Recombinant Oncolytic Virus and Its Use

Abstract

Recombinant oncolytic viruses and their uses are provided. The recombinant oncolytic virus comprises an M protein and a cytokine encoded by a foreign gene. The M protein includes a mutation from methionine to arginine at position 51 (M51R), a mutation from valine to phenylalanine at position 221 (V221F), and a mutation from serine to arginine at position 226 (S226R) compared to the amino acid sequence shown in SEQ ID NO: 1. All of the provided recombinant oncolytic viruses have good infectivity and in vitro killing ability against abnormally proliferating (tumor) LLC cells, 4T1 cells, MC38 cells, and Hela cells, and are difficult to be removed within LLC cells, 4T1 cells, MC38 cells, and Hela cells, and the infectivity against normal cells is significantly reduced.

Description

Technical Field

[0001] The present application relates to the technical field of biopharmaceuticals, and more specifically, to recombinant oncolytic viruses and their uses.

Background Art

[0002] Oncolytic viruses are tumor-killing viruses with replication ability and are currently widely accepted as an important field of tumor immunotherapy. Oncolytic viruses specifically target infected tumor cells. For example, due to the inactivation or deficiency of tumor suppressor genes in tumor cells, they selectively infect tumor cells. After infecting tumor cells, oncolytic viruses replicate massively within the tumor cells and ultimately destroy the tumor cells, thus killing the tumor cells. At the same time, oncolytic viruses can also provide immune-stimulatory signals necessary to enhance the host's own anti-cancer response, attract more immune cells, and continue to kill the remaining tumor cells.

[0003] Although oncolytic viruses hold great potential for good applications in the field of tumor immunotherapy, wild-type oncolytic viruses may always cause problems such as inflammation of the body's nervous system, and there is still a significant pathogenic risk in the process of using wild-type viruses to infect tumor cells. Therefore, in order to further promote the clinical application of oncolytic viruses, it is necessary to modify wild-type oncolytic viruses to obtain attenuated oncolytic viruses. Using attenuated oncolytic viruses in clinical applications thus reduces the pathogenic risk of oncolytic viruses and improves the safety of oncolytic viruses.

[0004] However, in the process of modifying oncolytic viruses, random genetic modification of wild-type oncolytic viruses can reduce their toxicity, but the modified oncolytic viruses may have a low cure rate and may not even be packaged, which is disadvantageous for promoting the clinical application of oncolytic viruses.

Summary of the Invention

Problems to be Solved by the Invention

[0005] In order to further improve the infectivity and killing ability of oncolytic viruses against tumor cells in vitro and in vivo, and to reduce the infectivity of oncolytic viruses against normal cells, the present application provides recombinant oncolytic viruses and their uses.

Means for Solving the Problems

[0006] The recombinant oncolytic virus provided in the present application adopts the following technical solutions.

[0007] A recombinant oncolytic virus comprising an M protein and a cytokine encoded by a foreign gene, wherein the M protein has a mutation from methionine to arginine at position 51 (M51R), a mutation from valine to phenylalanine at position 221 (V221F), and a mutation from serine to arginine at position 226 (S226R) compared to the amino acid sequence shown in SEQ ID NO: 1.

[0008] Furthermore, the M protein further comprises one or more site mutations such as a mutation from asparagine to serine at position 32 (N32S), and / or a mutation from asparagine to aspartic acid at position 49 (N49D), and / or a mutation from histidine to tyrosine at position 54 (H54Y), and / or a mutation from valine to isoleucine at position 225 (V225I).

[0009] Furthermore, the M protein further comprises one or more site mutations such as a knockout of the leucine-coding base at position 111, or a mutation from leucine to alanine at position 111 (L111A).

[0010] Furthermore, the M protein further includes one or more site mutations such as a mutation from glycine to alanine (G21E) at the 21st site, and / or a mutation from methionine to alanine (M33A) at the 33rd site, and / or a mutation from alanine to threonine (A133T) at the 133rd site.

[0011] In a specific embodiment, the site mutation of the M protein includes a mutation from methionine to arginine (M51R) at the 51st site.

[0012] In a specific embodiment, the site mutation of the M protein includes a mutation from valine to phenylalanine (V221F) at the 221st site.

[0013] In a specific embodiment, the site mutation of the M protein includes a mutation from serine to arginine (S226R) at the 226th site.

[0014] In a specific embodiment, the site mutation of the M protein includes a mutation from asparagine to serine (N32S) at the 32nd site.

[0015] In a specific embodiment, the site mutation of the M protein includes a mutation from asparagine to aspartic acid (N49D) at the 49th site.

[0016] In a specific embodiment, the site mutation of the M protein includes a mutation from histidine to tyrosine (H54Y) at the 54th site.

[0017] In a specific embodiment, the site mutation of the M protein includes a mutation from valine to isoleucine (V225I) at the 225th site.

[0018] In a specific embodiment, the site mutation of the M protein includes a knockout of the leucine-coding base at the 111th site.

[0019] In a specific embodiment, the site mutation of the M protein includes a mutation from leucine to alanine (L111A) at the 111th site.

[0020] In a specific embodiment, the site mutation of the M protein includes a mutation from glycine to alanine (G21E) at the 21st site.

[0021] In a specific embodiment, the site mutation of the M protein includes a mutation from methionine to alanine (M33A) at the 33rd site.

[0022] In a specific embodiment, the site mutation of the M protein includes a mutation from alanine to threonine (A133T) at the 133rd site.

[0023] In a specific embodiment, the M protein has amino acid substitutions of M51R, V221F, and S226R.

[0024] In a specific embodiment, the M protein has amino acid substitutions of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R.

[0025] In a specific embodiment, the M protein has amino acid substitutions of N32S, N49D, M51R, H54Y, knockout of the leucine - coding base at the 111th site, V221F, V225I, and S226R.

[0026] In a specific embodiment, the M protein has amino acid substitutions of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R.

[0027] In a specific embodiment, the M protein has amino acid substitutions of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R.

[0028] In a specific embodiment, the M protein has amino acid substitutions of G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R.

[0029] In a specific embodiment, the M protein has amino acid substitutions of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R.

[0030] In a specific embodiment, the M protein has amino acid substitutions of N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R.

[0031] In a specific embodiment, the M protein has amino acid substitutions of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R.

[0032] In a specific embodiment, the M protein has amino acid substitutions of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R.

[0033] In the present application, the wild-type VSV virus Indiana Mudd Summer subtype M protein contains the amino acid sequence shown in SEQ ID NO: 1.

[0034] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 2.

[0035] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 3.

[0036] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 4.

[0037] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 5.

[0038] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 6.

[0039] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 7.

[0040] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 8.

[0041] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 9.

[0042] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 10.

[0043] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 11.

[0044] Furthermore, the cytokine is selected from interleukin, interferon, tumor necrosis factor, colony stimulating factor, transforming growth factor β, and chemokine family.

[0045] Furthermore, the cytokine is selected from any one or more of GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β, and TNF-α.

[0046] Furthermore, the cytokine is selected from any one or more of GM-CSF, IL-2, IL-9, IL-12, IL-15, IL-18, TNF-α, and IFN-β.

[0047] In a specific embodiment, the cytokine is GM-CSF.

[0048] In a specific embodiment, the cytokine is IL-2.

[0049] In a specific embodiment, the cytokine is IL-12.

[0050] In a specific embodiment, the cytokine is IL-15.

[0051] In a specific embodiment, the cytokine is IL-18.

[0052] In a specific embodiment, the cytokine is TNF-α.

[0053] In a specific embodiment, the cytokine is IFN-β.

[0054] In a specific embodiment, the cytokine GM-CSF comprises the amino acid sequence shown in SEQ ID NO: 20.

[0055] In a specific embodiment, the cytokine IL-2 comprises the amino acid sequence shown in SEQ ID NO: 21.

[0056] In a specific embodiment, the cytokine IL-12-A comprises the amino acid sequence shown in SEQ ID NO: 22.

[0057] In a specific embodiment, the cytokine IL-12-B comprises the amino acid sequence shown in SEQ ID NO: 23.

[0058] In a specific embodiment, the cytokine IL-15 comprises the amino acid sequence shown in SEQ ID NO: 24.

[0059] In a specific embodiment, the cytokine IL-18 comprises the amino acid sequence shown in SEQ ID NO: 25.

[0060] In a specific embodiment, the cytokine TNF-α comprises the amino acid sequence shown in SEQ ID NO: 26.

[0061] In a specific embodiment, the cytokine IFN-β comprises the amino acid sequence shown in SEQ ID NO: 27.

[0062] In a specific embodiment, the cytokine IL-12-A comprises the amino acid sequence shown in SEQ ID NO: 28.

[0063] In a specific embodiment, the cytokine IL-12-A comprises the amino acid sequence shown in SEQ ID NO: 29.

[0064] In a specific embodiment, the cytokine IL-12-A comprises the amino acid sequence shown in SEQ ID NO: 30.

[0065] In a specific embodiment, the cytokine IL-15 comprises the amino acid sequence shown in SEQ ID NO: 31.

[0066] In a specific embodiment, the cytokine IL-18 comprises the amino acid sequence shown in SEQ ID NO: 32.

[0067] A recombinant oncolytic virus comprising the above-mentioned M protein, wherein the recombinant oncolytic virus further comprises a G protein, and the G protein has a mutation from valine to isoleucine (V53I) at the 53rd site, and / or a mutation from alanine to valine (A141V) at the 141st site, and / or a mutation from aspartic acid to tyrosine (D172Y) at the 172nd site, and / or a mutation from lysine to glutamic acid (K217E) at the 217th site, and / or a mutation from aspartic acid to glycine (D232G) at the 232nd site, and / or a mutation from valine to alanine (V331A) at the 331st site, and / or a mutation from valine to glutamic acid (V371E) at the 371st site, and / or a mutation from glycine to aspartic acid (G436D) at the 436th site, and / or a mutation from threonine to serine (T438S) at the 438th site, and / or a mutation from phenylalanine to leucine (F453L) at the 453rd site, and / or a mutation from threonine to isoleucine (T471I) at the 471st site, and / or a mutation from tyrosine to histidine (Y487H) at the 487th site, etc., including one or more site mutations.

[0068] In a specific embodiment, the site mutation of the G protein includes a mutation from valine to isoleucine (V53I) at the 53rd site.

[0069] In a specific embodiment, the site mutation of the G protein includes a mutation from alanine to valine (A141V) at the 141st site.

[0070] In a specific embodiment, the site mutation of the G protein includes a mutation from aspartic acid to tyrosine (D172Y) at the 172nd site.

[0071] In a specific embodiment, the site mutation of the G protein includes a mutation from lysine to glutamic acid (K217E) at the 217th site.

[0072] In a specific embodiment, the site mutation of the G protein includes a mutation from aspartic acid to glycine (D232G) at the 232nd site.

[0073] In a specific embodiment, the site mutation of the G protein includes a mutation from valine to alanine (V331A) at the 331st site.

[0074] In a specific embodiment, the site mutation of the G protein includes a mutation from valine to glutamic acid (V371E) at the 371st site.

[0075] In a specific embodiment, the site mutation of the G protein includes a mutation from glycine to aspartic acid (G436D) at the 436th site.

[0076] In a specific embodiment, the site mutation of the G protein includes a mutation from threonine to serine (T438S) at the 438th site.

[0077] In a specific embodiment, the site mutation of the G protein includes a mutation from phenylalanine to leucine (F453L) at the 453rd site.

[0078] In a specific embodiment, the site mutation of the G protein includes a mutation from threonine to isoleucine (T471I) at the 471st site.

[0079] In a specific embodiment, the site mutation of the G protein includes a mutation from tyrosine to histidine (Y487H) at the 487th site.

[0080] In a specific embodiment, the G protein has an amino acid substitution of V53I.

[0081] In a specific embodiment, the G protein has amino acid substitutions of V53I and A141V.

[0082] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, and D172Y.

[0083] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, and K217E.

[0084] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, and D232G.

[0085] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, and V331A.

[0086] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, and V371E.

[0087] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, and G436D.

[0088] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, and T438S.

[0089] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, and F453L.

[0090] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, and T471I.

[0091] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0092] In a specific embodiment, the G protein has amino acid substitutions of A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0093] In a specific embodiment, the G protein has amino acid substitutions of D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0094] In a specific embodiment, the G protein has amino acid substitutions of K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0095] In a specific embodiment, the G protein has amino acid substitutions of D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0096] In a specific embodiment, the G protein has amino acid substitutions of V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0097] In a specific embodiment, the G protein has amino acid substitutions of V371E, G436D, T438S, F453L, T471I, and Y487H.

[0098] In a specific embodiment, the G protein has amino acid substitutions of G436D, T438S, F453L, T471I, and Y487H.

[0099] In a specific embodiment, the G protein has amino acid substitutions of T438S, F453L, T471I, and Y487H.

[0100] In a specific embodiment, the G protein has amino acid substitutions of F453L, T471I, and Y487H.

[0101] In a specific embodiment, the G protein has amino acid substitutions of T471I and Y487H.

[0102] In a specific embodiment, the G protein has an amino acid substitution of Y487H.

[0103] In the present application, the G protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO: 12.

[0104] In a specific embodiment, the G protein contains the amino acid sequence shown in SEQ ID NO: 13.

[0105] A recombinant oncolytic virus comprising the above M protein or the above M protein and G protein, wherein the recombinant oncolytic virus further comprises an N protein, and the N protein has a mutation from isoleucine to valine (I14V) at the 14th site, and / or a mutation from arginine to lysine (R155K) at the 155th site, and / or a mutation from serine to asparagine (S353N) at the 353rd site, etc., compared to the amino acid sequence shown in SEQ ID NO: 14.

[0106] In a specific embodiment, the site mutation of the N protein includes a mutation from isoleucine to valine (I14V) at the 14th site.

[0107] In a specific embodiment, the site mutation of the N protein includes a mutation from arginine to lysine (R155K) at the 155th site.

[0108] In a specific embodiment, the site mutation of the N protein includes a mutation from serine to asparagine (S353N) at the 353rd site.

[0109] In a specific embodiment, the N protein has an amino acid substitution of I14V.

[0110] In a specific embodiment, the N protein has amino acid substitutions of I14V and R155K.

[0111] In a specific embodiment, the N protein has amino acid substitutions of I14V, R155K, and S353N.

[0112] In a specific embodiment, the N protein has amino acid substitutions of R155K and S353N.

[0113] In a specific embodiment, the N protein has an amino acid substitution of S353N.

[0114] In the present application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype includes the amino acid sequence shown in SEQ ID NO: 14.

[0115] In a specific embodiment, the N protein includes the amino acid sequence shown in SEQ ID NO: 15.

[0116] A recombinant oncolytic virus comprising the above-mentioned M protein, or the above-mentioned M protein and G protein, or the above-mentioned M protein, G protein and N protein, wherein the recombinant oncolytic virus further comprises a P protein, and the P protein has a mutation from arginine to lysine at position 50 (R50K), and / or a mutation from valine to alanine at position 76 (V76A), and / or a mutation from asparagine to glutamic acid at position 99 (D99E), and / or a mutation from leucine to serine at position 126 (L126S), and / or a mutation from leucine to serine at position 140 (L140S), and / or a mutation from histidine to tyrosine at position 151 (H151Y), and / or a mutation from isoleucine to methionine at position 168 (I168M), and / or a mutation from lysine to glutamic acid at position 170 (K170E), and / or a mutation from tyrosine to serine at position 189 (Y189S), and / or a mutation from asparagine to aspartic acid at position 237 (N237D), etc., compared with the amino acid sequence shown in SEQ ID NO: 16, and contains one or more site mutations.

[0117] In a specific embodiment, the site mutation of the P protein includes a mutation from arginine to lysine at position 50 (R50K).

[0118] In a specific embodiment, the site mutation of the P protein includes a mutation from valine to alanine at position 76 (V76A).

[0119] In a specific embodiment, the site mutation of the P protein includes a mutation from asparagine to glutamic acid at position 99 (D99E).

[0120] In a specific embodiment, the site mutation of the P protein includes a mutation from leucine to serine at position 126 (L126S).

[0121] In a specific embodiment, the site mutation of the P protein includes a mutation from leucine to serine at position 140 (L140S).

[0122] In a specific embodiment, the site mutation of the P protein includes a mutation from histidine to tyrosine at position 151 (H151Y).

[0123] In a specific embodiment, the site mutation of the P protein includes a mutation from isoleucine to methionine at position 168 (I168M).

[0124] In a specific embodiment, the site mutation of the P protein includes a mutation from lysine to glutamate at position 170 (K170E).

[0125] In a specific embodiment, the site mutation of the P protein includes a mutation from tyrosine to serine at position 189 (Y189S).

[0126] In a specific embodiment, the site mutation of the P protein includes a mutation from asparagine to aspartic acid at position 237 (N237D).

[0127] In a specific embodiment, the P protein has an amino acid substitution of R50K.

[0128] In a specific embodiment, the P protein has amino acid substitutions of R50K and V76A.

[0129] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, and D99E.

[0130] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, and L126S.

[0131] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, and L140S.

[0132] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, and H151Y.

[0133] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, and I168M.

[0134] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, and K170E.

[0135] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, and Y189S.

[0136] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0137] In a specific embodiment, the P protein has amino acid substitutions of V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0138] In a specific embodiment, the P protein has amino acid substitutions of D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0139] In a specific embodiment, the P protein has amino acid substitutions of L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0140] In a specific embodiment, the P protein has amino acid substitutions of L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0141] In a specific embodiment, the P protein has amino acid substitutions of H151Y, I168M, K170E, Y189S, and N237D.

[0142] In a specific embodiment, the P protein has amino acid substitutions of I168M, K170E, Y189S, and N237D.

[0143] In a specific embodiment, the P protein has amino acid substitutions of K170E, Y189S, and N237D.

[0144] In a specific embodiment, the P protein has amino acid substitutions of Y189S and N237D.

[0145] In a specific embodiment, the P protein has an amino acid substitution of N237D.

[0146] In this application, the P protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO: 16.

[0147] In a specific embodiment, the N protein contains the amino acid sequence shown in SEQ ID NO: 17.

[0148] A recombinant oncolytic virus comprising the above-mentioned M protein, or the above-mentioned M protein and G protein, or the above-mentioned M protein, G protein and N protein, or the above-mentioned M protein, G protein, N protein and P protein, wherein the recombinant oncolytic virus further comprises an L protein, and the L protein contains one or more site mutations such as a mutation from serine to proline (S87P) at the 87th site and / or a mutation from isoleucine to threonine (I487T) at the 487th site as compared with the amino acid sequence shown in SEQ ID NO: 18.

[0149] In a specific embodiment, the site mutation of the L protein comprises a mutation from serine to proline (S87P) at the 87th site.

[0150] In a specific embodiment, the site mutation of the L protein comprises a mutation from isoleucine to threonine (I487T) at the 487th site.

[0151] In a specific embodiment, the L protein has amino acid substitutions of S87P and I487T.

[0152] In the present application, the L protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO: 18.

[0153] In a specific embodiment, the L protein contains the amino acid sequence shown in SEQ ID NO: 19.

[0154] In some specific embodiments, the recombinant oncolytic virus is obtained by performing site-specific mutations based on baculovirus.

[0155] In some specific embodiments, the recombinant oncolytic virus is obtained by performing site-specific mutations based on Vesicular Stomatitis Virus (abbreviated as "VSV") virus.

[0156] In some specific embodiments, the recombinant oncolytic virus is obtained by performing site-specific mutations based on the VSV virus Indiana MuddSummer subtype.

[0157] In some specific embodiments, the recombinant oncolytic virus further contains or expresses an exogenous target protein.

[0158] In some specific embodiments, the recombinant oncolytic virus contains a nucleic acid molecule, and the nucleic acid molecule includes a nucleic acid sequence encoding the M protein having a site mutation, and / or a nucleic acid sequence encoding the G protein having a site mutation, and / or a nucleic acid sequence encoding the N protein having a site mutation, and / or a nucleic acid sequence encoding the P protein having a site mutation, and / or a nucleic acid sequence encoding the L protein having a site mutation, and a nucleic acid sequence encoding the cytokine.

[0159] In some specific embodiments, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation.

[0160] In some specific embodiments, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the M protein having a site mutation, and / or the nucleic acid sequence encoding the G protein having a site mutation, and / or the nucleic acid sequence encoding the N protein having a site mutation, and / or the nucleic acid sequence encoding the P protein having a site mutation, and / or the nucleic acid sequence encoding the L protein having the site mutation.

[0161] In a second aspect, the present application provides a recombinant oncolytic virus expression vector and adopts the following technical solutions.

[0162] A recombinant oncolytic virus expression vector, wherein the recombinant oncolytic virus expression vector can express the above-mentioned recombinant oncolytic virus.

[0163] In a third aspect, the present application provides virus-producing cells and adopts the following technical solutions.

[0164] Virus-producing cells, wherein the virus-producing cells can produce the above-mentioned recombinant oncolytic virus.

[0165] In a fourth aspect, the present application provides a vaccine and adopts the following technical solutions.

[0166] A vaccine, wherein the vaccine is prepared by the above-mentioned recombinant oncolytic virus.

[0167] In a fifth aspect, the present application provides a pharmaceutical composition and adopts the following technical solutions.

[0168] A pharmaceutical composition, wherein the pharmaceutical composition comprises the above-mentioned recombinant oncolytic virus or the above-mentioned vaccine and, optionally, a pharmaceutically acceptable carrier.

[0169] In a sixth aspect, the present application provides a method for preparing the above-mentioned recombinant oncolytic virus, the above-mentioned recombinant oncolytic virus expression vector, the above-mentioned virus-producing cells, the above-mentioned vaccine, and the above-mentioned pharmaceutical composition.

[0170] In a seventh aspect, the present application further provides the use of the above-mentioned recombinant oncolytic virus, the above-mentioned oncolytic virus expression vector, the above-mentioned virus-producing cells, the above-mentioned vaccine, and the above-mentioned pharmaceutical composition in the preparation of a medicament for preventing and / or treating a disease and / or illness.

[0171] In some specific embodiments, the recombinant oncolytic virus, the recombinant oncolytic virus expression vector, the virus-producing cell, the vaccine and / or the pharmaceutical composition are used in a method for continuously killing abnormal proliferating cells.

[0172] In some specific embodiments, the abnormal proliferating cells are selected from tumor cells or tumor tissue-related cells.

[0173] In an eighth aspect, the present application provides the use of the above-mentioned recombinant oncolytic virus, the above-mentioned vaccine, and the above-mentioned pharmaceutical composition in the preparation of a medicament for treating tumors.

[0174] In some specific embodiments, the tumor includes solid tumors or hematological tumors.

[0175] In some specific embodiments, the tumors include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic myeloid leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasms, colorectal cancer, endometrial cancer, epithelioma, esophageal cancer, diffuse large B-cell lymphoma, neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell histiocytosis, pharyngeal cancer, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and angioma.

Advantages of the Invention

[0176] In short, the present application has the following beneficial effects.

[0177] All the recombinant oncolytic viruses provided in this application have good infectivity and in vitro killing ability against abnormally proliferating (tumor) LLC cells, 4T1 cells, MC38 cells and Hela cells, and are difficult to be removed in LLC cells, 4T1 cells, MC38 cells and Hela cells. And all the recombinant oncolytic viruses provided in this application have low infectivity to normal MEF cells, low in vitro killing ability, and are easily removed in normal MEF cells of the recombinant oncolytic viruses provided in this application. Therefore, the recombinant oncolytic viruses provided in this application are often used for the infection and killing of cells such as tumors and cancers, and are easily removed in cells such as tumors and cancers. While further improving the cure rate of the recombinant oncolytic viruses in cells such as tumors and cancers, the recombinant oncolytic viruses provided above do not damage normal cells, and when they are in normal cells, they are more easily removed, further ensuring the safety of normal cells.

Brief Description of Drawings

[0178]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

[0179] In the above drawings, No. 0 on the horizontal axis represents the wild-type oncolytic virus, and Nos. 1 to 105 on the horizontal axis represent the recombinant oncolytic viruses prepared in Preparation Examples 1 to 105, respectively.

[0180] The vertical axis Log10 TCID50 represents the TCID50 value calculated by the Karber method. The larger the value of Log10 TCID50, the better the infectivity of the recombinant oncolytic virus to the cells, and the smaller the value of Log10 TCID50, the lower the infectivity of the recombinant oncolytic virus to the cells.

[0181] The vertical axis OD570 represents the OD value of the cells. The larger the value of OD570, the lower the killing ability of the recombinant oncolytic virus against the cells is shown, and the smaller the value of OD570, the better the killing ability of the recombinant oncolytic virus against the cells is shown.

[0182] The vertical axis IFN-β level represents the expression status of the IFN-β gene. The larger the value of the IFN-β level, the weaker the reproductive ability of the recombinant oncolytic virus in the cells and the easier it is to be removed is shown, and the smaller the value of the IFN-β level, the stronger the reproductive ability of the recombinant oncolytic virus in the cells and the easier it is to be removed is shown.

[0183] Those skilled in the art can easily understand other aspects and advantages of the present application from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are described and explained. As those skilled in the art understand, depending on the content of the present application, those skilled in the art can change the specific embodiments disclosed without departing from the spirit and scope of the invention according to the present application. Correspondingly, the drawings and descriptions in the specification of the present application are merely illustrative and not restrictive.

Modes for Carrying Out the Invention

[0184] Hereinafter, embodiments of the invention of the present application will be described with specific examples. However, those skilled in the art can easily understand other advantages and effects of the invention of the present application from the content disclosed in this specification.

[0185] Term Definition In the present application, the term "oncolytic virus" generally refers to a virus that can replicate and kill tumor cells in tumor cells. Oncolytic viruses include, but are not limited to, Vesicular Stomatitis Virus (abbreviated as "VSV virus"), poxvirus, herpes simplex virus, measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus, echotype enterovirus, coxsackievirus, Newcastle disease virus, and Maraba virus. In certain embodiments, the oncolytic virus is modified to improve its selectivity for tumor cells. In certain embodiments, the oncolytic virus is modified to reduce its immunogenicity.

[0186] In some embodiments, the oncolytic virus of the present application is the VSV virus.

[0187] In some embodiments, the VSV virus is a variant of the VSV virus Indiana MuddSummer subtype strain.

[0188] In some embodiments, site-specific genetic mutations may be made to the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus.

[0189] In certain embodiments, the recombinant oncolytic virus described in the present application is a genetically modified oncolytic virus, for example, by modification of one or more genes, its tumor selectivity is improved and / or it preferentially replicates in dividing cells. The genetic modification may be a modification of genes involved in the processes of DNA / RNA replication, nucleic acid metabolism, host tropism, surface attachment, toxicity, lysis and spread, or may be a modification incorporating an exogenous gene. The exogenous gene may include an exogenous immunomodulatory gene, an exogenous screening gene, an exogenous reporter gene, etc. The modified oncolytic virus is an oncolytic virus modified at the amino acid level, for example, an insertion, deletion, or substitution of one or more amino acids.

[0190] In the present application, the term "M protein" usually means the VSV virus matrix protein. The M protein is an important virulence factor of the VSV virus and is also a protein known to interfere with the innate immune response of mice in the VSV virus. The term "M protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In the present application, the M protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 1. In the present application, the M protein of the oncolytic virus may include the amino acid sequences shown in SEQ ID NOs: 2-11.

[0191] In the present application, the term "G protein" usually means the glycoprotein of the VSV virus and is also referred to as the envelope protein. The term "G protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In the present application, the G protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 12. In the present application, the G protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 13.

[0192] In this application, the term "N protein" generally refers to the nucleocapsid protein of the VSV virus. The term "N protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In this application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 14. In this application, the N protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 15.

[0193] In this application, the term "P protein" generally refers to the phosphoprotein of the VSV virus. The term "P protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In this application, the P protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 16. In this application, the P protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 17.

[0194] In this application, the term "L protein" generally refers to the RNA polymerase protein of the VSV virus. The L gene of the VSV virus encodes the RNA poly E protein. The term "L protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In this application, the L protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 18. In this application, the L protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 19.

[0195] In this application, the expression of protein mutation sites is generally represented by "amino acid + amino acid site number + mutated amino acid". In this application, the mutations include, but are not limited to, addition, substitution, deletion, and / or removal of amino acids. For example, the term "M51R" generally refers to the mutation from methionine M at position 51 to arginine R.

[0196] In the present application, the term "amino acid substitution" generally means substituting one amino acid residue present in the parental sequence with another amino acid residue. The amino acids in the parental sequence may be substituted, for example, by chemical synthesis or recombinant methods known to those skilled in the art. Therefore, "substituting at position xx" generally means substituting the amino acid present at position xx with an alternative amino acid residue. In the present application, the amino acid substitution may include amino acid mutations.

[0197] In the present application, the term "mutation" generally means changing the nucleotide or amino acid sequence of the wild-type molecule. The amino acid changes may include amino acid substitutions, deletions, insertions, additions, truncations, or protein processing and cleavage.

[0198] In the present application, the recombinant oncolytic virus simultaneously performs site-specific gene mutagenesis on the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus, and integrates a foreign gene. The foreign gene is specifically a gene encoding a cytokine.

[0199] In this application, the term "cytokines" refers to bioactive substances synthesized and secreted by immune cells (lymphocytes, monocytes, macrophages, etc.) and their related cells (vascular endothelial cells, fibroblasts, etc.) that regulate the functions of other immune cells or target cells and belong to small molecule peptides or glycoproteins. All cytokines with immunomodulatory effects can be expressed by recombinant oncolytic viruses. Depending on their main functions, cytokines can be classified into interleukin (IL), interferon (IFN), tumor necrosis factor (TNF), colony stimulating factor (CSF), transforming growth factor-β family (TGF-β family), growth factor (GF), and chemokine family.

[0200] Interleukins include IL-1, IL-2, IL-7, IL-9, IL-15, IL-21, IL-4, IL-12, and IL-18.

[0201] Specifically, regarding interleukin 1 (IL-1), IL-1 is a multifaceted cytokine related to cortical inflammatory responses, cell growth, and tissue repair. The IL-1 superfamily has 11 members, such as IL-1A, IL-1B, IL-1Ra, IL-18, etc. IL-1 is a drug target for some cancers and is also used in cell therapy. In cellular immunotherapy, IL-1 stimulates the proliferation of CD4+ T cells in vitro, induces the generation of IL-2, co-stimulates CD8+ / IL1R+ T cell activation, and stimulates the proliferation of mature B cells and the secretion of immunoglobulins.

[0202] Specifically, regarding interleukin-2 (IL-2), IL-2 is also known as a T cell growth factor. It is generated when T cells respond to an antigen or are stimulated by a mitogenic stimulus and is widely used to promote the activation and proliferation of T cells and NK cells. IL-2 stimulates the proliferation of NK cells, increases cytotoxicity, and enables NK cells to secrete various cytokines. However, further research has shown that IL-2 causes excessive differentiation of T cells, induces apoptosis of activated T cells, activates CD4+FoxP3 Treg regulatory cells, and inhibits the activation and tumor-killing activity of T cells. Therefore, IL-2 is not merely a T cell activator but is considered a T cell regulator. For this reason, there are also studies using IL-7, IL-15, and IL-21 instead of IL-2.

[0203] Specifically, regarding interleukin-7 (IL-7), IL-7 is a hematopoietic growth factor secreted by stromal cells in the bone marrow and thymus. It shares the γc receptor subunit with IL-2 and stimulates the proliferation of lymphocyte progenitor cells. IL-7 provides continuous stimulatory signals to naive T cells and memory T cells. As described above, IL-7 does not activate CD4+FoxP3+Treg cells during the activation of CD8+T cells. Clinically, IL-7 can also be used to restore the number of T cells after chemotherapy or hematopoietic stem cell transplantation. And IL-7 plays a major role at a certain stage when B cells mature and can affect their proliferation. IL-7 may also be a regulator of intestinal mucosal lymphocytes.

[0204] Specifically, regarding interleukin 15 (IL-15), IL-15 has a structure similar to IL-2, shares the γc receptor subunit, and belongs to the four α-helix helix bundle family (others include, for example, IL-2, IL-4, IL-7, IL-9, G-CSF, and GM-CSF). IL-15 regulates the activation and proliferation of T cells and NK cells. IL-15 is mainly a cell that kills viral infections in the innate immune system. At the same time, IL-15 can activate NKT cells and γδT cells. In immunocytotherapy, IL-15 causes apoptosis of activated T cells and does not activate CD8+ effector T cells. IL-15 maintains the survival of memory T cells and plays an important role in long-term antitumor activity.

[0205] Specifically, regarding interleukin 21 (IL-21), IL-21 also belongs to the IL-2 family, shares the γc receptor subunit, and has a very strong regulatory effect on immune system cells, and can induce cell division and proliferation in its target cells. In cell immunotherapy, IL-21 promotes the proliferation of CD4+ and CD8+ T cells, enhances the cytotoxicity of CD8+ T cells and NK cells, and there is no apoptosis of cells due to activation. IL-21 preferentially amplifies "young" CD27+CD28+ CD8+ T cells, and such cells have stronger cytotoxicity. Of course, since IL-21 does not cause the amplification of Tregs, the application of IL-21 in cell immunotherapy is becoming increasingly widespread.

[0206] Specifically, regarding interleukin 4 (IL-4), IL-4 activates the proliferation of activated B cells and T cells and regulates the expression of Fc receptors in lymphocytes and monocytes. IL-4 induces the conversion of Th1 cells to Th2 cells. IL-4 stimulates Th2 cells to secrete IL-4, IL-5, IL-6, IL-10, and IL-13. By suppressing macrophage growth, IL-4 guides monocytes to differentiate in the direction of dendritic cells (DCs). When IL-4 is not added to the culture system, monocytes differentiate into macrophages. IL-4 plays an important role in humoral immunity and acquired immunity, converting the B cell antibody class to IgE and upregulating the production of MHC class II molecules. When IL-4 and GM-CSF act together, they can direct the differentiation of monocytes into immature DCs. At this time, the DCs have a strong ability to capture and process antigens but a weak antigen-presenting ability. Using IL-4 and TNF-α in sequence can promote the maturation of DCs.

[0207] Specifically, regarding interleukin 12 (IL-12), IL-12 acts on activated T and NK cells, has broad biological activities, and acts on lymphocytes through the activation factor-mediated activation of the transcription protein STAT4. IL-12 is necessary for the T cell-independent induction of IFN-γ and plays an important role in the differentiation of Th1 and Th2 cells. IL12B binds to IL23A to form the IL-23 interleukin and has an acquired immune function. IL-12 is a drug target. In cellular immunotherapy, IL-12 promotes the differentiation of CD4+ T cells into CD4+ Th1 T cells and enhances the activity of CD8+ CTLs cells. The therapeutic effect of IL-12 is associated with its dosage, action time, and other cytokines that act on each other, and promotes the tumor-killing activity of immune cells through multiple mechanisms. In a mouse anti-melanoma model, high-dose IL-12 acts through NK cells, while low-dose IL-12 exerts a tumor-killing effect through NKT.

[0208] Specifically, regarding interleukin 18 (IL-18), IL-18, also known as interferon-γ-inducing factor, belongs to the inflammatory cytokines and is produced from macrophages and other cells. IL-18 can promote the secretion of IFN-γ by NK cells and CD8+ T cells and enhance the cytotoxicity of NK cells and CD8+ T cells. IL-18 can also activate macrophages, promote the development of Th1 CD4+ T cells, and promote lymphocytes to express functions such as FasL. IL-18 provides a potential therapeutic target for allergic diseases. In addition, IL-18, IL-12, and IL-15 can cooperate to maintain the Th1 response and monokine production in autoimmune diseases.

[0209] Gamma interferon is type II interferon, mainly produced by NK and NKT cells, with antiviral, antitumor and immunomodulatory effects, including IFN-γ and IFN-β. IFN-γ has an antiproliferative effect on transformed cells and can enhance the antiviral and antitumor effects of type I interferon. IFN-γ induces the expression of MHC I, MHC II and co-activating molecules in antigen-presenting cells (APCs) by activating macrophages. In addition, IFN-γ can induce changes in the expression of protein enzymes to enhance antigen-presenting ability. IFN-γ can promote the differentiation of CD4+ T cells into Th1 cells and also inhibit the subtype switching of IL-4-dependent B cells. IFN-γ activates the JAK-STAT cell pathway by phosphorylating JAK1 and JAK2 proteins. In cellular immunotherapy, IFN-γ acts on host immune cells and has a certain effect on macrophages, T cells, B cells and NK cells, etc. IFN-γ further enhances antigen-presenting ability by promoting the expression of macrophage MHC class II molecules or by inducing the expression of MHC class II molecules in cells that do not normally express MHC class II molecules (such as vascular endothelial cells, certain epithelial cells and connective tissue cells). IFN-γ can promote the differentiation of B cells and CD8+ T cells, but cannot promote their proliferation. IFN-γ can enhance the activity and immune function of TH1 cells. IFN-γ can enhance neutrophil phagocytosis, activate NK cells and enhance their cytotoxicity. Abnormal IFN-γ expression is associated with many autoinflammatory and autoimmune diseases.

[0210] Tumor necrosis factor belongs to the TNF superfamily cytokines and is a multifunctional molecule that regulates biological processes, including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. TNF-α is involved in anti-tumor effects. In cell immunotherapy, TNF-α differentiates immature DCs into mature DCs. This process is achieved by TNF-α downregulating the macropinocytosis of immature DCs and the expression of surface Fc receptors, and upregulating the expression of cell surface MHC class I, class II molecules, and B7 family molecules (such as CD80, CD86, etc.). Mature DCs have a significantly reduced ability to capture and process, but a significantly increased antigen presentation ability and can strongly activate T cells. TNF-α can affect the production of other cytokines. For example, it stimulates monocytes and macrophages to secrete IL-1, enhances the proliferation ability of IL-2-dependent thymocytes and T cells, promotes the production of lymphokines such as IL-2, CSF, and IFN-γ, and enhances the ability of mitogens or foreign antigens to stimulate the proliferation of B cells and Ig secretion.

[0211] Granulocyte macrophage colony-stimulating factor (GM-CSF) plays an important role in embryo implantation and its development. GM-CSF is one of the cytokines that was first discovered to act on DCs. In DC culture, GM-CSF promotes the differentiation of monocytes into macrophage-like cells, promotes the expression of cell surface MHC class II molecules, and enhances the antigen-presenting function of cells. In addition, GM-CSF can also promote the survival of DCs. In cellular immunotherapy, GM-CSF can activate the immune response and generate antitumor activity by activating macrophages and DCs. Regarding antigen presentation, GM-CSF can promote the maturation of DC cells, upregulate co-stimulatory molecules, and promote the expression of CD1d receptors. Recent research results have shown that GM-CSF stimulates hematopoietic progenitor cells to differentiate into monocytes and neutrophils and reduces the risk of febrile neutropenia in cancer patients. Other studies have shown that GM-CSF induces the differentiation of bone marrow DCs, promotes the polarization of Th1 cells towards the immune response, promotes angiogenesis, and affects the development of allergic inflammation and autoimmune diseases. Therefore, GM-CSF is clinically used in the treatment of malignant tumors.

[0212] In this application, the term "nucleic acid molecule" generally means nucleotides of any length. In this application, the term "nucleic acid molecule" can encode the proteins contained in the oncolytic virus. In this application, the nucleic acid molecule may include DNA and / or RNA. In some cases, the RNA may include single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), single-stranded RNA may include sense RNA, antisense RNA, or ambisense RNA.

[0213] In the present application, the term "expression vector" generally means a nucleic acid carrier. Under appropriate conditions, it can usually express a target gene and / or a target protein. In certain embodiments of the present application, the expression vector contains a nucleic acid molecule of one or more components for expressing a virus (e.g., an oncolytic virus). For example, the expression vector contains at least one viral genomic element and can be packaged into a virus or packaged as a virus particle.

[0214] In the present application, the term "virus-producing cell" generally means a cell, cell line or cell culture that may contain or already contains the nucleic acid molecule or expression vector described in the present application, or can express the recombinant oncolytic virus described in the present application. The cells may include the progeny of a single host cell. The cells may be obtained by using the expression vector transfection in vitro described in the present application.

[0215] In the present application, the term "pharmaceutical composition" means a preparation that does not contain another component that is toxic enough to be unacceptable to the subject to which it is administered in a form that enables the biological activity of the active ingredient. In certain embodiments, these preparations may include the active ingredient of the drug and a pharmaceutically acceptable carrier. In certain embodiments, the pharmaceutical product includes a pharmaceutical product for parenteral, transdermal, intraluminal, intraarterial, intrathecal and / or intranasal administration or direct injection into tissue. The pharmaceutical product may be administered in different ways, such as intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration.

[0216] In this application, the term "prevention" generally means preventing the occurrence, onset, recurrence, and / or spread of a disease or one or more of its symptoms by taking certain measures in advance. In this application, the term "treatment" generally means eliminating and improving a disease or one or more symptoms associated with the disease. In certain embodiments, treatment generally means administering one or more drugs to a patient suffering from this disease to eliminate or relieve the disease. In certain embodiments, "treatment" may be the pharmaceutical composition and / or drug product administered in the presence or absence of other drugs after the onset of symptoms of a specific disease. For example, the pharmaceutical composition and / or drug product described in this application is used to prevent the occurrence, development, recurrence, and / or metastasis of tumors.

[0217] In this application, the term "tumor" generally means the growth of any new pathological tissue. Tumors can be benign or malignant. In this application, the tumor may be a solid tumor and / or a hematoma. For research purposes, these tissues can be isolated from sources readily available by methods well known to those skilled in the art.

[0218] A wild-type VSV virus, specifically, the VSV Indiana strain and the VSV Indiana MuddSummer subtype strain. The amino acid sequence of its M protein is shown in SEQ ID NO: 1, the amino acid sequence of its G protein is shown in SEQ ID NO: 12, the amino acid sequence of its N protein is shown in SEQ ID NO: 14, the amino acid sequence of its P protein is shown in SEQ ID NO: 16, and the amino acid sequence of its L protein is shown in SEQ ID NO: 18. In this application, the M protein, G protein, N protein, P protein, and L protein can all be modified.

[0219] A oncolytic virus, which is obtained by mutating sites in the amino acid sequences of its M protein, G protein, N protein, P protein, and L protein based on the above wild-type VSV virus.

[0220] The present application provides a recombinant oncolytic virus. The recombinant oncolytic virus is obtained by introducing a foreign gene encoding a cytokine based on the above oncolytic virus.

[0221] The recombinant oncolytic virus contains an M protein and a cytokine encoded by a foreign gene. The M protein includes a mutation from methionine to arginine at the 51st site (M51R), a mutation from valine to phenylalanine at the 221st site (V221F), and a mutation from serine to arginine at the 226th site (S226R) compared to the amino acid sequence shown in SEQ ID NO: 1.

[0222] The M protein further includes one or more site mutations such as a mutation from asparagine to serine at the 32nd site (N32S), and / or a mutation from asparagine to aspartic acid at the 49th site (N49D), and / or a mutation from histidine to tyrosine at the 54th site (H54Y), and / or a mutation from valine to isoleucine at the 225th site (V225I).

[0223] The M protein further includes one or more site mutations such as knockout of the leucine - coding base at the 111th site, or a mutation from leucine to alanine at the 111th site (L111A).

[0224] The M protein further includes one or more site mutations such as a mutation from glycine to alanine at the 21st site (G21E), and / or a mutation from methionine to alanine at the 33rd site (M33A), and / or a mutation from alanine to threonine at the 133rd site (A133T). For example, the M protein includes the amino acid sequences shown in SEQ ID NOs: 2 - 11.

[0225] In the present application, the M protein includes amino acid substitutions at the 51st site, 221st site, and 226th site.

[0226] In the present application, the M protein includes amino acid substitutions at positions 32, 49, 51, 54, 221, 225, and 226.

[0227] In the present application, the M protein includes amino acid substitutions at positions 32, 49, 51, 54, 111, 221, 225, and 226.

[0228] In the present application, the M protein includes amino acid substitutions at positions 21, 32, 49, 51, 54, 221, 225, and 226.

[0229] In the present application, the M protein includes amino acid substitutions at positions 21, 32, 33, 49, 51, 54, 221, 225, and 226.

[0230] In the present application, the M protein includes amino acid substitutions at positions 21, 32, 33, 49, 51, 54, 133, 221, 225, and 226.

[0231] In the present application, the M protein includes amino acid substitutions at positions 32, 33, 49, 51, 54, 221, 225, and 226.

[0232] In the present application, the M protein includes amino acid substitutions at positions 32, 33, 49, 51, 54, 133, 221, 225, and 226.

[0233] In the present application, the M protein includes amino acid substitutions at positions 32, 49, 51, 54, 133, 221, 225, and 226.

[0234] In this application, the M protein may contain amino acid substitutions at other positions.

[0235] Furthermore, the cytokine is selected from interleukin, interferon, tumor necrosis factor, colony stimulating factor, transforming growth factor-β, chemokine family, and growth factor.

[0236] Furthermore, the cytokine is selected from any one or more of GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β, and TNF-α.

[0237] Furthermore, the cytokine is selected from any one or more of GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, and IFN-β.

[0238] A recombinant oncolytic virus containing the above-mentioned M protein, wherein the recombinant oncolytic virus further contains a G protein, and the G protein has a mutation from valine to isoleucine (V53I) at the 53rd site, and / or a mutation from alanine to valine (A141V) at the 141st site, and / or a mutation from aspartic acid to tyrosine (D172Y) at the 172nd site, and / or a mutation from lysine to glutamic acid (K217E) at the 217th site, and / or a mutation from aspartic acid to glycine (D232G) at the 232nd site, and / or a mutation from valine to alanine (V331A) at the 331st site, and / or a mutation from valine to glutamic acid (V371E) at the 371st site, and / or a mutation from glycine to aspartic acid (G436D) at the 436th site, and / or a mutation from threonine to serine (T438S) at the 438th site, and / or a mutation from phenylalanine to leucine (F453L) at the 453rd site, and / or a mutation from threonine to isoleucine (T471I) at the 471st site, and / or a mutation from tyrosine to histidine (Y487H) at the 487th site, compared with the amino acid sequence shown in SEQ ID NO: 12. For example, the G protein contains the amino acid sequence shown in SEQ ID NO: 13.

[0239] In the present application, the G protein may contain amino acid mutations at the 53rd site, 141st site, 172nd site, 217th site, 232nd site, 331st site, 371st site, 436th site, 438th site, 453rd site, 471st site and 487th site.

[0240] In the present application, the G protein may contain amino acid substitutions at other positions.

[0241] In one embodiment, the G protein comprises at least one or more amino acid substitutions in a conserved region. For example, the conserved region may comprise the amino acids at positions 437-461 of the G protein. In one embodiment, the G protein comprises at least one or more amino acid substitutions in a cleavage region of the cytoplasmic domain. For example, the cleavage region of the cytoplasmic domain may comprise the amino acids at positions 483-511 of the G protein.

[0242] The recombinant oncolytic virus comprising the above M protein, or the above M protein and G protein, further comprises an N protein, and the N protein has a mutation from isoleucine to valine (I14V) at position 14, and / or a mutation from arginine to lysine (R155K) at position 155, and / or a mutation from serine to asparagine (S353N) at position 353, etc., compared to the amino acid sequence shown in SEQ ID NO: 14. For example, the N protein comprises the amino acid sequence shown in SEQ ID NO: 15.

[0243] In the present application, the N protein may comprise amino acid mutations at positions 14, 155 and 353.

[0244] In the present application, the N protein may comprise amino acid substitutions at other positions.

[0245] A recombinant oncolytic virus comprising the above-mentioned M protein, or the above-mentioned M protein and G protein, or the above-mentioned M protein, G protein and N protein, wherein the recombinant oncolytic virus further comprises a P protein, and the P protein has a mutation from arginine to lysine (R50K) at the 50th position, and / or a mutation from valine to alanine (V76A) at the 76th position, and / or a mutation from asparagine to glutamic acid (D99E) at the 99th position, and / or a mutation from leucine to serine (L126S) at the 126th position, and / or a mutation from leucine to serine (L140S) at the 140th position, and / or a mutation from histidine to tyrosine (H151Y) at the 151st position, and / or a mutation from isoleucine to methionine (I168M) at the 168th position, and / or a mutation from lysine to glutamic acid (K170E) at the 170th position, and / or a mutation from tyrosine to serine (Y189S) at the 189th position, and / or a mutation from asparagine to aspartic acid (N237D) at the 237th position, compared with the amino acid sequence shown in SEQ ID NO: 16. For example, the P protein comprises the amino acid sequence shown in SEQ ID NO: 17.

[0246] In the present application, the P protein may include amino acid mutations at the 50th, 76th, 99th, 126th, 140th, 151st, 168th, 170th, 189th and 237th positions.

[0247] In the present application, the P protein may include amino acid substitutions at other positions.

[0248] A recombinant oncolytic virus comprising the above-mentioned M protein, or the above-mentioned M protein and G protein, or the above-mentioned M protein, G protein and N protein, or the above-mentioned M protein, G protein, N protein and P protein, wherein the recombinant oncolytic virus further comprises an L protein, and the L protein contains one or more site mutations such as a mutation from serine to proline (S87P) at the 87th site and / or a mutation from isoleucine to threonine (I487T) at the 487th site as compared with the amino acid sequence shown in SEQ ID NO: 18. For example, the L protein contains the amino acid sequence shown in SEQ ID NO: 19.

[0249] In the present application, the P protein may contain amino acid mutations at the 87th site and the 487th site.

[0250] In the present application, the P protein may contain amino acid substitutions at other positions.

[0251] The recombinant oncolytic virus contains a nucleic acid molecule, and the nucleic acid molecule contains a nucleic acid sequence encoding the M protein having a site mutation, and / or a nucleic acid sequence encoding the G protein having a site mutation, and / or a nucleic acid sequence encoding the N protein having a site mutation, and / or a nucleic acid sequence encoding the P protein having a site mutation, and / or a nucleic acid sequence encoding the L protein having a site mutation, and a nucleic acid sequence encoding the cytokine.

[0252] Furthermore, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation.

[0253] Furthermore, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the M protein having a site mutation, and / or the nucleic acid sequence encoding the N protein having a site mutation, and / or the nucleic acid sequence encoding the P protein having a site mutation, and / or the nucleic acid sequence encoding the L protein having the site mutation.

[0254] In the present application, the recombinant oncolytic virus described in the present application can be obtained by a virus packaging process and a virus rescue process. The specific process may include infecting and inoculating BSR-T7 cells with the poxvirus vTF7-3 expressing T7 RNA polymerase, and performing lipofectamine transfection using expression plasmids and backbone plasmids that respectively clone the VSV N, VSV P, and VSV L genes to obtain the target oncolytic virus.

[0255] The present application further provides a recombinant oncolytic virus expression vector, a virus-producing cell, a vaccine, and a pharmaceutical composition.

[0256] The recombinant oncolytic virus expression vector may include nucleic acid sequences encoding the M protein and the G protein of the recombinant oncolytic virus, and the recombinant oncolytic virus expression vector may further include nucleic acid sequences encoding the N protein, the P protein, and the L protein of the recombinant oncolytic virus.

[0257] The virus-producing cell can produce the recombinant oncolytic virus described above, and the virus-producing cell may include BSR-T7 cells, Vero cells, 293 cells, MRC-5 cells, and WI38 cells.

[0258] The vaccine is prepared from the recombinant oncolytic virus described above.

[0259] The pharmaceutical composition includes the above-described recombinant oncolytic virus and, optionally, a pharmaceutically acceptable carrier.

[0260] In certain embodiments, the pharmaceutical composition may include a suitable formulation of one or more (pharmaceutically effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, and / or preservatives. The acceptable components of the pharmaceutical composition are preferably non-toxic to the subject at the dosages and concentrations used. The pharmaceutical compositions of the present application include, but are not limited to, liquid, frozen, and lyophilized compositions.

[0261] In certain embodiments, the pharmaceutically acceptable carrier includes any solvent, dispersion medium, coating, isotonic agent, and absorption delaying agent that is suitable for drug administration and is generally safe and non-toxic.

[0262] The pharmaceutical composition includes the above-described recombinant oncolytic virus and, optionally, other pharmaceutically acceptable agents.

[0263] The above pharmaceutical composition may be used in combination therapy for diseases including, but not limited to, the treatment of tumors.

[0264] In certain embodiments, the pharmaceutical composition includes pharmaceutical products for parenteral, transdermal, intraluminal, intraarterial, intravenous, intrathecal, and / or intranasal administration or direct injection into tissue. For example, administration of the pharmaceutical composition to a patient or subject can be performed by infusion or injection. In certain embodiments, the pharmaceutical composition may be administered in different ways, such as intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal, or intratissue administration. In certain embodiments, the pharmaceutical composition can be administered without interruption. The uninterrupted (or continuous) administration can be achieved by measuring the flow of the therapeutic agent into the patient's body by means of a small pump system worn by the patient, as described in WO 2015 / 036583.

[0265] In addition, the present application provides methods for preparing the above recombinant oncolytic virus, the above recombinant oncolytic virus expression vector, the above virus-producing cell, the above vaccine, and the above pharmaceutical composition. Any method suitable for producing an oncolytic virus can be used for producing the recombinant oncolytic virus of the present application. For example, a poxvirus expressing T7 RNA polymerase is added to cells for transfection, and a plasmid expressing the recombinant oncolytic virus N protein, L protein, and P protein and a backbone plasmid are added for transfection, and the recombinant oncolytic virus of the present application is obtained by a virus rescue process.

[0266] The present application further provides the use of the above recombinant oncolytic virus, the above oncolytic virus expression vector, the above virus-producing cell, the above vaccine, and the above pharmaceutical composition in the preparation of a medicament for preventing and / or treating a disease and / or illness.

[0267] The recombinant oncolytic virus provided in the present application performs specific mutations on the amino acid sites of the M protein, G protein, N protein, P protein, and L protein of the oncolytic virus, thereby further improving the infectivity of the oncolytic virus on abnormally proliferating (tumor) LLC cells, 4T1 cells, MC38 cells, and Hela cells. At the same time, the prepared recombinant oncolytic virus has low infectivity to normal cells (normal MEF cells), indicating that the recombinant oncolytic virus prepared in the present application can be well used for infecting cells such as tumors and cancers, and at the same time, it has broad application potential without damaging normal cells.

[0268] The recombinant oncolytic virus provided in this application performs specific mutations on the amino acid sites of the M protein, G protein, N protein, P protein, and L protein of the oncolytic virus, thereby further improving the infectivity of the oncolytic virus to abnormal proliferating (tumor) LLC cells, 4T1 cells, MC38 cells, and Hela cells. The in vitro killing ability of the oncolytic virus to LLC cells, 4T1 cells, MC38 cells, and Hela cells is further improved. At the same time, the prepared recombinant oncolytic virus has little effect on normal MEF cells, indicating that the recombinant oncolytic virus prepared in this application can be well used for the damage and killing of abnormal cells such as tumors and cancers, and at the same time, it does not damage normal cells.

[0269] The recombinant oncolytic virus provided in this application is difficult to be removed in abnormal proliferating (tumor) LLC cells, 4T1 cells, MC38 cells, and Hela cells. Relatively speaking, the wild-type oncolytic virus is more easily removed in LLC cells, MC38 cells, and Hela cells. The recombinant oncolytic virus provided in this application performs site-specific mutations on the amino acids of the M protein, G protein, N protein, P protein, and L protein of the oncolytic virus, making the oncolytic virus more difficult to be removed in LLC cells, 4T1 cells, MC38 cells, and Hela cells, and further ensuring that the oncolytic virus can further exert its infectivity and killing ability in LLC cells, 4T1 cells, MC38 cells, and Hela cells. At the same time, the recombinant oncolytic virus provided in this application is more easily removed in normal MEF cells, further ensuring the safety of normal MEF cells, thereby improving the safety of the oncolytic virus.

[0270] Hereinafter, this application will be further described in detail with reference to Preparation Examples 1 to 106 and Examples 1 to 3.

[0271] Preparation Example Preparation Examples 1 to 70 Preparation Examples 1 to 70 each provide a recombinant oncolytic virus. The recombinant oncolytic virus contains an M protein and a cytokine.

[0272] Specifically, it is as follows.

[0273] The cytokine contained in the recombinant oncolytic virus provided in each of Preparation Examples 1 to 10 is GM-CSF, and the cytokine GM-CSF contains the amino acid sequence shown in SEQ ID NO: 20. The difference in each preparation example lies in the site of amino acid site-specific mutagenesis in the M protein of the wild-type oncolytic virus, specifically shown in Table 1.

[0274] The cytokine contained in the recombinant oncolytic virus provided in each of Preparation Examples 11 to 20 is IL-2, and the cytokine IL-2 contains the amino acid sequence shown in SEQ ID NO: 21. The difference in each preparation example lies in the site of amino acid site-specific mutagenesis in the M protein of the wild-type oncolytic virus, specifically shown in Table 1.

[0275] The cytokine contained in the recombinant oncolytic virus provided in each of Preparation Examples 21 to 30 is IL-12, and the cytokine IL-12 contains the amino acid sequences shown in SEQ ID NO: 22 and SEQ ID NO: 23. The difference in each preparation example lies in the site of amino acid site-specific mutagenesis in the M protein of the wild-type oncolytic virus, specifically shown in Table 1.

[0276] The cytokine contained in the recombinant oncolytic virus provided in each of Preparation Examples 31 to 40 is IL-15, and the cytokine IL-15 contains the amino acid sequence shown in SEQ ID NO: 24. The difference in each preparation example lies in the site of amino acid site-specific mutagenesis in the M protein of the wild-type oncolytic virus, specifically shown in Table 1.

[0277] The cytokine contained in the recombinant oncolytic virus provided in Preparation Examples 41 to 50 is IL-18, and the cytokine IL-18 contains the amino acid sequence shown in SEQ ID NO: 25. And the difference of each preparation example lies in the site of amino acid site-specific mutagenesis in the M protein of the wild-type oncolytic virus, specifically shown in Table 1.

[0278] The cytokine contained in the recombinant oncolytic virus provided in Preparation Examples 51 to 60 is TNF-α, and the cytokine TNF-α contains the amino acid sequence shown in SEQ ID NO: 26. And the difference of each preparation example lies in the site of amino acid site-specific mutagenesis in the M protein of the wild-type oncolytic virus, specifically shown in Table 1.

[0279] The cytokine contained in the recombinant oncolytic virus provided in Preparation Examples 61 to 70 is IFN-β, and the cytokine IFN-β contains the amino acid sequence shown in SEQ ID NO: 27. And the difference of each preparation example lies in the site of amino acid site-specific mutagenesis in the M protein of the wild-type oncolytic virus, specifically shown in Table 1.

[0280] The construction method of the recombinant oncolytic virus provided in each of the above preparation examples is as follows.

[0281] (1) Construction of vector Using the pRV-core plasmid (BioVector NTCC plasmid carrier bacterial cell gene preservation center) as a template, the M protein mutation site shown in Table 1 is introduced by PCR technology.

[0282] Synthesize a gene fragment containing the XbaI and MluI restriction enzyme cleavage sites and the protein mutation site, perform PCR amplification using it as a template, then perform 1% agarose gel electrophoresis on the PCR product, double enzyme cleavage with XbaI and MluI, and further perform rubber tapping recycling using a gel recovery kit to obtain a gene fragment with the protein mutation site.

[0283] The pRV-core plasmid is double-digested with XbaI and MluI, and rubber tapping recycling is performed using a gel recovery kit to obtain a pRV-core enzyme-digested and recovered backbone fragment.

[0284] The above gene fragment having the protein mutation site and the pRV-core enzyme-digested and recovered backbone fragment are ligated and transformed, plated, monoclonal bacteria are selected, PCR verification is performed, and the plasmid is extracted to obtain the constructed plasmid pRV-core Mut, which is sent to a sequencing company for sequencing.

[0285] (2) Insertion of foreign gene The plasmid pRV-core Mut obtained in step (1) is double-digested with Xho I and Mlu I to recover the long fragment.

[0286] The foreign gene encoding the cytokine is synthesized by a gene synthesis company, amplified with corresponding primers, double-digested with XhoI and NheI, the target gene fragment is recovered, ligated with the pRV-core Mut treated by the above double digestion with the foreign gene fragment, transformed, monoclonal is selected, after PCR or enzyme digestion identification, it is sent to a sequencing company for sequencing, and specifically, as shown in Table 1, the plasmid pRV-core Mut carrying the foreign gene is obtained.

[0287] Table 1 Mutation table of recombinant oncolytic virus in Preparation Examples 1 to 70

Table 1

[0288] (3) Virus rescue Using a calcium phosphate transfection kit (Thermo Fisher Scientific), the plasmid pRV-core Mut carrying the foreign gene was transfected into BSR-T7 cells (purchased from ATCC, the American Type Culture Collection) by cell transfection technology.

[0289] According to the mass ratio of 10:5:4:1 of pRV-core Mut, pP, pN, and pL, the four plasmids were mixed, the total amount of the plasmid was 5 μg, the plasmid was diluted with 200 μl of opti-MEM medium (Thermo Fisher Scientific), and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) was added to obtain a transfection plasmid premix solution. Here, pP is a plasmid carrying the baculovirus lint protein gene, pN is a plasmid carrying the baculovirus nucleoprotein gene, pL is a plasmid carrying the baculovirus polymerase protein gene, and the three plasmids of pN, pP, and pL all have the corresponding parental vector pCAGGS (purchased from ATCC).

[0290] 10 μl of Lipofectamine LTX (Thermo Fisher Scientific) was diluted with 200 μl of opti-MEM medium to obtain an LTX mixture.

[0291] Plasmid transfection was performed according to the method described in the Lipofectamine LTX instruction manual. After 6 hours, the BSR-T7 cells were washed twice with PBS and then inoculated into DMEM medium (Thermo Fisher Scientific) containing 10% fetal bovine serum and cultured for 3 days.

[0292] The cell supernatant obtained by culturing BSR-T7 cells was transferred to Vero cells (Thermo Fisher Scientific), and the Vero cells were cultured for 3 days under environmental conditions of 37°C. The green fluorescence inside the cells was observed with a fluorescence microscope to identify the situation of virus rescue. Furthermore, the rescued mutant baculovirus library was passaged through Vero cells, and monoclonal virus strains were picked from the constructed plaque screening system.

[0293] (3) Gene sequencing. The viral genomic RNA was extracted using the Trizol kit, reverse transcription reaction was performed using random primers, and PCR was performed on the cDNA reverse transcribed using the primers designed for the M protein gene sequence and the primers designed for the gene sequence encoding cytokines.

[0294] The primer sequences designed for the M protein gene sequence are as follows. PF: ATGAGTTCCTTAAAGAA; PR: TCATTTGAAGTGG.

[0295] The primer sequences designed for the gene sequence encoding cytokines are as follows. GMCSF F: CCCTCGAGATGTGGCTGCAGAGCCT, GMCSF R: CGGCTAGCTCACTCCTGGACTGGCTCC. IL-2 F: CCGATGTACAGGATGCAACTCC, IL-2 R: CGGCTAGCTCAAGTCAGTGTTG. IL12 F: CCCTCGAGATGTGGCCCCCTGGGT, IL12 R: CGGCTAGCTTAACTGCAGGGCACAGATG. IL-15 F: CCGCTCGAGATGAGAATTTCGAAACC, IL-15 R: CGGCTAGCTCAAGAAGTGTTGATGAAC. IL-18 F: CCCTCGAGATGGCTGCTGAACCAGTAG、 IL-18 R: CGGCTAGCCTAGTCTTCGTTTTGAAC。 TNFα F: CCGCTCGAGATGAGCACTGAAAGC、 TNFα R: CGGCTAGCTCACAGGGCAATGATCC。 IFNβ F: CCTCGAGATGACCAACAAGTGTC、 IFNβ R: CGGCTAGCTCAGTTTCGGAGG。

[0296] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1.

[0297] Preparation Examples 71 to 77 Preparation Examples 71 to 77 each provide a recombinant oncolytic virus. The recombinant oncolytic virus contains an M protein, a G protein, and a cytokine. Here, the mutation site of the M protein is the same as the corresponding mutation site in Preparation Example 2, and the G protein contains the amino acid sequence shown in SEQ ID NO: 13, as shown in Table 2. The difference between each preparation example lies in the difference in the type of cytokine contained, specifically as shown in Table 2.

[0298] The method for constructing the recombinant oncolytic virus provided in the above preparation example is the same as the construction method of Preparation Example 7, and the difference is that it further contains the G protein at the mutation site shown in Table 2. Specifically, the difference in the construction method is introducing the mutation site shown in Table 2 into the constructed plasmid in step (1) using PCR technology, step (3) is the determination of the G protein gene sequence. Extracting viral genomic RNA using a Trizol kit, performing a reverse transcription reaction using a random primer, and performing PCR on the reverse-transcribed cDNA using a primer designed for the G protein gene sequence, the primer sequence designed for the G protein gene sequence is as follows. PF: ATGAAGTGCCTTTTGTACTTAG, PR: TTACTTTCCAAGTCGGTTCATCT.

[0299] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.

[0300] Table 2 Mutation Table of Recombinant Oncolytic Viruses in Preparation Examples 71-77

Table 2

[0301] Preparation Examples 78-84 In Preparation Examples 78-84, recombinant oncolytic viruses are provided respectively. The recombinant oncolytic viruses contain M protein, G protein, N protein and cytokines. Here, the mutation sites of M protein and G protein are the same as the corresponding mutation sites in Preparation Example 71. The N protein contains the amino acid sequence shown in SEQ ID NO: 15 and is shown in Table 3. The difference between each preparation example lies in the difference in the type of cytokine contained, specifically as shown in Table 3.

[0302] The construction method of the recombinant oncolytic virus provided in the above preparation examples is the same as that of Preparation Example 71. The difference is that it further contains the N protein at the mutation site shown in Table 3. Specifically, the difference in the construction method is introducing the mutation site shown in Table 3 into the constructed plasmid in step (1) using PCR technology, step (3) is the N protein gene sequencing. Extracting viral genomic RNA using a Trizol kit, performing a reverse transcription reaction using a random primer, and performing PCR on the reverse transcribed cDNA using a primer designed for the N protein gene sequence, the primer sequence designed for the N protein gene sequence is as follows. PF: ATGTCTGTTACAGTCAAGAG, PR: TCATTTGTCAAATTCTGACTT.

[0303] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 3.

[0304] Table 3 Mutation table of recombinant oncolytic viruses in Preparation Examples 78 to 84

Table 3

[0305] Preparation Examples 85 to 91 In Preparation Examples 85 to 91, recombinant oncolytic viruses are respectively provided. The recombinant oncolytic viruses contain M protein, G protein, N protein, P protein and cytokines. Here, the mutation sites of M protein, G protein and P protein are the same as the corresponding mutation sites in Preparation Example 78. The P protein contains the amino acid sequence shown in SEQ ID NO: 17 and is shown in Table 4. The difference between each preparation example lies in the difference in the type of cytokine contained, specifically as shown in Table 4.

[0306] The construction method of the recombinant oncolytic virus provided in the above preparation example is the same as that of Preparation Example 78. The difference is that it further contains the P protein at the mutation site shown in Table 4. Specifically, the difference in the construction method is introducing the mutation site shown in Table 4 into the constructed plasmid in step (1) using PCR technology, step (3) is the determination of the P protein gene sequence. Extracting viral genomic RNA using a Trizol kit, performing a reverse transcription reaction using a random primer, and performing PCR on the reverse-transcribed cDNA using a primer designed for the P protein gene sequence, the primer sequence designed for the P protein gene sequence is as follows. PF: ATGGATAATCTCACAAAAGTTCG、 PR: CTACAGAGAATATTTGACTCTCG。

[0307] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 4.

[0308] Table 4 Mutation Table of Recombinant Oncolytic Viruses in Preparation Examples 85 - 91

Table 4

[0309] Preparation Examples 92 - 98 In Preparation Examples 92 - 98, recombinant oncolytic viruses are provided respectively. The recombinant oncolytic viruses contain M protein, G protein, N protein, P protein, L protein and cytokines. Here, the mutation sites of M protein, G protein, P protein and N protein are the same as the corresponding mutation sites in Preparation Example 85. The L protein contains the amino acid sequence shown in SEQ ID NO: 19 and is shown in Table 5. The difference between each preparation example lies in the difference in the type of cytokine contained, specifically as shown in Table 5.

[0310] The construction method of the recombinant oncolytic virus provided in the above preparation examples is the same as that of Preparation Example 85. The difference is that it further contains the L protein at the mutation site shown in Table 5. Specifically, the difference in the construction method is introducing the mutation site shown in Table 5 into the constructed plasmid in step (1) using PCR technology, step (3) is the determination of the L protein gene sequence. Extracting viral genomic RNA using the Trizol kit, performing a reverse transcription reaction using a random primer, and performing PCR on the reverse transcribed cDNA using a primer designed for the L protein gene sequence, the primer sequence designed for the L protein gene sequence is as follows, PF: ATGGAAGTCCACGATTTTGAGA, PR: TTAATCTCTCCAAGAGTTTTCCT.

[0311] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 5.

[0312] Table 5 Mutation table of recombinant oncolytic viruses in Preparation Examples 92 to 98

Table 5

[0313] Preparation Examples 99 to 105 Preparation Examples 99 to 105 provide recombinant oncolytic viruses. The above recombinant oncolytic viruses are obtained by introducing a foreign gene encoding a cytokine based on a wild-type oncolytic virus.

[0314] The construction methods of the recombinant oncolytic viruses provided in each of the above preparation examples are as follows.

[0315] (1) Insertion of foreign gene Using the pRV-core plasmid (BioVector NTCC plasmid carrier bacterial cell gene preservation center) as a template, double digestion was performed with XhoI and NheI. Then, a foreign gene encoding a cytokine (the foreign gene encoding a cytokine was synthesized by a gene synthesis company and then amplified with corresponding primers) was inserted, double digestion treatment was performed with XhoI and NheI, the target gene fragment was recovered, the pRV-core treated by the above double digestion was connected with the foreign gene fragment and transformed, monoclonal was selected, after PCR or enzyme digestion identification, it was sent to a sequencing company for sequencing, and specifically, as shown in Table 6, the plasmid pRV-core Mut carrying the foreign gene was obtained.

[0316] (2) Virus rescue Using a calcium phosphate transfection kit (Thermo Fisher Scientific), the plasmid pRV-core Mut carrying the foreign gene was transfected into BSR-T7 cells (purchased from ATCC (American Type Culture Collection, also known as the American Type Culture Collection)) by cell transfection technology.

[0317] According to the mass ratio of 10:5:4:1 of pRV-core Mut, pP, pN, and pL, the four plasmids were mixed, the total amount of the plasmid was 5 μg, the plasmid was diluted with 200 μl of opti-MEM medium (Thermo Fisher Scientific), and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) was added to obtain a transfection plasmid premix solution. Here, pP (a plasmid carrying the baculovirus late protein gene), pN (a plasmid carrying the baculovirus nucleoprotein gene), pL (a plasmid carrying the baculovirus polymerase protein gene), and the three plasmids of pN, pP, and pL all have the corresponding parental vector pCAGGS (purchased from ATCC). 10 μl of Lipofectamine LTX (Thermo Fisher Scientific) was diluted with 200 μl of opti-MEM medium to obtain an LTX mixture. Plasmid transfection was performed according to the method described in the Lipofectamine LTX instruction manual. After 6 hours, the BSR-T7 cells were washed twice with PBS and then inoculated into DMEM medium (Thermo Fisher Scientific) containing 10% fetal bovine serum and cultured for 3 days. The cell supernatant obtained by culturing BSR-T7 cells was transferred to Vero cells (Thermo Fisher Scientific), and the Vero cells were cultured for 3 days under environmental conditions of 37°C. The green fluorescence inside the cells was observed with a fluorescence microscope to identify the situation of virus rescue. Furthermore, the rescued mutant baculovirus library was passaged through Vero cells, and monoclonal virus strains were picked from the constructed plaque screening system.

[0318] (3) Sequencing of the gene. The viral genomic RNA was extracted using the Trizol kit, a reverse transcription reaction was performed using random primers, and PCR was performed on the cDNA reverse transcribed using primers designed for the gene sequence encoding the cytokine (the same as the primer sequences shown in Example 1). The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 6.

[0319] Table 6 Mutation table of the recombinant oncolytic virus in Preparation Examples 99 to 105

Table 6

[0320] Preparation Example 106 This preparation example provides a packaging process for the recombinant oncolytic virus prepared according to any one of the above Preparation Examples 1 to 105. Specifically, it includes the following steps.

[0321] 1) The BSR-T7 cells (purchased from ATCC) were infected and inoculated using the poxvirus vTF7-3 (BioVector NTCC plasmid carrier bacterial cell gene preservation center) expressing T7 RNA polymerase.

[0322] Specific steps: The BSR-T7 cells were seeded in a 6-well plate, and the number of cells per well was 3×10 5Control to reach [specific condition], add the poxvirus vTF7-3 that expresses T7 RNA polymerase 14 - 16 hours after laying, infect the BSR-T7 cells with the poxvirus vTF7-3, after 6 hours of infection, rinse the BSR-T7 cells once with DPBS buffer (Thermo Fisher Scientific), and perform transfection.

[0323] 2) Transfection process Specifically, according to the mass ratio of 10:5:4:1 of pRV-core Mut, pP, pN, and pL, mix the four plasmids, with the total amount of the plasmid being 5 μg. Dilute the plasmid using 200 μl of opti-MEM medium (Thermo Fisher Scientific) and add 7.5 μl of transfection reagent Plus Reagent (Life Technologies) to obtain a transfection plasmid premix solution. Here, pP (a plasmid carrying the baculovirus lint protein gene), pN (a plasmid carrying the baculovirus nucleoprotein gene), pL (a plasmid carrying the baculovirus polymerase protein gene), and the parental carriers of the three plasmids pN, pP, and pL are all pCAGGS (purchased from ATCC), and Dilute 10 μl of Lipofectamine LTX (Thermo Fisher Scientific) using 200 μl of opti-MEM medium to obtain an LTX mixture, and Mix 200 μl of the LTX mixture and 200 μl of the transfection plasmid premix solution, incubate at room temperature for 15 minutes to obtain an LTX-DNA mixture. Replace the DPBS buffer in the 6-well plate of Project 1) with Opti-MEM medium, add the LTX-DNA mixture into the 6-well plate for culturing BSR-T7 cells, gently shake the 6-well plate to evenly distribute the LTX-DNA mixture in the 6-well plate, perform transfection for 6-8 hours, then aspirate the transfection reagent, add 3 ml of fresh complete medium (Thermo Fisher Scientific), after 72 hours, obtain the cell supernatant of BSR-T7 cells, filter it using a 0.22 μm filter, and obtain the corresponding recombinant oncolytic virus of Preparation Examples 1 to 105.

[0324] Example Example 1 In this example, the infectivity of different cells was tested and detected using the recombinant oncolytic viruses prepared in Preparation Examples 1 to 105 and the wild-type recombinant oncolytic virus, respectively.

[0325] The detection method is the TCID50 detection method, that is, add 200 pfu of each of the recombinant oncolytic viruses of Preparation Examples 1 to 105 and the wild-type oncolytic virus to the culture solutions of different cells, and detect the tissue culture infective dose 50% (TCID50) produced by each oncolytic virus.

[0326] The detected cells include LLC cells (mouse lung cancer cell line), 4T1 cells (mouse breast cancer cell line), MC38 cells (mouse colon cancer cell line), Hela cells (human cervical cancer cell line), and MEF cells (human fibroblast cell line).

[0327] As a specific detection method, (1) Add 3 mL of Vero (LLC / 4T1 / MC38 / Hela / MEF) cell suspension to a 6-well culture plate, adjust the cell amount to reach 5 4×10 cells / well. There are a total of six wells, among which there are two wells for MEF cells. Culture the 6-well culture plate under the environmental conditions of 37°C and 5% CO2 for 16 hours. (2) Add 200 pfu of the recombinant oncolytic virus prepared in the preparation example to each well of the 6-well culture plate. After 24 hours, collect 100 μl of the supernatant of the MEF cells and each Vero cell, add the collected supernatant to the wells of a 96-well culture plate, and adjust the cell amount of each cell to reach 1 × 10 4 cells / ml. Culture the 96-well culture plate under the environmental conditions of 37 °C and 5% CO2 for 16 hours. (3) In a 1.5 ml EP tube, serially dilute the supernatant obtained in step (2) 10-fold. There are a total of 11 titers from 10 -1 to 10 -11 . Inoculate the diluted supernatant into a 96-well culture plate, inoculate 1 row for each dilution, a total of 8 wells, and inoculate 100 μl per well. (4) After 48 hours, observe the fluorescence status of each well cell. If there is fluorescence, mark that the well is infected, and calculate the TCID50 according to the Karber method.

[0328] The detection results are shown in Figures 1 to 10. Here, the horizontal axis 0 represents the wild-type oncolytic virus, and the horizontal axes 1 to 105 represent the recombinant oncolytic viruses prepared in Preparation Examples 1 to 105, respectively. The vertical axis Log 10 TCID50 represents the TCID50 value calculated by the Karber method. The larger the value of Log 10 TCID50, the better the infectivity of the recombinant oncolytic virus to the cells. The smaller the value of Log 10 TCID50, the lower the infectivity of the recombinant oncolytic virus to the cells.

[0329] Figure 1 shows the detection results of the infectivity of the recombinant oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application and the wild-type oncolytic virus to LLC cells.

[0330] Figure 2 shows the detection results of the infectivity of the recombinant oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application and the wild-type oncolytic virus to 4T1 cells.

[0331] Figure 3 shows the detection results of the infectivity of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application to MC38 cells.

[0332] Figure 4 shows the detection results of the infectivity of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application to Hela cells.

[0333] Figure 5 shows the detection results of the infectivity of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application to MEF cells.

[0334] Figure 6 shows the detection results of the infectivity of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application to LLC cells.

[0335] Figure 7 shows the detection results of the infectivity of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application to 4T1 cells.

[0336] Figure 8 shows the detection results of the infectivity of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application to MC38 cells.

[0337] Figure 9 shows the detection results of the infectivity of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application to Hela cells.

[0338] Figure 10 shows the detection results of the infectivity of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application to MEF cells.

[0339] As can be seen from the above drawings, all of the recombinant oncolytic viruses prepared in Preparation Examples 1 to 98 of the present application have good infectivity against LLC cells, 4T1 cells, MC38 cells and Hela cells, and all of them are better than the infectivity of the recombinant oncolytic viruses prepared by binding cytokines with wild oncolytic viruses in Preparation Examples 99 to 105 against LLC cells, 4T1 cells, MC38 cells and Hela cells. In particular, the infectivity of the recombinant oncolytic viruses provided in Preparation Examples 61 to 70 against LLC cells, 4T1 cells, MC38 cells and Hela cells is better than that of other preparation examples. At the same time, the above-prepared recombinant oncolytic viruses all have low infectivity to MEF cells, indicating that the recombinant oncolytic viruses prepared in the present application can be well used for the infection of cells such as tumors and cancers, and at the same time, they have broad application possibilities without damaging normal cells.

[0340] Example 2 In this example, in vitro killing test detection is performed on different cells using the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 105, respectively.

[0341] The detection method is the MTT detection method, that is, 200 pfu of each of the viruses prepared in Preparation Examples 1 to 105 and the wild-type oncolytic virus are added to the culture solutions of different cells, and after 24 hours, the cell viability is detected by the MTT detection method.

[0342] The detected cells include LLC cells, 4T1 cells, MC38 cells, Hela cells and MEF cells.

[0343] Specific detection methods include (1) Add 100 μl of Vero (LLC / 4T1 / MC38 / Hela / MEF) cell suspension to a 96-well culture plate so that the cell amount reaches 1×10 4 cells / well, and culture the 96-well culture plate under environmental conditions of 37 °C and 5% CO2 for 16 hours. (2) Dilute the recombinant oncolytic virus prepared in the preparation example until the multiplicity of infection (MOI) reaches 0.001, 0.01, 0.1, and 1.0 respectively. Inoculate the recombinant oncolytic virus of each dilution gradient into the 96-well culture plate in step (1), inoculate 4 wells for each dilution gradient, inoculate 100 μl per well, and culture the 96-well culture plate under cyclic conditions of 37 °C and 5% CO2 for 40 hours. (3) Take out the cell supernatant in the 96-well culture plate in step (2), add fresh medium and MTT solution to the 96-well culture plate, with the addition amount of 20 μL / well, and culture the 96-well culture plate under environmental conditions of 37 °C and 5% CO2 for 4 hours. (4) Centrifuge the 96-well culture plate at room temperature for 5 minutes, set the rotation speed to 2500 rpm / min, gently aspirate the supernatant using a 1 mL disposable sterile syringe, then add DMSO to each well of the 96-well culture plate, with the addition amount of 100 μl / well, and place it under environmental conditions of 37 °C for 10 minutes. Use a multifunctional microplate reader to shake for 2 minutes and measure the OD value of each well on the 96-well culture plate at a wavelength of 570 nm or 490 nm.

[0344] The detection results are shown in Figures 11 to 20. Here, the horizontal axis 0 represents the wild-type oncolytic virus, the horizontal axes 1 to 105 represent the recombinant oncolytic viruses prepared in Preparation Examples 1 to 105 respectively, and the vertical axis OD 570 represents the OD value of the cells, and the larger the value of OD 570 , the lower the killing ability of the recombinant oncolytic virus to the cells, and the smaller the value of OD 570 , the better the killing ability of the recombinant oncolytic virus to the cells.

[0345] Figure 11 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses prepared in Preparation Examples 1 to 70 and the wild-type oncolytic virus of the present application to LLC cells.

[0346] Figure 12 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application against 4T1 cells.

[0347] Figure 13 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application against MC38 cells.

[0348] Figure 14 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application against Hela cells.

[0349] Figure 15 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application against MEF cells.

[0350] Figure 16 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application against LLC cells.

[0351] Figure 17 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application against 4T1 cells.

[0352] Figure 18 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application against MC38 cells.

[0353] Figure 19 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application against Hela cells.

[0354] Figure 20 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application against MEF cells.

[0355] As can be seen from the above drawings, all of the recombinant oncolytic viruses prepared in Preparation Examples 1 to 98 of the present application have good in vitro killing ability against LLC cells, 4T1 cells, MC38 cells and Hela cells, and all of them are better than the in vitro killing ability of the recombinant oncolytic viruses prepared by binding cytokines using wild oncolytic viruses in Preparation Examples 99 to 105 against LLC cells, 4T1 cells, MC38 cells and Hela cells. In particular, the in vitro killing ability of the recombinant oncolytic viruses provided in Preparation Examples 61 to 70 against LLC cells, 4T1 cells, MC38 cells and Hela cells exceeds the in vitro killing ability of wild-type oncolytic viruses. At the same time, the prepared recombinant oncolytic viruses have almost no killing effect on normal MEF cells, indicating that the recombinant oncolytic viruses prepared in the present application can be well used for the damage and killing of abnormal cells such as tumors and cancers, and at the same time, they do not damage normal cells.

[0356] Wild-type oncolytic viruses have good in vitro killing ability against LLC cells, MC38 cells and 4T1 cells, but while damaging and killing these cells, they also significantly damage and kill MEF cells, restricting the clinical application of wild-type oncolytic viruses. Therefore, the modification of wild-type oncolytic viruses according to the present application ensures the safety of normal cells by oncolytic viruses, and at the same time guarantees the killing ability of oncolytic viruses against tumors and cancer cells, holding broad potential for clinical application.

[0357] Example 3 This example conducts test detection on the situation of inducing the expression of IFN-β in different cells by the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 105.

[0358] The detection indicator is the intracellular expression status of the gene IFN-β. The gene IFN-β is a soluble glycoprotein gene produced by cells, which has a wide range of antiviral, antitumor, and immunomodulatory effects. From the expression status of the gene IFN-β, the ability of cells to remove recombinant oncolytic viruses can be judged. When the expression of the gene IFN-β is high, it indicates that the recombinant oncolytic virus is easily removed intracellularly. When the expression of the gene IFN-β is low, it indicates that the recombinant oncolytic virus is difficult to be removed intracellularly.

[0359] The detected cells include LLC cells, 4T1 cells, MC38 cells, Hela cells, and MEF cells.

[0360] As a specific detection method, (1) Add 100 μl of Vero (LLC / 4T1 / MC38 / Hela / MEF) cell suspension to a 96-well culture plate so that the cell amount reaches 1×10 4 cells / well, and culture the 96-well culture plate under environmental conditions of 37°C and 5% CO2 for 16 hours. (2) Dilute the recombinant oncolytic virus prepared in the preparation example until the multiplicity of infection (MOI) reaches 0.001, 0.01, 0.1, and 1.0 respectively. Inoculate each dilution gradient of the recombinant oncolytic virus into the 96-well culture plate in step (1), inoculate 4 wells for each dilution gradient, inoculate 100 μl per well, and culture the 96-well culture plate under cyclic conditions of 37°C and 5% CO2 for 40 hours. (3) Crush each set of cells cultured and obtained in step (2), extract total RNA from each cell using TRIzol (Invitrogen), reverse transcribe it into cDNA using the PrimeScript RT Reagent Kit with DNA Eraser (Takara) reverse transcription kit, stain it using the LightCycler 480 SYBR Green I Master (Roche) dye, and detect the Ct value of each gene using a LightCycler 480 quantitative PCR instrument. Calculate the relative expression level of the target gene IFN-β by the ΔΔCt method.

[0361] The detection results are shown in FIGS. 21 to 30. Here, the horizontal axis 0 represents the wild-type oncolytic virus, the horizontal axes 1 to 105 represent the recombinant oncolytic viruses prepared in Preparation Examples 1 to 105, respectively, the vertical axis IFN-β level represents the expression status of the IFN-β gene, and the larger the value of the IFN-β level, the weaker the reproductive ability of the recombinant oncolytic virus in the cell and the easier it is to be removed, and the smaller the value of the IFN-β level, the stronger the reproductive ability of the recombinant oncolytic virus in the cell and the more difficult it is to be removed.

[0362] FIG. 21 shows the situation where the recombinant oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application and the wild-type oncolytic virus induce the expression of IFN-β in LLC cells.

[0363] FIG. 22 shows the situation where the recombinant oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application and the wild-type oncolytic virus induce the expression of IFN-β in 4T1 cells.

[0364] FIG. 23 shows the situation where the recombinant oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application and the wild-type oncolytic virus induce the expression of IFN-β in MC38 cells.

[0365] FIG. 24 shows the situation where the recombinant oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application and the wild-type oncolytic virus induce the expression of IFN-β in Hela cells.

[0366] FIG. 25 shows the situation where the recombinant oncolytic viruses prepared in Preparation Examples 1 to 70 of the present application and the wild-type oncolytic virus induce the expression of IFN-β in MEF cells.

[0367] FIG. 26 shows the situation where the recombinant oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application and the wild-type oncolytic virus induce the expression of IFN-β in LLC cells.

[0368] Figure 27 shows the situation where the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application induce the expression of IFN-β in 4T1 cells.

[0369] Figure 28 shows the situation where the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application induce the expression of IFN-β in MC38 cells.

[0370] Figure 29 shows the situation where the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application induce the expression of IFN-β in Hela cells.

[0371] Figure 30 shows the situation where the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 71 to 105 of the present application induce the expression of IFN-β in MEF cells.

[0372] As can be seen from the above drawings, the recombinant oncolytic viruses and wild-type oncolytic viruses provided in Preparation Examples 1 to 98 of the present application have strong reproductive ability in LLC cells, 4T1 cells, MC38 cells and Hela cells, are not easily removed, and in Preparation Examples 99 to 105, all have better reproductive ability in LLC cells, 4T1 cells, MC38 cells and Hela cells than the recombinant oncolytic viruses prepared by binding with cytokines using wild oncolytic viruses. In particular, the recombinant oncolytic viruses provided in Preparation Examples 61 to 70 are even more difficult to be removed in LLC cells, 4T1 cells, MC38 cells and Hela cells, and further ensure that the oncolytic viruses can better exert their ability of infection and killing in LLC cells, 4T1 cells, MC38 cells and Hela cells. At the same time, the recombinant oncolytic viruses provided in the present application are more easily removed in MEF cells, further ensuring the safety of MEF cells, thus improving the safety of oncolytic viruses.

[0373] This specific embodiment is only an explanation of the present application and does not limit the present application. After reading this specification, those skilled in the art can make corrections to this embodiment without creative contributions as needed, but as long as it is within the scope of the claims of the present application, it will all be protected by the patent law.

Claims

1. A recombinant oncolytic virus, wherein the recombinant oncolytic virus comprises an M protein and a cytokine encoded by a foreign gene, and the M protein comprises a mutation from methionine to arginine at position 51 (M51R), a mutation from valine to phenylalanine at position 221 (V221F), and a mutation from serine to arginine at position 226 (S226R) compared to the amino acid sequence shown in SEQ ID NO:

1. A recombinant oncolytic virus characterized by the above.

2. The M protein further comprises one or more site mutations such as a mutation from asparagine to serine at position 32 (N32S), and / or a mutation from asparagine to aspartic acid at position 49 (N49D), and / or a mutation from histidine to tyrosine at position 54 (H54Y), and / or a mutation from valine to isoleucine at position 225 (V225I). The recombinant oncolytic virus according to Claim 1, characterized by the above.

3. The M protein further comprises one or more site mutations such as knockout of the leucine-coding base at position 111, or a mutation from leucine to alanine at position 111 (L111A). The recombinant oncolytic virus according to Claim 1 or 2, characterized by the above.

4. The M protein further comprises one or more site mutations such as a mutation from glycine to alanine at position 21 (G21E), and / or a mutation from methionine to alanine at position 33 (M33A), and / or a mutation from alanine to threonine at position 133 (A133T). The recombinant oncolytic virus according to Claim 2 or 3, characterized by the above.

5. The site mutation of the M protein is selected from any one of the following groups: 1) The site mutation of the M protein comprises M51R, V221F, S226R. 2) The site mutation of the M protein comprises N32S, N49D, M51R, H54Y, V221F, V225I, S226R. 3) The site mutation of the M protein comprises N32S, N49D, M51R, H54Y, knockout of the leucine-coding base at position 111, V221F, V225I, S226R. 4) The site mutations of the M protein include N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R, 5) The site mutations of the M protein include G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R, 6) The site mutations of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R, 7) The site mutations of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R, 8) The site mutations of the M protein include N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R, 9) The site mutations of the M protein include N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R, 10) The site mutations of the M protein include N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R characterized in that it is the recombinant oncolytic virus according to any one of claims 1 to 4.

6. The M protein includes the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or SEQ ID NO: 11 characterized in that it is the recombinant oncolytic virus according to claim 5.

7. The cytokine is selected from interleukin, interferon, tumor necrosis factor, colony stimulating factor, transforming growth factor β, chemokine family characterized in that it is the recombinant oncolytic virus according to any one of claims 1 to 6.

8. The cytokine is selected from any one or more of GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β and TNF-α characterized in that it is the recombinant oncolytic virus according to claim 7.

9. The cytokine is selected from any one or more of GM-CSF, IL-2, IL-12, IL-15, IL-18, IFN-β, and TNF-α The recombinant oncolytic virus according to claim 8, characterized in that

10. A recombinant oncolytic virus, The recombinant oncolytic virus contains the M protein according to any one of claims 1 to 9, the recombinant oncolytic virus further contains a G protein, and the G protein has a mutation from valine to isoleucine at the 53rd site (V53I), and / or a mutation from alanine to valine at the 141st site (A141V), and / or a mutation from aspartic acid to tyrosine at the 172nd site (D172Y), and / or a mutation from lysine to glutamic acid at the 217th site (K217E), and / or a mutation from aspartic acid to glycine at the 232nd site (D232G), and / or a mutation from valine to alanine at the 331st site (V331A), and / or a mutation from valine to glutamic acid at the 371st site (V371E), and / or a mutation from glycine to aspartic acid at the 436th site (G436D), and / or a mutation from threonine to serine at the 438th site (T438S), and / or a mutation from phenylalanine to leucine at the 453rd site (F453L), and / or a mutation from threonine to isoleucine at the 471st site (T471I), and / or a mutation from tyrosine to histidine at the 487th site (Y487H), etc., including one or more site mutations The recombinant oncolytic virus, characterized in that

11. The G protein contains the amino acid sequence shown in SEQ ID NO: 13 The recombinant oncolytic virus according to claim 10, characterized in that

12. A recombinant oncolytic virus, A recombinant oncolytic virus comprising the M protein according to any one of claims 1 to 9, or the M protein and G protein according to any one of claims 10 to 11, wherein the recombinant oncolytic virus further comprises an N protein, and the N protein has a mutation from isoleucine to valine (I14V) at the 14th site, and / or a mutation from arginine to lysine (R155K) at the 155th site, and / or a mutation from serine to asparagine (S353N) at the 353rd site, etc., one or more site mutations compared to the amino acid sequence shown in SEQ ID NO: 14 A recombinant oncolytic virus characterized by the above.

13. The N protein comprises the amino acid sequence shown in SEQ ID NO: 15 The recombinant oncolytic virus according to claim 12, characterized by the above.

14. A recombinant oncolytic virus, comprising the M protein according to any one of claims 1 to 9, or the M protein and G protein according to any one of claims 10 to 11, or the M protein, G protein and N protein according to any one of claims 12 to 13, wherein the recombinant oncolytic virus further comprises a P protein, and the P protein has a mutation from arginine to lysine (R50K) at the 50th site, and / or a mutation from valine to alanine (V76A) at the 76th site, and / or a mutation from asparagine to glutamic acid (D99E) at the 99th site, and / or a mutation from leucine to serine (L126S) at the 126th site, and / or a mutation from leucine to serine (L140S) at the 140th site, and / or a mutation from histidine to tyrosine (H151Y) at the 151st site, and / or a mutation from isoleucine to methionine (I168M) at the 168th site, and / or a mutation from lysine to glutamic acid (K170E) at the 170th site, and / or a mutation from tyrosine to serine (Y189S) at the 189th site, and / or a mutation from asparagine to aspartic acid (N237D) at the 237th site, etc., one or more site mutations compared to the amino acid sequence shown in SEQ ID NO: 16 A recombinant oncolytic virus characterized by the above.

15. The P protein contains the amino acid sequence shown in SEQ ID NO: 17 The recombinant oncolytic virus according to claim 14, characterized in that it is such.

16. A recombinant oncolytic virus, wherein the recombinant oncolytic virus contains the M protein according to any one of claims 1 to 9, or the M protein and G protein according to any one of claims 10 to 11, or the M protein, G protein and N protein according to any one of claims 12 to 13, or the M protein, G protein, N protein and P protein according to any one of claims 14 to 15; the recombinant oncolytic virus further contains the L protein; the L protein contains one or more site mutations such as a mutation from serine to proline (S87P) at the 87th site and / or a mutation from isoleucine to threonine (I487T) at the 487th site as compared with the amino acid sequence shown in SEQ ID NO: 18 A recombinant oncolytic virus, characterized in that it is such.

17. The L protein contains the amino acid sequence shown in SEQ ID NO: 19 The recombinant oncolytic virus according to claim 16, characterized in that it is such.

18. The recombinant oncolytic virus further contains a baculovirus The recombinant oncolytic virus according to any one of claims 1 to 17, characterized in that it is such.

19. The recombinant oncolytic virus further contains Vesicular Stomatitis Virus (abbreviated as VSV) The recombinant oncolytic virus according to any one of claims 1 to 17, characterized in that it is such.

20. The recombinant oncolytic virus further contains the VSV virus Indiana MuddSummer subtype The recombinant oncolytic virus according to any one of claims 1 to 17, characterized in that it is such.

21. The recombinant oncolytic virus further contains or expresses an exogenous target protein The recombinant oncolytic virus according to any one of claims 1 to 20, characterized in that it is such.

22. The recombinant oncolytic virus contains a nucleic acid molecule, and the nucleic acid molecule contains a nucleic acid sequence encoding the M protein with a site mutation, and / or a nucleic acid sequence encoding the G protein with a site mutation, and / or a nucleic acid sequence encoding the N protein with a site mutation, and / or a nucleic acid sequence encoding the P protein with a site mutation, and / or a nucleic acid sequence encoding the L protein with a site mutation, and a nucleic acid sequence encoding the cytokine. The recombinant oncolytic virus according to any one of claims 1 to 21, characterized in that.

23. In the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein with a site mutation and the nucleic acid sequence encoding the L protein with the site mutation. The recombinant oncolytic virus according to claim 22, characterized in that.

24. In the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the M protein with a site mutation, the nucleic acid sequence encoding the N protein with a site mutation, or the nucleic acid sequence encoding the P protein with a site mutation, and the nucleic acid sequence encoding the L protein with the site mutation. The recombinant oncolytic virus according to claim 22, characterized in that.

25. The expression vector of the recombinant oncolytic virus can express the recombinant oncolytic virus according to any one of claims 1 to 24. The recombinant oncolytic virus expression vector, characterized in that.

26. A virus-producing cell, wherein The virus-producing cell can produce the recombinant oncolytic virus according to any one of claims 1 to 24. The virus-producing cell, characterized in that.

27. A vaccine prepared using the recombinant oncolytic virus according to any one of claims 1 to 24.

28. A pharmaceutical composition, wherein The pharmaceutical composition contains the recombinant oncolytic virus according to any one of claims 1 to 24, or the vaccine according to claim 27, and optionally a pharmaceutically acceptable carrier. The pharmaceutical composition, characterized in that.

29. The recombinant oncolytic virus according to any one of claims 1 to 24, the recombinant oncolytic virus expression vector according to claim 25, the virus-producing cell according to claim 26, the vaccine according to claim 27, the method for preparing the pharmaceutical composition according to claim 28.

30. Use of the recombinant oncolytic virus according to any one of claims 1 to 24, the recombinant oncolytic virus expression vector according to claim 25, the virus-producing cell according to claim 26, the vaccine according to claim 27, the pharmaceutical composition according to claim 28 in the preparation of a medicament for preventing and / or treating a disease and / or illness.

31. The use according to claim 30, wherein the recombinant oncolytic virus, the recombinant oncolytic virus expression vector, the virus-producing cell, the vaccine and / or the pharmaceutical composition is used in a method for continuously killing abnormal proliferating cells.

32. The use according to claim 31, wherein the abnormal proliferating cells are selected from tumor cells or tumor tissue-related cells.

33. Use of the recombinant oncolytic virus according to any one of claims 1 to 24, the vaccine according to claim 27, the pharmaceutical composition according to claim 28 in the preparation of a medicament for treating a tumor.

34. The use according to claim 33, wherein the tumor includes a solid tumor or a hematological tumor.

35. The tumor includes, but is not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, epithelioma, esophageal cancer, diffuse large B-cell lymphoma, neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell histiocytosis, pharyngeal cancer, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer and angioma. ​ ​ ​ ​

Images