Cancer treatment with chimeric antigen receptors that bind to TRAILshort polypeptides

Chimeric antigen receptors (CARs) targeting TRAILshort polypeptides improve cancer treatment by enhancing T cell cytotoxicity, addressing the limitations of TRAIL toxicity and blocking cell death, effectively reducing cancer cell numbers and improving survival in TRAILshort+ cancers.

JP2025524472APending Publication Date: 2025-07-30MAYO FOUNDATION FOR MEDICAL EDUCATION & RESEARCH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024575773
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-24
Filing Date
2023-06-23
Publication Date
2025-07-30

AI Technical Summary

Technical Problem

Existing cancer treatments using TRAIL, a member of the tumor necrosis factor superfamily, can be toxic to healthy cells, while its splice variant TRAILshort blocks cell death, limiting therapeutic efficacy.

Method used

Development of chimeric antigen receptors (CARs) that specifically bind to TRAILshort polypeptides, enhancing anti-tumor effects by increasing cytotoxicity in T cells, optionally combined with CD19-binding CARs, and administering engineered T cells, stem cells, or NK cells expressing these CARs to treat TRAILshort+ cancers.

Benefits of technology

The CARs targeting TRAILshort polypeptides enhance the cytotoxicity of T cells and other immune cells, effectively reducing cancer cell numbers and increasing survival in mammals with TRAILshort+ cancers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025524472000001_ABST
    Figure 2025524472000001_ABST
Patent Text Reader

Abstract

This book provides methods and materials for conjugating a chimeric antigen receptor (CAR) to a TRAILshort polypeptide. For example, provided are CARs that bind to a TRAILshort polypeptide, and methods and materials for using cells that express such CARs to treat mammals (e.g., humans) having cancer. Further provided is a chimeric antigen receptor comprising an antigen-binding domain, a hinge, a transmembrane domain, and one or more signaling domains.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority from U.S. Provisional Application Serial No. 63 / 355,394, filed on June 24, 2022. The disclosure of the prior application is considered a part of the disclosure of this application (incorporated herein by reference).

[0002] Sequence Listing This application includes a sequence listing that was electronically submitted as an XML file entitled "07039 - 2108WO1_SL_ST26.XML". This XML file was created on June 21, 2023 and is 148,041 bytes in size. The material in the XML file is incorporated herein by reference in its entirety.

[0003] 1. Technical Field This specification relates to methods and materials involved in the binding of chimeric antigen receptors (CARs) to TRAILshort polypeptides, which are splice variants of TNF - related apoptosis - inducing ligand (TRAIL) polypeptides. For example, this specification provides CARs that bind to TRAILshort polypeptides, as well as methods and materials for using such CARs to treat cancer and infectious diseases (e.g., chronic infections). This specification also provides cells (e.g., host cells) designed to express one or more CARs having the ability to bind to TRAILshort polypeptides, as well as methods and materials for using such cells to treat cancer and infectious diseases.

Background Art

[0004] 2. Background Information TRAIL is a member of the tumor necrosis factor (TNF) superfamily of death-inducing ligands, whose members include Fas ligand and TNF. When TRAIL binds to its cognate receptor, it can cause cell death by apoptosis or can cause activation of NF-κB (Hu et al., J. Biol. Chem., Vol. 274: 30603-10 (1999)). TRAIL is widely expressed in multiple cell lineages, shows strong toxicity to many tumors and virus-infected cells, but shows little toxicity to most healthy cells (Held et al., Drug Resist. Updat., Vol. 4: 243-52 (2001); and Baetu and Hiscott, Cytokine Growth Factor, Vol. 13: 199-207 (2002)). TRAIL mediates cell death through binding to one of five TRAIL receptors (e.g., TRAIL-R1, -R2, -R3, -R4 and osteoprotegerin (OPG)). TRAILshort is a splice variant of TRAIL and can block cell death by TRAIL. Summary of the Invention

[0005] This specification provides methods and materials related to the binding of CARs to TRAILshort polypeptides. TRAILshort is a splice variant of TRAIL and can bind to TRAIL-R1 (“R1”) and / or TRAIL-R2 (“R2”). When bound to R1 and / or R2, TRAILshort, as described elsewhere, prevents full-length TRAIL from inducing cell death (Schnepple et al., J Biol Chem 286:35742-35754, 2011). As described herein, T cells expressing a CAR that can specifically bind to a TRAILshort polypeptide (TsCAR T cells) exhibit a potent anti-tumor effect. T cell activation (e.g., pretreatment with PMA) can be used to increase TRAILshort expression and can increase the cytotoxicity of TsCAR T cells. Optionally, anti-tumor activity can be increased using T cells expressing two CARs (e.g., a CAR that can specifically bind to a TRAILshort polypeptide and a CAR that can specifically bind to CD19).

[0006] In some embodiments, this specification provides a CAR that binds to a TRAILshort polypeptide, and methods and materials for using one or more such CARs to treat a mammal (e.g., a human) having a cancer, such as a TRAILshort+ cancer.

[0007] This specification also provides cells (e.g., host cells) designed to express one or more CARs having the ability to bind to a TRAILshort polypeptide, and methods and materials for using such cells to treat a cancer, such as a TRAILshort+ cancer.

[0008] As described herein, one or more CARs can be designed to have the ability to bind to the TRAILshort polypeptide. For example, the CARs provided herein can have the ability to bind to a polypeptide comprising, consisting essentially of, or consisting of the amino acid sequence of the human TRAILshort polypeptide set forth in SEQ ID NO: 34 or 35 (see, e.g., FIG. 1).

[0009] In some cases, two sets of three CDRs of the antigen-binding fragments provided herein (e.g., SEQ ID NOs: 1-3 and SEQ ID NO: 9, amino acid sequence GAS, and SEQ ID NO: 10) are introduced into the CAR by manipulation to make a CAR that has the ability to target TRAILshort + cells (e.g., TRAILshort + tumor cells). + cells (e.g., CAR + T cells, CAR + stem cells, e.g., CAR + induced pluripotent stem cells or CAR + natural killer (NK) cells) can be generated.

[0010] As also described herein, a cell (e.g., a host cell) can be designed to express one or more CARs that have the ability to bind to the TRAILshort polypeptide. For example, cells such as T cells (e.g., CTLs), stem cells (e.g., induced pluripotent stem cells), or NK cells can be engineered to express one or more CARs that have the ability to bind to the TRAILshort polypeptide. Such cells (e.g., TRAILshort-specific CAR + T cells or NK cells) can be used to treat cancer in a mammal (e.g., TRAILshort +It can be used to treat cancer or an infectious disease (e.g., a chronic infectious disease). For example, a composition comprising one or more cells expressing a CAR described herein can be administered to a mammal (e.g., a human) having an infectious disease to reduce the number of infected cells in the mammal. For example, a composition comprising one or more cells expressing a CAR described herein can be administered to a mammal (e.g., a human) having TRAILshort+ cancer to reduce the number of cancer cells in the mammal and / or increase the survival period of the mammal from cancer.

[0011] In one aspect, the present specification features a chimeric antigen receptor comprising an antigen-binding domain, a hinge, a transmembrane domain, and one or more signaling domains, wherein the antigen-binding domain comprises a heavy-chain variable domain or region comprising the amino acid sequence set forth in SEQ ID NO: 1 (or SEQ ID NO: 1 having an addition, deletion, or substitution of 1, 2, or 3 amino acids), SEQ ID NO: 2 (or SEQ ID NO: 2 having an addition, deletion, or substitution of 1, 2, or 3 amino acids), and SEQ ID NO: 3 (or SEQ ID NO: 3 having an addition, deletion, or substitution of 1 amino acid), and a light-chain variable domain or region comprising the amino acid sequence set forth in SEQ ID NO: 9 (or SEQ ID NO: 9 having an addition, deletion, or substitution of 1, 2, or 3 amino acids), the amino acid sequence GAS (or GAS having an addition, deletion, or substitution of 1 amino acid), and the amino acid sequence set forth in SEQ ID NO: 10 (or SEQ ID NO: 10 having an addition, deletion, or substitution of 1, 2, or 3 amino acids). The antigen-binding domain may have the ability to bind to a human TRAILshort polypeptide (e.g., the amino acid sequence set forth in SEQ ID NO: 35). The antigen-binding domain may comprise an scFv, e.g., an scFv having the ability to bind to a TRAILshort polypeptide.

[0012] In some embodiments, the heavy-chain variable domain or region may comprise an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 8.

[0013] In some embodiments, the light chain variable domain or region may comprise an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO: 15.

[0014] In some embodiments, the hinge comprises the hinge described in FIG. 7A. For example, the hinge can be a CD8 hinge or a CD28 hinge.

[0015] In some embodiments, the transmembrane domain comprises the transmembrane domain described in FIG. 7C. For example, the transmembrane domain can be a CD8 transmembrane domain or a CD28 transmembrane domain.

[0016] In some embodiments, one or more signaling domains are selected from the group of signaling domains described in FIG. 7D. For example, one or more signaling domains can include one or more of the 4-1BB intracellular signaling domain, the CD28 intracellular signaling domain, or the CD3ζ intracellular signaling domain.

[0017] In some embodiments, the hinge comprises a CD8 hinge, the transmembrane domain comprises a CD8 transmembrane domain, and one or more signaling domains include the 4-1BB intracellular signaling domain and the CD3ζ intracellular signaling domain.

[0018] In another aspect, the present specification features a nucleic acid comprising a nucleic acid sequence encoding a chimeric antigen receptor of any of the embodiments described herein, and a host cell comprising such a nucleic acid. The nucleic acid can be a viral vector or a phagemid.

[0019] The present specification also features an isolated population of cells, wherein at least one cell of the population comprises a nucleic acid encoding a chimeric antigen receptor described herein. In some embodiments, at least one cell expresses the nucleic acid and comprises a chimeric antigen receptor on the cell surface. The cells can be T cells, stem cells, or NK cells.

[0020] In another aspect, the present specification features an isolated population of cells, wherein at least one cell of the population comprises a nucleic acid encoding a first chimeric antigen receptor and a nucleic acid encoding a second chimeric antigen receptor, and the first chimeric antigen receptor is a chimeric antigen receptor described herein (e.g., having the ability to bind to a human TRAILshort polypeptide). In some embodiments, at least one cell expresses a nucleic acid encoding the first chimeric antigen receptor and comprises the first chimeric antigen receptor on the cell surface.

[0021] In some embodiments, at least one cell expresses a nucleic acid encoding a second chimeric antigen receptor and comprises the second chimeric antigen receptor on the cell surface. The second chimeric antigen receptor comprises an antigen-binding domain, a hinge, a transmembrane domain, and one or more signaling domains, and the antigen-binding domain of the second chimeric antigen receptor has the ability to bind to any one of a human CD19 polypeptide, a human B cell maturation antigen (BCMA) polypeptide, a human thyroid-stimulating hormone receptor (TSHR) polypeptide, a human EPH receptor A3 (EPHA3) polypeptide, a human fibroblast growth factor receptor 2 (FGFR2) polypeptide, a human HER2 polypeptide, a human TROP2 polypeptide, a human NY-ESO polypeptide, a human mesothelin polypeptide, a human EGFR polypeptide, a human EGFRviii polypeptide, a human IL13Ra2 polypeptide, a human folate receptor alpha polypeptide, a human folate receptor beta polypeptide, a human gut integrin (e.g., ITGB7) polypeptide, a human CD103 polypeptide, a human CD83 polypeptide, a human CD22 polypeptide, a human CD20 polypeptide, a human CD79b polypeptide, a human CD79a polypeptide, a human CD123 polypeptide, a human CD33 polypeptide, a human ILR1a polypeptide, a human CD34 polypeptide, a human CD30 polypeptide, a human CD4 polypeptide, a human CD8 polypeptide, a human T cell receptor alpha polypeptide, a human T cell receptor beta polypeptide, a human CD3 polypeptide, a human CD5 polypeptide, a human CD7 polypeptide, a human gp120 polypeptide, a human galactomannan polypeptide, a human PSMA polypeptide, a human MUC polypeptide, a human PD-1 polypeptide, a human CD80 polypeptide, a human CD86 polypeptide, a human CEA polypeptide, a human GPC3 polypeptide, a human ROR1 polypeptide, a human AFP polypeptide, a human CD138 polypeptide, a human CD38 polypeptide, a human CD44v6 polypeptide, a human CD70 polypeptide, a human CLEC12A (CLL-1) polypeptide, a human CS-1 polypeptide, a human FAP polypeptide, a human GPRC5D polypeptide, a human MUC-1 polypeptide, a human MUC16 polypeptide, or a human NKG2D polypeptide.

[0022] For example, the second chimeric antigen receptor includes the CDRs of the FMC63 scFv antibody and can bind to the CD19 antigen, includes the CDRs of the MOR208 scFv antibody and can bind to the CD19 antigen, includes the CDRs of a humanized scFv antibody and can bind to the CD19 antigen, includes the CDRs of the 4G7 scFv antibody and can bind to the CD19 antigen, includes the CDRs of a low-affinity scFv antibody and can bind to the CD19 antigen, includes the CDRs of the 5E5 scFv antibody and can bind to the MUC-1 antigen, includes the CDRs of the 4D5 scFv antibody and can bind to the HER-2 antigen, includes the CDRs of the FRP5 scFv antibody and can bind to the HER-2 antigen, includes the CDRs of the M27 scFv antibody and can bind to the EGFR antigen, includes the CDRs of the cetuximab scFv antibody and can bind to the EGFR antigen, includes the CDRs of a C4-based scFv antibody and can bind to the folate receptor alpha antigen, includes the CDRs of the MOv19 scFv antibody and can bind to the folate receptor alpha antigen, includes the CDRs of the SS1 scFv antibody and can bind to the mesothelin antigen, includes the CDRs of the M clone scFv antibody and can bind to the mesothelin antigen, includes the CDRs of the amatuximab scFv antibody and can bind to the mesothelin antigen, includes the CDRs of the anetumab scFv antibody and can bind to the mesothelin antigen, includes the CDRs of the ET1402L1 scFv antibody and can bind to the AFP antigen, includes the CDRs of an anti-CEA scFv antibody and can bind to the CEA antigen, includes the CDRs of the CEACAM5 scFv antibody and can bind to the CEA antigen, includes the CDRs of the hMN14 scFv antibody and can bind to the CEA antigen, includes the CDRs of the 22172,22176 scFv antibody and can bind to the CD123 antigen, includes the CDRs of a humanized scFv antibody and can bind to the CD123 antigen, includes the CDRs of a humanized scFv antibody and can bind to the CD123 antigen, includes the CDRs of a tagraxofusp-based scFv antibody and can bind to the CD123 antigen, MY96Containing the CDR of the scFv antibody, capable of binding to the CD33 antigen, containing the CDR of the humanized scFv antibody, capable of binding to the CD33 antigen, containing the CDR of the humanized scFv antibody, capable of binding to the CLEC12A antigen, containing the CDR of the CLL1 scFv antibody, capable of binding to the CLEC12A antigen, containing the CDR of the M6E7 scFv antibody, capable of binding to the CLEC12A antigen, containing the CDR of the m21C9 scFv antibody, capable of binding to the CLEC12A antigen, containing the CDR of the M20B1 scFv antibody, capable of binding to the CLEC12A antigen, containing the CDR of the M28H12 scFv antibody, capable of binding to the CLEC12A antigen, containing the CDR of the M0971 scFv antibody, capable of binding to the CD22 antigen, containing the CDR of the humanized scFv clone antibody, capable of binding to the CD22 antigen, containing the CDR of the inotuzumab-based scFv antibody, capable of binding to the CD22 antigen, containing the CDR of the moxetumomab-based scFv antibody, capable of binding to the CD22 antigen, containing the CDR of the rituximab scFv antibody, capable of binding to the CD20 antigen, containing the CDR of the Leu 16 scFv antibody, capable of binding to the CD20 antigen, containing the CDR of the CD20 scFv antibody, capable of binding to the CD20 antigen, containing the CDR of the BCMA-02 scFv antibody, capable of binding to the BCMA antigen, containing the CDR of the LCAR38 scFv antibody, capable of binding to the BCMA antigen, containing the CDR of the BCMA scFv antibody, capable of binding to the BCMA antigen, containing the CDR of the bi-epitope scFv antibody, capable of binding to the BCMA antigen, containing the CDR of the NVS BCMA scFv antibody, capable of binding to the BCMA antigen, containing the CDR of the CS1R scFv antibody, capable of binding to the CS-1 antigen, containing the CDR of the CS1 scFv antibody, capable of binding to the CS-1 antigen, containing the CDR of the elotuzumab-based scFv antibody, capable of binding to the CS-1 antigen, containing the CDR of the scFv antibody, capable of binding to the CD138 antigen, containing the CDR of the humanized scFv antibody, capable of binding to the CD44v6 antigen, cMAb U36It contains the CDRs of scFv antibodies, can bind to the CD44v6 antigen, contains the CDRs of scFv antibodies, can bind to the NKG2D antigen, contains the CDRs of NKG2Dg scFv antibodies, can bind to the NKG2D antigen, contains the CDRs of nanobody CD38cFv antibodies, can bind to the CD38 antigen, contains the CDRs of humanized scFv antibodies, can bind to the CD38 antigen, contains the CDRs of humanized scFv antibodies, can bind to the GPRC5D antigen, contains the CDRs of scFv(L-H) and (H-L) antibodies, can bind to the CD79b antigen, contains the CDRs of M290 scFv antibodies, can bind to the CD103 antigen, contains the CDRs of FAP5 scFv antibodies, can bind to the FAP antigen, contains the CDRs of human CD70 scFv antibodies, can bind to the CD70 antigen, contains the CDRs of 4H11 scFv antibodies, can bind to the MUC16 antigen, contains the CDRs of IL13R scFv antibodies, can bind to the IL13Ra2 antigen, contains the CDRs of muromonab scFv antibodies, can bind to the CD3 antigen, contains the CDRs of teprilizumab scFv antibodies, can bind to the CD3 antigen, contains the CDRs of blinatumomab scFv antibodies, can bind to the CD3 antigen, contains the CDRs of brentuximab scFv antibodies, can bind to the CD30 antigen, contains the CDRs of 4C8 scFv antibodies, can bind to the CD34 antigen, contains the CDRs of ibalizumab scFv antibodies, can bind to the CD4 antigen, contains the CDRs of anti-CD5 scFv antibodies, can bind to the CD5 antigen, contains the CDRs of 9F2A11 scFv antibodies, can bind to the CD5 antigen, contains the CDRs of Ab5D7v scFv antibodies, can bind to the CD5 antigen, contains the CDRs of polatuzumab scFv antibodies, can bind to the CD7 antigen, contains the CDRs of Ab 4450 scFv antibodies, can bind to the CD79a antigen, contains the CDRs of anti-CD79a scFv antibodies, can bind to the CD79a antigen, contains the CDRs of crefmirumab scFv antibodies, can bind to the CD8 antigen, contains the CDRs of galiximab scFv antibodies, can bind to the CD80 antigen, contains the CDRs of 3C12 scFv antibodies, can bind to the CD83 antigen, 32AIt contains the CDRs of scFv antibodies that can bind to the CD86 antigen, contains the CDRs of anti-EGFRvIII scFv antibodies and can bind to the EGFRviii antigen, contains the CDRs of ifabotuzumab scFv antibodies and can bind to the EPHA3 antigen, contains the CDRs of apulumab scFv antibodies and can bind to the FGFR2 antigen, contains the CDRs of bemarituzumab scFv antibodies and can bind to the FGFR2 antigen, contains the CDRs of M909 scFv antibodies and can bind to the folate receptor beta antigen, contains the CDRs of ASO4498 scFv antibodies and can bind to the folate receptor beta antigen, contains the CDRs of antibody #2 scFv antibodies and can bind to the folate receptor beta antigen, contains the CDRs of antibody #3 scFv antibodies and can bind to the folate receptor beta antigen, contains the CDRs of EH7 scFv antibodies and can bind to the galactomannan antigen, contains the CDRs of BB10 scFv antibodies and can bind to the galactomannan antigen, contains the CDRs of erlizumab scFv antibodies and can bind to the gp120 antigen, contains the CDRs of suvizumab scFv antibodies and can bind to the gp120 antigen, contains the CDRs of telopabizumab scFv antibodies and can bind to the gp120 antigen, contains the CDRs of codrituzumab scFv antibodies and can bind to the GPC3 antigen, contains the CDRs of etrolizumab scFv antibodies and can bind to the intestinal integrin antigen, contains the CDRs of 10E12 scFv antibodies and can bind to the ILR1a antigen, contains the CDRs of 9E11 scFv antibodies and can bind to the ILR1a antigen, contains the CDRs of 9G5 scFv antibodies and can bind to the ILR1a antigen, contains the CDRs of canzumab scFv antibodies and can bind to the MUC antigen, contains the CDRs of clivatuzumab scFv antibodies and can bind to the MUC antigen, contains the CDRs of gachipotsumab scFv antibodies and can bind to the MUC antigen, contains the CDRs of sophituzumab scFv antibodies and can bind to the MUC antigen, contains the CDRs of umabatamab scFv antibodies and can bind to the MUC antigen, contains the CDRs of 12D7 scFv antibodies and can bind to the NY-ESO antigen, contains the CDRs of T1 scFv antibodies and can bind to the NY-ESO antigen, contains the CDRs of T2It contains the CDRs of the scFv antibody, can bind to the NY-ESO antigen, contains the CDRs of the T3 scFv antibody, can bind to the NY-ESO antigen, contains the CDRs of the nivolumab scFv antibody, can bind to the PD-1 antigen, contains the CDRs of the pembrolizumab scFv antibody, can bind to the PD-1 antigen, contains the CDRs of the J591 scFv antibody, can bind to the PSMA antigen, contains the CDRs of the zilovertamab scFv antibody, can bind to the ROR1 antigen, contains the CDRs of the anti-TCRa scFv antibody, can bind to the T cell receptor alpha antigen, contains the CDRs of the anti-TCRBC1 scFv antibody, can bind to the T cell receptor beta antigen, contains the CDRs of the K1-18 scFv antibody, can bind to the TSHR antigen, contains the CDRs of the sacituzumab scFv antibody, can bind to the TROP2 antigen, or contains the CDRs of the datopotamab scFv antibody, can bind to the TROP2 antigen.

[0023] In some cases, the antigen-binding domain of the second chimeric antigen receptor can contain the CDRs of the FMC63 scFv antibody and can bind to the CD19 antigen, contain the CDRs of the MOR208 scFv and can bind to the CD19 antigen, contain the CDRs of the humanized scFv antibody and can bind to the CD19 antigen, contain the CDRs of the 4G7 scFv antibody and can bind to the CD19 antigen, or contain the CDRs of the low-affinity scFv antibody and can bind to the CD19 antigen.

[0024] The hinge of the second chimeric antigen receptor can be the hinge described in Figure 7A. The transmembrane domain of the second chimeric antigen receptor can be the transmembrane domain described in Figure 7C. One or more signaling domains of the second chimeric antigen receptor can be selected from the group of signaling domains described in Figure 7D. The cell can be a T cell, a stem cell, or an NK cell.

[0025] In another aspect, the present specification features a method for generating chimeric antigen receptor positive (CAR+) cells. This method includes introducing a nucleic acid encoding a CAR into a cell, and the cell expresses the CAR, thereby generating CAR+ cells. The nucleic acid can be any nucleic acid sequence encoding a chimeric antigen receptor of any of the embodiments described herein. The nucleic acid can be a viral vector, and the cell can be infected with the viral vector. The CAR can be expressed on the cell surface.

[0026] The present specification also features a composition comprising a cell population described herein. In some embodiments, at least 50 percent, at least 75 percent, at least 95 percent, at least 99 percent or 100 percent of the cells express a chimeric antigen receptor. The composition can include a pro-apoptotic compound (e.g., a Bcl-2 inhibitor, an apoptosis inhibitor (IAP) inhibitor or a murine double minute 2 (MDM2) inhibitor). The Bcl-2 inhibitor can be venetoclax, navitoclax, obatoclax, ABT-737, S55746 or subtoclax. The IAP inhibitor can be AT-406, GDC-0917, LCL-161, GDC-0152, birinapant, HGS1029, TWX024 or AEG35156. The MDM2 inhibitor can be nutlin, ATSP-7041, or another apoptosis sensitizer, such as a smac mimetic, an MCL-1 inhibitor or a Bclxl inhibitor.

[0027] This specification also features a composition comprising a nucleic acid encoding a chimeric antigen receptor (e.g., a chimeric antigen receptor having the ability to bind to a human TRAILshort polypeptide). The composition may further comprise a nucleic acid encoding a chimeric antigen receptor comprising an antigen-binding domain, a hinge, a transmembrane domain, and one or more signaling domains, wherein the antigen-binding domain has the ability to bind to any one of a human CD19 polypeptide, a human BCMA polypeptide, a human TSHR polypeptide, a human EPHA3 polypeptide, a human FGFR2 polypeptide, a human HER2 polypeptide, a human TROP2 polypeptide, a human NY-ESO polypeptide, a human mesothelin polypeptide, a human EGFR polypeptide, a human EGFRviii polypeptide, a human IL13Ra2 polypeptide, a human folate receptor alpha polypeptide, a human folate receptor beta polypeptide, a human intestinal integrin (e.g., ITGB7) polypeptide, a human CD103 polypeptide, a human CD83 polypeptide, a human CD22 polypeptide, a human CD20 polypeptide, a human CD79b polypeptide, a human CD79a polypeptide, a human CD123 polypeptide, a human CD33 polypeptide, a human ILR1a polypeptide, a human CD34 polypeptide, a human CD30 polypeptide, a human CD4 polypeptide, a human CD8 polypeptide, a human T cell receptor alpha polypeptide, a human T cell receptor beta polypeptide, a human CD3 polypeptide, a human CD5 polypeptide, a human CD7 polypeptide, a human gp120 polypeptide, a human galactomannan polypeptide, a human PSMA polypeptide, a human MUC polypeptide, a human PD-1 polypeptide, a human CD80 polypeptide, a human CD86 polypeptide, a human CEA polypeptide, a human GPC3 polypeptide, a human ROR1 polypeptide, a human AFP polypeptide, a human CD138 polypeptide, a human CD38 polypeptide, a human CD44v6 polypeptide, a human CD70 polypeptide, a human CLEC12A (CLL-1) polypeptide, a human CS-1 polypeptide, a human FAP polypeptide, a human GPRC5D polypeptide, a human MUC-1 polypeptide, a human MUC16 polypeptide, or a human NKG2D polypeptide.In some cases, the antigen-binding domain has the ability to bind to the human CD19 polypeptide.

[0028] For example, the composition may further comprise a nucleic acid encoding a chimeric antigen receptor comprising an antigen-binding domain, a hinge, a transmembrane domain, and one or more signaling domains, wherein the antigen-binding domain comprises the CDRs of the FMC63 scFv antibody, binds to the CD19 antigen, comprises the CDRs of the MOR208 scFv antibody, binds to the CD19 antigen, comprises the CDRs of a humanized scFv antibody, binds to the CD19 antigen, comprises the CDRs of the 4G7 scFv antibody, binds to the CD19 antigen, comprises the CDRs of a low-affinity scFv antibody, binds to the CD19 antigen, comprises the CDRs of the 5E5 scFv antibody, binds to the MUC-1 antigen, comprises the CDRs of the 4D5 scFv antibody, binds to the HER-2 antigen, comprises the CDRs of the FRP5 scFv antibody, binds to the HER-2 antigen, comprises the CDRs of the M27 scFv antibody, binds to the EGFR antigen, comprises the CDRs of the cetuximab scFv antibody, binds to the EGFR antigen, comprises the CDRs of a C4-based scFv antibody, binds to the folate receptor alpha antigen, comprises the CDRs of the MOv19 scFv antibody, binds to the folate receptor alpha antigen, comprises the CDRs of the SS1 scFv antibody, binds to the mesothelin antigen, comprises the CDRs of the M clone scFv antibody, binds to the mesothelin antigen, comprises the CDRs of the amatuximab scFv antibody, binds to the mesothelin antigen, comprises the CDRs of the anetumab scFv antibody, binds to the mesothelin antigen, comprises the CDRs of the ET1402L1 scFv antibody, binds to the AFP antigen, comprises the CDRs of an anti-CEA scFv antibody, binds to the CEA antigen, comprises the CDRs of the CEACAM5 scFv antibody, binds to the CEA antigen, comprises the CDRs of the hMN14 scFv antibody, binds to the CEA antigen, comprises the CDRs of the 22172,22176 scFv antibody, binds to the CD123 antigen, comprises the CDRs of a humanized scFv antibody, binds to the CD123 antigen, comprises the CDRs of a humanized scFv antibody, binds to the CD123 antigen, comprises the CDRs of a tagraxofusp-based scFv antibody, binds to the CD123 antigen, comprises the CDRs of the MY96 scFv antibody, binds to the CD33 antigen, comprises the CDRs of a humanized scFv antibody, binds to the CD33 antigen, comprises the CDRs of a humanized scFv antibody, binds to the CLEC12A antigen, comprises the CDRs of the CLL1 scFv antibody, binds to the CLEC12A antigen, comprises the CDRs of the M6E7 scFv antibody, binds to the CLEC12A antigen, m21C9Comprising the CDRs of scFv antibodies, binding to the CLEC12A antigen, comprising the CDRs of the M20B1 scFv antibody, binding to the CLEC12A antigen, comprising the CDRs of the M28H12 scFv antibody, binding to the CLEC12A antigen, comprising the CDRs of the M0971 scFv antibody, binding to the CD22 antigen, comprising the CDRs of humanized scFv clone antibodies, binding to the CD22 antigen, comprising the CDRs of inotuzumab-based scFv antibodies, binding to the CD22 antigen, comprising the CDRs of moxetumomab-based scFv antibodies, binding to the CD22 antigen, comprising the CDRs of rituximab scFv antibodies, binding to the CD20 antigen, comprising the CDRs of the Leu 16 scFv antibody, binding to the CD20 antigen, comprising the CDRs of the CD20 scFv antibody, binding to the CD20 antigen, comprising the CDRs of the BCMA-02 scFv antibody, binding to the BCMA antigen, comprising the CDRs of the LCAR38 scFv antibody, binding to the BCMA antigen, comprising the CDRs of the BCMA scFv antibody, binding to the BCMA antigen, comprising the CDRs of the bi-epitope scFv antibody, binding to the BCMA antigen, comprising the CDRs of the NVS BCMA scFv antibody, binding to the BCMA antigen, comprising the CDRs of the CS1R scFv antibody, binding to the CS-1 antigen, comprising the CDRs of the CS1 scFv antibody, binding to the CS-1 antigen, comprising the CDRs of elotuzumab-based scFv antibodies, binding to the CS-1 antigen, comprising the CDRs of scFv antibodies, binding to the CD138 antigen, comprising the CDRs of humanized scFv antibodies, binding to the CD44v6 antigen, comprising the CDRs of the cMAb U36 scFv antibody, binding to the CD44v6 antigen, comprising the CDRs of scFv antibodies, binding to the NKG2D antigen, comprising the CDRs of the NKG2Dg scFv antibody, binding to the NKG2D antigen, comprising the CDRs of the nanobody CD38cFv antibody, binding to the CD38 antigen, comprising the CDRs of humanized scFv antibodies, binding to the CD38 antigen, comprising the CDRs of humanized scFv antibodies, binding to the GPRC5D antigen, comprising the CDRs of scFv(L-H) and (H-L) antibodies, binding to the CD79b antigen, comprising the CDRs of the M290 scFv antibody, binding to the CD103 antigen, comprising the CDRs of the FAP5 scFv antibody, binding to the FAP antigen, comprising the CDRs of human CD70 scFv antibodies, binding to the CD70 antigen, comprising the CDRs of the 4H11 scFv antibody, binding to the MUC16 antigen, IL13RComprising the CDRs of scFv antibodies, binding to the IL13Ra2 antigen, comprising the CDRs of muromonab scFv antibodies, binding to the CD3 antigen, comprising the CDRs of teprilizumab scFv antibodies, binding to the CD3 antigen, comprising the CDRs of blinatumomab scFv antibodies, binding to the CD3 antigen, comprising the CDRs of brentuximab scFv antibodies, binding to the CD30 antigen, comprising the CDRs of 4C8 scFv antibodies, binding to the CD34 antigen, comprising the CDRs of ibalizumab scFv antibodies, binding to the CD4 antigen, comprising the CDRs of anti-CD5 scFv antibodies, binding to the CD5 antigen, comprising the CDRs of 9F2A11 scFv antibodies, binding to the CD5 antigen, comprising the CDRs of Ab5D7v scFv antibodies, binding to the CD5 antigen, comprising the CDRs of polatuzumab scFv antibodies, binding to the CD7 antigen, comprising the CDRs of Ab4450 scFv antibodies, binding to the CD79a antigen, comprising the CDRs of anti-CD79a scFv antibodies, binding to the CD79a antigen, comprising the CDRs of crefmirumab scFv antibodies, binding to the CD8 antigen, comprising the CDRs of galiximab scFv antibodies, binding to the CD80 antigen, comprising the CDRs of 3C12 scFv antibodies, binding to the CD83 antigen, comprising the CDRs of 32A scFv antibodies, binding to the CD86 antigen, comprising the CDRs of anti-EGFRvIII scFv antibodies, binding to the EGFRviii antigen, comprising the CDRs of ifabotuzumab scFv antibodies, binding to the EPHA3 antigen, comprising the CDRs of apulizumab scFv antibodies, binding to the FGFR2 antigen, comprising the CDRs of bemarituzumab scFv antibodies, binding to the FGFR2 antigen, comprising the CDRs of M909 scFv antibodies, binding to the folate receptor beta antigen, comprising the CDRs of ASO4498 scFv antibodies, binding to the folate receptor beta antigen, comprising the CDRs of antibody #2 scFv antibodies, binding to the folate receptor beta antigen, comprising the CDRs of antibody #3 scFv antibodies, binding to the folate receptor beta antigen, comprising the CDRs of EH7 scFv antibodies, binding to the galactomannan antigen, BB10Comprising the CDRs of scFv antibodies, binding to galactomannan antigen, comprising the CDRs of erlizumab scFv antibody, binding to gp120 antigen, comprising the CDRs of sibuzumab scFv antibody, binding to gp120 antigen, comprising the CDRs of telopavizumab scFv antibody, binding to gp120 antigen, comprising the CDRs of codrituzumab scFv antibody, binding to GPC3 antigen, comprising the CDRs of etrolizumab scFv antibody, binding to intestinal integrin antigen, comprising the CDRs of 10E12 scFv antibody, binding to ILR1a antigen, comprising the CDRs of 9E11 scFv antibody, binding to ILR1a antigen, comprising the CDRs of 9G5 scFv antibody, binding to ILR1a antigen, comprising the CDRs of cantuzumab scFv antibody, binding to MUC antigen, comprising the CDRs of clivatuzumab scFv antibody, binding to MUC antigen, comprising the CDRs of gatipotuzumab scFv antibody, binding to MUC antigen, comprising the CDRs of sophituzumab scFv antibody, binding to MUC antigen, comprising the CDRs of ubatumumab scFv antibody, binding to MUC antigen, comprising the CDRs of 12D7 scFv antibody, binding to NY-ESO antigen, comprising the CDRs of T1 scFv antibody, binding to NY-ESO antigen, comprising the CDRs of T2 scFv antibody, binding to NY-ESO antigen, comprising the CDRs of T3 scFv antibody, binding to NY-ESO antigen, comprising the CDRs of nivolumab scFv antibody, binding to PD-1 antigen, comprising the CDRs of pembrolizumab scFv antibody, binding to PD-1 antigen, comprising the CDRs of J591 scFv antibody, binding to PSMA antigen, comprising the CDRs of zilovertamab scFv antibody, binding to ROR1 antigen, comprising the CDRs of anti-TCRa scFv antibody, binding to T cell receptor alpha antigen, comprising the CDRs of anti-TCRBC1 scFv antibody, binding to T cell receptor beta antigen, comprising the CDRs of K1-18 scFv antibody, binding to TSHR antigen, comprising the CDRs of sacituzumab scFv antibody, binding to TROP2 antigen, or comprising the CDRs of datopotamab scFv antibody, binding to TROP2 antigen. Optionally, the composition further comprises a nucleic acid encoding a chimeric antigen receptor comprising an antigen-binding domain, a hinge, a transmembrane domain and one or more signaling domains, the antigen-binding domain comprising the CDRs of the FMC63 scFv antibody, binding to CD19 antigen, MOR208It contains the CDRs of scFv, binds to the CD19 antigen, contains the CDRs of a humanized scFv antibody, binds to the CD19 antigen, contains the CDRs of a 4G7 scFv antibody, binds to the CD19 antigen, or contains the CDRs of a low-affinity scFv antibody and binds to the CD19 antigen.

[0029] A method of treating a mammal (e.g., a human) having cancer is also characterized. This method includes administering to the mammal (e.g., a human) a composition described herein (e.g., a composition containing a cell population described herein or a composition containing a nucleic acid encoding a chimeric antigen receptor described herein). The cancer can be a TRAILshort+ cancer, such as TRAILshort+ squamous cell carcinoma, lymphoma, cervical cancer, renal cell carcinoma, breast cancer, prostate cancer, ovarian cancer, lung cancer, bladder cancer, head and neck cancer, uterine cancer, esophageal cancer, gastric cancer, colorectal cancer, sarcoma, or pancreatic cancer. The number of cancer cells in the mammal (e.g., a human) can be reduced after the administration step. This method can include administering to the mammal a pro-apoptotic compound (e.g., a Bcl-2 inhibitor, an IAP inhibitor, an MDM2 inhibitor, a smac mimetic, a Bcxlx inhibitor, or an MCL-1 inhibitor).

[0030] In another aspect, a method of treating a mammal (e.g., a human) having an infectious disease is characterized. This method includes administering to the mammal (e.g., a human) a composition described herein (e.g., a composition containing a cell population described herein or a composition containing a nucleic acid encoding a chimeric antigen receptor described herein). The infectious disease can be a chronic infectious disease. The infectious disease can be selected from the group consisting of human immunodeficiency virus (HIV) infection, hepatitis B virus (HBV) infection, hepatitis C virus (HCV) infection, human papillomavirus (HPV) infection, tuberculosis (TB) infection, cytomegalovirus (CMV) infection, and Epstein-Barr virus (EBV) infection.

[0031] This specification also features a method of binding a chimeric antigen receptor to a TRAILshort polypeptide. The method includes contacting the TRAILshort polypeptide with the chimeric antigen receptor described herein. The contacting can be performed in vitro or in vivo. For example, the contacting can be performed in a mammal (e.g., a human) by administering cells comprising the chimeric antigen receptor to the mammal (e.g., a human).

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Methods and materials are described herein for use in the present disclosure, but other suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0033] Details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

Brief Description of the Drawings

[0034]

Figure 1

Figure 2

Figure 3A-1

Figure 3A-2

Figure 3B

Figure 3C-1

Figure 3C-2

Figure 4

Figure 5

Figure 6

Figure 7A-1

Figure 7A-2

Figure 7B

Figure 7C

Figure 7D

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17A

Figure 17B

Figure 17C

Figure 17D

Figure 17E

Figure 17F

[0035] This specification provides chimeric antigen receptors (CARs) that bind (e.g., specifically bind) to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide). For example, this specification provides CARs that bind (e.g., specifically bind) to a polypeptide comprising, consisting essentially of, or consisting of the TRAILshort amino acids (e.g., SEQ ID NO: 34) described in FIG. 1 or the 11 C-terminal amino acids (SEQ ID NO: 35, FIG. 1) unique to TRAILshort. Generation of TRAILshort antibodies specific for the 11 C-terminal amino acids unique to TRAILshort is described, for example, in Schnepple et al., J Biol Chem 286:35742 - 35754, 2011 and U.S. Patent No. 11,136,402. Targeting TRAILshort polypeptides with the CARs described herein can be used, for example, to increase apoptosis of TRAILshort+ cells (e.g., cancer cells or infected cells).

[0036] As used herein, the term "antibody" includes polyclonal antibodies, monoclonal antibodies, recombinant antibodies, humanized antibodies, human antibodies, chimeric antibodies, multispecific antibodies (e.g., bispecific antibodies) formed from at least two antibodies, diabodies, single-chain variable fragment antibodies (e.g., scFv antibodies), and tandem single-chain variable fragment antibodies (e.g., taFv). A diabody can comprise two chains each having a heavy-chain variable domain and a light-chain variable domain, which can be from the same antibody or from different antibodies (see, e.g., Hornig and Farber-Schwarz, Methods Mol. Biol., Vol. 907:713-727 (2012); and Brinkmann and Kontermann, MAbs., Vol. 9(2):182-212 (2017)). The two variable regions can be connected by a polypeptide linker (e.g., a polypeptide linker having a length of 5 to 10 residues). Optionally, interdomain disulfide bonds can be present in one or both of the pairs of heavy-chain and light-chain variable domains of the diabody. An scFv is a single-chain polypeptide antibody in which the heavy-chain variable domain and the light-chain variable domain are either directly linked or connected via a polypeptide linker (e.g., a polypeptide linker having a length of 8 to 18 residues). See also Chen et al., Adv. Drug Deliv. Rev., Vol. 65(10):1357-1369 (2013). The scFv can be designed to have an orientation in which the heavy-chain variable domain follows the light-chain variable domain, or an orientation in which the light-chain variable domain follows the heavy-chain variable domain. In either case, any linker can be positioned between the two domains.

[0037] The antibodies provided herein can include the CDRs described herein (e.g., those described in Table 1) and can be configured to be murine antibodies, humanized antibodies, or chimeric antibodies. In some cases, the antibodies provided herein can include the CDRs described herein (e.g., those described in Table 1) and can be monoclonal antibodies. In some cases, the antibodies provided herein can include the CDRs described herein (e.g., those described in Table 1) and can be configured as scFv antibodies.

[0038] As used herein, the term "antigen-binding fragment" refers to a fragment of an antibody that has the ability to bind to an antigen (e.g., a fragment of a humanized antibody, a murine antibody, or a chimeric antibody). Examples of antigen-binding fragments include, but are not limited to, Fab, Fab', or F(ab')2 antigen-binding fragments. The antigen-binding fragments provided herein can include the CDRs described herein (e.g., those described in Table 1) and can be configured to be murine antigen-binding fragments, humanized antigen-binding fragments, or chimeric antigen-binding fragments. In some cases, the antigen-binding fragments provided herein can include the CDRs described herein (e.g., those described in Table 1) and can be monoclonal antigen-binding fragments. In some cases, the antigen-binding fragments provided herein can include the CDRs described herein (e.g., those described in Table 1) and can be configured as Fab antibodies. In some cases, a Fab antibody can include a partial hinge sequence for a disulfide bond between the heavy and light chains of the Fab.

[0039] As used herein, the term "antibody domain" refers to the domain of an antibody in the absence of one or more other domains of the antibody, such as a heavy chain variable domain (VH domain) or a light chain variable domain (VL domain). In some cases, the antibody domain can be a single antibody domain (e.g., VH domain or VL domain) having the ability to bind to an antigen. The antibody domains provided herein can include the CDRs described herein (e.g., those described in Table 1), and can be murine antibody domains, human VH domains, humanized antibody domains (e.g., humanized VH domains) or chimeric antibody domains (e.g., chimeric VH domains). In some cases, the antibody domains provided herein can include the CDRs described herein (e.g., those described in Table 1), and can be monoclonal antibody domains. In some cases, the antibody domains provided herein can include the CDRs described herein (e.g., those described in Table 1), and can be generated by manipulation as a single VH domain or a single VL domain.

[0040] The anti-TRAILshort antibodies, anti-TRAILshort antigen-binding fragments or anti-TRAILshort antibody domains provided herein can be of the IgA-, IgD-, IgE-, IgG- or IgM-type, and can include IgG- or IgM-types, such as, but not limited to, IgG1-, IgG2-, IgG3-, IgG4-, IgM1- and IgM2-types. In some cases, the antibodies provided herein (e.g., anti-TRAILshort antibodies) can be scFv antibodies. In some cases, the antigen-binding fragments provided herein (e.g., anti-TRAILshort antibody fragments) can be Fab. In some cases, the antibodies provided herein (e.g., anti-TRAILshort antibodies) can be fully intact antibodies. In some cases, the antibody domains provided herein (e.g., anti-TRAILshort antibody domains) can be VH domains.

[0041] As used herein, "chimeric antigen receptor" refers to a chimeric polypeptide designed to include any signal peptide, antigen-binding domain, any hinge, transmembrane domain, and one or more intracellular signaling domains. As described herein, the antigen-binding domain of the CAR provided herein can be designed to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide). For example, the CAR provided herein can be designed to include, as the antigen-binding domain, a component of an antibody, antigen-binding fragment, and / or antibody domain described herein (e.g., a combination of CDRs), provided that its antigen-binding domain has the ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide). In some examples, the CAR provided herein can be designed to include an antigen-binding domain that includes two sets of three CDRs (e.g., CDR1, CDR2, and CDR3 of the heavy chain, and CDR1, CDR2, and CDR3 of the light chain) of an antigen-binding fragment provided herein (e.g., SEQ ID NOs: 1-3, SEQ ID NO: 9, the amino acid sequence GAS, and SEQ ID NO: 10). Optionally, the antigen-binding domain of a CAR that targets a TRAILshort polypeptide can be designed to include the VH domain described herein or the scFv antibody described herein.

[0042] Optionally, the CAR provided herein can be designed to include a signal peptide. Any suitable signal peptide can be used to design the CARs described herein. Examples of signal peptides that can be used to produce the CARs described herein include, but are not limited to, the tPA signal peptide, the BiP signal peptide, or the CD8α signal peptide.

[0043] In some cases, the CARs provided herein can be designed to include a hinge. Any suitable hinge can be used to design the CARs described herein. Examples of hinges that can be used to make the CARs described herein include, but are not limited to, Ig-derived hinges (e.g., IgG1-derived hinge, IgG2-derived hinge, or IgG4-derived hinge), Ig-derived hinges containing CD2 and CD3 domains, Ig-derived hinges containing CD2 domain and lacking CD3 domain, Ig-derived hinges containing CD3 domain and lacking CD2 domain, Ig-derived hinges lacking CD2 domain and lacking CD3 domain, CD8α-derived hinge, CD28-derived hinge, and CD3ζ-derived hinge. See, for example, the exemplary hinge of FIG. 7A. The CARs provided herein can be designed to include a hinge of any suitable length. For example, the CARs provided herein can be designed to include a hinge that is about 3 to about 75 (e.g., about 3 to about 65, about 3 to about 50, about 5 to about 75, about 10 to about 75, about 5 to about 50, about 10 to about 50, about 10 to about 40, or about 10 to about 30) amino acid residues in length. In some cases, linker sequences (e.g., (GGGGS) 2-5 ; SEQ ID NOs: 157, 47, 158, and 159, respectively) can be used as the hinge for making the CARs described herein.

[0044] The CARs provided herein can be designed to include any suitable transmembrane domain. See, for example, the exemplary transmembrane domains of FIGS. 7A and 7C. For example, the transmembrane domain of the CARs provided herein can be, but is not limited to, CD3ζ transmembrane domain, CD4 transmembrane domain, CD8α transmembrane domain, CD28 transmembrane domain, or 4-1BB transmembrane domain.

[0045] The CARs provided herein can be designed to include one or more intracellular signaling domains. See, for example, the exemplary intracellular domains of FIGS. 7A and 7D. For example, the CARs provided herein can be designed to include one, two, three, or four intracellular signaling domains. Any suitable intracellular signaling domain or combination of intracellular signaling domains can be used to generate the CARs described herein. Examples of intracellular signaling domains that can be used to generate the CARs described herein include, but are not limited to, the CD3ζ intracellular signaling domain, the CD27 intracellular signaling domain, the CD28 intracellular signaling domain, the OX40 (CD134) intracellular signaling domain, the 4-1BB (CD137) intracellular signaling domain, the CD278 intracellular signaling domain, the DAP10 intracellular signaling domain, and the DAP12 intracellular signaling domain. In some cases, the CARs described herein can be designed to be first-generation CARs having a CD3ζ intracellular signaling domain. In some cases, the CARs described herein can be designed to be second-generation CARs having a CD28 intracellular signaling domain followed by a CD3ζ intracellular signaling domain. In some cases, the CARs described herein can be designed to be third-generation CARs having (a) a CD28 intracellular signaling domain, followed by (b) a CD27 intracellular signaling domain, an OX40 intracellular signaling domain, or a 4-1BB intracellular signaling domain, followed by (c) a CD3ζ intracellular signaling domain. See, for example, Feins et al., Am J Hematol., 94(S1):S3-S9 (2019).

[0046] In some cases, a CAR targeting the TRAILshort polypeptide has a scFv having a heavy chain variable domain comprising SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, followed by a linker, such as (GGGGS) 2-5(SEQ ID NOs: 157, 47, 158, and 159, respectively), followed by the light chain variable domain comprising SEQ ID NO: 9, the amino acid sequence GAS, and SEQ ID NO: 10, followed by a hinge, such as a hinge / linker (e.g., an IgG4-derived hinge, a CD8α hinge, or a linker plus an IgG4-derived hinge), followed by a transmembrane domain (e.g., a human CD28 transmembrane domain or a CD8α transmembrane domain), followed by one or more intracellular signaling domains, can be designed to contain.

[0047] In some cases, CDR1 of the heavy chain variable domain of an antibody capable of binding to the TRAILshort polypeptide can be GYIFTNND (SEQ ID NO: 1). In some cases, CDR1 of the heavy chain variable domain of an antibody capable of binding to the TRAILshort polypeptide can be NNDMN (SEQ ID NO: 85). Other examples of CDR1 of the heavy chain variable domain of an antibody capable of binding to the TRAILshort polypeptide include, but are not limited to, GYIFTNN (SEQ ID NO: 86), GYIFTNNDM (SEQ ID NO: 87), YIFTNNDMN (SEQ ID NO: 88), YIFTNNDM (SEQ ID NO: 89), YIFTNND (SEQ ID NO: 90), IFTNNDMN (SEQ ID NO: 91), IFTNNDM (SEQ ID NO: 92), IFTNND (SEQ ID NO: 93), FTNNDMN (SEQ ID NO: 94), FTNNDM (SEQ ID NO: 95), FTNND (SEQ ID NO: 96), TNNDMN (SEQ ID NO: 97), TNNDM (SEQ ID NO: 98), and TNND (SEQ ID NO: 99). In some cases, CDR2 of the heavy chain variable domain of an antibody capable of binding to the TRAILshort polypeptide can be IDPGDGRTK (SEQ ID NO: 2). In some cases, CDR2 of the heavy chain variable domain of an antibody capable of binding to the TRAILshort polypeptide can be GIDPGDGRTKYNEKFKG (SEQ ID NO: 100). Other examples of CDR2 of the heavy chain variable domain of an antibody capable of binding to the TRAILshort polypeptide include, but are not limited to, IDPGDGRT (SEQ ID NO: 101), IDPGDGRTK (SEQ ID NO: 102), IDPGDGRTKYN (SEQ ID NO: 103), GIDPGDGRT (SEQ ID NO: 104), IDPGDGR (SEQ ID NO: 105), DPGDGRTKYN (SEQ ID NO: 106), DPGDGRTKY (SEQ ID NO: 107), PGDGRTKYNE (SEQ ID NO: 108), PGDGRTKYN (SEQ ID NO: 109), GDGRTKYNEKFKG (SEQ ID NO: 110), GDGRTKYNEKFK (SEQ ID NO: 111), IDPGDGRTKYNEKFK (SEQ ID NO: 112), DPGDGRTKYNEKF (SEQ ID NO: 113), and PGDGRTKYNEK (SEQ ID NO: 114). In some cases, CDR3 of the heavy chain variable domain of an antibody capable of binding to the TRAILshort polypeptide can be GRGGYEFGIDY (SEQ ID NO: 3).In some cases, the CDR3 of the heavy chain variable domain of an antibody that can bind to the TRAILshort polypeptide can be GGYEFGIDY (SEQ ID NO: 115). Other examples of the CDR3 of the heavy chain variable domain of an antibody that can bind to the TRAILshort polypeptide include, but are not limited to, GRGGYEFGID (SEQ ID NO: 116), GRGGYEFGI (SEQ ID NO: 117), GRGGYEFG (SEQ ID NO: 118), GRGGYEF (SEQ ID NO: 119), RGGYEFGIDY (SEQ ID NO: 120), RGGYEFGI (SEQ ID NO: 121), RGGYEFGID (SEQ ID NO: 122), GGYEFGID (SEQ ID NO: 123), GGYEFGI (SEQ ID NO: 124), GYEFGIDY (SEQ ID NO: 125), GYEFGID (SEQ ID NO: 126), YEFGIDY (SEQ ID NO: 127), and YEFGID (SEQ ID NO: 128).

[0048] In some cases, the CDR1 of the light chain variable domain of an antibody that can bind to the TRAILshort polypeptide can be QSLLNSGNQKNS (SEQ ID NO: 9). In some cases, the CDR1 of the light chain variable domain of an antibody that can bind to the TRAILshort polypeptide can be KSSQSLLNSGNQKNSLA (SEQ ID NO: 129). Other examples of the CDR1 of the light chain variable domain of an antibody that can bind to the TRAILshort polypeptide include, but are not limited to, QSLLNSGNQKNSL (SEQ ID NO: 130), QSLLNSGNQKNSLA (SEQ ID NO: 131), SQSLLNSGNQKNS (SEQ ID NO: 132), SQSLLNSGNQKNSL (SEQ ID NO: 133), SQSLLNSGNQKNSLA (SEQ ID NO: 134), SSQSLLNSGNQKNS (SEQ ID NO: 135), SSQSLLNSGNQKNSL (SEQ ID NO: 136), SSQSLLNSGNQKNSLA (SEQ ID NO: 137), KSSQSLLNSGNQKNS (SEQ ID NO: 138), KSSQSLLNSGNQKNSL (SEQ ID NO: 139), SLLNSGNQKNSLA (SEQ ID NO: 140), SLLNSGNQKNSL (SEQ ID NO: 141), and SLLNSGNQKNS (SEQ ID NO: 142).

[0049] In some cases, the CDR2 of the light chain variable domain of an antibody that can bind to the TRAILshort polypeptide can be GAS. In some cases, the CDR2 of the light chain variable domain of an antibody that can bind to the TRAILshort polypeptide can be GASTRES (SEQ ID NO: 143). Other examples of the CDR2 of the light chain variable domain of an antibody that can bind to the TRAILshort polypeptide include, but are not limited to, GAST (SEQ ID NO: 144), GASTR (SEQ ID NO: 145), GASTRE (SEQ ID NO: 146), ASTRES (SEQ ID NO: 147), ASTRE (SEQ ID NO: 148), and ASTR (SEQ ID NO: 149).

[0050] In some cases, the CDR3 of the light chain variable domain of an antibody that can bind to the TRAILshort polypeptide can be QNDHSFPLT (SEQ ID NO: 10). In some cases, the CDR3 of the light chain variable domain of an antibody that can bind to the TRAILshort polypeptide can be QNDHSFPL (SEQ ID NO: 150). Other examples of the CDR3 of the light chain variable domain of an antibody that can bind to the TRAILshort polypeptide include, but are not limited to, QNDHSFP (SEQ ID NO: 151), NDHSFPLT (SEQ ID NO: 152), NDHSFPL (SEQ ID NO: 153), DHSFPLT (SEQ ID NO: 154), and DHSFPL (SEQ ID NO: 155).

[0051] In some cases, a CAR that targets the TRAILshort polypeptide can be an scFv having a heavy chain variable domain comprising SEQ ID NO: 8, followed by a linker, such as (GGGGS) 2-5 (SEQ ID NOS: 157, 47, 158, and 159, respectively), followed by a light chain variable domain comprising SEQ ID NO: 15, followed by a hinge, such as a hinge / linker (e.g., an IgG4-derived hinge, a CD8α hinge, or a linker plus an IgG4-derived hinge), followed by a transmembrane domain, followed by one or more intracellular signaling domains, e.g., it can be designed to include one or more intracellular signaling domains.

[0052] In some cases, a CAR targeting a TRAILshort polypeptide can be designed to include a scFv having a light chain variable domain containing SEQ ID NO: 9, the amino acid sequence GAS and SEQ ID NO: 10, followed by a linker, such as (GGGGS) 2-5 (SEQ ID NOs: 157, 47, 158, and 159, respectively), followed by a heavy chain variable domain containing SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, followed by a hinge, such as a hinge / linker (e.g., an IgG4-derived hinge, a CD8α hinge, or a linker plus an IgG4-derived hinge), followed by a transmembrane domain, followed by one or more intracellular signaling domains.

[0053] In some cases, a CAR targeting a TRAILshort polypeptide can be designed to include a scFv having a light chain variable domain containing SEQ ID NO: 15, followed by a linker, such as (GGGGS) 2-5 (SEQ ID NOs: 157, 47, 158, and 159, respectively), followed by a heavy chain variable domain containing SEQ ID NO: 8, followed by a hinge, such as a hinge / linker (e.g., an IgG4-derived hinge, a CD8α hinge, or a linker plus an IgG4-derived hinge), followed by a transmembrane domain (e.g., a human CD28 transmembrane domain or a CD8α transmembrane domain), followed by one or more intracellular signaling domains.

[0054] In one embodiment, the CARs provided herein having the ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide) comprise: (i) a heavy chain variable domain having a CDR1 having the amino acid sequence set forth in SEQ ID NO: 1 (or a variant of SEQ ID NO: 1 having one or two amino acid modifications), a CDR2 having the amino acid sequence set forth in SEQ ID NO: 2 (or a variant of SEQ ID NO: 2 having one or two amino acid modifications), and a CDR3 having the amino acid sequence set forth in SEQ ID NO: 3 (or a variant of SEQ ID NO: 3 having one or two amino acid modifications); and / or (ii) a light chain variable domain having a CDR1 having the amino acid sequence set forth in SEQ ID NO: 9 (or a variant of SEQ ID NO: 9 having one or two amino acid modifications), a CDR2 having the amino acid sequence GAS (or a variant of GAS having one amino acid modification), and a CDR3 having the amino acid sequence set forth in SEQ ID NO: 10 (or a variant of SEQ ID NO: 10 having one or two amino acid modifications).

[0055] In some cases, the CARs provided herein that have the ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide), (a) a CDR1 having the amino acid sequence set forth in SEQ ID NO: 1 (or a variant of SEQ ID NO: 1 having one or two amino acid modifications), a CDR2 having the amino acid sequence set forth in SEQ ID NO: 2 (or a variant of SEQ ID NO: 2 having one or two amino acid modifications), and a CDR3 having the amino acid sequence set forth in SEQ ID NO: 3 (or a variant of SEQ ID NO: 3 having one or two amino acid modifications) in a heavy chain variable domain, and / or (b) a CDR1 having the amino acid sequence set forth in SEQ ID NO: 9 (or a variant of SEQ ID NO: 9 having one or two amino acid modifications), a CDR2 having the amino acid sequence GAS (or a variant of GAS having one amino acid modification), and a CDR3 having the amino acid sequence set forth in SEQ ID NO: 10 (or a variant of SEQ ID NO: 10 having one or two amino acid modifications) in a light chain variable domain may include any suitable framework region.For example, the antigen-binding domain of the CAR provided in this specification can include a heavy-chain variable domain comprising (a) a framework region 1 having the amino acid sequence set forth in SEQ ID NO: 4 (or a variant of SEQ ID NO: 4 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid modifications), a framework region 2 having the amino acid sequence set forth in SEQ ID NO: 5 (or a variant of SEQ ID NO: 5 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid modifications), a framework region 3 having the amino acid sequence set forth in SEQ ID NO: 6 (or a variant of SEQ ID NO: 6 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid modifications), and a framework region 4 having the amino acid sequence set forth in SEQ ID NO: 7 (or a variant of SEQ ID NO: 7 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid modifications), and / or (b) a light-chain variable domain comprising a framework region 1 having the amino acid sequence set forth in SEQ ID NO: 11 (or a variant of SEQ ID NO: 11 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid modifications), a framework region 2 having the amino acid sequence set forth in SEQ ID NO: 12 (or a variant of SEQ ID NO: 12 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid modifications), a framework region 3 having the amino acid sequence set forth in SEQ ID NO: 13 (or a variant of SEQ ID NO: 13 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid modifications), and a framework region 4 having the amino acid sequence set forth in SEQ ID NO: 14 (or a variant of SEQ ID NO: 14 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid modifications).

[0056] In some cases, the antigen-binding domain of a CAR having any of the CDRs depicted in Figure 3B can be designed to include a framework region (e.g., any of the framework regions of the heavy chain variable regions VH0 (SEQ ID NO: 16), VH1 (SEQ ID NO: 18), VH2 (SEQ ID NO: 20), VH3 (SEQ ID NO: 8) or VH4 (SEQ ID NO: 23), and / or any of the framework regions of the light chain variable regions LC0 (SEQ ID NO: 25), LC1 (SEQ ID NO: 27), LC2 (SEQ ID NO: 15), LC3 (SEQ ID NO: 30) or LC4 (SEQ ID NO: 32)), or can be designed to include one or more framework regions from another antibody, antibody fragment or antibody domain.

[0057] In some cases, the antigen-binding domain of a CAR provided herein having the ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide) can include (a) a heavy chain variable domain comprising an amino acid sequence having at least 90 percent identity to the amino acid sequence set forth in SEQ ID NO: 8, and / or (b) a light chain variable domain comprising an amino acid sequence having at least 90 percent identity to the amino acid sequence set forth in SEQ ID NO: 15. For example, a CAR provided herein can include (a) a heavy chain variable domain comprising an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to the amino acid sequence set forth in SEQ ID NO: 8, and / or (b) a light chain variable domain comprising an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 percent identity to the amino acid sequence set forth in SEQ ID NO: 15. In some cases, the antigen-binding domain of a CAR provided herein can include (a) a heavy chain variable domain comprising an amino acid sequence having 100 percent identity to the amino acid sequence set forth in SEQ ID NO: 8, and / or (b) a light chain variable domain comprising an amino acid sequence having 100 percent identity to the amino acid sequence set forth in SEQ ID NO: 15.

[0058] In some cases, the CARs provided herein having the ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide) can comprise an antigen-binding domain having a heavy-chain variable domain comprising an amino acid sequence having at least 90 percent identity to the amino acid sequence set forth in SEQ ID NO: 8, provided that the heavy-chain variable domain is not the heavy-chain variable domain comprising the amino acid sequences set forth in SEQ ID NOs: 1, 2, and 3, and / or a light-chain variable domain comprising an amino acid sequence having at least 90 percent identity to the amino acid sequence set forth in SEQ ID NO: 15, provided that the light-chain variable domain is not the light-chain variable domain comprising the amino acid sequence set forth in SEQ ID NO: 9, the amino acid sequence GAS, and the light-chain variable domain set forth in SEQ ID NO: 10. For example, the antigen-binding domain of the CARs provided herein can comprise a heavy-chain variable domain comprising an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to the amino acid sequence set forth in SEQ ID NO: 8, provided that the heavy-chain variable domain is not the heavy-chain variable domain comprising the amino acid sequences set forth in SEQ ID NOs: 1, 2, and 3, and / or a light-chain variable domain comprising an amino acid sequence having at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to the amino acid sequence set forth in SEQ ID NO: 15, provided that the light-chain variable domain can comprise the amino acid sequence set forth in SEQ ID NO: 9, the amino acid sequence GAS, and the light-chain variable domain set forth in SEQ ID NO: 10.

[0059] In some cases, the antigen-binding domain of the CAR provided herein that has the ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide) can include (a) a heavy chain variable domain having the amino acid sequence set forth in SEQ ID NO: 8, or the amino acids of SEQ ID NO: 8 having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions), and / or (b) a light chain variable domain including the amino acid sequence set forth in SEQ ID NO: 15, or the amino acids of SEQ ID NO: 15 having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions). For example, the antigen-binding domain of the CAR provided herein can have the ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide), can include a heavy chain variable domain having the amino acid sequence set forth in SEQ ID NO: 8 having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions), provided that the heavy chain variable domain includes the amino acid sequences set forth in SEQ ID NOs: 1, 2, and 3, and can include a light chain variable domain having the amino acid sequence set forth in SEQ ID NO: 15 having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid modifications (e.g., amino acid substitutions, amino acid deletions, and / or amino acid additions), provided that the light chain variable domain includes the amino acid sequence set forth in SEQ ID NO: 9, the amino acid sequence GAS, and SEQ ID NO: 10.

[0060] In some cases, the CARs provided herein having the ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide) may comprise an antigen-binding domain having a heavy chain variable domain comprising (a)(i) a CDR1 comprising, consisting essentially of, or consisting of the amino acid sequence set forth in SEQ ID NO: 1, (ii) a CDR2 comprising, consisting essentially of, or consisting of the amino acid sequence set forth in SEQ ID NO: 2, and (iii) a CDR3 comprising, consisting essentially of, or consisting of the amino acid sequence set forth in SEQ ID NO: 3, and / or (b)(i) a CDR1 comprising, consisting essentially of, or consisting of the amino acid sequence set forth in SEQ ID NO: 9, (ii) a CDR2 comprising, consisting essentially of, or consisting of the amino acid sequence GAS, and (iii) a CDR3 comprising, consisting essentially of, or consisting of the amino acid sequence set forth in SEQ ID NO: 10 in a light chain variable domain.

[0061] As used herein, a "CDR1 that consists essentially of the amino acid sequence set forth in SEQ ID NO: 1" is a CDR1 having 0, 1, or 2 amino acid substitutions within SEQ ID NO: 1, a CDR1 having 0, 1, 2, 3, 4, or 5 amino acid residues immediately preceding SEQ ID NO: 1, and / or a CDR1 having 0, 1, 2, 3, 4, or 5 amino acid residues immediately following SEQ ID NO: 1, provided that the CAR maintains its basic ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide).

[0062] As used herein, a "CDR2 that consists essentially of the amino acid sequence set forth in SEQ ID NO: 2" is a CDR2 having 0, 1, or 2 amino acid substitutions within SEQ ID NO: 2, a CDR2 having 0, 1, 2, 3, 4, or 5 amino acid residues immediately preceding SEQ ID NO: 2, and / or a CDR2 having 0, 1, 2, 3, 4, or 5 amino acid residues immediately following SEQ ID NO: 2, provided that the CAR maintains its basic ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide).

[0063] As used herein, "CDR3 consisting essentially of the amino acid sequence set forth in SEQ ID NO: 3" refers to a CDR3 having 0 or 1 amino acid substitution within SEQ ID NO: 3, a CDR3 having 0, 1, 2, 3, 4 or 5 amino acid residues immediately preceding SEQ ID NO: 3, and / or a CDR3 having 0, 1, 2, 3, 4 or 5 amino acid residues immediately following SEQ ID NO: 3, provided that the CAR maintains its basic ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide).

[0064] As used herein, "CDR1 consisting essentially of the amino acid sequence set forth in SEQ ID NO: 9" refers to a CDR1 having 0, 1, or 2 amino acid substitutions within SEQ ID NO: 9, a CDR1 having 0, 1, 2, 3, 4 or 5 amino acid residues immediately preceding SEQ ID NO: 9, and / or a CDR1 having 0, 1, 2, 3, 4 or 5 amino acid residues immediately following SEQ ID NO: 9, provided that the CAR maintains its basic ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide).

[0065] As used herein, "CDR2 consisting essentially of the amino acid sequence GAS" refers to a CDR2 having 0 or 1 amino acid substitution within the GAS sequence, a CDR2 having 0, 1, 2, 3, 4 or 5 amino acid residues immediately preceding the GAS sequence, and / or a CDR2 having 0, 1, 2, 3, 4 or 5 amino acid residues immediately following the GAS sequence, provided that the CAR maintains its basic ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide).

[0066] As used herein, "CDR3 consisting essentially of the amino acid sequence set forth in SEQ ID NO: 10" is a CDR3 having 0, 1, or 2 amino acid substitutions within SEQ ID NO: 10, a CDR3 having 0, 1, 2, 3, 4, or 5 amino acid residues immediately preceding SEQ ID NO: 10, and / or a CAR3 having 0, 1, 2, 3, 4, or 5 amino acid residues immediately following SEQ ID NO: 10, provided that the CAR maintains its basic ability to bind to the TRAILshort polypeptide (e.g., human TRAILshort polypeptide).

[0067] When designing a single-chain antibody (e.g., scFv) having a heavy-chain variable domain and a light-chain variable domain, the two regions can be directly connected or connected using any suitable linker sequence. For example, the heavy-chain variable domain having the CDRs of SEQ ID NOs: 1-3 can be directly connected to the light-chain variable domain having the CDRs of SEQ ID NO: 9, the amino acid sequence GAS, and SEQ ID NO: 11 via a linker sequence. Examples of linker sequences that can be used to connect the heavy-chain variable domain and the light-chain variable domain to produce an scFv include, but are not limited to, (GGGGS) 3-5 (SEQ ID NOs: 47, 158, and 159, respectively). In some cases, for example, the linker that can be used to connect the heavy-chain variable domain and the light-chain variable domain to produce an scFv can have the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 47), which can be encoded by the nucleic acid sequence ggtggcggtggctcgggcggtggtgggtcgggtggcggcggatct (SEQ ID NO: 156).

[0068] As shown herein, the amino acid sequences described herein may include amino acid modifications (e.g., the number of amino acid modifications described). Such amino acid modifications can include, but are not limited to, amino acid substitutions, amino acid deletions, amino acid additions, and combinations thereof. In some cases, the amino acid modifications can be made to improve binding and / or contact with an antigen and / or to improve the functional activity of the CARs provided herein. In some cases, the amino acid substitutions within the described sequence identifiers can be conservative amino acid substitutions. For example, a conservative amino acid substitution can be made by substituting one amino acid residue with another amino acid residue having a similar side chain. Families of amino acid residues having similar side chains can include amino acids having basic side chains (e.g., lysine, arginine, histidine), amino acids having acidic side chains (e.g., aspartic acid, glutamic acid), amino acids having uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids having nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids having beta-branched side chains (e.g., threonine, valine, isoleucine), and amino acids having aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0069] In some cases, the amino acid substitutions within the recited sequence identifiers can be non-conservative amino acid substitutions. Non-conservative amino acid substitutions can be made by substituting one amino acid residue with another amino acid residue having a different side chain. Examples of non-conservative substitutions include, but are not limited to, (a) substituting a hydrophilic residue (e.g., serine or threonine) with a hydrophobic residue (e.g., leucine, isoleucine, phenylalanine, valine or alanine); (b) substituting cysteine or proline with another residue; (c) substituting a residue having a basic side chain (e.g., lysine, arginine or histidine) with a residue having an acidic side chain (e.g., aspartic acid or glutamic acid); and (d) substituting a residue having a bulky side chain (e.g., phenylalanine) with glycine or another residue having a small side chain.

[0070] Methods for generating amino acid sequence variants (e.g., amino acid sequences that include one or more modifications with respect to the recited sequence identifiers) can include site-directed mutagenesis or random mutagenesis (e.g., by PCR) of nucleic acids encoding the antibody or fragment thereof. See, e.g., Zoller, Curr. Opin. Biotechnol. 3:348-354 (1992). Both naturally occurring amino acids and non-naturally occurring amino acids (e.g., amino acids that are artificially derivatized) can be used to generate the amino acid sequence variants provided herein.

[0071] A representative number of antigen-binding domains having the ability to bind to a TRAILshort polypeptide (e.g., a human TRAILshort polypeptide) is further set forth in Table 1.

[0072]

Table 1

[0073] The CARs provided herein can be generated using any suitable method. For example, the CARs provided herein can be generated in recombinant host cells. For example, nucleic acids encoding the CARs provided herein can be constructed, introduced into an expression vector, and expressed in a suitable host cell. In some cases, the binding factors provided herein (e.g., antibodies, antigen-binding fragments, antibody domains, and / or CARs) can be recombinantly produced in a prokaryotic host, such as Escherichia coli, Bacillus brevis, Bacillus subtilis, Bacillus megaterium, Lactobacillus zeae / casei, or Lactobacillus paracasei.The binding agents (e.g., antibodies, antigen-binding fragments, antibody domains, and / or CARs) provided herein can also be recombinantly produced in eukaryotic hosts, such as eukaryotic hosts such as yeast (e.g., Pichia pastoris, Saccharomyces cerevisiae, Hansenula polymorpha, Schizosaccharomyces pombe, Schwanniomyces occidentalis, Kluyveromyces lactis, or Yarrowia lipolytica), filamentous fungi of the genus Trichoderma (e.g., T. reesei), and filamentous fungi of the genus Aspergillus (e.g., A. niger and A. oryzae), protozoa such as Leishmania tarentolae, insect cells, or mammalian cells (e.g., mammalian cell lines such as Chinese hamster ovary (CHO) cells, Per.C6 cells, mouse myeloma NS0 cells, baby hamster kidney (BHK) cells, or human embryonic kidney cell line HEK293). See, e.g., the reference of Frenzel et al., Front Immunol., Vol. 4: 217 (2013).

[0074] In some cases, the antigen-binding fragments or antibody domains provided herein can be made by proteolytic digestion of intact antibodies. For example, antigen-binding fragments can be obtained by treating an antibody with an enzyme, such as papain or pepsin. Papain digestion of whole antibodies can be used to generate F(ab)2 or Fab fragments, while pepsin digestion of whole antibodies can be used to generate F(ab')2 or Fab' fragments.

[0075] In some cases, the CARs provided herein can be substantially pure. As used herein with respect to a CAR, the term "substantially pure" refers to a CAR that is substantially free of other polypeptides, lipids, carbohydrates, and nucleic acids that are naturally associated therewith. Thus, a substantially pure CAR provided herein is any CAR that has been removed from its natural environment and is at least 60 percent pure. A substantially pure CAR provided herein can be at least about 65, 70, 75, 80, 85, 90, 95, or 99 percent pure.

[0076] This specification also provides nucleic acid molecules (e.g., isolated nucleic acid molecules) having nucleic acid sequences encoding at least a portion of the CARs provided herein. For example, an isolated nucleic acid molecule provided herein can include a nucleic acid sequence encoding a heavy chain variable domain, such as the heavy chain variable domain depicted in FIG. 3C. In another example, an isolated nucleic acid molecule provided herein can include a nucleic acid sequence encoding a light chain variable domain, such as the light chain variable domain depicted in FIG. 3C. In some cases, an isolated nucleic acid molecule provided herein includes a nucleic acid sequence encoding both (a) a heavy chain variable domain and (b) a light chain variable domain, which may or may not encode a linker polypeptide (e.g., (SGGGG) 3-5 ). The nucleic acids (e.g., isolated nucleic acid molecules) provided herein can be single-stranded or double-stranded nucleic acids of any suitable type (e.g., DNA, RNA, or DNA / RNA hybrid).

[0077] This specification also provides vectors (e.g., plasmid vectors or viral vectors) that contain one or more nucleic acids provided herein. Examples of plasmid vectors that can be designed to contain one or more nucleic acids having a nucleic acid sequence encoding at least a portion of the CAR provided herein include, but are not limited to, phagemids and viral vectors. Examples of viral vectors that can be designed to contain one or more nucleic acids having a nucleic acid sequence encoding at least a portion of the CAR provided herein include, but are not limited to, retroviral vectors, parvovirus-based vectors (e.g., adenovirus-based vectors and adeno-associated virus (AAV)-based vectors), lentiviral vectors (e.g., herpes simplex virus (HSV)-based vectors), poxvirus vectors (e.g., vaccinia virus-based vectors and fowlpox virus-based vectors), and hybrid or chimeric viral vectors. For example, a viral vector having an adenovirus backbone and having a lentiviral component such as those described elsewhere (Zheng et al., Nat. Biotech., Vol. 18(2): 176-180 (2000); International Publication No. WO98 / 22143; International Publication No. WO98 / 46778; and International Publication No. WO00 / 17376), or a viral vector having an adenovirus backbone and having an AAV component as described elsewhere (Fisher et al., Hum. Gene Ther., Vol. 7: 2079-2087 (1996)) can be designed to contain one or more nucleic acids having a nucleic acid sequence encoding at least a portion of the CAR provided herein.

[0078] Optionally, the vectors (e.g., plasmid vectors or viral vectors) provided herein can contain a nucleic acid sequence encoding the scFv or antibody binding domain provided herein. Optionally, the vectors (e.g., plasmid vectors or viral vectors) provided herein can contain a nucleic acid sequence encoding the CAR provided herein.

[0079] The vectors provided herein (e.g., the plasmid vectors or viral vectors provided herein) can include any suitable promoter and other regulatory sequences (e.g., start codons and stop codons for transcription and translation) operably linked to a nucleic acid sequence encoding at least a portion of the CAR provided herein. Optionally, the promoter used to drive expression can be a constitutive promoter or a regulatable promoter. Examples of regulatable promoters that can be used as described herein include, but are not limited to, inducible promoters, repressible promoters, and tissue-specific promoters. Examples of viral promoters that can be used as described herein include, but are not limited to, adenoviral promoters, vaccinia viral promoters, CMV promoters (e.g., immediate early type CMV promoters), and AAV promoters.

[0080] Any suitable method can be used to generate a nucleic acid molecule (or vector, e.g., a plasmid vector or viral vector) having a nucleic acid sequence encoding at least a portion of the CAR provided herein. For example, molecular cloning techniques can be used as described elsewhere (e.g., see Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, NY (1989); and Ausubel et al., Current Protocols in Molecular Biology, Green Publishing Associates and John Wiley & Sons, New York, N.Y. (1994)) to generate a nucleic acid molecule (or vector, e.g., a plasmid vector or viral vector) having a nucleic acid sequence encoding at least a portion of the CAR provided herein.

[0081] This specification also provides host cells comprising a nucleic acid provided herein (e.g., a nucleic acid having a nucleic acid sequence encoding at least a portion of a CAR). Host cells that can be designed to comprise one or more nucleic acids provided herein can be prokaryotic or eukaryotic cells. Examples of prokaryotic cells that can be designed to comprise a nucleic acid provided herein include, but are not limited to, Escherichia coli (e.g., Tb-1, TG-1, DH5α, XL-Blue MRF (Stratagene), SA2821 or Y1090 cells), Bacillus subtilis, Salmonella typhimurium, Serratia marcescens or Pseudomonas (e.g., Pseudomonas aeruginosa) cells. Examples of eukaryotic cells that can be designed to comprise a nucleic acid provided herein include, but are not limited to, insect cells (e.g., Sf9 cells or Ea4 cells), yeast cells (e.g., S. cerevisiae cells) and mammalian cells (e.g., mouse, rat, hamster, monkey or human cells). For example, VERO cells, HeLa cells, 3T3 cells, Chinese hamster ovary (CHO) cells, W138 BHK cells, COS-7 cells and MDCK cells can be designed to comprise a nucleic acid provided herein. Any suitable method can be used to introduce one or more nucleic acids provided herein (e.g., a vector having a nucleic acid sequence encoding at least a portion of a binding factor provided herein, e.g., a plasmid vector or a viral vector) into a host cell.For example, the nucleic acids provided herein can be introduced into a host cell using calcium chloride-mediated transformation, transduction, conjugation, triparental mating, DEAE, dextran-mediated transfection, infection, membrane fusion by liposomes, high-velocity bombardment by DNA-coated microprojectiles, direct microinjection into single cells, electroporation, or combinations thereof (see, e.g., Sambrook et al., Molecular Biology: A Laboratory Manual, Cold Spring Harbor Laboratory, NY (1989); Davis et al., Basic Methods in Molecular Biology (1986); and Neumann et al., EMBO J., Vol. 1:841 (1982)).

[0082] In some cases, cells, such as T cells, stem cells (e.g., induced pluripotent stem cells or mesenchymal stem cells) or NK cells, can be engineered to express one or more nucleic acids encoding the CARs described herein. In some cases, at least 50 percent, at least 75 percent, at least 95 percent, at least 99 percent or 100 percent of the cells express one or more CARs. For example, a T cell population can be infected with a viral vector engineered to express a nucleic acid encoding a CAR described herein (e.g., a CAR having the ability to bind to a TRAILshort polypeptide).In some embodiments, the T cell population can also be designed to express a CAR that has the ability to bind to any one of a second CAR, such as a human CD19 polypeptide, a human BCMA polypeptide, a human TSHR polypeptide, a human EPHA3 polypeptide, a human FGFR2 polypeptide, a human HER2 polypeptide, a human TROP2 polypeptide, a human NY-ESO polypeptide, a human mesothelin polypeptide, a human EGFR polypeptide, a human EGFRviii polypeptide, a human IL13Ra2 polypeptide, a human folate receptor alpha polypeptide, a human folate receptor beta polypeptide, a human gut integrin (e.g., ITGB7) polypeptide, a human CD103 polypeptide, a human CD83 polypeptide, a human CD22 polypeptide, a human CD20 polypeptide, a human CD79b polypeptide, a human CD79a polypeptide, a human CD123 polypeptide, a human CD33 polypeptide, a human ILR1a polypeptide, a human CD34 polypeptide, a human CD30 polypeptide, a human CD4 polypeptide, a human CD8 polypeptide, a human T cell receptor alpha polypeptide, a human T cell receptor beta polypeptide, a human CD3 polypeptide, a human CD5 polypeptide, a human CD7 polypeptide, a human gp120 polypeptide, a human galactomannan polypeptide, a human PSMA polypeptide, a human MUC polypeptide, a human PD-1 polypeptide, a human CD80 polypeptide, a human CD86 polypeptide, a human CEA polypeptide, a human GPC3 polypeptide, a human ROR1 polypeptide, a human AFP polypeptide, a human CD138 polypeptide, a human CD38 polypeptide, a human CD44v6 polypeptide, a human CD70 polypeptide, a human CLEC12A (CLL-1) polypeptide, a human CS-1 polypeptide, a human FAP polypeptide, a human GPRC5D polypeptide, a human MUC-1 polypeptide, a human MUC16 polypeptide, a human NKG2D polypeptide or another target that complements TRAILshort activity. For example, a CAR having the ability to bind to a human CD19 polypeptide can include an antigen-binding domain, a hinge, a transmembrane domain, and one or more signaling domains. The antigen-binding domain of such a CAR can include the CDRs of FMC63 or 4G7 scFv.In some cases, such antigen-binding domains of CARs may include FMC63 or 4G7 scFv. See, for example, Kang et al., Int. J. Mol. Sci., Vol. 21(23):9163 (2020) and U.S. Patent No. 9,499,629. For the amino acid sequence of FMC63 scFv and the nucleic acid sequence encoding the scFv, see also Figure 2. The hinge of the second CAR may be the hinge described in Figure 7A, the transmembrane domain of the second CAR may be the transmembrane domain described in Figure 7C, and one or more signaling domains of the second CAR may be selected from the group of signaling domains described in Figure 7D. For example, a CAR having the ability to bind to a human CD19 polypeptide may include a CD8α leader, a CD8α hinge, a CD8α transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3ζ intracellular signaling domain.

[0083] Examples of scFv sequences and other binding sequences that can be used to design CARs against specific tumor antigens include, but are not limited to, those described in Table 2.

[0084]

Table 2-1

Table 2-2

Table 2-3

Table 2-4

Table 2-5

[0085] In some cases, an antibody (e.g., an scFv antibody) that binds to an antigen described herein (e.g., an antigen described in Table 2 such as CD19) can be designed to include the CDRs of a specific antibody described herein (e.g., the CDRs of FMC63 scFv). For example, an scFv antibody can be designed to include the CDRs of FMC63 scFv (e.g., CDR1, CDR2, and CDR3 of the heavy chain region, and CDR1, CDR2, and CDR3 of the light chain region) that have the same framework region as FMC63 scFv or a different framework region, provided that the designed scFv antibody retains the ability to bind to the CD19 antigen. In some cases, an scFv antibody can be designed to include the CDRs of an antibody (e.g., an scFv described in Table 2) whose framework region is a human framework region (e.g., CDR1, CDR2, and CDR3 of the heavy chain region, and CDR1, CDR2, and CDR3 of the light chain region), provided that the designed scFv antibody retains the ability to bind to its antigen.

[0086] In some cases, a nucleic acid provided herein (e.g., a nucleic acid encoding a CAR provided herein), a vector provided herein (e.g., a viral vector designed to express a CAR provided herein), and / or a host cell provided herein (e.g., a host cell designed to express a CAR provided herein) can be formulated as a composition for administration to a mammal (e.g., a human) having cancer (e.g., TRAILshort + cancer) or a mammal (e.g., a human) having an infectious disease to treat the mammal. In some cases, a nucleic acid provided herein (e.g., a nucleic acid encoding a CAR provided herein), a vector provided herein (e.g., a viral vector designed to express a CAR provided herein), and / or a host cell provided herein (e.g., a host cell designed to express one or more CARs provided herein) can be used to reduce the number of cancer cells or infected cells in a mammal and / or to treat cancer (e.g., TRAILshort +It can be formulated as a pharmaceutical composition for administration to a mammal (e.g., a human) to increase the survival of a mammal suffering from cancer. Optionally, the pharmaceutical composition provided herein can include a pharmaceutically acceptable carrier, such as a buffer, salt, surfactant, sugar, osmotic modifier, or a combination thereof, as described elsewhere (Gervasi et al., Eur. J. Pharmaceutics and Biopharmaceutics, Volume 131: pages 8 - 24 (2018)). Examples of pharmaceutically acceptable carriers that can be used to prepare the pharmaceutical composition provided herein include, but are not limited to, water, lactic acid, citric acid, sodium chloride, sodium citrate, sodium succinate, sodium phosphate, surfactants (e.g., polysorbate 20, polysorbate 80, or poloxamer 188), dextran 40, or sugars (e.g., sorbitol, mannitol, sucrose, dextrose, or trehalose), or a combination thereof. For example, a pharmaceutical composition designed to include the CAR provided herein (or the nucleic acid, vector, or host cell provided herein) can be formulated to include a buffer (e.g., acetate buffer, citrate buffer, histidine buffer, succinate buffer, phosphate buffer, or hydroxymethylaminomethane (Tris) buffer), a surfactant (e.g., polysorbate 20, polysorbate 80, or poloxamer 188), and a sugar, such as sucrose. Other components that can be included within the pharmaceutical composition provided herein include, but are not limited to, amino acids, such as glycine or arginine, antioxidants, such as ascorbic acid, methionine, or ethylenediaminetetraacetic acid (EDTA), pro - apoptotic agents, such as Bcl - 2 inhibitors (e.g., obatoclax, navitoclax, venetoclax, ABT - 737, S55746, subtoclax, or a combination thereof), IAP inhibitors (e.g., AT - 406, GDC - 0917, LCL - 161, GDC - 0152, birinapant, HGS1029, TWX024, AEG35156, or a combination thereof), or MDM2 inhibitors (e.g., nutlin, ATSP - 7041, smac mimetic, MCL - 1 inhibitor, Bclxl inhibitor, or a combination thereof).For example, the pharmaceutical composition provided herein can be formulated to include one or more pro-apoptotic compounds, such as Bcl-2 inhibitors (e.g., venetoclax, navitoclax, obatoclax ABT-737, S55746, or subtoclax), in combination with one or more cells designed to express a CAR having the ability to bind to the TRAILshort polypeptide provided herein.

[0087] Optionally, when the pharmaceutical composition is formulated to include one or more cells designed to express a CAR having the ability to bind to the TRAILshort polypeptide provided herein, any suitable concentration of the binding factor can be used. For example, the pharmaceutical composition provided herein can contain from about 1 mg to about 500 mg per mL (e.g., about 1 mg to about 500 mg, about 10 mg to about 500 mg, about 50 mg to about 500 mg, about 100 mg to about 500 mg, about 0.5 mg to about 250 mg, about 0.5 mg to about 150 mg, about 0.5 mg to about 100 mg, about 0.5 mg to about 50 mg, about 1 mg to about 300 mg, about 2 mg to about 200 mg, about 10 mg to about 300 mg, about 25 mg to about 300 mg, about 50 mg to about 150 mg, or about 150 mg to about 300 mg) of the CAR provided herein +It can be formulated into a liquid containing a cell population. Optionally, when the pharmaceutical composition is formulated to contain one or more nucleic acids (e.g., vectors, e.g., viral vectors) encoding at least a portion of the CARs provided herein, any suitable concentration of the nucleic acid can be used. For example, the pharmaceutical compositions provided herein can be formulated into a liquid containing from about 0.5 mg to about 500 mg (e.g., from about 1 mg to about 500 mg, from about 10 mg to about 500 mg, from about 50 mg to about 500 mg, from about 100 mg to about 500 mg, from about 0.5 mg to about 250 mg, from about 0.5 mg to about 150 mg, from about 0.5 mg to about 100 mg, from about 0.5 mg to about 50 mg, from about 1 mg to about 300 mg, from about 2 mg to about 200 mg, from about 10 mg to about 300 mg, from about 25 mg to about 300 mg, from about 50 mg to about 150 mg, or from about 150 mg to about 300 mg) of the nucleic acids provided herein per mL. In another example, the pharmaceutical compositions provided herein can be formulated into a solid or semi-solid containing from about 0.5 mg to about 500 mg (e.g., from about 1 mg to about 500 mg, from about 10 mg to about 500 mg, from about 50 mg to about 500 mg, from about 100 mg to about 500 mg, from about 0.5 mg to about 250 mg, from about 0.5 mg to about 150 mg, from about 0.5 mg to about 100 mg, from about 0.5 mg to about 50 mg, from about 1 mg to about 300 mg, from about 10 mg to about 300 mg, from about 25 mg to about 300 mg, from about 50 mg to about 150 mg, or from about 150 mg to about 300 mg) of the nucleic acids provided herein.

[0088] The pharmaceutical compositions provided herein can be in any suitable form. For example, the pharmaceutical compositions provided herein can be designed to be liquid, semi-solid or solid. Optionally, the pharmaceutical compositions provided herein can be a liquid solution (e.g., an injectable and / or infusible solution), dispersion, suspension, tablet, pill, powder, microemulsion, liposome or suppository. Optionally, the pharmaceutical compositions provided herein can be lyophilized.

[0089] This specification also provides one or more nucleic acids, vectors or host cells provided herein (e.g., CAR +Provided is a method of administering a composition (e.g., a pharmaceutical composition provided herein) comprising cells (e.g., CAR cells) to a mammal (e.g., a human). For example, one or more nucleic acids, vectors, and / or host cells (e.g., CAR cells) provided herein + A composition (e.g., a pharmaceutical composition provided herein) comprising cells (e.g., CAR cells) can be administered to a mammal (e.g., a human) having TRAILshort+ cancer to treat the mammal, or to a mammal (e.g., a human) having an infectious disease (e.g., a bacterial or viral infection) to treat the mammal. In some cases, for example, one or more nucleic acids, vectors, and / or host cells (CAR cells) provided herein + A composition (e.g., a pharmaceutical composition provided herein) comprising cells (e.g., CAR cells) can be administered to a mammal (e.g., a human) to reduce the number of cancer cells or infected cells in the mammal and / or increase the survival of a mammal suffering from cancer.

[0090] Any suitable cancer can be treated using a composition (e.g., a pharmaceutical composition provided herein) comprising one or more nucleic acids, vectors, or host cells (e.g., CAR cells). For example, a mammal (e.g., a human) having TRAILshort + cancer can be treated by administering the composition (e.g., a pharmaceutical composition) provided herein to the mammal. Examples of cancers that can be treated as described herein include, but are not limited to, TRAILshort + squamous cell carcinoma, lymphoma, cervical cancer, renal cell carcinoma, breast cancer, prostate cancer, ovarian cancer, lung cancer, bladder cancer, head and neck cancer, uterine cancer, esophageal cancer, gastric cancer, colorectal cancer, sarcoma, and pancreatic cancer. For example, a mammal having TRAILshort + cancer can be administered the composition (e.g., a pharmaceutical composition) provided herein to treat the mammal (e.g., reduce the number of cancer cells in the mammal). + For example, a mammal having TRAILshort cancer can be administered the composition (e.g., a pharmaceutical composition) provided herein to treat the mammal (e.g., reduce the number of cancer cells in the mammal).

[0091] When treating an infectious disease as described herein, the infectious disease can be, for example, a chronic infectious disease and / or a viral infectious disease. Examples of infectious diseases that can be treated as described herein include, but are not limited to, HIV, SIV, endogenous retrovirus, anellovirus, circovirus, human herpesvirus, varicella-zoster virus, cytomegalovirus, Epstein-Barr virus, polyomavirus, adeno-associated virus, herpes simplex virus, adenovirus, hepatitis B virus, hepatitis C virus, hepatitis D virus, GB virus C, papillomavirus, human T cell leukemia virus, xenotropic murine leukemia virus-related virus, polyomavirus, rubella virus, parvovirus, measles virus, and coxsackievirus infections. In some cases, the infectious disease treated as described herein can be an HIV infection.

[0092] Any suitable method can be used to administer the compositions provided herein (e.g., pharmaceutical compositions) to a mammal (e.g., a human). For example, the compositions provided herein can be administered to a mammal (e.g., a human) intravenously (e.g., via intravenous injection or infusion), subcutaneously (e.g., via subcutaneous injection), intraperitoneally (e.g., via intraperitoneal injection), orally, via inhalation, or intramuscularly (e.g., via intramuscular injection), depending on the components of the composition. In some cases, the route of administration and / or mode of administration of the composition (e.g., the pharmaceutical composition provided herein) can be adjusted according to the mammal being treated.

[0093] In some cases, an effective amount of a composition (e.g., a pharmaceutical composition provided herein) comprising one or more nucleic acids, vectors, or host cells (e.g., CAR + cells) can be an amount that reduces the number of cancer cells or infected cells in a mammal without causing significant toxicity in the mammal. In some cases, one or more nucleic acids, vectors, or host cells (e.g., CAR +An effective amount of a composition (e.g., a pharmaceutical composition provided herein) comprising cells can be an amount that increases the survival time of a mammal having cancer as compared to a control mammal having the same cancer and not treated with the composition. In some cases, for example, an effective amount of the composition can be from about 1×10 6 to about 1×10 10 CAR T cells (e.g., from about 1×10 6 to about 1×10 7 , from about 1×10 7 to about 1×10 8 , from about 1×10 8 to about 1×10 9 , from about 1×10 9 to about 1×10 10 , from about 1×10 7 to about 1×10 9 or from about 1.5×10 7 to about 1.15×10 9 CAR T cells). The effective amount can remain constant or can be adjusted as a sliding scale or variable dosage depending on the response of the mammal to the treatment. Various factors can affect the actual effective amount used for a particular application. For example, the severity of the cancer or the severity of the infection in treating a mammal having cancer, the route of administration, the age and general health of the mammal, the use of excipients, the possibility of concurrent use of other therapeutic and prophylactic treatments, e.g., the use of other agents (e.g., Bcl-2 inhibitors, IAP inhibitors or MDM2 inhibitors), and the judgment of the treating physician may require an increase or decrease in the actual effective amount of the composition (e.g., a pharmaceutical composition comprising one or more nucleic acids, vectors or CAR + host cells provided herein) to be administered.

[0094] In some cases, one or more nucleic acids, vectors or host cells provided herein (e.g., CAR +The effective frequency of administration of a composition (e.g., a pharmaceutical composition provided herein) comprising (e.g., CAR + The effective frequency of administration of a composition (e.g., a pharmaceutical composition provided herein) comprising cells can be a frequency that increases the survival time of a mammal having cancer compared to a control mammal having the same cancer and not treated with the composition without causing significant toxicity to the mammal or can be a frequency that decreases the number of infected cells in the mammal without causing significant toxicity. Typically, TRAILshort CART cells can be administered once, but in some cases, repeated administrations / doses can be used to achieve a deep response. For example, the effective frequency of administration of a pharmaceutical composition provided herein can be from about twice a day to once a year (e.g., from about twice a day to once a month, from about twice a day to once a week, from about once a day to once a month, or from about once a day to once a week). In some cases, the frequency of administration of a pharmaceutical composition provided herein can be daily. The frequency of administration of a pharmaceutical composition provided herein can be constant or variable during the treatment period. Various factors can affect the actual effective frequency used for a particular application. For example, the severity of the cancer or infection, the route of administration, the age and general health of the mammal, the use of excipients, the possibility of combination with other therapeutic or prophylactic treatments such as the use of other agents (e.g., Bcl-2 inhibitors, IAP inhibitors or MDM2 inhibitors), and the judgment of the treating physician may require an increase or decrease in the actual effective frequency of administration of the composition provided herein.

[0095] In some cases, one or more nucleic acids, vectors or host cells (e.g., CAR + The effective period of administration of a composition (e.g., a pharmaceutical composition provided herein) containing cells can be a period that reduces the number of cancer cells or infected cells in the mammal without causing significant toxicity to the mammal. In some cases, one or more nucleic acids, vectors or host cells (e.g., CAR+ The effective period of administration of a composition (e.g., the pharmaceutical composition provided herein) containing cells can be the period that increases the survival time of a mammal having cancer as compared to a control mammal having the same cancer and not treated with the composition. For example, the effective period of administration of the pharmaceutical composition provided herein can vary from a single time point of administration to several weeks to several months (e.g., 4 - 12 weeks). Multiple factors can affect the actual effective period used for a particular application. For example, the severity of cancer or infection, the route of administration, the age and general health of the mammal, the use of excipients, the possibility of combination with other therapeutic or prophylactic treatments such as the use of other agents (e.g., Bcl - 2 inhibitor, IAP inhibitor or MDM2 inhibitor), and the judgment of the treating physician may require an increase or decrease in the actual effective period of administration of the composition provided herein.

[0096] The present invention will be further illustrated by the following examples, which do not limit the scope of the invention described in the claims.

[0097] [Examples] [Example 1] Humanization of the anti - TRAILshort antibody The production of a TRAILshort antibody specific for 11 C - terminal amino acids (SEQ ID NO: 35; Figure 1) unique to TRAILshort is described, for example, in Schnepple et al., J Biol Chem 286:35742 - 35754, 2011. The mouse monoclonal antibody TRAIL 2.2 was humanized to produce antibody Ab866. See, for example, US Patent Application Publication No. 20190367626. Figure 3A contains the amino acid sequences of the mouse and humanized anti - TRAILshort heavy chains.

[0098] [Example 2] TRAILshort chimeric antigen receptor (TsCAR) from a binding factor having the ability to bind to the human TRAILshort polypeptide The TRAILshort CAR was made using the following combination: (1) TRAILshort scFv (L2H)-CD8 hinge and TM domain-41BB-CD3z signaling domain (2) TRAILshort scFv (H2L)-CD8 hinge and TM domain-41BB-CD3z signaling domain (3) TRAILshort scFv (L2H)-CD28 hinge and TM domain-CD28-CD3z signaling domain (4) TRAILshort scFv (H2L)-CD28 hinge and TM domain-CD28-CD3z signaling domain

[0099] Figure 4 shows the nucleic acid sequences encoding ScFv with HC3 and LC2, as well as the codon-optimized nucleic acid sequences encoding HC3 and LC2. Figure 5 shows the nucleic acid sequences encoding ScFv with LC2 and HC2, as well as the codon-optimized nucleic acid sequences encoding HC3 and LC2. A schematic diagram of the TRAILshort CAR used in the following examples is shown in Figure 7B.

[0100] [Example 3] TsCAR T cells do not have any T cell cytotoxicity Since it is known that some subsets of T cells express TRAIL, experiments were designed to determine whether TsCAR T cells target CD4 T cells, CD8 T cells, or total T cells. See Table 3 for details of the experimental design. The following types of cells were used in the experiments: UTD: Non-transduced T cells that are treated the same as TsCAR T cells but are not transduced with virus particles expressing CAR. K161: These are TsCAR T cells that express the TsCAR shown in Figure 7B. The CAR construct was designed and cloned into a lentiviral expression vector. The expression vector was co-transfected into 293T cells together with a packaging plasmid and an envelope plasmid. Virus particles were concentrated in the medium of the transfected 293T cells. Target: T cells from the same donor cultured alone. MUTD / M K161: These are TsCAR T cells cultured alone as negative controls (no proliferation is expected). PI UTD / PI K161: These are TsCAR T cells cultured with PMA / ionomycin (chemicals that activate T cells) as positive controls (strong activation is expected).

[0101] In this experiment, K161 cells or UTD cells were co-cultured with T cells (target cells) from the same donor at the ratios shown in Table 3. The T cells were pre-stained with CFSE dye. The numbers of TsCAR T cells, total T cells, CD4 + cells and CD8 + cells were monitored for 3 days, and the cell numbers were determined using flow cytometry and counting beads. As shown in Figure 8, when TsCAR T cells targeted any of the T cell populations, the number of target cells became significantly lower in the TsCAR T cell-T cell co-culture. Therefore, TsCAR T cells do not target total T cells (upper left panel of Figure 8), CD4 + cells (upper right panel of Figure 8) or CD8 + T cells (lower left panel of Figure 8). The results in Figure 8 were after 24 hours. Similar results were observed after 48 hours and 72 hours.

[0102] The experiment was repeated, and CAR T / UTD cells, total T cells, CD4 + T cells and CD8 + T cells were counted using counting beads with flow cytometry. If TsCAR T cells actively targeted any of the target cells, an increase in the number of TsCAR T cells compared to UTD cells was expected, and as a result of the targeting of TsCAR T cells, a decreased number of target cells was expected in the TsCAR T cell-target T cell co-culture. However, as shown in Figure 9, these results were not observed. Therefore, this experiment also demonstrated that TsCAR T cells do not target T cells. The results in Figure 9 were after 24 hours. Similar results were observed after 48 hours and 72 hours.

[0103] [Example 4] Cytotoxicity of TsCAR T cells against various cell lines Target cells expressing the luciferase gene (cells listed as cell lines in Table 4) were prepared. The target cells were co-cultured with either TsCAR T cells or UTD cells at various E:T ratios (E: effector cells = UTD cells or TsCAR T cells; T: target cells = tumor cell lines). Luciferin (luciferase target) was added to each well, and the signal generated by luciferase was measured. The target cells cultured by themselves were set as 100%, and the signal difference between each well was calculated as the killing percentage. In the case of TsCAR T cell-specific tumor cell killing, the signal from the co-culture of TsCAR T cells - tumor cell lines can be lower than that of UTD, and thus, the killing percentage can be higher in the co-culture of TsCAR T cells - tumor cells.

[0104] In the cytotoxicity assay, the ARG77, BCWM, Je-Ko1, and Jurkat cell lines were co-cultured with either UTD or TsCAR T cells at varying E:T ratios (shown in Figure 10). Compared to the UTD co-culture, higher killing percentages were observed in the co-culture wells of TsCAR T cells, indicating TsCAR-specific killing in these cells. See Figure 10.

[0105] To test whether TsCAR T cell killing is specific to the TRAILshort isoform, wild-type HeLa cells and HeLa cells with TRAIL knockout (KO) were used. As shown in Figure 11, TsCAR T cells showed cytotoxicity against wild-type HeLa cells expressing TRAILshort, especially at higher E:T ratios. However, since HeLa KO cells were not targeted by TsCAR T cells, the specificity of TsCAR T cells was demonstrated. TsCAR T cells were also not effective against the HBL1, RPM18226, MCF7, BXPC3, or L3.6 cell lines.

[0106] [Table 3]

[0107]

Table 4

[0108] [Example 5] Efficacy of Dual TsCAR / CAR19 T Cells In this experiment, T cells were transduced with viral particles expressing both CD19 CAR and TsCAR. Figure 7B includes a schematic diagram of both CARs. As controls, UTD, TsCAR T cells, and CD19 CAR T cells were also generated. Cancer cell lines (ARH77, BCWM, HeLa, HeLa TKO, or JeKo-1) were co-cultured with UTD, TsCAR T cells, CD19 CAR T cells, and dual CAR T cells in a cytotoxicity assay. All cell lines tested were TRAIL positive, but they showed different behaviors when co-cultured with CAR T cells. As shown in Figure 12, T cells expressing both CARs showed cytotoxicity against ARH88 and JeKo-1 cell lines in vitro. Dual CAR T cells were as effective as CD19 CAR T cells in ARH77 and JeKo-1 cell lines.

[0109] The proliferation assay was performed by co - culturing target cancer cell lines (HeLa, HeLa TKO, ARH77, BCWM or JeKo) at a 1:1 E:T ratio with either UTD T cells or TsCAR T cells, or dual CAR T cells. UTD T cells and TsCAR T cells were cultured alone (media negative control) which was expected not to proliferate. PI (PMA / ionomycin) activates T cells and serves as a positive control. The cancer cell lines and CAR T cells were co - cultured for 5 days, and the number of CAR T cells or UTD cells was determined by using flow cytometry with counting beads. CAR T cell activity was shown to correlate with the number of CAR T cells. The proliferation of dual CAR T cells was comparable to that of CD19 CAR T cells, indicating an effective proliferation activity of dual CAR T cells. See Figure 13.

[0110] Four groups (n = 5 mice per group) of NSG mice were generated. In each mouse, 1M luciferase + JeKo - 1 cell line was transplanted, and then 2 weeks later, each group of mice was transplanted with either 1M UTD, CD19 CAR T cells, TsCAR T cells or dual CAR T cells. Mice were injected with luciferin, and the tumor burden was regularly monitored by measuring the luciferase signal intensity. As shown in Figure 14, the mice transplanted with dual CAR T cells had a lower tumor burden compared to the other groups. CAR T cell counting was performed by bleeding from the tails of the mice. Briefly, red blood cells were lysed from the collected blood, and T cells were counted by using flow cytometry. The survival curves are also shown in Figure 14.

[0111] [Example 6] Combination of TsCAR T cells and Bcl - 2 inhibitor TsCAR T cells in combination with navitoclax (a BCL-2 inhibitor) resulted in decreased CAR T cell proliferation against the JeKo-1 cell line, but combination with venetoclax (a BCL-2 inhibitor) did not result in decreased proliferation. See Figure 15. In Figure 15, D1 refers to donor 1 and D2 refers to donor 2. In the results shown in Figure 15, UTD cells, CD19 CAR T cells (two different CD19 CARS - CAR19 4-1BB and CAR19 CD28 expressing the FDA-approved CAR19 construct used clinically to treat ALL (CAR19 4-1BB) and DLBCL (both CARS); the main difference between these is the 4-1BB or CD28 co-stimulatory domain), or TsCAR T cells were cultured as follows: (i) alone (M in Figure 15) as a negative control where no proliferation was expected, (ii) in the presence of PI (PMA / ionomycin) as a positive control where proliferation was expected, (iii) co-cultured with the JeKo-1 cell line (JeKo-1 in Figure 15), (iv) co-cultured with JeKo-1 cells in the presence of navitoclax (JeKo-1 Navi in Figure 15), or (v) co-cultured with the JeKo-1 cell line in the presence of venetoclax (JeKo-1 Vene in Figure 15). Overall, the number of TsCAR T cells decreased in JeKo-1 Navi compared to JeKo-1, but the number of TsCAR T cells in JeKo-1 Vene did not decrease compared to JeKo-1 TsCAR T cells, indicating the safety of combining CAR T cells with venetoclax. As shown in Figure 16, combination therapies of venetoclax and navitoclax with TsCAR T cells both resulted in increased cytotoxicity when these two drugs were added to the TsCAR T cell-JeKo-1 co-culture. Since increased cytotoxicity was also seen with CAR19 CART cells along with TsCAR T cells, the results were not specific to Ts CART cells.

[0112] When TsCAR T cells were co-cultured with JeKo-1, cytotoxicity of TsCAR T cells was increased, but not when co-cultured with Jurkat, MCF7, ARH77, Hela or HeLa Trail KO cell lines, in combination with Navitoclax treatment.

[0113] [Example 7] TsCAR T cells reduce JeKo-1 cell growth in a mouse xenograft model NSG mice with luciferase + Mantle cell lymphoma JeKo-1 cells (1×10 6 or 5×10 6 cells i.v.; Figure 17A) were transplanted. Two weeks after transplantation, the mice were subjected to bioluminescence imaging to confirm the transplantation, and then TRAILshort CART cells (1×10 6 cells or 5×10 6 cells i.v.) or control UTD cells (1×10 6 cells or 5×10 6Cells (i.v.) were randomly assigned. Mice were continuously subjected to bioluminescence imaging, and survival rates were also monitored. Bioluminescence after luciferin injection into mice transplanted with 1M UTD cells or CARTS1 cells was plotted against time in Figure 17B (n = 10 mice / group). Survival rates are shown in Figure 17C; all mice died between day 18 and day 25. Bioluminescence of UTD mice and CARTS1 mice transplanted with 5M UTD cells or CARTS1 cells was plotted in Figure 17D. Tumor burden in CARTS1 mice significantly decreased from day 16. Survival rates are shown in Figure 17E; CARTS1 (5M) mice showed an increase in survival rate compared to UTD (5M) mice. CARTS1 mice still had a low tumor burden when sacrificed on day 55 due to GVHD, an endpoint expected since human T cell-derived CART cells were transplanted into the mice. The number of CART cells in peripheral blood samples collected from mice on day 21 was plotted in Figure 17F. CARTS1 (5M) mice had a significantly higher number of CART cells than the UTD control. No T cells were detected (not shown) in UTD (1M), CARTS (1M), or UTD (5M) mice that survived until day 21. Collectively, these in vivo studies demonstrated that treatment with TRAILshort CART cells resulted in complete remission and extended survival of JeKo-1 xenografts and increased T cell proliferation in peripheral blood 21 days after CART treatment.

[0114] Other embodiments The invention has been described in conjunction with its detailed description, but it should be understood that the foregoing description is intended to illustrate, not limit, the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are included in the following claims.

Claims

**Claim 1** A chimeric antigen receptor comprising an antigen-binding domain, a hinge, a transmembrane domain, and one or more signaling domains, wherein the antigen-binding domain is the amino acid sequence set forth in SEQ ID NO: 1 (or SEQ ID NO: 1 with an addition, deletion, or substitution of 1, 2, or 3 amino acids), the amino acid sequence set forth in SEQ ID NO: 2 (or SEQ ID NO: 2 with an addition, deletion, or substitution of 1, 2, or 3 amino acids), and the amino acid sequence set forth in SEQ ID NO: 3 (or SEQ ID NO: 3 with an addition, deletion, or substitution of 1 amino acid), a heavy chain variable domain or region comprising the amino acid sequence set forth in SEQ ID NO: 9 (or SEQ ID NO: 9 with an addition, deletion, or substitution of 1, 2, or 3 amino acids), the amino acid sequence Gly-Ala-Ser (GAS) (or the amino acid sequence GAS with an addition, deletion, or substitution of 1 amino acid), and the amino acid sequence set forth in SEQ ID NO: 10 (or SEQ ID NO: 10 with an addition, deletion, or substitution of 1, 2, or 3 amino acids), a light chain variable domain or region comprising A chimeric antigen receptor comprising the same. **Claim 2** The chimeric antigen receptor according to claim 1, wherein the antigen-binding domain comprises the ability to bind to a human TRAILshort polypeptide. **Claim 3** The chimeric antigen receptor according to claim 2, wherein the human TRAILshort polypeptide comprises the amino acid sequence set forth in SEQ ID NO:

35. **Claim 4** The chimeric antigen receptor according to claim 1, wherein the antigen-binding domain comprises the ability to bind to the amino acid sequence set forth in SEQ ID NO:

35. **Claim 5** The chimeric antigen receptor according to claim 1, wherein the antigen-binding domain comprises an scFv. **Claim 6** The chimeric antigen receptor according to any one of claims 1 to 5, wherein the heavy chain variable domain or region comprises an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO:

8. **Claim 7** The chimeric antigen receptor according to any one of claims 1 to 6, wherein the light chain variable domain or region comprises an amino acid sequence having at least 90% identity with the amino acid sequence set forth in SEQ ID NO:

15. **Claim 8** The chimeric antigen receptor according to any one of claims 1 to 5, wherein the hinge comprises a CD8 hinge or a CD28 hinge. **Claim 9** The chimeric antigen receptor according to any one of claims 1 to 7, wherein the hinge comprises the hinge described in FIG. 7A. **Claim 10** The chimeric antigen receptor according to any one of claims 1 to 9, wherein the transmembrane domain comprises a CD8 transmembrane domain or a CD28 transmembrane domain.

11. The chimeric antigen receptor according to any one of claims 1 to 9, wherein the transmembrane domain comprises the transmembrane domain described in FIG. 7C.

12. The chimeric antigen receptor according to any one of claims 1 to 11, wherein the one or more signaling domains comprise one or more of a 4-1BB intracellular signaling domain, a CD28 intracellular signaling domain, or a CD3ζ intracellular signaling domain.

13. The chimeric antigen receptor according to any one of claims 1 to 12, wherein the one or more signaling domains are selected from the group of signaling domains described in FIG. 7D.

14. The chimeric antigen receptor according to claim 13, wherein the hinge comprises the CD8 hinge, the transmembrane domain comprises the CD8 transmembrane domain, and the one or more signaling domains comprise the 4-1BB intracellular signaling domain and the CD3ζ intracellular signaling domain.

15. An isolated population of cells, wherein at least one cell of the population comprises a nucleic acid encoding the chimeric antigen receptor according to any one of claims 1 to 14.

16. The population according to claim 15, wherein the at least one cell expresses the nucleic acid and comprises the chimeric antigen receptor on the cell surface.

17. An isolated population of cells, wherein at least one cell of the population comprises a nucleic acid encoding a first chimeric antigen receptor and a nucleic acid encoding a second chimeric antigen receptor, and the first chimeric antigen receptor is the chimeric antigen receptor according to any one of claims 1 to 14.

18. The population according to claim 17, wherein the at least one cell expresses the nucleic acid encoding the first chimeric antigen receptor and comprises the first chimeric antigen receptor on the cell surface.

19. The population according to claim 17 or claim 18, wherein the at least one cell expresses the nucleic acid encoding the second chimeric antigen receptor and comprises the second chimeric antigen receptor on the cell surface.

20. The population according to any one of claims 17 to 19, wherein the second chimeric antigen receptor comprises an antigen-binding domain, a hinge, a transmembrane domain, and one or more signaling domains.

21. The second chimeric antigen receptor includes the CDRs of the FMC63 scFv antibody, binds to the CD19 antigen, includes the CDRs of the MOR208 scFv antibody, binds to the CD19 antigen, includes the CDRs of the humanized scFv antibody, binds to the CD19 antigen, includes the CDRs of the 4G7 scFv antibody, binds to the CD19 antigen, includes the CDRs of the low-affinity scFv antibody, binds to the CD19 antigen, includes the CDRs of the 5E5 scFv antibody, binds to the MUC-1 antigen, includes the CDRs of the 4D5 scFv antibody, binds to the HER-2 antigen, includes the CDRs of the FRP5 scFv antibody, binds to the HER-2 antigen, includes the CDRs of the M27 scFv antibody, binds to the EGFR antigen, includes the CDRs of the cetuximab scFv antibody, binds to the EGFR antigen, includes the CDRs of the C4-based scFv antibody, binds to the folate receptor alpha antigen, includes the CDRs of the MOv19 scFv antibody, binds to the folate receptor alpha antigen, includes the CDRs of the SS1 scFv antibody, binds to the mesothelin antigen, includes the CDRs of the M clone scFv antibody, binds to the mesothelin antigen, includes the CDRs of the amatuximab scFv antibody, binds to the mesothelin antigen, includes the CDRs of the anetumab scFv antibody, binds to the mesothelin antigen, includes the CDRs of the ET1402L1 scFv antibody, binds to the AFP antigen, includes the CDRs of the anti-CEA scFv antibody, binds to the CEA antigen, includes the CDRs of the CEACAM5 scFv antibody, binds to the CEA antigen, includes the CDRs of the hMN14 scFv antibody, binds to the CEA antigen, includes the CDRs of the 22172,22176 scFv antibody, binds to the CD123 antigen, includes the CDRs of the humanized scFv antibody, binds to the CD123 antigen, includes the CDRs of the humanized scFv antibody, binds to the CD123 antigen, includes the CDRs of the Tagrazofusp-based scFv antibody, binds to the CD123 antigen, includes the CDRs of the MY96 scFv antibody, binds to the CD33 antigen, includes the CDRs of the humanized scFv antibody, binds to the CD33 antigen, includes the CDRs of the humanized scFv antibody, binds to the CLEC12A antigen, includes the CDRs of the CLL1 scFv antibody, binds to the CLEC12A antigen, includes the CDRs of the M6E7 scFv antibody, binds to the CLEC12A antigen, includes the CDRs of the m21C9 scFv antibody, binds to the CLEC12A antigen, M20B1Containing the CDRs of scFv antibodies, binding to the CLEC12A antigen, containing the CDRs of the M28H12 scFv antibody, binding to the CLEC12A antigen, containing the CDRs of the M0971 scFv antibody, binding to the CD22 antigen, containing the CDRs of humanized scFv cloned antibodies, binding to the CD22 antigen, containing the CDRs of inotuzumab-based scFv antibodies, binding to the CD22 antigen, containing the CDRs of moxetumomab-based scFv antibodies, binding to the CD22 antigen, containing the CDRs of rituximab scFv antibodies, binding to the CD20 antigen, containing the CDRs of Leu 16 scFv antibodies, binding to the CD20 antigen, containing the CDRs of CD20 scFv antibodies, binding to the CD20 antigen, containing the CDRs of BCMA-02 scFv antibodies, binding to the BCMA antigen, containing the CDRs of LCAR38 scFv antibodies, binding to the BCMA antigen, containing the CDRs of BCMA scFv antibodies, binding to the BCMA antigen, containing the CDRs of bi-epitope scFv antibodies, binding to the BCMA antigen, containing the CDRs of NVS BCMA scFv antibodies, binding to the BCMA antigen, containing the CDRs of CS1R scFv antibodies, binding to the CS-1 antigen, containing the CDRs of CS1 scFv antibodies, binding to the CS-1 antigen, containing the CDRs of elotuzumab-based scFv antibodies, binding to the CS-1 antigen, containing the CDRs of scFv antibodies, binding to the CD138 antigen, containing the CDRs of humanized scFv antibodies, binding to the CD44v6 antigen, containing the CDRs of cMAb U36 scFv antibodies, binding to the CD44v6 antigen, containing the CDRs of scFv antibodies, binding to the NKG2D antigen, containing the CDRs of NKG2Dg scFv antibodies, binding to the NKG2D antigen, containing the CDRs of nanobody CD38cFv antibodies, binding to the CD38 antigen, containing the CDRs of humanized scFv antibodies, binding to the CD38 antigen, containing the CDRs of humanized scFv antibodies, binding to the GPRC5D antigen, containing the CDRs of scFv(L-H) and (H-L) antibodies, binding to the CD79b antigen, containing the CDRs of M290 scFv antibodies, binding to the CD103 antigen, containing the CDRs of FAP5 scFv antibodies, binding to the FAP antigen, containing the CDRs of human CD70 scFv antibodies, binding to the CD70 antigen, containing the CDRs of 4H11 scFv antibodies, binding to the MUC16 antigen, IL13RContains the CDRs of scFv antibodies that bind to the IL13Ra2 antigen, contains the CDRs of muromonab scFv antibodies that bind to the CD3 antigen, contains the CDRs of teprilizumab scFv antibodies that bind to the CD3 antigen, contains the CDRs of blinatumomab scFv antibodies that bind to the CD3 antigen, contains the CDRs of brentuximab scFv antibodies that bind to the CD30 antigen, contains the CDRs of 4C8 scFv antibodies that bind to the CD34 antigen, contains the CDRs of ibalizumab scFv antibodies that bind to the CD4 antigen, contains the CDRs of anti-CD5 scFv antibodies that bind to the CD5 antigen, contains the CDRs of 9F2A11 scFv antibodies that bind to the CD5 antigen, contains the CDRs of Ab5D7v scFv antibodies that bind to the CD5 antigen, contains the CDRs of polatuzumab scFv antibodies that bind to the CD7 antigen, contains the CDRs of Ab4450 scFv antibodies that bind to the CD79a antigen, contains the CDRs of anti-CD79a scFv antibodies that bind to the CD79a antigen, contains the CDRs of crefmirumab scFv antibodies that bind to the CD8 antigen, contains the CDRs of galiximab scFv antibodies that bind to the CD80 antigen, contains the CDRs of 3C12 scFv antibodies that bind to the CD83 antigen, contains the CDRs of 32A scFv antibodies that bind to the CD86 antigen, contains the CDRs of anti-EGFRvIII scFv antibodies that bind to the EGFRviii antigen, contains the CDRs of ifabotuzumab scFv antibodies that bind to the EPHA3 antigen, contains the CDRs of apruvumab scFv antibodies that bind to the FGFR2 antigen, contains the CDRs of bemarituzumab scFv antibodies that bind to the FGFR2 antigen, contains the CDRs of M909 scFv antibodies that bind to the folate receptor beta antigen, contains the CDRs of ASO4498 scFv antibodies that bind to the folate receptor beta antigen, contains the CDRs of antibody #2 scFv antibodies that bind to the folate receptor beta antigen, contains the CDRs of antibody #3 scFv antibodies that bind to the folate receptor beta antigen, contains the CDRs of EH7 scFv antibodies that bind to the galactomannan antigen, BB10comprising the CDRs of the scFv antibody, binding to the galactomannan antigen, comprising the CDRs of the erlizumab scFv antibody, binding to the gp120 antigen, comprising the CDRs of the suvizumab scFv antibody, binding to the gp120 antigen, comprising the CDRs of the telopizumab scFv antibody, binding to the gp120 antigen, comprising the CDRs of the codrituzumab scFv antibody, binding to the GPC3 antigen, comprising the CDRs of the etrolizumab scFv antibody, binding to the gut integrin antigen, comprising the CDRs of the 10E12 scFv antibody, binding to the ILR1a antigen, comprising the CDRs of the 9E11 scFv antibody, binding to the ILR1a antigen, comprising the CDRs of the 9G5 scFv antibody, binding to the ILR1a antigen, comprising the CDRs of the canertuzumab scFv antibody, binding to the MUC antigen, comprising the CDRs of the clivatuzumab scFv antibody, binding to the MUC antigen, comprising the CDRs of the gatipotuzumab scFv antibody, binding to the MUC antigen, comprising the CDRs of the sophituzumab scFv antibody, binding to the MUC antigen, comprising the CDRs of the ubatumumab scFv antibody, binding to the MUC antigen, comprising the CDRs of the 12D7 scFv antibody, binding to the NY-ESO antigen, comprising the CDRs of the T1 scFv antibody, binding to the NY-ESO antigen, comprising the CDRs of the T2 scFv antibody, binding to the NY-ESO antigen, comprising the CDRs of the T3 scFv antibody, binding to the NY-ESO antigen, comprising the CDRs of the nivolumab scFv antibody, binding to the PD-1 antigen, comprising the CDRs of the pembrolizumab scFv antibody, binding to the PD-1 antigen, comprising the CDRs of the J591 scFv antibody, binding to the PSMA antigen, comprising the CDRs of the zilovertamab scFv antibody, binding to the ROR1 antigen, comprising the CDRs of the anti-TCRa scFv antibody, binding to the T cell receptor alpha antigen, comprising the CDRs of the anti-TCRBC1 scFv antibody, binding to the T cell receptor beta antigen, comprising the CDRs of the K1-18 scFv antibody, binding to the TSHR antigen, comprising the CDRs of the sacituzumab scFv antibody, binding to the TROP2 antigen, or comprising the CDRs of the datopotamab scFv antibody, binding to the TROP2 antigen, the population according to any one of claims 17 to 20.

22. The population according to any one of claims 17 to 20, wherein the second chimeric antigen receptor comprises the CDRs of the FMC63 scFv antibody and binds to the CD19 antigen, comprises the CDRs of the MOR208 scFv and binds to the CD19 antigen, comprises the CDRs of a humanized scFv antibody and binds to the CD19 antigen, comprises the CDRs of the 4G7 scFv antibody and binds to the CD19 antigen, or comprises the CDRs of a low-affinity scFv antibody and binds to the CD19 antigen.

23. The population according to any one of claims 15 to 22, wherein the cell is a T cell, a stem cell, or an NK cell.

24. An isolated nucleic acid comprising a nucleic acid sequence encoding the chimeric antigen receptor according to any one of claims 1 to 14.

25. The nucleic acid according to claim 24, wherein the nucleic acid is a viral vector.

26. The nucleic acid according to claim 24, wherein the nucleic acid is a phagemid.

27. A method for producing chimeric antigen receptor-positive (CAR+) cells, the method comprising introducing a nucleic acid encoding the CAR into a cell, wherein the cell expresses the CAR, thereby producing the CAR+ cells, and the nucleic acid is the nucleic acid according to any one of claims 24 to 26.

28. The method according to claim 27, wherein the nucleic acid is a viral vector.

29. The method according to claim 28, wherein the cell is infected with the viral vector.

30. The method according to claim 29, wherein the chimeric antigen receptor is expressed on the surface of the cell.

31. A composition comprising the population of cells according to any one of claims 15 to 23.

32. The composition according to claim 31, wherein at least 50 percent of the cells express the chimeric antigen receptor.

33. The composition according to claim 32, wherein at least 75 percent of the cells express the chimeric antigen receptor.

34. The composition according to claim 32, wherein at least 95 percent of the cells express the chimeric antigen receptor.

35. The composition according to claim 32, wherein at least 99 percent of the cells express the chimeric antigen receptor.

36. The composition according to claim 33, wherein 100 percent of the cells express the chimeric antigen receptor.

37. The composition according to any one of claims 31 to 36, wherein the composition contains a pro-apoptotic compound.

38. The composition according to claim 37, wherein the pro-apoptotic compound is a Bcl-2 inhibitor.

39. The composition according to claim 38, wherein the Bcl-2 inhibitor is venetoclax, navitoclax, obatoclax, ABT-737, S55746 or subtoclax.

40. The composition according to claim 37, wherein the pro-apoptotic compound is an inhibitor of inhibitor of apoptosis (IAP).

41. The composition according to claim 40, wherein the IAP inhibitor is AT-406, GDC-0917, LCL-161, GDC-0152, birinapant, HGS1029, TWX024 or AEG35156.

42. The composition according to claim 37, wherein the pro-apoptotic compound is a mouse double minute 2 (MDM2) inhibitor.

43. The composition according to claim 42, wherein the MDM2 inhibitor is nutlin, ATSP-7041, smac mimetic, MCL-1 inhibitor or Bclxl inhibitor.

44. A composition comprising the nucleic acid according to any one of claims 24 to 26.

45. The composition according to claim 44, further comprising a nucleic acid encoding a chimeric antigen receptor comprising an antigen-binding domain, a hinge, a transmembrane domain and one or more signaling domains, wherein the antigen-binding domain comprises the CDRs of the FMC63 scFv antibody, binds to the CD19 antigen, comprises the CDRs of the MOR208 scFv, binds to the CD19 antigen, comprises the CDRs of the humanized scFv antibody, binds to the CD19 antigen, comprises the CDRs of the 4G7 scFv antibody, binds to the CD19 antigen, or comprises the CDRs of the low-affinity scFv antibody and binds to the CD19 antigen.

46. A method for treating a mammal having cancer, the method comprising administering to the mammal the composition according to any one of claims 32 to 40.

47. The method according to claim 42, wherein the mammal is a human.

48. wherein the cancer is TRAILshort + The method according to claim 42 or claim 43, wherein the cancer is as defined above.

49. said TRAILshort + wherein the cancer is TRAILshort + The method according to claim 44, wherein the cancer is squamous cell carcinoma, lymphoma, cervical cancer, renal cell carcinoma, breast cancer, prostate cancer, ovarian cancer, lung cancer, bladder cancer, head and neck cancer, uterine cancer, esophageal cancer, gastric cancer, colorectal cancer, sarcoma or pancreatic cancer.

50. The method according to any one of claims 46 to 49, wherein the number of cancer cells in the mammal decreases after the administration step.

51. The method according to any one of claims 46 to 49, wherein the composition comprises the cell population according to any one of claims 15 to 23.

52. The method according to any one of claims 46 to 49, wherein the composition comprises the nucleic acid according to any one of claims 24 to 26.

53. The method according to any one of claims 46 to 52, wherein the method comprises administering a pro-apoptotic compound to the mammal.

54. The method according to claim 53, wherein the pro-apoptotic compound is a Bcl-2 inhibitor, an IAP inhibitor or an MDM2 inhibitor.

55. A method for treating a mammal having an infectious disease, the method comprising administering to the mammal the composition according to any one of claims 32 to 45.

56. The method according to claim 55, wherein the infectious disease is a chronic infectious disease.

57. The method according to claim 55, wherein the infectious disease is selected from the group consisting of human immunodeficiency virus (HIV) infection, hepatitis B virus (HBV) infection, hepatitis C virus (HCV) infection, human papillomavirus (HPV) infection, tuberculosis (TB) infection, cytomegalovirus (CMV) infection and Epstein-Barr virus (EBV) infection.

58. The method according to any one of claims 55 to 57, wherein the mammal is a human.

59. The method according to any one of claims 55 to 58, wherein the composition comprises the cell population according to any one of claims 15 to 23.

60. The method according to any one of claims 55 to 58, wherein the composition comprises the nucleic acid according to any one of claims 24 to 26.

61. A method for binding a chimeric antigen receptor to a TRAILshort polypeptide, the method comprising contacting the TRAILshort polypeptide with the chimeric antigen receptor according to any one of claims 1 to 14.

62. The method according to claim 61, wherein the contacting is performed in vitro.

63. The method according to claim 61, wherein the contacting is performed in vivo.

64. The method according to claim 63, wherein the contacting is performed by administering to the mammal cells comprising the chimeric antigen receptor within the mammal.

65. The method according to claim 64, wherein the mammal is a human.