Recombinant oncolytic virus and its uses
A recombinant oncolytic virus with targeted mutations and cytokine integration enhances tumor selectivity and safety by improving tumor cell killing efficacy while minimizing normal cell infection.
Patent Information
- Application Number
- JP2025501649
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-07-14
- Filing Date
- 2023-06-30
- Publication Date
- 2025-07-17
AI Technical Summary
Existing oncolytic viruses face challenges in selectively targeting tumor cells while minimizing pathogenic risks to normal cells, with random genetic modifications potentially reducing their efficacy and safety.
A recombinant oncolytic virus with specific mutations in the M protein (M51R, V221F, S226R) and the inclusion of a foreign cytokine gene, tailored to target specific tumor antigens such as CD19 and CD137, enhances tumor selectivity and safety by reducing normal cell infection.
The recombinant oncolytic virus demonstrates improved in vitro killing ability against tumor cells and reduced impact on normal cells, ensuring higher cure rates and safety in treating tumors.
Smart Images

Figure 2025523080000001_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the technical field of biomedicine, and more specifically, to recombinant oncolytic viruses and their uses.
Background Art
[0002] Oncolytic viruses are tumor-killing viruses with replication ability and are currently widely accepted as an important field of tumor immunotherapy. Oncolytic viruses specifically target infected tumor cells. For example, due to the inactivation or deficiency of tumor suppressor genes in tumor cells, they selectively infect tumor cells. After infecting tumor cells, oncolytic viruses replicate massively within the tumor cells and ultimately destroy the tumor cells, thus killing the tumor cells. At the same time, oncolytic viruses can also provide immune-stimulatory signals necessary to enhance the host's own anti-cancer response, attract more immune cells, and continue to kill the remaining tumor cells.
[0003] Although oncolytic viruses hold great potential for good applications in the field of tumor immunotherapy, wild-type oncolytic viruses may always cause problems such as inflammation of the body's nervous system. In the process of infecting tumor cells with wild-type viruses, there is still a significant pathogenic risk. Therefore, in order to further promote the clinical application of oncolytic viruses, it is necessary to modify wild-type oncolytic viruses to obtain attenuated oncolytic viruses. Using attenuated oncolytic viruses in clinical applications thus reduces the pathogenic risk of oncolytic viruses and improves the safety of oncolytic viruses.
[0004] However, in the process of modifying oncolytic viruses, random genetic modification of wild-type oncolytic viruses can reduce their toxicity, but the modified oncolytic viruses may have a low cure rate and may not be packaged even if they are modified oncolytic viruses, which is disadvantageous for promoting the clinical application of oncolytic viruses.
Summary of the Invention
Problems to be Solved by the Invention
[0005] In order to further improve the killing ability of oncolytic viruses against tumor cells in vitro and in vivo and to ensure the safety of oncolytic viruses against normal cells, the present application provides a recombinant oncolytic virus and its use.
Means for Solving the Problems
[0006] The recombinant oncolytic virus provided in the present application adopts the following technical solutions.
[0007] A recombinant oncolytic virus, wherein the recombinant oncolytic virus comprises an M protein and an antigen encoded by a foreign gene, and the M protein has a mutation from methionine to arginine at position 51 (M51R), a mutation from valine to phenylalanine at position 221 (V221F), and a mutation from serine to arginine at position 226 (S226R) compared to the amino acid sequence shown in SEQ ID NO: 1.
[0008] Furthermore, the antigen is selected from solid tumors or hematological tumors.
[0009] Furthermore, the solid tumor antigen is 5T4, ROR1, EGFR, FcγRI (CD64), FcγRIIa (CD32a), FcγRIIb (CD32b), CD28, CD137 (4-1BB), CTLA-4, HER-2, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) protein, lymphotoxin-β receptor (LTβR), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), human epidermal growth factor receptor 1 (EGFR1), EGFRvIII, ErbB3 (HER3), folate receptor, ephrin receptor, PDGFRa, ErbB-2, CD2, CD40, CD74, CD80, CD86, CCAM5 (CD66e), CCAM6 (CD66c), p53, cMet (tyrosine protein kinase Met), HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin (GDF8), Cripto (TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα,TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, Neuropilin 1 (Neuropilin, NRP-1), Phosphatidylinositol Proteoglycan (glypican2 / 3, GPC2 / 3), EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL, including but not limited to these.
[0010] Furthermore, the hematological tumor antigens include, but are not limited to, BCMA (TNFRSF17), CD4, CD5 (Leu-1), CD7, CD10, FcγRIIIa (CD16a), FcγRIIIb (CD16b), CD19, CD20 (MS4A1), CD22 (Siglec-2), CD23, CD30 (TNFRSF8), CD33 (Siglec-3), CD34, CD37, CD38, CD44, CD47, CD56 (NCAM1), CD70, CD117, CD123 (IL3RA), CD138 (SDC1), CD174, CLL-1, ROR1, NKG2DL1 / 2 (ULBP1 / 2), IL1R3 (IL-1-RAP), FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3 (CD229), SLAMF7 (CD319), TCR B-chain, ITGB7, k-1gG, TACI, TRBCI, LeY, MUC1.
[0011] Furthermore, the antigen is selected from any one or more of CD19, BCMA, NY-ESO-1, MUC-1, MSLN, EGFR, VEGFR2, MAGE A4, cMet, HGFR, Claude 18.2.
[0012] Furthermore, the recombinant oncolytic virus further includes a cytokine encoded by a foreign gene.
[0013] Furthermore, the cytokine is selected from interleukin, interferon, tumor necrosis factor, colony-stimulating factor, transforming growth factor-β, and chemokine family.
[0014] Furthermore, the cytokine is selected from any one or more of GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β, and TNF-α.
[0015] Furthermore, the cytokine is selected from any one or more of GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, and IFN-β.
[0016] Furthermore, the M protein further includes one or more site mutations such as a mutation from asparagine to serine at the 32nd site (N32S), and / or a mutation from asparagine to aspartic acid at the 49th site (N49D), and / or a mutation from histidine to tyrosine at the 54th site (H54Y), and / or a mutation from valine to isoleucine at the 225th site (V225I).
[0017] Furthermore, the M protein further includes one or more site mutations such as a knockout of the leucine-coding base at the 111th site, or a mutation from leucine to alanine at the 111th site (L111A).
[0018] Furthermore, the M protein further includes one or more site mutations such as a mutation from glycine to alanine at the 21st site (G21E), and / or a mutation from methionine to alanine at the 33rd site (M33A), and / or a mutation from alanine to threonine at the 133rd site (A133T).
[0019] In a specific embodiment, the site mutation of the M protein includes a mutation from methionine to arginine at position 51 (M51R).
[0020] In a specific embodiment, the site mutation of the M protein includes a mutation from valine to phenylalanine at position 221 (V221F).
[0021] In a specific embodiment, the site mutation of the M protein includes a mutation from serine to arginine at position 226 (S226R).
[0022] In a specific embodiment, the site mutation of the M protein includes a mutation from asparagine to serine at position 32 (N32S).
[0023] In a specific embodiment, the site mutation of the M protein includes a mutation from asparagine to aspartic acid at position 49 (N49D).
[0024] In a specific embodiment, the site mutation of the M protein includes a mutation from histidine to tyrosine at position 54 (H54Y).
[0025] In a specific embodiment, the site mutation of the M protein includes a mutation from valine to isoleucine at position 225 (V225I).
[0026] In a specific embodiment, the site mutation of the M protein includes a knockout of the leucine - coding base at position 111.
[0027] In a specific embodiment, the site mutation of the M protein includes a mutation from leucine to alanine at position 111 (L111A).
[0028] In a specific embodiment, the site mutation of the M protein includes a mutation from glycine to alanine at position 21 (G21E).
[0029] In a specific embodiment, the site mutation of the M protein includes a mutation from methionine to alanine at position 33 (M33A).
[0030] In a specific embodiment, the site mutation of the M protein includes a mutation from alanine to threonine at position 133 (A133T).
[0031] In a specific embodiment, the M protein has amino acid substitutions of M51R, V221F, and S226R.
[0032] In a specific embodiment, the M protein has amino acid substitutions of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R.
[0033] In a specific embodiment, the M protein has amino acid substitutions of N32S, N49D, M51R, H54Y, knockout of the leucine-coding base at position 111, V221F, V225I, and S226R.
[0034] In a specific embodiment, the M protein has amino acid substitutions of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R.
[0035] In a specific embodiment, the M protein has amino acid substitutions of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R.
[0036] In a specific embodiment, the M protein has amino acid substitutions of G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R.
[0037] In a specific embodiment, the M protein has amino acid substitutions of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R.
[0038] In a specific embodiment, the M protein has amino acid substitutions of N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R.
[0039] In a specific embodiment, the M protein has amino acid substitutions of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R.
[0040] In a specific embodiment, the M protein has amino acid substitutions of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R.
[0041] In the present application, the M protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO: 1.
[0042] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 2.
[0043] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 3.
[0044] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 4.
[0045] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 5.
[0046] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 6.
[0047] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 7.
[0048] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 8.
[0049] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 9.
[0050] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 10.
[0051] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 11.
[0052] In a specific embodiment, the antigen is CD19.
[0053] In a specific embodiment, the antigen is BCMA.
[0054] In a specific embodiment, the antigen is NY-ESO-1.
[0055] In a specific embodiment, the antigen is MUC-1.
[0056] In a specific embodiment, the antigen is MSLN.
[0057] In a specific embodiment, the antigen is EGFR.
[0058] In a specific embodiment, the antigen is VEGFR2.
[0059] In a specific embodiment, the antigen is MAGE A4.
[0060] In a specific embodiment, the antigen is cMet.
[0061] In a specific embodiment, the antigen is Claude 18.2.
[0062] In a specific embodiment, the antigen is CD22.
[0063] In a specific embodiment, the antigen CD19 comprises the amino acid sequence shown in SEQ ID NO: 28.
[0064] In a specific embodiment, the antigen BCMA comprises the amino acid sequence shown in SEQ ID NO: 29.
[0065] In a specific embodiment, the antigen NY-ESO-1 comprises the amino acid sequence shown in SEQ ID NO: 30.
[0066] In a specific embodiment, the antigen MUC-1 comprises the amino acid sequence shown in SEQ ID NO: 31.
[0067] In a specific embodiment, the antigen MSLN comprises the amino acid sequence shown in SEQ ID NO: 32.
[0068] In a specific embodiment, the antigen EGFR comprises the amino acid sequence shown in SEQ ID NO: 33.
[0069] In a specific embodiment, the antigen VEGFR2 comprises the amino acid sequence shown in SEQ ID NO: 34.
[0070] In a specific embodiment, the antigen MAGE A4 comprises the amino acid sequence shown in SEQ ID NO: 35.
[0071] In a specific embodiment, the antigen cMet comprises the amino acid sequence shown in SEQ ID NO: 36.
[0072] In a specific embodiment, the antigen Claude 18.2 comprises the amino acid sequence shown in SEQ ID NO: 37.
[0073] In a specific embodiment, the antigen CD22 comprises the amino acid sequence shown in SEQ ID NO: 38.
[0074] In a specific embodiment, the antigen CD19 comprises the amino acid sequence shown in SEQ ID NO: 39.
[0075] In a specific embodiment, the antigen MAGE A4 comprises the amino acid sequence shown in SEQ ID NO: 40.
[0076] In a specific embodiment, the antigen Claude 18.2 comprises the amino acid sequence shown in SEQ ID NO: 41.
[0077] In a specific embodiment, the cytokine is GM-CSF.
[0078] In a specific embodiment, the cytokine is IL-2.
[0079] In a specific embodiment, the cytokine is IL-12.
[0080] In a specific embodiment, the cytokine is IL-15.
[0081] In a specific embodiment, the cytokine is IL-18.
[0082] In a specific embodiment, the cytokine is TNF-α.
[0083] In a specific embodiment, the cytokine is IFN-β.
[0084] In a specific embodiment, the cytokine GM-CSF comprises the amino acid sequence shown in SEQ ID NO: 20.
[0085] In a specific embodiment, the cytokine IL-2 comprises the amino acid sequence shown in SEQ ID NO: 21.
[0086] In a specific embodiment, the cytokine IL-12-A comprises the amino acid sequence shown in SEQ ID NO: 22.
[0087] In a specific embodiment, the cytokine IL-12-B comprises the amino acid sequence shown in SEQ ID NO: 23.
[0088] In a specific embodiment, the cytokine IL-15 comprises the amino acid sequence shown in SEQ ID NO: 24.
[0089] In a specific embodiment, the cytokine IL-18 comprises the amino acid sequence shown in SEQ ID NO: 25.
[0090] In a specific embodiment, the cytokine TNF-α comprises the amino acid sequence shown in SEQ ID NO: 26.
[0091] In a specific embodiment, the cytokine IFN-β comprises the amino acid sequence shown in SEQ ID NO: 27.
[0092] A recombinant oncolytic virus comprising the above-mentioned M protein, wherein the recombinant oncolytic virus further comprises a G protein, and the G protein has a mutation from valine to isoleucine (V53I) at the 53rd site, and / or a mutation from alanine to valine (A141V) at the 141st site, and / or a mutation from aspartic acid to tyrosine (D172Y) at the 172nd site, and / or a mutation from lysine to glutamic acid (K217E) at the 217th site, and / or a mutation from aspartic acid to glycine (D232G) at the 232nd site, and / or a mutation from valine to alanine (V331A) at the 331st site, and / or a mutation from valine to glutamic acid (V371E) at the 371st site, and / or a mutation from glycine to aspartic acid (G436D) at the 436th site, and / or a mutation from threonine to serine (T438S) at the 438th site, and / or a mutation from phenylalanine to leucine (F453L) at the 453rd site, and / or a mutation from threonine to isoleucine (T471I) at the 471st site, and / or a mutation from tyrosine to histidine (Y487H) at the 487th site, etc., including one or more site mutations.
[0093] In a specific embodiment, the site mutation of the G protein includes a mutation from valine to isoleucine (V53I) at the 53rd site.
[0094] In a specific embodiment, the site mutation of the G protein includes a mutation from alanine to valine (A141V) at the 141st site.
[0095] In a specific embodiment, the site mutation of the G protein includes a mutation from aspartic acid to tyrosine (D172Y) at the 172nd site.
[0096] In a specific embodiment, the site mutation of the G protein includes a mutation from lysine to glutamic acid (K217E) at the 217th site.
[0097] In a specific embodiment, the site mutation of the G protein includes a mutation from aspartic acid to glycine at position 232 (D232G).
[0098] In a specific embodiment, the site mutation of the G protein includes a mutation from valine to alanine at position 331 (V331A).
[0099] In a specific embodiment, the site mutation of the G protein includes a mutation from valine to glutamic acid at position 371 (V371E).
[0100] In a specific embodiment, the site mutation of the G protein includes a mutation from glycine to aspartic acid at position 436 (G436D).
[0101] In a specific embodiment, the site mutation of the G protein includes a mutation from threonine to serine at position 438 (T438S).
[0102] In a specific embodiment, the site mutation of the G protein includes a mutation from phenylalanine to leucine at position 453 (F453L).
[0103] In a specific embodiment, the site mutation of the G protein includes a mutation from threonine to isoleucine at position 471 (T471I).
[0104] In a specific embodiment, the site mutation of the G protein includes a mutation from tyrosine to histidine at position 487 (Y487H).
[0105] In a specific embodiment, the G protein has an amino acid substitution of V53I.
[0106] In a specific embodiment, the G protein has amino acid substitutions of V53I and A141V.
[0107] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, and D172Y.
[0108] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, and K217E.
[0109] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, and D232G.
[0110] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, and V331A.
[0111] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, and V371E.
[0112] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, and G436D.
[0113] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, and T438S.
[0114] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, and F453L.
[0115] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, and T471I.
[0116] In a specific embodiment, the G protein has amino acid substitutions of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0117] In a specific embodiment, the G protein has amino acid substitutions of A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0118] In a specific embodiment, the G protein has amino acid substitutions of D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0119] In a specific embodiment, the G protein has amino acid substitutions of K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0120] In a specific embodiment, the G protein has amino acid substitutions of D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0121] In a specific embodiment, the G protein has amino acid substitutions of V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0122] In a specific embodiment, the G protein has amino acid substitutions of V371E, G436D, T438S, F453L, T471I, and Y487H.
[0123] In a specific embodiment, the G protein has amino acid substitutions of G436D, T438S, F453L, T471I, and Y487H.
[0124] In a specific embodiment, the G protein has amino acid substitutions of T438S, F453L, T471I, and Y487H.
[0125] In a specific embodiment, the G protein has amino acid substitutions of F453L, T471I, and Y487H.
[0126] In a specific embodiment, the G protein has amino acid substitutions of T471I and Y487H.
[0127] In a specific embodiment, the G protein has an amino acid substitution of Y487H.
[0128] In the present application, the G protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO: 12.
[0129] In a specific embodiment, the G protein contains the amino acid sequence shown in SEQ ID NO: 13.
[0130] The above-mentioned M protein, or a recombinant oncolytic virus containing the above-mentioned M protein and G protein, wherein the recombinant oncolytic virus further contains an N protein, and the N protein has a mutation from isoleucine to valine (I14V) at the 14th site, and / or a mutation from arginine to lysine (R155K) at the 155th site, and / or a mutation from serine to asparagine (S353N) at the 353rd site, etc., compared with the amino acid sequence shown in SEQ ID NO: 14.
[0131] In a specific embodiment, the site mutation of the N protein includes a mutation from isoleucine to valine (I14V) at the 14th site.
[0132] In a specific embodiment, the site mutation of the N protein includes a mutation from arginine to lysine (R155K) at the 155th site.
[0133] In a specific embodiment, the site mutation of the N protein includes a mutation from serine to asparagine (S353N) at the 353rd site.
[0134] In a specific embodiment, the N protein has an amino acid substitution of I14V.
[0135] In a specific embodiment, the N protein has amino acid substitutions of I14V and R155K.
[0136] In a specific embodiment, the N protein has amino acid substitutions of I14V, R155K, and S353N.
[0137] In a specific embodiment, the N protein has amino acid substitutions of R155K and S353N.
[0138] In a specific embodiment, the N protein has an amino acid substitution of S353N.
[0139] In the present application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype includes the amino acid sequence shown in SEQ ID NO: 14.
[0140] In a specific embodiment, the N protein includes the amino acid sequence shown in SEQ ID NO: 15.
[0141] A recombinant oncolytic virus comprising the above-mentioned M protein, or the above-mentioned M protein and G protein, or the above-mentioned M protein, G protein and N protein, wherein the recombinant oncolytic virus further comprises a P protein, and the P protein has a mutation from arginine to lysine (R50K) at the 50th site, and / or a mutation from valine to alanine (V76A) at the 76th site, and / or a mutation from asparagine to glutamic acid (D99E) at the 99th site, and / or a mutation from leucine to serine (L126S) at the 126th site, and / or a mutation from leucine to serine (L140S) at the 140th site, and / or a mutation from histidine to tyrosine (H151Y) at the 151st site, and / or a mutation from isoleucine to methionine (I168M) at the 168th site, and / or a mutation from lysine to glutamic acid (K170E) at the 170th site, and / or a mutation from tyrosine to serine (Y189S) at the 189th site, and / or a mutation from asparagine to aspartic acid (N237D) at the 237th site, etc., including one or more site mutations.
[0142] In a specific embodiment, the site mutation of the P protein includes a mutation from arginine to lysine (R50K) at the 50th site.
[0143] In a specific embodiment, the site mutation of the P protein includes a mutation from valine to alanine (V76A) at the 76th site.
[0144] In a specific embodiment, the site mutation of the P protein includes a mutation from asparagine to glutamic acid (D99E) at the 99th site.
[0145] In a specific embodiment, the site mutation of the P protein includes a mutation from leucine to serine (L126S) at the 126th site.
[0146] In a specific embodiment, the site mutation of the P protein includes a mutation from leucine to serine at position 140 (L140S).
[0147] In a specific embodiment, the site mutation of the P protein includes a mutation from histidine to tyrosine at position 151 (H151Y).
[0148] In a specific embodiment, the site mutation of the P protein includes a mutation from isoleucine to methionine at position 168 (I168M).
[0149] In a specific embodiment, the site mutation of the P protein includes a mutation from lysine to glutamic acid at position 170 (K170E).
[0150] In a specific embodiment, the site mutation of the P protein includes a mutation from tyrosine to serine at position 189 (Y189S).
[0151] In a specific embodiment, the site mutation of the P protein includes a mutation from asparagine to aspartic acid at position 237 (N237D).
[0152] In a specific embodiment, the P protein has an amino acid substitution of R50K.
[0153] In a specific embodiment, the P protein has amino acid substitutions of R50K and V76A.
[0154] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, and D99E.
[0155] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, and L126S.
[0156] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, and L140S.
[0157] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, and H151Y.
[0158] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, and I168M.
[0159] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, and K170E.
[0160] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, and Y189S.
[0161] In a specific embodiment, the P protein has amino acid substitutions of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0162] In a specific embodiment, the P protein has amino acid substitutions of V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0163] In a specific embodiment, the P protein has amino acid substitutions of D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0164] In a specific embodiment, the P protein has amino acid substitutions of L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0165] In a specific embodiment, the P protein has amino acid substitutions of L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0166] In a specific embodiment, the P protein has amino acid substitutions of H151Y, I168M, K170E, Y189S, and N237D.
[0167] In a specific embodiment, the P protein has amino acid substitutions of I168M, K170E, Y189S, and N237D.
[0168] In a specific embodiment, the P protein has amino acid substitutions of K170E, Y189S, and N237D.
[0169] In a specific embodiment, the P protein has amino acid substitutions of Y189S and N237D.
[0170] In a specific embodiment, the P protein has an amino acid substitution of N237D.
[0171] In the present application, the P protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO: 16.
[0172] In a specific embodiment, the N protein contains the amino acid sequence shown in SEQ ID NO: 17.
[0173] A recombinant oncolytic virus comprising the above M protein, or the above M protein and G protein, or the above M protein, G protein and N protein, or the above M protein, G protein, N protein and P protein, wherein the recombinant oncolytic virus further comprises an L protein, and the L protein contains one or more site mutations such as a serine to proline mutation (S87P) at the 87th site and / or an isoleucine to threonine mutation (I487T) at the 487th site compared to the amino acid sequence shown in SEQ ID NO: 18.
[0174] In a specific embodiment, the site mutation of the L protein comprises a serine to proline mutation (S87P) at the 87th site.
[0175] In a specific embodiment, the site mutation of the L protein comprises an isoleucine to threonine mutation (I487T) at the 487th site.
[0176] In a specific embodiment, the L protein has amino acid substitutions of S87P and I487T.
[0177] In the present application, the L protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO: 18.
[0178] In a specific embodiment, the L protein contains the amino acid sequence shown in SEQ ID NO: 19.
[0179] In some specific embodiments, the recombinant oncolytic virus is obtained by site-specific mutation based on baculovirus.
[0180] In some specific embodiments, the recombinant oncolytic virus is obtained by site-specific mutation based on Vesicular Stomatitis Virus (abbreviated as "VSV") virus.
[0181] In some specific embodiments, the recombinant oncolytic virus is obtained by performing site-specific mutations based on the VSV virus Indiana MuddSummer subtype.
[0182] In some specific embodiments, the recombinant oncolytic virus further contains or expresses an exogenous target protein.
[0183] In some specific embodiments, the recombinant oncolytic virus contains a nucleic acid molecule, and the nucleic acid molecule includes a nucleic acid sequence encoding the M protein having a site mutation, and / or a nucleic acid sequence encoding the G protein having a site mutation, and / or a nucleic acid sequence encoding the N protein having a site mutation, and / or a nucleic acid sequence encoding the P protein having a site mutation, and / or a nucleic acid sequence encoding the L protein having a site mutation, and a nucleic acid sequence encoding the cytokine.
[0184] In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation.
[0185] In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the M protein having a site mutation, the nucleic acid sequence encoding the N protein having a site mutation, or the nucleic acid sequence encoding the P protein having a site mutation, and the nucleic acid sequence encoding the L protein having the site mutation.
[0186] In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation.
[0187] In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the M protein having a site mutation, the nucleic acid sequence encoding the N protein having a site mutation, or the nucleic acid sequence encoding the P protein having a site mutation, and the nucleic acid sequence encoding the L protein of the site mutation.
[0188] In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the antigen and the nucleic acid sequence encoding the L protein of the site mutation.
[0189] In a specific embodiment, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein of the site mutation and the nucleic acid sequence encoding the antigen.
[0190] In a second aspect, the present application provides a recombinant oncolytic virus expression vector, and adopts the following technical solution.
[0191] A recombinant oncolytic virus expression vector, which can express the above recombinant oncolytic virus.
[0192] In a third aspect, the present application provides a virus-producing cell, and adopts the following technical solution.
[0193] A virus-producing cell, which can produce the above recombinant oncolytic virus.
[0194] In a fourth aspect, the present application provides a vaccine, and adopts the following technical solution.
[0195] A vaccine, which is prepared by the above recombinant oncolytic virus.
[0196] In the fifth aspect, the present application provides a pharmaceutical composition and adopts the following technical solution.
[0197] A pharmaceutical composition, wherein the pharmaceutical composition comprises the above-described recombinant oncolytic virus or the above vaccine, and optionally a pharmaceutically acceptable carrier.
[0198] In the sixth aspect, the present application provides a method for preparing the above recombinant oncolytic virus, the above recombinant oncolytic virus expression vector, the above virus-producing cell, the above vaccine, and the above pharmaceutical composition.
[0199] In the seventh aspect, the present application further provides the use of the above recombinant oncolytic virus, the above oncolytic virus expression vector, the above virus-producing cell, the above vaccine, and the above pharmaceutical composition in the preparation of a medicament for preventing and / or treating a disease and / or illness.
[0200] In some specific embodiments, the recombinant oncolytic virus, the recombinant oncolytic virus expression vector, the virus-producing cell, the vaccine and / or the pharmaceutical composition are used in a method for continuously killing abnormal proliferating cells.
[0201] In some specific embodiments, the abnormal proliferating cells are selected from tumor cells or tumor tissue-related cells.
[0202] In the eighth aspect, the present application provides the use of the above recombinant oncolytic virus, the above vaccine, and the above pharmaceutical composition in the preparation of a medicament for treating a tumor.
[0203] In some specific embodiments, the tumor includes solid tumors or hematological tumors.
[0204] In some specific embodiments, the tumors include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, epithelioma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell histiocytosis, pharyngeal cancer, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and angioma tumor.
[0205] In short, this application has the following beneficial effects.
[0206] All of the recombinant oncolytic viruses provided in this application have good in vitro killing ability against abnormally proliferating (tumor) LLC cells and are not easily removed in LLC cells. And all of the recombinant oncolytic viruses provided in this application have low in vitro killing ability against normal MEF cells and are easily removed in normal MEF cells. Therefore, the recombinant oncolytic viruses provided in this application are often used for the infection and killing of cells such as tumors and cancers, and are easily removed in cells such as tumors and cancers, further improving the cure rate of the recombinant oncolytic viruses in cells such as tumors and cancers. At the same time, the recombinant oncolytic viruses provided above do not damage normal cells and are more easily removed when present in normal cells, further ensuring the safety of normal cells.
Brief Description of the Drawings
[0207]
Figure 1
[0208]
Figure 2
[0209]
Figure 3
[0210]
Figure 4
[0211]
Figure 5
[0212]
Figure 6
[0213]
Figure 7
[0214]
Figure 8
[0215] In the above drawing, No. 0 on the horizontal axis represents the wild-type oncolytic virus, and Nos. 1 to 130 on the horizontal axis each represent the recombinant oncolytic viruses prepared in Preparation Examples 1 to 130.
[0216] The vertical axis OD570 represents the OD value of the cells. The larger the value of OD570, the lower the killing ability of the recombinant oncolytic virus on the cells is shown, and the smaller the value of OD570, the better the killing ability of the recombinant oncolytic virus on the cells is shown.
[0217] The vertical axis IFN-β level represents the expression status of the IFN-β gene. The larger the value of the IFN-β level, the weaker the reproductive ability of the recombinant oncolytic virus in the cells and the easier it is to be removed is shown, and the smaller the value of the IFN-β level, the stronger the reproductive ability of the recombinant oncolytic virus in the cells and the easier it is to be removed is shown.
[0218] Those skilled in the art can easily understand other aspects and advantages of the present application from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are described and explained. As those skilled in the art understand, depending on the content of the present application, those skilled in the art can modify the specific embodiments disclosed without departing from the spirit and scope of the invention according to the present application. Correspondingly, the descriptions of the drawings and the specification of the present application are merely exemplary and not restrictive.
Embodiments for Carrying out the Invention
[0219] Hereinafter, embodiments of the invention of the present application will be described with specific examples. Those skilled in the art can easily understand other advantages and effects of the invention of the present application from the content disclosed in this specification.
[0220] Term Definition In this application, the term "oncolytic virus" generally refers to a virus that can replicate and kill tumor cells in tumor cells. Oncolytic viruses include, but are not limited to, Vesicular Stomatitis Virus (abbreviated as "VSV virus"), poxvirus, herpes simplex virus (HSV), measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus (SVV), echotype enterovirus, coxsackievirus, Newcastle disease virus (NDV), and Maraba virus. In certain embodiments, the oncolytic virus is modified to improve its selectivity for tumor cells. In certain embodiments, the oncolytic virus is modified to reduce its immunogenicity.
[0221] In some embodiments, the oncolytic virus of this application is the VSV virus.
[0222] In some embodiments, the VSV virus is a mutant of the VSV virus Indiana MuddSummer subtype strain and can be used for the treatment of tumors. Such a virus cannot interact with endogenous IFN-β in normal cells and can only selectively amplify and grow in tumor cells.
[0223] The VSV virus can express various cell surface molecules including low-density lipoprotein receptor, phosphatidylserine, sialolipid, and heparan sulfate, and can attach to the cell surface through these molecules. Compared with other oncolytic cell virus platforms currently under development, the VSV virus has the following advantages: (1) It has a small genome size, a short replication time, and a high synaptic transmission rate; (2) Due to the very high expression of foreign genes, it has a high titer and can be mass-produced; (3) It has an independent cell cycle and there is no risk of transformation in the cytoplasm of host cells. Such oncolytic viruses do not integrate into DNA and can avoid the occurrence of nervous system inflammation caused by wild-type viruses after attenuation treatment. In view of the above characteristics, VSV holds great potential in tumor immunotherapy.
[0224] In some embodiments, site-specific gene mutations may be made to the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus.
[0225] In one embodiment, the recombinant oncolytic virus described in the present application is an oncolytic virus modified at the gene level, for example, by modifying one or more genes to improve its tumor selectivity and / or preferentially replicate in dividing cells. The modification at the gene level may be a modification of genes involved in DNA / RNA replication, nucleic acid metabolism, host tropism, surface attachment, toxicity, lysis, and diffusion processes, or a modification for integrating exogenous genes. The exogenous genes may include exogenous immunomodulatory genes, exogenous screening genes, exogenous reporter genes, etc. The modified oncolytic virus is an oncolytic virus modified at the amino acid level, for example, an insertion, deletion, or substitution of one or more amino acids.
[0226] In this application, the term "M protein" generally refers to the VSV virus matrix protein. The M protein is an important virulence factor of the VSV virus and is also a protein known to interfere with the natural immune response of mice in the VSV virus. The term "M protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In this application, the M protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 1. In this application, the M protein of the oncolytic virus may include the amino acid sequences shown in SEQ ID NOs: 2-11.
[0227] In this application, the term "G protein" generally refers to the glycoprotein of the VSV virus and is also referred to as the envelope protein. The term "G protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In this application, the G protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 12. In this application, the G protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 13.
[0228] In this application, the term "N protein" generally refers to the nucleocapsid protein of the VSV virus. The term "N protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In this application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 14. In this application, the N protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 15.
[0229] In this application, the term "P protein" usually means the phosphoprotein of the VSV virus. The term "P protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In this application, the P protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 16. In this application, the P protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 17.
[0230] In this application, the term "L protein" usually means the RNA polymerase protein of the VSV virus. The L gene of the VSV virus encodes the RNA poly E protein. The term "L protein" further includes its homologs, orthologs, variations, functionally active fragments, etc. In this application, the L protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 18. In this application, the L protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 19.
[0231] In this application, the expression of protein mutation sites is usually represented as "amino acid + amino acid site number + mutated amino acid". In this application, the mutations include, but are not limited to, addition, substitution, deletion and / or truncation of amino acids. For example, the term "M51R" usually means a mutation from methionine M at position 51 to arginine R.
[0232] In this application, the term "amino acid substitution" usually means substituting one amino acid residue present in the parental sequence with another amino acid residue. The amino acid in the parental sequence may be substituted, for example, by chemical synthesis or recombinant methods known to those skilled in the art. Therefore, "substitute at position xx" usually means substituting the amino acid present at position xx with an alternative amino acid residue. In this application, the amino acid substitution may include amino acid mutations.
[0233] In this application, the term "mutation" generally means changing the nucleotide or amino acid sequence of the wild-type molecule. Amino acid changes may include amino acid substitutions, deletions, truncations, insertions, additions, cleavages, or protein processing and cutting.
[0234] In this application, the recombinant oncolytic virus performs site-specific gene mutagenesis on the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus, and simultaneously integrates a foreign gene. Specifically, the foreign gene is a gene encoding a cytokine.
[0235] In this application, the term "antigen" refers to a substance that can cause the generation of antibodies or immune cells and is any substance that can induce an immune response in the body. That is, it is a substance that is specifically recognized and bound by the antigen receptors (TCR / BCR) on the surface of T / B lymphocytes, activates T / B cells, promotes their proliferation and differentiation, generates immune response products (sensitized lymphocytes or antibodies), and can specifically bind to the corresponding products in vivo and in vitro. Therefore, an antigenic substance has two important properties: immunogenicity and immunoreactivity. Immunogenicity refers to the ability of an antigen to induce a specific immune response in the body and generate antibodies and / or sensitized lymphocytes, and immunoreactivity refers to the ability to generate a specific binding reaction with the corresponding immune effector substance (antibody or sensitized lymphocyte) in vivo and in vitro.
[0236] In a specific embodiment, the oncolytic virus is engineered to carry the coding sequence of an antigen recognizable by CAR T cells.
[0237] In some specific embodiments, the antigen is exogenous, meaning that the antigen is derived from a different species.
[0238] In some specific embodiments, the antigen is an endogenous antigen. Specifically, the antigen is usually an antigen expressed in tumor cells.
[0239] In a specific embodiment, the antigen is a Tumor Associated Antigen (TAA) or a Tumor Specific Antigen (TSA).
[0240] In a specific embodiment, the TAA or TSA is presented on the cell surface or covers a molecule or a part thereof present in the tumor environment (e.g., in the tumor microenvironment).
[0241] In some specific embodiments, the cell is a tumor cell.
[0242] In some specific embodiments, the TAA or TSA includes tumor-associated antigens or tumor-specific antigens on the cell surface or within the cell membrane.
[0243] In some specific embodiments, the cell is a non-tumor cell present in the tumor environment. For example, but not limited to, cells present in the vascular tissue associated with a tumor or cancer.
[0244] In some specific embodiments, the TAA or TSA is an antigen generated by angiogenesis in the tumor microenvironment.
[0245] In some specific embodiments, the TAA or TSA is an antigen on the blood vessels in the tumor microenvironment.
[0246] In some specific embodiments, the cell is a stromal cell present in the tumor environment.
[0247] In some specific embodiments, the TAA or TSA is a stromal cell antigen in the tumor microenvironment.
[0248] In some specific embodiments, the TAA or TSA includes an extracellular epitope of a tumor cell surface antigen, a tetramer inside and outside the tumor cell membrane, or other structures recognizable by antibodies or immune cells.
[0249] In some specific embodiments, the TAA or TSA includes an extracellular matrix antigen.
[0250] In some specific embodiments, the TAA or TSA includes antigens present in the tumor microenvironment (TME).
[0251] In some specific embodiments, the TAA or TSA includes molecules secreted by tumor cells into the TME.
[0252] In some specific embodiments, the TAA or TSA includes effector molecules secreted by tumor cells into the TME.
[0253] In some specific embodiments, the TAA or TSA includes effector molecules secreted by tumor cells into the TME and downregulating or inhibiting the activity of cytotoxic natural killer (NK) cells or T cells.
[0254] In some specific embodiments, the TAA or TSA includes soluble activating receptor ligands secreted by tumor cells into the TME and inhibiting the recognition of tumor cells by NK cells or T cells.
[0255] In some specific embodiments, examples of TAA or TSA include 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa, FcγRIIIb, CD28, CD137, CTLA-4, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) protein, lymphotoxin-β receptor (LTβR), toll-like receptor (TLR), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), human epidermal growth factor receptor 1 (EGFR1), EGFRvIII, human epidermal growth factor receptor 2 (Her2 / neu;Erb2), ErbB3 (Her3), folate receptor, ephrin receptor, PDGFRa, ErbB2, CD2, CD20, CD22, CD30, CD33, CD40, CD37, CD38, CD70, CD74, CD56, CD80, CD86, CD123, CCAM5, CCAM6, BCMA, p53, cMet (tyrosine protein kinase Met), hepatocyte growth factor receptor (HGFR), MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BAGE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosine, Wilms tumor antigen (WT1), TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC1, MUC2, P-cadherin, myostatin (GDF8), Cripto (TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, WT1, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, mesothelin, DR5, PD-1, PD-L1, HER-2, IGF-1R, CXCR4, neuropilin 1, phosphatidylinositol proteoglycan, EphA2, CD138, B7-H3, B7-H4, gpA33, GPC3, SSTR2 or VEGF-R2, including but not limited to these.;
[0256] In this application, the term "cytokines" refers to bioactive substances synthesized and secreted by immune cells (lymphocytes, monocytes, macrophages, etc.) and their related cells (vascular endothelial cells, fibroblasts, etc.) that regulate the functions of other immune cells or target cells and belong to small molecule peptides or glycoproteins. All cytokines with immunomodulatory effects can be expressed by recombinant oncolytic viruses. According to their main functions, cytokines can be classified into interleukin (IL), interferon (IFN), tumor necrosis factor (TNF), colony stimulating factor (CSF), transforming growth factor-β family (TGF-β family), growth factor (GF), and chemokine family.
[0257] Interleukins include IL-1, IL-2, IL-7, IL-9, IL-15, IL-21, IL-4, IL-12, IL-18.
[0258] Specifically, for interleukin 1 (IL-1), IL-1 is a pleiotropic cytokine related to cortical inflammatory responses, cell growth, and tissue repair. The IL-1 superfamily has 11 members, such as IL-1A, IL-1B, IL-1Ra, IL-18, etc. IL-1 is a drug target for some cancers and is also used in cell therapy. In cellular immunotherapy, IL-1 stimulates the proliferation of CD4+ T cells in vitro, induces the generation of IL-2, stimulates CD8+ / IL1R+ T cell activation together, and stimulates the proliferation of mature B cells and the secretion of immunoglobulin proteins.
[0259] Specifically, regarding interleukin-2 (IL-2), IL-2 is also known as a T-cell growth factor. It is generated when T cells respond to an antigen or are stimulated by a mitogenic stimulus and is widely used to promote the activation and proliferation of T cells and NK cells. IL-2 stimulates the proliferation of NK cells, increases cytotoxicity, and enables NK cells to secrete various cytokines. However, further research has shown that IL-2 causes excessive differentiation of T cells, induces apoptosis of activated T cells, activates CD4+FoxP3 Treg regulatory cells, and inhibits the activation and tumor-killing activity of T cells. Therefore, since IL-2 is considered not just an activator of T cells but a regulator of T cells, there are also studies using IL-7, IL-15, and IL-21 instead of IL-2.
[0260] Specifically, regarding interleukin-7 (IL-7), IL-7 is a hematopoietic growth factor secreted by stromal cells in the bone marrow and thymus. It shares the γc receptor subunit with IL-2 and stimulates the proliferation of lymphocyte progenitor cells. IL-7 provides a continuous stimulatory signal to naive T cells and memory T cells. As described above, IL-7 does not activate CD4+FoxP3+ Treg cells during the activation of CD8+ T cells. Clinically, IL-7 can also be used to restore the T-cell count after chemotherapy or hematopoietic stem cell transplantation. And IL-7 plays a major role at a certain stage when B cells mature and can affect their proliferation. IL-7 may also be a regulator of intestinal mucosal lymphocytes.
[0261] Specifically, regarding interleukin 15 (IL-15), IL-15 has a structure similar to IL-2, shares the γc receptor subunit, and belongs to the four α-helix bundle family (others include, for example, IL-2, IL-4, IL-7, IL-9, G-CSF, and GM-CSF). IL-15 regulates the activation and proliferation of T cells and NK cells. IL-15 is mainly a cell that kills viral infections in the innate immune system. At the same time, IL-15 can activate NKT cells and γδT cells. In immunocyte therapy, IL-15 causes apoptosis of activated T cells and does not activate CD8+ effector T cells. IL-15 maintains the survival of memory T cells and plays an important role in long-term antitumor activity.
[0262] Specifically, regarding interleukin 21 (IL-21), IL-21 also belongs to the IL-2 family, shares the γc receptor subunit, has a very strong regulatory effect on immune system cells, and can induce cell division and proliferation in its target cells. In cellular immunotherapy, IL-21 promotes the proliferation of CD4+ and CD8+ T cells, enhances the cytotoxicity of CD8+ T cells and NK cells, and there is no apoptosis of cells due to activation. IL-21 preferentially amplifies "young" CD27+CD28+ CD8+ T cells, and such cells have stronger cytotoxicity. Of course, since IL-21 does not cause the amplification of Tregs, the application of IL-21 in cellular immunotherapy is becoming increasingly widespread.
[0263] Specifically, regarding interleukin 4 (IL-4), IL-4 activates the proliferation of activated B cells and T cells and regulates the expression of Fc receptors in lymphocytes and monocytes. IL-4 induces the conversion of Th1 cells to Th2 cells. IL-4 stimulates Th2 cells to secrete IL-4, IL-5, IL-6, IL-10, and IL-13. By suppressing macrophage growth, IL-4 guides monocytes to differentiate in the direction of DCs. When IL-4 is not added to the culture system, monocytes differentiate into macrophages. IL-4 plays an important role in humoral immunity and acquired immunity, converting the B cell antibody class to IgE and upregulating the production of MHC class II molecules. When IL-4 and GM-CSF act together, they can direct the differentiation of monocytes into immature DCs. At this time, the DCs have a strong ability to capture and process antigens but a weak antigen presentation ability. Using IL-4 and TNF-α in sequence can promote the maturation of DCs.
[0264] Specifically, regarding interleukin 12 (IL-12), IL-12 acts on activated T and NK cells, has broad biological activities, and acts on lymphocytes through the activation factor-mediated activation of the transcription protein STAT4. IL-12 is necessary for the T cell-independent induction of IFN-γ and plays an important role in the differentiation of Th1 and Th2 cells. IL12B binds to IL23A to form the IL-23 interleukin and has an acquired immune function. IL-12 is a drug target. In cellular immunotherapy, IL-12 promotes the differentiation of CD4+ T cells into CD4+ Th1 T cells and enhances the activity of CD8+ CTLs cells. The therapeutic effect of IL-12 is associated with its dosage, action time, and other cytokines that act on each other, and promotes the tumor-killing activity of immune cells through various mechanisms. In a mouse anti-melanoma model, high-dose IL-12 acts through NK cells, while low-dose IL-12 exerts a tumor-killing effect through NKT.
[0265] Specifically, regarding interleukin 18 (IL-18), IL-18, also known as interferon-γ inducing factor, belongs to inflammatory cytokines and is produced from macrophages and other cells. IL-18 can promote NK cells and CD8+ T cells to secrete IFN-γ and enhance the cytotoxic effects of NK cells and CD8+ T cells. IL-18 can also activate macrophages, promote the development of Th1 CD4+ T cells, and promote lymphocytes to express functions such as FasL. IL-18 provides a potential therapeutic target for allergic diseases. In addition, IL-18, IL-12, and IL-15 can cooperate to maintain the Th1 response and monokine production in autoimmune diseases.
[0266] Gamma interferon is a type II interferon, mainly produced by NK and NKT cells, with antiviral, antitumor, and immunomodulatory effects, including IFN-γ and IFN-β. IFN-γ has an antiproliferative effect on transformed cells and can enhance the antiviral and antitumor effects of type I interferon. IFN-γ induces the expression of MHC I, MHC II, and costimulatory molecules in antigen-presenting cells (APCs) by activating macrophages. Additionally, IFN-γ can induce changes in the expression of protein enzymes to enhance antigen-presenting ability. IFN-γ can promote the differentiation of CD4+ T cells into Th1 cells and inhibit the subtype switching of IL-4-dependent B cells. IFN-γ activates the JAK-STAT cell pathway through the phosphorylation of JAK1 and JAK2 proteins. In cellular immunotherapy, IFN-γ acts on host immune cells and has a certain effect on macrophages, T cells, B cells, and NK cells, etc. IFN-γ further enhances antigen-presenting ability by promoting the expression of macrophage MHC class II molecules or inducing the expression of MHC class II molecules in cells that do not normally express MHC class II molecules (such as vascular endothelial cells, certain epithelial cells, and connective tissue cells). IFN-γ can promote the differentiation of B cells and CD8+ T cells but cannot promote their proliferation. IFN-γ can enhance the activity and immune function of TH1 cells. IFN-γ can enhance neutrophil phagocytosis, activate NK cells, and enhance their cytotoxic effect. Abnormal IFN-γ expression is associated with many autoinflammatory and autoimmune diseases.
[0267] Tumor necrosis factor belongs to the TNF superfamily cytokines and is a multifunctional molecule that regulates biological processes, including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. TNF-α is involved in anti-tumor effects. In cell immunotherapy, TNF-α differentiates immature DCs into mature DCs. This process is achieved by TNF-α downregulating the macropinocytosis of immature DCs and the expression of surface Fc receptors, and upregulating the expression of cell surface MHC class I, class II molecules, and B7 family molecules (CD80, CD86, etc.). Mature DCs have a significantly reduced ability to capture and process, but a significantly increased antigen presentation ability and can strongly activate T cells. TNF-α can affect the production of other cytokines. For example, it stimulates monocytes and macrophages to secrete IL-1, enhances the proliferation ability of IL-2-dependent thymocytes and T cells, promotes the production of lymphokines such as IL-2, CSF, and IFN-γ, and enhances the ability of mitogens or foreign antigens to stimulate the proliferation of B cells and Ig secretion.
[0268] Granulocyte macrophage colony-stimulating factor (GM-CSF) plays an important role in embryo implantation and its development. GM-CSF is one of the cytokines first discovered to act on dendritic cells (DCs). In DC culture, GM-CSF promotes the differentiation of monocytes into macrophage-like cells, enhances the expression of cell surface MHC class II molecules, and strengthens the antigen-presenting function of cells. In addition, GM-CSF can also promote the survival of DCs. In cellular immunotherapy, GM-CSF can activate the immune response and generate antitumor activity by activating macrophages and DCs. Regarding antigen presentation, GM-CSF can promote the maturation of DC cells, upregulate co-stimulatory molecules, and promote the expression of CD1d receptors. Recent research findings have shown that GM-CSF stimulates hematopoietic progenitor cells to differentiate into monocytes and neutrophils, reducing the risk of febrile neutropenia in cancer patients. Other studies have shown that GM-CSF induces the differentiation of bone marrow DCs, promotes the polarization of Th1 cells towards the immune response, promotes angiogenesis, and affects the development of allergic inflammation and autoimmune diseases. Therefore, GM-CSF is clinically used in the treatment of malignant tumors.
[0269] In this application, the term "nucleic acid molecule" generally means nucleotides of any length. In this application, the term "nucleic acid molecule" can encode the proteins contained in the oncolytic virus. In this application, the nucleic acid molecule may contain DNA and / or RNA. In some cases, the RNA may contain single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), the single-stranded RNA may contain sense RNA, anti-sense RNA, or ambisense RNA.
[0270] In this application, the term "expression vector" generally means a nucleic acid carrier. Under appropriate conditions, it can usually express a target gene and / or a target protein. In certain embodiments of this application, the expression vector contains a nucleic acid molecule of one or more components for expressing a virus (for example, an oncolytic virus). For example, the expression vector contains at least one viral genomic element and can be packaged into a virus or packaged as a viral particle.
[0271] In this application, the term "virus-producing cell" generally means a cell, cell line or cell culture that may or already contains the nucleic acid molecule or expression vector described in this application and can express the recombinant oncolytic virus described in this application. The cells may include the progeny of a single host cell. The cells may be obtained by using the expression vector transfection in vitro described in this application.
[0272] In this application, the term "pharmaceutical composition" means a preparation that contains no other components that are toxic enough to be unacceptable to the subject to whom it is administered in a form that enables the biological activity of the active ingredient. In certain embodiments, these preparations may contain the active ingredient of the drug and a pharmaceutically acceptable carrier. In certain embodiments, the drug product includes drug products for parenteral, transdermal, intraluminal, intraarterial, intrathecal and / or intranasal administration or direct injection into tissue. The drug product may be administered in different ways, such as intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal or intra-tissue administration.
[0273] In this application, the term "prevention" generally means preventing the occurrence, onset, recurrence, and / or spread of a disease or one or more of its symptoms by taking certain measures in advance. In this application, the term "treatment" generally means eliminating and improving a disease or one or more symptoms associated with the disease. In certain embodiments, treatment generally means administering one or more drugs to a patient suffering from this disease to eliminate or relieve the disease. In certain embodiments, "treatment" may be the pharmaceutical composition and / or drug product administered in the presence or absence of other drugs after the onset of symptoms of a particular disease. For example, prevent the occurrence, development, recurrence, and / or metastasis of tumors using the pharmaceutical composition and / or drug product described in this application.
[0274] In this application, the term "tumor" generally means the growth of any new pathological tissue. Tumors can be benign or malignant. In this application, the tumor may be a solid tumor and / or a hematological tumor. For research purposes, these tissues can be isolated from readily available sources by methods well known to those skilled in the art.
[0275] In some specific embodiments, the tumor includes, but is not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, breast cancer (BRCA), cervical cancer, chronic myeloproliferative tumor, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell histiocytosis, pharyngeal cancer, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and angioma.
[0276] Content of the Invention A wild-type VSV virus, specifically, the VSV Indiana strain or the VSV Indiana MuddSummer subtype strain. The amino acid sequence of its M protein is shown in SEQ ID NO: 1, the amino acid sequence of its G protein is shown in SEQ ID NO: 12, the amino acid sequence of its N protein is shown in SEQ ID NO: 14, the amino acid sequence of its P protein is shown in SEQ ID NO: 16, and the amino acid sequence of its L protein is shown in SEQ ID NO: 18. In the present application, any of the M protein, G protein, N protein, P protein, and L protein can be modified.
[0277] An oncolytic virus, which is obtained by mutating sites in the amino acid sequences of its M protein, G protein, N protein, P protein, and L protein based on the above wild-type VSV virus.
[0278] The present application provides a recombinant oncolytic virus. The recombinant oncolytic virus is obtained by introducing a foreign gene encoding an antigen based on the above oncolytic virus.
[0279] The above recombinant oncolytic virus contains an M protein and an antigen encoded by a foreign gene. The M protein contains a mutation from methionine to arginine at position 51 (M51R), a mutation from valine to phenylalanine at position 221 (V221F), and a mutation from serine to arginine at position 226 (S226R) compared to the amino acid sequence shown in SEQ ID NO: 1.
[0280] Furthermore, the recombinant oncolytic virus is obtained by introducing a foreign gene encoding an antigen based on the above recombinant oncolytic virus.
[0281] Furthermore, the antigen is selected from blood cancers and solid tumors.
[0282] Furthermore, the solid tumor is 5T4, ROR1, EGFR, FcγRI (CD64), FcγRIIa (CD32a), FcγRIIb (CD32b), CD28, CD137 (4-1BB), CTLA-4, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) protein, lymphotoxin-β receptor (LTβR), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), human epidermal growth factor receptor 1 (EGFR1), EGFRvIII, human epidermal growth factor receptor 2 (Her2 / neu;Erb2), ErbB3 (HER3), folate receptor, ephrin receptor, PDGFRa, ErbB-2, CD2, CD40, CD74, CD80, CD86, CCAM5 (CD66e), CCAM6 (CD66c), p53, cMet (tyrosine protein kinase Met), HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosine, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin (GDF8), Cripto (TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, neuropilin 1 (Neuropilin, NRP-1), phosphatidylinositol proteoglycan (glypican2 / 3, GPC2 / 3), EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL, including but not limited to these.;
[0283] Furthermore, the hematological tumor includes, but is not limited to, BCMA (TNFRSF17), CD4, CD5 (Leu-1), CD7, CD10, FcγRIIIa (CD16a), FcγRIIIb (CD16b), CD19, CD20 (MS4A1), CD22 (Siglec-2), CD23, CD30 (TNFRSF8), CD33 (Siglec-3), CD34, CD37, CD38, CD44, CD47, CD56 (NCAM1), CD70, CD117, CD123 (IL3RA), CD138 (SDC1), CD174, CLL-1, ROR1, NKG2DL1 / 2 (ULBP1 / 2), IL1R3 (IL-1-RAP), FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3 (CD229), SLAMF7 (CD319), TCR B-chain, ITGB7, k-1gG, TACI, TRBCI, LeY, MUC1.
[0284] Furthermore, the antigen is selected from any one or more of CD19, BCMA, NY-ESO-1, MUC-1, MSLN, EGFR, VEGFR2, MAGE A4, cMet, HGFR, Claude 18.2.
[0285] Furthermore, the recombinant oncolytic virus further includes a cytokine encoded by a foreign gene.
[0286] Furthermore, the cytokine is selected from interleukins, interferons, tumor necrosis factors, colony-stimulating factors, transforming growth factor-β, chemokine family, growth factors.
[0287] Furthermore, the cytokine is selected from any one or more of GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β and TNF-α.
[0288] Furthermore, the cytokine is selected from any one or more of GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, and IFN-β.
[0289] The M protein further includes one or more site mutations such as a mutation from asparagine to serine at the 32nd site (N32S), and / or a mutation from asparagine to aspartic acid at the 49th site (N49D), and / or a mutation from histidine to tyrosine at the 54th site (H54Y), and / or a mutation from valine to isoleucine at the 225th site (V225I).
[0290] The M protein further includes one or more site mutations such as a knockout of the leucine-coding base at the 111th site, or a mutation from leucine to alanine at the 111th site (L111A).
[0291] The M protein further includes one or more site mutations such as a mutation from glycine to alanine at the 21st site (G21E), and / or a mutation from methionine to alanine at the 33rd site (M33A), and / or a mutation from alanine to threonine at the 133rd site (A133T). For example, the M protein includes the amino acid sequences shown in SEQ ID NOs: 2 to 11.
[0292] In the present application, the M protein includes amino acid substitutions at the 51st site, 221st site, and 226th site.
[0293] In the present application, the M protein includes amino acid substitutions at the 32nd site, 49th site, 51st site, 54th site, 221st site, 225th site, and 226th site.
[0294] In the present application, the M protein includes amino acid substitutions at the 32nd site, 49th site, 51st site, 54th site, 111th site, 221st site, 225th site, and 226th site.
[0295] In the present application, the M protein contains amino acid substitutions at positions 21, 32, 49, 51, 54, 221, 225, and 226.
[0296] In the present application, the M protein contains amino acid substitutions at positions 21, 32, 33, 49, 51, 54, 221, 225, and 226.
[0297] In the present application, the M protein contains amino acid substitutions at positions 21, 32, 33, 49, 51, 54, 133, 221, 225, and 226.
[0298] In the present application, the M protein contains amino acid substitutions at positions 32, 33, 49, 51, 54, 221, 225, and 226.
[0299] In the present application, the M protein contains amino acid substitutions at positions 32, 33, 49, 51, 54, 133, 221, 225, and 226.
[0300] In the present application, the M protein contains amino acid substitutions at positions 32, 49, 51, 54, 133, 221, 225, and 226.
[0301] In the present application, the M protein may also contain amino acid substitutions at other positions.
[0302] A recombinant oncolytic virus containing the above-mentioned M protein, wherein the recombinant oncolytic virus further contains a G protein, and the G protein has a mutation from valine to isoleucine (V53I) at the 53rd site, and / or a mutation from alanine to valine (A141V) at the 141st site, and / or a mutation from aspartic acid to tyrosine (D172Y) at the 172nd site, and / or a mutation from lysine to glutamic acid (K217E) at the 217th site, and / or a mutation from aspartic acid to glycine (D232G) at the 232nd site, and / or a mutation from valine to alanine (V331A) at the 331st site, and / or a mutation from valine to glutamic acid (V371E) at the 371st site, and / or a mutation from glycine to aspartic acid (G436D) at the 436th site, and / or a mutation from threonine to serine (T438S) at the 438th site, and / or a mutation from phenylalanine to leucine (F453L) at the 453rd site, and / or a mutation from threonine to isoleucine (T471I) at the 471st site, and / or a mutation from tyrosine to histidine (Y487H) at the 487th site, compared with the amino acid sequence shown in SEQ ID NO: 12. For example, the G protein contains the amino acid sequence shown in SEQ ID NO: 13.
[0303] In the present application, the G protein may include amino acid mutations at the 53rd site, 141st site, 172nd site, 217th site, 232nd site, 331st site, 371st site, 436th site, 438th site, 453rd site, 471st site and 487th site.
[0304] In the present application, the G protein may include amino acid substitutions at other positions.
[0305] In one embodiment, the G protein comprises at least one or more amino acid substitutions in a conserved region. For example, the conserved region may include the amino acids at positions 437-461 of the G protein. In one embodiment, the G protein comprises at least one or more amino acid substitutions in a cleavage region of the cytoplasmic domain. For example, the cleavage region of the cytoplasmic domain may include the amino acids at positions 483-511 of the G protein.
[0306] A recombinant oncolytic virus comprising the above M protein, or the above M protein and G protein, wherein the recombinant oncolytic virus further comprises an N protein, and the N protein has a mutation from isoleucine to valine (I14V) at position 14, and / or a mutation from arginine to lysine (R155K) at position 155, and / or a mutation from serine to asparagine (S353N) at position 353, etc., compared to the amino acid sequence shown in SEQ ID NO: 14. For example, the N protein comprises the amino acid sequence shown in SEQ ID NO: 15.
[0307] In the present application, the N protein may include amino acid mutations at positions 14, 155 and 353.
[0308] In the present application, the N protein may include amino acid substitutions at other positions.
[0309] A recombinant oncolytic virus comprising the above-mentioned M protein, or the above-mentioned M protein and G protein, or the above-mentioned M protein, G protein and N protein, wherein the recombinant oncolytic virus further comprises a P protein, and the P protein has a mutation from arginine to lysine at position 50 (R50K), and / or a mutation from valine to alanine at position 76 (V76A), and / or a mutation from asparagine to glutamic acid at position 99 (D99E), and / or a mutation from leucine to serine at position 126 (L126S), and / or a mutation from leucine to serine at position 140 (L140S), and / or a mutation from histidine to tyrosine at position 151 (H151Y), and / or a mutation from isoleucine to methionine at position 168 (I168M), and / or a mutation from lysine to glutamic acid at position 170 (K170E), and / or a mutation from tyrosine to serine at position 189 (Y189S), and / or a mutation from asparagine to aspartic acid at position 237 (N237D), etc., compared to the amino acid sequence shown in SEQ ID NO: 16. For example, the P protein comprises the amino acid sequence shown in SEQ ID NO: 17.
[0310] In the present application, the P protein may include amino acid mutations at positions 50, 76, 99, 126, 140, 151, 168, 170, 189 and 237.
[0311] In the present application, the P protein may include amino acid substitutions at other positions.
[0312] A recombinant oncolytic virus comprising the above-mentioned M protein, or the above-mentioned M protein and G protein, or the above-mentioned M protein, G protein and N protein, or the above-mentioned M protein, G protein, N protein and P protein, wherein the recombinant oncolytic virus further comprises an L protein, and the L protein comprises one or more site mutations such as a mutation from serine to proline (S87P) at position 87 and / or a mutation from isoleucine to threonine (I487T) at position 487 as compared to the amino acid sequence shown in SEQ ID NO: 18. For example, the L protein comprises the amino acid sequence shown in SEQ ID NO: 19.
[0313] In the present application, the P protein may comprise amino acid mutations at positions 87 and 487.
[0314] In the present application, the P protein may comprise amino acid substitutions at other positions.
[0315] The recombinant oncolytic virus comprises a nucleic acid molecule, and the nucleic acid molecule comprises a nucleic acid sequence encoding the M protein having a site mutation, and / or a nucleic acid sequence encoding the G protein having a site mutation, and / or a nucleic acid sequence encoding the N protein having a site mutation, and / or a nucleic acid sequence encoding the P protein having a site mutation, and / or a nucleic acid sequence encoding the L protein having a site mutation, and a nucleic acid sequence encoding the cytokine.
[0316] Furthermore, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation.
[0317] Furthermore, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the M protein having a site mutation, the nucleic acid sequence encoding the N protein having a site mutation, or the nucleic acid sequence encoding the P protein having a site mutation, and the nucleic acid sequence encoding the L protein having the site mutation.
[0318] Furthermore, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein of the site mutation.
[0319] Furthermore, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the M protein having a site mutation, and / or the nucleic acid sequence encoding the N protein having a site mutation, and / or the nucleic acid sequence encoding the P protein having a site mutation, and / or the nucleic acid sequence encoding the L protein of the site mutation.
[0320] Furthermore, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the antigen and the nucleic acid sequence encoding the L protein of the site mutation.
[0321] Furthermore, in the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein of the site mutation and the nucleic acid sequence encoding the antigen.
[0322] In the present application, the recombinant oncolytic virus described in the present application can be obtained by a virus packaging process and a virus rescue process. The specific process may include infecting and inoculating BSR-T7 cells with the poxvirus vTF7-3 expressing T7 RNA polymerase, and performing lipofectamine transfection using expression plasmids and backbone plasmids that respectively clone the VSV N, VSV P, and VSV L genes to obtain the target oncolytic virus.
[0323] The present application further provides a recombinant oncolytic virus expression vector, a virus-producing cell, a vaccine, and a pharmaceutical composition.
[0324] The recombinant oncolytic virus expression vector may contain nucleic acid sequences encoding the M protein and G protein of the recombinant oncolytic virus, and the recombinant oncolytic virus expression vector may further contain nucleic acid sequences encoding the N protein, P protein and L protein of the recombinant oncolytic virus.
[0325] The virus-producing cells can produce the above-mentioned recombinant oncolytic virus, and the virus-producing cells may include BSR-T7 cells, Vero cells, 293 cells, MRC-5 cells, WI38 cells.
[0326] The vaccine is prepared with the above-mentioned recombinant oncolytic virus.
[0327] The pharmaceutical composition includes the above-mentioned recombinant oncolytic virus and, optionally, a pharmaceutically acceptable carrier.
[0328] In certain embodiments, the pharmaceutical composition may include appropriate formulations of one or more (pharmaceutically effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers and / or preservatives. The acceptable components of the pharmaceutical composition are preferably non-toxic to the subject at the dosages and concentrations used. The pharmaceutical compositions of the present application include, but are not limited to, liquid, frozen and lyophilized compositions.
[0329] In certain embodiments, the pharmaceutically acceptable carrier includes any solvent, dispersion medium, coating, isotonic agent and absorption delaying agent suitable for drug administration, and is usually safe and non-toxic.
[0330] The pharmaceutical composition includes the above-mentioned recombinant oncolytic virus and, optionally, other pharmaceutically acceptable drugs.
[0331] The above-mentioned pharmaceutical composition may be used for combination therapy of diseases including, but not limited to, the treatment of tumors.
[0332] In certain embodiments, the pharmaceutical composition includes a pharmaceutical product for parenteral, transdermal, intraluminal, intra-arterial, intravenous, intrathecal and / or intranasal administration or direct injection into tissue. For example, the administration of the pharmaceutical composition to a patient or subject can be effected by infusion or injection. In certain embodiments, the pharmaceutical composition may be administered in different ways, such as intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal or intratissue administration. In certain embodiments, the pharmaceutical composition can be administered without interruption. The uninterrupted (or continuous) administration can be achieved by measuring the flow of the therapeutic agent into the patient's body by means of a small pump system worn by the patient, as described in WO 2015 / 036583.
[0333] In addition, the present application provides methods for preparing the above recombinant oncolytic virus, the above recombinant oncolytic virus expression vector, the above virus-producing cell, the above vaccine, and the above pharmaceutical composition. Any method suitable for producing an oncolytic virus can be used for producing the recombinant oncolytic virus of the present application. For example, a poxvirus expressing T7 RNA polymerase is added to cells for transfection, and a plasmid expressing the recombinant oncolytic virus N protein, L protein and P protein and a backbone plasmid are added for transfection, and the recombinant oncolytic virus of the present application is obtained by a virus rescue process.
[0334] The present application further provides the use of the above recombinant oncolytic virus, the above oncolytic virus expression vector, the above virus-producing cell, the above vaccine, and the above pharmaceutical composition in the preparation of a medicament for preventing and / or treating a disease and / or illness.
[0335] The recombinant oncolytic virus provided in this application performs site-specific mutations on the amino acids in the M protein, G protein, N protein, P protein, and L protein of the oncolytic virus, and at the same time inserts antigens and / or cytokines encoded by foreign genes, thereby further improving the in vitro killing ability of the oncolytic virus against abnormal proliferation (tumor) LLC cells. At the same time, the above-prepared recombinant oncolytic virus has little effect on normal MEF cells, indicating that the recombinant oncolytic virus prepared in this application can be well used for the damage and killing of abnormal cells such as tumors and cancers, and at the same time, it does not damage normal cells, showing great potential for wide application.
[0336] The recombinant oncolytic virus provided in this application performs site-specific mutations on the amino acids in the M protein, G protein, N protein, P protein, and L protein of the oncolytic virus, and at the same time inserts antigens and / or cytokines encoded by foreign genes, thereby further improving the in vitro killing ability of the oncolytic virus against abnormal proliferation (tumor) LLC cells. At the same time, the above-prepared recombinant oncolytic virus has little effect on normal MEF cells, indicating that the recombinant oncolytic virus prepared in this application can be well used for the damage and killing of abnormal cells such as tumors and cancers, and at the same time, it does not damage normal cells.
[0337] The recombinant oncolytic virus provided in the present application is not easily removed in abnormally proliferating (tumor) LLC cells. Relatively speaking, the wild-type oncolytic virus is more easily removed in LLC cells. The recombinant oncolytic virus provided in the present application performs site-specific mutations on the amino acids of the M protein, G protein, N protein, P protein, and L protein of the oncolytic virus, and at the same time inserts the antigen and / or cytokine encoded by the foreign gene, so that the oncolytic virus is less likely to be removed in LLC cells, 4T1 cells, MC38 cells and Hela cells, and further ensures that the oncolytic virus further exerts its infectivity and killing ability in LLC cells, 4T1 cells, MC38 cells and Hela cells. At the same time, the recombinant oncolytic virus provided in the present application is more easily removed in normal MEF cells, further ensuring the safety of normal MEF cells, thus improving the safety of the oncolytic virus.
[0338] Hereinafter, the present application will be further described in detail with reference to Preparation Examples 1 to 131 and Examples 1 to 2.
[0339] Preparation Example Preparation Examples 1 to 10 Preparation Examples 1 to 10 each provide a recombinant oncolytic virus. The recombinant oncolytic virus contains an M protein and an antigen.
[0340] The difference between each preparation example lies in the difference in the type of antigen, specifically shown in Table 1.
[0341] The construction method of the recombinant oncolytic virus provided in each of the above preparation examples is as follows.
[0342] (1) Construction of vectors Using the pRV-core plasmid (BioVector NTCC plasmid carrier bacterial cell gene preservation center) as a template, the M protein mutation sites shown in Table 1 are introduced by PCR technology.
[0343] Synthesize a gene fragment containing XbaI and MluI restriction enzyme cleavage sites and the protein mutation site, perform PCR amplification using it as a template, then perform 1% agarose gel electrophoresis on the PCR product, double enzyme cut with XbaI and MluI, and further perform rubber tapping recycling using a gel recovery kit to obtain a gene fragment with the protein mutation site.
[0344] The pRV-core plasmid is double enzyme cut with XbaI and MluI, and rubber tapping recycling is performed using a gel recovery kit to obtain a pRV-core enzyme cut and recovered backbone fragment.
[0345] Connect and transform the above gene fragment with the protein mutation site and the pRV-core enzyme cut and recovered backbone fragment, coat it on a plate, select monoclonal bacteria for PCR verification, extract the plasmid to obtain the constructed plasmid pRV-core Mut, and send it to a sequencing company for sequencing.
[0346] (2) Insertion of foreign gene Recover the long fragment from the plasmid pRV-core Mut obtained in step (1) by double enzyme digestion with Xho I and Mlu I.
[0347] The foreign gene encoding the antigen is synthesized by a gene synthesis company, amplified with corresponding primers, subjected to double enzyme digestion with XhoI and NheI, recover the target gene fragment, connect and transform the pRV-core Mut treated by the above double enzyme digestion with the foreign gene fragment, select monoclonal, perform PCR or enzyme digestion identification, and then send it to a sequencing company for sequencing. Specifically, as shown in Table 1, obtain the plasmid pRV-core Mut carrying the foreign gene.
[0348] Table 1 Mutation table of recombinant oncolytic virus in Preparation Examples 1 - 10
Table 1
[0349] (3) Virus rescue Using a calcium phosphate transfection kit (Thermo Fisher Scientific), the plasmid pRV-core Mut carrying the foreign gene was transfected into BSR-T7 cells (purchased from ATCC (American Type Culture Collection, also known as the American Type Culture Collection)) by cell transfection technology.
[0350] According to the mass ratio of 10:5:4:1 of pRV-core Mut, pP, pN, and pL, the four plasmids were mixed, the total amount of the plasmid was 5 μg, the plasmid was diluted with 200 μl of opti-MEM medium (Thermo Fisher Scientific), and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) was added to obtain a transfection plasmid premix solution. Here, pP (a plasmid carrying the baculovirus lint protein gene), pN (a plasmid carrying the baculovirus nucleoprotein gene), and pL (a plasmid carrying the baculovirus polymerase protein gene), and the parental carriers of the three plasmids pN, pP, and pL were all pCAGGS (purchased from ATCC). 10 μl of Lipofectamine LTX (Thermo Fisher Scientific) was diluted with 200 μl of opti-MEM medium to obtain an LTX mixture. Plasmid transfection was performed according to the method described in the Lipofectamine LTX instruction manual. After 6 hours, the BSR-T7 cells were washed twice with PBS and then inoculated into DMEM medium (Thermo Fisher Scientific) containing 10% fetal bovine serum and cultured for 3 days. The cell supernatant obtained by culturing BSR-T7 cells was transferred to Vero cells (Thermo Fisher Scientific), and the Vero cells were cultured for 3 days under environmental conditions of 37 °C. The green fluorescence inside the cells was observed with a fluorescence microscope to identify the situation of virus rescue. Furthermore, the rescued mutant baculovirus library was passaged through Vero cells, and monoclonal virus strains were picked from the constructed plaque screening system.
[0351] (4) Gene sequencing. The viral genomic RNA was extracted using a Trizol kit, a reverse transcription reaction was performed using random primers, and PCR was performed on the cDNA reverse transcribed using primers designed for the M protein gene sequence and primers designed for the gene sequence encoding the antigen.
[0352] The primer sequences designed for the M protein gene sequence are as follows. PF: ATGAGTTCCTTAAAGAA, PR: TCATTTGAAGTGG.
[0353] The primer sequences designed for the gene sequence encoding the antigen are as follows. CD19 F: ACGCTCGAGATGCCACCTCCTCGCCTCC, CD19 R: TCTGGCTAGCTCATCTTTTCCTCCTCAGG. BCMA F: ACGCTCGAGATGTTGCAGATGGCTGGGC, BCMA R: TCTGGCTAGCTTATAGCAAAAACATTAGC. NY-ESO-1 F: ACGCTCGAGATGCAGGCAGAAGGAAG, NY-ESO-1 R: TCTGGCTAGCTCATCTTCTCTGTCCGCTA. MUC-1 F: ACGCTCGAGATGTCTGGTCATGCAAGC, MUC-1-R: TCTGGCTAGCTTACAAGGCAATGAGATAG. MSLN F: ACGCTCGAGATGGAAGTGGAGAAGACAG、 MSLN R: TCTGGCTAGCTCAGGCCAGGGTGGAGGCT。 EGFR F: ACGCTCGAGATGCGACCCTCCGGGACGG、 EGFR R: TCTGGCTAGCTTACATGAAGAGGCCGAT。 VEGFR2 F: ACGCTCGAGATGCAGAGCAAGGTGCTG、 VEGFR2 R: TCTGGCTAGCTCAGATGATGACAAGAAGT。 MAGE A4 F: ACGCTCGAGACAGAGGAGCACCAAGGAG、 MAGE A4 R: TCTGGCTAGCATAGACTGAGGCATAAGGC。 cMet F: ACGCTCGAGATGGAGTGCAAGGAGGCC、 cMet R: TCTGGCTAGCTTACAGCCACAGGAAGAAG。 Claude 18.2 F: ACGCTCGAGATGGACCAGTGGAGCACCC、 Claude 18.2 R: TCTGGCTAGCTTAGGCGATGCACATCATC。
[0354] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1.
[0355] Preparation Examples 11 to 20 Preparation Examples 11 to 20 each provide a recombinant oncolytic virus. The recombinant oncolytic virus contains an M protein, a G protein, and an antigen.
[0356] Here, the mutation site of the M protein is the same as the corresponding mutation site in Preparation Example 1. The G protein contains the amino acid sequence shown in SEQ ID NO: 13 and is shown in Table 2. The difference between each preparation example lies in the difference in the type of antigen contained, specifically as shown in Table 2.
[0357] The construction method of the recombinant oncolytic virus provided in the above preparation example is the same as the construction method of Preparation Example 2. The difference lies in that it further contains the G protein at the mutation site shown in Table 2. Specifically, as the difference in the construction method, introduce the mutation site shown in Table 2 into the constructed plasmid in step (1) using the PCR technique, step (4) is the determination of the G protein gene sequence. Extract the viral genomic RNA using the Trizol kit, perform a reverse transcription reaction using a random primer, and perform PCR on the reverse transcribed cDNA using a primer designed for the G protein gene sequence.
[0358] The primer sequences designed for the G protein gene sequence are as follows. PF: ATGAAGTGCCTTTTGTACTTAG, PR: TTACTTTCCAAGTCGGTTCATCT.
[0359] Recover the product by 1% agarose gel electrophoresis, send it to a sequencing company for sequencing. The sequencing results are shown in Table 2.
[0360] Table 2 Mutation table of recombinant oncolytic virus in Preparation Examples 11-20
Table 2
[0361] Preparation Examples 21-30 Preparation Examples 21-30 each provide a recombinant oncolytic virus. The recombinant oncolytic virus contains the M protein, G protein, N protein and antigen.
[0362] Here, the mutation sites of the M protein and the G protein are the same as the corresponding mutation sites in Preparation Example 11. The N protein contains the amino acid sequence shown in SEQ ID NO: 15 and is shown in Table 3. The difference between each preparation example lies in the difference in the type of antigen contained, specifically as shown in Table 3.
[0363] The method for constructing the recombinant oncolytic virus provided in the above preparation example is the same as the construction method of Preparation Example 11. The difference lies in that it further contains the N protein at the mutation site shown in Table 3. Specifically, the difference in the construction method is as follows: Introducing the mutation site shown in Table 3 into the constructed plasmid in step (1) using the PCR technique; Step (4) is the N protein gene sequencing. Extract the viral genomic RNA using the Trizol kit, perform a reverse transcription reaction using a random primer, and perform PCR on the cDNA reverse transcribed using a primer designed for the N protein gene sequence.
[0364] The primer sequences designed for the N protein gene sequence are as follows: PF: ATGTCTGTTACAGTCAAGAG, PR: TCATTTGTCAAATTCTGACTT.
[0365] Recover the product by 1% agarose gel electrophoresis, send it to a sequencing company for sequencing. The sequencing results are shown in Table 3.
[0366] Table 3 Mutation Table of Recombinant Oncolytic Viruses in Preparation Examples 21 - 30
Table 3
[0367] Preparation Examples 31 - 40 Preparation Examples 31 - 40 each provide a recombinant oncolytic virus. The recombinant oncolytic virus contains an M protein, a G protein, an N protein, a P protein, and an antigen.
[0368] Here, the mutation sites of the M protein, G protein, and P protein are the same as the corresponding mutation sites in Preparation Example 21. The P protein contains the amino acid sequence shown in SEQ ID NO: 17 and is shown in Table 4. The difference between each preparation example lies in the difference in the type of antigen contained, specifically as shown in Table 4.
[0369] The method for constructing the recombinant oncolytic virus provided in the above preparation example is the same as the construction method of Preparation Example 21. The difference is that it further contains the P protein at the mutation site shown in Table 4. Specifically, the difference in the construction method is introducing the mutation site shown in Table 4 into the constructed plasmid in step (1) using the PCR technique, step (4) is the determination of the P protein gene sequence. Extract the viral genomic RNA using the Trizol kit, perform a reverse transcription reaction using a random primer, and perform PCR on the cDNA reverse-transcribed using a primer designed for the P protein gene sequence.
[0370] The primer sequences designed for the P protein gene sequence are as follows. PF: ATGGATAATCTCACAAAAGTTCG, PR: CTACAGAGAATATTTGACTCTCG.
[0371] Recover the product by 1% agarose gel electrophoresis, send it to a sequencing company for sequencing. The sequencing results are shown in Table 4.
[0372] Table 4 Mutation Table of Recombinant Oncolytic Viruses in Preparation Examples 21 to 30
Table 4
[0373] Preparation Examples 41 to 50 Preparation Examples 41 to 50 each provide a recombinant oncolytic virus. The recombinant oncolytic virus contains an M protein, a G protein, an N protein, a P protein, an L protein, and an antigen.
[0374] Here, the mutation sites of the M protein, G protein, P protein, and N protein are the same as the corresponding mutation sites in Preparation Example 31. The L protein contains the amino acid sequence shown in SEQ ID NO: 19 and is shown in Table 5. The difference between each preparation example lies in the difference in the type of antigen contained, specifically as shown in Table 5.
[0375] The method for constructing the recombinant oncolytic virus provided in the above preparation examples is the same as the construction method of Preparation Example 31. The difference is that it further contains the L protein at the mutation sites shown in Table 5. Specifically, the difference in the construction method is introducing the mutation sites shown in Table 5 into the constructed plasmid in step (1) using the PCR technique, step (4) is the determination of the L protein gene sequence. Extract the viral genomic RNA using the Trizol kit, perform a reverse transcription reaction using a random primer, and perform PCR on the cDNA reverse-transcribed using a primer designed for the L protein gene sequence.
[0376] The primer sequences designed for the L protein gene sequence are as follows. PF:ATGGAAGTCCACGATTTTGAGA, PR:TTAATCTCTCCAAGAGTTTTCCT.
[0377] Recover the product by 1% agarose gel electrophoresis and send it to a sequencing company for sequencing. The sequencing results are shown in Table 5.
[0378] Table 5 Mutation Table of Recombinant Oncolytic Viruses in Preparation Examples 41 to 50
Table 5
[0379] Preparation Examples 51 to 120 In Preparation Examples 51 to 120, recombinant oncolytic viruses are respectively provided. The recombinant oncolytic viruses contain an M protein, a G protein, an N protein, an L protein, a P protein, an antigen, and a cytokine.
[0380] The difference between the recombinant oncolytic viruses provided in the above Preparation Examples and Preparation Examples 41 to 50 is that the recombinant oncolytic viruses further contain a cytokine.
[0381] Specifically, it is as follows.
[0382] The cytokine contained in the recombinant oncolytic viruses respectively provided in Preparation Examples 51 to 60 is GM-CSF. The cytokine GM-CSF contains the amino acid sequence shown in SEQ ID NO: 20 and is specifically shown in Table 6.
[0383] The cytokine contained in the recombinant oncolytic viruses respectively provided in Preparation Examples 61 to 70 is IL-2. The cytokine IL-2 contains the amino acid sequence shown in SEQ ID NO: 21 and is specifically shown in Table 6.
[0384] The cytokine contained in the recombinant oncolytic viruses respectively provided in Preparation Examples 71 to 80 is IL-12. The cytokine IL-12 contains the amino acid sequences shown in SEQ ID NO: 22 and SEQ ID NO: 23 and is specifically shown in Table 6.
[0385] The cytokine contained in the recombinant oncolytic viruses respectively provided in Preparation Examples 81 to 90 is IL-15. The cytokine IL-15 contains the amino acid sequence shown in SEQ ID NO: 24 and is specifically shown in Table 6.
[0386] The cytokine contained in the recombinant oncolytic virus provided in Preparation Examples 91 to 100 is IL-18, and the cytokine IL-18 contains the amino acid sequence shown in SEQ ID NO: 25, specifically shown in Table 6.
[0387] The cytokine contained in the recombinant oncolytic virus provided in Preparation Examples 101 to 110 is TNF-α, and the cytokine TNF-α contains the amino acid sequence shown in SEQ ID NO: 26, specifically shown in Table 6.
[0388] The cytokine contained in the recombinant oncolytic virus provided in Preparation Examples 111 to 120 is IFN-β, and the cytokine IFN-β contains the amino acid sequence shown in SEQ ID NO: 27, specifically shown in Table 6.
[0389] The method for constructing the recombinant oncolytic virus provided in the above Preparation Examples is the same as the construction method of Preparation Example 1, and the difference is that it further contains a foreign gene encoding a cytokine. Specifically, the differences in the construction method are as follows: Similar to Preparation Examples 41 to 50, introducing the mutation sites shown in Table 6 using PCR technology in the plasmid constructed in step (1). Step (2) further includes the step of inserting a foreign gene encoding a cytokine. Step (4) further includes sequencing the cytokine. Extract the viral genomic RNA using the Trizol kit, perform a reverse transcription reaction using a random primer, and perform PCR on the reverse-transcribed cDNA using a primer designed for the cytokine gene sequence.
[0390] The primer sequences designed for the gene sequence encoding the cytokine are as follows. GMCSF F: CCCTCGAGATGTGGCTGCAGAGCCT, GMCSF R: CGGCTAGCTCACTCCTGGACTGGCTCC. IL-2 F: CCGATGTACAGGATGCAACTCC, IL-2 R: CGGCTAGCTCAAGTCAGTGTTG. IL12 F: CCCTCGAGATGTGGCCCCCTGGGT, IL12 R: CGGCTAGCTTAACTGCAGGGCACAGATG. IL-15 F: CCGCTCGAGATGAGAATTTCGAAACC, IL-15 R: CGGCTAGCTCAAGAAGTGTTGATGAAC. IL-18 F: CCCTCGAGATGGCTGCTGAACCAGTAG, IL-18 R: CGGCTAGCCTAGTCTTCGTTTTGAAC. TNFα F: CCGCTCGAGATGAGCACTGAAAGC, TNFα R: CGGCTAGCTCACAGGGCAATGATCC. IFNβ F: CCTCGAGATGACCAACAAGTGTC, IFNβ R: CGGCTAGCTCAGTTTCGGAGG.
[0391] Table 6 Mutation Table of Recombinant Oncolytic Viruses in Preparation Examples 51 to 120
Table 6
[0392] Preparation Examples 121 to 130 Preparation Examples 121 to 130 provide recombinant oncolytic viruses. The above recombinant oncolytic viruses are obtained by introducing a foreign gene encoding an antigen based on a wild-type oncolytic virus.
[0393] The construction methods of the recombinant oncolytic viruses provided in each of the above preparation examples are as follows.
[0394] (1) Insertion of foreign gene Using the pRV-core plasmid (BioVector NTCC plasmid vector bacterial cell gene preservation center) as a template, perform double enzyme digestion with XhoI and NheI. Then, insert a foreign gene encoding an antigen (the foreign gene encoding the antigen is synthesized by a gene synthesis company and then amplified with corresponding primers), perform double enzyme digestion treatment with XhoI and NheI, recover the target gene fragment, connect and transform the pRV-core treated by the above double enzyme digestion with the foreign gene fragment, select monoclonal, perform PCR or enzyme digestion identification, and then send it to a sequencing company for sequencing. Specifically, as shown in Table 7, obtain the plasmid pRV-core Mut carrying the foreign gene.
[0395] (2) Virus rescue Using the calcium phosphate transfection kit (Thermo Fisher Scientific), transfect the plasmid pRV-core Mut carrying the foreign gene into BSR-T7 cells (purchased from ATCC (American Type Culture Collection, also known as the American Bacterial Preservation Center)) by cell transfection technology.
[0396] Mix the four plasmids according to the mass ratio of pRV-core Mut, pP, pN, and pL of 10:5:4:1, with the total plasmid amount being 5 μg. Dilute the plasmids using 200 μl of opti-MEM medium (Thermo Fisher Scientific), add 7.5 μl of the transfection reagent Plus Reagent (Life Technologies) to obtain a transfection plasmid premix solution. Here, pP is a plasmid carrying the baculovirus late protein gene, pN is a plasmid carrying the baculovirus nucleoprotein gene, and pL is a plasmid carrying the baculovirus polymerase protein gene. The three plasmids of pN, pP, and pL all have the corresponding parental vector pCAGGS (purchased from ATCC). Dilute 10 μl of Lipofectamine LTX (Thermo Fisher Scientific) using 200 μl of opti-MEM medium to obtain an LTX mixture. Perform plasmid transfection according to the method described in the Lipofectamine LTX instruction manual. After 6 hours, wash the BSR-T7 cells twice with PBS, and then inoculate them into DMEM medium (Thermo Fisher Scientific) containing 10% fetal bovine serum and culture for 3 days. Transfer the cell supernatant obtained by culturing BSR-T7 cells to Vero cells (Thermo Fisher Scientific), place the Vero cells under environmental conditions of 37 °C and culture for 3 days. Observe the green fluorescence in the cells with a fluorescence microscope to identify the virus rescue situation. Further passage the rescued mutant baculovirus library through Vero cells and pick monoclonal virus strains from the constructed plaque screening system.
[0397] (3) Gene sequencing. Extract viral genomic RNA using the Trizol kit, perform reverse transcription reaction using random primers, and perform PCR on the cDNA reverse-transcribed using primers designed for the gene sequence encoding the cytokine (the same as the primer sequences shown in Example 1).
[0398] Recover the product by 1% agarose gel electrophoresis, send it to a sequencing company for sequencing. The sequencing results are shown in Table 7.
[0399] Table 7 Mutation table of recombinant oncolytic virus in Preparation Examples 121 to 130
Table 7
[0400] Preparation Example 131 This preparation example provides a packaging process for the recombinant oncolytic virus prepared by the preparation example of any one of the above Preparation Examples 1 to 120. Specifically, it includes the following steps.
[0401] 1) Use the poxvirus vTF7-3 (BioVector NTCC plasmid carrier bacterial strain cell gene preservation center) that expresses T7 RNA polymerase to infect and inoculate BSR-T7 cells (purchased from ATCC).
[0402] Specific process: Seed BSR-T7 cells in a 6-well plate, control the number of cells per well to reach 3×10 5 Add the poxvirus vTF7-3 that expresses T7 RNA polymerase 14 to 16 hours after seeding, infect BSR-T7 cells with the poxvirus vTF7-3, after 6 hours of infection, rinse the BSR-T7 cells once with DPBS buffer (Thermo Fisher Scientific), and perform transfection.
[0403] 2) Transfection process Specifically, it includes the following steps. According to the mass ratio of 10:5:4:1 of pRV-core Mut, pP, pN, and pL, four plasmids are mixed, the total amount of the plasmids is 5 μg, and the plasmids are diluted using 200 μl of opti-MEM medium (Thermo Fisher Scientific), and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) is added to obtain a transfection plasmid premix solution. Here, pP (a plasmid carrying the baculovirus lint protein gene), pN (a plasmid carrying the baculovirus nucleoprotein gene), pL (a plasmid carrying the baculovirus polymerase protein gene), and the three plasmids of pN, pP, and pL all have the corresponding parental vector pCAGGS (purchased from ATCC). Dilute 10 μl of Lipofectamine LTX (Thermo Fisher Scientific) using 200 μl of opti-MEM medium to obtain an LTX mixture. Mix 200 μl of the LTX mixture and 200 μl of the transfection plasmid premix solution, and incubate at room temperature for 15 minutes to obtain an LTX-DNA mixture. Replace the DPBS buffer in the 6-well plate in step 1) with opti-MEM medium, add the LTX-DNA mixture into the 6-well plate for culturing BSR-T7 cells, gently shake the 6-well plate to evenly distribute the LTX-DNA mixture in the 6-well plate, perform transfection for 6 - 8 hours, then aspirate the transfection reagent, add 3 ml of fresh complete medium (Thermo Fisher Scientific), and after 72 hours, obtain the cell supernatant of BSR-T7 cells, filter it using a 0.22 μm filter to obtain the corresponding recombinant oncolytic virus for each of Preparation Examples 1 - 130.
[0404] Example Example 1 In this example, in vitro killing test detection is performed on different cells using the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 130, respectively.
[0405] The detection method is the MTT detection method, that is, 200 pfu of the recombinant oncolytic viruses prepared in Preparation Examples 1 to 130 and the wild-type oncolytic virus are added to the culture solutions of different cells respectively. After 24 hours, the cell viability is detected by the MTT detection method.
[0406] The detected cells include LLC cells and MEF cells.
[0407] As a specific detection method, (1) Add 100 μl of Vero (LLC / MEF) cell suspension to a 96-well culture plate so that the cell amount reaches 1×10 4 cells / well. Culture the 96-well culture plate under environmental conditions of 37°C and 5% CO2 for 16 hours. (2) Dilute the recombinant oncolytic viruses prepared in the preparation examples until the multiplicity of infection (MOI) reaches 0.001, 0.01, 0.1, and 1.0 respectively. Inoculate the recombinant oncolytic viruses of each dilution gradient into the 96-well culture plate in step (1), inoculate 4 wells for each dilution gradient, inoculate 100 μl per well, and culture the 96-well culture plate under environmental conditions of 37°C and 5% CO2 for 40 hours. (3) Take out the cell supernatant in the 96-well culture plate in step (2), add fresh medium and MTT solution to the 96-well culture plate, with the addition amount being 20 μL / well, and culture the 96-well culture plate under environmental conditions of 37°C and 5% CO2 for 4 hours. (4) Centrifuge the 96-well culture plate at room temperature for 5 minutes, set the rotation speed to 2500 rpm / min, gently aspirate the supernatant using a 1 mL disposable sterile syringe, then add DMSO to each well of the 96-well culture plate, with the addition amount being 100 μl / well, and place it under environmental conditions of 37°C for 10 minutes. Use a multifunctional microplate reader to shake for 2 minutes and measure the OD value of each well on the 96-well culture plate at a wavelength of 570 nm or 490 nm.
[0408] The detection results are shown in FIGS. 1 to 4. Here, the horizontal axis 0 represents the wild-type oncolytic virus, the horizontal axes 1 to 130 represent the recombinant oncolytic viruses prepared in Preparation Examples 1 to 130, respectively, and the vertical axis OD 570 represents the OD value of the cells, and the smaller the value of OD 570 , the lower the killing ability of the recombinant oncolytic virus on the cells, and the larger the value of OD 570 , the better the killing ability of the recombinant oncolytic virus on the cells.
[0409] FIG. 1 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses prepared in Preparation Examples 1 to 50, 121 to 130 of the present application and the wild-type oncolytic virus on LLC cells.
[0410] FIG. 2 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses prepared in Preparation Examples 1 to 50, 121 to 130 of the present application and the wild-type oncolytic virus on MEF cells.
[0411] FIG. 3 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses prepared in Preparation Examples 51 to 120 of the present application and the wild-type oncolytic virus on LLC cells.
[0412] FIG. 4 shows the detection results of the in vitro killing ability of the recombinant oncolytic viruses prepared in Preparation Examples 51 to 120 of the present application and the wild-type oncolytic virus on MEF cells.
[0413] As can be seen from the above drawings, the recombinant oncolytic viruses prepared in Preparation Examples 1 to 120 of the present application have good in vitro killing ability against LLC cells, and all of them are better than the in vitro killing ability of the recombinant oncolytic viruses prepared by binding to antigens using wild oncolytic viruses in Preparation Examples 121 to 130 against LLC cells. In particular, the in vitro killing ability of the recombinant oncolytic viruses provided in Preparation Examples 111 to 120 against LLC cells exceeds the in vitro killing ability of the wild-type oncolytic virus.
[0414] As can be seen from the above detection results, the recombinant oncolytic virus provided in the present application has good in vitro killing ability against LLC cells. As can be judged, the recombinant oncolytic virus provided in the present application has good in vitro killing ability against cancer cells (such as 4T1 cells, MC38 cells and Hela cells, etc.). At the same time, the above-prepared recombinant oncolytic virus has almost no killing effect on normal MEF cells, indicating that the recombinant oncolytic virus prepared in the present application can be well used for the damage and lethality of abnormal cells such as tumors and cancers, and at the same time, it does not damage normal cells.
[0415] The wild-type oncolytic virus has good in vitro killing ability against LLC cells, but while damaging and killing the above cells, it also significantly damages and kills MEF cells, limiting the clinical application of the wild-type oncolytic virus. Therefore, the modification of the wild-type oncolytic virus according to the present application ensures the safety of normal cells by the oncolytic virus, while also ensuring the killing ability of the oncolytic virus against tumors and cancer cells, and has broad potential for clinical application.
[0416] Example 2 In this example, test detections are carried out on the situation of inducing the expression of IFN-β in different cells of the recombinant oncolytic viruses and wild-type oncolytic viruses prepared in Preparation Examples 1 to 130.
[0417] The detection indicator is the intracellular expression status of the gene IFN-β. The gene IFN-β is a soluble glycoprotein gene produced by cells, which has a wide range of antiviral, antitumor, and immunomodulatory effects. From the expression status of the gene IFN-β, the ability of cells to remove recombinant oncolytic viruses can be judged. When the expression of the gene IFN-β is high, it indicates that the recombinant oncolytic virus is easily removed intracellularly. When the expression of the gene IFN-β is low, it indicates that the recombinant oncolytic virus is difficult to be removed intracellularly.
[0418] The detected cells include LLC cells and MEF cells.
[0419] As a specific detection method, (1) Add 100 μl of Vero (LLC / MEF) cell suspension to a 96-well culture plate so that the cell amount reaches 1×10 4 cells / well, and culture the 96-well culture plate under environmental conditions of 37°C and 5% CO2 for 16 hours. (2) Dilute the recombinant oncolytic virus prepared in the preparation example until the multiplicity of infection (MOI) is 0.001, 0.01, 0.1, and 1.0 respectively. Inoculate each dilution gradient of the recombinant oncolytic virus into the 96-well culture plate in step (1), inoculate 4 wells for each dilution gradient, inoculate 100 μl per well, and culture the 96-well culture plate under cyclic conditions of 37°C and 5% CO2 for 40 hours. (3) Crush each set of cells cultured and obtained in step (2), extract total RNA from each cell using TRIzol (Invitrogen), reverse transcribe it into cDNA using the PrimeScript RT Reagent Kit with DNA Eraser (Takara) reverse transcription kit, stain it using the LightCycler 480 SYBR Green I Master (Roche) dye, and detect the Ct value of each gene using a LightCycler 480 quantitative PCR instrument. Calculate the relative expression level of the target gene IFN-β by the ΔΔCt method.
[0420] The detection results are shown in FIGS. 5 to 8. Here, the horizontal axis 0 represents the wild-type oncolytic virus, the horizontal axes 1 to 130 represent the recombinant oncolytic viruses prepared in Preparation Examples 1 to 130, respectively, the vertical axis IFN-β level represents the expression status of the IFN-β gene, and the larger the value of the IFN-level, the weaker the reproductive ability of the recombinant oncolytic virus in the cell and the easier it is to be removed. On the contrary, the smaller the value of the IFN-β level, the stronger the reproductive ability of the recombinant oncolytic virus in the cell and the more difficult it is to be removed.
[0421] FIG. 5 shows the situation where the recombinant oncolytic viruses prepared in Preparation Examples 1 to 50 and 121 to 130 of the present application and the wild-type oncolytic virus induce the expression of IFN-β in LLC cells.
[0422] FIG. 6 shows the situation where the recombinant oncolytic viruses prepared in Preparation Examples 1 to 50 and 121 to 130 of the present application and the wild-type oncolytic virus induce the expression of IFN-β in MEF cells.
[0423] FIG. 7 shows the situation where the recombinant oncolytic viruses prepared in Preparation Examples 51 to 120 of the present application and the wild-type oncolytic virus induce the expression of IFN-β in LLC cells.
[0424] FIG. 8 shows the situation where the recombinant oncolytic viruses prepared in Preparation Examples 51 to 120 of the present application and the wild-type oncolytic virus induce the expression of IFN-β in MEF cells.
[0425] As can be seen from the above drawings, the recombinant oncolytic viruses and wild-type oncolytic viruses provided in Preparation Examples 1 to 120 of the present application have strong reproductive ability in LLC cells, are not easily removed, and both are superior to the reproductive ability of the recombinant oncolytic viruses prepared by binding to antigens using wild oncolytic viruses in Preparation Examples 121 to 130 in LLC cells. In particular, the recombinant oncolytic viruses provided in Preparation Examples 111 to 120 are more difficult to be removed in LLC cells, and further ensure that the oncolytic viruses can better exert their ability of infection and killing in LLC cells.
[0426] As can be seen from the above detection results, the recombinant oncolytic viruses provided in the present application have strong reproductive ability in LLC cells and are not easily removed. As can be judged, the recombinant oncolytic viruses provided in the present application have strong reproductive ability in cancer cells (such as 4T1 cells, MC38 cells and Hela cells, etc.) and are not easily removed. At the same time, the recombinant oncolytic viruses provided in the present application are more easily removed in MEF cells, further ensuring the safety of MEF cells, thus improving the safety of oncolytic viruses.
[0427] This specific embodiment is only for the description of the present application and does not limit the present application. After reading this specification, those skilled in the art can make corrections without creative contributions to this embodiment as needed, but as long as it is within the scope of the claims of the present application, it is all protected by the patent law.
Claims
**Claim 1** A recombinant oncolytic virus, wherein the recombinant oncolytic virus comprises an M protein and an antigen encoded by a foreign gene, and the M protein comprises a mutation from methionine to arginine at position 51 (M51R), a mutation from valine to phenylalanine at position 221 (V221F), and a mutation from serine to arginine at position 226 (S226R) compared to the amino acid sequence shown in SEQ ID NO: 1 A recombinant oncolytic virus characterized by the above. **Claim 2** The antigen is selected from hematological tumors and solid tumors The recombinant oncolytic virus according to claim 1, characterized by the above. **Claim 3** The antigens of the solid tumor are 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, CD28, CD137, CTLA-4, HER-2, FAS, FAP, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNF receptor-related protein, LTβR, TRAIL receptor 1, TRAIL receptor 2, prostate-specific membrane antigen protein, prostate stem cell antigen protein, tumor-related protein carbonic anhydrase IX, EGFR1, EGFRvIII, ErbB3, folate receptor, ephrin receptor, PDGFRa, ErbB-2, CD2, CD40, CD74, CD80, CD86, CCAM5, CCAM6, p53, cMet, HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin, Cripto, MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, neuropilin 1, phosphatidylinositol proteoglycan, EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1,The antigens of the hematoma tumor include, but are not limited to, AXL, and are BCMA, CD4, CD5, CD7, CD10, FcγRIIIa, FcγRIIIb, CD19, CD20, CD22, CD23, CD30, CD33, CD34, CD37, CD38, CD44, CD47, CD56, CD70, CD117, CD123, CD138, CD174, CLL-1, ROR1, NKG2DL1 / 2, IL1R3, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3, SLAMF7, TCR B-chain, ITGB7, k-1gG, TACI, TRBCI, LeY, MUC1, etc., but are not limited to these. The recombinant oncolytic virus according to claim 2, characterized by the above. **Claim 4** The antigen is selected from any one or more of CD19, BCMA, NY-ESO-1, HER-2, MUC-1, MSLN, EGFR, VEGFR2, MAGE A4, cMet, Claudin 18.2 The recombinant oncolytic virus according to claim 3, characterized by the above. **Claim 5** The recombinant oncolytic virus further comprises a cytokine encoded by a foreign gene The recombinant oncolytic virus according to any one of claims 1 to 4, characterized by the above. **Claim 6** The cytokine is selected from interleukin, interferon, tumor necrosis factor, colony stimulating factor, transforming growth factor β, chemokine family The recombinant oncolytic virus according to any one of claims 1 to 5, characterized by the above. **Claim 7** The cytokine is selected from any one or more of GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β and TNF-α The recombinant oncolytic virus according to claim 6, characterized by the above. **Claim 8** The cytokine is selected from any one or more of GM-CSF, IL-2, IL-12, IL-15, IL-18, IFN-β, TNF-α The recombinant oncolytic virus according to claim 7, characterized by the above. **Claim 9** The M protein further includes one or more site mutations such as a mutation from asparagine to serine at the 32nd site (N32S), and / or a mutation from asparagine to aspartic acid at the 49th site (N49D), and / or a mutation from histidine to tyrosine at the 54th site (H54Y), and / or a mutation from valine to isoleucine at the 225th site (V225I), etc. The recombinant oncolytic virus according to any one of claims 1 to 8, characterized in that.
10. The M protein further includes one or more site mutations such as knockout of the leucine-coding base at the 111th site, or a mutation from leucine to alanine at the 111th site (L111A). The recombinant oncolytic virus according to claim 9, characterized in that.
11. The M protein further includes one or more site mutations such as a mutation from glycine to alanine at the 21st site (G21E), and / or a mutation from methionine to alanine at the 33rd site (M33A), and / or a mutation from alanine to threonine at the 133rd site (A133T). The recombinant oncolytic virus according to claim 9 or 10, characterized in that.
12. The site mutation of the M protein is selected from any one of the following groups: 1) The site mutation of the M protein includes M51R, V221F, S226R. 2) The site mutation of the M protein includes N32S, N49D, M51R, H54Y, V221F, V225I, S226R. 3) The site mutation of the M protein includes N32S, N49D, M51R, H54Y, knockout of the leucine-coding base at the 111th site, V221F, V225I, S226R. 4) The site mutation of the M protein includes N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R. 5) The site mutation of the M protein includes G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R. 6) The site mutation of the M protein includes G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R. 7) The site mutations of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R, 8) The site mutations of the M protein include N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R, 9) The site mutations of the M protein include N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R, 10) The site mutations of the M protein include N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R The recombinant oncolytic virus according to any one of claims 1 to 11, characterized in that.
13. The M protein includes the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or SEQ ID NO: 11 The recombinant oncolytic virus according to claim 12, characterized in that.
14. A recombinant oncolytic virus, The recombinant oncolytic virus contains the M protein according to any one of claims 1 to 13, and the recombinant oncolytic virus further contains a G protein, and the G protein has a mutation from valine to isoleucine (V53I) at the 53rd site, and / or a mutation from alanine to valine (A141V) at the 141st site, and / or a mutation from aspartic acid to tyrosine (D172Y) at the 172nd site, and / or a mutation from lysine to glutamic acid (K217E) at the 217th site, and / or a mutation from aspartic acid to glycine (D232G) at the 232nd site, and / or a mutation from valine to alanine (V331A) at the 331st site, and / or a mutation from valine to glutamic acid (V371E) at the 371st site, and / or a mutation from glycine to aspartic acid (G436D) at the 436th site, and / or a mutation from threonine to serine (T438S) at the 438th site, and / or a mutation from phenylalanine to leucine (F453L) at the 453rd site, and / or a mutation from threonine to isoleucine (T471I) at the 471st site, and / or a mutation from tyrosine to histidine (Y487H) at the 487th site, etc., including one or more site mutations. A recombinant oncolytic virus, characterized in that.
15. The G protein contains the amino acid sequence shown in SEQ ID NO: 13 The recombinant oncolytic virus according to claim 14, characterized in that.
16. A recombinant oncolytic virus, comprising the M protein according to any one of claims 1 to 13, or a recombinant oncolytic virus containing the M protein and the G protein according to any one of claims 14 to 15, and the recombinant oncolytic virus further contains an N protein, and the N protein has a mutation from isoleucine to valine (I14V) at the 14th site, and / or a mutation from arginine to lysine (R155K) at the 155th site, and / or a mutation from serine to asparagine (S353N) at the 353rd site, etc., including one or more site mutations. A recombinant oncolytic virus, characterized in that.
17. The N protein contains the amino acid sequence shown in SEQ ID NO: 15 The recombinant oncolytic virus according to claim 16, characterized in that
18. A recombinant oncolytic virus, which is the M protein according to any one of claims 1 to 13, or the M protein and G protein according to any one of claims 14 to 15, or the M protein, G protein and N protein according to any one of claims 16 to 17, and the recombinant oncolytic virus further contains a P protein, and the P protein has a mutation from arginine to lysine at the 50th site (R50K), and / or a mutation from valine to alanine at the 76th site (V76A), and / or a mutation from asparagine to glutamic acid at the 99th site (D99E), and / or a mutation from leucine to serine at the 126th site (L126S), and / or a mutation from leucine to serine at the 140th site (L140S), and / or a mutation from histidine to tyrosine at the 151st site (H151Y), and / or a mutation from isoleucine to methionine at the 168th site (I168M), and / or a mutation from lysine to glutamic acid at the 170th site (K170E), and / or a mutation from tyrosine to serine at the 189th site (Y189S), and / or a mutation from asparagine to aspartic acid at the 237th site (N237D), etc., including one or more site mutations The recombinant oncolytic virus is characterized in that
19. The P protein contains the amino acid sequence shown in SEQ ID NO: 17 The recombinant oncolytic virus according to claim 18, characterized in that
20. A recombinant oncolytic virus, The recombinant oncolytic virus contains the M protein according to any one of claims 1 to 13, or the M protein and G protein according to any one of claims 14 to 15, or the M protein, G protein and N protein according to any one of claims 16 to 17, or the M protein, G protein, N protein and P protein according to any one of claims 18 to 19. The recombinant oncolytic virus further contains an L protein, and the L protein contains one or more site mutations such as a mutation from serine to proline at the 87th site (S87P) and / or a mutation from isoleucine to threonine at the 487th site (I487T) as compared with the amino acid sequence shown in SEQ ID NO:
18. A recombinant oncolytic virus characterized by the above.
21. The L protein contains the amino acid sequence shown in SEQ ID NO:
19. The recombinant oncolytic virus according to claim 20, characterized by the above.
22. The recombinant oncolytic virus further contains a baculovirus. The recombinant oncolytic virus according to any one of claims 1 to 21, characterized by the above.
23. The recombinant oncolytic virus further contains a Vesicular Stomatitis Virus (abbreviated as VSV). The recombinant oncolytic virus according to any one of claims 1 to 21, characterized by the above.
24. The recombinant oncolytic virus further contains the VSV virus Indiana MuddSummer subtype. The recombinant oncolytic virus according to any one of claims 1 to 21, characterized by the above.
25. The recombinant oncolytic virus further contains or expresses an exogenous target protein. The recombinant oncolytic virus according to any one of claims 1 to 24, characterized by the above.
26. The recombinant oncolytic virus contains a nucleic acid molecule, and the nucleic acid molecule contains a nucleic acid sequence encoding the M protein with a site mutation, and / or a nucleic acid sequence encoding the G protein with a site mutation, and / or a nucleic acid sequence encoding the N protein with a site mutation, and / or a nucleic acid sequence encoding the P protein with a site mutation, and / or a nucleic acid sequence encoding the L protein with a site mutation, and a nucleic acid sequence encoding the cytokine. The recombinant oncolytic virus according to any one of claims 1 to 25, characterized in that.
27. In the nucleic acid molecule, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein with a site mutation and the nucleic acid sequence encoding the L protein with the site mutation. The recombinant oncolytic virus according to claim 26, characterized in that.
28. In the nucleic acid molecule, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the M protein with a site mutation, the nucleic acid sequence encoding the N protein with a site mutation, or the nucleic acid sequence encoding the P protein with a site mutation, and the nucleic acid sequence encoding the L protein with the site mutation. The recombinant oncolytic virus according to claim 27, characterized in that.
29. In the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein with a site mutation and the nucleic acid sequence encoding the L protein with the site mutation. The recombinant oncolytic virus according to claim 26, characterized in that.
30. In the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the M protein with a site mutation, the nucleic acid sequence encoding the N protein with a site mutation, or the nucleic acid sequence encoding the P protein with a site mutation, and the nucleic acid sequence encoding the L protein with the site mutation. The recombinant oncolytic virus according to claim 29, characterized in that.
31. In the nucleic acid molecule, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the antigen and the nucleic acid sequence encoding the L protein of the site mutation, or between the nucleic acid sequence encoding the G protein of the site mutation and the nucleic acid sequence encoding the antigen. The recombinant oncolytic virus according to claim 26, characterized in that.
32. The expression vector of the recombinant oncolytic virus can express the recombinant oncolytic virus according to any one of claims 1 to 31. A recombinant oncolytic virus expression vector, characterized in that.
33. A virus-producing cell, The virus-producing cell can produce the recombinant oncolytic virus according to any one of claims 1 to 31. A virus-producing cell, characterized in that.
34. A vaccine prepared using the recombinant oncolytic virus according to any one of claims 1 to 31.
35. A pharmaceutical composition, The pharmaceutical composition contains the recombinant oncolytic virus according to any one of claims 1 to 31, or the vaccine according to claim 34, and optionally a pharmaceutically acceptable carrier. A pharmaceutical composition, characterized in that.
36. A method for preparing the recombinant oncolytic virus according to any one of claims 1 to 31, the recombinant oncolytic virus expression vector according to claim 32, the virus-producing cell according to claim 33, the vaccine according to claim 34, and the pharmaceutical composition according to claim 35.
37. The recombinant oncolytic virus according to any one of claims 1 to 31, the recombinant oncolytic virus expression vector according to claim 32, the virus-producing cell according to claim 33, the vaccine according to claim 34, and the pharmaceutical composition according to claim 35 in the preparation of a medicament for preventing and / or treating a disease and / or illness.
38. The recombinant oncolytic virus, the recombinant oncolytic virus expression vector, the virus-producing cell, the vaccine and / or the pharmaceutical composition are used in a method for continuously killing abnormal proliferating cells. Use according to claim 37, characterized in that.
39. The abnormal proliferating cells are selected from tumor cells or tumor tissue-related cells. Use according to claim 38, characterized in that.
40. Use of the recombinant oncolytic virus according to any one of claims 1 to 31, the vaccine according to claim 34, and the pharmaceutical composition according to claim 35 in the preparation of a medicament for treating tumors.
41. The tumor includes a solid tumor or a hematological tumor The use according to claim 40, characterized in that.
42. The tumors are acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, epithelioma, esophageal cancer, diffuse large B-cell lymphoma, neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastroenteric carcinoid tumor, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell histiocytosis, pharyngeal cancer, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumor, but are not limited thereto The use according to claim 40, characterized in that.
Citation Information
Patent Citations
Apparatus with a row hit rate / refresh management mechanism and operation method thereof
CN111145806A
Oncolytic virus carrier system of engomphosis exogenous super cell factor and application of oncolytic virus carrier system in medicines
CN111154806A
Oncolytic virus vaccine and medicine for treating tumors by combining oncolytic virus vaccine with immune cells
CN111286493A
Oncolytic virus vaccine and adoptive immune cell combination therapy
CN111320677A
Tumor treatment drug
CN111467489A