieces and the mold (underscale - normal scale 550 g of dough). Let the dough rest at ambient temperature for 10 minutes. Mold on Benier MS500 with the following settings: Preform - 16 Drum press 3 Press board front 4.0 (3.5 for impact) Press board back 3.5 (3.1 for impact) Front width 330, back width 290
[0605] Put the bread dough into a greased tin and proof at 43 °C, 95% RH for 70 minutes (long proof - normal proof 60 minutes). Drop the dough including the tin from a height of 6.5 cm onto the table twice to give an impact to half of the bread. Bake at 200 °C for 26 minutes (MIWE oven program 4).
[0606] Take the bread out of the tin, cool for 70 minutes, then weigh and measure the volume. The characteristics of the dough and the bread are evaluated by those skilled in the art.
[0607]
Table 7
[0608]
Table 8
[0609] Extraction of dough lipids. Samples of well-fermented dough were frozen and freeze-dried. The dried dough was pulverized and sieved. 1.5 g of the pulverized and sieved sample was mixed with 1.5 g of a carrier (diatomaceous earth, Thermo Scientific, P / N: 60-033854) and transferred to a 10 ml ASE sample tube. Using a Dionex ASE 350 (Thermo Scientific), extraction was carried out at 40 °C with water-saturated butanol as the solvent and a static run time of 10 minutes. After extraction, the solvent was evaporated at 60 °C and 1000 rpm using a Scan Speed 40 (Scanvac, Labogene APS). The dried lipid was dissolved in 3.75 ml of heptane:isopropanol (3:2).
[0610] HPLC analysis of phospholipids extracted from the dough: The dough lipid sample was analyzed by liquid chromatography using an electrified aerosol detector. The column was a normal-phase column (DIOL), and the mobile phase was a gradient of A: acetone / methanol 96 / 4 with 1 mM ammonium formate added and B: acetone / methanol / H2O 60 / 34 / 6 with 1 mM ammonium formate added.
[0611] NALPE was used as a standard for quantification.
[0612] Equipment: Dionex Ultimate 3000 UHPLC, Thermo Scientific VANQOISH detector, Thermo Scientific Column: Fortis Hilic Diol, 1.7 μm, 50 x 2.1 mm
[0613]
Table 9
[0614] The column temperature was 30 °C and the injection volume was 4 μL.
[0615] Sample preparation: Lipids were extracted from the dough as described in "Lipid Extraction from Dough", filtered through a 0.45 μM filter, and then injected.
[0616] Calculation: Chromatograms were integrated using Cromeleon software, and the molar concentrations of NAPE, NALPE, and NAGPE were calculated based on the NALPE standard curve.
[0617] Presentation of results: The respective lipid levels of NAPE, NALPE, and NAGPE were obtained by first normalizing the respective molar levels of each component across all doughs to the "average total molar lipid (NAPE + NALPE + NAGPE)". Subsequently, each lipid level is shown relative to the NAPE level in the negative control (no enzyme added). Thus, NAPE starts at 1 (negative control). NALPE and NAGPE are presented as the levels generated relative to the NAPE starting level.
[0618] RVA analysis Samples were prepared using Brabender Farinograph AACC Method No. 54-2 and Reform wheat flour for RVA analysis. In the control sample, the water content was adjusted to 400 BU. For all samples containing enzymes, the same water content as the control sample was used. Dough samples were made and frozen in liquid nitrogen. For RVA analysis, the dough was thawed and homogenized in distilled water using Ultra-Turex T25 Basic, IKA Labortechnik. RVA analysis was performed using a Rapid Visco analyzer RVA-2 Stand Alone manufactured by Newport Scientific (Appleton, Warrington, UK), Calibre control International ltd. The RVA analysis profile was run over 28 minutes from 40 °C to 95 °C. Data were analyzed using the Thermocline software program.
[0619]
Table 10
[0620] Mix with a Tweedy K5 mixer. Water absorption of flour by analysis: 400 BU - 4%
[0621] Procedure Add all dry ingredients to the mixer, then add water and start mixing (mixing energy at 400 rpm, -0.6 bar is 11.5 watts / kg). The dough temperature must be about 29°C. Leave the dough under a cloth at ambient temperature for 5 minutes. Weigh out 700 g of dough pieces and shape them into balls by hand. Let the dough rest for 5 minutes at ambient temperature under a cloth. Next, shape the dough onto a Benier MS500 with the following settings. Preform: -18 Drum press: 3, Press board: 4.5 cm in front, 4.0 cm at the back, 370 mm in front, 340 mm at the back. Add the shaped dough to a 10 x 10 x 30 cm tin and ferment at 40°C, 70% RH for 70 minutes. Drop the dough with the tin from a height of 6.5 cm onto the table twice to give an impact to half of the bread. Bake at 205°C for 30 minutes. Cool the bread at ambient temperature for 70 minutes before measuring the weight and volume. The characteristics of the dough and the bread are evaluated by those skilled in the art.
[0622] Chemical structure In the following structure, R1, R2 and R3 are C12 - C24 hydrocarbons. The C12 - 24 hydrocarbons are either saturated or unsaturated. R1, R2 and R3 may be the same or different hydrocarbons. PC
Chemical formula
Chemical formula
Chemical formula
Chemical formula
[0623] Note that the embodiments described below are presented by way of example only and should not be construed as limiting the concept of the present invention to any particular enzyme.
Example
[0624] Example 1 - CRC08310 - ThaPla1 Cloning of Phospholipase ThaPla1 (CRC08310) from Trichoderma harzianum A putative phospholipase gene designated CRC08310 was identified in Trichoderma harzianum and determined from a BLAST search (Altschul et al., J Mol Biol, 215:403 - 410, 1990) to encode a protein having 100% identity with a sequence available from the NCBI database (NCBI accession number: KKO98756.1). The codon - optimized synthetic nucleic acid sequence of full - length CRC08310 is provided in SEQ ID NO: 19. The corresponding protein encoded by the full - length CRC08310 gene is shown in SEQ ID NO: 1. At the N - terminus, this protein has a signal peptide 16 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods 8:785 - 786). The presence of the signal sequence suggests that CRC08310 is a secreted enzyme. The pro - protein sequence of CRC08310 is shown in SEQ ID NO: 2.
[0625] Example 2 - Expression of CRC08310 A codon-optimized synthetic DNA sequence encoding the full-length CRC08310 protein (SEQ ID NO: 19) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTpyr2 vector described in the published PCT application WO 2015 / 017256 pamphlet, which is incorporated herein by reference), to obtain plasmid pGXT-CRC08310. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced by the Trichoderma reesei pry2 gene. The Aspergillus nidulans amdS and pry2 selectable markers allow the growth of transformants on acetamide as the sole nitrogen source, and the Trichoderma reesei telomere region enables the maintenance of episomal plasmids in fungal cells. pGXT-CRC08310 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator region, allowing for strong inducible expression of the gene of interest.
[0626] The pGXT-CRC08310 plasmid was then transformed into a suitable Trichoderma reesei strain using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99) (the method described in the published PCT patent application WO 05 / 001036 pamphlet). Transformants were selected on solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron(II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt(II) chloride 1 mg / L; manganese(II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformant colonies appeared in about one week. After growth on acetamide plates, the transformants were picked and transferred individually to acetamide agar plates. After growing on acetamide plates for 5 days, transformants showing a stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in a 96-well microtiter plate. The microtiter plate was incubated at 28 °C for 5 days in an oxygen growth chamber. The supernatant from these cultures was used to confirm protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250 mL shake flask containing glucose / sophorose defined medium.
[0627] Example 3 - CRC08316 - PfiPla1 Cloning of Phospholipase PfiPla1 (CRC08316) from Pestalotiopsis fici W106 - 1 The putative phospholipase gene named CRC08316 was identified in Pestalotiopsis fici W106-1 and encodes a protein with 100% identity to a sequence available from the NCBI database (NCBI accession number: ETS81250.1) as determined by BLAST search (Altschul et al., JMolBiol, 215:403-410, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08316 is provided in SEQ ID NO: 20. The corresponding protein encoded by the full-length CRC08316 gene is shown in SEQ ID NO: 3. At the N-terminus, this protein has a signal peptide 18 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods 8:785-786). The presence of the signal sequence suggests that CRC08316 is a secreted enzyme. The proprotein sequence of CRC08316 is shown in SEQ ID NO: 4.
[0628] Example 4 - Expression of CRC08316 A codon-optimized synthetic DNA sequence encoding the full-length CRC08316 protein (SEQ ID NO: 20) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTpyr2 vector described in the published PCT application WO 2015 / 017256 pamphlet, which is incorporated herein by reference) to obtain plasmid pGXT-CRC08316. In the pGXT vector, the Aspergillus nidulans pyrG gene has been replaced with the Trichoderma reesei pry2 gene. The Aspergillus nidulans amdS and pry2 selectable markers allow the growth of transformants on acetamide as the sole nitrogen source, and the Trichoderma reesei telomere region enables the maintenance of non-chromosomal plasmids in fungal cells. pGXT-CRC08316 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing for strong inducible expression of the gene of interest.
[0629] The pGXT-CRC08316 plasmid was then transformed into a suitable Trichoderma reesei strain using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99) (the method described in the published PCT patent application WO 05 / 001036 pamphlet). Transformants were selected on solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron(II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt(II) chloride 1 mg / L; manganese(II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared in about one week. After growth on the acetamide plates, the transformants were picked and transferred individually to acetamide agar plates. After growing on the acetamide plates for 5 days, transformants showing a stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in a 96-well microtiter plate. The microtiter plate was incubated at 28 °C for 5 days in an oxygen growth chamber. The supernatant from these cultures was used to confirm protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250 mL shake flask containing glucose / sophorose defined medium.
[0630] The crude broth was concentrated to approximately 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Subsequently, ammonium sulfate was added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction was applied to a 60 mL Phenyl-FF Sepharose column pre-equilibrated with a loading buffer containing 20 mM sodium acetate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted from the column using a gradient of 20 mM sodium acetate (pH 5.0) and 0.5 - 0.3 M ammonium sulfate. Fractions containing the active target protein were pooled, concentrated, and subsequently loaded onto a HiLoad Q HP Sepharose column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted from the column using a gradient of 20 mM Tris buffer (pH 8.0) and 0 - 0.4 M NaCl. Subsequently, fractions containing the active target protein were pooled, concentrated via a 10K Amicon Ultra device, and stored at -20 °C in 20 mM Tris buffer (pH 8.0) and 40% glycerol until use.
[0631] Example 5 - CRC08319 - MguPla1 Cloning of Phospholipase MguPla1 (CRC08319) from Metarhizium guizhouense ARSEF977 A putative phospholipase gene called CRC08319 was identified in Metarhizium guizhouense ARSEF977 and encodes a protein with 100% identity to the sequence available from the NCBI database (NCBI accession number: KID92477.1) when determined from a BLAST search (Altschul et al., J Mol Biol, 215:403-410, 1990). A codon-optimized synthetic nucleic acid sequence of full-length CRC08319 is provided in SEQ ID NO: 21. The corresponding protein encoded by the full-length CRC08319 gene is shown in SEQ ID NO: 5. At the N-terminus, this protein has a signal peptide 16 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods 8:785-786). The presence of the signal sequence suggests that CRC08319 is a secreted enzyme. The proprotein sequence of CRC08319 is shown in SEQ ID NO: 6.
[0632] Example 6 - Expression of CRC08319 A codon-optimized synthetic DNA sequence encoding the full-length CRC08319 protein (SEQ ID NO: 21) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTpyr2 vector described in the published PCT application WO 2015 / 017256 pamphlet, which is incorporated herein by reference) to obtain plasmid pGXT-CRC08319. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced with the Trichoderma reesei pry2 gene. The Aspergillus nidulans amdS and pry2 selection markers allow the growth of transformants on acetamide as the sole nitrogen source, and the Trichoderma reesei telomere region enables the maintenance of non-chromosomal plasmids in fungal cells. pGXT-CRC08319 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing for strong inducible expression of the gene of interest.
[0633] The pGXT-CRC08319 plasmid was then transformed into a suitable Trichoderma reesei strain using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99) (the method described in the published PCT patent application WO 05 / 001036 pamphlet). Transformants were selected on solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron(II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt(II) chloride 1 mg / L; manganese(II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on acetamide plates, the transformants were picked and transferred individually to acetamide agar plates. After growing on acetamide plates for 5 days, transformants showing a stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in a 96-well microtiter plate. The microtiter plate was incubated at 28 °C for 5 days in an oxygen growth chamber. The supernatant from these cultures was used to confirm protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250 mL shake flask containing glucose / sophorose defined medium.
[0634] The crude broth was concentrated to approximately 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction was applied to a 60 mL Phenyl-FF Sepharose column pre-equilibrated with a loading buffer containing 20 mM sodium phosphate (pH 7.0) and 1 M ammonium sulfate. The target protein was eluted from the column using 20 mM sodium phosphate (pH 7.0) and 0.25 M ammonium sulfate. Fractions containing the active target protein were pooled and concentrated, and then loaded onto a Superdex 75 gel filtration column pre-equilibrated with 20 mM sodium phosphate buffer (pH 7.0) supplemented with an additional 0.15 M NaCl and 10% glycerol. Next, fractions containing the active target protein were pooled, concentrated via a 10K Amicon Ultra device, and stored at -20 °C in 20 mM sodium phosphate buffer (pH 7.0) supplemented with 0.15 M NaCl and 40% glycerol until use.
[0635] Example 7 - CRC08405 - DamPla1 Cloning of Diaporthe ampelina Phospholipase DamPla1 (CRC08405) A putative phospholipase gene named CRC08405 was identified in Diaporthe ampelina and encodes a protein with 100% identity to the sequence available from the NCBI database (NCBI accession number: KKY36548.1) when determined from a BLAST search (Altschul et al., J Mol Biol, 215:403 - 410, 1990). Codon-optimized synthetic nucleic acid The sequence of full-length CRC08405 is provided as SEQ ID NO: 22. The corresponding protein encoded by the full-length CRC08405 gene is shown in SEQ ID NO: 7. At the N-terminus, this protein has a signal peptide 18 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods 8:785-786). The presence of the signal sequence suggests that CRC08405 is a secreted enzyme. The proprotein sequence of CRC08405 is shown in SEQ ID NO: 8.
[0636] Example 8 - Expression of CRC08405 A codon-optimized synthetic DNA sequence encoding the full-length CRC08405 protein (SEQ ID NO: 22) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTpyr2 vector described in the published PCT application WO 2015 / 017256 pamphlet, which is incorporated herein by reference), to obtain plasmid pGXT-CRC08405. In the pGXT vector, the Aspergillus nidulans pyrG gene has been replaced by the Trichoderma reesei pry2 gene. The Aspergillus nidulans amdS and pry2 selectable markers allow the growth of transformants on acetamide as the sole nitrogen source, and the Trichoderma reesei telomere region enables the maintenance of the episomal plasmid in fungal cells. pGXT-CRC08405 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator region, allowing for strong inducible expression of the gene of interest.
[0637] The pGXT-CRC08405 plasmid was then transformed into a suitable Trichoderma reesei strain using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99) (the method described in the published PCT patent application WO 05 / 001036 pamphlet). Transformants were selected on solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron(II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt(II) chloride 1 mg / L; manganese(II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformant colonies appeared in about 1 week. After growth on the acetamide plates, the transformants were picked and transferred individually to acetamide agar plates. After growing on the acetamide plates for 5 days, the transformants showing a stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in 96-well microtiter plates. The microtiter plates were incubated at 28 °C for 5 days in an oxygen growth chamber. The supernatant from these cultures was used to confirm protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in 250 mL shake flasks containing glucose / sophorose defined medium.
[0638] The crude broth was concentrated to approximately 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction was applied to a 60 mL Phenyl-FF Sepharose column pre-equilibrated with a loading buffer containing 20 mM sodium phosphate (pH 7.0) and 1 M ammonium sulfate. The target protein was eluted from the column with 20 mM sodium phosphate (pH 7.0). Fractions containing the active target protein were pooled, concentrated, and subsequently loaded onto a HiPrep Q-XL Sepharose column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted with a gradient of 20 mM Tris buffer (pH 8.0) and 0 - 0.5 M NaCl. Next, fractions containing the active target protein were pooled, concentrated via a 10K Amicon Ultra device, and stored at -20 °C in 20 mM Tris buffer (pH 8.0) supplemented with 0.15 M NaCl and 40% glycerol until use.
[0639] Example 9 - CRC08418 - MorPla3 Cloning of Magnaporthe oryzae Y34 Phospholipase MorPla3 (CRC08418) The putative phospholipase gene named CRC08418 was identified in Magnaporthe oryzae Y34 and encodes a protein with 100% identity to the sequence available from the NCBI database (NCBI accession number: ELQ41978.1) as determined by BLAST search (Altschul et al., JMolBiol, 215:403-410, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08418 is provided in SEQ ID NO: 23. The corresponding protein encoded by the full-length CRC08418 gene is shown in SEQ ID NO: 9. At the N-terminus, this protein has a signal peptide 25 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods 8:785-786). The presence of the signal sequence suggests that CRC08418 is a secreted enzyme. The proprotein sequence of CRC08418 is shown in SEQ ID NO: 10.
[0640] Example 10 - Expression of CRC08418 A codon-optimized synthetic DNA sequence encoding the full-length CRC08418 protein (SEQ ID NO: 23) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTpyr2 vector described in the published PCT application WO 2015 / 017256 pamphlet, which is incorporated herein by reference) to obtain plasmid pGXT-CRC0418. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced by the Trichoderma reesei pry2 gene. The Aspergillus nidulans amdS and pry2 selection markers allow the growth of transformants on acetamide as the sole nitrogen source, and the Trichoderma reesei telomere region enables the maintenance of non-chromosomal plasmids in fungal cells. pGXT-CRC08418 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator region, allowing for strong inducible expression of the gene of interest.
[0641] The pGXT-CRC08418 plasmid was then transformed into a suitable Trichoderma reesei strain using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99) (the method described in WO 05 / 001036 pamphlet, a published PCT patent application). Transformants were selected on solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron(II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt(II) chloride 1 mg / L; manganese(II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on the acetamide plates, the transformants were picked and transferred individually to acetamide agar plates. After growing on the acetamide plates for 5 days, transformants showing a stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in 96-well microtiter plates. The microtiter plates were incubated at 28 °C for 5 days in an oxygen growth chamber. The supernatant from these cultures was used to confirm protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250 mL shake flask containing glucose / sophorose defined medium.
[0642] The crude broth was concentrated to approximately 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 0.8 M. After filtration, the resulting soluble fraction was applied to a 60 mL Phenyl-FF Sepharose column pre-equilibrated with a loading buffer containing 20 mM sodium phosphate (pH 7.0) and 1 M ammonium sulfate. The target protein was eluted from the column with 20 mM sodium phosphate (pH 7.0). The fractions containing the active target protein were pooled, concentrated, and subsequently loaded onto a Superdex 75 gel filtration column pre-equilibrated with 20 mM sodium phosphate buffer (pH 7.0) containing 0.15 M NaCl (pH 7.0). The fractions containing the active target protein were then pooled, concentrated via a 10K Amicon Ultra device, and stored at -20 °C in 20 mM sodium phosphate buffer (pH 7.0) containing 0.15 M NaCl (pH 7.0) and 40% glycerol until use.
[0643] Example 11 - CRC08826 - NdiPla1 Cloning of Phospholipase NdiPa1 (CRC08826) from Neonectria ditissima The putative phospholipase gene named CRC08826 was identified in Neonectria ditissima and encodes a protein that has 100% identity with the sequence available from the NCBI database (NCBI accession number: KPM45012.1) when determined by BLAST search (Altschul et al., JMolBiol, 215:403-410, 1990). The codon-optimized synthetic nucleic acid sequence of full-length CRC08826 is provided in SEQ ID NO: 24. The corresponding protein encoded by the full-length CRC08826 gene is shown in SEQ ID NO: 11. At the N-terminus, this protein has a signal peptide 16 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods 8:785-786). The presence of the signal sequence suggests that CRC08826 is a secreted enzyme. The proprotein sequence of CRC08826 is shown in SEQ ID NO: 12.
[0644] Example 12 - Expression of CRC08826 A codon-optimized synthetic DNA sequence encoding the full-length CRC08826 protein (SEQ ID NO: 24) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTpyr2 vector described in the published PCT application WO 2015 / 017256 pamphlet, which is incorporated herein by reference), to obtain plasmid pGXT-CRC08826. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced by the Trichoderma reesei pry2 gene. The Aspergillus nidulans amdS and pry2 selectable markers allow the growth of transformants on acetamide as the sole nitrogen source, and the Trichoderma reesei telomere region enables the maintenance of non-chromosomal plasmids in fungal cells. pGXT-CRC08826 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and cbh1 terminator region, allowing for strong inducible expression of the gene of interest.
[0645] The pGXT-CRC08826 plasmid was then transformed into a suitable Trichoderma reesei strain using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99) (the method described in the published PCT patent application WO 05 / 001036 pamphlet). Transformants were selected on solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron(II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt(II) chloride 1 mg / L; manganese(II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared in about one week. After growth on the acetamide plates, the transformants were picked and transferred individually to acetamide agar plates. After growing on the acetamide plates for 5 days, the transformants showing a stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in a 96-well microtiter plate. The microtiter plate was incubated at 28 °C for 5 days in an oxygen growth chamber. The supernatant from these cultures was used to confirm protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250 mL shake flask containing glucose / sophorose defined medium.
[0646] The crude broth was concentrated to approximately 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Subsequently, ammonium sulfate was added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction was applied to a HiPrep Phenyl FF 16 / 10 column pre-equilibrated with a loading buffer containing 20 mM sodium phosphate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted from the column using a gradient of 20 mM sodium phosphate (pH 5.0) and 0.5 - 0 M ammonium sulfate. Fractions containing the active target protein were pooled, concentrated, and subsequently loaded onto a HiPrep Q FF 16 / 10 column pre-equilibrated with 20 mM sodium phosphate buffer (pH 7.0). The target protein was eluted with a gradient of 20 mM sodium phosphate buffer (pH 7.0) and 0 - 0.5 M NaCl. Next, fractions containing the active target protein were pooled, concentrated, and then loaded onto a HiLoad 26 / 60 Superdex 75 Prep column pre-equilibrated with 20 mM sodium acetate (pH 5.0) and 150 mM NaCl. Fractions containing the active target protein were pooled, concentrated, loaded onto a HiPrep Phenyl HP 16 / 10 column pre-equilibrated with a loading buffer containing 20 mM sodium phosphate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted with a gradient of 20 mM sodium phosphate (pH 5.0) and 0.75 - 0 M ammonium sulfate. Fractions containing the active target protein were pooled, concentrated via a 10K Amicon Ultra device, and stored at -20 °C in 20 mM sodium phosphate (pH 5.0) and 40% glycerol until use.
[0647] Example 13 - CRC08833 - TgaPla1 Cloning of Trichoderma gamsii Phospholipase TgaPla1 (CRC08833) A putative phospholipase gene named CRC08833 was identified in Trichoderma gamsii and was determined from a BLAST search (Altschul et al., JMolBiol, 215:403-410, 1990) to encode a protein with 100% identity to the sequence available from the NCBI database (NCBI accession number: KUF04745.1). The codon-optimized synthetic nucleic acid sequence of full-length CRC08833 is provided in SEQ ID NO: 25. The corresponding protein encoded by the full-length CRC08833 gene is shown in SEQ ID NO: 13. At the N-terminus, this protein has a signal peptide 16 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods 8:785-786). The presence of the signal sequence suggests that CRC08833 is a secreted enzyme. The proprotein sequence of CRC08826 is shown in SEQ ID NO: 14.
[0648] Example 14 - Expression of CRC08833 A codon-optimized synthetic DNA sequence encoding the full-length CRC08833 protein (SEQ ID NO: 25) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTpyr2 vector described in the published PCT application WO 2015 / 017256 pamphlet, which is incorporated herein by reference) to obtain plasmid pGXT-CRC08833. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced by the Trichoderma reesei pry2 gene. The Aspergillus nidulans amdS and pry2 selection markers allow the growth of transformants on acetamide as the sole nitrogen source, and the Trichoderma reesei telomere region enables the maintenance of non-chromosomal plasmids in fungal cells. pGXT-CRC08833 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing for strong inducible expression of the gene of interest.
[0649] The pGXT-CRC08833 plasmid was then transformed into a suitable Trichoderma reesei strain using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99) (the method described in the published PCT patent application WO 05 / 001036 pamphlet). Transformants were selected on solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron(II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt(II) chloride 1 mg / L; manganese(II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared in about one week. After growth on acetamide plates, the transformants were picked and transferred individually to acetamide agar plates. After growing on acetamide plates for 5 days, transformants showing a stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in a 96-well microtiter plate. The microtiter plate was incubated at 28 °C for 5 days in an oxygen growth chamber. The supernatant from these cultures was used to confirm protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250 mL shake flask containing glucose / sophorose defined medium.
[0650] The crude broth was concentrated to approximately 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Ammonium sulfate was then added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction was applied to a 60 mL Phenyl-FF Sepharose column pre-equilibrated with a loading buffer containing 20 mM sodium phosphate (pH 7.0) and 1 M ammonium sulfate. The target protein was eluted from the column using 20 mM sodium phosphate (pH 7.0) and 0.5 M ammonium sulfate. Fractions containing the active target protein were pooled, concentrated, and subsequently loaded onto a HiLoad Q XL Sepharose column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted with a gradient of 20 mM Tris buffer (pH 8.0) and 0 - 0.5 M NaCl. The fractions containing the active target protein were then pooled, concentrated via a 10K Amicon Ultra device, and stored at -20 °C in 20 mM Tris buffer (pH 8.0) and 40% glycerol until use.
[0651] Example 15 - CRC08845 - ManPla1 Cloning of Phospholipase ManPla1 (CRC08845) from Metarhizium anisopliae BRIP53293 A putative phospholipase gene called CRC08845 was identified in Metarhizium anisopliae BRIP53293 and encodes a protein that has 100% identity with the sequence available from the NCBI database (NCBI accession number: KJK84204.1) when determined from a BLAST search (Altschul et al., J Mol Biol, 215:403-410, 1990). A codon-optimized synthetic nucleic acid sequence of full-length CRC08845 is provided in SEQ ID NO: 26. The corresponding protein encoded by the full-length CRC08845 gene is shown in SEQ ID NO: 15. At the N-terminus, this protein has a signal peptide 17 amino acids in length as predicted by SignalP version 4.0 (Nordahl Petersen et al. (2011) Nature Methods 8:785-786). The presence of the signal sequence suggests that CRC08845 is a secreted enzyme. The proprotein sequence of CRC08845 is shown in SEQ ID NO: 16.
[0652] Example 16 - Expression of CRC08845 A codon-optimized synthetic DNA sequence encoding the full-length CRC08845 protein (SEQ ID NO: 26) was synthesized and inserted into the Trichoderma reesei expression vector pGXT (the same as the pTTpyr2 vector described in the published PCT application WO 2015 / 017256 pamphlet, which is incorporated herein by reference), to obtain plasmid pGXT-CRC08845. In the pGXT vector, the Aspergillus nidulans pyrG gene is replaced by the Trichoderma reesei pry2 gene. The Aspergillus nidulans amdS and pry2 selection markers allow the growth of transformants on acetamide as the sole nitrogen source, and the Trichoderma reesei telomere region enables the maintenance of extrachromosomal plasmids in fungal cells. pGXT-CRC08845 contains the Trichoderma reesei cbh1-derived promoter (cbh1) and the cbh1 terminator region, allowing for strong inducible expression of the gene of interest.
[0653] The pGXT-CRC08845 plasmid was then transformed into a suitable Trichoderma reesei strain using protoplast transformation (Te’o et al. (2002) J. Microbiol. Methods 51:393-99) (the method described in the published PCT patent application WO 05 / 001036 pamphlet). Transformants were selected on solid medium containing acetamide as the sole source of nitrogen (acetamide 0.6 g / L; cesium chloride 1.68 g / L; glucose 20 g / L; potassium dihydrogen phosphate 15 g / L; magnesium sulfate heptahydrate 0.6 g / L; calcium chloride dihydrate 0.6 g / L; iron(II) sulfate 5 mg / L; zinc sulfate 1.4 mg / L; cobalt(II) chloride 1 mg / L; manganese(II) sulfate 1.6 mg / L; agar 20 g / L; pH 4.25). Transformed colonies appeared in about 1 week. After growth on the acetamide plates, the transformants were picked and transferred individually to acetamide agar plates. After growing on the acetamide plates for 5 days, the transformants showing a stable morphology were inoculated into 200 μL of glucose / sophorose defined medium in a 96-well microtiter plate. The microtiter plate was incubated at 28 °C for 5 days in an oxygen growth chamber. The supernatant from these cultures was used to confirm protein expression by SDS-PAGE analysis. The stable strain with the highest protein expression was selected and subjected to fermentation in a 250 mL shake flask containing glucose / sophorose defined medium.
[0654] The crude broth was concentrated to approximately 80 mL using a VivaFlow 200 ultrafiltration device (Sartorius Stedim). Subsequently, ammonium sulfate was added to the concentrated solution to a final concentration of 1 M. After filtration, the resulting soluble fraction was applied to a Butyl FF column pre-equilibrated with a loading buffer containing 20 mM sodium acetate (pH 5.0) and 1 M ammonium sulfate. The target protein was eluted from the column using a gradient of 20 mM sodium acetate (pH 5.0) and 0.3 - 0 M ammonium sulfate. Fractions containing the active target protein were pooled, concentrated, and subsequently loaded onto a QHP column pre-equilibrated with 20 mM sodium phosphate buffer (pH 7.0). The target protein was eluted with a gradient of 20 mM sodium phosphate buffer (pH 7.0) and 0 - 0.5 M NaCl. Next, fractions containing the active target protein were pooled, concentrated, and subsequently loaded onto a QHP column pre-equilibrated with 20 mM Tris buffer (pH 8.0). The target protein was eluted with a gradient of 20 mM Tris buffer (pH 8.0) and 0 - 0.5 M NaCl. Then, fractions containing the active target protein were pooled, concentrated via a 10K Amicon Ultra device, and stored at -20 °C in 20 mM Tris buffer (pH 8.0), 0.15 M NaCl, and 40% glycerol until use.
[0655] Example 17. Characterization of the Phospholipase of the Invention Against Powerbake 4080 and Lipopan F The characterization of the enzymes is done by determining the specific activity using different lipid substrates according to the activity methods presented in "Assays and Methods". Powerbake 4080 is a commercial product of TIFF. Powerbake 4080 acts on polar lipids at the sn1 position. The active enzyme component of Powerbake 4080 is shown as SEQ ID NO: 6 in U.S. Patent No. 8,012,732, which is incorporated herein by reference (also described herein as SEQ ID NO: 17). This enzyme is known to have both galactolipase activity and phospholipase activity. Lipopan F is a commercial product of Novozymes. The active enzyme in Lipopan F acts on polar lipids at the sn1 position and is at SEQ ID NO: 2 in European Patent No. 0869167, which is incorporated herein by reference (also described herein as SEQ ID NO: 18). This enzyme is also known to have galactolipase activity.
[0656] The specific activity is determined using phosphatidylcholine substrate (PC-P assay), lysophosphatidylcholine substrate (LPC-P assay), N-acylphosphatidylethanolamine substrate (NAPE-P assay) and lysophosphatidyl-N-acylethanolamine substrate (NALPE-P assay). The activity is shown against the protein concentration and shows the specific activity of various enzymes using different substrates - see Table 1.
[0657]
Table 11
[0658] As can be seen from Table 1, all enzymes (except Powerbake 4080 and Lipopan F) show very low specific activity against LPC and NALPE substrates. The ratio of LPC to PC and the ratio of NALPE activity to NALPE activity are shown in Table 2.
[0659]
Table 12
[0660] From Table 2, it is clear that the candidate substances tested show significantly lower activity against the lysophospholipid substrate than existing commercially available enzyme products such as Powerbake 4080 and Lipopan F.
[0661] Surprisingly, the candidates evaluated represent a new group of phospholipases, "no lysophospholipase", which is characterized by the absence or very low levels of lysophospholipase activity.
[0662] Currently commercially available products show LPC-U / PC-U or NALPE-U / NAPE-U ratios exceeding 0.014 and 0.13, respectively. In contrast, "non-lysophospholipases" show ratios of less than 0.002 and 0.0016, respectively. Thus, the ratios of "non-lysophospholipases" are 7-fold and 90-fold lower, respectively, than currently commercially available products.
[0663] This feature of "non-lysophospholipase" activity provides an opportunity for a more robust system to generate emulsifying components in a lipid-containing food matrix. "No lysophospholipase" provides a more robust system by eliminating the risk of overdosage, as seen with currently commercially available enzymes. "Non-lysophospholipases" enable the generation of emulsifying components (lysophospholipids such as LPC or NALPE) without the risk of degradation of the generated emulsifying components. Thus, the "rollover effect" observed with currently commercially available enzymes, where lysophospholipid components are not only generated but further hydrolyzed / degraded, is eliminated, providing the potential for overall higher levels of emulsifying components.
[0664] Example 18. Characterization of Phospholipase Positional Specificity. Enzyme positional specificity was characterized by measuring the release of free fatty acids (FFAs) from specifically designed PC and NAPE substrates. Determination of FFAs was performed by GLC analysis as shown under "Gas Chromatography (GLC)" after the assays for phospholipase activity on PC (phosphatidylcholine) and the determination of positional specificity at sn1 and sn2, and the assays for phospholipase activity on NAPE (N-acylphosphatidylethanolamine) and the determination of positional specificity at sn1 and sn2, under "Assays and Methods".
[0665] Specificity was determined by assaying the release of free fatty acids (FFAs) by GLC analysis. Based on the internal standard (fatty acid C17:0), the amounts of C16:0 and C18:1 fatty acids in the PC assay and C16:0 and C18:2 fatty acids in the NAPE assay were determined, respectively. Positional specificity was shown as relative PLA1 activity % and relative PLA2 activity %. See Tables 3 (A and B) for the specificity identification of different candidates using the PC and NAPE positional specificity assays, respectively.
[0666]
Table 13
[0667]
Table 14
[0668] Example 19. Firing Experiment to Test the Application Effect of "Non-lyso-phospholipase" against Commercially Available Phospholipase Lipopan F and the Fabric Lipid Profiling In this experiment, the commercially available phospholipase product Lipopan F was tested with a hard-skin roll test device to show the application performance by the correlation of dose increase and lipid profiling of the fabric matrix. Furthermore, the application performance and fabric lipid profiling of "non-lyso-phospholipase" CRC08319 were compared.
[0669] The hard crust roll baking was carried out according to the description of the "hard crust roll" presented in the "Assay and Method" section above.
[0670] The experimental setup of the coating test, the bread baking evaluation, and the results from the dough lipid profiling are shown in Tables 4 (A and B), Figures 1 (A and B), and 2 (A and B), respectively.
[0671] Tables 4A and B. Experimental settings of the enzyme dosage reaction test in hard crust roll baking. All dosages are shown as dosages relative to the optimal dosage of Lipopan F (relative amount based on mg protein / kg flour). The optimal dosage of Lipopan F is defined as the dosage that gives the highest specific volume in the presented baking settings. The optimal Lipopan F dosage is indicated as "1", and the negative control is indicated as "0".
[0672] For example, in Lipopan F dosage reaction test 2 (Table 4A): a Lipopan F dosage of 0.10 reflects that the Lipopan F dosage in this test was "0.10 times the optimal dosage of Lipopan F", in other words, the Lipopan F dosage in this test was 10% of the dosage used in the test showing the optimal dosage of Lipopan F (the test shows the highest specific volume (Test 4)).
[0673] [Table 15]
[0674] [Table 16]
[0675] Figure 1A shows the hard crust roll specific volume (ccm / g) presented as the following function. Optimal dosage of Lipopan F.
[0676] The optimal dosage of Lipopan F is defined as the highest Lipopan F dosage. Let "1" be the specific volume and the optimal Lipopan F dosage presented in the given baking settings. All other dosages presented are relative to the optimal Lipopan dosage (based on mg protein / kg wheat flour). 0 represents the negative control. The dose response of Lipopan F.0, the negative control (no enzyme added) and "1" is the optimal Lipopan F dosage (= highest specific volume).
[0677] Figure 1B shows the dose response of "CRC08319 - non - phospholipase". 0 represents the negative control (no enzyme added), and the CRC08319 dosage is shown relative to the optimal Lipopan F dosage (relative dosage based on mg protein / kg wheat flour).
[0678] Lipopan F indicates the optimal dosage represented by "1x optimal dosage". An increase in the dosage of Lipopan F indicates over - dosage shown by a decrease in specific volume. In contrast, an increase in the dosage of CRC08319 indicates a specifically continuous increase or leveling off at a particular volume.
[0679] The fully fermented dough was frozen, freeze - dried, the lipids in the dried dough were extracted with water - saturated butanol, and analyzed by HPLC according to the procedures described in the assay and method. The results are shown in Figure 2.
[0680] The application effect on specific volume is supported by the lipid profile. The currently commercially available product - Lipopan F - shows hydrolysis from NAPE to NALPE, and at higher doses, further hydrolysis from NALPE to NAGPE aligns with the decrease in specific volume. 80% hydrolysis of NAPE (NAPE decreased to 20% of the starting level (starting level = 0x optimal dose (negative ctrl))) shows that Lipopan F produces approximately 60% NALPE. This 80% hydrolysis of NAPE and 60% production of NALPE correlate with the optimal dose (highest specific volume = 1x optimal dose) of Lipopan F. Lipopan F shows an alignment between the specific volume and the peak of the NALPE level. For Lipopan F, after the peak of approximately 60% NALPE level, a decrease in NALPE at higher doses (doses exceeding the optimal dose (1)) that aligns with the formation of NAGPE is tested. The highest level of NAGPE is observed at the highest dose of Lipopan F.
[0681] In contrast, the "non - phospholipase" CRC08319 shows complete conversion from NAPE to NALPE. At 80% hydrolysis of NAPE (NAPE decreased to 20% of the starting level), the NALPE level is 80%. With further hydrolysis of NAPE, the "non - phospholipase" shows a continuous increase or leveling off of the NALPE level and also aligns with the specific volume.
[0682] With complete hydrolysis of NAPE (>90 - 95% hydrolysis), the reaction equilibrium begins to be shown with a continuous increase or leveling off of the NALPE level.
[0683] Even when the "non - phospholipase" is administered at 20 times the optimal dose of Lipopan F, which corresponds to 4 - 6 times the dose of the "non - phospholipase" that brings about complete NAPE, the hydrolysis (about 10% residual NAPE) results in an NAGPE level that is still less than 5%.
[0684] Example 20. Application of Phospholipase to a Lipid - containing Food Matrix Non - phospholipase can be used, for example, in egg yolk and whole eggs, processed meat, degumming of vegetable oils, dairy products such as cheese, and bakery products such as bread, and bakery products such as sweet bakery goods including cakes and cookies.
[0685] Egg yolk - containing products Egg yolk is well - known for its use in the food industry due to its emulsifying properties. Approximately 30% of the lipids in egg yolk are phospholipids, which contribute to the emulsifying properties of egg yolk. In many foods including mayonnaise, sauces, dressings, and cakes, the emulsifying properties of egg yolk are utilized. However, in some food applications, the emulsifying properties of egg yolk are not sufficient to obtain a homogeneous product without separation. In mayonnaise, for example, the product separates due to the low - temperature sterilization of the product at high temperature. Non - phospholipase can be used to modify the phospholipids in egg yolk (and foods containing egg yolk) into lysophospholipids. Using enzymatically modified egg yolk can avoid the separation of the product during high - temperature and low - temperature sterilization.
[0686] Processed meat products Non - phospholipase can be used in processed meat products. Non - phospholipase contributes to the improvement of emulsification of processed meat products, contributing to better consistency and reduction of cooking loss. Non - phospholipase added to processed meat converts meat phospholipids into lysophospholipids. Due to the emulsifying properties of lysophospholipids, this component contributes to improved consistency and reduction of cooking - induced loss due to improved emulsification of fat in meat.
[0687] Vegetable oil Crude vegetable oils such as soybean oil contain 1-2% phospholipids. Phospholipids are removed from the oil during the refining process to improve the quality of the oil and prevent sedimentation in the oil. The removal of phospholipids is carried out by a so-called degumming process during the oil extraction process. Degumming can be carried out by chemical or enzymatic means. In the degumming process, "non-lysophospholipase" can be used to convert phospholipids into lysophospholipids which are more water-soluble and can be removed from the oil by washing with water. The enzymatic hydrolysis of phospholipids is a milder process compared to chemical degumming which requires harsh alkaline or acidic conditions. Degumming with non-lysophospholipase produces less effluent.
[0688] Dairy products Non-lysophospholipase can be used in dairy products. Non-lysophospholipase contributes to an increase in yield during cheese production. Non-lysophospholipase added to milk converts milk phospholipids into lysophospholipids. Due to the emulsifying properties of lysophospholipids, this contributes to an increase in cheese yield by trapping more lipids in the cheese curd.
[0689] Confectionery Eggs are a significant part of most cake products. Non-lysophospholipase can be used to modify the phospholipids in eggs by the production of lysophospholipids, which contributes to an improvement in emulsification during cake mixing and gives a softer and more tender crumb. Lysophospholipase can also be used directly on cake batter to modify the phospholipids in wheat flour.
[0690] Example 21. Baking effect of "non-lysophospholipase" in the presence of a supplement Substrate - lecithin (SOLECF) In this example, "non-lyso phospholipase" CRC08319 and Powerbake 4080 were tested in the presence and absence of co-substrate. The form of SOLECFSOLECF is a commercial product of IFFF. SOELCF is easy to handle defatted soy lecithin. "Non-lyso phospholipase" CRC08319 and Powerbake 4080 show significant improvement in both the shocked volume and the unshocked volume in the presence of co-substrate. The effects of the co-substrate without the presence of CRC08319 and Powerbake 4080 are very limited and potentially even negative in the case of shock stability. The sponge & dough baking trajectory was carried out according to the description of "sponge & dough". It is presented in the section of "Assays and Methods" above.
[0691] Experimental apparatus for coating test and results of baking The evaluations are shown in Table 6 and Figure 3 respectively.
[0692] The dosage of CRC08319 is presented as the dosage relative to the optimal dosage of Lipopan F shown in Example 19 (relative value based on mg protein / kg flour). The optimal dosage of Lipopan F is defined as the dosage that gives the highest specific volume in the hard roll baking composition presented in Example 19. The optimal Lipopan F dosage is shown as "1" and the negative control as "0".
[0693] For example, the 5-fold dosage of CRC08319 in this test was "5-fold the optimal dosage of Lipopan F" (based on mg protein / kg flour) as presented in the hard roll test of Example 19.
[0694]
Table 17
[0695] Figure 3 shows the relative specific volume of sponge and dough as the effect of "CRC08319 + Powerbake 4080" regardless of the presence or absence of SOLEC F.
[0696] Figure 3 shows the relative specific volumes of shocked and unshocked bread (relative to the unshocked negative control). The sponge and fabric tests show a specific increase in the specific volume of "CRC08319 + Powerbake 4080" without shock and with shock relative to the negative control (NegCtrl) without the presence of SOLEC F. The effect of "CRC08319 + Powerbake 4080" in the presence of SOLEC F provides a further increase in the specific volume of "CRC08319 + Powerbake 4080" without the presence of supplemental SOLEC F.
[0697] Example 22. Proteolysis of Phospholipase CRC08319 when Recombinantly Expressed in Trichoderma reesei 1. Summary A Trichoderma strain expressing phospholipase CRC08319 was developed. The secreted CRC08319 phospholipase was found to lose activity in the fermentation broth. The loss of activity was found to likely correlate with the loss of amino acids of the CRC08319 lipase at the C-terminus due to proteolysis.
[0698] 2. Trichoderma Strains for Recombinant Expression of Phospholipase CRC08319 Two expression cassettes for phospholipase C R08319 were developed using methods known to those skilled in the art, placing the proenzyme coding sequence for the phospholipase under the control of the cbh1 promoter sequence and terminator sequence and having a signal sequence from Trichoderma pap1 containing an intron from Trichoderma gla1. The two cassettes differ in the selectable marker placed at one end of the cassette to facilitate isolation of Trichoderma transformants carrying the expression cassette, one having the Trichoderma pyr2 gene and the other having the Aspergillus amdS gene. Schematic maps of the expression cassettes are shown in FIGS. 4A and 4B, showing the relative positions and orientations of the DNA portions within the cassette. The relevant biological portions of the cassette are listed in Table 7 in the order found in the cassette along with the corresponding SEQ ID NOs. These cassettes can be constructed and / or commercially synthesized (e.g., GeneArt, IDT) by those skilled in the art from the disclosed information.
[0699]
Table 18
[0700] First, Trichoderma strains were co-transformed with the restriction enzyme SwaI using the pry2-linked expression cassette. Protoplasts of the AZP79 strain, a pry2 mutant Trichoderma reesei strain in which the four native cellulase genes cbh1, cbh2, egl1, and egl2 are deleted, were transformed using approximately 15 μg of the purified expression cassette. Transformation was carried out using a standard polyethylene glycol (PEG)-mediated protoplast transformation protocol. Transformants were grown on Vogel's minimal medium agar plates and selected for uridine prototrophy acquired by the pyr2 marker. Then, as generally described in Section 3 of this example, the transformants were isolated and grown on Vogel's minimal agar plates before screening for phospholipase expression. The strain ASQ29 expressing phospholipase was selected for transformation with the amdS-linked expression cassette.
[0701] Second, Trichoderma strains were co-transformed with the restriction enzyme NotI using the amdS-linked expression cassette. Protoplasts of the ASQ29 strain were transformed using PEG-mediated transformation as described above, except that approximately 15 μg of the purified expression cassette DNA was used and the transformants were selected on minimal medium containing acetamide as the sole nitrogen source. Then, the transformants were isolated and grown on minimal agar plates containing acetamide as the sole nitrogen source, and then screened for phospholipase expression as generally described in Section 3 of this example. The strain AWG09 was selected for fermentation and characterization of the CRC08319 phospholipase.
[0702] 3. Fermentation and Evaluation of Transformants in Microtiter Plates The methods for microtiter plate fermentation of transformants and analysis of fermentation broth by SDS-PAGE and PC-P assay are as follows. Medium Composition: 400x T. reesei Trace Elements: Citric acid (anhydrous), 175 g / L; FeSO4·7H2O, 200 g / L, ZnSO4·7H2O, 16 g / L, CuSO4·5H2O, 3.2 g / L; MnSO4·H2O, 1.4 g / L; H3BO3, 0.8 g / L. Citrate minimal medium 5 g / L (NH4)2SO4, 4.5 g / L KH2PO4, 1 g / L MgSO4·7H2O, and 14.4 g / L citric acid, adjusted to pH 5.5 with 5% NaOH. After autoclaving for 30 minutes, sterile 50% glucose was added to a final concentration of 0.5% along with 2.5 mL / L of 400x trace element solution.
[0703] Liquid defined (LD) culture medium contained the following components. Casein amino acids, 12 g / L; (NH4)2SO4, 5 g / L; MgSO4·7H2O, 1 g / L; KH2PO4, 4.5 g / L; CaCl2·2H2O, 1 g / L; PIPPS, 33 g / L; 400x T. reesei trace elements, 2.5 mL / L; adjusted to pH 6.9 with NaOH. After sterilization, lactose or glucose / sophorose mixture was added to a final concentration of 1.5% w / v.
[0704] Fermentation: Transformants were grown in citrate minimal medium at 32 °C for 36 - 48 hours with shaking in a 96-well plate. After incubation, 0.11 mL of the seed culture was added to 0.99 mL of LD medium per well in a 24-well 20% lactose sustained-release microtiter plate (srMTP). The srMTP is described in U.S. Patent No. 10,030,221 B2. These production cultures were then fermented at 25 °C and 250 RPM for 4 - 5 days. After fermentation, the secreted protein was separated from the cell mass to a 96-well non-binding assay plate by filtration through a filter-bottom 96-well plate.
[0705] Phosphatidylcholine Assay: To evaluate phospholipase activity (PC-U), the filtrate was assayed for activity against phosphatidylcholine using the PC-P assay described in the above assay and method.
[0706] SDS-PAGE analysis: To observe the proteins secreted into the fermentation broth by Trichoderma, 1 - 5 microliters of the filtrate were diluted with 4x LDS loading buffer (Invitrogen), denatured, and run on a NuPAGE 4 - 12% Bis-Tris SDS-PAGE gel (Invitrogen) together with SeeBlue Plus2 molecular weight standard (Invitrogen) in 1x NuPAGE MES buffer (Invitrogen). The gel was then stained with SimplyBlue SafeStain (Invitrogen) and destained in water using standard molecular biology procedures.
[0707] Fermentation of AWG09 in a 4.14 L fermenter To produce a fermentation broth that is more representative of commercial-scale fermentation, a Trichoderma strain engineered to express CRC08319 phospholipase was fermented in a 14 L fermenter.
[0708] Briefly, the spores of the strain were added to 500 mL of medium in a 3 L flask equipped with both side baffles and bottom baffles. The culture was grown for 48 hours in minimal medium in a shaking incubator at 34 °C. After 48 hours, the contents of each flask were separately added to a 14 L fermenter containing 9.5 L of medium containing 4.7 g / L KHPO, 1.0 g / L MgSO₄·7H₂O, 4.3 g / L (NH₄)₂SO₄ and 2.5 mL / L of 400x T. reesei trace element solution ((anhydrous) citric acid, 175 g / L; FeSO₄·7H₂O, 200 g / L; ZnSO₄·7H₂O, 16 g / L; CuSO₄·5H₂O, 3.2 g / L; MnSO₄·H₂O, 1.4 g / L; H₃BO₃, 0.8 g / L; soybean meal, 15 g / L). These components were autoclaved together at 121 °C for 30 minutes. A solution of 60% glucose and 0.48% CaCl₂·2H₂O was separately autoclaved, cooled and added to the fermenter to a final concentration of 75 g / L glucose and 0.6 g / L CaCl₂·2H₂O. The medium was adjusted to pH 3.5 using 28% NH₃ and the temperature was maintained at 34 °C throughout the growth period. When glucose was depleted, the temperature dropped to 28 °C, so glucose-sophorose was fed to the culture. The pH of the broth was controlled at approximately 7 using an ammonia feed. The dry cell weight (DCW), total protein concentration and other parameters were measured and the specific productivity of total protein and the yield on the supplied sugars were calculated.
[0709] 5. Stability of CRC08319 The CRC08319 phospholipase activity (PC-U) was found to be not consistently stable in Trichoderma broth supernatant.
[0710] Approximately 1 ml of fresh fermentation broth from the 14L fermentation of AWG09 was transferred to 1.5 ml microcentrifuge tubes. These were spun at 21,000 x g for 3 minutes in a benchtop microcentrifuge, and then the supernatant was aliquoted into 200 μl PCR tubes and stored at -20°C. 40 μl (40 μl) of thawed supernatant from 10 independent Trichoderma AWG09 14L fermentation broths were aliquoted into two sets of 200 μl PCR tubes. One set of tubes was stored at 4°C, and the other set of tubes was stored at 33°C for 1 day, after which phospholipase activity was measured for both by PC-P assay. Residual activity was calculated as the ratio of the broth activity after incubation at 33°C to the broth activity after incubation at 4°C.
[0711] As shown in Figure 5, all samples lost CRC08319 phospholipase activity upon incubation at 33°C, in the range from almost complete loss of all activity to about half.
[0712] 6. Analysis of recombinant CRC08319 protein species produced by Trichoderma Recombinant CRC08319 protein species produced by Trichoderma and present in the fermentation broth were analyzed. The CRC08319 proteins were found to be a mixture of three distinct species with different C-terminal processing, two mature active species, and a cleaved inactive species. CRC08319 proteins with purity over 90% from both high-activity and low-activity fermentation broths were analyzed to better understand the loss of activity. Samples were assayed for phosphatidylcholine activity (PC-U), the CRC08319 protein was quantified, and the sequences of the CRC08319 species were deduced by LC-MS.
[0713] The phosphatidylcholine activity (PC-U) of the fractions was measured by phosphatidylcholine PC-P assay.
[0714] The protein was quantified by SDS-PAGE gel and densitometry using a GelDoc™ Go imaging system (Bio-Rad). Reagents used in this analysis: Concentrated (2x) Laemmli sample buffer (Bio-Rad, catalog number 1610737); 26-well TGX Any kD gel (Bio-Rad, catalog number 5678125); Protein marker "Precision Plus Protein™ Unstained Protein Standards" (Bio-Rad, catalog number 161-0363); Protein standard (total amino acid analysis, protein concentration assigned by Eurofins Scientific). The analysis was performed as follows: In a 96-well PCR plate, 50 μL of diluted enzyme sample was mixed with 50 μL of sample buffer containing 2.7 mg of DTT. The plate was sealed with a Bio-Rad Microseal "B" Film, placed in a PCR machine, and heated at 70 °C for 10 minutes. Next, the chamber was filled with running buffer and the gel cassette was set. Then, 10 μL of each sample and standard (protein standard of approximately 0.1 - 1.00 mg / mL) were loaded onto the gel, and 10 μL of marker was loaded. Thereafter, electrophoresis was performed at 200 V for 34 minutes. After electrophoresis, the gel was transferred to a GelDoc Go Imager. Image Lab software was used to calculate the intensity of each band. A calibration curve was created by knowing the amount of protein in the sample used as a standard. The amount of the target protein in the sample was determined from the band intensity and the calibration curve.
[0715] The samples were analyzed as intact proteins by CapLC-MS. The only sample preparation was a 10-fold dilution in 6 M guanidinium hydrochloride, 50 mM ammonium bicarbonate pH 7.0.
[0716] The mass corresponding to the main component was extracted from the deconvoluted (using the complete envelope of the protein, calculated using the mass of the protein molecule detected in several charge states. The Xtract function of Thermo Xcalibur Qual Browser was used for deconvolution) MS spectrum and used to calculate the relative ratio between the main components.
[0717] CapLC-ESI-MS device: Agilent CapLC system: Solvent A: H2O 99.9% / formic acid 1% Solvent B: ACN 99.9% / formic acid 1% Column: 10 cm, ID 75 μm ~ 3 μm C18-A2
[0718] MS instrument: LTQ Orbitrap, high-resolution mass spectrometer (Thermo Finnigan)
[0719]
Table 19
[0720]
Table 20
[0721] This revealed the variation in the C-terminal processing of the CRC08319 protein in Trichoderma broth (Table 8). Two species were identified: SEQ ID NOs: 27 and 28 have high specific activity against phosphatidylcholine and are collectively referred to herein as mature CRC08319. The third prominent species is 6 or 7 amino acids shorter than mature CRC08319 and has a specific activity approximately 40-fold lower and is referred to herein as truncated CRC08319 (SEQ ID NO: 29).
[0722]
Table 21
[0723] Example 23: Stabilization of CRC08319 in Trichoderma clarification broth by supplementation with exogenously produced BASI 1. Overview Clarification broth from Trichoderma strain AWG09 fermented in a 14 L fermenter was incubated and analyzed at warm temperature with or without the addition of Bacillus-produced BASI. Inclusion of the BASI protein in the fermentation product increases the CRC08319 incubation stability 2.4-fold.
[0724] 2. Bacillus subtilis strain for recombinant expression of BASI An expression cassette was developed for the integration of the barley amylase subtilisin inhibitor (BASI) expression cassette at the yhfN locus with the alrA selection marker in Bacillus subtilis. A schematic map of the expression cassette showing the relative positions and orientations of the DNA parts within the cassette is shown in Figure 6. The relevant biological parts of the cassette are listed in Table 9 in the order found in the cassette along with the corresponding SEQ ID NOs. This cassette can be constructed as described below and / or can be commercially synthesized by one skilled in the art from the disclosed information (e.g., GeneArt, IDT).
[0725] [Table 22]
[0726] B. subtilis-derived yhfN region and rrnI (engineered) promoter, as well as B. subtilis-derived aprE signal sequence, were amplified from a B. subtilis expression strain having primers CF17-79 and CF19-20 (Table 10). Primer CF17-79 also contains an overhang from the end of the alrA cassette enabling assembly. A 20 bp overhang from the end of the aprE signal sequence, the gene encoding the barley alpha-amylase subtilisin inhibitor (BASI) protein (SEQ ID NO: 58) (codon-optimized by the software Geneious) + the first 20 base pairs of the BPN’ terminator from B. amyloliquefaciens were synthesized by an external vendor (Eurofins Genomics). This synthetic DNA fragment was amplified with primers CF19-19 and CF19-22 (Table 1). Using techniques known in the art, two fragments were fused together using PCR with primers CF17-79 and CF19-22 (Table 10) to form PCR fusion 1.
[0727] A DNA fragment containing the BPN’ terminator and alrA expression cassette was amplified with primers CF19-21 and CF17-80 (Table 10) from a B. subtilis expression strain (CF17-80 has an overhang in the yhfN upstream region for future Gibson assembly). Using techniques known in the art, this PCR fragment and PCR fusion 1 were assembled using Gibson Assembly (New England Biolabs) to create a circular DNA cassette.
[0728] Rolling circle amplification (Evomics) was performed on the assembly and this was used to transform 200 μl of competent cells of an appropriate B. subtilis strain. The transformed cells were incubated at 37 °C for 1 hour with shaking at 250 rpm. This method is based on the observation that the alrA gene encoding alanine racemase is essential for B. subtilis (Ferrari et al., Bio / Technol., 3:1003 - 1007, 1987) and can thus be used as a selectable marker. Alanine racemase converts natural L-alanine to D-alanine required for cell wall synthesis. The alanine racemase inhibitor, b-chloro-D-alanine (CDA), can be used for the selection / amplification of the alrA gene (Heaton et al., Biochem. Biophys. Res. Comm., 149:576 - 579, 1987). The alrA gene cassette was integrated with the BASI cassette and introduced into a host lacking the native alrA gene, and selection was carried out on plates supplemented with no D-alanine. Cells from the transformation mixture were plated onto agar plates. Single colonies were selected and grown to an optical density of 1.0 at 600 nm in Luria broth containing b-chloro-D-alanine (CDA). The strain samples were then frozen at -80 °C with 20% glycerol.
[0729]
Table 23
[0730] 3. Fermentation of Bacillus subtilis expressing BASI on a 14 L scale in liquid culture The inoculum was grown in a seed flask containing LB medium as shown in Table 11.
[0731]
Table 24
[0732] The production medium used to produce BASI protein contained the minerals shown in Tables 12 and 13, one or more carbon sources, and a complex nitrogen source. The BASI protein accumulated in the broth / cells.
[0733]
Table 25
[0734]
Table 26
[0735] Growth in a 14 L fermenter consisted of two steps: generating a seed culture and generating a production culture while producing protein. Seed culture was initiated by inoculating 30 mL of LB medium into a 350 mL flask. The seed culture was incubated at 180 rpm and 37 °C for approximately 2 hours (until it became turbid). A 30 mL volume of the seed culture was inoculated into each tank, and the final volume was made up to 7 kg of the appropriate production medium. The production culture had one-sided pH control (base addition only) during the experiment and was controlled at pH 7.1 using NH4OH for base addition. The feed was triggered when OUR reached 25 mmol / L / h and was increased from 0.28 g / min to 1.65 g / min over 10 hours.
[0736] During operation, various parameters were monitored, including but not limited to: CER (carbon dioxide evolution rate), OUR (oxygen uptake rate), pH, DO (dissolved oxygen), OD (optical density), etc.
[0737] To produce Bacillus-produced BASIUFC, the resulting fermentation broth was diluted with two parts of process water. Cationic polymer C581 was added at 1% to agglomerate the cells. The agglomerated cells were removed by depth filtration using a Buchner filter fitted with an HR900 filter pad pre-coated with diatomaceous earth FW12. The clarified filtrate was concentrated using a 10K PES MWCO ultrafiltration membrane.
[0738] 4. Stabilization of Trichoderma-produced CRC08319 by Bacillus-produced BASI Approximately 1 ml of fresh fermentation broth from the 14L fermentation of AWG09 was transferred to 1.5 ml microcentrifuge tubes. These were spun at 21,000 xg for 3 minutes in a benchtop microcentrifuge, and then the supernatant was aliquoted into 200 ul PCR tubes and stored at -20°C. Forty microliters (40 ul) of thawed supernatant from six independent Trichoderma AWG09 14L fermentation broths were aliquoted into four sets of 200 ul PCR tubes (「test sets」A - D) (see Table 14).
[0739] [Table 27]
[0740] To the supernatants of test sets B and D, 1 ul of Bacillus-produced BASIUFC at approximately 20 g / L was added to each tube, mixed briefly, and then pulse-spun. Immediately thereafter, test sets A and B were transferred to a 4°C refrigerator, and test sets C and D were transferred to a 33°C incubator. After 18 hours of incubation, all test set samples were diluted and assayed using the PC-P assay as generally described in 「Assays and Methods」. To calculate 「residual activity」, the activity value of each supernatant test set set at 33°C was divided by the activity value of the supernatant test set stored at 4°C, i.e., the value obtained by dividing the set °C value by the set A value and the value obtained by dividing the set D value by the set B value.
[0741] Results As shown in Figure 7, the clarified 14L supernatant broth derived from the CRC08319-expressing strain AWG09 lost an average of 65% of their activity when stored at 33°C for 18 hours. However, when these same supernatants were stored at 33°C for 18 hours with the addition of Bacillus-expressed BASI supernatant, they only lost an average of 25% of their activity. This indicates that BASI can stabilize CRC08319 in Trichoderma broth, presumably through inhibition of the Trichoderma subtilisin-like protease that is naturally co-expressed in Trichoderma.
[0742] Example 24: Recombinant co-expression of phospholipase CRC08319 and BASI by Trichoderma reesei 1. Overview A Trichoderma strain expressing phospholipase CRC08319 was developed. When the expression cassette of BASI was added to this strain, BASI expression was revealed by SDS-PAGE analysis and phospholipase stability was improved.
[0743] 2. Trichoderma strain for recombinant expression of phospholipase CRC08319 A Trichoderma strain expressing phospholipase CRC08319 was constructed by co-transformation of an expression cassette marked with the py2 selection marker and Cas9-RNP targeting the carboxypeptidase (cpa5) locus.
[0744] Using the pry2-linked CRC08319 expression cassette as described in Example 22, Trichoderma strains were co-transformed with the assembled Cas9 nuclease and synthetic guide RNAs (sgRNAs, SEQ ID NOs: 65 and 66) targeting regions within the Trichoderma genome encoding the predicted carboxypeptidase (cpa5, JGIPID120998). These Cas9-sgRNA complexes were constructed in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma as generally described in PCT Publication No. WO 2016 / 100568 pamphlet. Protoplasts of the pry2 mutant Trichoderma reesei strain AZP79, in which the four native cellulase genes cbh1, cbh2, egl1, and egl2 were deleted, were transformed using approximately 15 μg of the purified fragment and the constructed Cas9-sgRNA complex. Transformation was performed using standard polyethylene glycol (PEG)-mediated protoplast transformation. Transformants were grown on minimal medium agar plates and selected for uridine prototrophy acquired by the pyr2 marker. Then, as generally described in Example 22, the transformants were isolated and grown on Vogel's minimal agar plates before screening for phospholipase expression. Strain BBS89, which expresses phospholipase, was selected to evaluate BASI co-expression.
[0745] 3. Strains for Recombinant Co-Expression of BASI and CRC08319 Here, an expression cassette for the BASI fusion protein was developed and used to target integration at locus A of the Trichoderma BBS89 strain expressing phospholipase CRC08319.
[0746] Using methods known to those skilled in the art, an expression cassette for overexpressing barley α - amylase subtilisin inhibitor (BASI) in Trichoderma was developed as a translational fusion with catalytically inactive Cbh1_core having a linker. DNA encoding several amino acids intended to facilitate cleavage of the fusion protein and release of the BASI protein was placed at the end of the Cbh1 linker immediately before the start of the mature BASI sequence (the kexin site). Expression of the fusion protein was placed under the control of the Trichoderma cbh2 promoter and the Aspergillus nidulans trpC terminator. To facilitate isolation of Trichoderma transformants having the expression cassette, the Aspergillus nidulans amdS gene was placed at one end of the cassette. The expression cassette was flanked by approximately 1 kb upstream and downstream homology regions to facilitate integration of the cassette in an intergenic region of the Trichoderma genome, herein referred to as locus A. A schematic of the expression cassette is shown in FIG. 8, which shows the relative orientation of the DNA portions within the cassette. The relevant biological parts of the cassette are listed in Table 15 in the order found in the cassette along with the corresponding SEQ ID NOs. This cassette can be constructed and / or commercially synthesized (e.g., GeneArt, IDT) by those skilled in the art from the disclosed information.
[0747]
Table 28
[0748] Using a cassette, the Trichoderma strain BBS89, which was prepared from the second section, was co-transformed with a pooled Cas9 nuclease having a synthetic guide RNA (SEQ ID NO: 73) targeting locus A, an intergenic region within the Trichoderma genome. These Cas9-sgRNA complexes were constructed in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma as generally described in PCT Publication No. WO 2016 / 100568 pamphlet. Approximately 5 μg of the purified fragment and the assembled Cas9-sgRNA complex were used to transform the protoplasts of BBS89. Transformation was performed using a polyethylene glycol (PEG)-mediated protoplast transformation protocol (Ouedraogo et al., 2015; Penttila et al., 1987). Transformants were grown on Trichoderma minimal medium agar plates containing acetamide as the sole nitrogen source to select for the amdS marker. The transformants were then isolated and grown on Trichoderma minimal agar plates with acetamide as the sole nitrogen source prior to testing the transformants.
[0749] 4. Fermentation in microtiter plates Transformants from two independent PEG transformations (BASI1 and BASI2), the parental strain (BBS89), and the spontaneous prototrophic revertant of the host strain AZP79 (AZP79pp) were fermented in srMTP essentially as described in Example 22. After fermentation, the broth filtrate was analyzed by SDS-PAGE and phosphatidylcholine activity assay essentially as described in Example 22.
[0750] Results: As shown in Fig. 9, a new band with an apparent molecular weight of approximately 12 kDa was seen in the filtrate of strain BBS89 containing the CRC08319 phospholipase cassette (lane 2), but not in the filtrate of AZP79pp (lane 1), a pyrimidine prototrophic derivative of the same parental strain. This is consistent with the calculated molecular weight of the mature CRC08319 phospholipase species at 13 kDa. In the pooled filtrates of BBS89 transformants having the BASI expression cassette (lanes 3 and 4), two additional bands were observed relative to BBS89 parent (lane 2). One band at approximately 60 kDa is consistent with the expected mobility of glycosylated Cbh1_core with a linker. Another prominent band found between 14 kDa and 28 kDa is consistent with the expected molecular weight of mature BASI at 20 kDa.
[0751] 5. Stability of recombinant CRC08319 expressed by Trichoderma reesei regardless of the co-expression of recombinant BASI The CRC08319 phospholipase was demonstrated to be more stable in Trichoderma filtrates when co-expressed with BASI.
[0752] To evaluate phospholipase stability in Trichoderma filtrates, aliquots of the filtrates were transferred to non-binding MTPs, sealed, and incubated at 4 °C and 33 °C for 3 days. Then, the activity was measured using the phosphatidylcholine assay essentially as described in Example 22. Residual activity was calculated as the ratio of the broth activity after incubation at 33 °C to the broth activity after incubation at 4 °C.
[0753] Results: As shown in Figure 10, the phospholipase produced by the BBS89 parental strain retained only 48% of its activity after incubation at 33°C compared to incubation at 4°C. However, in both sets of BBS89-derived transformants (BASI1 and BASI2) using the BASI expression cassette, the phospholipase retained 55% of its activity. This represents a 14% increase in phospholipase stability.
[0754] Example 25: Co-expression of BASI and phospholipase CRC08319 in Trichoderma with protease deletion 1. Summary Here, proteases were knocked out (inactivated) by cas9-mediated mutagenesis of their genes in the genome of the CRC08319 phospholipase expressed in the Trichoderma strain AWG09 (Example 22) through three consecutive transformations with a selectable marker. In the final round, the BASI expression cassette was introduced into the gef1 locus. On average, the transformants expressing BASI had a 6% improved CRC08319 incubation stability.
[0755] 2. Knockout of carboxypeptidase cpa5 Here, the expression cassette of CRC08319 was targeted to replace and inactivate a part of the predicted carboxypeptidase (cpa5, JGIPID120998).
[0756] This cpa5-targeting cassette contained a DNA sequence having a 1.0 Kb region homologous to the DNA sequence spanning exon 1 and 2 and a contiguous portion of intron 1 of cpa5 (left side). Also contained within the plasmid was a DNA sequence having a 1.0 Kb region homologous to a DNA sequence spanning a portion of exon 2 of the cpa5 gene and the adjacent downstream sequence (right side). These sequences were designed to target the cpa5 gene and replace the genomic region between the left and right sides with the intervening cassette sequence. These intervening sequences contained, using methods known to those skilled in the art, the coding sequence for the phospholipase proenzyme CRC08319 for phospholipase under the control of the cbh1 promoter sequence and terminator sequence, as well as a signal sequence from Trichoderma pep1 containing an intron from Trichoderma gla1, and an expression cassette for the phospholipase proenzyme coding sequence containing an engineered Trichoderma sdi1 selectable marker capable of conferring resistance to the fungicide carboxin.
[0757] The design of the expression cassette is essentially the same as that shown in Figure 8, except for two modifications. 1) Use of homology regions upstream and downstream of the cpa5 locus instead of the region of locus A, and 2) use of the sdi1 marker instead of the amdS marker. The relevant biological parts are listed in Table 16 along with the corresponding sequence numbers. This cassette can be constructed and / or commercially synthesized (e.g., GeneArt, IDT) by those skilled in the art from the disclosed information.
[0758]
Table 29
[0759] Using the cpa5-targeting cassette, the Trichoderma strain AWG09 prepared in Example 22 was co-transformed with a pooled Cas9 nuclease having synthetic guide RNAs (sgRNAs, SEQ ID NOs: 65 and 66) that target the cpa5 locus. These Cas9-sgRNA complexes were constructed in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma as generally described in PCT Publication No. WO 2016 / 100568 pamphlet. Protoplasts of the AWG09 strain were transformed using approximately 10 μg of purified cpa5-targeting cassette DNA and the assembled Cas9-sgRNA complex. Transformation was performed using a standard polyethylene glycol (PEG)-mediated protoplast transformation protocol. Transformants were grown on Vogel's minimal medium agar plates containing 150 ug / ml of carboxy and selected for acquisition of the sdi1 marker. Stable transformants were isolated, grown, and then screened by PCR for targeted integration at the cpa5 locus by homologous recombination. The homologous integration of the cpa5 disruption cassette at the cpa5 locus was verified by amplifying a DNA fragment of the expected size using two primer pairs. Primer pair RPG2641 and RPG2594 amplified a DNA fragment that started outside the 5' end of the disruption cassette region and ended within the selectable marker. RPG2641 cgtccctcaaggagtcgtttggc (SEQ ID NO: 77) RPG2594 gagcctgtaccgctgcctcaccattctcaactgcacgcgg (SEQ ID NO: 78)
[0760] Primer pair RPG2642 and RPG2537 amplified a DNA fragment that started within the selectable marker of the disruption cassette and ended outside the 3' end of the disruption cassette region. RPG2642 cgcgtagagccgatagcgaagaat (SEQ ID NO: 79) RPG2537 cgggaatgagtgcctgctactgc (SEQ ID NO: 80)
[0761] The generated strain in which homologous integration of the cpa5 disruption cassette was confirmed was named BAH83.
[0762] 3. Knockout of proteases amp1, slp3, slp6 and Tr22210 Here, the cpa5 deletion strain BAH83 is co-transformed with an als selection marker and a Cas9-sgRNA complex targeting four protease loci.
[0763] Using a DNA fragment containing the als marker (SEQ ID NO: 81), the BAH83 strain was co-transformed with the constructed Cas9 nuclease together with synthetic guide RNAs (SEQ ID NOs: 82 - 89) targeting the amp1 (JGIPID81070), slp3 (JGIPID123234), slp6 (JGIPID121495) and Tr22210 (JGIPID22210) loci. These Cas9-sgRNA complexes were constructed in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma as generally described in PCT Publication No. WO 2016 / 100568 pamphlet. The protoplasts of the BAH83 strain were transformed using approximately 10 μg of purified als marker DNA and the constructed Cas9-sgRNA complex. Transformation was carried out using a standard polyethylene glycol (PEG)-mediated protoplast transformation protocol.
[0764] Transformants were selected for resistance to the herbicide chlorimuron ethyl. The transformants were then screened by PCR for mutation events at the target loci by PCR amplification of amplicons spanning the paired cas9-RNP target sites. Table 17 lists the primers used to screen the transformants. The selected transformant named BBR87, which showed mutation events by PCR and whole genome sequencing analysis at all four loci, was selected for further protease deletion.
[0765]
Table 30
[0766] 4. Knockout of proteases pep2 and sed2 Here, the 5-protease knockout strain BBR87 was co-transformed with a Cas9-sgRNA complex targeting the sucA selection marker and two additional proteases, pep2 and sed2, as well as the cpa5 locus to remove the CRC08319 expression cassette and the sdi1 selection marker.
[0767] The BBR87 strain was co-transformed with a pooled Cas9 nuclease having synthetic guide RNAs (SEQ ID NOs: 99-104) targeting pep2 (JGIPID53961), sed2 (JGIPID70962), and the cpa5 locus, along with a DNA fragment containing the sucA marker (SEQ ID NO: 98). These Cas9-sgRNA complexes were constructed in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma. The protoplasts of the BBR87 strain were transformed using approximately 10 μg of purified sdi1 marker DNA and the constructed Cas9-sgRNA complex. Transformation was performed using a standard polyethylene glycol (PEG)-mediated protoplast transformation protocol.
[0768] Transformants were selected on Vogel's minimal medium containing sucrose as the sole carbon source. The transformants were then screened by PCR for mutation events at the target loci by PCR amplification of amplicons spanning the paired cas9-RNP target sites. Table 18 lists the primers used to screen the transformants. A selected transformant designated BBX71, which showed mutation events by PCR and whole-genome sequencing analysis at all three loci, was selected for further protease deletion.
[0769]
Table 31
[0770] Integration of the BASI expression cassette at the gef1 locus Here, the 7-protease knockout strain BBX71 was co-transformed with an expression cassette for BASI containing a Cas9-sgRNA complex targeting the sdi1 selection marker and the gef1 (JGIPID120482) locus.
[0771] An expression cassette for the barley α-amylase / subtilisin inhibitor (BASI) was developed to overexpress BASI in Trichoderma that was substantially the same as the cassette of Example 24, except that catalytically inactive Cbh1_core was replaced with active Cbh1_core (SEQ ID NO: 105) by a linker (SEQ ID NO: 70), and the selection marker (SEQ ID NO: 51) was replaced with the sdi1 marker (SEQ ID NO: 106). Furthermore, the homologous regions (SEQ ID NOs: 67 and 68) were excluded. The relevant biological parts of the cassette are listed in Table 19 in the order found in the cassette together with the corresponding SEQ ID NOs. This cassette can be constructed and / or commercially synthesized (e.g., GeneArt, IDT) by a person skilled in the art from the disclosed information.
[0772]
Table 32
[0773] Using only this BASI expression cassette and the sdi1 marker, the BBX71 strain was co-transformed with a pooled Cas9 nuclease having synthetic guide RNAs (SEQ ID NOs: 107 and 108) targeting the gef1 locus. These Cas9-sgRNA complexes were constructed in vitro according to the manufacturer's protocol (Synthego) and used to transform Trichoderma as generally described in PCT Publication No. WO 2016 / 100568 Pamphlet. The protoplasts of the BBX71 strain were transformed using approximately 10 μg of purified BASI expression cassette DNA and the constructed Cas9-sgRNA complex. In a separate transformation, the protoplasts of the BBX71 strain were transformed using approximately 5 μg of purified sdi1 selection marker DNA (SEQ ID NO: 106) and the pooled Cas9-sgRNA complex. Transformation was carried out using a standard polyethylene glycol (PEG)-mediated protoplast transformation protocol.
[0774] Transformants were selected on Vogel's minimal medium agar plates containing 150 μg / ml of the agricultural fungicide carboxin for acquisition of the sdi1 marker. The transformants were isolated on the selection medium and then screened in microtiter plates for phospholipase, Cbh1_core, and BASI expression by SDS-PAGE analysis essentially as described in Example 22. Four independent transformants showing expression of phospholipase, Cbh1_core, and BASI were selected for evaluation of CRC08319 stability. Four randomly isolated strains targeting only the sdi1 selection marker to the gef1 locus were analyzed in parallel with the control for the effect of gef1 disruption.
[0775] 6. Stability of recombinant CRC08319 expressed by Trichoderma reesei protease knockout strains with and without co-expression of recombinant BASI The following strains were evaluated by srMTP fermentation: BBX71, a phospholipase-negative control strain, four independent BBX71 transformants having only the sdi1 selection marker at the gef1 locus, and four independent BBX71 transformants in which the BASI expression cassette and the sdi1 selection marker were targeted for integration at the gef1 locus. srMTP fermentation and subsequent phosphatidylcholine activity assays were performed as essentially described in Example 22 herein.
[0776] Results As shown in Figure 11, the transformants expressing BASI ("BASI") had an average of 6% higher residual phospholipase activity after 2 days of incubation at 33°C (0.56 vs. 0.53 residual activity) compared to the transformants in which only the sdi1 marker ("marker only") was integrated at the gef1 locus. Surprisingly, integration of the marker alone at the gef1 locus increased the phospholipase residual activity by 26% under the same conditions compared to the BBX71 parent ("BBX71", 0.53 vs. 0.42 residual activity).
[0777] Example 26: Phospholipase in mature form According to one aspect of the present invention, as shown in Table 20, active fragments of other phospholipases were also observed.
[0778] [Table 33]
[0779] Example 27. Firing experiment to test the application effect of the active fragment of phospholipase CRC08319 mature form. In this experiment, the mature active fragment of the CRC08319 phospholipase was tested at increasing doses in a hard skin roll assay setup to show the application performance. The hard skin roll firing was performed according to the description of "hard skin roll" presented in the "Assays and Methods" section above.
[0780] The experimental configuration of the application trial and the results of the firing evaluation are shown in Table 21 and Figure 12, respectively.
[0781]
Table 34
[0782] Figure 12 shows a dose - response study of the CRC08319 mature active fragment in the application of a hard - skin roll, measuring the specific volume after proofing times of both 45 and 60 minutes. The phospholipase CRC08319 mature active fragment was tested in a constant hard - skin roll matrix, where the lowest dose was given as 1 and other doses were increased by a factor of two compared to the lowest dose tested. The increase in the dose of the phospholipase CRC08319 mature active fragment shows a continuous increase in the specific volume.
[0783] Example 28. Experimental setup of the xylanase response test in combination with CRC08319 + POWERBake4080 in a hard - skin roll In this experiment, xylanase Bs3 (listed as SEQ ID NO: 118 and sold as POWERBake® 950, Dupont Nutrition Bioscience, Denmark) was tested in a hard - skin roll experimental setup, showing the supplementary dose response in combination with "lysophospholipase - free" CRC08319 and POWERBake4080.
[0784] Hard - skin roll baking was carried out according to the description of "hard - skin roll" presented in the "Assays and Methods" section above.
[0785] The experimental configuration of the application trial and the results of the baking evaluation are shown in Table 22 and Figure 13 respectively.
[0786]
Table 35
[0787] Figure 13 shows the volume responses of xylanase Bs3 in combination with CRC08319 mature fragment, active fragment and POWERBake4080 in the application of a hard roll for measuring specific volume.
[0788] Phospholipase CRC08319 mature form and active fragment are used in combination with POWERBake4080. The dosage of the phospholipase CRC08319 mature form and active fragment used is x5.4 relative to the dosage indication provided in Example 19, Figure 1.
[0789] As seen by the increase in the specific volume of xylanase Bs3 over CRC08319 + POWERBake4080 in the hard roll of the skin, it is observed that the combination of xylanase and CRC08319 + POWERBake4080 has a complementary positive effect.
[0790] Example 29. Experimental setup of the xylanase response test in combination with CRC08319 + POWERBake4080 for white toast coating of tweed In this experiment, xylanase Bs3 (listed as SEQ ID NO: 118 and sold as the product POWERBake® 950, Dupont Nutrition Bioscience, Denmark) was tested in a white toast experimental device for tweed to show the supplementary dosage response in combination with "non-lyso-phospholipase" CRC08319 and POWERBake4080.
[0791] According to the description of "white toast of tweed" presented in the "Assay and Method" section above, white toast baking of tweed was carried out.
[0792] The experimental configuration of the application trial and the results of the baking evaluation are shown in Table 23 and Figure 14 respectively.
[0793]
Table 36
[0794] Figure 14 shows the volume response of xylanase Bs3 in combination with CRC08319 mature fragment, active fragment and POWERBake4080 in the application of white toast of tweed for measuring the specific volume with and without impact.
[0795] The mature form and active fragment of phospholipase CRC08319 are used in combination with POWERBake4080. The dosage of the mature form and active fragment of phospholipase CRC08319 used is x5.9 relative to the dosage indication provided in Example 19, Figure 1.
[0796] The combination of xylanase and CRC08319 + POWERBake4080 is observed to have a complementary positive effect, as seen by the increase in the specific volume of xylanase Bs3 over CRC08319 + POWERBake4080 in white toast of tweed - with and without impact.
[0797] Example 30. Experimental setup of the glucose oxidase response test in combination with CRC08319 + POWERBake4080 in the application of white toast of tweed In this experiment, glucose oxidase GOX (listed as SEQ ID NO: 117 and sold as Grindamyl® S860, Dupont Nutrition Bioscience, Denmark) was tested in a white toast experimental apparatus for tweed to show the supplementary dosage response in combination with "non - lysophospholipase" CRC08319 and POWERBake4080.
[0798] According to the description of "white toast of tweed" presented in the "Assays and Methods" section above, the baking of white toast of tweed was carried out.
[0799] The experimental configuration of the application trial and the results of the baking evaluation are shown in Table 24 and Figure 15 respectively.
[0800]
Table 37
[0801] Figure 15 shows the volume response of glucose oxidase GOX (listed as SEQ ID NO: 117 and sold as the product Grindamyl® S860) combined with CRC08319 mature fragment, active fragment and POWERBake4080 in the application of white toast of tweed, measuring the specific volume when impact is applied without applying impact.
[0802] The mature form and active fragment of phospholipase CRC08319 are used in combination with POWERBake4080. The dosage of the mature form and active fragment of phospholipase CRC08319 used is x5.9 relative to the dosage indication provided in Example 19, Figure 1.
[0803] The combination of glucose oxidase and CRC08319 + POWERBake4080 is observed to have a positive effect on the supplement, as seen by the increase in the specific volume of glucose oxidase GOX over CRC08319 + POWERBake4080 in white toast of tweed - with and without impact.
[0804] Example 31. Experimental setup of hexose oxidase response test in the application of white toast of tweed in combination with CRC08319 + POWERBake4080 In this experiment, hexose oxidase HOX (listed as SEQ ID NO: 116 and sold as the product Grindamyl® SUREBake800, Dupont Nutrition Bioscience, Denmark) was tested in the experimental setup of white toast of tweed to show the supplement amount response in combination with "non - lysophospholipase" CRC08319 and POWERBake4080.
[0805] White toast of tweed was baked according to the description of "white toast of tweed" presented in the "Assay and Method" section above.
[0806] The experimental configurations of the application trials and the results of the firing evaluations are shown in Table 25 and Figure 16, respectively.
[0807]
Table 38
[0808] Figure 16 shows the volume responses of hexose oxidase HOX (listed as SEQ ID NO: 116 and sold as the product Grindamyl® SUREBake800) in combination with CRC08319 mature form, active fragment, and POWERBake4080 in the white toast application of tweed, where the specific volume was measured with and without impact.
[0809] The mature form and active fragment of phospholipase CRC08319 are used in combination with POWERBake4080. The dosage of the mature form and active fragment of phospholipase CRC08319 used is x5.9 relative to the dosage indication provided in Example 19, Figure 1.
[0810] The combination of hexose oxidase and CRC08319 + POWERBake4080 is observed to have a positive effect of the supplement, as seen by the increase in the specific volume of hexose oxidase HOX over CRC08319 + POWERBake4080 in white toast of tweed - with and without impact.
[0811] Example 32. Experimental analysis of the effect of CRC08319 and amylase on the pasting temperature using RVA analysis RVA analyses containing CRC08319 with or without different amylases (NBA, VERONMAXIMA, WAAA245, WAAA249, SAS3) were performed according to the RVA analysis in the assay and methods section.
[0812] Table 26. Experimental settings for the amylase response test in RVA analysis. RVA (Rapid ViscoAnalyzer) analysis including phospholipase CRC08319 mature form, active fragments with or without different amylases - NBA (listed as SEQ ID NO: 120, used as product POWERFresh® Bread8100, Dupont Nutrition Bioscience, Denmark), VERONMAXIMA (enumerated as SEQ ID NO: 122, sold as product VERON® MAXIMA, AB Enzymes), WAAA245 (enumerated as SEQ ID NO: 123), WAAA249 (enumerated as SEQ ID NO: 119) or SAS3 (listed as SEQ ID NO: 121, sold as product GRINDAMYL® CAPTIVETS - E1514, Dupont Nutrition Bioscience, Denmark).
[0813] The dosage of the phospholipase CRC08319 mature form and active fragments used is x7.9 relative to the dosage indication provided in Example 19, Figure 1.
[0814] The dosages of WAAA245 and WAAA249 are shown as dosages relative to the dosage of POWERFresh® Bread8100.
[0815] The dose - response relationship is based on active units / kg of wheat flour, and the enzyme activity is assayed with blocked p - nitrophenyl - α - D - maltoheptoside (Megazyme, α - amylase reagent (Ceralpha), product code: R - CAAR4) - substrate preparation according to the manufacturer's instructions. The activity assay is performed at pH 5.6 (malic acid buffer), 30 °C for 5 minutes.
[0816] The activity of POWERFresh® Bread8100 at 250 ppm is defined as 1, and the dosages of WAAA245 and WAAA249 relative to this are shown.
[0817]
Table 39
[0818] Figure 17 shows the pasting temperature of RVA samples containing CRC08319 in combination with different amylases. CRC08319 alone provides a higher gelatinization temperature compared to the control fabric. Surprisingly, when CRC08319 is combined with an amylase, even higher adhesion temperatures are observed.
[0819] The above invention can be modified within the scope of the specific changes and the appended claims for the purpose of clarity of understanding. Also, each reference provided in this specification is hereby incorporated by reference in its entirety for all purposes to the same extent as if each reference was individually incorporated by reference. The content of any citation, including website or accession number, may change over time and means the version effective as of the filing date of this application. Unless it is clear from the context that this is not the case, any step, element, aspect, feature of an embodiment can be used in combination with any other.
Claims
**Claim 1** An isolated polypeptide having phospholipase A1 activity, comprising a protein sequence having at least 80% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO:
45. **Claim 2** The isolated polypeptide according to claim 1, comprising a protein sequence having at least 80% sequence identity with SEQ ID NO:
27. **Claim 3** The isolated polypeptide according to claim 1, comprising a protein sequence having at least 90% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO:
45. **Claim 4** The isolated polypeptide according to claim 3, comprising a protein sequence having at least 90% sequence identity with SEQ ID NO:
27. **Claim 5** The isolated polypeptide according to claim 3, comprising a protein sequence having at least 95% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO:
45. **Claim 6** The isolated polypeptide according to claim 5, comprising a protein sequence having at least 95% sequence identity with SEQ ID NO:
27. **Claim 7** The isolated polypeptide according to claim 5, comprising a protein sequence having 100% sequence identity with SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 or SEQ ID NO:
45. **Claim 8** The isolated polypeptide according to claim 7, comprising a protein sequence having 100% sequence identity with SEQ ID NO:
27. **Claim 9** A method for producing dough, comprising mixing dough components selected from the group consisting of flour, salt, water, sugar, fat, lecithin, oil emulsifier, and yeast with the isolated polypeptide according to any one of claims 1 to 8.
10. The method for producing dough according to claim 9, further comprising adding at least one additional enzyme useful for improving the dough and / or a baked product made therefrom.
11. The method for producing dough according to claim 10, wherein the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from the phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX), or oxidase.
12. The method according to claim 11, wherein the amylase is exoamylase.
13. The method according to claim 12, wherein the exoamylase is maltose-forming amylase.
14. The method according to claim 12, wherein the exoamylase is non-maltose-forming amylase.
15. The method according to claim 14, wherein the non-maltose-forming amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 to 8 D-glucopyranosyl units from the non-reducing ends of the side chains of amylopectin.
16. The method according to claim 11, wherein the additional enzyme is a phospholipase.
17. The method according to claim 16, wherein the phospholipase has galactolipase activity.
18. The method according to claim 16 or 17, wherein the phospholipase comprises a protein having at least 80, 90, 95, 99, or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO:
18.
19. Dough comprising the isolated polypeptide according to any one of claims 1 to 8.
20. The dough according to claim 19, having improved dough extensibility and / or stability.
21. The dough according to claim 20, further comprising at least one additional enzyme useful for improving the raw dough and / or the baked product made therefrom.
22. The dough according to claim 21, wherein the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from the phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
23. The dough according to claim 22, wherein the amylase is exoamylase.
24. The dough according to claim 23, wherein the exoamylase is maltose-producing amylase.
25. The dough according to claim 23, wherein the exoamylase is non-maltose-producing amylase.
26. The dough according to claim 25, wherein the non-maltose-producing amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 to 8 D-glucopyranosyl units from the non-reducing end of the side chain of amylopectin.
27. The dough according to claim 22, wherein the additional enzyme is phospholipase.
28. The dough according to claim 27, wherein the phospholipase has galactolipase activity.
29. The dough according to claim 27 or 28, wherein the phospholipase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO:
18.
30. A method for producing a baked product, comprising baking the dough according to any one of claims 19 to 29.
31. A baked product obtained by the method according to claim 30.
32. The baked product according to claim 31, having at least one improved property selected from the group consisting of improved crumb pore size, improved bubble uniformity, non-separation of the skin and the crumb, increased volume, increased crispness of the skin and improved oven spring.
33. The baked product according to claim 32, wherein the improved property is the crispness of the skin.
34. A baking premix comprising wheat flour and the isolated polypeptide according to any one of claims 1 to 8.
35. The premix according to claim 34, further comprising at least one additional enzyme useful for improving dough and / or baked products made therefrom.
36. The premix according to claim 35, wherein the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from the phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
37. The premix according to claim 36, wherein the amylase is exoamylase.
38. The premix according to claim 37, wherein the exoamylase is maltose-producing amylase.
39. The premix according to claim 37, wherein the exoamylase is non-maltose-producing amylase.
40. The premix according to claim 39, wherein the non-maltose-producing amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 to 8 D-glucopyranosyl units from the non-reducing end of the side chain of amylopectin.
41. The premix according to claim 36, wherein the additional enzyme is phospholipase.
42. The premix according to claim 41, wherein the phospholipase has galactolipase activity.
43. The premix according to claim 41 or 42, wherein the phospholipase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO:
18.
44. A baking improver comprising granules or agglomerated powder containing the isolated polypeptide according to any one of claims 1 to 9.
45. The baking improver according to claim 44, further comprising at least one additional enzyme useful for improving dough and / or baked products made therefrom.
46. The baking improver according to claim 45, wherein the additional enzyme is one or more of amylase, cyclodextrin glucanotransferase, peptidase, transglutaminase, lipase, galactolipase, a phospholipase different from the phospholipase A1, cellulase, hemicellulase, protease, protein disulfide isomerase, glycosyltransferase, peroxidase, lipoxygenase, laccase, xylanase, glucose oxidase (GOX), hexose oxidase (HOX) or oxidase.
47. The baking improver according to claim 46, wherein the amylase is exoamylase.
48. The baking improver according to claim 47, wherein the exoamylase is maltose-forming amylase.
49. The baking improver according to claim 47, wherein the exoamylase is non-maltose-forming amylase.
50. The baking improver according to claim 49, wherein the non-maltose-forming amylase hydrolyzes starch by cleaving one or more linear maltooligosaccharides containing mainly 4 to 8 D-glucopyranosyl units from the non-reducing end of the side chain of amylopectin.
51. The baking improver according to claim 46, wherein the additional enzyme is phospholipase.
52. The baking improver according to claim 51, wherein the phospholipase has galactolipase activity.
53. The baking improver according to claim 51 or 52, wherein the phospholipase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 17 and / or SEQ ID NO:
18.
54. An isolated polynucleotide comprising a nucleic acid sequence encoding the isolated polypeptide according to any one of claims 1 to 8.
55. A recombinant expression vector comprising the polynucleotide according to claim 54.
56. A host cell comprising the recombinant expression vector according to claim 55.
57. A method for modifying a phospholipid emulsifier, comprising treating the emulsifier with an enzyme comprising the isolated polypeptide according to any one of claims 1 to 8.
58. The method according to claim 57, wherein the phospholipid emulsifier is lecithin or lysophosphatidylcholine.
59. A method for producing lysophospholipids in a lipid-containing food matrix, comprising adding the isolated polypeptide according to any one of claims 1 to 8 to the lipid-containing food matrix.
60. The method for producing lysophospholipids in a lipid-containing food matrix according to claim 59, wherein the lipid-containing food matrix is selected from the group consisting of eggs and egg-containing foods, sweet bakery dough, processed meat, milk-based products, and vegetable oils.
61. A recombinant cell comprising: a) a heterologously expressed barley α-amylase subtilisin inhibitor (BASI) polypeptide; and b) a heterologously expressed protein.
62. The heterologously expressed protein is aminopeptidase, α-amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α-galactosidase, beta-galactosidase, glucose oxidase (GOX), alpha-glucosidase, β-glucosidase, glucuronidase, glycosyltransferase hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenol oxidase, polyphenol oxidase, protein disulfide isomerase, protease, ribonuclease, α-1,6-transglucosidase, transglutaminase, urokinase, xylanase, or β-xylosidase, The recombinant cell according to claim 61.
63. The recombinant cell according to claim 62, wherein the heterologously expressed protein is a phospholipase.
64. The recombinant cell according to claim 63, wherein the phospholipase comprises the isolated polypeptide according to any one of claims 1 to 8.
65. The recombinant cell according to any one of claims 61 to 64, wherein the cell is a bacterial cell, a fungal cell, a yeast cell, a plant cell, or a mammalian cell.
66. The recombinant cell according to claim 65, wherein the cell is Trichoderma, Aspergillus, Bacillus or Myceliophthora.
67. The recombinant cell according to claim 66, wherein the cell is Trichoderma reesei.
68. The recombinant cell according to claim 66, wherein the cell is Aspergillus niger or Aspergillus oryzae.
69. The recombinant cell according to claim 66, wherein the cell is Bacillus subtilis or Bacillus licheniformis.
70. The recombinant cell according to any one of claims 61 to 69, wherein the BASI polypeptide comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
58.
71. A fermentation broth comprising the cell according to any one of claims 61 to 70.
72. A method for reducing proteolysis of a heterologously expressed protein, comprising: a) culturing a recombinant cell comprising a heterologously expressed barley alpha - amylase / subtilisin inhibitor (BASI) polypeptide and b) the heterologously expressed protein under conditions suitable for the production of the heterologously expressed protein and the BASI polypeptide.
73. The method according to claim 72, further comprising isolating the heterologously expressed protein.
74. The method according to claim 72 or 73, wherein the heterologous expressed protein is aminopeptidase, α - amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α - galactosidase, beta - galactosidase, glucose oxidase (GOX), alpha - glucosidase, β - glucosidase, glucuronidase, glycosyltransferase, hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenol oxidase, polyphenol oxidase, protein disulfide isomerase, protease, ribonuclease, α - 1,6 - transglucosidase, transglutaminase, urokinase, xylanase, or β - xylosidase.
75. The method according to claim 74, wherein the heterologous expressed protein is phospholipase.
76. The method according to claim 70, wherein the phospholipase comprises the isolated polypeptide according to any one of claims 1 - 8.
77. The method according to any one of claims 72 - 76, wherein the cell is a bacterial cell, a fungal cell, a yeast cell, a plant cell or a mammalian cell.
78. The method according to claim 77, wherein the cell is Trichoderma, Aspergillus, Bacillus or Myceliophthora.
79. The method according to claim 78, wherein the cell is Trichoderma reesei.
80. The method according to claim 78, wherein the cell is Aspergillus niger or Aspergillus oryzae.
81. The method according to claim 78, wherein the cell is Bacillus subtilis or Bacillus licheniformis.
82. The method according to any one of claims 72 to 81, wherein the BASI polypeptide comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
58.
83. A method for reducing proteolysis of a recombinantly expressed protein, comprising isolating the recombinantly expressed protein in the presence of an exogenously added barley α - amylase / subtilisin inhibitor (BASI) polypeptide.
84. The method according to claim 83, wherein the recombinantly expressed protein comprises aminopeptidase, α - amylase, arabinanase, arabinofuranosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, cyclodextrin glycosyltransferase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, α - galactosidase, beta - galactosidase, glucose oxidase (GOX), alpha - glucosidase, β - glucosidase, glucuronidase, glycosyltransferase hemicellulase, hexose oxidase (HOX), invertase, isomerase, laccase, ligase, lipase, lipoxygenase, mannanase, mannosidase, peroxidase, phospholipase, galactolipase, oxidase, phytase, phenol oxidase, polyphenol oxidase, protein disulfide isomerase, protease, ribonuclease, α - 1,6 - transglucosidase, transglutaminase, urokinase, xylanase, or β - xylosidase.
85. The method according to claim 84, wherein the recombinantly expressed protein is a phospholipase.
86. The method according to claim 84, wherein the phospholipase comprises the isolated polypeptide according to any one of claims 1 to 8.
87. The method according to any one of claims 83 to 86, wherein the cell is a bacterial cell, a fungal cell, a yeast cell, a plant cell or a mammalian cell.
88. The method according to claim 87, wherein the cell is Trichoderma, Aspergillus, Bacillus or Myceliophthora.
89. The method according to claim 88, wherein the cell is Trichoderma reesei.
90. The method according to claim 88, wherein the cell is Aspergillus niger or Aspergillus oryzae.
91. The method according to claim 88, wherein the cell is Bacillus subtilis or Bacillus licheniformis.
92. The method according to any one of claims 83 to 91, wherein the BASI polypeptide comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
58.
93. The recombinant cell according to claim 66, wherein the cell is Myceliophthora thermophila.
94. The method according to claim 78, wherein the cell is Myceliophthora thermophila.
95. The method according to claim 88, wherein the cell is Myceliophthora thermophila.
96. The method according to claim 11, wherein the amylase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO:
123.
97. The method according to claim 11, wherein the xylanase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
118.
98. The method according to claim 11, wherein the glucose oxidase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
117.
99. The method according to claim 11, wherein the hexose oxidase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
116.
100. The fabric according to claim 22, wherein the amylase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO:
123.
101. The fabric according to claim 22, wherein the xylanase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
118.
102. The fabric according to claim 22, wherein the glucose oxidase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
117.
103. The fabric according to claim 22, wherein the hexose oxidase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
116.
104. The premix according to claim 36, wherein the amylase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO:
123.
105. The premix according to claim 36, wherein the xylanase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
118.
106. The premix according to claim 36, wherein the glucose oxidase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
117.
107. The premix according to claim 36, wherein the hexose oxidase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
116.
108. The baking improver according to claim 46, wherein the amylase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122 or SEQ ID NO:
123.
109. The baking improver according to claim 46, wherein the xylanase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
118.
110. The baking improver according to claim 46, wherein the glucose oxidase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO:
117.
111. The baking improver according to claim 46, wherein the hexose oxidase comprises a protein having at least 80, 90, 95, 99 or 100% sequence identity with SEQ ID NO: 116.