Affinity binding entities directed against CD70 and methods of using the same

Abstract

Aspects of the present disclosure include compositions and methods for treating tumors expressing CD70 with engineered γδ T cells. In some embodiments, the γδ-T cells comprise a chimeric antigen receptor (CAR) construct. The CAR construct can include the full-length CD27 receptor domain, a co-stimulatory domain, an intracellular signaling domain, combinations thereof, or all of them. The CAR construct can contain a domain encoding an additional polypeptide that confers advantageous functions to the γδ T cells.

Description

Technical Field

[0001] Cross - reference to Related Applications This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 393,787, filed on July 29, 2022, the disclosure of which is hereby incorporated by reference in its entirety.

[0002] Field of the Disclosure The present disclosure generally relates to chimeric antigen receptors (CARs) comprising antigen - binding molecules that bind to CD70, polynucleotides encoding the same, host cells comprising the polynucleotide and / or the CAR, and methods of using the same to treat disorders associated with the expression of CD70 in a patient.

Background Art

[0003] In recent years, T - cell - engaging therapies using chimeric antigen receptor (CAR) T cells have opened up a new frontier in cancer immunotherapy (June et al., Science, 2018; 359: 1361 - 1365). One attractive target is human differentiation antigen group 70 (CD70). CD70 is a transmembrane glycoprotein, a member of the tumor necrosis factor (TNF) superfamily, and the only known ligand of CD27. CD70 exhibits aberrant constitutive expression in various cancers, including renal cell carcinoma, leukemia, non - small cell lung cancer, melanoma, glioblastoma, and the like.

[0004] The first-generation CD70-targeted CAR utilized the full-length CD27 protein targeting B-cell malignancies (Shafer et al., Blood, 2011; 117:4304-4314). Subsequently, efficacy improvement was demonstrated with a truncated CD27 protein (Wang et al., Clin. Cancer Res. 2017; 23:2267-2276). This CAR has been subjected to a Phase I clinical trial in solid tumors (NCT02830724) and has been demonstrated to be effective against head and neck cancers and gliomas expressing CD70. To date, CD70-targeted CARs have been investigated in relation to alpha-beta (αβ) T cells derived from peripheral blood T cells. However, unfortunately, the effective use of αβ T cells is generally complicated by the high likelihood of alloreactivity and, in particular, the property of inducing cytokine release syndrome (CRS).

[0005] Gamma-delta (γδ) T cells are thymus-derived lymphocytes that differ from αβ T cells in terms of the mechanisms of their activation and function, as well as their anatomical distribution. In particular, while αβ T cells function solely in adaptive immunity, γδ T cells are innate immune-like cells that recognize malignant cells via a repertoire of activating receptors in an MHC-independent manner, similar to natural killer (NK) cells (Welsh et al., Immunol. Rev. 1997; 159:79-93). Therefore, in contrast to αβ T cells, γδ T cells may be used in an allogeneic setting without the risk of causing graft-versus-host disease (GvHD). Furthermore, recent studies have suggested that engineered γδ-T cells may produce fewer pro-inflammatory cytokines than αβ-T cells, thereby potentially reducing the risk of CRS in patients (Harrer et al., BMC. Cancer, 2017; 17(1):551).

[0006] Despite the rapid and powerful development of CAR T therapies, the optimal parameters regarding the interaction between CAR T cells and targets that result in in vivo and human efficacy are not yet fully understood. Considering that the mechanism of action and function of αβ T cells are different from those of γδ T cells, demonstration of the function and efficacy of CARs in the context of αβ T cells does not predict the function and efficacy of CARs in the context of γδ T cells. Therefore, the practical application of the approach of CAR T therapy targeting CD70 on γδ T cells is uncertain at best.

Summary of the Invention

[0007] The present disclosure provides CAR T γδ T cells that target CD70. In one aspect, provided are γδ T cells comprising a chimeric antigen receptor (CAR), wherein the CAR comprises a binding domain that recognizes the CD70 antigen, at least one co-stimulatory domain, and at least one intracellular signaling domain, and the γδ T cells functionally express the binding domain of the CAR on the surface of the γδ T cells.

[0008] In embodiments, the binding domain comprises a full-length CD27 receptor having the amino acid sequence set forth in SEQ ID NO: 33. In embodiments, the binding domain comprises a full-length CD27 receptor having the amino acid sequence set forth in SEQ ID NO: 91.

[0009] In embodiments, the binding domain comprises a truncated CD27 receptor having the amino acid sequence set forth in SEQ ID NO: 43. In embodiments, the binding domain comprises a truncated CD27 receptor having the amino acid sequence set forth in SEQ ID NO: 92.

[0010] In embodiments, at least one co-stimulatory domain is selected from TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, CD2, CD3C, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD70, CD80, CD83, CD86, CD134 (OX40), CD137 (4-1BB), CD278 (ICOS), FcR, LAT, NKD2C, SLP76, TRIM, and ZAP70, or a combination thereof. In embodiments, at least one co-stimulatory domain is 4-1BB.

[0011] In embodiments, at least one intracellular signaling domain is selected from CD3ζ, DAP12, LFA-1, and the repeat (2-5) DAP10YINM motif. In embodiments, at least one signaling domain is CD3ζ.

[0012] In some embodiments, the CAR comprises a binding domain that recognizes the CD70 antigen, followed by a 4-1BB co-stimulatory domain, followed by a CD3ζ signaling domain.

[0013] In embodiments, the CAR is encoded by an isolated nucleic acid operably linked to a regulatable promoter.

[0014] In embodiments, the isolated nucleic acid encoding the CAR encodes one or more additional polypeptides. In embodiments, the one or more additional polypeptides are selected from, or consist of, the lymphotoxin beta receptor (LTBR), the dominant negative (dn) receptor of TGF-beta or Fas, the truncated human epidermal growth factor receptor (EGFRt), and the membrane-bound IL-12 (mbIL-12).

[0015] In embodiments, the one or more additional polypeptides are lymphotoxin beta receptor (LTBR). In embodiments, the LTBR encoded by the isolated nucleic acid has the amino acid sequence shown in SEQ ID NO: 27. In embodiments, the one or more additional polypeptides are dominant negative (dn) receptors of TGF-beta. In embodiments, the dominant negative receptor of TGF-beta is dnTGFβR2. In embodiments, the dnTGFβR2 encoded by the isolated nucleic acid has the amino acid sequence shown in SEQ ID NO: 23. In embodiments, the one or more additional polypeptides are the truncated form of the human epidermal growth factor receptor (EGFRt). In embodiments, the EGFRt encoded by the isolated nucleic acid has the amino acid sequence shown in SEQ ID NO: 19. In embodiments, the one or more additional polypeptides are dominant negative Fas (dnFas). In embodiments, the one or more additional polypeptides are membrane-bound IL-12 (mbIL-12).

[0016] In embodiments, the isolated nucleic acid encodes at least one cleavage polypeptide sequence. In embodiments, the at least one cleavage polypeptide sequence is a 2A self-cleavage polypeptide sequence selected from the self-cleavage polypeptide sequences of T2A, P2A, E2A, and F2A. In embodiments, the 2A self-cleavage polypeptide sequence is the P2A self-cleavage polypeptide sequence. In embodiments, the P2A self-cleavage polypeptide sequence encoded by the isolated nucleic acid has the amino acid sequence shown in SEQ ID NO: 8, 77, or 78.

[0017] In embodiments, the isolated nucleic acid encodes SEQ ID NO: 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, or 71. In embodiments, the isolated nucleic acid molecule encodes SEQ ID NO: 57.

[0018] In an embodiment, the γδ T cells contain at least one disrupted endogenous gene. In an embodiment, the at least one disrupted endogenous gene is cytokine-inducible SH2-containing protein (CISH). In an embodiment, the at least one disrupted endogenous gene is CBL proto-oncogene B (CBL-B). In an embodiment, the at least one disrupted endogenous gene is zinc finger protein 91 (ZFP91). In an embodiment, the at least one disrupted endogenous gene is Roquin. In an embodiment, the at least one disrupted endogenous gene is CD58 and / or ICAM-1.

[0019] In an embodiment, the γδ T cells exhibit in vitro and / or in vivo tumor cell killing activity against hematological tumor cells and / or solid tumor cells that show cell surface expression of the CD70 antigen.

[0020] In an embodiment, the tumor cell killing activity of the γδ cells is greater than the native level of in vitro and / or in vivo tumor cell killing activity in control γδ cells that do not contain a CAR.

[0021] In an embodiment, the tumor cell killing activity persists for 6 to 180 days, about 6 to 180 days, at least 6 to 180 days, or at least about 6 to 180 days after the first contact with hematological tumor cells and / or solid tumor cells that show cell surface expression of the CD70 antigen.

[0022] In an embodiment, the γδ T cells proliferate in response to contact with hematological tumor cells and / or solid tumor cells that show cell surface expression of the CD70 antigen.

[0023] In an embodiment, the γδ T cells show an increase in proliferation in response to contact with hematological tumor cells and / or solid tumor cells that show cell surface expression of the CD70 antigen, as compared to control γδ T cells that do not functionally express the binding domain of the CAR on the surface of the γδ T cells.

[0024] In an embodiment, γδ T cells proliferate in a host organism containing hematological tumor cells and / or solid tumor cells that exhibit cell surface expression of the CD70 antigen.

[0025] In an embodiment, γδ T cell proliferation or an increase in γδ T cell proliferation persists for 6 to 180 days, about 6 to 180 days, at least 6 to 180 days, or at least about 6 to 180 days after the initial contact with hematological tumor cells and / or solid tumor cells that exhibit cell surface expression of the CD70 antigen.

[0026] In an embodiment, γδ T cells express pro-inflammatory cytokines including tumor necrosis factor alpha or interferon gamma after contact with hematological tumor cells and / or solid tumor cells that exhibit cell surface expression of the CD70 antigen.

[0027] In an embodiment, compared to the graft-versus-host response exhibited by αβ T cells administered to an allogeneic host, γδ T cells, when introduced into an allogeneic host, reduce, substantially reduce, essentially do not show, or do not show at all the graft-versus-host response.

[0028] In an embodiment, the γδ T cells are δ1, δ2, δ3, or δ4 γδ T cells, preferably δ2-γδ T cells, more preferably δ1 γδ T cells.

[0029] In one aspect of the present invention, provided are a plurality of γδ T cells according to the embodiments described herein.

[0030] In an embodiment, the plurality is at least about 10 7 γδ T cells, preferably about 10 8 γδ T cells to about 10 11 γδ T cells.

[0031] In an embodiment, the plurality is at least 60%, 80%, or about 60% or 80% to about 90% or 95% of δ1, δ2, δ3, or δ4 γδ T cells, preferably δ1 or δ2 γδ T cells, more preferably δ2 -It comprises a composition of γδ T cells, most preferably δ1 γδ T cells.

[0032] In one aspect, provided is a method of generating γδ T cells according to embodiments herein, or a plurality of γδ T cells according to embodiments herein, wherein the method comprises transducing γδ T cell(s) with a construct comprising an isolated nucleic acid according to embodiments herein. In an embodiment, the method comprises retroviral transduction. In an embodiment, the method comprises in vitro expansion of the γδ T cell(s), wherein the in vitro expansion is performed before and / or after transduction of the isolated nucleic acid sequence.

[0033] In one aspect, provided is a pharmaceutical composition comprising a pharmaceutically acceptable excipient and γδ T cells according to embodiments herein.

[0034] In one aspect, provided is a method of killing hematological tumor cells and / or solid tumor cells that exhibit cell surface expression of the CD70 antigen, the method comprising contacting the hematological tumor cells and / or solid tumor cells with a tumor cell killing effective amount of γδ T cells according to embodiments herein, a plurality of γδ T cells according to embodiments herein, or a pharmaceutical composition according to embodiments herein.

[0035] In an embodiment, the method comprises introducing a therapeutically effective amount of γδ T cell(s) or pharmaceutical composition into a host organism comprising hematological tumor cells and / or solid tumor cells.

[0036] In an embodiment, the method comprises introducing a therapeutically effective amount of γδ T cell(s) or pharmaceutical composition into a host organism comprising hematological tumor cells and / or solid tumor cells and concurrently or sequentially performing one or more methods of elevating a common gamma chain cytokine(s).

[0037] In an embodiment, performing one or more methods of increasing common gamma chain cytokine(s) comprises administering an effective amount of common gamma chain cytokine(s) to increase the proliferation, cytotoxic activity, persistence, or combinations thereof of the introduced γδ T cell(s), simultaneously or sequentially with the introduction of the γδ T cell(s). Preferably, in that case, the method comprises administering IL-2. More preferably, in that case, the method comprises administering IL-15.

[0038] In an embodiment, one or more methods of increasing common gamma chain cytokine(s) comprises administering an effective amount of common gamma chain cytokine(s) to increase the proliferation, cytotoxic activity, persistence, or combinations thereof of the introduced γδ T cell(s) before and / or after the introduction of the γδ T cell(s).

[0039] In an embodiment, one or more methods of increasing common gamma chain cytokine(s) comprises lymphodepletion prior to introducing the γδ T cell(s).

[0040] In an embodiment, one or more methods of increasing common gamma chain cytokine(s) comprises secretion of one or more common gamma chain cytokine(s) from the introduced γδ T cell(s).

[0041] In an embodiment, the method decreases the in vivo tumor burden of the host organism and / or increases the average survival time of the host organism as compared to a control organism, where the control organism is not treated with γδ T cell(s) or a pharmaceutical composition.

[0042] In an embodiment, the method is a method of treating cancer in a subject in need thereof.

[0043] In one aspect, provided is a method of treating cancer in a subject in need thereof, the method comprising administering a therapeutically effective amount of γδ T cells, where the cancer comprises hematological tumor cells that exhibit cell surface expression of CD70.

[0044] In one aspect, provided is a method of treating cancer in a subject in need thereof, the method comprising administering a therapeutically effective amount of γδ T cells, wherein the cancer comprises solid tumor cells that exhibit cell surface expression of CD70.

[0045] In one aspect, provided is a method of treating cancer in a subject in need thereof, the method comprising administering a therapeutically effective amount of γδ T cells, wherein the cancer comprises hematological tumor cells and / or solid tumor cells that exhibit cell surface expression of CD70.

[0046] In some embodiments of any one of the methods of treating cancer described herein, the method may comprise performing multiple administrations of γδ T cells, wherein the interval between the multiple administrations is at least about 1 week, preferably at least about 2, 3, 4, 5, 6, 7, 8, or 12 weeks, and / or the multiple administrations are no more than once every 6 months or 12 months.

[0047] In one aspect, provided is a method of reducing or inhibiting a graft-versus-host response against immune cells administered to a subject in need thereof, the method comprising administering a therapeutically effective amount of γδ T cells according to the subject invention. In embodiments, the γδ T cells may comprise a dual CAR that binds CD70 and another tumor-associated antigen, or the method may further comprise co-administering, simultaneously or sequentially, the γδ T cells according to the subject invention with immune cells (e.g., T cells or NK cells) that comprise a CAR that binds another tumor-associated antigen.

[0048] INCORPORATION BY REFERENCE All publications, patents, and patent applications mentioned herein are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0049]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17A

Figure 17B

Figure 18A

Figure 18B

Figure 19A

Figure 19B

Figure 20A

Figure 20B

Figure 20C

Figure 21

Figure 22

Figure 23A

Figure 23B

Figure 23C

Figure 23D

Figure 24

Figure 25

Figure 26A

Figure 26B

Figure 27A

Figure 27B

Figure 28A

Figure 28B

Figure 29A

Figure 29B

Mode for Carrying Out the Invention

[0050] I. Definitions For the purposes of interpreting this specification, the following definitions apply, and where appropriate, terms used in the singular also include the plural and vice versa. If the definitions set forth herein conflict with a document incorporated herein by reference, the definitions set forth below shall control. Unless otherwise noted, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0051] As used herein when referring to a measurable value, such as an amount, a duration of time, etc., "about" means to encompass variations of ±20%, ±10%, more preferably ±5%, more preferably ±1%, and even more preferably ±0.1% from the specified value, as appropriate for performing the disclosed method.

[0052] As used herein, "w / v" refers to the weight of a component in a given volume of solution.

[0053] "Range": Throughout this disclosure, various aspects of the disclosure may be presented in range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, a description of a range should be considered to specifically disclose not only the individual numerical values within that range but also all possible sub-ranges. For example, a description of a range such as 1 - 6 is considered to specifically disclose sub-ranges such as 1 - 3, 1 - 4, 1 - 5, 2 - 4, 2 - 6, 3 - 6, etc., as well as the individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0054] The terms "patient", "subject", "individual", etc. are used interchangeably herein and refer to any animal that is suitable for the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0055] The term "diagnosis" or "diagnosing" refers to the process of identifying a disease, such as cancer, based on signs, symptoms, and / or the results of various tests. The conclusion reached through such a process is the diagnosis. Commonly performed test modalities include blood tests, medical image analysis, urine tests, biopsies, and the like.

[0056] As used herein, the term "agent" refers to any protein, nucleic acid molecule (including chemically modified nucleic acids), compound, antibody, small molecule, organic compound, inorganic compound, molecule for other purposes, or cell (e.g., a cell engineered to express a chimeric antigen receptor). An agent can include a therapeutic agent, a diagnostic agent, or a pharmaceutical. A therapeutic agent or pharmaceutical agent, alone or together with additional agents, is one that induces a desired response (including induction of a therapeutic or prophylactic effect when administered to a subject, including treating a subject suffering from cancer or other disease / condition).

[0057] The term "therapeutically effective amount" or simply "effective amount" refers to the amount of an agent or composition (e.g., a composition comprising an agent) that elicits the biological or medical response of a tissue, system, or subject that is sought by a researcher, veterinarian, physician, or other clinician. The term "therapeutically effective amount" includes the amount of an agent or composition comprising an agent that, when administered, is sufficient to prevent the occurrence of one or more signs or symptoms of the disorder or disease being treated (e.g., tumor cells expressing CD70) or to alleviate the signs or symptoms to some extent. The therapeutically effective amount will vary depending on the composition, the disease and its severity, and the age, weight, and the like of the subject being treated.

[0058] As used herein, the term "γδ T cell (gamma-delta T cell)" refers to a subset of T cells that express on their surface a distinct T cell receptor (TCR), namely γδ TCR, which is composed of one γ chain and one δ chain. The term "γδ T cell" includes all subsets of γδ T cells, including but not limited to, in particular, Vδ1 and Vδ2, Vδ3 γδ T cells, as well as naive, effector memory, central memory and terminally differentiated γδ T cells. As a further example, the term "γδ T cell" includes Vδ4, Vδ5, Vδ7 and Vδ8 γδ T cells, as well as Vγ2, Vγ3, Vγ5, Vγ8, Vγ9, Vγ10 and Vγ11 γδ T cells. In some embodiments, the γδ T cell is Vδ1 - , Vδ2 - or Vδ1 - and Vδ2 - . Compositions and methods for making and using genetically engineered and non-genetically engineered γδ T cells and / or their subtypes include, but are not limited to, those described in US2016 / 0175358, WO2017 / 197347, US9499788, US2018 / 0169147, US9907820, US2018 / 0125889 and US2017 / 0196910. The content of each of these is incorporated by reference for all purposes, such as compositions and methods for making and using these genetically engineered and non-genetically engineered γδ T cells and / or their subtypes. This application further contemplates T cells that express one γ chain or one δ chain, optionally in combination with a second polypeptide to form a functional TCR, or other genetically engineered leukocytes or lymphocytes. Such genetically engineered leukocytes or lymphocytes that express one γ chain or one δ chain may be used in the methods or may be present in the compositions described herein.

[0059] As used herein, the terms "T lymphocyte" or "T cell" refer to immune cells that express, or have expressed, CD3 (CD3+) and the T cell receptor (TCR+). T cells play a central role in cell-mediated immunity. T cells that "express" CD3 and TCR have been engineered to remove cell surface expression of CD3 and / or TCR.

[0060] As used herein, the terms "TCR" or "T cell receptor" refer to dimeric heterologous cell surface signaling proteins that form the alpha-beta or gamma-delta receptors or combinations thereof. The αβTCR recognizes antigens presented by MHC molecules, whereas the γδTCR can recognize antigens independent of MHC presentation.

[0061] As used herein, the term "CD70" refers to a molecule belonging to the tumor necrosis factor (TNF) ligand family, also known as CD27LG and TNFSF7. CD70 is a ligand for CD27 (TNFRSF27). The term CD70 can include, but is not limited to, native CD70, isoforms of CD70, or interspecies CD70 homologs. The amino acid sequence of human CD70 (hCD70) is provided by NCBI accession number NP001243.1 (GI:4507605) (SEQ ID NO:1). Residues 1-17 of SEQ ID NO:1 correspond to the cytoplasmic region of hCD70, residues 18-38 correspond to the transmembrane region of hCD70, and residues 39-193 correspond to the extracellular region of hCD70. At least one other isoform of hCD70 is known and is identified by the UniProt identifier P32970-2. As used herein, CD70 includes, but is not limited to, human CD70 and non-human CD70 homologs, as well as their variants, fragments, or post-translational modification forms, including N-linked and O-linked glycosylated forms of CD70. The CD70 protein can further include fragments that include all or a portion of SEQ ID NO:1 (e.g., amino acids 39-193 of SEQ ID NO:1 corresponding to the extracellular component of hCD70, amino acids 18-193 corresponding to the transmembrane form, and the extracellular component of hCD70).

[0062] The term "MHC" (major histocompatibility complex) refers to a subset of genes encoding antigen-presenting proteins on the cell surface. In humans, these genes are referred to as human leukocyte antigen (HLA) genes. In this specification, the abbreviations MHC or HLA are used interchangeably.

[0063] As used herein, "activation" refers to the state of a T cell that has been sufficiently stimulated to induce detectable cell proliferation. Activation may also be associated with induced cytokine production and detectable effector function. The term "activated T cell" refers, among other things, to a T cell that is undergoing cell division.

[0064] As used herein, the term "antibody" refers to an immunoglobulin molecule that specifically binds to an antigen. An antibody can be a complete immunoglobulin obtained from a natural or recombinant source, or it can be the immunoreactive portion of an intact immunoglobulin. Typically, an antibody is a tetramer of immunoglobulin molecules. The antibodies of the present invention may exist in various forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single-chain antibodies and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, N.Y.; Houston et al., 1988, Proc. Natl. Acad. Sci. USA, 85:5879-5883; Bird et al., 1988, Science, 242:423-426).

[0065] As used herein, the terms "antigen" or "Ag" are defined as molecules that induce an immune response. This immune response can include either, or both, antibody production or activation of specific immunocompetent cells. One of ordinary skill in the art will understand that any macromolecule, including proteins or peptides, can function as an antigen.

[0066] The term "epitope" includes protein determinants, lipid determinants, and carbohydrate determinants that can specifically bind to immunoglobulins or receptors. Epitope determinants usually consist of the active surface groups of molecules such as amino acid, lipid, or sugar side chains, and usually have specific three-dimensional structural characteristics and specific charge characteristics.

[0067] As used herein, the term "specifically binds" refers to a receptor (e.g., full-length CD27) that recognizes a specific molecule / ligand (e.g., CD70) but does not substantially recognize or bind other molecules in a sample. For example, a receptor that specifically binds to a molecule of one species may also bind to one or more molecules of other species. However, such cross-reactivity does not change the classification that it is specific in itself. In another example, a receptor that specifically binds to a molecule may also bind to different genotypes of the molecule. However, such cross-reactivity itself does not change the classification as specific. In some cases, the terms "specific binding" or "specifically binds" can be used with respect to the interaction of a protein (or peptide) with a second chemical species, meaning that the interaction depends on the presence of a specific structure (e.g., antigenic determinant or epitope) on the chemical species; for example, the receptor recognizes and binds to a specific structure rather than a general protein. If a receptor is specific for epitope "A", in a reaction containing label "A" and the receptor, the amount of labeled A that binds to the receptor will be reduced if a molecule containing epitope A (or unlabeled, unlabeled A) is present.

[0068] In some embodiments, specific binding is at least about 1×10 -8It can be characterized by an equilibrium dissociation constant of less than M (for example, the smaller the KD, the stronger the binding). Methods for determining whether two molecules specifically bind are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, and the like.

[0069] The "costimulatory domain" in the context of the chimeric antigen receptor (CAR) of the present disclosure and the chimeric receptor referred to herein enhances the cell proliferation, cell survival, and development of memory cells of cytotoxic cells expressing the chimeric receptor. The chimeric receptors of the present invention may include one or more costimulatory domains selected from the costimulatory domains of proteins of the TNFR superfamily, CD28, CD137 (4-1BB), CD134 (OX40), Dapl0, CD27, CD2, CD7, CD5, ICAM-1, LFA-1 (CD11a / CD18), Lck, TNFR-I, PD-1, TNFR-II, Fas, CD30, CD40, ICOS LIGHT, NKG2C, B7-H3, or combinations thereof. When the chimeric receptor includes more than one costimulatory domain, these domains may optionally be separated by a linker and arranged in a tandem array. The costimulatory domain may be an intracellular domain that may be located between the CD27 (truncated or full-length) of the chimeric receptor and the intracellular signaling domain.

[0070] As used herein, the term "costimulatory domain" also encompasses any modifications thereof, examples of which are described in U.S. Patent Application No. 20200129554, U.S. Patent Application No. 20200317777, WO2019010383, Li, W., et al., (2020) Immunity, 53:456-470; and Li, G., et al., (2017) J. Immunol. 198(1 Supplement):198.4, the contents of each of which are incorporated herein by reference in their entirety.

[0071] In the context of the chimeric receptors of the present disclosure, the "intracellular signaling domain" transmits effector function signals and instructs cytotoxic cells to perform their special function, namely, the function of damaging and / or destroying target cells. Examples of suitable intracellular signaling domains include, for example, the ζ chain of the T cell receptor complex or its homologs, such as the η chain, FcsRly chain, and β chain, MB1 (Iga) chain, B29 (Ig) chain, etc., human CD3ζ chain, CD3 polypeptides (Δ, δ, and ε), syk family tyrosine kinases (Syk, ZAP70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.), and other molecules involved in T cell transmission, such as CD2, CD5, and CD28. In embodiments, the intracellular signaling domain of the chimeric receptor may be a human CD3ζ chain, FcyRIII, FcsRI, the cytoplasmic tail of the Fc receptor, an immunoreceptor tyrosine-based activation motif (ITAM) having a cytoplasmic receptor, and combinations thereof.

[0072] Intracellular signaling domains include intracellular signaling domains of various other immune signaling receptors, including, but not limited to, first, second, and third generation T cell signaling proteins, including CD3, B7 family costimulatory factors, and tumor necrosis factor receptor (TNFR) superfamily receptors (Park et al., “Are all chimeric antigen receptors created equal?” J Clin Oncol., vol. 33, pp. 651 - 653, 2015). Additional intracellular signaling domains include signaling domains used by NK cells and NKT cells (Hermanson, et al.,”Utilizing chimeric antigen receptors to direct natural killer cell activity,” Front Immunol., vol. 6, p. 195, 2015), for example, the signaling domain of NKp30 (B7 - H6) (Zhang et al.,”An NKp30 - based chimeric antigen receptor promotes T cell effector functions and antitumor efficacy in vivo,” J. Immunol., vol. 189, pp. 2290 - 2299, 2012), and DAP12 (Topfer et al.,”DAP12 - based activating chimeric antigen receptor for NK cell tumor immunotherapy,” J. Immunol., vol. 194, pp. 3201 - 3212, 2015), NKG2D, NKp44, NKp46, DAP10, as well as CD3z.Furthermore, the intracellular signaling domain also includes immunoreceptor tyrosine-based activation motifs (ITAMs), such as the signaling domains of human immunoglobulin receptors containing FcgammaRI, FcgammaRIIA, FcgammaRIIC, FcgammaRIIIA, FcRL5 (Gillis et al., “Contribution of Human Fc.gamma.Rs to Disease with Evidence from Human Polymorphisms and Transgenic Animal Studies,” Front Immunol., vol. 5, p. 254, 2014).

[0073] In embodiments, the intracellular signaling domain includes the cytoplasmic signaling domains of TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, or CD66d. In an exemplary embodiment, the intracellular signaling domain in the chimeric receptor includes the cytoplasmic signaling domain of human CD3ζ. As used herein, the term “intracellular signaling domain” also encompasses any modifications thereof, examples of which are described in U.S. Patent Application No. 2020 / 0317777, as well as Roda-Navarro, P., and Reyburn, H.T., (2009), J. Biol. Chem. 284(24):16463-16472; Giuri Satoshi, E., et al., (2007), Mol. Cell. Biol. 27(24):8583-8599, and Wu, J., et al., (2000), J. Exp. Med. 192(7):1059-1068, the contents of each of which are incorporated herein by reference in their entirety.

[0074] As used herein, the term “anti-tumor effect” refers to a biological effect that can be manifested by a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in mean survival, or an improvement in various physiological symptoms associated with the cancerous state. Also, the “anti-tumor effect” can also be manifested by the ability of the peptides, polynucleotides, cells, and antibodies of the present invention to prevent the occurrence of tumors in the first place.

[0075] As used herein, the term "self-derived" refers to a substance that is derived from an individual and later reintroduced into the same individual.

[0076] As used herein, the term "allogeneic" refers to a substance that is derived from one animal and later introduced into a different animal of the same species.

[0077] As used herein, to "treat" a disease means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject. In one example, a therapy (e.g., administration of a therapeutic agent of the present disclosure) treats a disease or condition by, for example, reducing one or more signs or symptoms associated with the disease or condition as compared to the response in the absence of the therapy. For example, administration of a therapeutic agent may provide an anti-tumor effect that reduces one or more signs or symptoms associated with cancer.

[0078] As used herein, the term "administer" means to provide or give to a subject one or more agents, such as agents that treat one or more signs or symptoms associated with a condition / disorder or disease, including, but not limited to, cancer (e.g., lymphoma), viral infections, bacterial infections, etc., by any effective route. Exemplary routes of administration include, but are not limited to, injection (e.g., subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, sublingual, rectal, transdermal, intranasal, vaginal, and inhalation routes. Administration "in combination with" one or more additional therapeutic agents includes simultaneous (concurrent) administration and sequential administration in any order.

[0079] As used herein, the term "pharmaceutically acceptable" refers to substances, including but not limited to salts, carriers or diluents, which do not inhibit the biological activity or properties of a compound and are relatively non-toxic, i.e., the substance may be administered to an individual without causing undesirable biological effects or acting in a harmful manner with any of the components of the composition in which it is contained. Pharmaceutically acceptable carriers (vehicles) useful in the present disclosure are conventional ones. Remington’s Pharmaceutical Sciences, by E.W. Martin, Mack Publishing Co., Easton, Pa., 19th Edition (1995), describes compositions and formulations suitable for the delivery of one or more agents, such as one or more modulators. Generally, the nature of the carrier will depend on the particular mode of administration employed. For example, parenteral formulations may include injectable solutions containing pharmaceutically and physiologically acceptable fluids such as water, saline, balanced salt solutions, aqueous dextrose, glycerol, etc. as a vehicle. In addition to biologically neutral carriers, the pharmaceutical agents administered may contain minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents, for example, sodium acetate or sorbitan monolaurate, sodium lactate, potassium chloride, calcium chloride, and triethanolamine oleate. For example, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable excipient and, for example, γδT cells, preferably γδT cells engineered to express a CAR directed to CD70, as described herein.

[0080] "Encoding" refers to the inherent property of a specific sequence of nucleotides in a polynucleotide such as a gene, cDNA, or mRNA, and the biological properties resulting therefrom, for serving as a template for the synthesis of other polymers and macromolecules in a biological process having either a defined sequence of nucleotides (i.e., rRNA, tRNA, and mRNA) or a defined sequence of amino acids. Thus, a gene encodes a protein if transcription and translation of the mRNA corresponding to the gene produce the protein within a cell or other biological system. It is possible to say that both the coding strand, which is identical to the sequence of the mRNA and is usually the nucleotide sequence provided in the sequence listing, and the non-coding strand used as the template for transcription of the gene or cDNA encode the protein or other product of that gene or cDNA.

[0081] "Isolated" means changed or removed from its natural state. For example, a nucleic acid or peptide that naturally exists in a living animal is not "isolated", but the same nucleic acid or peptide that is partially or completely separated from its coexisting substances in its natural state is "isolated". An isolated nucleic acid or protein can exist in a substantially purified form or can exist in a non-natural environment such as, for example, a host cell.

[0082] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are mutually degenerate versions and encode the same amino acid sequence. Nucleotide sequences encoding proteins and RNAs may include introns.

[0083] Terms such as "patient", "subject", "individual", etc. are used interchangeably herein and refer to any animal that is suitable for the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0084] "Expression cassette" refers to a nucleic acid comprising an expression control sequence operably linked to a nucleic acid encoding a transcript or polypeptide to be expressed. The expression cassette contains cis-acting elements sufficient for expression, and other elements for expression can be supplied by the host cell or in an in vitro expression system. The expression cassette can be a component of a vector such as a cosmid, plasmid (e.g., naked or liposome-containing in liposomes), or virus (e.g., lentivirus, retrovirus, adenovirus, and adeno-associated virus). The expression cassette can be present in a host cell such as a γδ T cell.

[0085] II. Compositions and Methods of the Invention Unless otherwise noted, the technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. In particular, the present disclosure utilizes routine techniques in the fields of recombinant genetics, immunology, and biochemistry. Basic texts that disclose general terms in molecular biology and genetics include, for example: Lackie, Dictionary of Cell and Molecular Biology, Elsevier (5th ed. 2013). Basic texts that disclose methods in recombinant genetics and molecular biology include, for example: Sambrook et al, Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Press 4th Edition (Cold Spring Harbor, N.Y. 2012) and Current Protocols in Molecular Biology Volumes 1 - 3, John Wiley & Sons, Inc. (1994 - 1998) and Supplements 1 - 115 (1987 - 2016). Basic texts that disclose general methods and terms in biochemistry include, for example: Lehninger Principles of Biochemistry sixth edition, David L. Nelson and Michael M. Cox eds. W.H. Freeman (2012). Basic texts that disclose general methods and terms in immunology include: Janeway’s Immunobiology (Ninth Edition) by Kenneth M. Murphy and Casey Weaver (2017) Garland Science; Fundamental Immunology (Seventh Edition) by William E. Paul (2013) Lippincott, Williams and Wilkins.

[0086] A. Chimeric Antigen Receptor Construct Aspects of the invention include nucleic acids encoding a CAR, as well as constructs and vectors containing such nucleic acids. Optionally, the nucleic acid is, for example, a component of a heterologous expression cassette. In some embodiments, the nucleic acid is, for example, a component of a heterologous retroviral vector. In some embodiments, the nucleic acid is a component of, for example, a heterologous αβ T cell or γδ T cell, preferably a γδ T cell. In some embodiments, the nucleic acid is, for example, a heterologous component of a γ + T cell and / or δ + T cell. In some embodiments, the nucleic acid is, for example, a heterologous α - T cell and / or β - T cell.

[0087] Described herein are nucleic acids encoding a CAR binding domain that specifically binds to a tumor-associated antigen (TAA) expressed on the surface of tumor cells. In an embodiment, the TAA is CD70. CD70 belongs to the TNF superfamily and has the amino acid sequence of SEQ ID NO: 1. CD70 is involved in the proliferation and survival of lymphocyte-derived cells when it interacts with its receptor, CD27.

[0088] Embodiments of the present invention provide a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen-binding transmembrane domain comprising a CD27 amino acid sequence. In this regard, the CAR may comprise both a CD27 antigen-binding domain and a transmembrane domain of CD27. The CD27 amino acid sequence may comprise, or consist of, the CD27 amino acid sequence of any suitable human antigen-binding domain and transmembrane domain. In one embodiment of the present invention, the full-length CD27 comprising a signal peptide, an antigen-binding domain, a transmembrane domain, and a co-stimulatory signaling domain has the amino acid sequence of SEQ ID NO: 33. In one embodiment of the present invention, the antigen-binding domain of CD27 is composed of amino acid residues 20 to 191 of SEQ ID NO: 33, has the amino acid sequence of SEQ ID NO: 35, the transmembrane domain of CD27 is composed of amino acid residues 192 to 212 of SEQ ID NO: 33, has the amino acid sequence of SEQ ID NO: 37, the co-stimulatory domain of CD27 is composed of amino acid residues 213 to 260, and has the amino acid sequence of SEQ ID NO: 39. Thus, in one embodiment of the present invention, the CAR comprises an antigen-binding transmembrane domain comprising the amino acid sequences of SEQ ID NOs: 35 and 37. The antigen-binding domain of CD27 specifically binds to CD70.

[0089] In one embodiment of the present invention, the antigen-binding domain of CD27 has the amino acid sequence of SEQ ID NO: 41 (R58W), the transmembrane domain of CD27 has the amino acid sequence of SEQ ID NO: 37, and the intracellular signaling domain of CD27 has the amino acid sequence of SEQ ID NO: 39. Thus, in one embodiment of the present invention, the CAR comprises an antigen-binding transmembrane domain comprising the amino acid sequences of SEQ ID NOs: 41 and 37.

[0090] One embodiment of the present invention provides a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen-binding transmembrane domain that includes the amino acid sequence of CD27 lacking all or a part of the CD27 co-stimulatory domain, wherein the portion lacking from the CAR is at least consecutive amino acid residues 238-260, at least consecutive amino acid residues 237-260, at least consecutive amino acid residues 236-260, at least consecutive amino acid residues 235-260, at least consecutive amino acid residues 234-260, at least consecutive amino acid residues 233-260, at least consecutive amino acid residues 232-260, at least consecutive amino acid residues 231-260, at least consecutive amino acid residues 230-260, at least consecutive amino acid residues 229-260, at least adjacent amino acid residues 228-260, at least consecutive amino acid residues 227-260, at least consecutive amino acid residues 226-260, at least consecutive amino acid residues 225-260, at least consecutive amino acid residues 224-260, at least consecutive amino acid residues 223-260, at least consecutive amino acid residues 222-260, at least consecutive amino acid residues 221-260, at least consecutive amino acid residues 220-260, at least consecutive amino acid residues 219-260, at least consecutive amino acid residues 218-260, at least consecutive amino acid residues 217-260, at least consecutive amino acid residues 216-260, at least consecutive amino acid residues 215-260, at least consecutive amino acid residues 214-260, at least consecutive amino acid residues 213-260, or at least consecutive amino acid residues 212-260 of SEQ ID NO: 33.

[0091] In one embodiment, the antigen-binding transmembrane domain comprises the amino acid sequence of CD27 lacking the consecutive amino acid residues 238-260, 237-260, 236-260, 235-260, 235-260, 234-260, 233-260, 232-260, 231-260, 230-260, 229-260, 228-260, 227-260, 226-260, 225-260, 224-260, 223-260, 222-260, 221-260, 220-260, 219-260, 218-260, 217-260, 216-260, 215-260, 214-260, 213-260, or 212-260 of SEQ ID NO: 33.

[0092] The amino acid sequence of CD27 lacking all or part of the CD27 co-stimulatory domain is also referred to herein as the "truncated CD27 amino acid sequence" or "truncated CD27". Thus, in embodiments, the nucleic acids disclosed herein encode a truncated CD27 amino acid sequence.

[0093] In a preferred embodiment, the nucleic acid encodes a CAR comprising an antigen-binding domain comprising or consisting of at least SEQ ID NO: 35 or SEQ ID NO: 41, a transmembrane domain comprising or consisting of SEQ ID NO: 37, and a co-stimulatory domain comprising or consisting of SEQ ID NO: 39, and optionally further comprises a signal peptide, preferably wherein the signal peptide comprises or consists of SEQ ID NO: 2.

[0094] In an embodiment, the CAR encoded by the nucleic acid may further include at least one co-stimulatory domain, wherein the co-stimulatory domain is, for example, a functional co-stimulatory signaling domain derived from, for example, an MHC class I molecule, a TNF receptor protein, an immunoglobulin-like protein, a cytokine receptor, an integrin, a signaling lymphocyte activation molecule (SLAM protein), an activated NK cell receptor, BTLA, a Toll ligand receptor, and the like. For example, it is within the scope of the present disclosure that the CAR may include 2, 3, 4 or more co-stimulatory domains. It is also within the scope of the present disclosure that when multiple co-stimulatory domains are included, the co-stimulatory domains may be the same or different.In an embodiment, the co-stimulatory domain is derived from one or more, or a part thereof, and one or more combinations thereof, of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, B7-H3, CEACAM1, CRTAM, CD2, CD3C, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, IL2Rβ, IL2γ, IL7Rα, IL4R, IL7R, IL15R, IL21R, CD18, CD19, CD19a, CD27, CD28, CD29, CD30, CD40, CDS, CD49a, CD49D, CD49f, CD54(ICAM), CD69, CD70, CD80, CD83, CD84, CD86, CD96(Tactile), CD100(SEMA4D), CD103, CD134(OX40), CD137(4-1BB), CD152(CTLA-4), CD160(BY55), CD162(SELPLG), CD244(2B4), CD270(HVEM), CD226(DNAM1), CD229(Ly9), CD278(ICOS), ICAM-1, LFA-1(CD11a / CD18), FcR, FcγRI, FcγRII, FcγRIII, LAT, NKG2C, SLP76, TRIM, ZAP70, GITR, BAFFR, LTBR, LAT, GADS, LIGHT, HVEM(LIGHTR), KIRDS2, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, NKG2C, NKG2D, IA4, VLA-1, VLA-6, SLAM(SLAMF1, CD150, IPO-3), SLAMF4, SLAMF6(NTB-A, Ly108), SLAMF7, SLAMF8(BLAME), SLP-76, PAG / Cbp, NKp80(KLRF1), NKp44, NKp30, NKp46, BTLA, JAML, CD150, PSGL1, TSLP, TNFR2, and TRANCE / RANKL.

[0095] In some embodiments, the nucleic acid encoding the CAR encodes at least one 4-1BB co-stimulatory domain and optionally a second co-stimulatory domain selected from the 4-1BB, 2B4, ICOS, CD28, OX40, and CD27 co-stimulatory domains, or any of the co-stimulatory domains described above. In some embodiments, the nucleic acid encodes at least two 4-1BB co-stimulatory domains, or at least two 4-1BB co-stimulatory domains in combination with one, two, three, or four or more co-stimulatory domains selected from 4-1BB, ICOS, CD28, OX40, and CD27, or any of the co-stimulatory domains described above. In some embodiments, the 4-1BB co-stimulatory domain comprises SEQ ID NO: 4. In some embodiments, the 4-1BB co-stimulatory domain comprises an amino acid sequence having at least one, at least two, or at least three or more modifications of the amino acid sequence of SEQ ID NO: 4. In embodiments, the 4-1BB co-stimulatory domain is substantially similar to the 4-1BB co-stimulatory domain comprising SEQ ID NO: 4.

[0096] In some embodiments, the nucleic acid encoding the CAR encodes at least one CD27 co-stimulatory domain and optionally at least one second co-stimulatory domain selected from the 4-1BB, ICOS, CD28, OX40, 2B4, and CD27 co-stimulatory domains, or any of the co-stimulatory domains described above. In some embodiments, the nucleic acid encodes at least one CD27 co-stimulatory domain and a 4-IBB co-stimulatory domain. In some embodiments, the nucleic acid encodes two CD27 co-stimulatory domains and at least one second co-stimulatory domain selected from 4-1BB, ICOS, CD28, and CD27. In some embodiments, the CD27 co-stimulatory domain comprises SEQ ID NO: 39. In some embodiments, the CD27 co-stimulatory domain comprises an amino acid sequence having at least one, at least two, at least three, or more modifications of the amino acid sequence of SEQ ID NO: 39. In some embodiments, the CD27 co-stimulatory domain is substantially similar to the CD27 co-stimulatory domain comprising SEQ ID NO: 39.

[0097] In some embodiments, the nucleic acid encoding the CAR encodes at least one CD28 co-stimulatory domain and optionally a second co-stimulatory domain selected from the 4-1BB, 2B4, ICOS, CD28, OX40, and CD27 co-stimulatory domains, or any of the co-stimulatory domains described above. In some embodiments, the nucleic acid encodes at least two CD28 co-stimulatory domains, or at least two CD28 co-stimulatory domains in combination with one, two, three, or four or more co-stimulatory domains selected from 4-1BB, ICOS, CD28, OX40, and CD27, or any of the co-stimulatory domains described above. In some embodiments, the CD28 co-stimulatory domain comprises SEQ ID NO: 73. In some embodiments, the CD28 co-stimulatory domain comprises SEQ ID NO: 74. Contained in SEQ ID NO: 73 and SEQ ID NO: 74 are YMNM, PRRP, and PYAP, which are three subdomains capable of regulating signal transduction pathways. In embodiments, the disclosed CARs contain one or more mutations or deletions of the subdomains (see, e.g., WO2019010383). In some embodiments, the CD28 co-stimulatory domain comprises an amino acid sequence having at least one, at least two, at least three, or more modifications of the amino acid sequence of SEQ ID NO: 73 or the amino acid sequence of SEQ ID NO: 74. In some embodiments, the CD28 co-stimulatory domain is substantially similar to the CD28 co-stimulatory domain comprising SEQ ID NO: 73. In some embodiments, the CD28 co-stimulatory domain is substantially similar to the CD28 co-stimulatory domain comprising SEQ ID NO: 74.

[0098] In some embodiments, the nucleic acid encoding the CAR encodes at least one ICOS co-stimulatory domain and optionally a second co-stimulatory domain selected from the 4-1BB, 2B4, ICOS, CD28, OX40, and CD27 co-stimulatory domains, or any of the co-stimulatory domains described above. In some embodiments, the nucleic acid encodes at least two ICOS co-stimulatory domains, or at least two ICOS co-stimulatory domains in combination with one, two, three, or four or more co-stimulatory domains selected from 4-1BB, ICOS, CD28, OX40, and CD27, or any of the co-stimulatory domains described above. In some embodiments, the ICOS co-stimulatory domain comprises SEQ ID NO: 75. In some embodiments, the ICOS co-stimulatory domain comprises an amino acid sequence having at least one, at least two, at least three, or more modifications of the amino acid sequence of SEQ ID NO: 75 (see, e.g., US20170209492). In some embodiments, the ICOS co-stimulatory domain is substantially similar to the ICOS co-stimulatory domain comprising SEQ ID NO: 75.

[0099] In some embodiments, the nucleic acid encoding the CAR encodes at least one OX40 co-stimulatory domain and optionally a second co-stimulatory domain selected from the 4-1BB, 2B4, ICOS, CD28, OX40, and CD27 co-stimulatory domains, or any of the co-stimulatory domains described above. In some embodiments, the nucleic acid encodes at least two OX40 co-stimulatory domains, or at least two OX40 co-stimulatory domains in combination with one, two, three, or four or more co-stimulatory domains selected from 4-1BB, ICOS, CD28, OX40, and CD27, or any of the co-stimulatory domains described above. In some embodiments, the OX40 co-stimulatory domain comprises SEQ ID NO: 76. In some embodiments, the OX40 co-stimulatory domain comprises an amino acid sequence having at least one, at least two, at least three, or more modifications of the amino acid sequence of SEQ ID NO: 76. In some embodiments, the OX40 co-stimulatory domain is substantially similar to the OX40 co-stimulatory domain comprising SEQ ID NO: 76.

[0100] In embodiments, the nucleic acid encoding the CAR encodes at least one intracellular signaling domain. In embodiments, at least one intracellular signaling domain is added to one or more co-stimulatory domains. In embodiments, one or more intracellular signaling domains are included to enhance the proliferation, persistence, and / or cytotoxic activity of host cells, preferably γδ cells, carrying the CAR as disclosed herein. For example, in some embodiments, the intracellular signaling domain(s) include signaling domains derived from CD3ζ, repeat (e.g., 2-5) DAP10YINM motif; LFA-1, DAP12, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD79a, CD79b, CD5, CD22, FcεRI, CD66d, etc. It is within the scope of the present disclosure that the endodomain of the disclosed CAR may include multiple (e.g., 2, 3, 4, or more) intracellular signaling domains. When multiple intracellular signaling domains are included, the intracellular signaling domains may be the same or different.

[0101] In some embodiments, the intracellular signaling domain of the disclosed CAR is, or includes, the CD3ζ signaling domain. In some embodiments, the signaling domain of CD3ζ is, or includes, the amino acid sequence set forth in SEQ ID NO: 10, 12, or 13.

[0102] In some embodiments, the nucleic acid encoding the CAR encodes one or more co-stimulatory domains (e.g., 4-1BB co-stimulatory domain) and one or more intracellular signaling domains (e.g., CD3ζ signaling domain). In some embodiments, the nucleic acid encodes at least one 4-1BB co-stimulatory domain, at least one CD27 or CD28 domain, and at least one CD3ζ signaling domain. In other embodiments, the nucleic acid encodes one or more first co-stimulatory domains (e.g., 4-1BB, CD27, CD28, OX40, ICOS), one or more second co-stimulatory domains (e.g., 4-1BB, CD27, CD28, OX40, ICOS), and one or more intracellular signaling domains (e.g., CD3ζ). In embodiments, the CD3ζ signaling domain is downstream (C-terminus) of the co-stimulatory domain(s) (e.g., 4-1BB). In some embodiments, the CD3ζ signaling domain is upstream (N-terminus) of the co-stimulatory domain(s) (e.g., 4-1BB).

[0103] In embodiments, the isolated nucleic acid encoding the CAR of the subject invention can also encode one or more polycistronic linker region(s) configured to facilitate the translation of the CAR polypeptide and one or more additional polypeptides. In embodiments, the nucleic acid encoding the one or more additional polypeptides and the associated linker region(s) can be located at the 3′ end of the isolated nucleic acid, or at the 5′ end of the isolated nucleic acid, or in some instances at both the 5′ and 3′ ends of the isolated nucleic acid. In some instances, the linker region(s) can encode a self-cleaving and / or cleaving polypeptide sequence. In some instances, the self-cleaving sequence is a 2A self-cleaving sequence (e.g., T2A, P2A, E2A, F2A) that can induce ribosome skipping during translation of the CAR. In embodiments, the cleaving sequence is a furin sequence. In some instances, the cleaving sequence (e.g., the furin cleavage sequence shown in SEQ ID NO: 79) is the amino terminus of a self-cleaving sequence, e.g., furin P2A (FP2A). In some embodiments, the polycistronic linker region encodes an internal ribosome entry site. In some embodiments, the addition of any linker such as “GSG” or “SGSG” can improve the cleavage efficiency. In this way, one or more additional polypeptides can be released from the CAR and directed to the secretory pathway.

[0104] In some embodiments, the cleavage sequence is the FP2A amino acid sequence set forth in SEQ ID NO: 6. In some embodiments, the cleavage sequence is the P2A amino acid sequence set forth in SEQ ID NO: 8 or SEQ ID NOs: 77-78. In some embodiments, the cleavage sequence is the amino acid sequence of furin set forth in SEQ ID NO: 79. In some embodiments, the cleavage sequence is the F2A amino acid sequence set forth in SEQ ID NO: 80. In some embodiments, the cleavage sequence is the E2A amino acid sequence set forth in SEQ ID NO: 81. In some embodiments, the cleavage sequence is the T2A amino acid sequence set forth in SEQ ID NO: 82. In certain embodiments, the multiple cleavage sequence and / or self-cleaving sequence can be encoded at the carboxy terminus of the signaling domain and / or costimulatory domain(s) and the amino terminus of one or more additional polypeptides encoded. In certain embodiments, one or more self-cleaving sequences and one or more sequences cleaved by endogenous proteases are encoded in the constructs described herein. In certain embodiments, the endogenous protease recognition site is encoded at the amino terminus of the self-cleaving sequence. Further suitable internal ribosome entry sites include those disclosed in Nucleic Acids Res. 2010, Jan; 38(Database issue): D131-6.doi:10.1093 / nar / gkp981.Epub, 2009, Nov. 16; those described at iresite.org; those described in WO2018 / 215787; the sequence described in GenBank accession No. KP019382.1; and the IRES element described in GenBank accession No. LT727339.1, but are not limited thereto. Additional multicistronic linker regions containing cleavage self-cleavage and IRES elements are disclosed in US2018 / 0360992 and US8,865,467.

[0105] In some embodiments, the polycistronic linker region encodes an internal ribosome entry site. Exemplary internal ribosome entry sites are encoded by the nucleotide sequences shown in SEQ ID NO: 83. Another exemplary internal ribosome entry site is encoded by the nucleotide sequence shown in SEQ ID NO: 84.

[0106] In embodiments, the one or more additional polypeptides include one or more soluble common gamma chain cytokines expressed as a polypeptide separate from the CAR. The one or more soluble common gamma chain cytokines include, but are not limited to, IL-2, IL-4, IL-7, IL-9, IL-15, IL-21, IL-23. In some embodiments, the common gamma chain cytokine is selected from IL-2, IL-7, and IL-15. In some embodiments, the common gamma chain cytokine is IL-15. IL-15 sequences containing a codon-optimized nucleic acid sequence encoding soluble IL-15 (sIL-15) are disclosed herein and in WO2007 / 037780.

[0107] In embodiments, the one or more additional polypeptides include one or more labels or markers, for example, to facilitate the ability to monitor CAR expression levels, to function as an internal control, etc. In some embodiments, the isolated nucleic acid encoding the CAR encodes a fluorescent protein, examples of which include, but are not limited to, green fluorescent protein (GFP), red fluorescent protein (RFP), enhanced GFP (EGFP), enhanced cyan fluorescent protein (ECFP), enhanced yellow fluorescent protein (EYFP). Other examples include, but are not limited to, chloramphenicol acetyltransferase, β-galactosidase, β-glucuronidase, β-lactamase, luciferase.

[0108] In embodiments, one or more additional polypeptides can encode a protein that is expressed on the cell surface, for example, to facilitate detection and / or isolation of cells expressing the protein via fluorescence-activated cell sorting (FACS); or for enrichment by positive selection using an antibody specific for the encoded protein, for example, an antibody for purifying or concentrating a cell product on a column or device; or for in vivo binding of an antibody to a protein to enhance or remove activity, for example, to facilitate removal of cells expressing the protein in a patient considering safety. Exemplary proteins useful for these purposes include, for example, CD19, CD20 (rituximab recognition domain), LNGFR, truncated human epidermal growth factor receptor (EGFRt), and the like. As an example, EGFRt can be targeted by a clinical-stage antibody, and such treatment of a patient with the antibody results in elimination of isolated nucleic acids encoding the CAR and / or cells comprising the CAR as disclosed herein.

[0109] In embodiments, one or more additional polypeptides include proteins that function to enhance resistance to exhaustion and activation-induced apoptosis and / or to upregulate one or more pro-inflammatory cytokines, co-stimulatory molecules, and / or antigen presentation machinery. A representative example, but not limited to, is lymphotoxin beta receptor (LTBR). LTBR is normally expressed in a subset of myeloid cells but not in lymphocytes. When expressed in T cells, LTBR may induce transcriptional remodeling that confers one or more of the above advantageous functions to the T cells (Legut et al., Blood. (2021); 138(1):1726).

[0110] In some embodiments, the one or more additional polypeptides include, for example, polypeptides that confer on the host cell the ability to be resistant to tumor antigen-specific cellular immunity mediated by transforming growth factor beta (TGF-β). For example, the isolated nucleic acid may encode a dominant negative receptor for TGF-beta (dnTGFβR2) as described, for example, in Foster et al., J. Immunother. (2008); 31:500-505, WO2019 / 173324A1, WO2020 / 183131A1, and WO2020042647A1. Incorporating such a dominant negative receptor for TGF-β may provide functional advantages such as enhanced antitumor activity relative to control cells that do not have the dominant negative receptor for TGF-β in the presence of a tumor that secretes TGF-β. In some embodiments, the isolated nucleic acid encodes a signal peptide operably linked to facilitate the induction of one or more additional polypeptides into the secretory pathway. Such one or more additional polypeptides can be those that are present inside a particular organelle, secreted from the host cell, or inserted into the cell membrane. In embodiments, the signal peptide comprises, or consists of, the amino acid sequence set forth in SEQ ID NO: 2. In embodiments, the signal peptide comprises, or consists of, the amino acid sequence set forth in SEQ ID NO: 17. In embodiments, the signal peptide comprises, or consists of, the amino acid sequence set forth in SEQ ID NO: 21. In embodiments, the signal peptide comprises, or consists of, the amino acid sequence set forth in SEQ ID NO: 25. In embodiments, the signal peptide comprises, or consists of, the amino acid sequence set forth in SEQ ID NO: 29. In embodiments, the signal peptide comprises, or consists of, the amino acid sequence set forth in SEQ ID NO: 85.

[0111] In some embodiments, the one or more additional polypeptides comprise the amino acid sequence of EGFRt set forth in SEQ ID NO: 19. In embodiments, a signal peptide comprising, or consisting of, the amino acid sequence set forth as SEQ ID NO: 17 is operably linked to SEQ ID NO: 19. In some embodiments, the one or more additional polypeptides comprise the amino acid sequence of dominant negative TGFβ receptor II (dnTGFβR2) set forth in SEQ ID NO: 23. In embodiments, a signal peptide comprising, or consisting of, the amino acid sequence set forth as SEQ ID NO: 21 is operably linked to SEQ ID NO: 23. In some embodiments, the one or more additional polypeptides comprise the amino acid sequence of full-length LTBR set forth in SEQ ID NO: 27. In embodiments, a signal peptide comprising, or consisting of, the amino acid sequence set forth as SEQ ID NO: 25 is operably linked to SEQ ID NO: 27. In some embodiments, the one or more additional polypeptides comprise the amino acid sequence of LNGFR set forth in SEQ ID NO: 31. In embodiments, a signal peptide comprising, or consisting of, the amino acid sequence set forth as SEQ ID NO: 21 is operably linked to SEQ ID NO: 23. In some embodiments, the one or more additional polypeptides comprise the amino acid sequence of sIL-15 set forth in SEQ ID NO: 86. In embodiments, a signal peptide comprising, or consisting of, the amino acid sequence set forth as SEQ ID NO: 85 is operably linked to SEQ ID NO: 86.

[0112] In some embodiments, the one or more additional polypeptides include a chimeric switch receptor comprising an extracellular domain of a TGFβ receptor for binding TGFβ (e.g., TGFβRI and / or TGFβRII) and an intracellular domain of a cytokine receptor. The chimeric switch receptor can convert a TGFβ signal into a cytokine signal that promotes cytotoxicity. Examples of such chimeric switch receptors are described in WO201213,8858, WO2016122738, WO2018094244, WO2014172584, WO2019109980, and WO2022037562, each of which is incorporated by reference in its entirety.

[0113] In embodiments, the one or more additional polypeptides include dominant negative Fas (dnFas). Incorporating such dominant negative Fas into T cells may be functionally advantageous over control cells lacking such dominant negative Fas in preventing Fas ligand-induced apoptosis and enabling T cell persistence and anti-tumor effects. Examples of dnFas include those described in Yamamoto TN et al., T cells genetically engineered to overcome death signaling enhance adoptive cancer immunotherapy, J Clin Invest. 2019, Feb. 25;129(4):1551-1565, which is hereby incorporated by reference in its entirety.

[0114] In embodiments, the one or more additional polypeptides include membrane-bound IL-12 (mbIL-12). Incorporating such mbIL-12 into T cells may be functionally advantageous over control cells lacking such mbIL-12 in enhancing the effector function of T cells and / or suppressing the systemic toxicity associated with IL-12. Examples of mbIL-12 include those described in Hu J. et al., Cell membrane-anchored and tumor-targeted IL-12 (attIL12)-T cell therapy for eliminating large and heterogeneous solid tumors, J. Immunother. Cancer. 2022, Jan;10(1):e003633; Hombach A. et al., IL12 integrated into the CAR exodomain converts CD8+ T cells to poly-functional NK-like cells with superior killing of antigen-loss tumors, Mol. Ther. 2022, Feb. 2;30(2):593-605; and Lee EH. et al., Antigen-dependent IL-12 signaling in CAR T cells promotes regional to systemic disease targeting, bioRxiv. 2023, Jan. 7;2023.01.06.522784, each of which is incorporated herein by reference in its entirety.

[0115] The present disclosure provides CARs having "substantial identity" or "substantial similarity" to the sequences provided herein. The term "substantial identity" or "substantially identical," when referring to a nucleic acid or a fragment thereof, when optimally aligned with another nucleic acid (or the complementary strand of another nucleic acid), as measured by any well-known algorithm for sequence identity, such as FASTA, BLAST, or GAP, as described below, indicates, for example, nucleotide sequence identity of at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% of the nucleotide bases. A nucleic acid molecule having substantial identity to a reference nucleic acid molecule may, in certain instances, encode a polypeptide having the same or substantially similar amino acid sequence as the polypeptide encoded by the reference nucleic acid molecule.

[0116] When applied to polypeptides, the terms "substantially similar" or "substantially similarity" mean that when optimally aligned by programs such as GAP or BESTFIT using the default gap weights, two peptide sequences share at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% sequence identity. In some embodiments, the positions of non-identical residues differ by conservative amino acid substitutions. A "conservative amino acid substitution" is one in which an amino acid residue is replaced with another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, conservative amino acid substitutions will not substantially change the functional properties of the protein. If two or more amino acid sequences differ from each other by conservative substitutions, the percent or degree of similarity may be adjusted upward to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. See, for example, Pearson, (1994), Methods Mol. Biol. 24:307-331 (incorporated herein by reference). Examples of groups of amino acids having side chains with similar chemical properties include the following: 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic hydroxyl side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containing side chains: cysteine and methionine. Preferred conservative amino acid substituents are valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspartate, and asparagine-glutamine.Alternatively, a conservative substitution is any change in the PAM250 log-likelihood matrix, which is incorporated herein by reference from Gonnet et al. (1992) Science, 256:1443-45, that has a positive value. A "moderately conservative" substitution is any change that has a non-negative value in the PAM250 log-likelihood matrix.

[0117] The sequence identity and / or similarity of polypeptides is typically measured using sequence analysis software. Protein analysis software matches similar sequences using similarity measures assigned to various substitutions, deletions, and other modifications, including conservative amino acid substitutions. For example, GCG software contains programs such as GAP and BESTFIT, which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species, or between a wild-type protein and its mutant protein. See, for example, GCG version 6.1. Polypeptide sequences can also be compared using the FASTA program of GCG version 6.1 with default or recommended parameters. FASTA (e.g., FASTA2 and FASTA3) provides a sequence comparison of the best overlapping regions between a query sequence and a search sequence and the percentage of sequence identity (Pearson (2000) supra). Sequences can also be compared using the Smith-Waterman homology search algorithm with an affine gap search having a gap open penalty of 12, a gap extension penalty of 2, and a BLOSUM matrix of 62. Another preferred algorithm for comparing a database containing a large number of sequences from different organisms with the sequences disclosed herein is the computer program BLAST, particularly BLASTP or TBLASTN, using default parameters. See, for example, Altschul et al. (1990), J. Mol. Biol. 215:403-410 and (1997), Nucleic Acids Res. 25:3389-3402, each of which is incorporated herein by reference.

[0118] Alternatively or additionally, the parent CAR of the present disclosure can include at least one non-conservative amino acid substitution. In this case, it is preferred that the non-conservative amino acid substitution does not interfere with or inhibit the biological activity of the parent CAR. Since the non-conservative amino acid substitution may enhance the biological activity of the modified CAR, the biological activity of the modified CAR is increased compared to the parent CAR.

[0119] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL648 having SEQ ID NO: 45 and the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, and an EGFP domain.

[0120] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1090 having SEQ ID NO: 47 and the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, a signal peptide, and an EGFRt domain.

[0121] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1093 having SEQ ID NO: 49 and the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, a signal peptide, and a TGFβR2 domain.

[0122] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1106 having SEQ ID NO: 51 and the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, a signal peptide, and an LTBR domain.

[0123] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1107 having SEQ ID NO: 53 and the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, and a CD3ζ signaling domain.

[0124] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1110 having SEQ ID NO: 55 and the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, a signal peptide, and an LNGFRt domain.

[0125] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1179 having SEQ ID NO: 57 and the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, a P2A cleavage domain, a signal peptide, and a TGFβR2 domain.

[0126] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1099 having SEQ ID NO: 59 and the following domains in order: a full-length CD27 domain, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, a P2A cleavage domain, a signal peptide, and an LNGFRt domain.

[0127] In any of the above CAR polypeptides encoded by the isolated nucleic acid, the FP2A cleavage domain may be replaced by a P2A cleavage domain (or other cleavage domain), and vice versa. Further, or alternatively, any of the above CAR polypeptides may include an R58W modification.

[0128] In some embodiments, the nucleic acid encoding the PL648 CAR comprises the sequence of SEQ ID NO: 46.

[0129] In some embodiments, the nucleic acid encoding the PL1090 CAR comprises the sequence of SEQ ID NO: 48.

[0130] In some embodiments, the nucleic acid encoding the PL1093 CAR comprises the sequence of SEQ ID NO: 50.

[0131] In some embodiments, the nucleic acid encoding the PL1106 CAR comprises the sequence of SEQ ID NO: 52.

[0132] In some embodiments, the nucleic acid encoding the PL1107 CAR comprises the sequence of SEQ ID NO: 54.

[0133] In some embodiments, the nucleic acid encoding the PL1110 CAR comprises the sequence of SEQ ID NO: 56.

[0134] In some embodiments, the nucleic acid encoding the PL1179 CAR comprises the sequence of SEQ ID NO: 58.

[0135] In some embodiments, the nucleic acid encoding the PL1099 CAR comprises the sequence of SEQ ID NO: 60.

[0136] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1092 comprising, in order, the sequence of SEQ ID NO: 61, the following domains: a full-length CD27 domain containing an R58W modification, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, and an EGFRt domain.

[0137] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1095 comprising, in order, the sequence of SEQ ID NO: 63, the following domains: a full-length CD27 domain containing an R58W modification, a 4-1BB co-stimulatory domain, a CD3ζ signaling domain, an FP2A cleavage domain, and an EGFP domain.

[0138] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1109 comprising, in order, the sequence of SEQ ID NO: 65, the following domains: a full-length CD27 domain containing an R58W modification, a 4-1BB co-stimulatory domain, and a CD3ζ signaling domain.

[0139] In any of the above CAR polypeptides containing the R58W modification, the FP2A cleavage domain may be replaced by a P2A cleavage domain (or other cleavage domain). Further, or alternatively, another additional polypeptide, for example, EGFP or EGFRt may be replaced with dnTGFβR2.

[0140] In some embodiments, the nucleic acid encoding the PL1092 CAR comprises the sequence of SEQ ID NO: 62.

[0141] In some embodiments, the nucleic acid encoding the PL1095 CAR comprises the sequence of SEQ ID NO: 64.

[0142] In some embodiments, the nucleic acid encoding the PL1109 CAR comprises the sequence of SEQ ID NO: 66.

[0143] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1091 that comprises, in order, the sequence of SEQ ID NO: 67, the following domains: truncated CD27 domain, 4-1BB co-stimulatory domain, CD3ζ signaling domain, FP2A cleavage domain, and EGFRt domain.

[0144] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1094 that comprises, in order, the sequence of SEQ ID NO: 69, the following domains: truncated CD27 domain, 4-1BB co-stimulatory domain, CD3ζ signaling domain, FP2A cleavage domain, and EGFP domain.

[0145] In some embodiments, the isolated nucleic acid encodes a CAR polypeptide PL1108 that comprises, in order, the sequence of SEQ ID NO: 71, the following domains: truncated CD27 domain, 4-1BB co-stimulatory domain, and CD3ζ signaling domain.

[0146] In any of the above CAR polypeptides comprising truncated CD27, the FP2A cleavage domain may be replaced by a P2A cleavage domain (or other cleavage domain). Further, or alternatively, another additional polypeptide, for example, EGFP or EGFRt may be replaced with dnTGFβR2.

[0147] In some embodiments, the nucleic acid encoding the PL1091 CAR comprises the sequence of SEQ ID NO: 68.

[0148] In some embodiments, the nucleic acid encoding the PL1094 CAR comprises the sequence of SEQ ID NO: 70.

[0149] In some embodiments, the nucleic acid encoding the PL1108 CAR comprises the sequence of SEQ ID NO: 72.

[0150] Representative CARs of the present disclosure are summarized in Table 1 together with the relevant SEQ ID numbers corresponding to the CAR amino acid sequences. Further sequences relevant to the present disclosure are summarized in Table 1 below.

Table 1

[0151] In some embodiments, as described in Leick et al., Cancer Cell, (2022); 40:1 - 15, the content of which is incorporated herein by reference in its entirety, the isolated nucleic acid encodes a CAR polypeptide comprising the following domains in order: a protease-resistant CD27 comprising a CD8α hinge and a transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3ζ intracellular signaling domain. Other co-stimulatory domains and / or intracellular signaling domains disclosed herein may further or alternatively be included in such CAR polypeptides. Further, other hinges and / or transmembrane domains are within the scope of the present disclosure for the production of CAR polypeptides comprising protease-resistant CD27.

[0152] For example, without limitation, the transmembrane domain may be of natural or synthetic origin. When the source is natural, the domain may be derived from any membrane-bound or transmembrane protein. The transmembrane regions particularly used in the present invention are 4-1BB / CD137, activating NK cell receptor, immunoglobulin protein, B7-H3, BAFFR, BL4-1BB / CD137, activating NK cell receptor, immunoglobulin protein, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD3 zeta, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8, CD8α, CD8β, CD96 (tactile), CD11a, CD11b, CD11c, CD11d, CDS, CEACAM1, CRTAM, cytokine receptor, DAP10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Igα (CD79a), IL-2Rβ, IL-2Rγ, IL-7Rα, inducible T cell co-stimulator (ICOS), integrin, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGBl, KIRDS2, LAT, LFA-1, a ligand that specifically binds to CD83, LIGHT, LTBR, Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD11a / CD18), MHC class 1 molecule, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), signal-transducing lymphocyte activation molecule (SLAM protein), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A;It may be derived from Lyl08), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or fragments, truncated forms, or combinations thereof (i.e., including at least their transmembrane region(s)). Alternatively, the transmembrane domain may be synthetic, in which case it will mainly contain hydrophobic residues such as leucine and valine. Preferably, a triplet of phenylalanine, tryptophan, and valine will be found at each end of the synthetic transmembrane domain.;

[0153] For example, but not limited to, the hinge region related to the present disclosure may be derived from the extracellular region of type I membrane proteins such as CD8α, CD8β, CD4, CD28, CD28T, 4-1BB, CD7, and may be the wild-type hinge region of these molecules or may be modified.

[0154] B. Expression of the CAR construct As used herein, an isolated nucleic acid is intended to mean a DNA molecule that is transformed or introduced into a host cell, preferably a γδ T cell, and transcribed and translated to produce a product (e.g., the CAR described herein). In the isolated nucleic acid of the present invention, the promoter is operably linked to the nucleic acid sequence encoding the CAR of the present invention, i.e., it is arranged to promote the transcription of messenger RNA from the DNA encoding the CAR. The term "operably linked" refers to the juxtaposition of the components so described in a relationship that enables them to function in the intended manner.

[0155] The promoter can be of genomic origin or synthetically generated. Various promoters for use in host cells related to the present disclosure are well known in the art (for example, the CD4 promoter disclosed by Marodon, et al. (2003) Blood, 101(9):3416-23). The promoter can be constitutive or inducible, and the induction is related to a specific cell type or a specific maturation level. Alternatively, a number of well-known viral promoters can also be suitable. Promoters of interest include the β-actin promoter, the SV40 early and late promoters, the immunoglobulin promoter, the human cytomegalovirus promoter, the retroviral promoter, and the Friend spleen focus-forming virus promoter. The promoter may or may not be associated with an enhancer, and the enhancer may be naturally associated with a specific promoter or associated with a different promoter. In an embodiment, the expression of the CAR polypeptide is under the control of an inducible promoter, for example, a promoter that can be induced by a molecule present in the tumor microenvironment (e.g., TGFβ).

[0156] The sequences of the open reading frames encoding various segments of the CARs of the present disclosure can be obtained from genomic DNA sources, cDNA sources, or can be synthesized (e.g., via PCR), or combinations thereof.

[0157] In an embodiment, for the expression of the CARs of the present invention, the CAR can be produced in host cells using the naturally occurring or endogenous transcription start region of the nucleic acid sequence encoding the N-terminal component of CD27. Alternatively, exogenous transcription start regions that allow constitutive or inducible expression can be used, and the expression can be optionally controlled according to the host cell, the desired expression level, the nature of the host cell, etc.

[0158] The terminating region encoding the C-terminal component of the CAR may be included. Generally speaking, the source of the terminating region is considered unimportant for the expression of the recombinant protein, and a wide variety of terminating regions can be adopted without adversely affecting the expression.

[0159] The isolated nucleic acid encoding the CAR according to the present invention can be prepared by conventional methods. The sequence (natural or synthetic) is isolated and appropriately manipulated so that various components can be properly joined. Thus, the various nucleic acid sequences encoding the various segments of the CAR can be isolated by using appropriate primers, for example, by utilizing the polymerase chain reaction (PCR). If necessary, specific primers can be designed that result in the deletion of unwanted portions of the nucleic acid sequence used as a template. Additionally, or alternatively, the isolated nucleic acid constructs of the present disclosure can be generated using restriction digests of cloned genes. In either case, the sequences can be selected to provide blunt-ended restriction sites or to have complementary overlaps to facilitate integration into various vectors. In the examples, modifications of the nucleic acid sequence (such as introducing one or more point mutations, insertions, or deletions) are performed. In one embodiment regarding the CAR of the present disclosure, the modification can include, for example, an amino acid change at position R58 of SEQ ID NO: 35. Methods for introducing modifications into nucleic acid sequences are known in the art and can include the use of various commercially available kits (e.g., QuickChange Site Directed Mutagenesis Kit, Agilent, Santa Clara, CA).

[0160] The various operations for preparing an isolated nucleic acid encoding the CAR of the present disclosure can be carried out in vitro. In certain embodiments, the sequence encoding the CAR is introduced into a vector for cloning and expression in a suitable host cell using standard transformation or transfection methods. Thus, after each operation, the construct obtained from the ligation of the DNA sequences is cloned, the vector is isolated, and the sequences are screened to confirm that the sequence encodes the desired CAR. The sequences can be screened by restriction analysis, sequencing, etc.

[0161] It is contemplated that the isolated nucleic acid can be introduced into a host cell as naked DNA or in a suitable vector. Many suitable vectors are known to those of ordinary skill in the art of molecular biology, and this selection depends on the desired function and includes plasmids, cosmids, viruses, bacteriophages, and other vectors conventionally used in genetic engineering. Methods well known to those of skill in the art can be used to construct various plasmids and vectors, see for example the techniques described below: Sambrook et al. (1989) and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1989), (1994). Alternatively, the polynucleotides and vectors of the present disclosure can be reconstituted into liposomes for delivery to target cells.

[0162] Methods for stably transfecting host cells by electroporation using naked DNA are known in the art (see for example U.S. Patent No. 6,410,319 which discloses transfection of T cells). Naked DNA generally refers to the DNA encoding the CAR of the present invention contained within a plasmid expression vector in the appropriate orientation for expression. Advantageously, the use of naked DNA shortens the time required to generate host cells expressing the CAR of the present invention.

[0163] Alternatively, an isolated nucleic acid encoding the CAR of the present invention can be introduced into a host cell using a viral vector (e.g., a retroviral vector, an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector). A vector suitable for use according to the method of the present invention does not replicate in T cells. A number of virus-based vectors are known, and the copy number of the virus maintained intracellularly is low enough to maintain the viability of the cells. Exemplary vectors include the pFB-neo vector (STRATAGENE®) and vectors based on HIV, SV40, EBV, HSV, or BPV.

[0164] Thus, in some embodiments, it may be understood that the isolated nucleic acid is a circular nucleic acid. In some embodiments, the isolated nucleic acid is a vector, e.g., a plasmid vector, an adenoviral vector, an adeno-associated viral vector, a viral vector, a retroviral vector (e.g., a gammaretroviral vector), or a lentiviral vector. In some embodiments, the isolated nucleic acid or, e.g., a continuous portion thereof, is integrated into the genome of a host cell such as a host γδ T cell. In an exemplary embodiment, the isolated nucleic acid is a retroviral vector.

[0165] C. γδ T cells Aspects of the invention include γδ T cells that functionally express the isolated nucleic acids described herein and thereby express a CAR on the surface of the γδ T cells.

[0166] Aspects of the invention can further or alternatively comprise γδ T cells having in vitro or in vivo cytotoxic activity against hematological tumor cells and / or solid tumor cells that exhibit cell surface expression of CD70. Optionally, the cytotoxic activity is a native activity. Optionally, the cytotoxicity is at least partially, significantly (> about 25%), or completely due to the presence of a CAR construct having a binding domain that specifically binds to CD70 expressed on the surface of hematological tumor cells and / or solid tumor cells. Optionally, the γδ T cells exhibit higher hematological tumor cell and / or solid tumor cell cytotoxic activity than the native level of in vitro and / or in vivo hematological tumor cell and / or solid tumor cell cytotoxic activity in control γδ T cells. Optionally, the control γδ T cells do not contain a CAR construct. Optionally, the control γδ T cells contain a CAR construct lacking one or more of the binding domains described herein, the hinge regions described herein, the transmembrane domains described herein, the signaling domains described herein, and / or the co-stimulatory domains described herein.

[0167] Optionally, the cytotoxicity is at least partially, significantly (> about 25%), or completely due to the presence of a CAR construct having a binding domain that specifically binds to CD70 or an epitope within CD70. Optionally, the γδ T cells functionally express a CD70-specific CAR encoded by an isolated nucleic acid described herein.

[0168] The γδ T cells described herein can exhibit strong and / or persistent hematological tumor cell and / or solid tumor cell killing activity. In some cases, the hematological tumor cell and / or solid tumor cell killing activity can persist for at least about 6 days to about 120 days, or at least about 6 days to about 180 days, from the first contact with the hematological tumor cells and / or solid tumor cells. In some cases, the hematological tumor cell and / or solid tumor cell killing activity of the γδ T cells described herein, or their progeny, can persist for at least about 6 days to about 120 days, or at least about 6 days to about 180 days, from the first contact with the hematological tumor cells and / or solid tumor cells, or from the administration of the γδ T cells described herein. This persistent hematological tumor cell and / or solid tumor killing activity can be demonstrated in vitro, in vivo, or both in vitro and in vivo.

[0169] Aspects of the invention can further or alternatively include γδ T cells that proliferate in response to contact with cells that exhibit cell surface expression or overexpression of CD70. Cells that exhibit cell surface expression of CD70 can be activated immune cells (Bowman et al., J. Immunol. (1994); 152:1756-1761; Nolte et al., Immunol. Rev. (2009); 229:216-231), stromal cells of the thymic medulla, and antigen-presenting cells (Keller et al., Proc. Nat. Acad. Sci. USA. (2007); 104:5989-94; Borst et al., Curr. Opin. Immunol. (2005); 17:275-81; Hendriks et al., J. Immunol. (2005); 175:1665-76). Cells that exhibit cell surface expression or overexpression of CD70 can be hematologic tumor cells (Fieswasser et al., Cancers. (2019); 11) and / or solid tumor cells (Pahl et al., Cancer Cell Int. (2015); 15:31; Jilaveanu et al., Hum. Pathol. (2012); 43:1394-9; Hishima et al., Int. J. Cancer. (2002); 98:352-6; Burvenich et al., Theranostics. (2018); 8:4199-209). In some cases, the proliferation is a native activity. In some cases, the proliferation is at least partially, significantly (> about 20% or > about 25%), or completely due to the presence of a CAR construct having a binding domain that specifically binds to CD70 expressed on the surface of cells, such as hematologic tumor cells and / or solid tumor cells. In some cases, the γδ T cells exhibit a higher level of proliferation in vitro and / or in vivo compared to control γδ T cells. In some cases, the control γδ T cells do not contain the CAR construct.In some cases, the control γδ T cells comprise a CAR construct lacking the binding domain, hinge region, transmembrane domain, intracellular signaling domain, and / or costimulatory domain described herein.

[0170] In some cases, proliferation is at least partially, significantly (> about 20% or > about 25%), or completely due to the presence of a CAR construct having a binding domain that specifically binds to CD70 or an epitope within CD70. In some cases, γδ T cells that exhibit proliferation in response to contact with cells, such as hematological tumor cells and / or solid tumor cells that show cell surface expression of CD70, functionally express a CD70-specific CAR encoded by the isolated nucleic acid described herein.

[0171] The γδ T cells described herein can exhibit robust and / or sustained proliferation in a host organism containing cells that exhibit cell surface expression or overexpression of CD70, such as hematological tumor cells and / or solid tumor cells. In some cases, the proliferation can persist for at least about 6 days to about 120 days, or at least about 6 days to about 180 days, from the initial contact with CD70-expressing cells, such as hematological tumor cells and / or solid tumor cells, or from the date of administration of the γδ T cells to the host organism. In some cases, the proliferation of the γδ T cells described herein or their progeny in a host organism containing hematological tumor cells and / or solid tumor cells that exhibit cell surface expression or overexpression of CD70 can persist for at least about 6 days to about 120 days, or at least about 6 days to about 180 days, from the initial contact with CD70-expressing cells, such as hematological tumor cells and / or solid tumor cells, or from the first date of administration of the γδ T cells to the host organism. In some cases, the proliferation in the host organism is at least partially, significantly (> about 20% or > about 25%), or completely due to the presence of a CAR construct having a binding domain that specifically binds to CD70 or an epitope within CD70. In some cases, γδ T cells that exhibit proliferation in a host organism containing cells that exhibit cell surface expression of CD70, such as hematological tumor cells and / or solid tumor cells, functionally express a CD70-specific CAR encoded by the isolated nucleic acid described herein.

[0172] In some embodiments, the γδ T cells described herein express, or continuously express, a pro-inflammatory cytokine such as, but not limited to, tumor necrosis factor alpha or interferon gamma, after contact with CD70-expressing cells, such as hematological tumor cells and / or solid tumor cells. In some embodiments, the γδ T cells described herein or their progeny express, or continuously express, a pro-inflammatory cytokine such as tumor necrosis factor alpha or interferon gamma in a host organism containing hematological tumor cells and / or solid tumor cells that express CD70, after contact with the CD70-expressing cells.

[0173] In some embodiments, γδ T cells or a pharmaceutical composition containing γδ T cells, when introduced into an allogeneic host, do not substantially exhibit, or do not exhibit, a graft-versus-host response. In some embodiments, γδ T cells or a pharmaceutical composition containing γδ T cells, when introduced into an allogeneic host, exhibit a graft-versus-host response at a clinically acceptable level. In some embodiments, a clinically acceptable level is the amount of graft-versus-host response that does not require discontinuation of γδ T cell therapy to achieve a therapeutically effective treatment. In some embodiments, a clinically acceptable level of graft-versus-host reaction (GvHD) is an acute reaction that is less severe than grade C according to the applicable International Bone Marrow Transplant Registry (IBMTR) staging scale. The severity of acute graft-versus-host reaction is determined by assessing the degree of involvement of the skin, liver, and gastrointestinal tract. The stages of lesions in individual organs are combined to create an overall grade with prognostic significance. Grade I (A) GvHD is a mild disease, grade II (B) GvHD is moderate, grade III (C) is severe, and grade IV (D) is considered life-threatening. In the IBMTR staging system, the severity of acute GvHD is defined as follows (Rowlings et al., Br. J. Haematol. 1997;97:855): ● Grade A - No lesions in the liver or gastrointestinal tract, only stage 1 skin lesions (maculopapular rash covering <25% of the body) ● Grade B - Stage 2 skin lesions, stage 1 to 2 intestinal or liver lesions ● Grade C - Stage 3 lesions in any organ system (generalized erythroderma, bilirubin 6.1 - 15.0 mg / dL, diarrhea 1500 - 2000 mL / day) ● Grade D - Stage 4 lesions in any organ system (generalized erythroderma with blister formation, bilirubin >15 mg / dL, diarrhea >2000 mL / day or pain or intestinal obstruction). See also Tables 1 and 2 of Schoemans et al., Bone Marrow Transplantation, volume 53, pages 1401 - 1415 (2018), which disclose criteria for assessing and staging acute GvHD.

[0174] In some embodiments, a γδ T cell, or a pharmaceutical composition comprising a γδ T cell, when introduced into an allogeneic host, exhibits a decrease or substantial decrease in graft-versus-host response as compared to the graft-versus-host response exhibited by a control αβ T cell or a control pharmaceutical composition comprising a control αβ T cell administered to the allogeneic host. In some cases, the control αβ T cell is an allogeneic, non-genetically engineered control αβ T cell. In some cases, the control αβ T cell does not comprise a CAR or does not comprise the same CAR as the reference γδ T cell.

[0175] The γδ T cells described herein can be δ1, δ2, δ3 or δ4 γδ T cells, or combinations thereof. In some cases, the γδ T cells are mostly (>50%), substantially (>90%), essentially all, or completely δ2 - γδ T cells. In some cases, the γδ T cells are mostly (>50%), substantially (>90%), essentially all, or completely δ1 γδ T cells.

[0176] In some embodiments, the γδ T cells described herein can be modified to include one or more gene edits. As discussed herein, gene editing is a type of genetic manipulation that inserts, deletes, or substitutes nucleotides / nucleic acids into a DNA sequence such as the genome of γδ T cells. Targeted gene editing enables insertion, deletion, and / or substitution at a preselected site within the genome of the target cell. When the nucleotide sequence of an endogenous gene is edited, for example, by deletion, insertion, or substitution of nucleotides / nucleic acids, the endogenous gene containing the affected sequence may be knocked out or knocked down due to the change in the nucleotide sequence. Thus, targeted editing can be used to disrupt the expression of an endogenous gene. As discussed herein, a "disrupted gene" refers to a gene that includes an insertion, deletion, or substitution to an endogenous gene such that the expression of the functional protein from the endogenous gene is reduced or inhibited. As used herein, "disrupting a gene" refers to a method of inserting, deleting, or substituting at least one nucleotide / nucleic acid into an endogenous gene such that the expression of the functional protein from the endogenous gene is reduced or inhibited. Methods of disrupting genes are known to those of skill in the art and are described, for example, in U.S. Patent No. 11,254,912, which is incorporated herein by reference in its entirety.

[0177] In embodiments, nuclease-dependent approaches can be used to perform targeted gene editing of T cells. Such nuclease-dependent approaches can achieve targeted editing through the specific introduction of double-strand breaks (DSBs) by a specific endonuclease. Such nuclease-dependent targeted editing utilizes DNA repair mechanisms that occur in response to DSBs, such as non-homologous end joining (NHEJ). DNA repair by NHEJ often results in the random insertion or deletion (indel) of a small number of endogenous nucleotides. In contrast to NHEJ-mediated repair, repair can also occur by homologous recombination repair (HDR). If a donor template containing exogenous genetic material flanked by a pair of homology arms is present, the exogenous genetic material can be introduced into the genome by HDR, resulting in targeted integration of the exogenous genetic material. Available endonucleases that can introduce specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided CRISPR-Cas9 nucleases (CRISPR / Cas9, clustered regularly interspaced short palindromic repeats-associated 9). The CRISPR system, or CRISPR nuclease system, discussed herein can include a non-coding RNA (e.g., guide RNA) that binds to DNA and a Cas protein (e.g., Cas9) having nuclease activity (Sander et al., Nature Biotechnology, (2014); 32:347-355; Hsu et al., Cell, (2014); 157(6):1262-1278).

[0178] In an embodiment, the γδ T cells contain one or more disrupted genes. For example, one or more genes whose expression is disrupted are adenosine A2A receptor (ADORA), CD276, V-set domain-containing T cell activation inhibitor 1 (VTCN1), B and T lymphocyte associated (BTLA), cytotoxic T lymphocyte-associated protein 4 (CTLA4), indoleamine 2,3-dioxygenase 1 (IDO1), killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 (KIR3DL1), lymphocyte activation gene 3 (LAG3), programmed cell death 1 (PD-1), hepatitis A virus cellular receptor 2 (HAVCR2), V domain immunoglobulin suppressor of T cell activation (VISTA), natural killer cell receptor 2B4 (CD244), cytokine-induced SH2-containing protein (CISH), hypoxanthine phosphoribosyltransferase 1 (HPRT), adeno-associated virus integration site (AAVS SITE(EGAAVS1, AAVS2, ETT.)), or chemokine (C-C motif) receptor 5 (gene / pseudogene) (CCR5), CD160 molecule (CD160), T cell immunoreceptor with Ig and ITIM domains (TIGIT), CD96 molecule (CD96), cytotoxic and regulatory T cell molecule (CRTAM), leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), sialic acid-binding Ig like lectin 7 (SIGLEC7) like lectin 7, sialic acid-binding Ig like lectin 9 (SIGLEC9) like lectin 9, tumor necrosis factor receptor superfamily member 10b (TNFRSF10B), tumor necrosis factor receptor superfamily member 10a (TNFRSF10A), caspase 8 (CASP8), caspase 10 (CASP10), caspase 3 (CASP3), caspase 6 (CASP6), caspase 7 (CASP7), Fas associated via death domain (FADD), Fas cell surface death receptor (Fas), transforming growth factor beta receptor II (TGFBRII), transforming growth factor beta receptor I (TGFBR1), SMAD family member 2 (SMAD2), SMAD family member 3 (SMAD3), SMAD family member 4 (SMAD4), SKI proto-oncogene (SKI), SKI-like proto-oncogene (SKIL), TGFB-induced factor homeobox 1 (TGIF1), interleukin 10 receptor subunit alpha (IL10RA), interleukin 10 receptor subunit beta (IL10RB), heme oxygenase 2 (HMOX2), interleukin 6 receptor (IL6R), interleukin 6 signal transducer (IL6ST), c-src tyrosine kinase (CSK), Phosphoprotein Membrane Anchor 1 (PAG1) having glycosphingolipid microdomains, Signal Transduction Threshold Regulatory Transmembrane Adapter 1 (SIT1), Forkhead Box P3 (FOXP3), PR Domain 1 (PRDM1), Basic Leucine Zipper Transcription Factor, ATF-like (BATF), Guanylate Cyclase 1, Soluble, Alpha 2 (GUCY1A2), Guanylate Cyclase 1, Soluble, Alpha 3 (GUCY1A3), Guanylate Cyclase 1, Soluble, Beta 2 (GUCY1B2), Guanylate Cyclase 1, Soluble, Beta 3 (GUCY1B3), Cytokine-Induced SH2-Containing Protein (CISH), proteins of the protein prolyl hydroxylase domain (PHD1, PHD2, PHD3) family, Cbl Proto-Oncogene B (CBL-B), Zinc Finger Protein 91 (ZFP91), Roquin, CD58, ICAM-1 or any combination thereof.

[0179] In a preferred embodiment, the gene whose expression is disrupted is CISH, a negative regulator of TCR signaling. Disruption of the CISH gene may provide functional advantages over control cells having an intact CISH gene in terms of improved sensitivity to certain cytokines (e.g., IL-2 / IL-15), increased T cell proliferation, and / or suppression of T cell exhaustion. In some examples, the CISH gene may be disrupted by the method described in Daher M. et al, Targeting a cytokine checkpoint enhances the fitness of armored cord blood CAR-NK cells, Blood. 2021, Feb. 4;137(5):624-636, which is hereby incorporated by reference in its entirety. In one example, the CISH gene is disrupted by gene editing using a CRISPR-Cas system comprising one or more guide RNAs comprising any one of the sequences of SEQ ID NOs: 78-90. In another example, the CISH gene is disrupted by gene editing using a CRISPR-Cas system comprising one or more guide RNAs comprising any one of the sequences of SEQ ID NOs: 96-97.

[0180] In an embodiment, the gene whose expression is disrupted is CBL-B, a negative regulator of T cell activation. Disruption of the CBL-B gene may be functionally advantageous over control cells having an intact CBL-B gene in enhancing T cell activation. In some examples, the CBL-B gene is disrupted by gene editing using a CRISPR-Cas system comprising one or more guide RNAs comprising any one of the sequences of SEQ ID NOs: 93-95, each of which is incorporated herein by reference in its entirety: Augustin R. et al., Targeting Cbl-b in cancer immunotherapy, J. Immunother. Cancer. 2023, Feb;11(2):e006007; Hooper K. et al., Knockout of CBLB Greatly Enhances Anti-Tumor Activity of CAR T Cells, Blood, (2018), 132(Supplement 1):338; and Guo X. et al., CBLB ablation with CRISPR / Cas9 enhances cytotoxicity of human placental stem cell-derived NK cells for cancer immunotherapy, J. Immunother. Cancer. 2021, Mar;9(3):e001975. In one example, the CBL-B gene is disrupted by gene editing using a CRISPR-Cas system comprising one or more guide RNAs comprising any one of the sequences of SEQ ID NOs: 93-95.

[0181] In an embodiment, the gene whose expression is disrupted is Roquin (e.g., Roquin-1). Disruption of the Roquin gene may provide a functional advantage over control cells having an intact Roquin gene in increasing T cell proliferation and enhancing antitumor activity. In some examples, the Roquin gene may be disrupted by the method described in Mai D. et al., Combined disruption of T cell inflammatory regulators Regnase-1 and Roquin-1 enhances antitumor activity of engineered human T cells, Proc. Natl. Acad. Sci. USA. 2023, Mar. 21; 120(12): e2218632120, which is incorporated herein by reference in its entirety.

[0182] In an embodiment, the gene whose expression is disrupted is ZFP91. Disruption of the ZFP91 gene may provide a functional advantage over control cells having an intact ZFP91 gene in improving the glycolytic fitness and effector function of T cells. In some examples, the ZFP91 gene may be disrupted by the method described in Wang F. et al., J. Clin. Invest. 2021, Oct. 1; 131(19):e144318, which is incorporated herein by reference in its entirety. In an embodiment, the gene whose expression is disrupted is CD58. In an embodiment, the gene whose expression is disrupted is ICAM-1. In some embodiments, both CD58 and ICAM-1 are disrupted. Disruption of the CD58 gene and / or the ICAM-1 gene may provide a functional advantage over control cells having an intact CD58 gene and / or ICAM-1 gene in disrupting T cell adhesion and costimulatory interactions to reduce host-versus-graft allocytotoxicity. In one example, the ICAM-1 gene may be disrupted as described in Teo HY. et al. IL12 / 18 / 21 Preactivation Enhances the Antitumor Efficacy of Expanded γδT Cells and Overcomes Resistance to Anti-PD-L1 Treatment, Cancer Immunol. Res. 2023, Jul. 5; 11(7):978-999, which is incorporated herein by reference in its entirety. In one example, the ICAM-1 gene is disrupted by gene editing using a nuclease system (e.g., CRISPR-Cas or CRISPR-Mad7 system) guided by an RNA comprising one or more guide RNAs comprising any one of the sequences of SEQ ID NOs: 103-104. In one example, the CD58 gene is disrupted by gene editing using a nuclease system (e.g., CRISPR-Cas or CRISPR-Mad7 system) guided by an RNA comprising one or more guide RNAs comprising any one of the sequences of SEQ ID NOs: 105-106.

[0183] γδ T cells can be obtained from allogeneic or autologous donors. γδ T cells can be partially or fully purified or can be expanded ex vivo without purification. Methods and compositions for ex vivo amplification include, but are not limited to, those described in WO2017 / 197347. Expansion may be performed before, after, or both before and after the CAR construct is introduced into the γδ T cell(s).

[0184] In some embodiments, the γδ T cells can be modified to include a nucleic acid construct encoding a protein that confers a desired functionality to the γδ T cells of the present disclosure. For example, without limitation, such nucleic acids may encode a chimeric DAP10 adapter polypeptide described in U.S. Provisional Application No. 63 / 272,613 and U.S. Provisional Application No. 63 / 347,194, the respective contents of which are hereby expressly incorporated by reference in their entirety. In some embodiments, the chimeric DAP10 adapter polypeptide can associate with the chimeric antigen receptor of the present disclosure. For example, the CAR of the present disclosure may include a DAP10 interaction domain. In additional or alternative examples, the chimeric DAP10 adapter polypeptide may not associate with the CAR of the present disclosure, but instead may interact with an endogenous or exogenous polypeptide that includes a DAP10 interaction domain.

[0185] The γδ T cells described herein can be stored, for example, by cryopreservation for use in adoptive cell transfer.

[0186] D. Method of inhibiting or killing CD70-expressing cells The cells targeted by the CAR of the present disclosure may be any type of cell containing the CD70 antigen, including cancer cells in a broad sense. In certain embodiments, the cancer cells are hematological malignant cells. In certain embodiments, the cancer cells are solid malignant cells. In certain aspects, the cancer cells are, for example, lymphoma cells, renal cell carcinoma cells, or glioblastoma cells. In some aspects, the cancer cells are, for example, HTLV-1-related malignant cells or EBV-related malignant cells. In certain embodiments, the cancer cells are CD70-positive. In certain embodiments, the cancers to be treated are renal cell carcinoma, thymic carcinoma, nasopharyngeal carcinoma, brain tumors, Hodgkin's and non-Hodgkin's lymphomas, Waldenström macroglobulinemia, chronic lymphocytic leukemia, T-cell leukemia, multiple myeloma, malignancies associated with EBV and HTLV-1, malignancies of the kidney, pancreas, larynx, pharynx, melanoma, ovarian cancer, lung (including lung adenocarcinoma), colon, breast, or brain.

[0187] In certain embodiments of the present invention, the T cells containing the chimeric receptor target any cell containing the CD70 antigen, regardless of whether the target cell is cancerous. For example, in some embodiments, CD70 is expressed on cells associated with autoimmune disorders, but in certain aspects related to the present invention, this is because there is a dysregulation of CD70-CD27 co-stimulation contributing to autoimmunity. In certain embodiments, CD70 cells are present in individuals with autoimmune disorders such as rheumatoid arthritis (RA), arthritis (including psoriatic arthritis), inflammation, autoimmune encephalitis, inflammatory bowel disease, colitis, and lupus.

[0188] One or more unengineered γδT cell populations, engineered γδT cell populations, and / or mixtures thereof having cytotoxic activity against cells expressing CD70, such as hematological tumor cells and / or solid tumor cells expressing CD70, can be administered to a subject in any order or simultaneously. If simultaneously, the multiple unengineered γδT cell populations, engineered γδT cell populations, and / or mixtures thereof of the present invention can be provided in a single, unified form, such as by intravenous injection, or in multiple forms, such as multiple intravenous infusions, s.c. injections, or as a pill. The unengineered γδT cell populations, engineered γδT cell populations, and / or mixtures thereof of the present invention can be packaged together or separately in a single package or multiple packages. One or all of the unengineered γδT cell populations, engineered γδT cell populations, and / or mixtures thereof of the present invention can be administered in multiple doses. If not administered simultaneously, the timing between multiple administrations can vary from about one week, one month, two months, three months, four months, five months, six months, or up to about one year. In some cases, the unengineered, enriched γδT cell populations, engineered, enriched γδT cell populations, and / or mixtures thereof of the present invention can grow in vivo, within the subject's body, after administration to the subject. One or more unengineered γδT cell populations, one or more engineered γδT cell populations, and / or mixtures thereof can be frozen to provide cells for multiple treatments with the same cell preparation. One or more unengineered γδT cell populations, one or more engineered γδT cell populations, and / or mixtures thereof of the present disclosure, as well as pharmaceutical compositions containing the same, can be packaged as a kit. The kit may include instructions (such as written instructions) regarding the use of the unengineered γδT cell populations, engineered γδT cell populations, and / or mixtures thereof, as well as the compositions containing the same.

[0189] In some cases, a method of treating CD70 expression disorder includes administering to a subject a therapeutically effective amount of an unmanipulated γδT cell population, a manipulated γδT cell population, and / or a mixture thereof, and the administration treats a disease or condition (e.g., cancer) expressing CD70. In some embodiments, the therapeutically effective amount of the unmanipulated γδT cell population, the manipulated γδT cell population, and / or a mixture thereof is administered for at least about 10 seconds, 30 seconds, 1 minute, 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or 1 year. In some embodiments, the therapeutically effective amount of the unmanipulated γδT cell population, the manipulated γδT cell population, and / or a mixture thereof is administered for at least 1 week. In some embodiments, a therapeutically effective amount of the unmanipulated γδT cell population, the manipulated γδT cell population, and / or a mixture thereof is administered for at least 2 weeks.

[0190] The unmanipulated γδT cell population, the genetically engineered γδT cell population, and / or mixtures thereof described herein can be administered before, during, or after the onset of a disease or condition, and the timing of administration of the pharmaceutical composition containing the γδT cell population can vary. For example, the γδT cell population can be used as a prophylactic agent and can be administered continuously to a subject showing a tendency for a symptom or disease in order to reduce the likelihood of the occurrence of the disease or condition. The first administration can be carried out via any practical route, such as via any of the routes described herein using any of the formulations described herein. In some examples, the administration of the γδT cell population of the present disclosure is intravenous administration. For example, one or more doses of the γδT cell population can be administered as soon as possible after the onset of CD70-expressing cancer and for a period necessary for the treatment of the disease, such as for about 24 hours to about 48 hours, about 48 hours to about 1 week, about 1 week to about 2 weeks, about 2 weeks to about 1 month, about 1 month to about 3 months, etc. In some embodiments, one or more doses of the γδT cell population can be administered for years after the onset of cancer and before and after other treatments.

[0191] In some embodiments, the γδ T cell population is administered simultaneously or sequentially in one or more ways that increase the common gamma chain cytokine(s). As used herein, "one or more ways that increase the common gamma chain cytokine(s)" refers to a method or combination of methods that change the physiological state of a subject such that the level of at least one common gamma chain cytokine is increased in the subject. In some embodiments, the method increases the level of one or more common gamma chain cytokine(s) selected from the group consisting of IL-2, IL-7, and IL-15, and preferably, in which case, the method increases the level of IL-15 in the subject. In some embodiments, the method includes lymphodepletion. In some embodiments, the method includes administering to the subject one or more common gamma chain cytokine(s). Optionally, IL-2, IL-7, and / or IL-15, preferably IL-15, is administered. In some embodiments, the method includes secreting a common gamma chain cytokine(s) from, such as, the administered γδ T cells. Optionally, IL-2, IL-7, and / or IL-15, preferably IL-15, is secreted.

[0192] In some embodiments, one or more administration methods for increasing common gamma chain cytokine(s) include lymphodepletion prior to introduction of γδ T cell(s). In some embodiments, one or more administration methods for increasing common gamma chain cytokine(s) include, simultaneously with the introduction of γδ T cell(s) or by continuously administering an effective amount of common gamma chain cytokine(s), increasing the proliferation, cytotoxic activity, persistence, or combination thereof of the introduced γδ T cell(s), preferably wherein the method includes administering IL-2 or one or more mimetics thereof, and more preferably wherein the method includes administering IL-15 or one or more mimetics thereof. The dosage of common gamma chain cytokine(s) can increase the proliferation, cytotoxic activity, persistence, or combination thereof of the introduced γδ T cell(s) before and / or after introduction of the γδ T cell(s). Exemplary amounts of IL-15 include, but are not limited to, between 0.01 and 10 μg / kg / dose every 24 hours for IL-15. Exemplary amounts of IL-2 include, without limitation, between about 3×10 6 ~ about 22×10 6 units. For example, the dosing schedule of IL2 in RCC is intravenous injection of 600,000 international units / kg (0.037 mg / kg) over 15 minutes for up to 14 doses, every 8 hours.

[0193] In some embodiments, performing one or more methods for increasing common gamma chain cytokines includes lymphodepleting prior to administering γδ T cells and administering an effective amount of common gamma chain cytokines, simultaneously with or sequentially after the introduction of γδ T cells, to increase the proliferation, cytotoxic activity, persistence, or combination thereof of the introduced γδ T cells.

[0194] The γδ T cells of the subject invention can also be advantageously administered to a patient in combination with (e.g., before, simultaneously, or after) any number of related therapies (e.g., for treating cancer), including, for example, chemotherapy, radiation therapy, or immunotherapy. The patient can also be pre-treated with a therapeutically effective amount of γδ T cells before receiving chemotherapy, radiation therapy, or immunotherapy (such as cell therapy). Immunotherapies suitable for use in combination with γδ T cells include autologous and allogeneic cell therapies, engineered T and NK cells, immune engagers, fusion proteins, or other immuno-oncology agents.

[0195] In some embodiments, the subject's γδ T cells can be administered in combination with an appropriate cellular immunotherapy (e.g., CAR T or CAR NK cells, or Treg therapy) for treating a disease such as cancer. For example, the treatment method according to the present invention (e.g., for treating cancer) can include a pre-treatment step, such as a pre-pre-treatment step, of administering a therapeutically effective amount of γδ T cells to the subject simultaneously or sequentially with the administration of a cellular immunotherapy for the disease (e.g., cancer). In an embodiment, the cellular immunotherapy can further include performing an engineered T cell or NK cell therapy that includes a CAR that binds to any tumor-associated antigen of interest. In an embodiment, the subject's γδ T cells may include dual CAR binding to CD70 and another tumor-associated antigen.

[0196] In embodiments, the γδ T cells of the subject invention may be advantageously administered in combination with adoptive cell therapy (ACT) (for an overview of HSCT and adoptive cell therapy approaches, see Rager & Porter, Ther. Adv. Hematol. (2011), 2(6)409-428; Roddie & Peggs, Expert Opin. Biol. Ther. (2011), 11(4):473-487; Wang et al. Int. J. Cancer: (2015), 136, 1751-1768; and Chang, Y.J. and X.J. Huang, Blood Rev, 2013.27(1):55-62, each of which is incorporated herein by reference in its entirety). Such adoptive cell therapies include, but are not limited to, allogeneic and autologous hematopoietic stem cell transplantation, donor leukocyte (or lymphocyte) infusion (DLI), adoptive transfer of tumor-infiltrating lymphocytes, or adoptive transfer of T cells or NK cells (including recombinant cells, e.g., CAR T, CAR NK). In addition to the need for donor-derived cells to reconstitute hematopoiesis after radiotherapy and chemotherapy, immunological reconstitution from transplanted cells is important for eliminating residual tumor cells. The effectiveness of ACT as a curative option for malignancies is influenced by many factors, including the origin, composition, and phenotype of donor cells (lymphocyte subsets, activation status), underlying diseases, pre-transplant conditioning regimens, and post-transplant immune support (e.g., IL-2 therapy), and the graft-versus-tumor (GVT) effect mediated by donor cells within the graft. Furthermore, these factors may often balance the transplant-related mortality resulting from the conditioning regimen and / or excessive immune activity of donor cells in the host (i.e., graft-versus-host disease, cytokine release syndrome, etc.).

[0197] Method for E.CAR detection Quantification of the CAR transgene level in the host cells of the present disclosure can be achieved by various methods. Examples include, but are not limited to, genomic detection (e.g., quantitative PCR, digital PCR), transcriptome detection (e.g., RNA sequencing, RNA in situ hybridization), proteome detection (e.g., fluorescence microscopy), and biodetection (e.g., positron emission tomography (PET) scanning, two-photon microscopy), and various combinations thereof.

[0198] As discussed above, in embodiments, the isolated nucleic acid encoding the CAR polypeptide may include one or more labels or markers that facilitate the ability to monitor the expression level of the CAR. However, it is recognized herein that including a label or marker, such as LNGFR, for example, can have an adverse effect on the viral titer level as the resulting molecular weight of the CAR increases, particularly when other polypeptides are also associated with the CAR (e.g., dnTGFβR2). Other additional or alternative methodologies, such as those that rely on vector copy number (VCN), also have drawbacks including, but not limited to, the fact that the ratio of VCN to CAR can require a significant amount of process development time and can vary through scale-up / process improvement.

[0199] In one embodiment, quantification of the CAR may be determined via immunological detection of a cleavage linker region that attaches one or more co-stimulatory domains and / or intracellular domains to an additional polypeptide (e.g., dnTGFβR2) following a linker region (e.g., T2A, P2A, E2A, F2A), such as, for example, the CD27 domain. The advantage of such an approach is that the linker region binds directly to the CAR and enables detection of the intracellular C-terminus of the CAR. For example, without limitation, an antibody that can be used to detect the 2A peptide includes anti-2A (3H4) (Novus Biologicals, Littleton, CO).

[0200] In the case of the 2A peptide, the self-cleavage mechanism results from the ribosome skipping the formation of the glycyl-prolyl peptide bond at the C-terminus of the 2A peptide. For efficient cleavage, in a preferred embodiment, the P2A peptide is used. Efficient cleavage of the P2A peptide can reduce or eliminate foreign epitopes associated with the gene of interest, resulting in reduced immunogenicity and a lower likelihood that a patient treated with the CAR-engineered host cells will exhibit an immune response against the engineered host cells (see WO2020 / 223478).

[0201] F. Dosage One or more populations of engineered host cells, non-engineered cells, and / or mixtures thereof of the present disclosure may be formulated in unit dosage forms suitable for single administration of an exact dosage. In some cases, the unit dosage form contains additional lymphocytes. In the unit dosage form, the formulation is divided into unit doses containing an appropriate amount of one or more compounds. The unit dosage can take the form of a package containing a separate amount of the formulation. Non-limiting examples are packaged tablets or capsules, and powders in vials or ampoules. An aqueous suspension composition can be packaged in a non-resealable single-dose container. A resealable container for multiple administrations can be used, for example, in combination with a preservative or without a preservative. In some examples, the pharmaceutical composition does not contain a preservative. A formulation for parenteral injection can be provided, for example, in unit dosage form in an ampoule or in a multiple-dose container containing a preservative.

[0202] One or more populations of engineered host cells, non-engineered cells, and / or mixtures thereof of the present disclosure can be present in the composition in the following amounts: at least 5 cells, at least 10 cells, at least 20 cells, at least 30 cells, at least 40 cells, at least 50 cells, at least 60 cells, at least 70 cells, at least 80 cells, at least 90 cells, at least 100 cells, at least 200 cells, at least 300 cells, at least 400 cells, at least 500 cells, at least 600 cells, at least 700 cells, at least 800 cells, at least 900 cells, at least 1×103 Cells, at least 2×10 3 Cells, at least 3×10 3 Cells, at least 4×10 3 Cells, at least 5×10 3 Cells, at least 6×10 3 Cells, at least 7×10 3 Cells, at least 8×10 3 Cells, at least 9×10 3 Cells, at least 1×10 4 Cells, at least 2×10 4 Cells, at least 3×10 4 Cells, at least 4×10 4 Cells, at least 5×10 4 Cells, at least 6×10 4 Cells, at least 7×10 4 Cells, at least 8×10 4 Cells, at least 9×10 4 Cells, at least 1×10 5 Cells, at least 2×10 5 Cells, at least 3×10 5 Cells, at least 4×10 5 Cells, at least 5×10 5 Cells, at least 6×10 5 Cells, at least 7×10 5 Cells, at least 8×10 5 Cells, at least 9×10 5 Cells, at least 1×10 6 Cells, at least 2×10 6 Cells, at least 3×10 6 Cells, at least 4×10 6 Cells, at least 5×10 6 Cells, at least 6×10 6 Cells, at least 7×10 6 Cells, at least 8×10 6 Cells, at least 9×10 6 Cells, at least 1×10 7 Cells, at least 2×10 7 Cells, at least 3×10 7 Cells, at least 4×10 7 Cells, at least 5×107 cells, at least 6×10 7 cells, at least 7×10 7 cells, at least 8×10 7 cells, at least 9×10 7 cells, at least 1×10 8 cells, at least 2×10 8 cells, at least 3×10 8 cells, at least 4×10 8 cells, at least 5×10 8 cells, at least 6×10 8 cells, at least 7×10 8 cells, at least 8×10 8 cells, at least 9×10 8 cells, at least 1×10 9 cells, or more.

[0203] A therapeutically effective dose of one or more populations of engineered host cells, non-engineered cells, and / or mixtures thereof of the present invention is from about 1 cell to about 10 cells, from about 1 cell to about 100 cells, from about 1 cell to about 10 cells, from about 1 cell to about 20 cells, from about 1 cell to about 30 cells, from about 1 cell to about 40 cells, from about 1 cell to about 50 cells, from about 1 cell to about 60 cells, from about 1 cell to about 70 cells, from about 1 cell to about 80 cells, from about 1 cell to about 90 cells, from about 1 cell to about 100 cells, from about 1 cell to about 1×10 3 cells, from about 1 cell to about 2×10 3 cells, from about 1 cell to about 3×10 3 cells, from about 1 cell to about 4×10 3 cells, from about 1 cell to about 5×10 3 cells, from about 1 cell to about 6×10 3 cells, from about 1 cell to about 7×10 3 cells, from about 1 cell to about 8×10 3 cells, from about 1 cell to about 9×10 3 cells, from about 1 cell to about 1×10 4 cells, from about 1 cell to about 2×10 4 cells, from about 1 cell to about 3×10 4 cells, from about 1 cell to about 4×10 4 cells, from about 1 cell to about 5×10 4 cells, from about 1 cell to about 6×10 4 cells, from about 1 cell to about 7×104 Cells, about 1 cell to about 8×10 4 Cells, about 1 cell to about 9×10 4 Cells, about 1 cell to about 1×10 5 Cells, about 1 cell to about 2×10 5 Cells, about 1 cell to about 3×10 5 Cells, about 1 cell to about 4×10 5 Cells, about 1 cell to about 5×10 5 Cells, about 1 cell to about 6×10 5 Cells, about 1 cell to about 7×10 5 Cells, about 1 cell to about 8×10 5 Cells, about 1 cell to about 9×10 5 Cells, about 1 cell to about 1×10 6 Cells, about 1 cell to about 2×10 6 Cells, about 1 cell to about 3×10 6 Cells, about 1 cell to about 4×10 6 Cells, about 1 cell to about 5×10 6 Cells, about 1 cell to about 6×10 6 Cells, about 1 cell to about 7×10 6 Cells, about 1 cell to about 8×10 6 Cells, about 1 cell to about 9×10 6 Cells, about 1 cell to about 1×10 7 Cells, about 1 cell to about 2×10 7 Cells, about 1 cell to about 3×10 7 Cells, about 1 cell to about 4×10 7 Cells, about 1 cell to about 5×10 7 Cells, about 1 cell to about 6×10 7 Cells, about 1 cell to about 7×10 7 Cells, about 1 cell to about 8×10 7 Cells, about 1 cell to about 9×10 7 Cells, about 1 cell to about 1×10 8 Cells, about 1 cell to about 2×10 8 Cells, about 1 cell to about 3×10 8 Cells, about 1 cell to about 4×10 8 Cells, about 1 cell to about 5×10 8 Cells, about 1 cell to about 6×10 8 Cells, about 1 cell to about 7×10 8 Cells, about 1 cell to about 8×10 8 Cells, about 1 cell to about 9×10 8Cells, or can be about 1 cell to about 1×10 9 cells.

[0204] In some cases, a therapeutically effective dose of one or more populations of engineered host cells, non-engineered cells, and / or mixtures thereof of the present invention is about 1×10 3 cells to about 2×10 3 cells, about 1×10 3 cells to about 3×10 3 cells, about 1×10 3 cells to about 4×10 3 cells, about 1×10 3 cells to about 5×10 3 cells, about 1×10 3 cells to about 6×10 3 cells, about 1×10 3 cells to about 7×10 3 cells, about 1×10 3 cells to about 8×10 3 cells, about 1×10 cells to about 9×10 3 cells, about 1×10 cells to about 1×10 4 cells, about 1×10 3 cells to about 2×10 4 cells, about 1×10 3 cells to about 3×10 4 cells, about 1×10 3 cells to about 4×10 4 cells, about 1×10 3 cells to about 5×10 4 cells, about 1×10 3 cells to about 6×10 4 cells, about 1×10 3 cells to about 7×10 4 cells, about 1×10 3 cells to about 8×10 4 cells, about 1×10 3 cells to about 9×10 4 cells, about 1×10 3 cells to about 1×10 5 cells, about 1×10 3 cells to about 2×10 5 cells, about 1×10 3 cells to about 3×10 5 cells, about 1×10 3 cells to about 4×10 5Cells, about 1×10 3 cells ~ about 5×10 5 cells, about 1×10 3 cells ~ about 6×10 5 cells, about 1×10 3 cells ~ about 7×10 5 cells, about 1×10 3 cells ~ about 8×10 5 cells, about 1×10 3 cells ~ about 9×10 5 cells, about 1×10 3 cells ~ about 1×10 6 cells, about 1×10 3 cells ~ about 2×10 6 cells, about 1×10 3 cells ~ about 3×10 6 cells, about 1×10 3 cells ~ about 4×10 6 cells, about 1×10 3 cells ~ about 5×10 6 cells, about 1×10 3 cells ~ about 6×10 6 cells, about 1×10 3 cells ~ about 7×10 6 cells, about 1×10 3 cells ~ about 8×10 6 cells, about 1×10 3 cells ~ about 9×10 6 cells, about 1×10 3 cells ~ about 1×10 7 cells, about 1×10 3 cells ~ about 2×10 7 cells, about 1×10 3 cells ~ about 3×10 7 cells, about 1×10 3 cells ~ about 4×10 7 cells, about 1×10 3 cells ~ about 5×10 7 cells, about 1×10 3 cells ~ about 6×10 7 cells, about 1×10 3 cells ~ about 7×10 7 cells, about 1×10 3 cells ~ about 8×10 7 cells, about 1×10 3 cells ~ about 9×10 7 cells, about 1×10 3 cells ~ about 1×108 Cells, about 1×10 3 cells to about 2×10 8 cells, about 1×10 3 cells to about 3×10 8 cells, about 1×10 3 cells to about 4×10 8 cells, about 1×10 3 cells to about 5×10 8 cells, about 1×10 cells to about 6×10 8 cells, about 1×10 cells to about 7×10 8 cells, about 1×10 3 cells to about 8×10 8 cells, about 1×10 3 cells to about 9×10 8 cells, or about 1×10 3 cells to about 1×10 9 cells can be.

[0205] In some cases, the therapeutically effective dose of one or more populations of engineered host cells, non-engineered cells, and / or mixtures thereof of the present invention is: about 1×10 6 cells to about 2×10 6 cells, about 1×10 6 cells to about 3×10 6 cells, about 1×10 6 cells to about 4×10 6 cells, about 1×10 6 cells to about 5×10 6 cells, about 1×10 6 cells to about 6×1 06 cells, about 1×10 6 cells to about 7×10 6 cells, about 1×10 6 cells to about 8×10 6 cells, about 1×10 6 cells to about 9×10 6 cells, about 1×10 6 cells to about 1×10 7 cells, about 1×10 6 cells to about 2×10 7 cells, about 1×10 6 cells to about 3×10 7 cells, about 1×10 6 cells to about 4×10 7 cells, about 1×10 6Cells ~ about 5×10 7 Cells, about 1×10 6 Cells ~ about 6×10 7 Cells, about 1×10 6 Cells ~ about 7×10 7 Cells, about 1×10 6 Cells ~ about 8×10 7 Cells, about 1×10 6 Cells ~ about 9×10 7 Cells, about 1×10 6 Cells ~ about 1×10 8 Cells, about 1×10 6 Cells ~ about 2×10 8 Cells, about 1×10 6 Cells ~ about 3×10 8 Cells, about 1×10 6 Cells ~ about 4×10 8 Cells, about 1×10 6 Cells ~ about 5×10 8 Cells, about 1×10 6 Cells ~ about 6×10 8 Cells, about 1×10 6 Cells ~ about 7×10 8 Cells, about 1×10 6 Cells ~ about 8×10 8 Cells, about 1×10 6 Cells ~ about 9×10 8 Cells, about 1×10 6 Cells ~ about 1×10 9 Cells, about 1×10 6 Cells ~ about 2×10 9 Cells, about 1×10 6 Cells ~ about 3×10 9 Cells, about 1×10 6 Cells ~ about 4×10 9 Cells, about 1×10 6 Cells ~ about 5×10 9 Cells, about 1×10 6 Cells ~ about 6×10 9 Cells, about 1×10 6 Cells ~ about 7×10 9 Cells, about 1×10 6 Cells ~ about 8×10 9 Cells, about 1×10 6 Cells ~ about 9×10 9 Cells, about 1×10 7 Cells ~ about 1×10 9 Cells, about 1×107 Cells ~ about 2×10 9 Cells, about 1×10 7 Cells ~ about 3×10 9 Cells, about 1×10 7 Cells ~ about 4×10 9 Cells, about 1×10 7 Cells ~ about 5×10 9 Cells, about 1×10 7 Cells ~ about 6×10 9 Cells, about 1×10 7 Cells ~ about 7×10 9 Cells, about 1×10 7 Cells ~ about 8×10 9 Cells, about 1×10 7 Cells ~ about 9×10 9 Cells, about 1×10 8 Cells ~ about 1×10 9 Cells, about 1×10 8 Cells ~ about 2×10 9 Cells, about 1×10 8 Cells ~ about 3×10 9 Cells, about 1×10 8 Cells ~ about 4×10 9 Cells, about 1×10 8 Cells ~ about 5×10 9 Cells, about 1×10 8 Cells ~ about 6×10 9 Cells, about 1×10 8 Cells ~ about 7×10 9 Cells, about 1×10 8 Cells ~ about 8×1 0 9 Cells, about 1×10 8 Cells ~ about 9×10 9 Cells, or about 1×10 8 Cells ~ about 1×10 10 Cells can be.

[0206] G. Preservation In some embodiments, one or more populations of engineered host cells, non-engineered cells, and / or mixtures thereof of the present invention may be formulated in a cryopreservation medium and stored in a cryogenic storage unit, such as a liquid nitrogen freezer (-195 °C) or an ultra-low temperature freezer (-65 °C, -80 °C, or -120 °C), for long-term storage for at least about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year, 2 years, 3 years, or at least 5 years. The cryopreservation medium can contain dimethyl sulfoxide (DMSO), and / or sodium chloride (NaCl), and / or dextrose, and / or dextran sulfate and / or hydroxyethyl starch (HES) together with a physiological pH buffer to maintain the pH at about 6.0 to about 6.5, about 6.5 to about 7.0, about 7.0 to about 7.5, about 7.5 to about 8.0, or about 6.5 to about 7.5. In embodiments, cryopreserved cells can be thawed and further processed, for example, by stimulation with antibodies, proteins, peptides, and / or cytokines as referred to herein. Cryopreserved cells can be thawed and genetically modified with viral vectors (e.g., retroviral vectors and lentiviral vectors) or non-viral means (e.g., RNA, DNA, and proteins) as described herein. Alternatively, the host cells described herein can be optionally grown, genetically modified by the methods described herein, and then cryopreserved.

[0207] Accordingly, the genetically engineered cells and / or non-genetically engineered cells disclosed herein can be cryopreserved in a cryopreservation medium at at least about 1, 5, 10, 100, 150, 200, 500 vials per mL, at least about 10 1 、10 2 、10 3 、10 4 、10 5 、10 6 、10 7 、10 8 、10 9 、or at least about 10 10With an amount of cells, it can be cryopreserved to generate a cell bank. The cryopreserved cell bank can retain functionality and can be thawed and optionally activated / stimulated and / or proliferated. In some embodiments, the thawed cells can be stimulated and proliferated in a suitable sealed container such as a cell culture bag and / or a bioreactor to generate a large amount of cells as an allogeneic cell product. In other examples, the cryopreserved cells include autologous cell products. The cryopreserved cells can maintain biological function for at least about 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 15 months, 18 months, 20 months, 24 months, 30 months, 36 months, 40 months, 50 months, or at least about 60 months under cryopreservation conditions. In some embodiments, preservatives are not used in the formulation. In some embodiments, the cryopreserved cells can be thawed and injected into multiple patients as an off-the-shelf allogeneic cell product.

Example

[0208] The following examples are presented to provide those skilled in the art with a complete disclosure and description of the methods of making and using the methods and compositions of the invention and are not intended to limit the scope that the inventors regard as the invention. While efforts have been made to ensure the accuracy of the numerical values (e.g., amounts, temperatures, etc.) used, some experimental error and deviation should be considered. Unless otherwise indicated, parts are by weight, molecular weight is average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric pressure.

[0209] Example 1. In vitro Activity of Vδ1 CD27 Receptor CAR T Cells

[0210] This example demonstrates that Vδ1 CD27 CAR T cells exhibit strong activity against cells expressing CD70 in vitro.

[0211] As shown in Figure 1, the target cell lines Raji, HeLa, ACHN, A498, and 786 - O (ATCC) were stained with anti - CD70 antibody (Biolegend) or isotype (R&D Systems). Cells were analyzed using Novocyte (Agilent). The expression of CD70 in different cell lines was graphed as the MFI (mean fluorescence intensity) ratio. The ratio of the obtained antibody MFI to the isotype MFI was graphed. CD70 low expression: HeLa and ACHN, CD70 medium expression: Raji, and CD70 high expression: A498 and 786 - O.

[0212] In the long - term cytotoxicity assay, Vδ1 CD27 receptor CAR T cells were co - cultured with target cell lines (HeLa, Figure 2A; Raji, Figure 2B; A498, Figure 2C) at an effector - to - target ratio (E:T) of 2:1 for 120 hours. Target cells were modified to express Nuc - NIR by transducing them with Incucyte® NucLIGHT NIR lentivirus (Sartorius). Live Nuc - NIR - expressing target cells were quantified every 4 hours using Incucyte® SX5 (Sartorius). The cytotoxicity index was calculated by dividing the sum of the NIR target areas at each time point by the value at 0 hours. Vδ1 CD27 receptor CAR T cells showed strong cytotoxic activity against various cancer cell lines such as HeLa (cervical), Raji (lymphoma), and A498 (renal cell). A low cytotoxicity index indicates a better cytotoxic potential of Vδ1 CD27 receptor CAR T cells (squares) against target cells alone (circles).

[0213] We evaluated whether soluble CD27 affects the cytotoxic potential of Vδ1 CD27 receptor CAR T cells. Briefly, Vδ1 CD27 receptor CAR T cells were co-cultured with the Nuc-NIR-expressing A498 target cell line at an E:T ratio of 1:2. Soluble CD27 (Acro Biosystems) was added at 0 to 8 μg / mL at 0 hours. Live Nuc-NIR-expressing target cells were quantified every 2 hours using Incucyte® SX5 (Sartorius). The cytotoxicity indices at 18 hours and 36 hours were calculated by dividing the total NIR target area at each time point by the value at 0 hours. Since there was no difference in the cytotoxicity indices when co-cultured with 0 μg and 0.25 to 8 μg / mL of soluble CD27, it was shown that the presence of soluble CD27 does not inhibit the cytotoxic potential of Vδ1 CD27 receptor CAR T cells (Figure 3).

[0214] Example 2. In Vivo Control of Renal Cell Carcinoma by Vδ1 CD27 Receptor CAR T Cells

[0215] This example demonstrates that a full-length CD27 CAR having a 4-1BB co-stimulatory domain and a CD3ζ signaling domain shows improved in vivo tumor control compared to a truncated CD27 CAR having a CD8 hinge / TM domain, a 4-1BB co-stimulatory domain, and a CD3ζ signaling domain.

[0216] The in vivo efficacy of Vδ1 CD27 receptor CAR T cells was evaluated in a subcutaneous renal cancer model using A498 cells. In female NSG mice (The Jackson Laboratory), 4×10 6 A498 cells (ATCC) mixed with Matrigel (1:1 ratio) (Corning) were implanted subcutaneously. When the tumor volume reached an average of 100 mm 3 , the animals were randomly divided into 5 groups and injected with 2.5×10 6 , 5×10 6 , 10×10 6 of Vδ1 CD27 receptor CAR T cells (tail vein). The negative control group was injected with 5×10 of non-functional Vδ1 CD27 truncated receptor CAR T cells6 The group administered with the CAR+ cells of (Group E) and the tumor-only groups (Group A, untreated) were used. Human IL-2 (Proleukin) was administered intraperitoneally before treatment and then three times a week thereafter. The tumor volume was measured twice a week with calipers. In all three dose levels (Groups B - D) of Vδ1 CD27 receptor CAR T cells, the tumor response was sustained compared to the control groups (tumor-only group and non-functional Vδ1 CD27 truncated receptor CAR T cell-administered group). These data support the cytotoxic potential of Vδ1 CD27 receptor CAR T cells in a human renal cancer cell xenograft model.

[0217] The in vivo efficacy of Vδ1 CD27 receptor CAR T cells was evaluated in a subcutaneous renal cancer model using ACHN cells. In female NSG mice (The Jackson Laboratory), 5×10 6 ACHN cells (ATCC) mixed with Matrigel (1:1 ratio) (Corning) were implanted subcutaneously. When the tumor volume reached an average of 120 mm 3 , the animals were randomly divided into five groups and injected with 2.5×10 6 , 5×10 6 , 10×10 6 Vδ1 CD27 receptor CAR T cells (tail vein). The negative control groups included the group treated with 5×10 6 CAR+ cells of Vδ1 CD27 truncated receptor CAR-T cells (Group E) and the untreated group (Group A). Human IL-2 was administered intraperitoneally before treatment and then three times a week thereafter. The tumor volume was measured twice a week with calipers. In the high-dose administered groups (Groups C and D) of Vδ1 CD27 receptor CAR T cells, the tumor response was sustained compared to the control groups (tumor-only group, non-functional Vδ1 CD27 truncated receptor CAR T cell-administered group). These data support the cytotoxic potential of Vδ1 CD27 receptor CAR-T cells in a human renal cancer cell xenograft model with low CD70 expression.

[0218] Example 3. Identification of CD27 CAR Expression

[0219] ​This example demonstrates that the surface expression of CD27 CAR can be determined using an antibody against the 2A peptide included as part of the CD27 CAR.

[0220] Vδ1 T cells modified with three different CD20 CAR constructs (two containing P2A and one not) were thawed and counted by Annexin-Dapi on a Novocyte (Agilent). Approximately 5×10 5 cells were stained with the cell viability dye Zombie Aqua (Biolegend). Cells were surface stained for Vδ1 (Biolegend) and anti-CAR idiotypic antibody (Adicet Bio) and fixed with fixation buffer (Biolegend). Cells were then permeabilized with permeabilization buffer (BD Biosciences). After permeabilization, cells were stained with anti-P2A antibody (Novus Biosciences) and data acquisition was performed on a Novocyte (Agilent). The P2A-positive population was co-stained in the CAR surface staining for samples CD20 CAR-P2A-DAP10.7 and CD20 CAR-P2A-DAP10.9 (Figure 6). These results suggest that intracellular staining of P2A can be used for CAR detection.

[0221] Example 4. Gene editing of γδ T cells

[0222] This example demonstrates the use of the CRISPR / Cas9 system to generate CISH knockout in γδ T cells.

[0223] To knockout the CISH gene in Vδ1 T cells, a ribonucleoprotein (RNP) complex composed of CRISPR / Cas9 (Integrated DNA Technologies) and CISH sgRNA (Synthego Corporation) was combined with activated Vδ1 T cells from PBMCs (P3 primary cells, 4D-Nucleofector X kit L, Lonza). The RNP complex was delivered to Vδ1 T cells by electroporation (Lonza 4D-Nucleofector). After electroporation, the cells were transferred to a T flask (Corning) containing X-Vivo15 (Lonza) for cell recovery and proliferation in a 37 °C CO2 incubator (ThermoFisher). To evaluate the KO efficiency of CISH, cell pellets were recovered 7 days after gene editing following αβ T cell depletion (StemCell Technologies), and genomic DNA was extracted using the NucleoSpin Tissue kit (MACHEREY-NAGEL). The edited region of the CISH gene was amplified by PCR and Sanger sequenced (Sequetech). The gene knockout efficiency was determined using the ICE analysis tool (Synthego). High-efficiency knockout of the CISH gene was observed in Vδ1 T cells (Figure 7).

[0224] After CISH gene knockout, the enrichment of Vδ1 T cells in PBMCs was monitored over time by flow cytometry (anti-Vδ1, BioLegend). CISH gene knockout did not affect the enrichment of Vδ1 T cells compared to unedited mock control cells. Similar purity of CISH gene-edited Vδ1 T cells was achieved after TCRαβ depletion (StemCell Technologies) compared to mock control cells (Figure 8A).

[0225] The cell viability of PBMCs enriched for Vδ1 T cells was monitored after CISH gene knockout (Countess II, ThermoFisher). CISH KO cells maintained a similarly high cell viability as unedited mock control cells (Figure 8B).

[0226] Example 5. Identification of CAR expression

[0227] ADI-270 cells (PL1179, cells expressing SEQ ID NO: 57) were thawed and counted by Annexin-Dapi on a Novocyte (Agilent). Approximately 2×10 5 cells were stained with the cell viability dye Zombie Aqua (Biolegend). The cells were fixed with Fixation Buffer (Biolegend). The cells were then permeabilized with Permeabilization Buffer (BD Biosciences). After permeabilization, the cells were stained with anti-P2A antibody (Novus Biosciences) and data acquisition was performed on a Novocyte. The P2A-positive population represents the transduction efficiency of CAR. The results are shown in Fig. 9, which suggests that intracellular staining of P2A can be used for CAR detection in ADI-270.

[0228] Example 6. In vitro activity of ADI-270

[0229] Target cell lines Caki-1, Caki-2, 769-P, ACHN, A498, 786-O, H1792, H1975, H460, and HuT78 (ATCC) were stained with anti-CD70 antibody conjugated to PE (Biolegend) or isotype control conjugated to PE (R&D Systems). The cells were analyzed on a Novocyte. The number of CD70 molecules per cell was quantified using the Flow Cytometry BD Quantivite™ Bead Kit (BD Biosciences) (Fig. 10). For subsequent in vitro functional evaluation of ADI-270, several tumor cell lines expressing a wide range of CD70 levels were identified.

[0230] For the long-term cytotoxicity assay, ADI-270 was co-cultured with target cell lines at effector-to-target ratios (E:T) of 2:1, 1:1, and 1:2 for 120 hours. The target cells were modified to express Nuc-NIR by transduction with Incucyte® NucLIGHT NIR lentivirus (Sartorius). Live Nuc-NIR-expressing target cells were quantified every 4 hours by Incucyte® SX5 (Sartorius). The cytotoxicity index was calculated by dividing the sum of the NIR target areas at each time point by the value at 0 hours. The increase in tumor cell killing was represented by the decrease in the cytotoxicity index. As shown in Figure 11, ADI-270 showed potent cytotoxic activity when co-cultured with multiple RCC cell lines (A498, 769-P, Caki-2) expressing various CD70 levels, and CD70-positive NSCLC cell line (H1945) and T cell lymphoma cell line (HuT78). No cytotoxicity was observed against the CD70 knockout A498 cell line at the examined E:T ratios, suggesting that the cytolytic activity of ADI-270 is specific and dependent on CD70 expression.

[0231] ADI-270 is equipped with dnTGFβRII protection to mitigate the immunosuppressive effects of TGFβ1 that can exist within the tumor microenvironment (TME). To demonstrate the functionality of dnTGFβRII expressed by ADI-270, the cytolytic activity against CD70-positive cell lines was compared, in the absence and presence of exogenously added TGFβ1 (R&D Systems), using an in vitro repeated stimulation assay, with anti-CD70 CAR Vδ1 γδT cells (without dnTGFβRII) (PL1107, SEQ ID NO: 53). A498- and ACHN-Nuc NIR fluorescent-labeled RCC tumor cell lines and effector cells were added to 96-well plates at an E:T ratio of 5:1. TGFβ1 was added to each co-culture condition at a final concentration of 20 ng / mL. The first stimulation was monitored for 2 days, after which fresh target cells were seeded into another 96-well plate. Subsequently, effector cells from the first stimulation were transferred to the plate containing the fresh target cells. The second stimulation was monitored for an additional 2 days. The co-cultures were monitored every 4 hours using Incucyte® SX5. The cytotoxicity index was calculated based on the remaining viable target tumor cells by dividing the sum of the NIR target areas at each time point by the value at time point 0 of each stimulation. The results are shown in Figure 12. In the presence of TGFβ1, ADI-270 maintained cytolytic activity against A498 and ACHN compared to the condition without TGFβ1 addition, after the second stimulation by tumor cells. Anti-CD70 CAR Vδ1 γδT cells in the presence of TGFβ1 had the lowest tumor control rate after the second stimulation because there was no protection to mitigate the inhibitory effect by TGFβ1. This data suggests that ADI-270 maintains potent in vitro cytotoxicity against RCC cell lines even in the presence of TGFβ1, demonstrating the functionality of dnTGFβRII protection in Vδ1 γδT cells.

[0232] TGFβ1 is known to directly inhibit the proliferation of T cells. To further evaluate the functionality of dnTGFβR2 protection, the in vitro proliferation of ADI-270 was evaluated in the absence and presence of exogenously added TGFβ1 (R&D Systems). ADI-270 and anti-CD70 CAR Vδ1 γδT cells (effector cells) were labeled with Cell Trace Violet (CTV) (ThermoFisher), and their proliferative capacity was measured. Effector cells labeled with CTV were co-cultured with A498 target cells at an E:T ratio of 1:2 for 7 days. The co-cultures were harvested, and the proliferation of effector cells was evaluated using flow cytometry (Novocyte) by determining the percentage of cell division in which the CTV fluorescence intensity decreased using FlowJo™ Proliferation Modeling software (FlowJo). The results are shown in Figure 13. In the presence of TGFβ1, ADI-270 maintained in vitro proliferation after stimulation with A498 tumor cells compared to the case without TGFβ1 addition, based on a similar percentage of detected cell division. In contrast, anti-CD70 CAR Vδ1 γδT cells had a decreased percentage of cell division detected when stimulated by A498 cells in the presence of TGFβ1 compared to the condition without TGFβ1 addition. These results indicate that dnTGFβRII protection reduces the effect of TGFβ1 in inhibiting the proliferation of Vδ1 γδT cells. The data are representative of four different donors. Numbers represent the percentage of cells undergoing cell division within each gated range.

[0233] When TGFβ1 binds to a heteromeric complex of TGFβ type II and type I receptors, a signaling cascade is induced that phosphorylates SMAD2 and SMAD3 (pSMAD2 / 3). To examine whether dnTGFβRII protection in ADI-270 reduces the phosphorylation of SMAD2 / 3, ADI-270 and anti-CD70 CAR Vδ1 γδT cells were serum-starved for 2 hours and then cultured for 15 minutes in the presence and absence of exogenous TGFβ1 (R&D Systems). Cells were then fixed, permeabilized, stained for anti-pSMAD2 / 3, and analyzed using flow cytometry (Novocyte). The results are shown in Figure 14. After exposure to TGFβ1, ADI-270 had lower levels of pSMAD2 / 3 compared to anti-CD70 CAR Vδ1 γδT cells, further supporting the functionality of dnTGFβRII. The small increase in pSMAD2 / 3 by ADI-270 compared to the condition without TGFβ1 addition is likely due to the presence within the entire population of untransformed CAR Vδ1 γδT cells not protected by dnTGFβR2. The data shown are the mean geometric means from three donors. Statistical analysis was performed using a paired t-test (**<0.005).

[0234] To determine whether the dnTGFβRII protection of ADI-270 can minimize changes in transcript levels associated with T cell effector function, ADI-270 and anti-CD70 CAR Vδ1 γδT cells were activated with rhuCD70 (AcroBio) for 24 hours in the presence and absence of TGF-β1 (R&D Systems). RNA was extracted from the cells using the RNeasy Plus kit (Qiagen). T cell-related transcripts were quantified from the samples using the nCounter® CAR-T Characterization Panel (Nanostring) and the nCounter® SPRINT Profiler (Nanostring). Differentially expressed genes (DEGs) were identified using the nCounter® Advanced Analysis Software (NanoString). The results are shown in Figure 15. The Volcano plot represents DEGs derived from ADI-270 anti-CD70 CAR Vδ1 γδT cells (without protection) activated with rhuCD70 (5 μg / mL) for 24 hours in the presence or absence of TGF-β1 (20 ng / mL) from two different donors. Blue (upward) triangles indicate DEGs upregulated in the comparison of TGF-β1-treated versus untreated. Red (downward) triangles represent DEGs downregulated in the comparison of TGF-β1-treated versus untreated. Stimulated anti-CD70 CAR Vδ1 γδT cells were associated with an increase in transcript changes when compared between + / − TGF-β1 conditions. When ADI-270 was stimulated under TGF-β1 + / − conditions, the changes in transcripts were minimal, further supporting that the protection of dnTGFβRII minimizes TGF-β1-induced transcript changes in Vδ1 γδT cells.

[0235] ADI-270 has multiple effector functions such as the production of soluble mediators and the recognition and killing of CD70+ tumor cells, contributing to effective anti-tumor activity. To examine the cytokine and chemokine production of ADI-270 and anti-CD70 CAR Vδ1 γδT cells, co-cultures were performed at an E:T ratio of 1:1 with A498 and ACHN target cell lines, and the supernatants were collected 24 hours after stimulation. The supernatants were analyzed using the Milliplex Immunology Multiplex Assay Panel on a Luminex® FLEXMAP 3D instrument. From the analysis of the supernatants, it was revealed that after stimulation with the A498 and ACHN cell lines, IFN-γ, GM-CSF, TNF-α, MIP-1α, MIP-1β, IL-17A, and IL-10 were measured at comparable levels in both ADI-270 and anti-CD70 CAR Vδ1 γδT cells. The results are shown in FIGS. 16A - 16B. The data suggest that the protection of dnTGFβRII in ADI-270 does not change the cytokine and chemokine release profiles when compared to anti-CD70 CAR Vδ1 γδT cells. Minimal cytokine and chemokine secretion was seen with ADI-270 and the target alone. The data shown are the mean concentrations (pg / mL) of cytokines and chemokines from two different donors.

[0236] Example 7. In Vivo Control of Human Tumor Xenografts in NSG Mice by ADI-270 Treatment

[0237] ADI-270 was designed using dnTGFβRII protection against the immunosuppressive factor TGF-β1. Research-grade ADI-270 and anti-CD70 CAR Vδ1 γδT cells (without dnTGFβRII) were produced from three separate donors. Next, the activity of ADI-270 with and without protection was examined in female NSG mice (Charles River) subcutaneously implanted with the CD70-expressing human renal cell carcinoma (RCC) cell line A498 (n = 5 per group). When the tumor volume reached approximately 150 mm 3When this was achieved, the mice were randomly divided into the test cohorts. 5E6 ADI-270, 5E6 anti-CD70 CAR Vδ1 γδT cells, and 5E6 untransduced γδ1 T cells were administered as a single bolus dose on day 0. During the test period, human IL-2 was replenished three times a week. During the experimental period, tumor volume and mouse weight were monitored. The results are shown in Figures 17A - 17B. (Figure 17A) The mean tumor volume (MTV) and standard error bars for each group are shown over the test period until the endpoint was reached on day 40 when the mean tumor volume of the tumor-alone cohort reached approximately 2000 mm 3 3 is shown over the test period until the endpoint was reached on day 40 when the mean tumor volume of the tumor-alone cohort reached approximately 2000 mm. (Figure 17B) Statistical analysis of the tumor volume data on day 40 (the end point of the test) was performed using one-way ANOVA and Tukey's multiple comparison test. ADI-270 did not cause harmful effects on health and showed significant tumor control compared to untreated controls or mice treated with untransduced γδT cells. Furthermore, ADI-270 showed a functional advantage with a significant enhancement of efficacy when compared to anti-CD70 CAR Vδ1 γδT cells without protection.

[0238] Technical grade ADI-270 was evaluated at three dose levels (5e6, 10e6, 15e6 CAR+ viable cells) in an A498 human RCC subcutaneous xenograft model. A498 subcutaneous xenografts of human renal cell carcinoma were established by seeding 4E6 cells / mouse in the right hind flank of female NSG mice. When the tumor volume reached approximately 150 mm 3 3 , the mice were randomly divided into the test cohorts (N = 5 mice per group). ADI-270 was administered as a single bolus dose on day 0. During the test period, human IL-2 was replenished three times a week. During the experimental period, tumor volume and mouse weight were monitored. The results are shown in Figures 18A - 18B. (Figure 18A) The mean tumor volume during the test period, and (Figure 18B) the mean tumor volume of the tumor-alone cohort reached approximately 2000 mm 3A statistical comparison (Tukey's multiple comparison test) was performed between the treatment group and the vehicle control group at the end of the test (day 39) when the criteria were met. **** indicates a p-value ≤ 0.0001. ADI-270 of the technical grade showed the same efficacy as the substance of the research grade previously examined in this model and did not cause any harmful effects on health. The high-dose levels (10e6 and 15e6) of ADI-270 completely eliminated tumors in this RCC solid tumor model.

[0239] The activity of ADI-270 was evaluated against different indications with low CD70 expression levels. HuT78, a CD70 low-expressing human T cell lymphoma cell line, was subcutaneously transplanted by seeding 2E6 HuT78 cells into the right posterior part of female NSG mice. 3 When the tumor volume reached approximately 200 mm 3 the mice were randomly divided into test cohorts (N = 5 per group). ADI-270 was administered as a single bolus dose on day 0. During the test period, human IL-2 was replenished three times a week to the appropriate groups. The results are shown in FIGS. 19A-19B. (FIG. 19A) The mean tumor volume (MTV) and standard error bars for each group are shown over the test period until the endpoint was reached on day 21 when the mean tumor volume of the tumor-alone cohort reached approximately 2000 mm

[0240] Example 8. In vitro tissue analysis from ADI-270-treated NSG mice implanted with human tumor xenografts

[0241] Based on the fact that ADI-270 strongly controlled tumors in vivo without developing xenogeneic GvHD in A498-bearing NSG mice, it was confirmed that the proliferation and activation of ADI-270 were specific to tumors and hardly accumulated in normal tissues. Tissues of A498-bearing NSG mice administered with a single intravenous injection of ADI-270 labeled with Cell Trace Violet (CTV) (ThermoFisher) were collected on day 7 and day 14. The results are shown in FIGS. 20A to 20B. (FIG. 20A) CTV-labeled ADI-270 showed an increase in cell proliferation in tumors as indicated by the dilution of CTV dye (histogram plot) compared to the control on day 0. (FIG. 20B) The collected ADI-270 was stained for activation-related markers, and (FIG. 20C) on day 7 and day 14, it was observed that ADI-270 homed specifically to tumors compared to the lung, spleen, blood, and bone marrow.

[0242] Example 9. Host-versus-graft (HvG) protection of ADI-270

[0243] ADI-270 and irrelevant CAR (targeting CD20) Vδ1 γδT cells (target cells) were isolated from autologous and allogeneic (donors A and B) PBMC donors using the EasySep™ Human T Cell Enrichment Kit (StemCell Technologies) together with T cells (effectors), and co-cultured with the E:T ratio fixed at 5:1 and 10:1 while supplementing with IL-2. Half of the medium (10% FBS RPMI-1640) was replaced with fresh IL-2 every 2 - 3 days. On day 5, the cells were harvested and analyzed by flow cytometry (Novocyte) to quantify the absolute numbers of ADI-270 and irrelevant CAR Vδ1 γδT cells from co-culture with autologous and allogeneic T cells. The ratio of HvG sensitivity was determined by comparing the absolute numbers of ADI-270 and irrelevant CAR Vδ1 γδT cell effector cells in T cell autologous co-cultures (controls to minimize cell killing) with those in T cell allogeneic co-cultures. The results are shown in Figure 21. The reduced HvG sensitivity of ADI-270 compared to Vδ1 T cells expressing irrelevant CAR suggests that ADI-270 potentially targets CD70+ activated alloreactive host T cells and helps to limit and sustain the rejection reaction of HvG Vδ1 T cells. Statistical comparison between the ADI-270 and irrelevant CAR groups was performed using two-way ANOVA. This result suggests that using a CAR that binds to CD70 and another tumor-associated antigen doubly, or co-administering a CAR that binds to CD70 and a CAR that binds to another tumor-associated antigen, may reduce alloreactivity compared to using a CAR that binds to another tumor-associated antigen alone.

[0244] Example 10: Enhancement of effector function of CAR Vδ1 T cells using membrane-bound IL-12 (mbIL-12)

[0245] Anti-CD19 (clone FMC63) scFv (as described in Kochendefer JN et al., Adoptive transfer of syngeneic T cells transduced with a chimeric antigen receptor that recognizes murine CD19 can eradicate lymphoma and normal B cells, Blood. 2010, Nov. 11; 116(19):3875-86), followed by the hinge and transmembrane domains of CD8α, 4-1BB, and the CD3ζ signaling domain, and a CAR vector consisting of a self-cleaving P2A sequence used to separate the mbIL-12 molecule (as described in Lee et al., Antigen-dependent IL-12 signaling in CAR T cells promotes regional to systemic disease targeting, bioRxiv. 2023, Jan. 7; 2023.01.06.522784) was constructed by cloning a DNA fragment (Integrated DNA Technologies) containing all CAR domains into a self-inactivating (SIN) Moloney Murine leukemia virus (MMLV) γ-retroviral plasmid. The design of the constructs is shown in Figure 22. (Construct A) CAR (FMC63) construct, (Construct B) CAR-mbIL-12 construct, and (Construct C) mbIL-12 construct.

[0246] Using peripheral blood mononuclear cells (PBMCs) from healthy donors, Vδ1 γδT cells were activated, proliferated, and engineered to express the CD19 CAR-mbIL-12 transgene. The results are shown in Figures 23A - 23D. (Figure 23A) Vδ1 γδT cells (after transduction) were harvested at various time points over the course of proliferation to determine cell numbers. The lack of difference in total Vδ1 γδT cell numbers between CAR and CAR-mbIL-12 suggests that mbIL-12 does not have an adverse effect on the proliferation of Vδ1 γδT cells. Cells were harvested and stained for CAR and mbIL-12 using anti-FMC63 antibody conjugated to PE (Acrobio Systems, Newark, DE) and anti-IL12 antibody conjugated to APC (Miltenyi Biotec), respectively, and data were acquired on a Novocyte flow cytometer (Agilent Technologies) to determine the percentage of CAR- and mbIL-12-positive Vδ1 γδT cells. (Figure 23B) No difference in the percentage of CAR was observed between Vδ1 γδT cells expressing CAR and Vδ1 γδT cells expressing CAR-mbIL-12 at the end of the process, further supporting that mbIL-12 does not affect the surface expression of CAR. (Figure 23C) Over the course of proliferation, the percentage of mbIL-12 expressed on the cell surface of Vδ1 γδT cells decreased over time. (Figure 23D) CAR-mbIL-12 Vδ1 γδT cells were co-cultured with CD19+ Raji cells or without CD19+ Raji cells for 18 hours. After stimulation with target cells, mbIL-12 increased on the cell surface of Vδ1 γδT cells compared to the unstimulated state, suggesting that the surface expression of mbIL-12 is dependent on the activation of CAR.

[0247] To demonstrate the functionality of CAR-mbIL-12, cell lysis activity against CD19-positive cell lines was evaluated in an in vitro repeated stimulation assay using CAR, CAR-mbIL-12, and mbIL-12-transduced Vδ1 γδT cells. The Raji-Nuc NIR fluorescent-labeled cell line and effector cells were added to a 96-well plate at E:T ratios of 5:1, 2.5:1, and 1.25:1. After monitoring the first stimulation for 3 days, new target cells were seeded into another 96-well plate. Subsequently, the effector cells from the first stimulation were transferred to the plate containing fresh target cells. The second stimulation was monitored for an additional 3 days, and the same procedure was performed for the third stimulation. The co-cultures were monitored every 4 hours using Incucyte® SX5 (Satorius). The cytotoxicity index was calculated based on the remaining viable target tumor cells by dividing the total NIR target area at each time point by the value at time point 0 of each stimulation. The lower the cytotoxicity index, the better the cytotoxicity. After the second and third stimulations, CAR-mbIL-12 Vδ1 γδT cells were associated with greater tumor cell killing compared to CAR and mbIL12 Vδ1 γδT cells, regardless of the E:T ratios examined. Co-culture conditions with a cytotoxicity index > 1 (indicating incomplete tumor control) were not analyzed in subsequent stimulations. This result is shown in Figure 24, demonstrating that CAR-mbIL-12 expressed by Vδ1 γδT cells has the functionality to sustain the cytolytic killing of tumor cells.

[0248] CAR-mbIL-12 Vδ1 γδT cells were evaluated at an optimal dose of 2.5e6 CAR+ viable cells in a Raji cell subcutaneous xenograft tumor model. Raji cell subcutaneous xenografts were established by seeding 1E6 cells / mouse in the right hind flank of female NSG mice. Tumor volume was approximately 200 mm 3When this was achieved, the mice were randomly divided into the test cohorts (N = 5 mice per group). Vδ1 γδT cells expressing CAR and CAR-mbIL-12 were administered as a single bolus dose on day 0. During the test period, human IL-2 was replenished three times a week. During the experimental period, tumor volume and mouse weight were monitored. The results are shown in Figure 25. CAR-mbIL-12 Vδ1 γδT cells were associated with a substantially greater inhibition of tumor cell proliferation compared to the sub-optimal therapeutic dose of CAR Vδ1 γδT cell group. These data support the improved functionality of Vδ1 γδT cells expressing CAR-mbIL-12.

[0249] Example 11: KO of CISH enhances the function of Vδ1 T cells

[0250] Using peripheral blood mononuclear cells (PBMCs) from healthy donors, Vδ1 γδT cells were activated, proliferated, CRISPR gene-edited, and engineered to express a chimeric antigen receptor (CAR). To knock out the CISH gene in Vδ1 T cells, a ribonucleoprotein (RNP) complex containing CRISPR-Cas9 (Integrated DNA Technologies) or -MAD7 (Aldevron) and CISH single-guide RNA (sgRNA) was combined with activated Vδ1 T cells (P3 primary cells, 4D-Nucleofector X Kit L, Lonza) obtained from PBMCs. The RNP complex was delivered into Vδ1 T cells by electroporation (Lonza 4D-Nucleofector). After electroporation, the cells were transferred to T flasks (Corning) containing X-Vivo15 (Lonza) for cell recovery and then grown prior to transduction with a gamma-retroviral vector encoding the CAR. To evaluate the efficiency of CISH knockout, cell pellets were harvested and genomic DNA was extracted using the NucleoSpin Tissue kit (MACHEREY-NAGEL). The edited region of the CISH gene was amplified by PCR and Sanger sequenced (Sequetech). The gene knockout efficiency was determined using the ICE analysis tool (Synthego). To assess the knockout of CISH protein in CAR Vδ1 T cells, wild-type (WT, unedited) and CISH KO CAR Vδ1 T cells were incubated for 5 hours with or without interleukin-2 (IL-2, Peprotech). Cell lysates were generated for Western blot detection of CISH protein using an anti-CISH rabbit monoclonal antibody (Cell Signaling). An IRDye 800CW goat anti-rabbit IgG secondary antibody (LI-COR) was used for detection of the primary antibody, and the presence of IRDye was imaged with an Odyssey imaging system (LI-COR). The results are shown in Figures 26A–26B. (Figure 26A) WT CAR Vδ1 T cells showed an increase in the level of CISH protein when exposed to IL-2. In contrast, CISH KO CAR Vδ1 T cells showed a substantial decrease in the level of CISH protein in the presence of IL-2, supporting the knockout of CISH.(FIG. 26B) To show the enhanced function of CISH KO CAR-transduced Vδ1 T cells and untransduced Vδ1 T cells, an in vitro repeated stimulation assay was used to evaluate the cytotoxic activity against the B7-H6+ HCT-15 cell line (ATCC). The HCT-15 NIR fluorescently labeled cell line and effector cells were added to 96-well plates at an E:T ratio of 5:1, with or without different concentrations of IL-2. Each stimulation was monitored for 3 days, after which fresh target cells were seeded into another 96-well plate. Then, the effector cells from each stimulation were transferred to the plate containing the fresh target cells. The co-cultures were monitored every 4 hours using Incucyte® SX5 (Satorius). The cytotoxicity index was calculated based on the remaining viable target tumor cells by dividing the sum of the NIR target areas at each time point by the value at time point 0 of each stimulation. The lower the cytotoxicity index, the higher the cytotoxicity. After the second stimulation, CISH KO untransduced Vδ1 T cells were associated with greater tumor cell killing compared to WT untransduced Vδ1 T cells only in the presence of IL-2. Without IL-2, CISH KO CAR Vδ1 T cells had superior tumor control compared to WT CAR Vδ1 T cells. These results suggest that KO of CISH enhances the in vitro cytotoxicity of Vδ1 T cells.

[0251] CAS9 CISH sgRNA: TGTACAGCAGTGGCTGGTGG(AGG) (SEQ ID NO: 96)

[0252] MAD7 CISH sgRNA: (TTTA)GGTGTACAGCAGTGGCTGGTG (SEQ ID NO: 97).

[0253] Example 12: KO of CBL-B enhances the function of Vδ1 T cells

[0254] Using peripheral blood mononuclear cells (PBMCs) from healthy donors, Vδ1 γδT cells were activated, proliferated, CRISPR gene-edited, and engineered to express a chimeric antigen receptor (CAR). To knockout the CBL-B gene in Vδ1 T cells, a ribonucleoprotein (RNP) complex containing CRISPR-Cas9 (Integrated DNA Technologies) and CBL-B sgRNA was combined with activated Vδ1 T cells obtained from PBMCs (P3 Primary Cell 4D-Nucleofector X Kit L, Lonza). The RNP complex was delivered into Vδ1 T cells by electroporation (Lonza 4D-Nucleofector). After electroporation, the cells were transferred to a T flask (Corning) containing X-Vivo15 (Lonza) for cell recovery and then grown prior to transduction with a gamma-retroviral vector encoding the CAR. The results are shown in Figures 27A-27B. (Figure 27A) To measure the KO efficiency of CBL-B, genomic DNA was extracted from cell pellets using the NucleoSpin Tissue kit (MACHARY-NAGEL). The edited region was amplified by PCR using primers previously optimized in-house. The PCR reaction products were run on an agarose gel, prominent bands were excised, and the gel was extracted using the NucleoSpin Gel and PCR Cleanup kit (MACHARY-NAGEL). The extracted DNA was sequenced by Sanger sequencing (Sequetech). The indel ratio was determined using the ICE analysis tool (Synthego). (Figure 27B) To demonstrate the enhanced function of Vδ1 T cells transduced with CBL-B KO CAR and untransduced Vδ1 T cells, the cytolytic activity against the PSMA+PC3 cell line was evaluated using an in vitro repeated stimulation assay. The PC3-PSMA NIR fluorescent-labeled cell line and effector cells were added to a 96-well plate at an E:T ratio of approximately 3:1, with or without IL-2. Each stimulation was monitored for 3 days, after which fresh target cells were seeded into another 96-well plate. Subsequently, the effector cells from each stimulation were transferred to the plate containing the fresh target cells.Co-cultures were monitored every 4 hours using an Incucyte® SX5 (Satorius). The cytotoxicity index was calculated based on the remaining viable target tumor cells by dividing the sum of the NIR target areas at each time point by the value at time point 0 of each stimulus.

[0255] RNA sequences of Cas9 multi-guide sg:

[0256] AAGACUCUUUAAAAGAAGGCA (SEQ ID NO: 93)

[0257] AGUACUCAUUCUCACUGAGU (SEQ ID NO: 94)

[0258] CGUAAAUGCUGAUAUGUAUC (SEQ ID NO: 95)

[0259] Cas9 single guide: TAATCTGGTGGACCTCATGA (AGG) (SEQ ID NO: 98).

[0260] Example 13: KO of Roquin-1 enhances the function of Vδ1 T cells

[0261] Using peripheral blood mononuclear cells (PBMCs) from healthy donors, Vδ1 γδT cells were activated, proliferated, CRISPR gene-edited, and engineered to express a CAR. To knockout the Roquin-1 gene in Vδ1 T cells, a ribonucleoprotein (RNP) complex containing CRISPR-Cas9 (Integrated DNA Technologies) and Roquin-1 sgRNA was combined with activated Vδ1 T cells obtained from PBMCs (P3 Primary Cell 4D-Nucleofector X Kit L, Lonza). The RNP complex was delivered into Vδ1 T cells by electroporation (Lonza 4D-Nucleofector). After electroporation, the cells were transferred to a T flask (Corning) containing X-Vivo15 (Lonza) for cell recovery and then grown before transduction with a gamma-retroviral vector encoding the CAR. The results are shown in Figures 28A - 28B. (Figure 28A) To measure the KO efficiency of Roquin, genomic DNA was extracted from cell pellets using the NucleoSpin Tissue kit (MACHARY-NAGEL). The edited region was amplified by PCR using primers previously optimized in-house. The PCR reaction products were run on an agarose gel, prominent bands were excised, and the gel was extracted using the NucleoSpin Gel and PCR Cleanup kit (MACHARY-NAGEL). The extracted DNA was sequenced by Sanger sequencing (Sequetech). The indel ratio was determined using the ICE analysis tool (Synthego). First, to demonstrate the ability to edit genes in Vd1 T cells, three gRNA sequences were used at a 1:1:1 ratio to generate edits, and then single-guide optimization was performed to identify the gRNA with the highest KO efficiency. (Figure 28B) To demonstrate the enhanced function of Roquin-1 KO CAR-introduced Vδ1 T cells and non-introduced Vδ1 T cells, the cytolytic activity against the PSMA + PC3 cell line was evaluated using an in vitro repeated stimulation assay. The PC3-PSMA NIR fluorescent-labeled cell line and effector cells were added to a 96-well plate at an E:T ratio of approximately 3:1, with or without IL-2.Each stimulation was monitored for 3 days, after which fresh target cells were seeded into another 96-well plate. Next, effector cells from each stimulation were transferred to the plate containing fresh target cells. The co-cultures were monitored every 4 hours using Incucyte® SX5 (Satorius). The cytotoxicity index was calculated based on the remaining viable target tumor cells by dividing the sum of the NIR target areas at each time point by the value at time point 0 of each stimulation.

[0262] RNA sequences of Cas9 multi-guide sg:

[0263] AAGCCCAUCAGUUUGGGUUG (SEQ ID NO: 99)

[0264] UGUACAAGCUCCACAAUGGA (SEQ ID NO: 100)

[0265] CAAAUGGGCAAGCCUUGCGG (SEQ ID NO: 101)

[0266] In-house optimized single gRNA sequence: CCTGAATAAACTCCACCGCA(AGG) (SEQ ID NO: 102)

[0267] Example 14: KO of ICAM-1 and CD58 improves in vitro cell survival of CAR Vδ1 T cells in the presence of allogeneic PBMCs

[0268] Using peripheral blood mononuclear cells (PBMCs) from healthy donors, Vδ1 γδT cells were activated, proliferated, CRISPR gene edited, and engineered to express a chimeric antigen receptor (CAR). To knockout the CISH gene in Vδ1 T cells, a ribonucleoprotein (RNP) complex composed of CRISPR-Cas9 (Integrated DNA Technologies) or -MAD7 (Aldevron) and ICAM-1 or CD58 single guide RNA (sgRNA) was combined with activated Vδ1 T cells obtained from PBMCs (P3 Primary Cell 4D-Nucleofector X Kit L, Lonza). The RNP complex was delivered into Vδ1 T cells by electroporation (Lonza 4D-Nucleofector). After electroporation, the cells were transferred to a T flask (Corning) containing X-Vivo15 (Lonza) for cell recovery and then grown prior to transduction with a gammaretroviral vector encoding the CAR. To determine the knockout (KO) efficiency of ICAM-1 and CD58, wild-type (WT, unedited), ICAM-1 KO, and CD58 KO CAR Vδ1 γδ T cells were stained with anti-ICAM-1, anti-CD58, or isotype control antibodies conjugated to phycoerythrin (PE, BioLegend), and data were acquired using a Novocyte flow cytometer (Agilent Technologies). The results are shown in FIGS. 29A-29B. (FIG. 29A) KO efficiencies exceeding 80% were observed for both ICAM-1 and CD58 KO in CAR Vδ1 γδT cells. (FIG. 29B)

[0269] To evaluate whether the KO of ICAM-1 and CD58 improves the survival of CAR Vδ1 T cells in the presence of allogeneic PBMCs, a 10-day mixed lymphocyte reaction assay (MLR) was performed. WT (unedited), CISH KO, ICAM-1 KO, and CD58 KO CAR Vδ1 γδT cells (target cells) were co-cultured with allogeneic PBMCs (effector cells) at an E:T ratio of 10:1 in the presence of IL-2. During co-culture, half of the medium was replaced with fresh medium containing IL-2 every 2-3 days. On days 3, 6, and 10, cells were harvested from the co-culture, and CAR+ and Vδ1+ γδT cells were stained using an anti-B7-H6 antibody conjugated to APC (manufactured by Adicet Bio) for CAR detection and an anti-Vδ1 antibody conjugated to PE-CY7 (manufactured by Adicet Bio) for Vδ1 T cell detection. Cells were acquired using a Novocyte flow cytometer, and the absolute number of double-positive CAR+Vδ1+ T cells was obtained. To determine the target cell change rate at each time point, the formula: [(number of WT CAR+Vδ1+ γδT cells - number of KO CAR+Vδ1+ γδT cells) ÷ (number of WT CAR+Vδ1+ γδT cells)] × 100 was used to compare the absolute number of WT CAR+Vδ1+ γδT cells with the number of KO CAR+Vδ1+ γδT cells. Based on the target cell change rate relative to the number of WT CAR+Vδ1+ γδT cells, the fact that only the KO of ICAM-1 and CD58 CAR+Vδ1+ γδT cells increased the target change rate suggests that the disruption of ICAM-1 and CD58 reduced in vitro killing by allogeneic PBMCs and improved cell survival.

[0270] CAS9 ICAM-1 sgRNA: AAAGUCAUCCUGCCCCGGGG (SEQ ID NO: 103)

[0271] MAD7 ICAM-1 sgRNA: TTTG / AATAGCACATTGGTTGGCTAT (SEQ ID NO: 104)

[0272] CAS9 CD58 sgRNA: AAAUAUAUGGUGUUGUGUAU (SEQ ID NO: 105)

[0273] MAD7 CD58 sgRNA: TTTA / GACACTGTGTCAGGTAGCCTC (SEQ ID NO: 106)

[0274] The above embodiments and examples are merely illustrative and are intended to be non-limiting. Those skilled in the art will be able to recognize or confirm numerous equivalents of specific compounds, materials, and procedures using only routine experimentation. All such equivalents are considered to be within the scope of the present invention and are encompassed by the appended claims. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13]

Table 2-14

Table 2-15

Table 2-16

Table 2-17

Table 2-18

Table 2-19

Table 2-20

Table 2-21

Table 2-22

Table 2-23

Table 2-24

Table 2-25

Table 2-26

Table 2-27

Table 2-28

Table 2-29

Table 2-30

Table 2-31

Table 2-32

Table 2-33

Table 2-34

Table 2-35

Table 2-36

Table 2-37

Table 2-38

Claims

**Claim 1** A γδ T cell, comprising a chimeric antigen receptor (CAR), wherein the CAR comprises a binding domain that recognizes a CD70 antigen, at least one co-stimulatory domain, and at least one intracellular signaling domain, and the γδ T cell functionally expresses the binding domain of the CAR on the surface of the γδ T cell. **Claim 2** The γδ T cell according to claim 1, wherein the binding domain comprises a full-length CD27 receptor having the amino acid sequence shown in SEQ ID NO:

33. **Claim 3** The γδ T cell according to claim 1, wherein the binding domain comprises a full-length CD27 receptor having the amino acid sequence shown in SEQ ID NO:

91. **Claim 4** The γδ T cell according to any one of claims 1 to 3, wherein the at least one co-stimulatory domain is selected from TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, CARD11, CD2, CD3C, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD70, CD80, CD83, CD86, CD134 (OX40), CD137 (4-1BB), CD278 (ICOS), FcR, LAT, NKD2C, SLP76, TRIM, and ZAP70, or a combination thereof. **Claim 5** The γδ T cell according to claim 4, wherein the at least one co-stimulatory domain is 4-1BB. **Claim 6** The γδ T cell according to any one of claims 1 to 5, wherein the at least one intracellular signaling domain is selected from CD3ζ, DAP12, LFA-1, and repeat (2-5) DAP10 YINM motif. **Claim 7** The γδ T cell according to claim 6, wherein the at least one intracellular signaling domain is CD3ζ. **Claim 8** The γδ T cell according to any one of claims 1 to 7, wherein the CAR comprises a binding domain that recognizes the CD70 antigen, followed by a 4-1BB co-stimulatory domain, followed by a signaling domain of CD3ζ. **Claim 9** The γδ T cell according to any one of claims 1 to 8, which is encoded by an isolated nucleic acid operably linked to a regulatable promoter. **Claim 10** The γδ T cell according to claim 9, wherein the isolated nucleic acid encoding the CAR encodes one or more additional polypeptides. **Claim 11** The above one or more additional polypeptides are lymphotoxin beta receptor (LTBR), and optionally, at that time, the LTBR encoded by the isolated nucleic acid has the amino acid sequence shown in SEQ ID NO: 27, the γδ T cell according to claim 10.

12. The above one or more additional polypeptides are dominant negative (dn) receptors of TGF-beta; preferably, at that time, the dominant negative receptor of TGF-beta is dnTGFβR2, and optionally, at that time, the dnTGFβR2 encoded by the isolated nucleic acid has the amino acid sequence shown in SEQ ID NO: 23, the γδ T cell according to claim 10.

13. The above one or more additional polypeptides are truncated forms (EGFRt) of the human epidermal growth factor receptor; optionally, at that time, the isolated nucleic acid has the amino acid sequence shown in SEQ ID NO: 19, the γδ T cell according to claim 10.

14. The above one or more additional polypeptides are dominant negative Fas (dnFas), the γδ T cell according to claim 10.

15. The above one or more additional polypeptides are membrane-bound IL-12 (mbIL-12), the γδ T cell according to claim 10.

16. The isolated nucleic acid encodes at least one cleavage polypeptide sequence; optionally, at that time, the at least one cleavage polypeptide sequence is a 2A self-cleavage polypeptide sequence selected from T2A, P2A, E2A, and F2A self-cleavage polypeptide sequences, the γδ T cell according to any one of claims 10 to 15.

17. The 2A self-cleavage polypeptide sequence is a P2A self-cleavage polypeptide sequence; optionally, at that time, the P2A self-cleavage polypeptide sequence encoded by the isolated nucleic acid has the amino acid sequence shown in SEQ ID NO: 8, 77, or 78, the γδ T cell according to claim 16.

18. The isolated nucleic acid encodes SEQ ID NO: 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, or 71, the γδ T cell according to any one of claims 10 to 17.

19. The isolated nucleic acid encodes SEQ ID NO: 57, the γδ T cell according to any one of claims 10 to 17.

20. Furthermore, the γδ T cell according to any one of claims 1 to 19, comprising at least one disrupted endogenous gene.

21. The γδ T cell according to claim 20, wherein the at least one disrupted endogenous gene is selected from the group consisting of, or consists of, cytokine-inducible SH2-containing protein (CISH), Cbl proto-oncogene B (CBL-B), zinc finger protein 91 (ZFP91), and Roquin.

22. The γδ T cell according to claim 20, wherein the at least one disrupted endogenous gene is CD58 and / or ICAM-1.

23. The γδ T cell according to any one of claims 1 to 22, wherein the γδ T cell exhibits in vitro and / or in vivo tumor cell killing activity against hematological tumor cells and / or solid tumor cells that show cell surface expression of the CD70 antigen; preferably, in this case, the tumor cell killing activity persists for 6 days to 180 days, about 6 days to 180 days, at least 6 days to 180 days, or at least about 6 days to 180 days after the first contact with hematological tumor cells and / or solid tumor cells that show cell surface expression of the CD70 antigen.

24. The γδ T cell according to claim 23, wherein the γδ T cell proliferates in response to contact with the hematological tumor cells and / or solid tumor cells that show cell surface expression of the CD70 antigen; preferably, in this case, the proliferation of the γδ T cell or the increase in the proliferation of the γδ T cell persists for 6 days to 180 days, about 6 days to 180 days, at least 6 days to 180 days, or at least about 6 days to 180 days after the first contact with the hematological tumor cells and / or solid tumor cells that show cell surface expression of the CD70 antigen.

25. The γδ T cell according to claim 23 or 24, wherein the γδ T cell expresses a pro-inflammatory cytokine including tumor necrosis factor alpha or interferon gamma after contact with the hematological tumor cells and / or solid tumor cells that show cell surface expression of the CD70 antigen.

26. The γδ T cell according to any one of claims 1 to 25, wherein the γδ T cell is a δ1 γδ T cell.

27. A pharmaceutical composition comprising a plurality of γδ T cells according to any one of claims 1 to 26, wherein the plurality comprises at least about 10 ７ γδ T cells, preferably about 10 ８ γδ T cells to about 10 １１ γδ T cells; optionally further comprising a pharmaceutically acceptable excipient, said pharmaceutical composition.

28. The plurality is at least 60%, 80%, or about 60% or 80% to about 90% or 95% of δ1, δ2, δ3, or δ4 γδ T cells, preferably δ1 or δ2 γδ T cells, more preferably δ2 － The pharmaceutical composition according to claim 27, comprising a composition that is γδ T cells, most preferably δ1 γδ T cells.

29. A method for preparing the pharmaceutical composition according to claim 27 or 28, wherein the method includes in vitro proliferation of the γδ T cell(s), and in this case, the in vitro proliferation is carried out before and / or after transfection of the isolated nucleic acid sequence.

30. A method for killing hematological tumor cells and / or solid tumor cells that exhibit cell surface expression of CD70 antigen, said method comprising contacting said hematological tumor cells and / or solid tumor cells with an effective amount for killing tumor cells of the γδ T cells according to any one of claims 1 to 27, or the pharmaceutical composition according to claim 27 or 28, said method.

31. The method according to claim 30, comprising introducing a therapeutically effective amount of said γδ T cells or said pharmaceutical composition into a host organism comprising said hematological tumor and / or solid tumor cells.

32. The method further comprises simultaneously or sequentially performing one or more methods for increasing common γ-chain cytokine(s); optionally, the method further comprises administering IL-2 or IL-15, or secreting one or more common γ-chain cytokine(s) from said introduced γδ T cell(s), the method according to claim 30 or 31.

33. A method for treating cancer in a subject in need of treatment, comprising administering a therapeutically effective amount of the γδ T cells according to any one of claims 1 to 26, or the pharmaceutical composition according to claim 27 or 28, wherein said cancer comprises hematological tumor cells and / or solid tumor cells that exhibit cell surface expression of CD70, said method.

34. The method according to claim 33, comprising administering the γδ T cells in multiple doses, wherein the interval between said multiple doses is at least about 1 week, preferably at least about 2, 3, 4, 5, 6, 7, 8, or 12 weeks, and / or said multiple doses are administered no more than once every 6 months or 12 months.

35. A method for reducing or inhibiting a graft-versus-host reaction against immune cells administered to a subject in need of administration, comprising administering a therapeutically effective amount of the γδ T cells according to any one of claims 1 to 26, or the pharmaceutical composition according to claim 27 or 28, said method.

36. The method according to claim 35, wherein said γδ T cells comprise dual CAR binding to CD70 and another tumor-associated antigen.

37. The method according to claim 35 or 36, further comprising co-administering a therapeutically effective amount of the γδ T cells according to any one of claims 1 to 26 with T cells or NK cells comprising a CAR that binds to another tumor-associated antigen.

Images