Pharmaceutical solution of anti-N3pGlu Aβ antibody and its use
Aqueous pharmaceutical solutions of anti-N3pGlu Aβ antibodies with specific buffers and surfactants address stability and aggregation issues, providing improved stability and solubility for effective treatment of diseases like Alzheimer's disease.
Patent Information
- Application Number
- JP2025502865
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-07-21
- Filing Date
- 2023-07-20
- Publication Date
- 2025-08-05
AI Technical Summary
Existing pharmaceutical formulations of anti-N3pGlu Aβ antibodies face challenges in stability and aggregation during manufacturing, distribution, and storage, making them unsuitable for therapeutic use due to unpredictable effects of formulation components and lack of correlation between component adjustments and formulation properties.
Development of aqueous pharmaceutical solutions comprising anti-N3pGlu Aβ antibodies with specific buffers, tonicity agents, and surfactants that maintain stability and purity, reducing aggregation and improving solubility, suitable for long-term storage and administration.
The aqueous solutions exhibit improved stability and reduced aggregation, ensuring consistent therapeutic efficacy over weeks to years, suitable for treating diseases like Alzheimer's disease.
Smart Images

Figure 2025525587000062 
Figure 2025525587000063 
Figure 2025525587000064
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to pharmaceutical solutions of certain anti-N3pGlu Aβ antibodies and their uses, including use in the treatment of Alzheimer's disease.
[0002] Numerous antibodies are being studied for their therapeutic efficacy, including, but not limited to, antibodies administered to patients (e.g., human patients) for the treatment or prevention of disease. Treatment of disease using antibody therapeutics typically involves administering a pharmaceutical formulation of the antibody to a subject in need thereof.
[0003] It is recognized in the art that formulating therapeutic antibodies into pharmaceutical formulations suitable for administration to a subject (including, but not limited to, subcutaneous, intramuscular, intravenous, and / or intraperitoneal administration) can be difficult and unpredictable, at least in part, due to the numerous properties that a pharmaceutical formulation must have to be therapeutically viable, including, but not limited to, that the formulation be suitable for manufacture, distribution, and storage.
[0004] Each individual component, its concentration, its ratio relative to other components, and / or its characteristics can affect the suitability of a formulation for manufacturing, distribution, and / or storage (among other functional characteristics essential for therapeutic function). Thus, while a particular adjustment may beneficially affect a given property of the formulation, the same adjustment may also adversely affect other properties of the formulation. As just one example, surfactants may impart beneficial properties to antibody formulations, but including a surfactant (such as polyoxyethylene (20) sorbitan monooleate) in a pharmaceutical formulation of an antibody can also cause the formation of antibody aggregates, which is undesirable.
[0005] There remain few to no correlations for predicting the effect that modifying individual components (or their concentrations and / or ratios relative to other components) will have on the properties of pharmaceutical antibody formulations. Further adding to the challenge is the fact that an almost infinite number of different formulation components (e.g., buffers and excipients) and their concentrations are possible. Summary of the Invention
[0006] The present inventors have identified unique and unexpected properties of the anti-N3pGlu antibodies discussed herein, including that lyophilized antibody preparations of the antibody were unsuitable for manufacture, distribution, and storage due to unacceptable levels of protein aggregation, whereas aqueous pharmaceutical solutions of the non-lyophilized antibody were surprisingly suitable for manufacture, distribution, and storage, and for maintaining the essential functional characteristics of the antibody for therapeutic use.
[0007] Lyophilization is often used to ensure the stability of protein drug products and their suitability for manufacturing, distribution, and storage, particularly for therapeutic antibodies delivered at high doses and antibodies that have exhibited challenging stability characteristics, including cloud point, aggregation, and discoloration. Lyophilization of protein drug products is generally a more stable presentation; for example, lyophilized drug products are more resistant to stresses encountered during pharmaceutical product distribution (e.g., during pharmaceutical product packaging, transportation, and / or storage). Indeed, lyophilization has been described as "the method of choice for long-term storage of monoclonal antibodies, as lyophilized antibodies are much more stable than those in solution." See Johnson, M., "Antibody Storage and Antibody Shelf Life," Mater. Methods 2012, 2:120 (available online at labome.com; DOI: / / dx.doi.org / 10.13070 / mm.en.2.120). However, when the inventors prepared lyophilized formulations of the humanized anti-N3pGlu antibodies discussed herein and subjected them to physical stresses designed to simulate a global distribution shipping environment (e.g., ISTA 3A shipping assessment, details of which are known to those of skill in the art and available through the International Safe Transit Association at ista.org), it was found that the lyophilized formulations exhibited certain undesirable properties, such as protein aggregation and lyophilization cake instability.
[0008] In an exemplary experiment, vials containing a lyophilized formulation of an anti-N3pGlu antibody discussed herein were prepared. The vials initially contained an intact lyophilized cake, with no powder present in the vial shoulder. After being subjected to physical stresses designed to simulate a global distribution shipping environment, the vials exhibited shrunken lyophilized cake and / or collapsed lyophilized cake and powder in the vial shoulder, characteristics that are considered undesirable.
[0009] In another exemplary experiment, lyophilized formulations of the anti-N3pGlu antibody discussed herein were prepared and packaged in vials, which were then subjected to physical stresses designed to simulate a global distribution shipping environment. The vials were stored at −20°C, 5°C, 25°C, and 40°C, and samples were periodically withdrawn, reconstituted with water for injection, and analyzed for subvisible particles (SVPs) by microflow imaging (MFI). Samples from vials exposed to physical stresses designed to simulate a global distribution shipping environment consistently exhibited higher levels of SVPs (particles sized ≥2 μm and 5 μm) after one month (and at all subsequent time points measured) compared with samples from vials not exposed to these physical stresses. Again, these characteristics were considered undesirable. Additionally, samples of the lyophilized formulation exhibited aggregation, a problem typically exacerbated by, for example, one or more of shipping stress, freeze-thaw stress, and solubility constraints.
[0010] The properties discussed above make lyophilized formulations undesirable for several important reasons. For example, potential changes to the drug material as a result of decreased cake stability or increased aggregation can affect the solubility of the drug, which in turn affects the accuracy and consistency of the dose delivered to the patient. Such problems pose significant challenges in delivering the intended therapeutic dose to the patient.
[0011] Thus, a need exists for pharmaceutical compositions comprising the antibodies of the present disclosure that provide improved stability suitable for manufacturing, distribution, storage, and administration to patients for their intended therapeutic benefit. The present disclosure fulfills that need by providing pharmaceutical solutions of anti-N3pGlu Aβ antibodies with improved properties. For example, aspects of the present disclosure relate to the development of pharmaceutical solutions comprising antibodies that exhibit improved stability upon storage over time. Improved stability upon storage over time is a surprising result associated with embodiments of the disclosed pharmaceutical solutions. Indeed, the art teaches that sufficient stabilization of biomolecules often cannot be achieved in a liquid state. See Langford, A., et al., "Drying Technologies for Biotechnology and Pharmaceutical Applications" (Introduction), Wiley (2020). For example, lyophilization, rather than aqueous solution formulation, was previously considered the method of choice for long-term storage of monoclonal antibodies because lyophilized antibodies are much more stable than in solution. See Johnson, M., "Antibody Storage and Antibody Shelf Life," Mater. Methods 2012, 2:120. Additionally, Langford et al. explain that in aqueous solutions, water serves as a medium for significant molecular mobility and conformational perturbations, acting as a catalyst for chemical degradation that can promote instability during storage and shipping. Thus, contrary to conventional wisdom in the art, embodiments of the present disclosure relate to pharmaceutical solutions that exhibit improved stability, including improved stability over periods of weeks, months, or years, when stored between 5° C. and 35° C., e.g., at 5° C., 25° C., or 35° C. Aspects of the present disclosure also relate to pharmaceutical solutions suitable for administration to human patients for the treatment or prevention of diseases, including, but not limited to, Alzheimer's disease.
[0012] Accordingly, aspects of the present disclosure relate to pharmaceutical solutions comprising an antibody of the present disclosure, a buffer, a tonicity agent, a surfactant, and optional excipients. Aspects of the present disclosure also relate to pharmaceutical solutions comprising an antibody of the present disclosure, a buffer, a tonicity agent, a surfactant, and optional excipients that exhibit one or more of improved antibody stability, improved solution stability, improved solution purity, improved antibody solubility, and suitability for an intended therapeutic benefit.
[0013] Aspects of the present disclosure also relate to pharmaceutical solutions comprising an antibody of the present disclosure, a buffer, a tonicity agent, a surfactant, and optional excipients, the pharmaceutical solutions being suitable as drug products for administration to patients. Aspects of the present disclosure also relate to pharmaceutical solutions comprising an antibody of the present disclosure, one or more buffers, one or more tonicity agents, one or more surfactants, and one or more optional excipients, the pharmaceutical solutions exhibiting one or more of reduced polyoxyethylene (20) sorbitan monooleate hydrolysis, reduced polyoxyethylene (20) sorbitan monooleate oxidation, reduced levels of free oleic acid and / or total oleic acid, and reduced levels of free radicals.
[0014] Pharmaceutical solutions of the antibodies disclosed herein are useful for treating diseases characterized by the deposition of Aβ, including, but not limited to, diseases such as Alzheimer's disease (AD) (including, but not limited to, preclinical AD, prodromal AD, mild AD, moderate AD, and severe AD), Down's syndrome, and cerebral amyloid angiopathy. [Brief explanation of the drawings]
[0015] [Figure 1A] The percentage change in the main peak from the initial time as measured by size-exclusion chromatography (SEC) for different exemplary pharmaceutical solutions is plotted. [Figure 1B]1 depicts the change in percentage of high molecular weight (% HMW) from an initial time as measured by size exclusion chromatography for different exemplary pharmaceutical solutions. [Figure 1C] 1 depicts the change in percentage of low molecular weight (%LMW) for different exemplary pharmaceutical solutions as measured by size exclusion chromatography. [Figure 2A] 1 depicts the difference (Δ) in % donanemab as measured by non-reducing capillary electrophoresis-sodium dodecyl sulfate (CE-SDS) for different exemplary pharmaceutical solutions. [Figure 2B] The difference (Δ) in maximum % related substance (RS) for different exemplary pharmaceutical solutions is plotted as measured by non-reducing CE-SDS chromatography. [Figure 3] 1 depicts the difference in purity (Δ) as a function of temperature and time as measured by reduced capillary electrophoresis-sodium dodecyl sulfate (CE-SDS) for different exemplary pharmaceutical solutions. [Figure 4A] Results for particulate matter 10 μm or larger, as measured by light obscuration in particles per mL, for different exemplary pharmaceutical solutions are plotted. [Figure 4B] Results for particulate matter 25 μm and larger, as measured by light obscuration in particles per mL, for different exemplary pharmaceutical solutions are plotted. [Figure 5A] 1 depicts the % main peak (monomer) results, as measured by size exclusion chromatography (SEC), for different exemplary pharmaceutical solutions containing various amounts of polysorbate from freeze-thaw experiments. [Figure 5B]1 depicts the results of % high molecular weight species (% HMW), as measured by size exclusion chromatography (SEC), for different exemplary pharmaceutical solutions containing various amounts of polysorbate from freeze-thaw experiments. [Figure 5C] 1 depicts the results of % low molecular weight species (% LMW), as measured by size exclusion chromatography (SEC), for different exemplary pharmaceutical solutions containing various amounts of polysorbate from freeze-thaw experiments. [Figure 6A] 1 depicts the results of particulate matter of 10 μm or greater, as measured by light obscuration, for different exemplary pharmaceutical solutions containing various amounts of polysorbate from freeze-thaw experiments. [Figure 6B] 1 depicts the results of particulate matter of 25 μm or greater, as measured by light obscuration, for different exemplary pharmaceutical solutions containing various amounts of polysorbate from freeze-thaw experiments. [Figure 7A] 1 depicts the % main peak (monomer) results, as measured by size exclusion chromatography (SEC), for different exemplary pharmaceutical solutions containing various amounts of polysorbate from agitation experiments. [Figure 7B] 1 depicts the results of % high molecular weight species (% HMW), as measured by size exclusion chromatography (SEC), for different exemplary pharmaceutical solutions containing various amounts of polysorbate from agitation experiments. [Figure 7C] 1 depicts the results of % low molecular weight species (% LMW), as measured by size exclusion chromatography (SEC), for different exemplary pharmaceutical solutions containing various amounts of polysorbate from agitation experiments. [Figure 8] 1 depicts the % intact donanemab results as measured by non-reducing capillary electrophoresis-sodium dodecyl sulfate (CE-SDS) data for different exemplary pharmaceutical solutions containing various amounts of polysorbate from agitation experiments. [Figure 9]1 depicts the % purity, as measured by reduced capillary electrophoresis-sodium dodecyl sulfate (CE-SDS), for different exemplary pharmaceutical solutions containing various amounts of polysorbate from agitation experiments. [Figure 10A] 1 depicts the results of particulate matter 10 μm and larger, as measured by light obscuration, for different exemplary pharmaceutical solutions containing various amounts of polysorbate from agitation experiments. [Figure 10B] 1 depicts the results of particulate matter of 25 μm or greater, as measured by light obscuration, for different exemplary pharmaceutical solutions with varying amounts of polysorbate from agitation experiments. [Figure 11A] 1 depicts a sample of an exemplary drug solution at an initial time of 0. [Figure 11B] A sample of the exemplary pharmaceutical solution of FIG. 15A is depicted after 24 hours of storage at −5° C. [Figure 12A] Size exclusion chromatography (SEC) data (monomer content) for different exemplary pharmaceutical solutions is plotted. [Figure 12B] 1 depicts size exclusion chromatography (SEC) data (total aggregate content) for different exemplary pharmaceutical solutions. [Figure 13A] Reduced CE-SDS data (% purity) for different exemplary pharmaceutical solutions is plotted. [Figure 13B] Reduced CE-SDS data (% total aggregates) for different exemplary pharmaceutical solutions are plotted. [Figure 14A] Non-reduced CE-SDS data (% purity) for different exemplary pharmaceutical solutions are plotted. [Figure 14B] Non-reduced CE-SDS data (% total aggregates) for different exemplary pharmaceutical solutions are plotted. [Figure 15] 1 depicts free oleic acid (%FOA) data, as measured by HPLC-UV, for different exemplary pharmaceutical solutions. [Figure 16A]1 depicts the results for subvisible particles 2 μm and larger as measured by microflow imaging (MFI) in particles per mL for different exemplary pharmaceutical solutions. [Figure 16B] 1 depicts the results for subvisible particles of 5 μm or greater as measured by microflow imaging (MFI) in particles per mL for different exemplary pharmaceutical solutions. [Figure 17A] 1 depicts the results for subvisible particles of 2 μm or greater, as measured by light obscuration in particles per mL, for different exemplary pharmaceutical solutions. [Figure 17B] 1 depicts the results for subvisible particles of 5 μm or greater, as measured by light obscuration in particles per mL, for different exemplary pharmaceutical solutions. [Figure 17C] 1 depicts results for particulate matter 10 μm or larger as measured by light obscuration in particles per mL for different exemplary pharmaceutical solutions. [Figure 17D] Results for different exemplary pharmaceutical solutions above 25 μm as measured by light obscuration of particles per mL are plotted. [Figure 18A] Results for different exemplary pharmaceutical solutions above 10 μm as measured by light obscuration in particles per container are plotted. [Figure 18B] Results for different exemplary pharmaceutical solutions, as measured by light obscuration in particles per container, above 25 μm, are plotted. [Figure 19A] 1 depicts the results of subvisible particles 2 μm and larger as measured by microflow imaging (MFI) in particles per mL for different exemplary pharmaceutical solutions subjected to ISTA-3A release testing. [Figure 19B] 1 depicts the results of subvisible particles 5 μm and larger as measured by microflow imaging (MFI) in particles per mL for different exemplary pharmaceutical solutions subjected to ISTA-3A release testing. [Figure 20A]1 depicts the results of particulate matter 10 μm or larger, as measured by light obscuration in particles per mL, for different exemplary pharmaceutical solutions subjected to ISTA-3A release testing. [Figure 20B] 1 depicts the results of particulate matter 25 μm and larger, as measured by light obscuration in particles per mL, for different exemplary pharmaceutical solutions subjected to ISTA-3A release testing. [Figure 21A] 1 depicts the % monomer, as measured by size exclusion chromatography (SEC), for different exemplary pharmaceutical solutions subjected to ISTA-3A release testing. [Figure 21B] 1 depicts the % total aggregates, as measured by size exclusion chromatography data (SEC), for different exemplary pharmaceutical solutions subjected to ISTA-3A release testing. [Figure 22A] 1 depicts the % purity, as measured by non-reducing capillary electrophoresis-sodium dodecyl sulfate (CE-SDS), for different exemplary pharmaceutical solutions subjected to ISTA-3A release testing. [Figure 22B] 1 depicts the % total fragments, as measured by non-reducing capillary electrophoresis-sodium dodecyl sulfate (CE-SDS), for different exemplary pharmaceutical solutions subjected to ISTA-3A release testing. [Figure 22C] 1 depicts the % total aggregates, as measured by non-reducing capillary electrophoresis-sodium dodecyl sulfate CE-SDS, for different exemplary pharmaceutical solutions subjected to ISTA-3A release testing. [Figure 23A] The % monomer, as measured by size exclusion chromatography (SEC), for different exemplary pharmaceutical solutions is plotted. [Figure 23B] The % total aggregates, as measured by size exclusion chromatography (SEC), for different exemplary pharmaceutical solutions are plotted. [Figure 24A] The % purity, as measured by reduced CE-SDS, for different exemplary pharmaceutical solutions is plotted. [Figure 24B]The % total fragments, as measured by reduced CE-SDS, for different exemplary pharmaceutical solutions are plotted. [Figure 24C] The % total aggregates, as measured by reduced CE-SDS, for different exemplary pharmaceutical solutions are plotted. [Figure 25A] The % purity, as measured by non-reducing CE-SDS, for different exemplary pharmaceutical solutions is plotted. [Figure 25B] The % total fragments, as measured by non-reducing CE-SDS, for different exemplary pharmaceutical solutions are plotted. [Figure 25C] The % total aggregates, as measured by non-reducing CE-SDS, for different exemplary pharmaceutical solutions are plotted. [Figure 26A] 1 depicts the total oleic acid content, as measured by HPLC-UV, for different exemplary pharmaceutical solutions. [Figure 26B] 1 depicts the free oleic acid content, as measured by HPLC-UV, for different exemplary pharmaceutical solutions. [Figure 27A] 1 depicts the results for subvisible particles 2 μm and larger as measured by microflow imaging (MFI) in particles per mL for different exemplary pharmaceutical solutions. [Figure 27B] 1 depicts the results for subvisible particles of 5 μm or greater as measured by microflow imaging (MFI) in particles per mL for different exemplary pharmaceutical solutions. [Figure 28A] 1 depicts the results for subvisible particles of 2 μm or greater, as measured by light obscuration in particles per mL, for different exemplary pharmaceutical solutions. [Figure 28B] 1 depicts the results for subvisible particles of 5 μm or greater, as measured by light obscuration in particles per mL, for different exemplary pharmaceutical solutions. [Figure 28C] 1 depicts results for particulate matter 10 μm or larger as measured by light obscuration in particles per mL for different exemplary pharmaceutical solutions. [Figure 28D] 1 depicts results for particulate matter 25 μm and larger as measured by light obscuration in particles per mL for different exemplary pharmaceutical solutions. [Figure 29A] 1 depicts the results for particulate matter 10 μm or larger as measured by light obscuration in particles per container for different exemplary pharmaceutical solutions. [Figure 29B] 1 depicts particulate matter results of 25 μm or greater, as measured by light obscuration in particles per container, for different exemplary pharmaceutical solutions. DETAILED DESCRIPTION OF THE INVENTION
[0016] The disclosed compositions and processes may be more readily understood by reference to the following detailed description in conjunction with the accompanying drawings, which form a part of this disclosure.
[0017] According to the present disclosure, pharmaceutical solutions of antibodies are provided. As used herein, the term "pharmaceutical" refers to a composition (e.g., a solution) that is suitable for use in contact with the tissues of a subject (e.g., a human) without undue toxicity, irritation, allergic response, and / or other problems or complications, within the scope of sound medical judgment, and commensurate with a reasonable benefit / risk ratio. In some embodiments of pharmaceutical solutions according to the present disclosure, the pharmaceutical solution comprises an aqueous medium. Exemplary aqueous media include water, such as water for injection, and saline. The aqueous medium may include one or more buffers, as discussed elsewhere herein. In some embodiments of pharmaceutical solutions according to the present disclosure, the pharmaceutical solution contains undissolved particles.
[0018] In some embodiments, the antibody pharmaceutical solution comprises an antibody, a buffer, a tonicity agent, a surfactant, and optional excipients.
[0019] In some embodiments, the antibody is present in a pharmaceutical solution according to the present disclosure at a concentration of 0.1 mg / mL to about 1,000 mg / mL, e.g., about 1 mg / mL to about 500 mg / mL, about 1 mg / mL to about 300 mg / mL, about 1 mg / mL to about 150 mg / mL, about 1 mg / mL to about 100 mg / mL, about 1 mg / mL to about 50 mg / mL, about 1 mg / mL to about 40 mg / mL, about 100 mg / mL to about 300 mg / mL (e.g., 200 mg / mL), about 150 mg / mL to about 250 mg / mL, about 125 mg / mL, or about 150 mg / mL. The compound may be present at a concentration of from about 275 mg / mL to about 275 mg / mL, from about 5 mg / mL to about 75 mg / mL, from about 5 mg / mL to about 50 mg / mL, from about 10 mg / mL to about 30 mg / mL, from about 10 mg / mL to about 25 mg / mL, or from about 15 mg / mL to about 20 mg / mL, e.g., 15 mg / mL, 15.5 mg / mL, 16 mg / mL, 16.5 mg / mL, 17 mg / mL, 17.5 mg / mL, 18 mg / mL, 18.5 mg / mL, 19 mg / mL, 19.5 mg / mL, or 20 mg / mL. The term "about," as used herein, refers to a difference of ±10% of the stated value in some embodiments, ±5% of the stated value in some embodiments, or ±1% of the stated value in some embodiments.
[0020] In some embodiments, the antibody is present in a pharmaceutical solution according to the present disclosure at a concentration of 16.0 mg / mL to 19.0 mg / mL. In some embodiments, the antibody is present in a pharmaceutical solution according to the present disclosure at a concentration of 16.28 mg / mL to 18.73 mg / mL. In some embodiments, the antibody is present in a pharmaceutical solution according to the present disclosure at a concentration of 16.63 mg / mL to 18.38 mg / mL.
[0021] Antibody pharmaceutical solutions according to the present disclosure can be prepared using the humanized monoclonal anti-N3pGlu antibodies disclosed herein. In some embodiments, the monoclonal anti-N3pGlu antibody from which the antibody pharmaceutical solution is prepared has been purified. In some embodiments, the monoclonal anti-N3pGlu antibody from which the antibody pharmaceutical solution is prepared has been subjected to one or more purification schemes (i.e., schemes for purifying monoclonal antibodies) such as those described in "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use," USDapartment of Health and Human Services, Food and Drug Administration, Center for Biologics Evaluation and Research (Feb. 28, 1997). For example, in some embodiments, the purification scheme includes one or more of the following: (a) production techniques that prevent the introduction of and / or eliminate contaminants, including, but not limited to, animal proteins and materials, DNA, endotoxins, pyrogens, culture medium components, components that can leach from the column, and viruses; (b) one or more robust virus removal / inactivation procedures (e.g., low pH, heat, solvent and / or detergent treatment, and filtration) that have been shown to work well under a variety of conditions (e.g., pH or ionic strength of the column buffer) using a variety of monoclonal antibodies. (c) Incorporating one or more steps known to remove or inactivate retrovirus in excess of the endogenous particle load, where applicable; (c) Demonstrating the ability of the purification scheme to remove adventitious agents and other contaminants through clearance studies; (d) Future limits on the number of times purification components (e.g., chromatography columns) can be reused; (e) Preserving retention samples from each product so that side-by-side comparisons can be made to determine product comparability; and (f) Description of design features of the purification room, HVAC, and other support systems, equipment, movement, and personnel.
[0022] In some embodiments, the monoclonal anti-N3pGlu antibody from which the antibody pharmaceutical solution is prepared is purified to be free of non-immunoglobulin (Ig) contaminants, or to contain less than 5% by weight of non-Ig contaminants, less than 4% by weight of non-Ig contaminants, less than 3% by weight of non-Ig contaminants, less than 2% by weight of non-Ig contaminants, or less than 1% by weight of non-Ig contaminants. In some embodiments, the monoclonal anti-N3pGlu antibody from which the antibody pharmaceutical solution is prepared is not fragmented, aggregated, and / or otherwise modified (e.g., by loss of carbohydrate side chains).
[0023] In some embodiments, the monoclonal anti-N3pGlu antibody from which the antibody pharmaceutical solution is prepared has been tested for one or more of the following: (a) protein quantity; (b) potency; (c) purity (e.g., as determined by electrophoretic migration of the antibody on a polyacrylamide gel under both native and reduced conditions compared to a reference standard); (d) sterility; (e) one or more tests for endotoxin (e.g., a Limulus Amebocyte Lysate (LAL) assay); (f) identity testing; (g) moisture, if appropriate; (h) preservatives, if appropriate; (i) excipients, if appropriate; and (j) pH, if appropriate.
[0024] In some embodiments, the monoclonal anti-N3pGlu antibody from which the antibody pharmaceutical solution is prepared has been subjected to one or more tests for stability. For example, in some embodiments, the monoclonal anti-N3pGlu antibody from which the antibody pharmaceutical solution is prepared has been subjected to a stability testing program including tests for one or more of: (a) physicochemical integrity (e.g., fragmentation and / or aggregation), (b) potency, (c) sterility, (d) moisture (if appropriate); (e) pH (if appropriate); and (f) storage stability (if appropriate). In some embodiments, the monoclonal anti-N3pGlu antibody from which the antibody pharmaceutical solution is prepared has been subjected to one or more tests to ensure biological activity (e.g., a quantitative in vitro potency assay).
[0025] Antibodies against N3pGlu Aβ are known in the art and have uses in the treatment or prevention of disease. Those skilled in the art will understand and appreciate that anti-N3pGlu Aβ antibodies (along with methods for making and using such antibodies) are identified and disclosed in U.S. Patent No. 8,679,498 (B2), which is incorporated herein by reference in its entirety. For example, donanemab (disclosed in U.S. Patent No. 8,679,498) is an antibody against a pyroglutamic acid modification of the third amino acid of the amyloid beta (N3pGlu Aβ) epitope, which is present only in amyloid plaques in the brain. As used herein, "donanemab" refers to an anti-N3pGlu Aβ antibody comprising a light chain variable region (LCVR) comprising SEQ ID NO: 1, a heavy chain variable region (HCVR) comprising SEQ ID NO: 2, a light chain (LC) consisting of SEQ ID NO: 3, a heavy chain (HC) consisting of SEQ ID NO: 4, a light chain complementarity determining region 1 (LCDR1) of SEQ ID NO: 5, a light chain complementarity determining region 2 (LCDR2) of SEQ ID NO: 6, a light chain complementarity determining region 3 (LCDR3) of SEQ ID NO: 7, a heavy chain complementarity determining region 1 (HCDR1) of SEQ ID NO: 8, a heavy chain complementarity determining region 2 (HCDR2) of SEQ ID NO: 9, and a heavy chain complementarity determining region 3 (HCDR3) of SEQ ID NO: 10.
[0026] In some embodiments, the antibody is an anti-N3pGlu Aβ IgG antibody having a kappa light chain. In some embodiments, the anti-N3pGlu Aβ antibody comprises a kappa light chain and an IgG heavy chain. In some embodiments, the anti-N3pGlu Aβ antibody is of the human IgG1 isotype. In some embodiments, the antibody is an anti-N3pGlu Aβ antibody comprising an LCVR and an HCVR, wherein the LCVR comprises an LCDR1 of SEQ ID NO:5, an LCDR2 of SEQ ID NO:6, and an LCDR3 of SEQ ID NO:7, and the HCVR comprises an HCDR1 of SEQ ID NO:8, an HCDR2 of SEQ ID NO:9, and an HCDR3 of SEQ ID NO:10. In some embodiments, the antibody comprises an LCVR comprising SEQ ID NO:1 and / or an HCVR comprising SEQ ID NO:2. In some embodiments, the antibody comprises an LC comprising SEQ ID NO:3 and / or an HC comprising SEQ ID NO:4. In some embodiments, the antibody comprises an LCVR consisting of SEQ ID NO:1 and / or an HCVR consisting of SEQ ID NO:2. In some embodiments, the antibody comprises an LC consisting of SEQ ID NO:3 and / or an HC consisting of SEQ ID NO:4.
[0027] In some embodiments of the pharmaceutical solution according to the present disclosure, the antibody is a humanized anti-N3pGlu antibody. For example, in one embodiment, a pharmaceutical solution is disclosed herein that includes an anti-N3pGlu Aβ antibody, a buffer, a tonicity agent, a surfactant, and optional excipients. Also, for example, in one embodiment, a pharmaceutical solution is disclosed herein that includes an anti-N3pGlu Aβ antibody, a buffer, a tonicity agent, a surfactant, and optional excipients, and has a pH of 5.0 to 7.5.
[0028] As used herein, an "optional excipient" refers to an agent that, within the scope of sound judgment, may be included in a pharmaceutical solution according to the present disclosure, which agent, when included in the pharmaceutical solution, is suitable for use in contact with the tissues of a subject (e.g., a human) without undue toxicity, irritation, allergic response, and / or other problems or complications, is commensurate with a reasonable benefit / risk ratio, and has properties other than, but not necessarily excluding, those of a "buffer," "tonicity agent," and / or "surfactant" as defined elsewhere herein. Non-limiting examples of optional excipients include, for example, agents disclosed in Remington: The Science and Practice of Pharmacy, 22nd Edition, Lippincott Williams & Wilkins, Philadelphia, PA. (2013) and / or other editions. For example, non-limiting examples of excipients include diluents, binders, disintegrants, controlled-release agents, emulsifiers, encapsulating agents, and coating agents.
[0029] It should be understood that pharmaceutical solutions according to the present disclosure can be prepared using antibodies that have been lyophilized. Nevertheless, it should also be understood that in some embodiments of pharmaceutical solutions according to the present disclosure, the pharmaceutical solutions are prepared using antibodies that have not been lyophilized or have never been lyophilized. In some embodiments of pharmaceutical solutions according to the present disclosure, the antibodies in the pharmaceutical solutions are not reconstituted from lyophilized material.
[0030] In some embodiments of the pharmaceutical solution according to the present disclosure, the total concentration of the buffer solution is 0.1 mM to 1,000 mM, e.g., about 1 mM to about 1,000 mM, about 10 to about 1,000 mM, about 10 mM to about 100 mM, about 100 mM to about 250 mM, about 175 mM to about 225 mM, about 5 mM to about 50 mM, about 10 mM to about 75 mM, about 75 mM to about 175 mM, about 10 mM to about 250 mM, about 1 mM The concentration is about 1 mM to about 100 mM, about 1 mM to about 50 mM, about 1 mM to about 40 mM, about 1 mM to about 30 mM (e.g., 10 mM), about 2.5 mM to about 100 mM (e.g., 5 mM), about 3 mM to about 75 mM, 3 mM to 50 mM, about 5 mM to about 25 mM, about 5 mM to about 15 mM, about 2.5 mM to about 25 mM, about 5 mM to about 10 mM, about 2.5 mM to about 15 mM, or about 3 mM to about 12 mM.
[0031] In some embodiments, the pharmaceutical solution of the present disclosure comprises an anti-N3pGlu Aβ antibody at a concentration of 1 to 40 mg / mL, the anti-N3pGlu Aβ antibody comprising (a) a light chain variable region (LCVR) comprising an LCDR1 of SEQ ID NO: 5, an LCDR2 of SEQ ID NO: 6, and an LCDR3 of SEQ ID NO: 7, and (b) a heavy chain variable region (HCVR) comprising an HCDR1 of SEQ ID NO: 8, an HCDR2 of SEQ ID NO: 9, and an HCDR3 of SEQ ID NO: 10; a buffer in an amount of 1 mM to 30 mM; a tonicity agent in an amount of 1 to 20% weight / volume (w / v); a surfactant in an amount of 0.005% to 0.06% weight / volume; and optional excipients. In some embodiments, the LCVR of the anti-N3pGlu Aβ antibody comprises SEQ ID NO: 1 and / or the HCVR of the anti-N3pGlu Aβ antibody comprises SEQ ID NO: 2. In some embodiments, the anti-N3pGlu Aβ antibody comprises a light chain (LC) comprising SEQ ID NO: 3 and a heavy chain (HC) comprising SEQ ID NO: 4.
[0032] As used herein, a "buffer" is an agent that acts to adjust the pH of a composition, although it should be understood that a "buffer" may also serve other functions in a composition (e.g., affecting the tonicity of the composition). In some embodiments, a "buffer" may be a "buffer system." The term "single buffer system," as used herein, refers to an agent that acts to adjust the pH of a composition, and it should be understood that this agent includes two or more components (e.g., an acid compound and its conjugate base). A representative, non-limiting example of a single buffer system is benzoic acid, which may be present in solution as a combination of benzoic acid and benzoate anion.
[0033] In some embodiments of the pharmaceutical solution according to the present disclosure, the buffer solution comprises an organic acid, an inorganic acid, an amino acid, or a combination thereof. In some embodiments of the pharmaceutical solution according to the present disclosure, the buffer solution comprises a salt of an organic acid, a salt of an inorganic acid, and an amino acid, or a combination thereof. Non-limiting examples of organic acids include citric acid, acetic acid, ascorbic acid, carbonic acid, tartaric acid, gluconic acid, succinic acid, phthalic acid, fumaric acid, malic acid, maleic acid, glutamic acid, benzoic acid, salicylic acid, toluenesulfonic acid, methanesulfonic acid, stearic acid, and lactic acid. Non-limiting examples of inorganic acids include hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, and sulfuric acid. Non-limiting examples of amino acids include arginine, lysine, histidine, ornithine, isoleucine, leucine, alanine, glycine, glutamic acid, and aspartic acid. In some embodiments of the pharmaceutical solution according to the present disclosure, the buffer comprises citric acid or a salt thereof, acetic acid or a salt thereof, ascorbic acid or a salt thereof, carbonic acid or a salt thereof, tartaric acid or a salt thereof, gluconic acid or a salt thereof, succinic acid or a salt thereof, phosphoric acid or a salt thereof, phthalic acid or a salt thereof, arginine or a salt thereof, lysine or a salt thereof, histidine or a salt thereof, ornithine or a salt thereof, isoleucine or a salt thereof, leucine or a salt thereof, alanine or a salt thereof, glycine or a salt thereof, glutamic acid or a salt thereof, and aspartic acid or a salt thereof. In some embodiments, the buffer comprises citric acid or a salt thereof and histidine or a salt thereof. In some embodiments, the buffer is a buffer system, as that term is defined elsewhere herein.
[0034] In some embodiments of pharmaceutical solutions according to the present disclosure, the total amount of one or more tonicity agents is from 0.01% w / v to about 30% w / v, e.g., from about 1% w / v to about 20% w / v, from about 1% w / v to about 15% w / v, from about 5% w / v to about 15% w / v (e.g., 8% w / v), from about 1% w / v to about 10% w / v, from about 5% w / v to about 10% w / v, or from about 3% w / v to about 10% w / v. In some embodiments of a pharmaceutical solution according to the present disclosure, the total amount of one or more tonicity agents is 0.01 mM to about 1,000 mM, e.g., about 1 mM to about 500 mM, about 1 mM to about 300 mM, about 1 mM to about 250 mM, about 50 mM to about 300 mM, about 50 mM to about 150 mM, about 100 mM to about 200 mM, about 50 mM to about 200 mM, about 1 mM to about 25 mM, about 50 mM to about 200 mM, about 2.5 mM to about 15 mM, about 2.5 mM to about 25 mM, or about 75 mM to about 175 mM.
[0035] As used herein, a "tonicity agent" is an agent that affects the osmotic pressure of a composition, although it should be understood that a "tonicity agent" may also serve other functions in the composition (e.g., buffering the pH of the composition).
[0036] In some embodiments of the pharmaceutical solution according to the present disclosure, the tonicity agent is selected from a sugar, an amino acid, a salt, and a combination thereof. In some embodiments, the tonicity agent is selected from a monosaccharide, a disaccharide, a polysaccharide, and a combination thereof. In some embodiments, the tonicity agent is selected from sodium chloride, arginine or a salt thereof, lysine or a salt thereof, histidine or a salt thereof, methionine or a salt thereof, ornithine or a salt thereof, isoleucine or a salt thereof, leucine or a salt thereof, alanine or a salt thereof, glycine or a salt thereof, glutamic acid, aspartic acid, sucrose, fructose, glucose, maltose, trehalose, galactose, mannose, sorbose, lactose, cellobiose, mannitol, lactitol, xylitol, sorbitol, and maltitol, and a combination thereof. In some embodiments, the tonicity agent is sodium chloride. In some embodiments, the tonicity agent is sucrose. In some embodiments, the pharmaceutical solution of an antibody contains a single tonicity agent.
[0037] As used herein, a "surfactant" is an agent that reduces the surface tension of an aqueous composition, although it should be understood that a "surfactant" may also serve other functions in the composition (e.g., buffering the pH of the composition). In some embodiments of the pharmaceutical solution according to the present disclosure, the surfactant is selected from polyoxyethylene sorbitan esters, poloxamers, and combinations thereof. In some embodiments, the surfactant is selected from polyoxyethylene (20) sorbitan monolaurate, polyoxyethylene (20) sorbitan monopalmitate, polyoxyethylene (20) sorbitan monostearate, polyoxyethylene (20) sorbitan monooleate, poloxamer 188, and combinations thereof. In some embodiments, the surfactant is selected from polyoxyethylene (20) sorbitan monolaurate, polyoxyethylene (20) sorbitan monopalmitate, polyoxyethylene (20) sorbitan monostearate, polyoxyethylene (20) sorbitan monooleate, poloxamers, and combinations thereof. In some embodiments, the surfactant is polyoxyethylene (20) sorbitan monooleate.
[0038] In some embodiments of the pharmaceutical solution according to the present disclosure, the surfactant is present in an amount of about 0.001% by weight to about 10% by weight by volume, e.g., about 0.001% by weight to about 1% by weight by volume, about 0.005% by weight to about 0.03% by weight by volume (e.g., 0.005% by weight to 0.030% by weight by volume), about 0.005% by weight to about 0.1% by weight by volume, about 0.01% by weight to about 0.5% by weight by volume, about 0.01% by weight to about 0.25% by weight by volume, about 0.01% by weight to about 0.20% by weight by volume, about 0.01% by weight to about 0.20% by weight by volume, about 0.01% by weight to about 0.25 ...5% by weight by volume, about 0.01% by weight to about 0.20% by weight by volume, about 0.01% by weight to about 0.25% by weight by volume, about 0.01% by weight to about 0.25% by weight by volume, about 0.01% by weight to about 0.20% by weight by volume, about 0.01% by weight to about 0.25% by weight by volume The surfactant is present in an amount of about 0.03% by weight (e.g., 0.010% to 0.030% by weight), about 0.10% to about 0.30% by weight, about 0.01% to about 0.05% by weight, about 0.01% to about 0.03% by weight, about 0.02% to about 0.10% by weight, about 0.02% to about 0.08% by weight, about 0.025% to about 0.06% by weight, about 0.02% to about 0.04% by weight, or about 0.03% to about 0.05% by weight. In some embodiments of a pharmaceutical solution according to the present disclosure, the surfactant is present in an amount of about 0.04% by weight.
[0039] In some embodiments, the pharmaceutical solution according to the present disclosure does not include one or more of sodium chloride, trehalose, and mannitol. In some embodiments, the pharmaceutical solution according to the present disclosure does not include one or more of glycine, poloxamer (e.g., Poloxamer 188), and polyoxyethylene (20) sorbitan monolaurate.
[0040] In some embodiments of pharmaceutical solutions according to the present disclosure, the pH of the solution is 4.0 to 10.0, e.g., 5.0 to 9.0, 5.0 to 8.0, 5.0 to 7.5, 5.0 to 7.0, 5.2 to 6.4, 5.3 to 6.3, 5.5 to 7.5, 5.5 to 6.5, 5.75 to 6.25, 5.8 to 6.2, or 5.9 to 6.1. In some embodiments, the pH of the solution is 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0. In some embodiments, the pH of the solution is 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, or 6.5.
[0041] In some embodiments of the pharmaceutical solution according to the present disclosure, the pH of the solution is about 4.0 to about 10.0, e.g., about 5.0 to about 9.0, about 5.0 to about 7.5, about 5.0 to about 7.0, about 5.2 to about 6.4, about 5.5 to about 7.5, about 5.5 to about 6.5, about 5.75 to about 6.25, about 5.8 to about 6.2, or about 5.9 to about 6.1. In some embodiments, the pH of the solution is about 4.0, about 4.5, about 5.0, about 5.5, about 6.0, about 6.5, about 7.0, about 7.5, about 8.0, about 8.5, about 9.0, about 9.5, or about 10.0. In some embodiments, the pH of the solution is about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, or about 6.5.
[0042] In some embodiments, the pH of a pharmaceutical solution according to the present disclosure is maintained at one or more of the pH values or ranges described herein using one or more of the buffers described herein.
[0043] In some embodiments, the disclosure encompasses a pharmaceutical solution comprising an anti-N3pGlu Aβ antibody comprising (a) a light chain variable region (LCVR) comprising an LCDR1 of SEQ ID NO: 5, an LCDR2 of SEQ ID NO: 6, and an LCDR3 of SEQ ID NO: 7, and (b) a heavy chain variable region (HCVR) comprising an HCDR1 of SEQ ID NO: 8, an HCDR2 of SEQ ID NO: 9, and an HCDR3 of SEQ ID NO: 10, at a concentration of 1 to 40 mg / mL; a buffer in an amount of 1 mM to 30 mM; an isotonicity agent in an amount of 1 to 20% by volume; a surfactant in an amount of 0.005% to 0.06% by volume; and optional excipients.
[0044] In some embodiments, the disclosure encompasses a pharmaceutical solution comprising an anti-N3pGlu Aβ antibody at a concentration of 17.5 mg / mL, a buffer comprising citric acid or a salt thereof in an amount of 10 mM, an isotonicity agent comprising sucrose in an amount of 8% w / v, and a surfactant comprising polyoxyethylene(20)sorbitan monooleate in an amount of 0.02% w / v, wherein the anti-N3pGlu Aβ comprises a LCVR of SEQ ID NO: 1 and / or a HCVR of SEQ ID NO: 2, and optionally, the anti-N3pGlu Aβ comprises a LC of SEQ ID NO: 3 and / or a HC of SEQ ID NO: 4.
[0045] In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains less than or equal to 0.12 EU / mg of bacterial endotoxin as measured according to European Pharmacopeia (Ph.Eur.) Chapter 2.6.32.
[0046] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution is prepared according to the European Pharmacopoeia (Ph.Eur.) Chapter 2.2.35 and / or USP <785> The drug solution has an osmolality of 255 mOsm / kg or more and 345 mOsm / kg or less as measured according to the method of the present invention.
[0047] In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution has a color no darker than Color Standard Y3, BY3, or B3 when measured according to European Pharmacopoeia (Ph.Eur.) Chapter 2.2.2.
[0048] In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution has a clarity that is less than or equal to 60 NTU (Nephelometric Turbidity Units) as measured according to European Pharmacopoeia (Ph.Eur.) Chapter 2.2.1.
[0049] In some embodiments, as used herein, the term "about" refers to any value that is within 10% of the stated value. In some embodiments, the term "about" refers to any value that is within 5% of the stated value. In some embodiments, the term "about" refers to any value that is within 1% of the stated value.
[0050] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises an anti-N3pGlu antibody of the present disclosure present at a concentration of about 1 mg / mL to about 300 mg / mL (e.g., about 1 mg / mL to about 75 mg / mL, about 1 mg / mL to about 50 mg / mL, about 1 mg / mL to about 40 mg / mL, about 5 mg / mL to about 30 mg / mL, about 10 mg / mL to about 25 mg / mL, about 150 mg / mL to about 250 mg / mL). The composition comprises an Aβ antibody, a buffer solution present at a concentration of about 1 mM to about 50 mM (e.g., about 1 mM to about 30 mM or about 5 mM to about 15 mM), a tonicity agent present in a total amount of 1% w / v to 20% w / v (e.g., about 5% w / v to about 15% w / v), a surfactant present in a total amount of about 0.005% w / v to 0.1% w / v (e.g., about 0.005% w / v to about 0.06% w / v or about 0.01% w / v to about 0.04% w / v), and one or more optional excipients.
[0051] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 94% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 35° C. for 3 months. In the context of size exclusion chromatography, percentage refers to peak area percent (% area). Size exclusion chromatography evaluates the total amount of high molecular weight (HMW) species (also referred to as aggregates) and low molecular weight (LMW) species (fragments) present in a sample. This evaluation is performed by integrating the eluted peaks to represent the fractional ratio of each peak of interest to the total integrated peak area (which, when multiplied by 100, gives a percentage (e.g., % total aggregation)). In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total antibody monomer content of at least 94% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 25° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 94% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 95% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 96% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total antibody monomer content of at least 97% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months. In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 97.5% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months.In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 95% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution for 29 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 96% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution for 29 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 96.0% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution for 29 months at about 5° C.
[0052] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 94% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 95% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 96% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total antibody monomer content of at least 97% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 97.5% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 95% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 29 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 96% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 29 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits an antibody monomer content of at least 96.0% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 29 months.
[0053] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 6% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C., about 25° C., or about 35° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 5% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C., about 25° C., or about 35° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 4% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 25° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 3% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 29 months. In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 2% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months.
[0054] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 4% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution for 29 months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 3% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution for 29 months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 2% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution for 3 months at 2-8° C.
[0055] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total oleic acid content of less than 0.03% by weight volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage of the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total oleic acid content of less than 0.03% by weight volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage of the pharmaceutical solution for 29 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total oleic acid content of 0.01% to 0.03% by weight volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage of the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total oleic acid content of about 0.01% to about 0.03% by weight volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage of the pharmaceutical solution for 29 months at about 5° C. In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total free oleic acid content of less than about 0.015% by weight by volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storing the pharmaceutical solution at about 5°C, about 25°C, or about 35°C for 3 months.In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total free oleic acid content of less than about 0.015% by weight or volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage of the pharmaceutical solution for 29 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total free oleic acid content of less than about 0.005% by weight or volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage of the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total free oleic acid content of less than 0.0025% by weight or volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storing the pharmaceutical solution for 29 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total free oleic acid content of less than 0.0025% by weight or volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storing the pharmaceutical solution for 29 months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total free oleic acid content of less than 0.0025% by weight or volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storing the pharmaceutical solution for 3 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total free oleic acid content of less than 0.0025% by weight or volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storing the pharmaceutical solution for 3 months at 2-8° C.
[0056] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total free oleic acid content of less than 0.001% by weight or volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storing the pharmaceutical solution for 29 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a total free oleic acid content of less than 0.005% by weight or volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storing the pharmaceutical solution for 29 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises polyoxyethylene (20) sorbitan monooleate, and the pharmaceutical solution exhibits a difference in the amount of total free oleic acid content of less than 0.0025% by weight or volume when the pharmaceutical solution is stored at about 5° C. for 3 months compared to when the pharmaceutical solution is stored at about 5° C. for 29 months, as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard.
[0057] In some embodiments, the pharmaceutical solution of anti-N3pGlu Aβ antibody comprises polyoxyethylene(20) sorbitan monooleate, and the pharmaceutical solution exhibits a total oleic acid content of less than 0.0025% weight by volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage of the pharmaceutical solution at about 5° C., about 25° C., or about 35° C. for 3 months.
[0058] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 85% by area as measured by non-reducing capillary electrophoresis sodium dodecyl sulfate (CE-SDS) after storage of the pharmaceutical solution for 6 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 90% by area as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 6 months at about 5° C. or about 25° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 90.5% by area as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 6 months at about 5° C. or about 25° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 89.0% by area as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 6 months at about 5° C. or about 25° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 92% by area as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 6 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 90.5% by area as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 6 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 89.0% by area as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 6 months at about 5° C.
[0059] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 90% by area as measured by reduced CE-SDS after storage of the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 94% by area as measured by reduced CE-SDS after storage of the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 95% by area as measured by reduced CE-SDS after storage of the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 95% by area as measured by reduced CE-SDS after storage of the pharmaceutical solution for 3 months at about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 94% by area as measured by reduced CE-SDS after storing the pharmaceutical solution for 3 months at about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 92% by area as measured by reduced CE-SDS after storing the pharmaceutical solution for 3 months at about 35° C.
[0060] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 94% by area as measured by reduced CE-SDS after storing the pharmaceutical solution for 3 months at about 5° C. or about 25° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 94% by area as measured by reduced CE-SDS after storing the pharmaceutical solution for 6 months at about 5° C. or about 25° C.
[0061] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a purity of at least 96 area % as measured by reduced CE-SDS after storing the pharmaceutical solution at about 5° C. for 3 months.
[0062] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a 5 area % difference in purity as measured by reduced CE-SDS between the pharmaceutical solution stored at about 5° C. for 3 months and the pharmaceutical solution stored at about 5° C. for 6 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a 3 area % difference in purity as measured by reduced CE-SDS between the pharmaceutical solution stored at about 5° C. for 3 months and the pharmaceutical solution stored at about 5° C. for 6 months.
[0063] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 4 area % as measured by reduced CE-SDS after storing the pharmaceutical solution at about 5° C. or about 25° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 4 area % as measured by reduced CE-SDS after storing the pharmaceutical solution at about 5° C. or about 25° C. for 6 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 3 area % as measured by reduced CE-SDS after storing the pharmaceutical solution at about 5° C. or about 25° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 3 area % as measured by reduced CE-SDS after storing the pharmaceutical solution at about 5° C. or about 25° C. for 6 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 5 area % as measured by reduced CE-SDS after storing the pharmaceutical solution at about 35° C. for 3 months.
[0064] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 4% relative to the total antibody peak area when measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 4% relative to the total antibody peak area when measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 2% relative to the total antibody peak area when measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 2% relative to the total antibody peak area when measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 1.5% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 1.5% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 1% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 1% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months.
[0065] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 9 area % as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 3 months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 8.5 area % as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 3 months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 7.5 area % as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 3 months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 4 area % as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 3 months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 4 area % as measured by non-reducing CE-SDS after storage of the pharmaceutical solution for 3 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 2 area % as measured by non-reducing CE-SDS after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 2 area % as measured by non-reducing CE-SDS after storing the pharmaceutical solution at about 5° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 1.5 area % as measured by non-reducing CE-SDS after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 1.5 area % as measured by non-reducing CE-SDS after storing the pharmaceutical solution at about 5° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 1 area % as measured by non-reducing CE-SDS after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution exhibits a total aggregate content of less than 1 area % as measured by non-reducing CE-SDS after storing the pharmaceutical solution at about 5° C. for 3 months.
[0066] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 10,000 microparticles per milliliter, and the microparticles are greater than 2 μm in size when measured using microflow imaging after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 6,000 microparticles per milliliter, and the microparticles are greater than 2 μm in size when measured using microflow imaging after storing the pharmaceutical solution for 6 months at about 5° C. or about 25° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 2,000 microparticles per milliliter, and the microparticles are greater than 2 μm in size when measured using microflow imaging after storing the pharmaceutical solution for 6 months at about 5° C. or about 25° C.
[0067] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 2,000 microparticles per milliliter, and the microparticles are greater than 5 μm in size when measured using microflow imaging after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 2,000 microparticles per milliliter, and the microparticles are greater than 5 μm in size when measured using microflow imaging after storing the pharmaceutical solution for 6 months at about 5° C. or about 25° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 1,000 microparticles per milliliter, and the microparticles are greater than 5 μm in size when measured using microflow imaging after storing the pharmaceutical solution for 6 months at about 5° C. or about 25° C. In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 1,000 microparticles per milliliter, and the microparticles are greater than 5 μm in size as measured using microflow imaging after storing the pharmaceutical solution at about 5° C. or about 25° C. for 29 months.
[0068] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 3,000 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by light obscuration using a high accuracy liquid particle counter (HIAC) after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 1,500 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by light obscuration using a HIAC after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 1,000 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by light obscuration using a HIAC after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 750 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 500 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 250 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 100 microparticles per milliliter, and the microparticles are greater than 2 μm in size as measured by light obscuration using an HIAC after storing the pharmaceutical solution at about 5° C., about 25° C., or about 35° C. for 3 months.In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 75 microparticles per milliliter, and the microparticles are greater than 2 μm in size as measured by light obscuration using an HIAC after storing the pharmaceutical solution at about 5° C., about 25° C., or about 35° C. for 3 months.
[0069] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 3,000 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for three months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 1,500 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for three months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 1,000 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for three months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 750 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by HIAC with light protection after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 500 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by HIAC with light protection after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 250 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by HIAC with light protection after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 100 microparticles per milliliter, the microparticles being greater than 2 μm in size when measured by HIAC with light protection after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 75 particulates per milliliter, and the particulates are greater than 2 μm in size as measured by light obscuration using an HIAC after storing the pharmaceutical solution at 2-8° C. for 3 months.
[0070] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 800 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 500 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 200 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 200 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 100 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 75 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C.
[0071] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 800 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light protection after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 500 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light protection after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 200 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light protection after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 200 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light protection after storing the pharmaceutical solution at 2-8° C. for 3 months. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 100 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at 2-8° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 75 microparticles per milliliter, the microparticles being greater than 5 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at 2-8° C.
[0072] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 125 microparticles per milliliter, the microparticles being greater than 10 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 50 microparticles per milliliter, the microparticles being greater than 10 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 25 microparticles per milliliter, the microparticles being greater than 10 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 20 microparticles per milliliter, the microparticles being greater than 10 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 15 microparticles per milliliter, the microparticles being greater than 10 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 5 microparticles per milliliter, the microparticles being greater than 10 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 3 months at about 5° C., about 25° C., or about 35° C.
[0073] In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 25 microparticles per milliliter, the microparticles being greater than 10 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 6 months at about 5° C. or about 25° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 25 microparticles per milliliter, the microparticles being greater than 10 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 29 months at about 5° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 3 microparticles per milliliter, the microparticles being greater than 10 μm in size when measured by HIAC with light obscuration after storing the pharmaceutical solution for 6 months at about 5° C. or about 25° C. In some embodiments of the pharmaceutical solution according to the present disclosure, the pharmaceutical solution contains fewer than 3 particulates per milliliter, and the particulates are greater than 10 μm in size as measured by light obscuration using an HIAC after storing the pharmaceutical solution at about 5° C. for 29 months.
[0074] In some embodiments, a pharmaceutical solution according to the present disclosure exhibits a UV absorbance at 550 nm that changes less than ±3% over 4 weeks of storage at 2-8° C. In some embodiments, a pharmaceutical solution according to the present disclosure exhibits a UV absorbance at 550 nm that changes less than ±2% over 4 weeks of storage at 2-8° C. In some embodiments, a pharmaceutical solution according to the present disclosure exhibits a UV absorbance at 550 nm that changes less than ±1% over 4 weeks of storage at 2-8° C. In some embodiments, a pharmaceutical solution according to the present disclosure exhibits a UV absorbance at 550 nm that changes less than ±3% over 4 weeks of storage at about 5° C. In some embodiments, a pharmaceutical solution according to the present disclosure exhibits a UV absorbance at 550 nm that changes less than ±2% over 4 weeks of storage at about 5° C. In some embodiments, a pharmaceutical solution according to the present disclosure exhibits a UV absorbance at 550 nm that changes less than ±1% over 4 weeks of storage at about 5° C.
[0075] In some embodiments, a pharmaceutical solution according to the present disclosure exhibits a change in protein content of about 0.1% to about 25% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 5° C., for example, a change in protein content from 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, about 10%, about 15%, about 20%, or about 25% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 5° C. In some embodiments, a pharmaceutical solution according to the present disclosure exhibits a change in protein content of 0.4% to 25% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 5° C. In some embodiments, pharmaceutical solutions according to the present disclosure exhibit a change in protein content of about 0.4% to about 13% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 5° C. In some embodiments, pharmaceutical solutions according to the present disclosure exhibit a change in protein content of about 1% to about 13% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 5° C. In some embodiments, a pharmaceutical solution according to the present disclosure exhibits a change in protein content of 0.1% to 25% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 2-8° C., for example, a change in protein content from 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, about 15%, about 20%, or about 25% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 2-8° C. In some embodiments, a pharmaceutical solution according to the present disclosure exhibits a change in protein content of about 0.4% to about 25% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 2-8° C. In some embodiments, pharmaceutical solutions according to the present disclosure exhibit a change in protein content of about 0.4% to about 13% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 2-8° C. In some embodiments, pharmaceutical solutions according to the present disclosure exhibit a change in protein content of about 1% to about 13% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 2-8° C.
[0076] In some embodiments, a pharmaceutical solution according to the present disclosure has at least 92% of the anti-N3pGlu antibodies appearing in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2-8° C. In some embodiments, a pharmaceutical solution according to the present disclosure has at least 93% of the anti-N3pGlu antibodies appearing in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2-8° C. In some embodiments, a pharmaceutical solution according to the present disclosure has at least 94% of the anti-N3pGlu antibodies appearing in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2-8° C. In some embodiments, a pharmaceutical solution according to the present disclosure has at least 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, or 93.9% of the anti-N3pGlu antibodies appearing in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2-8° C. In some embodiments, a pharmaceutical solution according to the present disclosure has 93.3% to 93.8% of the anti-N3pGlu antibodies appearing in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2-8° C.
[0077] In some embodiments, a pharmaceutical solution according to the present disclosure has at least 92% of the anti-N3pGlu antibodies appearing in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at about 5° C. In some embodiments, a pharmaceutical solution according to the present disclosure has at least 93% of the anti-N3pGlu antibodies appearing in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at about 5° C. In some embodiments, a pharmaceutical solution according to the present disclosure has at least 94% of the anti-N3pGlu antibodies appearing in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at about 5° C. In some embodiments, a pharmaceutical solution according to the present disclosure has at least 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, or 93.9% of the anti-N3pGlu antibodies appearing in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at about 5° C. In some embodiments, a pharmaceutical solution according to the present disclosure has 93.3% to 93.8% of the anti-N3pGlu antibodies appearing in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at about 5° C.
[0078] In some embodiments, a pharmaceutical solution according to the disclosure exhibits a 15% or less area reduction in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution at 2-8° C. for 4 weeks. In some embodiments, a pharmaceutical solution according to the disclosure exhibits a 12.5% or less area reduction in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution at 2-8° C. for 4 weeks. In some embodiments, a pharmaceutical solution according to the disclosure exhibits a 11% or less area reduction in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution at 2-8° C. for 4 weeks. In some embodiments, a pharmaceutical solution according to the disclosure exhibits a 10% or less area reduction in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution at 2-8° C. for 4 weeks. In some embodiments, a pharmaceutical solution according to the disclosure exhibits a 10.0 area%, 10.1 area%, 10.2 area%, 10.3 area%, 10.4 area%, 10.5 area%, 10.6 area%, 10.7 area%, 10.8 area%, or 10.9 area% or less decrease in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution for 4 weeks at 2-8° C. In some embodiments, a pharmaceutical solution according to the disclosure exhibits a 15 area% or less decrease in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution for 4 weeks at 5° C. In some embodiments, a pharmaceutical solution according to the disclosure exhibits a 12.5 area% or less decrease in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution for 4 weeks at about 5° C. In some embodiments, a pharmaceutical solution according to the present disclosure exhibits no more than an 11 area % decrease in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution for 4 weeks at about 5° C. In some embodiments, a pharmaceutical solution according to the present disclosure exhibits no more than a 10 area % decrease in the amount of anti-N3pGlu antibodies as measured by reducing CE-SDS after storing the pharmaceutical solution for 4 weeks at about 5° C.In some embodiments, a pharmaceutical solution according to the present disclosure exhibits no more than a 10.0 area%, 10.1 area%, 10.2 area%, 10.3 area%, 10.4 area%, 10.5 area%, 10.6 area%, 10.7 area%, 10.8 area%, or 10.9 area% decrease in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution at about 5° C. for 4 weeks.
[0079] In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises an anti-N3pGlu Aβ antibody, a buffer, a tonicity agent, a surfactant, and optional excipients in amounts sufficient in combination such that the pharmaceutical solution exhibits one or more of the following: (a) an antibody monomer content of at least 97% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (b) a total aggregate content of less than 2% as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (c) an antibody purity of at least 92% as measured by reduced capillary electrophoresis sodium dodecyl sulfate (CE-SDS) after storage of the pharmaceutical solution at about 35° C. for 3 months; (d) after storage of the pharmaceutical solution at 2-8°C for 3 months, a total aggregate content of (i) less than 2% as measured by size exclusion chromatography, or (ii) less than 1.5% as measured by non-reducing CE-SDS; (e) Less than 500 particulates per milliliter, the particulates being greater than 2 μm in size when measured by light obscuration using a high accuracy particle counter (HIAC) after storing the pharmaceutical solution at 2-8° C. for 3 months; (f) less than 100 particulates per milliliter, the particulates being greater than 5 μm in size when measured by light obscuration using a high accuracy particle counter (HIAC) after storing the pharmaceutical solution at 2-8° C. for 3 months; (g) UV absorbance at 550 nm that changes less than ±3% over 4 weeks of storage at 2-8°C; (h) a change in protein content of about 1% to about 13% as measured by UV absorbance at 280 nm after 4 weeks of storage at 2-8°C; (i) at least 93% of the anti-N3pGlu antibodies appear in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2-8°C; (j) a decrease of about 11% or less in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution at 2-8°C for 4 weeks; and (k) Not more than four particles having a size of 25 μm or less as measured by differential count per mL after storing the pharmaceutical solution at 2-8° C. for 4 weeks.
[0080] In some embodiments of the foregoing pharmaceutical solution, one or more of characteristics (a)-(k) are present before and after storage of the pharmaceutical solution.
[0081] In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises an anti-N3pGlu Aβ antibody, a buffer, a tonicity agent, a surfactant, and optional excipients in amounts sufficient in combination such that the pharmaceutical solution exhibits one or more of the following: (a) an antibody monomer content of at least 97% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at about 5° C. for 3 months; (b) a total aggregate content of less than 2% as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months; (c) UV absorbance at 550 nm that changes by less than ±3% over 4 weeks of storage at about 5°C; (d) a change in protein content of about 1% to about 13% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 5°C; (e) after 4 weeks of storage at about 5°C, at least 93% of the anti-N3pGlu antibodies appear in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography; (f) an 11% or less decrease in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storing the pharmaceutical solution at about 5° C. for 4 weeks; and (g) No more than 4 particles having a size of 25 μm or less as measured by differential count per mL after storing the pharmaceutical solution at about 5° C. for 4 weeks.
[0082] In some embodiments of the foregoing pharmaceutical solution, one or more of characteristics (a)-(g) are present before and after storage of the pharmaceutical solution.
[0083] In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises an anti-N3pGlu Aβ antibody, a buffer, a tonicity agent, a surfactant, and optional excipients in amounts sufficient in combination such that the pharmaceutical solution exhibits one or more of the following: (a) an antibody monomer content of at least 97.5% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (b) a total aggregate content of less than 1.5% as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (c) an antibody purity of at least 94% as measured by reduced CE-SDS after storage of the pharmaceutical solution at about 35° C. for 3 months; (d) 93.3% to 93.8% of anti-N3pGlu antibodies appear in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2 to 8°C; (e) A decrease of 6.9% or less in the amount of anti-N3pGlu antibodies as measured by reduced CE-SDS after storing the pharmaceutical solution at 2-8°C for 4 weeks.
[0084] In some embodiments of the foregoing pharmaceutical solution, one or more of characteristics (a)-(e) are present before and after storage of the pharmaceutical solution.
[0085] In some embodiments of a pharmaceutical solution according to the present disclosure, the pharmaceutical solution comprises an anti-N3pGlu Aβ antibody, a buffer, a tonicity agent, a surfactant, and optional excipients in amounts sufficient in combination such that the pharmaceutical solution exhibits one or more of the following: (a) an antibody monomer content of at least 97.5% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at about 5° C. for 3 months; (b) a total aggregate content of less than 1.5% as measured by size exclusion chromatography after storage of the pharmaceutical solution at 5° C. for 3 months; (c) at least 96% antibody purity as measured by reduced CE-SDS after storage of the pharmaceutical solution at about 5° C. for 3 months; (d) 93.3% to 93.8% of anti-N3pGlu antibodies appear in the main peak when analyzed by size exclusion chromatography after 4 weeks of storage at about 5°C; (e) a 6.9% or less decrease in the amount of anti-N3pGlu antibodies as measured by reduced CE-SDS after storing the pharmaceutical solution at about 5° C. for 4 weeks; (f) less than 500 particulates per milliliter, wherein the particulates are greater than 2 μm in size when measured by light obscuration using an HIAC after storing the pharmaceutical solution at about 5° C. for 3 months; (g) Less than 100 particulates per milliliter, wherein the particulates are greater than 5 μm in size when measured by light obscuration using an HIAC after storing the pharmaceutical solution at about 5° C. for 3 months.
[0086] In some embodiments of the foregoing pharmaceutical solution, one or more of characteristics (a)-(g) are present before and after storage of the pharmaceutical solution.
[0087] Aspects of the present disclosure also relate to a container comprising a pharmaceutical solution according to the present disclosure. In some embodiments, the container is a vial, a syringe (e.g., a pre-filled syringe), a bag, or a tube.
[0088] Aspects of the present disclosure also relate to administering the pharmaceutical solutions of the present disclosure to a patient. The terms "subject" and "patient" are used interchangeably in this disclosure. In some embodiments, a patient (or, interchangeably, "subject") is a human (also referred to as a "human patient" or, interchangeably, a "human subject"). The pharmaceutical compositions of the present disclosure can be administered by a parental route (e.g., subcutaneous, intravenous, intraperitoneal, intramuscular) to a subject at risk for or exhibiting a disease or disorder described herein. In some embodiments, administration is by subcutaneous and / or intravenous route. In some embodiments, an antibody (e.g., an anti-N3pGlu Aβ antibody) is administered by intravenous infusion.
[0089] As used herein, terms such as "treatment," "treating," or "treat" include inhibiting, slowing, or halting the progression or severity of an existing symptom, condition, disease, or disorder in a subject. In some embodiments, treatment includes reducing amyloid beta in the brain of a human patient.
[0090] As used herein, "method of treatment" is equally applicable to the use of a composition (e.g., a composition that is a pharmaceutical solution according to the present disclosure) for treating a disease or disorder described herein and / or the use of a composition (e.g., a composition that is a pharmaceutical solution according to the present disclosure) for use in the manufacture of a medicament for treating a disease or disorder described herein and / or for multiple uses.
[0091] As used herein, the term "prevention" refers to the prophylactic administration of an antibody to an asymptomatic subject or a subject with preclinical disease (e.g., preclinical Alzheimer's disease) to prevent the onset or progression of the disease.
[0092] Aspects of the present disclosure relate to treating diseases characterized by amyloid beta (Aβ) deposition and / or diseases characterized by amyloid beta (Aβ) deposits. In some embodiments, the present disclosure relates to methods of treating diseases characterized by amyloid beta (Aβ) deposition and / or diseases characterized by amyloid beta (Aβ) deposits by administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical solution according to the present disclosure. As used herein, the terms "disease characterized by amyloid beta (Aβ) deposition" or "disease characterized by amyloid beta (Aβ) deposits" refer to diseases pathologically characterized by Aβ deposits in the brain or cerebral vasculature. This includes diseases such as Alzheimer's disease (AD), Down's syndrome, and cerebral amyloid angiopathy. In some embodiments, the Alzheimer's disease is preclinical AD, prodromal AD, mild AD, moderate AD, or severe AD. In some embodiments, a method of treating a disease characterized by amyloid beta (Aβ) deposits and / or a disease characterized by amyloid beta (Aβ) deposits according to the present disclosure comprises administering to a patient in need thereof a pharmaceutical solution according to the present disclosure obtained from a container according to the present disclosure.
[0093] In some embodiments, a human patient in need thereof is administered one or more doses of a pharmaceutical solution according to the present disclosure. For the avoidance of doubt, administering a "dose" should be understood to refer to administering a quantity of a pharmaceutical solution according to the present disclosure. Nevertheless, a "dose" may be expressed in terms of an amount of antibody rather than an amount of pharmaceutical solution. For example, as one of skill in the art would understand, a reference to administering, e.g., a 100 mg dose of an antibody would refer to administering, e.g., 10 mL of a pharmaceutical solution of the antibody (wherein the pharmaceutical solution has a concentration of 10 mg of antibody per mL of solution (also referred to as a 10 mg / mL concentration)), or to administering, e.g., 5 mL of a pharmaceutical solution of the antibody (wherein the pharmaceutical solution has a concentration of 20 mg of antibody per mL of solution (also referred to as a 20 mg / mL concentration)). Also, for the avoidance of doubt, a reference to administering an antibody should be understood to refer to administering a pharmaceutical solution (according to the present disclosure) of that antibody.
[0094] In some embodiments, a method of treatment according to the present disclosure comprises administering to a patient one or more doses of about 100 mg to about 10,000 mg of an anti-N3pGlu Aβ antibody, e.g., one or more doses of 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, or 1,000 mg or more of the antibody. In some embodiments, a method of treatment according to the present disclosure comprises administering to a patient one or more doses of a non-lyophilized anti-N3pGlu Aβ antibody.
[0095] In some embodiments, a subject is administered one or more first doses of an antibody. In some embodiments, one or more first doses are administered to a human subject such that each first dose is administered once every four weeks. In some embodiments, the first dose is administered once to a subject. In some embodiments, the first dose is administered twice to a subject, with each first dose administered once every four weeks. In some embodiments, the first dose is administered three times to a subject, with each first dose administered once every four weeks.
[0096] In some embodiments, the subject is administered one or more second doses of the antibody. In some embodiments, the one or more second doses comprise greater than about 700 mg to about 1400 mg of the antibody (e.g., an anti-N3pGlu Aβ antibody). In some embodiments, the subject is administered one or more second doses of greater than about 700 mg to about 1400 mg of the antibody (e.g., an anti-N3pGlu Aβ antibody), each second dose being administered approximately once every four weeks. In some embodiments, the second dose is administered four weeks after the one or more first doses.
[0097] Doses may also be expressed in mg / kg. As used herein, "mg / kg" refers to the amount of antibody or drug administered to a subject in milligrams based on their body weight in kilograms. The dose is given at one time. For example, a 10 mg / kg dose of antibody to a 70 kg patient is a single 700 mg dose of antibody administered in a single administration. Similarly, a 20 mg / kg dose of antibody to a 70 kg patient is a 1400 mg dose of antibody administered in a single administration. In some embodiments, the first dose is about 1 mg / kg to about 10 mg / kg of antibody. In some embodiments, the patient is administered up to three first doses of about 1 mg / kg to about 10 mg / kg. In some embodiments, the patient is administered one first dose, two first doses, or three first doses of about 1 mg / kg to about 10 mg / kg. In some embodiments, the patient is administered three first doses of about 10 mg / kg once every four weeks. In some embodiments, the first dose is about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, or about 10 mg / kg.
[0098] In some embodiments, the antibodies, methods, dosing regimens, and / or uses of the present disclosure result in a reduction of amyloid beta in the brain of a human patient. In some embodiments, administration of a pharmaceutical solution according to the present disclosure results in at least a 5% reduction in the amount of amyloid beta in the brain of a human patient. In some embodiments, administration of a pharmaceutical solution according to the present disclosure results in about a 5%, about a 10%, about a 15%, about a 20%, about a 25%, about a 30%, about a 35%, about a 40%, about a 45%, about a 50%, about a 55%, about a 60%, about a 65%, about a 70%, about a 75%, about a 80%, about a 85%, about a 90%, about a 95%, about a 99% or more reduction in the amount of amyloid beta in the brain of a human patient. [Example]
[0099] Example 1: Preformulation studies on donanemab 1. Abbreviations and Definitions API (Active pharmaceutical ingredient) CE-SDS-Capillary Electrophoresis-Sodium Dodecyl Sulfate DLS(Dynamic Light Scattering)-Dynamic Light Scattering BDS (Bulk Drug Substance) - bulk drug substance, starting material for the process (donanemab) DSC (Differential Scanning Calorimetry) EP (European Pharmacopoeia) - European Pharmacopoeia ISO (International Organization for Standardization) NF (National Formulary) - National Formulary PDS (Pharmaceutical Development Services) SDS (Sodium Dodecyl Sulfate) SEC - Size Exclusion Chromatography TC (Thermo Couples) USP (United States Pharmacopoeia)
[0100] 2. Materials and Equipment The materials used during development are summarized in Table 1.
[0101] [Table 1]
[0102] Table 2 summarizes the equipment used during development.
[0103] [Table 2]
[0104] 3. Method Protein content: UV absorbance at 280 nm (calculated extinction coefficient = 1.48 mL mg cm) The turbidity of the solution is determined by measuring the absorbance at 550 nm. Particulate matter was analyzed using the Accusizer SIS in accordance with USP <788> Monitor using the (light obscuration) method Thermal stability is monitored using microcalorimetry (differential scanning calorimetry, DSC).
[0105] 4. Experimental Design 4.1 pH research Without wishing to be bound by theory, it is believed that the pH of an antibody solution affects properties of the antibody, including, but not limited to, its solubility in solution. The solubility of an antibody in solution is an important parameter because it influences the amount of solution (i.e., dose) that must be administered to a patient to deliver a given amount of antibody and achieve the target biological effect in the patient. Without wishing to be bound by theory, it is also believed that the pH of an antibody solution affects the stability of the solution (e.g., an antibody may degrade more rapidly in solution at a first pH than at a second, different pH). Given the importance of pH, a pH rate profile stability study was conducted to examine the solution pH conditions for donanemab. The experimental design is presented in Table 3.
[0106] Thawed bulk drug substance (10 mM citrate, 150 mM NaCl, pH 6.5; 57.5 mg / mL) was dialyzed against 10 mM citrate buffer using a 30,000 MWCO Slide-a-lyzer cassette. Dialysis was performed at 2-8 °C, and the buffer was changed daily. After buffer exchange, the protein concentration in each solution was measured and diluted to the desired concentration (approximately 50 mg / mL for F4 and 2 mg / mL for the other solutions). The final solution was filtered using a 0.22 μm syringe filter.
[0107] The filtered solutions were filled into 20R glass vials, which were then stoppered and sealed. The vials of each solution were stored under specified storage conditions in the relevant stability chambers (e.g., 5±3°C, 25±2°C / 60±5%RH, and 40±2°C / 75±5%RH). The test schedule is listed in Table 4.
[0108] Samples were tested for purity (SEC and CE-SDS reduced and non-reduced), protein content (UV assay at 280 nm), insoluble particulate matter (light obscuration and appearance), turbidity (A550), and pH. Approximately 1 mL of each solution was sent for thermal stability (calorimetry).
[0109] [Table 3]
[0110] [Table 4] X = pull a sample and test, O = pull a sample and test as needed * The samples were analyzed by standard DSC and microcalorimetry.
[0111] 4.2 Freezing / thawing studies The stability of the donanemab solution was assessed after freezing and thawing up to three times.
[0112] The solutions were subjected to three freeze-thaw cycles and analyzed in the following manner: Morning of Day -1: TO analysis, freeze vials at -70°C Day -1 PM: Thaw at room temperature for T1 analysis, freeze vials at -70°C Morning of day -2: Thaw at room temperature for T2 analysis; freeze vials at -70°C. Day 2 (afternoon): Thaw at room temperature and analyze for T3.
[0113] The bulk drug substance was dialyzed against selected 10 mM citrate buffer (pH 6.0), and then polysorbate 80 was added at different concentrations (0.01, 0.02, 0.04 w / v%) and finally diluted to approximately 25 mg / mL. Dialysis was performed at 2-8°C, and the buffer was exchanged 4, 8, and 24 hours after the start of dialysis.
[0114] Samples were formulated as outlined in the study design in Table 5.
[0115] After 0.22 μm filtration, the solutions were divided into 10R vials, filled with 5 mL of each solution, stoppered and sealed. The test schedule was as listed in Table 6.
[0116] Samples were tested for soluble aggregate (SEC), insoluble particulate matter (light obscuration and appearance), protein content (UV assay at 280 nm), aggregation (DLS), turbidity (A550), and pH.
[0117] [Table 5]
[0118] [Table 6] Note: X = sample removed and tested; blank = no test
[0119] 4.3 Mixing studies The stability of donanemab was evaluated after 24 and 48 hours of agitation on a rotary shaker at 100 rpm at room temperature. This speed caused the solution in the vial to vibrate slightly. Solutions with the same matrix and the same dialysis procedure as in the freeze-thaw study were analyzed (see Table 5). After 0.22 μm filtration, the solution was divided into 10 R vials, each filled with 5 mL of each solution, stoppered, and sealed. The test schedule is listed in Table 7.
[0120] [Table 7]
[0121] 4.4 Solubility studies The solubility of donanemab was studied in 10 mM citrate buffer at pH 6 using 0.01% (w / v) polysorbate 80. Donanemab BDS was dialyzed into the appropriate buffer (the same dialysis procedure was followed for freeze-thaw and agitation studies), concentrated using an Amicon® Ultra 30K centrifugal filter unit, filled into 5 mL glass vials, stoppered, sealed, and stored at -5°C on a pre-cooled freeze-dryer shelf. After 24 hours, samples were visually observed for phase separation. If no phase separation occurred, the samples were subjected to additional physical stability testing at 5°C for 1 week. The testing schedule was as listed in Table 8.
[0122] [Table 8] Note: A complete study is only foreseen for one time point. 5.Results 5.1 pH research This study was designed to investigate the stability of donanemab at different pH levels. Seven solutions (F1-F7), shown in Table 3, were studied. The effects of sodium chloride and protein concentration were also investigated at pH 6.0. The pH range of 5-7 was selected based on previous studies that showed maximum chemical and physical stability at pH 6.0. Tables A.1-A.9 in Appendix A tabulate the results from this study.
[0123] Protein content, turbidity (Abs at 550 nm) and pH values remained unchanged throughout the study for all solutions. After 4 weeks at 2°C-8°C, almost no particles were observed in all solutions (F1-F7). After 4 weeks at 40°C / 75% RH, few particles and filaments were observed in all solutions (Tables A.1 and A.2).
[0124] Looking at the overall SEC data, the results obtained from the 40°C / 75% RH storage temperature were considered more meaningful than those obtained from the 2°C-8°C storage conditions. The SEC chromatograms showed a shoulder after the main peak, which was identified as a fragment of donanemab and was therefore included in the low molecular weight species (LMW%) or fragmentation. After 4 weeks at 2-8°C, minimal differences in aggregation / fragmentation were observed in all test samples. After 4 weeks at 40°C, fragmentation was more evident in F7 (pH 6.0, NaCl) and F6 (pH 5.0). In contrast, aggregation was higher in F4 (pH 6.0, 50 mg / mL), which may be due to the higher protein concentration. Solutions F1 (pH 7.0), F2 (pH 6.5), F3 (pH 6.0), and F5 (pH 5.5) showed a lower degree of fragmentation and / or aggregation. Figure 1 and Table A.3 in Appendix A provide further SEC data for solutions at different pHs.
[0125] Non-reducing CE-SDS purity results remained relatively unchanged over 4 weeks of storage at 5° C. The least decrease in % donanemab was observed after 4 weeks at 40° C. in the following solutions: F7 (pH 6.0 NaCl) and F5 (pH 5.5). % donanemab refers only to the % area of the peak identified as intact monoclonal antibody.
[0126] Figures 2A, 2B, and Table A.4 in Appendix A provide further details regarding the pH studies.
[0127] After 4 weeks of storage, the overall % purity by reduced CE-SDS decreased. Solution F5 (pH 5.5) had the smallest change in purity after 4 weeks, while solution F1 (pH 7.0) had the largest change in purity after 4 weeks. Figure 3 and Table A.5 in Appendix A provide additional purity data.
[0128] Differential scanning calorimetry (DSC) analysis was performed on the pH Study 1 samples and the data is reported in Table A.7. The results showed that the Tm1 transition was the highest energy transition.
[0129] Regarding subvisible particles, as shown in Figures 4A and 4B, the number of particles / mL in each solution decreased for each size investigated after 1 month of stabilization.
[0130] Without wishing to be bound by theory, the foregoing results suggest that antibody stability in solution may be maximized by preparing solutions at a pH between 5.5 and 6.0, e.g., pH 5.5, 5.6, 5.7, 5.8, 5.9, or 6.0. Table A.9 in Appendix A provides a summary of the results for the pH studies.
[0131] 5.2 Freeze-Thaw Research This study was conducted on solutions containing 25 mg / mL donanemab at pH 6.0 (based on the results of the pH study) at various polysorbate 80 levels (Table 5). The donanemab solutions were subjected to three freeze-thaw cycles as described above. All tabulated analytical results from the freeze-thaw study are summarized in Tables A.10-A.14 in Appendix A.
[0132] Very few particles were observed in solutions F2 (0.01% polysorbate 80), F3 (0.02% polysorbate 80), and F4 (0.04% polysorbate 80) throughout the study. In contrast, solution F1 (no polysorbate 80) showed an increase in particles from the first freeze-thaw cycle. See Table A.10 in Appendix A.
[0133] For solutions F2 (0.01% polysorbate 80) and F3 (0.02% polysorbate 80), no significant variation was observed in the UV assay at 280 nm. Solutions F1 (no polysorbate 80) and F4 (0.04% polysorbate 80) showed a slight decrease in the UV assay at 280 nm. See Table A.11 in Appendix A.
[0134] No pH variation was observed for all solutions (Table A.12 in Appendix A).
[0135] For solutions F1 (no polysorbate 80) and F2 (0.01% polysorbate 80), no significant variation of Abs at 550 nm was observed, whereas for solutions F3 (0.02% polysorbate 80) and F4 (0.04% polysorbate 80), a slight decrease of this parameter was observed. See Table A.12 in Appendix A.
[0136] The SEC analysis showed a shoulder after the main peak, which was identified as a fragment of donanemab and was therefore included in the low molecular weight species % (LMW%) or fragments. For solutions F2 (0.01% polysorbate 80) and F4 (0.04% polysorbate 80), no significant changes in the SEC profile were observed, whereas solution F1 (no polysorbate 80) showed a slight increase in the main peak and a concomitant decrease in fragmentation. For solution F3 (0.02% polysorbate 80), a decrease in the main peak and a concomitant increase in fragmentation were observed.
[0137] No variation in aggregation percentage was detected throughout the study. For a graphical representation of the above discussion, see Table A.13 in Appendix A, and Figures 5A, 5B, and 5C.
[0138] Without wishing to be bound by theory, these results indicated that the presence of a low percentage of polysorbate (e.g., 0.01% w / v) improves the overall physical properties of the solution, such as by reducing the number of visible and subvisible particles in the solution.
[0139] Soluble aggregates increased slightly in all samples after the freeze-thaw treatment. As shown in Figures 6A and 6B, after the third freeze / thaw cycle, the number of particles / mL generally increased for each solution at each size investigated.
[0140] Samples formulated without polysorbate 80 exhibited higher particulate matter counts as measured by light obscuration. See Table A.14 in Appendix A.
[0141] Without wishing to be bound by theory, the above results suggested a benefit to including 0.01% (w / v) polysorbate 80 in solutions containing donanemab to protect donanemab from physical instability associated with freezing and thawing.
[0142] 5.3 Stirring A study was conducted to evaluate potential stability concerns associated with freeze-thawing and processing (mixing, pumping, filling, etc.) of donanemab solutions. Testing was performed on solutions containing a protein concentration of 25 mg / mL at pH 6.0 (based on the results of Study 1) and formulated as outlined in Table 5. Donanemab was subjected to agitation on a rotary shaker as described above. The results of the spun samples are tabulated in Tables A.15-A.21.
[0143] Some particles were observed in solution F1 (no polysorbate 80), while a reduction in particles was observed throughout the study in solutions F2 (0.01% polysorbate 80), F3 (0.02% polysorbate 80), and F4 (0.04% polysorbate 80). See Table A.15 in Appendix A.
[0144] No significant variation was observed in the UV assay at 280 nm for solutions F1 (no polysorbate 80), F2 (0.01% polysorbate 80), and F3 (0.02% polysorbate 80). A slight decrease in the UV assay at 280 nm was observed for solution F4 (0.04% polysorbate 80). See Table A.15A in Appendix A.
[0145] No pH variation was observed for all solutions (Table A.16 in Appendix A).
[0146] No significant variation in Abs at 550 nm was observed for solutions F1 (no polysorbate 80), F2 (0.01% polysorbate 80), and F4 (0.04% polysorbate 80). A slight decrease in this parameter was observed in solution F3 (0.02% polysorbate 80). See Table A.16 in Appendix A.
[0147] The SEC analysis showed a shoulder after the main peak, which was identified as a fragment of donanemab and was therefore included in the % low molecular weight species (LMW%) or fragments. No significant variations in the SEC profile were observed for solutions F1 (no polysorbate 80) and F2 (0.01% polysorbate 80). Solutions F3 (0.02% polysorbate 80) and F4 (0.04% polysorbate 80) showed a decrease in the main peak and a concomitant increase in fragmentation.
[0148] No variation in percentage aggregation was recorded throughout the study. For a graphical representation of the above discussion, see Table A.17, Figures 7A, 7B, and 7C in Appendix A.
[0149] Non-reduced CE-SDS analysis showed an overall increase in % donanemab. See Table A.18 and Figure 8 in Appendix A.
[0150] An overall increase in % purity was observed by reduced CE-SDS analysis in all solutions. See Table A.19 and Figure 9 in Appendix A.
[0151] Donanemab was chemically stable after 2 days of rotation. Similarly, soluble aggregation was minimal after agitation for all samples. Solutions containing polysorbate 80 had the lowest particle counts / mL relative to solutions without it, primarily at 10 μm size (Figures 10A and 10B). See also Table A.20 in Appendix A.
[0152] Without wishing to be bound by theory, the above results suggested a benefit from including 0.01% (w / v) polysorbate 80 in a solution containing donanemab to protect donanemab from physical instability associated with mixing. For example, the above results suggested that a solution containing 10 mM citrate buffer, 0.01% (w / v) polysorbate 80, and pH 6.0 provided a stable solution of donanemab. See Table A.21 in Appendix A for a summary of the freeze-thaw and agitation study results.
[0153] 5.4 Solubility Taking into account pH, freeze-thaw, and agitation studies, the solubility of donanemab was studied in 10 mM citrate buffer at pH 6 in the presence of 0.01% (w / v) polysorbate 80. The solution was concentrated after dialysis against the selected citrate buffer. After the addition of polysorbate 80, the concentration was measured and shown to be approximately 125 mg / mL. The sample was stored at -5°C for 24 hours; the solution appeared more milky than at time 0, but no phase separation occurred. Figures 11A and 11B show snapshots of the sample. This same sample became clear upon equilibration to room temperature.
[0154] Samples were stored at 2-8°C for 1 week and then analyzed. The donanemab solution remained yellow throughout the study. No phase separation was observed after 24 hours of storage. After 1 week of storage at 2-8°C, the solution was clear, with particles and filaments present in the solution. A slight decrease in the UV assay was detected. Without wishing to be bound by theory, the absorbance (Ab) results at 550 nm may have been affected by the yellow color of the solution. No pH fluctuations were observed. SEC results were consistent with those obtained in a previous study of lower-concentration donanemab solutions.
[0155] The results are summarized in Table 9.
[0156] [Table 9]
[0157] 6. Conclusion A series of preformulation studies were conducted to select the pH and agent necessary to stabilize donanemab. These studies included identifying a pH range from 5.0 to 7.0 and studying the effects of polysorbate 80 on freeze-thaw and agitation, as well as donanemab solubility. The molecule demonstrated good chemical stability at pH 5.5 and pH 6.0. The pH 5.5 solution showed the least decrease in % purity with reduced and non-reduced CE-SDS. The pH 6.0 solution showed the least decrease in % purity with reduced and non-reduced CE-SDS.
[0158] Without wishing to be bound by theory, these results suggested that formulating donanemab at pH 6.0 confers benefits in terms of solution stability.
[0159] The addition of 0.01% (w / v) polysorbate 80 surfactant was also investigated. Without wishing to be bound by theory, the results suggested that formulating donanemab with 0.01% (w / v) polysorbate 80 confers a benefit in terms of solution stability.
[0160] During the solubility experiments, no phase separation was observed at a concentration of about 125 mg / mL.
[0161] Table 10 summarizes certain observations from the preformulation studies described above.
[0162] [Table 10]
[0163] 7. Example 1 - Appendix A
[0164] [Table 11]
[0165] [Table 12]
[0166]
Table 13
[0167]
Table 14
[0168]
Table 15
[0169] Table 16
[0170]
Table 17
[0171]
Table 18
[0172] Table 19
[0173] Table 20
[0174] Table 21
[0175] Table 22
[0176] Table 23
[0177] Table 24
[0178] Table 25
[0179] Table 26
[0180] Table 27
[0181] Table 28
[0182] Table 29
[0183] Table 30
[0184] Table 31
[0185] Table 32
[0186]
Table 33
[0187] Table 34
[0188] Table 35
[0189] Table 36
[0190] Table 37
[0191] Table 38
[0192] Table 39
[0193] Table 40
[0194] Table 41
[0195] Table 42
[0196] Table 43
[0197] Example 2 - Further solution studies with donanemab 2.1 Research design The initial prototype solution screening study evaluated 13 prototypes with various donanemab concentrations, tonicity agents, buffer systems, and surfactant levels.
[0198] Donanemab solutions were prepared, and 20 mL vials were filled with 14 mL of solution to provide a worst-case scenario for headspace and potential sensitivity to oxidation and agitation. The vials were stoppered, capped, sealed, and stored upright at 5°C, 25°C, and 35°C for 3 months (the 10 and 17.5 mg / mL "R2" and "R13" solutions, described in the next section, were stored only at 5°C and 35°C due to material constraints). The vials were also subjected to an ISTA 3A shipping stress evaluation. A subset of solutions of interest was selected based on 3 months of data, and the retentates were tested after 29 months of storage.
[0199] Table 11 provides an overview of the solutions studied. P188 refers to Poloxamer 188. PS20 refers to Polysorbate 20 (Polyoxyethylene (20) sorbitan monolaurate). PS80 refers to Polysorbate 80 (Polyoxyethylene (20) sorbitan monooleate).
[0200] As discussed in Example 1, without wishing to be bound by theory, it is believed that the pH of an antibody solution affects the properties of the solution and / or the antibody in solution. Also discussed in Example 1, without wishing to be bound by theory, the results of that Example suggested that antibody stability in solution may be maximized by preparing the solution at a pH of 5.5 to 6.0. Taking this information into account, in this Example, a solution was prepared with a target pH of 6.0.
[0201] [Table 44] * All solutions were prepared at a target pH of 6.0.
[0202] Without wishing to be bound by theory, it is believed that the concentration of antibody in solution affects the stability of the solution. For example, without wishing to be bound by theory, it is believed that even highly purified samples of antibody nevertheless contain trace amounts of impurities such as enzymes (e.g., esterases). Without wishing to be bound by theory, it is believed that these impurities may promote (e.g., catalyze) processes that lead to solution degradation and / or the formation of particulate matter. Thus, without wishing to be bound by theory, it is believed that a higher concentration of antibody in solution correlates with a higher concentration of trace impurities (e.g., enzymes), and therefore is more likely to result in solution degradation and / or the formation of particulate matter in solution (each of which is undesirable). For example, in a solution containing polyoxyethylene (20) sorbitan monooleate, trace amounts of esterases may catalyze the hydrolysis of polyoxyethylene (20) sorbitan monooleate to produce free oleic acid, which in turn may cause the accumulation of particulate matter.
[0203] For at least these reasons, antibody concentration is understood to be one of many factors affecting solution stability. Therefore, antibody concentration was the variable investigated in this study. Specifically, a donanemab concentration range of 10 to 50 mg / mL was investigated. The 50 mg / mL concentration (R3) was expected to provide a worst-case scenario for potential particulate growth over time, as previously tested lyophilized formulations showed a tendency for increased particulate growth as a function of donanemab concentration. The use of a 50 mg / mL donanemab solution concentration would allow a single vial to be used for a 700 mg clinical dose. The 10 and 25 mg / mL concentrations were selected as the lower and upper limits of the expected range for a feasible solution formulation to mitigate the risk of particulate growth and provide an acceptable stability profile. The 17.5 mg / mL concentration (R13) was selected as the midpoint between the lower and upper ends of the expected acceptable solution range. At a concentration of 17.5 mg / mL, a clinical dose of 700 mg could be administered from two 20 mL drug product vials.
[0204] Without wishing to be bound by theory, it is believed that the buffer properties of an antibody solution can affect the stability of the solution and / or the antibody therein. For example, without wishing to be bound by theory, it is believed that polyoxyethylene (20) sorbitan monooleate is susceptible to oxidation when present in solution. Without wishing to be bound by theory, it is believed that oxidation of polyoxyethylene (20) sorbitan monooleate generates free radical species that can attack the antibody and cause protein modification and / or degradation. Without wishing to be bound by theory, it is also believed that oxidation of polyoxyethylene (20) sorbitan monooleate results in an increase in the amount of free oleic acid in the solution, which in turn causes an increase in the formation of particulate matter in the solution. Without wishing to be bound by theory, it is believed that certain buffers can reduce or prevent oxidation of polyoxyethylene (20) sorbitan monooleate. Therefore, it is believed that the selection of one or more buffers used in an antibody solution can affect the stability of the antibody solution by reducing or preventing antibody alteration and / or degradation and / or reducing or preventing particulate matter formation. In this study, several prototype solutions evaluated a 10 mM citrate buffer system to minimize antibody matrix changes between previously tested lyophilized formulations and the study solutions. A 25 mg / mL donanemab solution, R5, containing a 3:1 ratio of histidine to citrate, and R10, all containing histidine, were also studied for comparison with R1, which contained 10 mM citrate with 25 mg / mL donanemab.
[0205] Without wishing to be bound by theory, it is believed that the nature of one or more tonicity agents present in an antibody solution can affect the stability of the solution and / or the antibody therein. For example, without wishing to be bound by theory, it is believed that certain tonicity agents may act as cryoprotectants to prevent antibody degradation during the freeze-thaw process. Therefore, it is believed that the selection of one or more buffers used in an antibody solution can affect the stability of the antibody solution. In this study, several solutions were evaluated at a 10% w / v sucrose level. Previous lyophilized formulations utilized 8% w / v sucrose to provide isotonic conditions. Prototypes R4 and R6 evaluated glycine in combination with sucrose or mannitol, respectively, to provide an alternative to the 10% w / v sucrose level. Prototype R8 evaluated the addition of methionine to mitigate any potential oxidation-related chemical degradation observed in previous forced degradation studies. Solutions R7 and R9 evaluated trehalose and sodium chloride as alternative to sucrose as tonicity agents. Solution vial retention was evaluated for the lead prototype and selected prototypes from the initial study after 29 months of storage at 5° C. Based on the extended 5° C. storage conditions and acceptable chemical and physical property data, the sucrose-based solution formulation was modified to provide isotonic conditions (reducing sucrose from 10% w / v to 8% w / v).
[0206] Without wishing to be bound by theory, it is believed that the nature and / or concentration of one or more surfactants present in an antibody solution can affect the stability of the solution and / or the antibody therein. For example, without wishing to be bound by theory, in a solution containing polyoxyethylene (20) sorbitan monooleate (PS80), a higher concentration of PS80 is believed to be associated with a greater number of free radical species (which, as discussed above, are themselves formed by oxidation of PS80), while a lower concentration of PS80 is believed to be associated with a fewer number of free radical species. As discussed above, without wishing to be bound by theory, it is believed that the free radical species can attack the antibody, causing protein alteration and / or degradation. Therefore, without wishing to be bound by theory, it is believed that it is preferable to reduce the number of free radical species present in the antibody solution. Without wishing to be bound by theory, one way to do so is believed to be by adjusting the concentration of PS80 surfactant in the solution (e.g., identifying a concentration high enough to impart beneficial properties, but low enough to minimize or avoid the generation of free radical species). Conventional lyophilized formulations utilized PS80 at 0.02% w / v. In this study, several solutions had a target PS80 concentration of 0.02% w / v, except for R11, which used 0.02% w / v polysorbate 20 (PS20), and R12, which contained 0.04% w / v poloxamer 188. Solutions R1 and R3 contained 0.20% w / v PS80.
[0207] In a separate study, prototype solution vials were also subjected to ISTA-3A shipping evaluation to understand whether there was any susceptibility to particulate growth as a result of shipping stress conditions. After exposing various lyophilized formulations to ISTA-3A shipping conditions, particulate generation was observed.
[0208] 2.2 Research results When discussing differences between solutions, the corresponding figure (by figure number) is referenced. Where there are potential specifications associated with chemical or physical property attributes, lines indicating the specification limits are shown on the figure.
[0209] SEC monomer loss and corresponding aggregate growth were observed for all solutions at 35°C storage for 3 months (Figures 12A and 12B). At 25°C, both the sodium chloride-containing solution and the solution with a surfactant instead of PS80 all showed higher monomer loss when compared to the other solutions. The sodium chloride-containing solution also showed monomer loss after 3 months at 5°C storage. Without wishing to be bound by theory, these results suggested that the PS80-containing solution may provide improved stability over time compared to the PS20-containing solution and / or that the sodium chloride-containing solution may experience decreased stability over time compared to solutions containing a different tonicity agent.
[0210] The CE-SDS reduction data (FIGS. 13A and 13B) show that the two solutions containing glycine had a higher % purity loss and correspondingly higher total aggregate / non-reduced species levels than all other solutions at 3 months at 25° C. and 35° C. storage conditions. All solutions had similar stability profiles for total fragments. Without wishing to be bound by theory, these results suggested that including glycine in the solution may have a detrimental effect on the long-term stability of the solution.
[0211] Non-reducing CE-SDS data (Figures 14A and 14B) showed similar main peak purity and total aggregate stability profiles for all solutions. The 10 mM histidine solution showed lower total aggregates at all temperature conditions after 3 months compared to all other solutions. The solution containing 7.5 mM histidine showed less total aggregate growth than the other solutions, but at higher levels than the 10 mM histidine formulation, providing evidence that the presence of increased histidine levels in the DP matrix can prevent aggregate formation.
[0212] Evaluation of surfactant chemistry data indicates that none of the PS80-based solutions exhibited appreciable changes in total oleic acid (TOA) over the three-month storage conditions. In addition, Figure 15 shows that free oleic acid (FOA) in solutions containing sodium chloride and 10 mM histidine was higher after three months of storage at 25°C and 35°C than all other solutions containing 0.02% w / v PS80. After three months at 25°C, more than 25% of the TOA levels were present as FOA in these solutions, suggesting their greater susceptibility to PS80 hydrolysis.
[0213] Without wishing to be bound by theory, it is believed that esterases contained in the antibody solution may catalyze the hydrolysis of PS80 to produce free oleic acid. Without wishing to be bound by theory, it is believed that increasing the amount of free oleic acid in the antibody solution results in the formation of more particulate matter.
[0214] Solutions containing PS20 showed an increase in free lauric acid after 3 months at 25° C., approaching levels similar to those observed for the 10 mM histidine-based solution (about 25% of the total present in the free state). Solutions containing poloxamer showed no signs of loss over storage time at 5° C. Without wishing to be bound by theory, these results suggested that solutions containing PS20 and / or histidine may be less preferable than solutions containing PS80 due to the increased free lauric acid observed in solutions containing PS20 or histidine.
[0215] Figures 16A, 16B, 17A, 17B, 17C, 17D, 18A, and 18B plot the particulate data (MFI and light obscuration) of the study solutions. For all solutions except the glycine and histidine solutions, particulate data remained low at 3 months for all temperatures. Solutions containing glycine, methionine, and 10 mM histidine showed slightly elevated 10 and 25 micron particle count light obscuration data compared to the other solutions. Without wishing to be bound by theory, these results suggest that antibody solutions containing glycine, methionine, and / or histidine result in increased amounts of particulate matter compared to solutions containing, for example, sucrose and / or trehalose, and therefore, solutions containing sucrose and / or trehalose may be preferable in terms of reducing particulate matter and / or reducing particulate matter formation over time. Comparing the 29-month 5°C data to the 3-month stability data, there was little change in chemical or physical property attributes from the 3-month 5°C data. The SEC data showed a slight increase in aggregates and a corresponding decrease in monomer. The changes between 3 and 29 months at 5°C storage were not as significant as the differences observed between the 3-month 5°C data and the accelerated temperature data.
[0216] Samples of the solution were subjected to the ISTA-3A test. As described elsewhere herein, details of the ISTA-3A test are known to those skilled in the art and are available through the International Safe Transit Association at ista.org. Briefly, the ISTA-3A test is used to examine the effects of vibration, shock, and other stresses that may be encountered during handling and / or transportation of materials in a package delivery system. During the test, the test material is subjected to drops, vibrations, and shocks. While not wishing to be bound by theory, it is believed that damage to the test material is cumulative. In some instances of the test, an acceleration factor may be used. While not wishing to be bound by theory, it is believed that the use of an acceleration factor allows for trading increased force for increased time. For example, while not wishing to be bound by theory, it is believed that exposing a sample to a first vibration force for one hour has the same effect on the sample as exposing the sample to a second vibration force that is one-fifth the strength of the first vibration force for five hours.
[0217] ISTA-3A shipping exposure data for the test solutions, including data for various sized particulates as measured by microflow imaging (MFI), data for various sized particulates as measured by light obscuration using a high-precision particle counter (HIAC), data for percent monomer content as measured by size exclusion chromatography, data for total aggregate content as measured by size exclusion chromatography, data for purity as measured by non-reducing CE-SDS, data for percent fragment content as measured by non-reducing CE-SDS, and data for percent aggregates as measured by non-reducing CE-SDS, are shown in Figures 19A, 19B, 20A, 20B, 21A, 21B, 22A, 22B, and 22C. The data showed no substantial differences in chemical attributes or particulate counts between control samples of solutions (not subjected to ISTA-3A shipping testing) and samples subjected to ISTA-3A shipping testing, with the exception of solutions containing poloxamer. For example, as shown in Figures 23A and 23B, solutions containing poloxamer showed a several-fold increase in particles 2 μm or larger and particles 5 μm or larger as measured by MFI. Without wishing to be bound by theory, these results suggested that solutions containing poloxamer as a surfactant may be less suitable for packaging and shipping. However, for all solutions except the poloxamer-containing solution, the solutions did not show a substantial increase in particle formation. Notably, this result contrasts with the results of ISTA-3A shipping tests performed on lyophilized formulations of antibodies, which, as discussed elsewhere herein, showed consistently higher levels of particulate matter after 1 month of storage and at subsequent time points. Without wishing to be bound by theory, these results suggested that antibody solutions similar or identical to those tested herein (e.g., anti-N3pGlu Aβ antibody solutions containing citrate or histidine buffer, containing one or more tonicity agents selected from sucrose, trehalose, mannitol, and glycine, and containing PS20 and / or PS80 surfactant) may exhibit properties (e.g., physicochemical properties) that make them suitable for packaging and shipping.
[0218] Without wishing to be bound by theory, the foregoing chemical and stability performance data of the tested solutions suggested that the presence of histidine, methionine, sodium chloride, and / or glycine in the solution may adversely affect one or more chemical properties, microparticle growth, and / or solution and / or antibody stability. Without wishing to be bound by theory, the foregoing data suggested that a combination of 17.5 mg / mL anti-N3pGlu Aβ antibody concentration in a citrate buffer containing 10% w / v sucrose and 0.02% w / v PS80 provided an ideal solution in terms of usability and stability. For example, while the chemical and microparticle data for the antibody solution containing that combination of components were comparable to the previously tested lyophilized antibody matrix, the antibody solution containing that combination exhibited superior stability over time compared to the previously tested lyophilized antibody matrix.
[0219] 2.3 Further studies on tonicity agents and long-term storage of solutions at 5°C Two additional solutions were prepared at a donanemab concentration of 17.5 mg / mL in 5 mM citrate and contained 0.02% w / v PS80. In these solutions (identified as P1 and P2), sucrose was substituted for either mannitol (5.3% w / v concentration) or trehalose (10% w / v concentration). Sample vials were filled to a 20 mL fill volume, and the solutions were stored. Chemical and physical property data for the two additional solutions, as well as a solution containing 17.5 mg / mL donanemab in 10 mM citrate, 0.02% PS80, and 10% w / v sucrose (identified as R13) (the latter solution is shown for comparison with the two additional solutions), are illustrated in Figures 23A-29B. Samples of solutions P1 and P2 were stored at 5° C. for 1 month, 3 months, and 6 months, and at 25° C. for 1 month, 3 months, and 6 months. Samples of solution R13 were stored at 5° C. for 3 months and 29 months, and at 35° C. for 3 months. The collected data, illustrated in FIGS. 23A-29B, include percent monomer content as measured by size exclusion chromatography, percent total aggregate content as measured by size exclusion chromatography, purity as measured by reduced CE-SDS, percent fragment content as measured by reduced CE-SDS, percent aggregates as measured by reduced CE-SDS, purity as measured by non-reduced CE-SDS, percent fragment content as measured by non-reduced CE-SDS, percent aggregates as measured by non-reduced CE-SDS, total oleic acid, free oleic acid, variously sized particulates as measured by microflow imaging (MFI), and variously sized particulates as measured by light obscuration using a high precision particle counter (HIAC).
[0220] Comparison of the 29-month and 6-month 5°C data for the chemical and physical properties of the three solutions (i.e., sucrose-containing, mannitol-containing, and trehalose-containing solutions) revealed no significant differences among the three solutions. In addition, the 3-month 35°C data indicated no stability concerns for any of the three solutions. The increased SEC monomer loss and total aggregate growth, the extent of total acidic variants, and the reduction in the main peak observed with elevated temperature storage were within expected ranges. Without wishing to be bound by theory, the foregoing data indicate that combinations of donanemab (e.g., at a concentration of 17.5 mg / mL) in citrate (e.g., at a concentration of 5 mM or 10 mM), PS80 (e.g., at a concentration of 0.02% w / v), and one or more of sucrose (e.g., at a concentration of 10% w / v), mannitol (e.g., at a concentration of 5.3% w / v), or trehalose (e.g., at a concentration of 10% w / v) provide acceptable stability over time (e.g., for 3 months, 6 months, or 29 months at 5°C, 25°C, and / or 35°C), and / or or improved stability over time (e.g., for 3 months, 6 months, or 29 months at 5°C, 25°C, and / or 35°C), for example, compared to a solution omitting one or more of citrate (e.g., 5 mM or 10 mM citrate), PS80 (e.g., 0.02% w / v PS80), and one or more of sucrose, mannitol, and / or trehalose (e.g., 10% w / v sucrose, 5.3% w / v mannitol, or 10% w / v trehalose).
[0221] 2.4 Peptide mapping studies Peptide mapping by LC-MS was performed on selected solutions after 29 months of storage at 5°C. Solutions in citrate matrix at 10, 17.5, and 25 mg / mL (R2, R13, and R8, respectively) and a 25 mg / mL histidine-based solution (R10) were compared to reference standards. The 25 mg / mL solution in citrate matrix (R8) also contained 5 mM methionine. Table 12 provides the peptide mapping results.
[0222] [Table 45]
[0223] Peptide mapping results for the three citrate-based solutions were comparable to the reference standard. There appeared to be no additional benefit to the addition of methionine in reducing oxidized species beyond the levels observed in the other citrate-based solutions. The histidine-based solution showed elevated oxidized species (HC M250) compared to the citrate solution and the reference standard.
[0224] The citrate-based solutions appeared comparable to the reference standard in overall peptide map profile, with all solutions exhibiting reduced levels of incomplete pyroglutamate and Des Gly amidated degradants compared to the reference standard.
[0225] Without wishing to be bound by theory, these peptide mapping results suggested that incorporating a citrate buffer into a solution of an anti-N3pGlu Aβ antibody was beneficial in terms of reducing antibody degradation. Without wishing to be bound by theory, these results suggested that incorporating histidine into a solution of an anti-N3pGlu Aβ antibody had a detrimental effect on antibody degradation. Furthermore, these peptide mapping results, combined with the results discussed above for solutions containing sucrose, mannitol, and trehalose (e.g., no significant increase in aggregates or particulates after 29 months of storage at 5°C), suggest that, without wishing to be bound by theory, solutions containing donanemab (e.g., at a concentration of 17.5 mg / mL) in citrate (e.g., at a concentration of 5 mM or 10 mM), PS80 (e.g., at a concentration of 0.02%), and a combination of one or more of sucrose (e.g., at a concentration of 10% w / v), mannitol (e.g., at a concentration of 5.3% w / w), or trehalose (e.g., at a concentration of 10% w / v) may increase over time. The results further indicated that the compositions exhibited acceptable stability (e.g., for 3 months, 6 months, or 29 months at 5°C, 25°C, and / or 35°C) and / or improved stability over time (e.g., for 3 months, 6 months, or 29 months at 5°C, 25°C, and / or 35°C), for example, improved stability compared to solutions omitting one or more of citrate (e.g., 5 mM or 10 mM citrate), PS80 (e.g., 0.02% w / v PS80), and one or more of sucrose, mannitol, and / or trehalose (e.g., sucrose at a 10% w / v concentration, mannitol at a 5.3% w / v concentration, or trehalose at a 10% w / v concentration).
[0226] [Table 46]
[0227] Example 3 - Product Specifications The complete specifications of the donanemab drug product are provided below.
[0228] [Table 47] Abbreviations: CE-SDS = capillary electrophoresis with sodium dodecyl sulfate; CEX = cation exchange chromatography; HPLC-UV = high performance liquid chromatography-ultraviolet spectroscopy; icIEF = imaging capillary isoelectric focusing; SEC = size exclusion chromatography; UV = ultraviolet spectroscopy. a Match to reference standard indicates that the sample chromatographic profile compares favorably to the reference standard with respect to main peak retention time and chromatographic profile. b Identity is confirmed if the test sample exhibits a similar sigmoidal dose-response curve as the donanemab reference standard. c Equivalent to 16.63 mg / mL or more and 18.38 mg / mL or less. d Equivalent to 16.28 mg / mL or more and 18.73 mg / mL or less. e Agreement with the reference standard indicates that the electrophoretic profile of the sample compares favorably to the reference standard, with no new peaks and / or no peaks present based on examples in the method and clinical experience. f In the context of these specifications, release refers to the initial test results that meet the release specifications. g In the context of these specifications, end of ultimate shelf life refers to test results through 24 months or less of storage that meet the end of shelf life specifications.
[0229] [Table 48] MES = 2-(N-morpholino)ethanesulfonic acid, TRIS = tris(hydroxymethyl)aminomethane, HEPES = (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), CHES = N-cyclohexyl-2-aminoethanesulfonic acid, CAPS = N-cyclohexyl-3-aminopropanesulfonic acid
[0230] [Table 49]
[0231] [Table 50]
[0232] [Table 51]
[0233] [Table 52]
[0234] [Table 53]
[0235] [Table 54]
[0236] [Table 55]
[0237] Sequence (underlined parts indicate CDRs) SEQ ID NO: 1; Light chain variable region (LCVR)
[0238] [Table 56] SEQ ID NO: 2; Heavy chain variable region (HCVR)
[0239] [Table 57] SEQ ID NO: 3; light chain (LC)
[0240] [Table 58] SEQ ID NO: 4; Heavy chain (HC)
[0241] [Table 59] SEQ ID NO: 5; Light chain complementarity determining region 1 (LCDR1) KSSQSLLYSRGKTYLN SEQ ID NO: 6; Light chain complementarity determining region 2 (LCDR2) AVSKLDS SEQ ID NO: 7; Light chain complementarity determining region 3 (LCDR3) VQGTHYPFT SEQ ID NO: 8; Heavy chain complementarity determining region 1 (HCDR1) GYDFTRYYIN SEQ ID NO: 9; Heavy chain complementarity determining region 2 (HCDR2) WINPGSGNTKYNEKFKG SEQ ID NO: 10; Heavy chain complementarity determining region 3 (HCDR3) EGITVY SEQ ID NO: 11; Nucleotide sequence of SEQ ID NO: 1 Light chain variable region (LCVR)
[0242] [Table 60] SEQ ID NO: 12; Nucleotide sequence of SEQ ID NO: 2 Heavy chain variable region (HCVR)
[0243] [Table 61] SEQ ID NO: 13; nucleotide sequence of SEQ ID NO: 3 Light chain (LC) GATATTGTGATGACTCAGACTCCACTCTCCCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCAAGTCAGAGCCTCTTATATAGTCGCGGAAAAACCTATTTGAATTGGCTCCTGCAGAAGCCAGGCCAATCTCCACAGCTCCTAATTTATGCGGTGTCTAAACTGGACTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGGTCAGGCACAGATTTCACACTGAAAATCAGCAGGGTGGAGGCCGAAGATGTTGGGGTTTATTACTGCGTGCAAGGTACACATTACCCATTCACGTTTGGCCAAGGGACCAAGCTGGAGATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGC Sequence number 14; nucleotide sequence of the heavy chain (HC) of sequence number 4
Claims
1. 1. A pharmaceutical solution comprising: an anti-N3pGlu Aβ antibody comprising: (a) a light chain variable region (LCVR) comprising an LCDR1 of SEQ ID NO: 5, an LCDR2 of SEQ ID NO: 6, and an LCDR3 of SEQ ID NO: 7; and (b) a heavy chain variable region (HCVR) comprising an HCDR1 of SEQ ID NO: 8, an HCDR2 of SEQ ID NO: 9, and an HCDR3 of SEQ ID NO: 10; a buffer solution; an isotonicity agent; A surfactant, and optional excipients.
10. The pharmaceutical solution comprising: (a) an antibody monomer content of at least 95% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (b) a total aggregate content of less than 5% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (c) an antibody purity of at least 94% area as measured by reduced capillary electrophoresis sodium dodecyl sulfate (CE-SDS) after storage of the pharmaceutical solution at 35° C. for 3 months; (d) after storage of the pharmaceutical solution at 2-8°C for 3 months, (i) a total aggregate content of less than 5% relative to the total antibody peak area as measured by size exclusion, or (ii) a total aggregate content of less than 8.5 area % as measured by non-reducing CE-SDS; (e) less than 500 particulates per milliliter, the particulates being greater than 2 μm in size when measured with a high accuracy particle counter (HIAC) by light obscuration after storing the pharmaceutical solution at 2-8° C. for 3 months; (f) less than 100 particulates per milliliter, said particulates being greater than 5 μm in size as measured by light obscuration using a high accuracy particle counter (HIAC) after storing said pharmaceutical solution at 2-8° C. for 3 months; (g) UV absorbance at 550 nm that changes by less than ±3% over 4 weeks of storage at 2-8°C; (h) a change in protein content of 1% to 13% as measured by UV absorbance at 280 nm after 4 weeks of storage at 2-8°C; (i) at least 93% of the anti-N3pGlu antibodies appear in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2-8°C; (j) a decrease of no more than 11% in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storage of the pharmaceutical solution at 2-8°C for 4 weeks; and (k) no more than 4 particles having a size of 25 μm or less as measured by differential count per mL after storing said pharmaceutical solution at 2-8° C. for 4 weeks; in amounts sufficient in combination to exhibit one or more of the following:
2. The anti-N3pGlu Aβ antibody, the buffer, the tonicity agent, the surfactant, and the optional excipients are mixed in a pharmaceutical solution comprising: (a) an antibody monomer content of at least 95% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months; (b) a total aggregate content of less than 5% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months; (c) UV absorbance at 550 nm that changes less than ±3% over 4 weeks of storage at 5°C; (d) a change in protein content of 1% to 13% as measured by UV absorbance at 280 nm after 4 weeks of storage at about 5°C; (e) at least 93% of the anti-N3pGlu antibody appears in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at about 5°C; (f) a decrease of no more than 11% in the amount of the anti-N3pGlu antibody as measured by non-reducing CE-SDS after storing the pharmaceutical solution at about 5°C for 4 weeks; and (g) no more than 4 particles having a size of 25 μm or less as measured by differential count per mL after storing said pharmaceutical solution at about 5° C. for 4 weeks; 10. The medical solution of claim 1, comprising:
3. The anti-N3pGlu Aβ antibody, the buffer, the tonicity agent, the surfactant, and the optional excipients are mixed in a pharmaceutical solution comprising: (a) an antibody monomer content of at least 96% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (b) a total aggregate content of less than 4% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 2-8°C for 3 months; (c) an antibody purity of at least 95% area as measured by reduced CE-SDS after storage of the pharmaceutical solution at 35° C. for 3 months; (d) 93.3% to 93.8% of the anti-N3pGlu antibody appears in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2-8°C; (e) a decrease of 6.9% or less in the amount of the anti-N3pGlu antibody as measured by reduced CE-SDS after storing the pharmaceutical solution at 2-8°C for 4 weeks; 3. The pharmaceutical solution of claim 1, comprising:
4. The anti-N3pGlu Aβ antibody, the buffer, the tonicity agent, the surfactant, and the optional excipients are mixed in a pharmaceutical solution comprising: (a) an antibody monomer content of at least 96% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months; (b) a total aggregate content of less than 4% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at about 5° C. for 3 months; (c) an antibody purity of at least 95% area as measured by reduced CE-SDS after storage of the pharmaceutical solution at about 5° C. for 3 months; (d) 93.3% to 93.8% of the anti-N3pGlu antibody appears in a major peak when analyzed by size exclusion chromatography after 4 weeks of storage at about 5°C; (e) a decrease of 6.9% or less in the amount of the anti-N3pGlu antibody as measured by reduced CE-SDS after storing the pharmaceutical solution at about 5° C. for 4 weeks; (f) less than 500 particulates per milliliter, said particulates being greater than 2 μm in size as measured by light obscuration using a HIAC after storing said pharmaceutical solution at about 5° C. for 3 months; (g) less than 100 particulates per milliliter, said particulates being greater than 5 μm in size as measured by light obscuration using a HIAC after storing said pharmaceutical solution at about 5° C. for 3 months; 3. The medical solution of claim 2, comprising:
5. 5. The pharmaceutical solution of any one of claims 1 to 4, wherein one or more of features (a) to (k) of claim 1 are present before and after storage; one or more of features (a) to (g) of claim 2 are present before and after storage; one or more of features (a) to (e) of claim 3 are present before and after storage; and / or one or more of features (a) to (g) of claim 4 are present before and after storage.
6. 10. The pharmaceutical solution of any one of the preceding claims, wherein the LCVR of the anti-N3pGlu Aβ antibody comprises SEQ ID NO: 1 and / or the HCVR of the N3pGlu Aβ antibody comprises SEQ ID NO:
2.
7. 3. The pharmaceutical solution of any one of the preceding claims, wherein the anti-N3pGlu Aβ antibody comprises a light chain (LC) comprising SEQ ID NO:3 and / or a heavy chain (HC) comprising SEQ ID NO:
4.
8. 10. The pharmaceutical solution of any one of the preceding claims, having a pH of 5.0 to 7.
5.
9. 9. The pharmaceutical solution of any one of claims 1 to 8, comprising polyoxyethylene (20) sorbitan monooleate, wherein the pharmaceutical solution exhibits a total free oleic acid content of less than 0.0025% weight by volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage at 2-8°C for 3 months.
10. 9. The pharmaceutical solution of any one of claims 1 to 8, comprising polyoxyethylene (20) sorbitan monooleate, wherein the pharmaceutical solution exhibits a total free oleic acid content of less than 0.0025% weight / volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage at 2-8°C for 29 months.
11. 11. The pharmaceutical solution of claim 1, wherein the buffer comprises a salt of an organic acid, a salt of an inorganic acid, an amino acid, or a combination thereof.
12. 12. The pharmaceutical solution of any one of claims 1 to 11, wherein the buffer comprises citric acid or a salt thereof, acetic acid or a salt thereof, ascorbic acid or a salt thereof, carbonic acid or a salt thereof, tartaric acid or a salt thereof, gluconic acid or a salt thereof, succinic acid or a salt thereof, phosphoric acid or a salt thereof, phthalic acid or a salt thereof, arginine or a salt thereof, lysine or a salt thereof, histidine or a salt thereof, ornithine or a salt thereof, isoleucine or a salt thereof, leucine or a salt thereof, alanine or a salt thereof, glycine or a salt thereof, glutamic acid or a salt thereof, aspartic acid or a salt thereof, and combinations thereof.
13. 13. The pharmaceutical solution of any one of claims 1 to 12, wherein the buffer comprises citric acid or a salt thereof, histidine or a salt thereof, and combinations thereof.
14. The pharmaceutical solution of any one of claims 1 to 13, wherein the buffer is a single buffer system.
15. 15. The pharmaceutical solution of any one of claims 1 to 14, wherein the tonicity agent is selected from a sugar, an amino acid, a salt, or a combination thereof.
16. 16. The pharmaceutical solution of any one of claims 1 to 15, wherein the tonicity agent is selected from monosaccharides, disaccharides, polysaccharides, and combinations thereof.
17. 17. The pharmaceutical solution of any one of claims 1 to 16, wherein the isotonicity agent is selected from sodium chloride, arginine or a salt thereof, lysine or a salt thereof, histidine or a salt thereof, methionine or a salt thereof, ornithine or a salt thereof, isoleucine or a salt thereof, leucine or a salt thereof, alanine or a salt thereof, glycine or a salt thereof, glutamic acid or a salt thereof, aspartic acid or a salt thereof, sucrose, fructose, glucose, maltose, trehalose, galactose, mannose, sorbose, lactose, cellobiose, mannitol, lactitol, xylitol, sorbitol, and maltitol, and combinations thereof.
18. The medical solution of any one of claims 1 to 17, wherein the medical solution comprises a single tonicity agent.
19. 19. The pharmaceutical solution of any one of claims 1 to 18, wherein the surfactant is selected from polyoxyethylene sorbitan esters, poloxamers, and combinations thereof.
20. 11. The medical solution of any one of claims 1 to 10, wherein the medical solution does not contain one or more of sodium chloride, trehalose, and mannitol.
21. 11. The pharmaceutical solution of any one of claims 1 to 10, which does not contain one or more of glycine, poloxamer, and polyoxyethylene (20) sorbitan monolaurate.
22. the anti-N3pGlu antibody at a concentration of 1 to 40 mg / mL; the buffer in an amount of 1 mM to 30 mM; the tonicity agent in an amount of 1% to 20% by weight / volume; 22. The medical solution of any one of claims 1 to 21, comprising the surfactant in an amount of 0.005% to 0.06% by weight / volume.
23. the anti-N3pGlu antibody at a concentration of 10 to 25 mg / mL; the buffer in an amount of 5 mM to 15 mM; the tonicity agent in an amount of 5% to 15% by weight / volume; 23. The medical solution of claim 22, comprising the surfactant in an amount of 0.01% to 0.04% by weight or volume.
24. 24. The pharmaceutical solution of claim 22 or 23, comprising a buffer selected from citric acid or a salt thereof, an isotonicity agent which is sucrose, and a surfactant which is polyoxyethylene (20) sorbitan monooleate.
25. the anti-N3pGlu antibody at a concentration of 17.5 mg / mL; citric acid or a salt thereof in an amount of 10 mM; said sucrose in an amount of 8% by weight / volume (w / v); 25. The medical solution of claim 24, comprising the polyoxyethylene (20) sorbitan monooleate in an amount of 0.02% by weight and volume.
26. 26. The pharmaceutical solution of any one of claims 22 to 25, having a pH of 5.0 to 7.
0.
27. 27. The medical solution of any one of claims 22 to 26, having a pH of 6.
0.
28. 28. A method of making the pharmaceutical solution of any one of claims 1 to 27, comprising: A method comprising combining the anti-N3pGlu Aβ antibody, the buffer, the tonicity agent, the surfactant, and the one or more optional excipients.
29. 29. The method of claim 28, wherein the anti-N3pGlu Aβ antibody is not reconstituted from lyophilized material.
30. A container comprising the medical solution of any one of claims 1 to 27.
31. 28. A method for treating a disease characterized by amyloid beta (Aβ) deposition, comprising administering to a patient in need thereof a therapeutically effective amount of the pharmaceutical solution of any one of claims 1 to 27.
32. 32. The method of claim 31, comprising administering to the patient a medicinal solution obtained from the container of claim 30.
33. 33. The method of claim 31 or 32, comprising administering to the patient a non-lyophilized anti-N3pGlu Aβ antibody.
34. 34. The method of any one of claims 31 to 33, wherein the disease is selected from Alzheimer's disease (AD), Down's syndrome, and cerebral amyloid angiopathy.
35. 35. The method of claim 34, wherein the disease is selected from preclinical AD, prodromal AD, mild AD, moderate AD, and severe AD.
36. 36. The method of any one of claims 31 to 35, comprising administering to the patient one or more doses of 100 mg to 10,000 mg of the anti-N3pGlu Aβ antibody.
37. 28. A pharmaceutical solution according to any one of claims 1 to 27 for use in the treatment of a disease characterised by the deposition of amyloid beta (Aβ).
38. 38. The medical solution for use according to claim 37, wherein the medical solution is obtained from a container according to claim 30.
39. 39. The pharmaceutical solution for use according to claim 37 or 38, wherein the anti-N3pGlu Aβ antibody is not lyophilized.
40. 40. The pharmaceutical solution for use according to any one of claims 37 to 39, wherein the disease is selected from Alzheimer's disease (AD), Down's syndrome, and cerebral amyloid angiopathy.
41. 41. The pharmaceutical solution for use according to claim 40, wherein the disease is selected from preclinical AD, prodromal AD, mild AD, moderate AD, and severe AD.
42. 42. The pharmaceutical solution for use according to any one of claims 37 to 41, wherein said treatment comprises administering to said patient one or more doses of between 100 mg and 10,000 mg of said anti-N3pGlu Aβ antibody.
43. Use of a pharmaceutical solution according to any one of claims 1 to 27 in the manufacture of a medicament for the treatment of a disease characterized by the deposition of amyloid beta (Aβ).
44. 44. Use of the medical solution of claim 43, wherein the medical solution is obtained from a container of claim 30.
45. 45. The use of the pharmaceutical solution according to claim 43 or 44, wherein the anti-N3pGlu Aβ antibody is not lyophilized.
46. 46. The use of the pharmaceutical solution according to any one of claims 43 to 45, wherein the disease is selected from Alzheimer's disease (AD), Down's syndrome, and cerebral amyloid angiopathy.
47. 47. The use of the pharmaceutical solution of claim 46, wherein the disease is selected from preclinical AD, prodromal AD, mild AD, moderate AD and severe AD.
48. 48. The use of the pharmaceutical solution of any one of claims 43 to 47, wherein said treatment comprises administering to said patient one or more doses of 100 mg to 10,000 mg of said anti-N3pGlu Aβ antibody.
49. 28. A method of reducing amyloid beta (Aβ) in a patient in need thereof, comprising administering to said patient a pharmaceutical solution according to any one of claims 1 to 27.
50. 50. The method of claim 49, wherein said administration results in a reduction in the amount of amyloid beta by at least 5%.
51. 1. A pharmaceutical solution comprising: an anti-N3pGlu Aβ antibody at a concentration of 1 to 40 mg / mL, comprising: (a) a light chain variable region (LCVR) comprising an LCDR1 of SEQ ID NO: 5, an LCDR2 of SEQ ID NO: 6, and an LCDR3 of SEQ ID NO: 7; and (b) a heavy chain variable region (HCVR) comprising an HCDR1 of SEQ ID NO: 8, an HCDR2 of SEQ ID NO: 9, and an HCDR3 of SEQ ID NO: 10; a buffer solution in an amount of 1 mM to 30 mM; a tonicity agent in an amount of 1% to 20% by weight / volume; a surfactant in an amount of 0.005% to 0.06% by weight volume; A pharmaceutical solution, optionally including excipients.
52. 52. The pharmaceutical solution of claim 51 , wherein the LCVR of the anti-N3pGlu Aβ antibody comprises SEQ ID NO: 1 and / or the HCVR of the N3pGlu Aβ antibody comprises SEQ ID NO:
2.
53. 53. The pharmaceutical solution of claim 51 or 52, wherein the anti-N3pGlu Aβ antibody comprises a light chain (LC) comprising SEQ ID NO: 3 and / or a heavy chain (HC) comprising SEQ ID NO:
4.
54. 54. The pharmaceutical solution of any one of claims 51 to 53, having a pH of 5.0 to 7.
5.
55. 55. The pharmaceutical solution of any one of claims 51 to 54, wherein the buffer comprises a salt of an organic acid, a salt of an inorganic acid, an amino acid, and combinations thereof.
56. 56. The pharmaceutical solution of any one of claims 51 to 55, wherein the buffer comprises citric acid or a salt thereof, acetic acid or a salt thereof, ascorbic acid or a salt thereof, carbonic acid or a salt thereof, tartaric acid or a salt thereof, gluconic acid or a salt thereof, succinic acid or a salt thereof, phosphoric acid or a salt thereof, phthalic acid or a salt thereof, arginine or a salt thereof, lysine or a salt thereof, histidine or a salt thereof, ornithine or a salt thereof, isoleucine or a salt thereof, leucine or a salt thereof, alanine or a salt thereof, glycine or a salt thereof, glutamic acid or a salt thereof, aspartic acid or a salt thereof, and combinations thereof.
57. 57. The pharmaceutical solution of any one of claims 51 to 56, wherein the buffer comprises citric acid or a salt thereof, histidine or a salt thereof, and combinations thereof.
58. 58. The pharmaceutical solution of any one of claims 51 to 57, wherein the buffer is a single buffer system.
59. 59. The pharmaceutical solution of any one of claims 51 to 58, wherein the tonicity agent is selected from a sugar, an amino acid, a salt, or a combination thereof.
60. 60. The pharmaceutical solution of any one of claims 51 to 59, wherein the tonicity agent is selected from monosaccharides, disaccharides, polysaccharides, and combinations thereof.
61. 61. The pharmaceutical solution of any one of claims 51 to 60, wherein the isotonicity agent is selected from sodium chloride, arginine or a salt thereof, lysine or a salt thereof, histidine or a salt thereof, methionine or a salt thereof, ornithine or a salt thereof, isoleucine or a salt thereof, leucine or a salt thereof, alanine or a salt thereof, glycine or a salt thereof, glutamic acid or a salt thereof, aspartic acid or a salt thereof, sucrose, fructose, glucose, maltose, trehalose, galactose, mannose, sorbose, lactose, cellobiose, mannitol, lactitol, xylitol, sorbitol, and maltitol, and combinations thereof.
62. 62. The pharmaceutical solution of any one of claims 51 to 61, comprising one tonicity agent.
63. 63. The medical solution of any one of claims 51 to 62, wherein the surfactant is selected from polyoxyethylene sorbitan esters, poloxamers, and combinations thereof.
64. 63. The medical solution of any one of claims 51 to 62, wherein the medical solution does not contain one or more of sodium chloride, trehalose, and mannitol.
65. 63. The pharmaceutical solution of any one of claims 51 to 62, which does not contain one or more of glycine, poloxamer, and polyoxyethylene (20) sorbitan monolaurate.
66. the anti-N3pGlu antibody at a concentration of 10 to 25 mg / mL; the buffer in an amount of 5 mM to 15 mM; the tonicity agent in an amount of 5% to 15% by weight / volume; 66. The medical solution of any one of claims 51 to 65, comprising the surfactant in an amount of 0.01% to 0.04% by weight or volume.
67. the anti-N3pGlu antibody at a concentration of 17.5 mg / mL; citric acid or a salt thereof in an amount of 10 mM; said sucrose in an amount of 8% by weight and volume; 67. The pharmaceutical solution of any one of claims 51 to 66, comprising the polyoxyethylene (20) sorbitan monooleate in an amount of 0.02% by weight / volume.
68. 68. The pharmaceutical solution of any one of claims 51 to 67, having a pH of 5.0 to 7.
0.
69. 69. The pharmaceutical solution of any one of claims 51 to 68, having a pH of 6.
0.
70. The anti-N3pGlu Aβ antibody, the buffer, the tonicity agent, the surfactant, and the optional excipients are mixed in a pharmaceutical solution comprising: (a) an antibody monomer content of at least 97% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (b) a total aggregate content of less than 2% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (c) an antibody purity of at least 92% area as measured by reduced capillary electrophoresis sodium dodecyl sulfate (CE-SDS) after storage of the pharmaceutical solution at 35° C. for 3 months; (d) after storage of the pharmaceutical solution at 2-8°C for 3 months, (i) a total aggregate content of less than 2% relative to the total antibody peak area as measured by size exclusion, or (ii) a total aggregate content of less than 1.5 area % as measured by non-reducing CE-SDS; (e) less than 500 particulates per milliliter, the particulates being greater than 2 μm in size when measured with a high accuracy particle counter (HIAC) by light obscuration after storing the pharmaceutical solution at 2-8° C. for 3 months; (f) less than 100 particulates per milliliter, said particulates being greater than 5 μm in size as measured by light obscuration using a high accuracy particle counter (HIAC) after storing said pharmaceutical solution at 2-8° C. for 3 months; (g) UV absorbance at 550 nm that changes by less than ±3% over 4 weeks of storage at 2-8°C; (h) a change in protein content of 1% to 13% as measured by UV absorbance at 280 nm after 4 weeks of storage at 2-8°C; (i) at least 93% of the anti-N3pGlu antibodies appear in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2-8°C; (j) a decrease of no more than 11% in the amount of anti-N3pGlu antibodies as measured by non-reducing CE-SDS after storage of the pharmaceutical solution at 2-8°C for 4 weeks; and (k) no more than 4 particles having a size of 25 μm or less as measured by differential count per mL after storing said pharmaceutical solution at 2-8° C. for 4 weeks; 70. The pharmaceutical solution of any one of claims 51 to 69, comprising in amounts sufficient in combination to exhibit one or more of the following:
71. The anti-N3pGlu Aβ antibody, the buffer, the tonicity agent, the surfactant, and the optional excipients are mixed in a pharmaceutical solution comprising: (a) an antibody monomer content of at least 97% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 5° C. for 3 months; (b) a total aggregate content of less than 2% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 5° C. for 3 months; (c) UV absorbance at 550 nm that changes less than ±3% over 4 weeks of storage at 5°C; (d) a change in protein content of 1% to 13% as measured by UV absorbance at 280 nm after 4 weeks of storage at 5°C; (e) at least 93% of the anti-N3pGlu antibody appears in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 5°C; (f) a decrease of no more than 11% in the amount of the anti-N3pGlu antibody as measured by non-reducing CE-SDS after storage of the pharmaceutical solution at 5°C for 4 weeks; and (g) no more than 4 particles having a size of 25 μm or less as measured by differential count per mL after storing said pharmaceutical solution at 5° C. for 4 weeks; 71. The pharmaceutical solution of any one of claims 51 to 70, comprising in amounts sufficient in combination to exhibit one or more of the following:
72. The anti-N3pGlu Aβ antibody, the buffer, the tonicity agent, the surfactant, and the optional excipients are mixed in a pharmaceutical solution comprising: (a) an antibody monomer content of at least 97.5% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (b) a total aggregate content of less than 1.5% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 2-8°C for 3 months; (c) an antibody purity of at least 94% area as measured by reduced CE-SDS after storage of the pharmaceutical solution at 35° C. for 3 months; (d) 93.3% to 93.8% of the anti-N3pGlu antibody appears in the main chromatographic peak (monomer) when analyzed by size exclusion chromatography after 4 weeks of storage at 2-8°C; (e) a decrease of 6.9% or less in the amount of the anti-N3pGlu antibody as measured by reduced CE-SDS after storing the pharmaceutical solution at 2-8°C for 4 weeks; 72. The pharmaceutical solution of any one of claims 51 to 71, comprising in amounts sufficient in combination to exhibit one or more of the following:
73. The anti-N3pGlu Aβ antibody, the buffer, the tonicity agent, the surfactant, and the optional excipients are mixed in a pharmaceutical solution comprising: (a) an antibody monomer content of at least 97.5% relative to the total antibody peak area as measured by size exclusion chromatography after storage of the pharmaceutical solution at 5° C. for 3 months; (b) a total aggregate content of less than 1.5% relative to the total antibody peak area as measured by size exclusion chromatography after storing the pharmaceutical solution at 5° C. for 3 months; (c) an antibody purity of at least 96% area as measured by reduced CE-SDS after storage of the pharmaceutical solution at 5°C for 3 months; (d) 93.3% to 93.8% of the anti-N3pGlu antibody appears in a major peak when analyzed by size exclusion chromatography after 4 weeks of storage at 5°C; (e) a decrease of 6.9% or less in the amount of the anti-N3pGlu antibody as measured by reduced CE-SDS after storing the pharmaceutical solution at 5°C for 4 weeks; (f) less than 500 particulates per milliliter, said particulates being greater than 2 μm in size as measured by light obscuration using a HIAC after storing said pharmaceutical solution at 5° C. for 3 months; and (g) less than 100 particulates per milliliter, said particulates being greater than 5 μm in size as measured by light obscuration using a HIAC after storing said pharmaceutical solution at 5° C. for 3 months; 73. The pharmaceutical solution of any one of claims 51 to 72, comprising in amounts sufficient in combination to exhibit one or more of the following:
74. 74. The pharmaceutical solution of any one of claims 70 to 73, wherein one or more of features (a) to (k) of claim 69 are present before and after storage; one or more of features (a) to (g) of claim 70 are present before and after storage; one or more of features (a) to (e) of claim 71 are present before and after storage; and / or one or more of features (a) to (g) of claim 72 are present before and after storage.
75. 75. The pharmaceutical solution of any one of claims 51 to 74, comprising polyoxyethylene (20) sorbitan monooleate, wherein the pharmaceutical solution exhibits a total free oleic acid content of less than 0.0025% weight by volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage at 2-8°C for 3 months.
76. 76. The pharmaceutical solution of any one of claims 51 to 75, comprising polyoxyethylene (20) sorbitan monooleate, and exhibiting a total free oleic acid content of less than 0.0025% weight by volume as measured by high performance liquid chromatography with UV detection (HPLC-UV) using an internal standard after storage of the pharmaceutical solution for 29 months at 2-8°C.
77. 77. A method of making the pharmaceutical solution of any one of claims 51 to 76, comprising the steps of: A method comprising combining the anti-N3pGlu Aβ antibody, the buffer, the tonicity agent, the surfactant, and the one or more optional excipients.
78. 78. The method of claim 77, wherein the anti-N3pGlu Aβ antibody is not reconstituted from lyophilized material.
79. A container comprising the medical solution of any one of claims 51 to 76.
80. 77. A method for treating a disease characterized by amyloid beta (Aβ) deposition, comprising administering to a patient in need thereof a therapeutically effective amount of the pharmaceutical solution of any one of claims 51 to 76.
81. 81. The method of claim 80, comprising administering to the patient a medicinal solution obtained from the container of claim 79.
82. 82. The method of claim 80 or 81, comprising administering to the patient a non-lyophilized anti-N3pGlu Aβ antibody.
83. 83. The method of any one of claims 80 to 82, wherein the disease is selected from Alzheimer's disease (AD), Down's syndrome, and cerebral amyloid angiopathy.
84. 84. The method of claim 83, wherein the disease is selected from preclinical AD, prodromal AD, mild AD, moderate AD, and severe AD.
85. 85. The method of any one of claims 80-84, comprising administering to the patient one or more doses of 100 mg to 10,000 mg of the anti-N3pGlu Aβ antibody.
86. 77. A pharmaceutical solution according to any one of claims 51 to 76 for use in the treatment of a disease characterised by the deposition of amyloid beta (Aβ).
87. 87. The medical solution for use according to claim 86, wherein the medical solution is obtained from a container according to claim 79.
88. 88. The pharmaceutical solution for use according to claim 86 or 87, wherein the anti-N3pGlu Aβ antibody is not lyophilized.
89. 89. The pharmaceutical solution for use according to any one of claims 86 to 88, wherein the disease is selected from Alzheimer's disease (AD), Down's syndrome, and cerebral amyloid angiopathy.
90. 90. The pharmaceutical solution for use according to claim 89, wherein the disease is selected from preclinical AD, prodromal AD, mild AD, moderate AD, and severe AD.
91. 91. The pharmaceutical solution for use according to any one of claims 86 to 90, wherein said treatment comprises administering to said patient one or more doses of between 100 mg and 10,000 mg of said anti-N3pGlu Aβ antibody.
92. Use of a pharmaceutical solution according to any one of claims 51 to 76 in the manufacture of a medicament for the treatment of a disease characterized by the deposition of amyloid beta (Aβ).
93. 93. The use of the medical solution of claim 92, wherein the medical solution is obtained from a container of claim 79.
94. 94. The use of claim 92 or 93, wherein the anti-N3pGlu Aβ antibody is not lyophilized.
95. 95. The use of the pharmaceutical solution of any one of claims 92 to 94, wherein the disease is selected from Alzheimer's disease (AD), Down's syndrome, and cerebral amyloid angiopathy.
96. 96. The use of claim 95, wherein the disease is selected from preclinical AD, prodromal AD, mild AD, moderate AD, and severe AD.
97. 97. The use of any one of claims 92 to 96, wherein said treatment comprises administering to said patient one or more doses of 100 mg to 10,000 mg of said anti-N3pGlu Aβ antibody.
98. 77. A method of reducing amyloid beta (Aβ) in a patient in need thereof, comprising administering to said patient a pharmaceutical solution according to any one of claims 51 to 76.
99. 99. The method of claim 98, wherein said administration results in a reduction in the amount of amyloid beta by at least 5%.
100. 1. A pharmaceutical solution comprising: an anti-N3pGlu Aβ antibody at a concentration of 17.5 mg / mL; a buffer solution containing citric acid or a salt thereof in an amount of 10 mM; a tonicity agent comprising sucrose in an amount of 8% by weight and volume; a surfactant comprising polyoxyethylene (20) sorbitan monooleate in an amount of 0.02% by weight volume; the anti-N3pGlu Aβ antibody comprises (a) a light chain variable region (LCVR) comprising SEQ ID NO: 1, and / or (b) a heavy chain variable region (HCVR) comprising SEQ ID NO: 2; The pharmaceutical solution, wherein the pharmaceutical solution has a pH of 6.
0.
101. 101. The pharmaceutical solution of claim 100, comprising: (a) a light chain (LC) comprising SEQ ID NO: 3, and / or a heavy chain (HC) comprising SEQ ID NO: 4.
Citation Information
Patent Citations
Anti-N3pGlu amyloid-beta peptide antibody and its use
JP2013536191A