Methods and kits for detecting single nucleotide polymorphisms (SNPs) by loop-mediated isothermal amplification (LAMP)

JP2025527936A5Pending Publication Date: 2026-05-13MAST GROUP LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
MAST GROUP LTD
Filing Date
2023-07-26
Publication Date
2026-05-13

AI Technical Summary

Technical Problem

Current methods for detecting single nucleotide polymorphisms (SNPs) using loop-mediated isothermal amplification (LAMP) are complex, require additional processing steps, and produce ambiguous results, making them unsuitable for widespread use in clinical settings.

Method used

A method involving the use of two complementary fluorescently labeled oligonucleotide probes, one for wild-type and one for mutant sequences, and optionally blank oligos, to compete for binding sites during LAMP, allowing real-time detection without post-amplification manipulations.

Benefits of technology

Enables clear and unbiased distinction between wild-type and mutant sequences, reducing complexity and time, and is suitable for use in clinics with varying sample concentrations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present invention provides a method for detecting and / or identifying one or more single nucleotide polymorphisms (SNPs) in a target nucleic acid sequence in a sample. The method includes: providing a first oligonucleotide probe complementary to the wild-type target sequence, the first oligonucleotide probe comprising a fluorescent label attached to an internal cytosine base, and the oligonucleotide probe lacking a terminator at its 3' end; amplifying the target nucleic acid sequence in the sample by loop-mediated isothermal amplification (LAMP) in a reaction vessel containing the first oligonucleotide probe and a second probe, or the first oligonucleotide probe, an intercalator dye, and a blank oligo, to provide amplified nucleic acid; and probing the amplified nucleic acid sequence; detecting the presence of the target wild-type nucleic acid sequence and / or mutant nucleic acid sequence; and (d) identifying the presence of the target wild-type nucleic acid sequence and / or mutant nucleic acid sequence based on the fluorescent label. The present invention also provides a kit for identifying nucleotide polymorphisms in a target nucleic acid sequence in a sample.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to methods and kits for detecting one or more single nucleotide polymorphisms (SNPs) using loop-mediated isothermal amplification (LAMP) and fluorescent probes. [Background technology]

[0002] Nucleic acid amplification is one of the most valuable tools in the life sciences, including application-oriented fields such as clinical medicine, where it is particularly useful in the diagnosis of infectious diseases, genetic diseases, and inherited traits. This process allows DNA, RNA, or fragments thereof to be amplified and further studied, such as for the detection of target sequences.

[0003] There are various methods for nucleic acid amplification, including polymerase chain reaction (PCR), nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR), and loop-mediated isothermal amplification (LAMP). PCR utilizes heat denaturation of double-stranded DNA products to facilitate the next round of DNA synthesis. 3SR and NASBA utilize a combination of transcription and reverse transcription to amplify target sequences without heat denaturation.

[0004] Nucleic acid amplification methods generally amplify target nucleic acids to similar scales, with detection limits of less than 10 copies and completion times of less than one hour. Furthermore, these methods have low target sequence specificity, requiring either highly accurate equipment for amplification or complex methods for detecting the amplified products. Despite its simplicity and the resulting amplification scale, PCR requires a highly accurate thermal cycler, making it difficult for this powerful method to be widely adopted as a routine diagnostic tool in private clinics and other settings. Unlike PCR amplification, LAMP can amplify a few copies of DNA to over 100 copies in less than one hour under isothermal conditions and has higher specificity than PCR.

[0005] In certain circumstances, it may be necessary to determine the presence of mutated or otherwise altered nucleic acid sequences, which may arise as variants of DNA or RNA, e.g., as genetic mutations or deletions, including the emergence of new variants of viruses, etc.

[0006] Much of the genetic variation between individuals occurs in the form of single nucleotide polymorphisms (SNPs) or, less frequently, double- or triple-nucleotide polymorphisms (DNPs and TNPs). Such polymorphisms can affect a variety of human, animal, and agricultural traits, including disease susceptibility and pathogenic drug resistance. However, SNP variation can also influence and / or enhance the transmissibility and infectivity of pathogens, as demonstrated by the recent evolution and continued persistence of the SARS-CoV-2 virus.

[0007] SNPs can be detected using nucleic acid sequencing. However, current methods other than LAMP are time-consuming, expensive, and / or unreliable, and often require specialized equipment and / or assay components that are prone to degradation. For example, polymerase chain reaction (PCR) amplification, a common method for SNP detection, involves cycling the temperature of the reaction mixture during the assay, which adds complexity and cost and typically requires specialized equipment.

[0008] Loop-mediated isothermal amplification (LAMP) generally requires a short turnaround time and does not require temperature cycling. LAMP requires four to six primers, which can be prepared from dry packs at room temperature and are performed at a constant temperature without the need for the high-precision temperature cycling equipment required for PCR. Therefore, LAMP has the potential to be used in a wider range of applications and offers clear advantages over other detection methods. However, various barriers remain before LAMP can be widely adopted for SNP mutation detection.

[0009] For example, current SNP detection methods using LAMP require additional functions or complex processes, such as incorporating SNP mutations at the ends of FIP / BIP LAMP primers (see Non-Patent Document 1). Furthermore, such methods require post-amplification processing steps, such as enzymatic digestion of the amplified sample with restriction enzymes (see Non-Patent Document 2) and / or prior probe annealing to enable SNP detection (Non-Patent Document 3). These additional steps increase the technical complexity, cost, and time required to carry out the amplification and detection process.

[0010] Furthermore, even with additional processing, these methods generally produce ambiguous results. These ambiguous results can take the form of shifts in reaction amplification time (identifiable by direct visual detection or turbidity) or changes in baseline fluorescent signal or nonspecific DNA-intercalating dye fluorescence. Direct visual detection typically provides results at the end of the reaction, preventing real-time amplification data. Turbidity and nonspecific intercalating dyes provide real-time data as amplification occurs, but this data is nonspecific. This means that all amplifications, whether true positives or spurious amplifications due to mispriming or cross-specificity, are detected. These results can be difficult to interpret when varying amounts of nucleic acid template are used in the reaction, which is a common occurrence in clinical samples, making real-time analysis impossible. [Prior art documents] [Non-patent literature]

[0011] [Non-Patent Document 1] Costa-Junior et al., J. Parasit, Dis., 2021; 46(1): 47-55 [Non-patent document 2] Carvalhais et al., Frontiers in Plant Sci. 2019; 10: 547 [Non-patent document 3] Hyman et al., 2021; bioRxiv doi: https: / / doi.org / 10.1101 / 2021.03.29.437576 Summary of the Invention [Problem to be solved by the invention]

[0012] Therefore, there is a need for an improved system for SNP detection that is easy to use, provides results in real time, and requires minimal equipment. Improved systems for SNP detection may, for example, identify homologous sequences that differ only in the presence or absence of one or more single nucleotide polymorphisms. Specifically, there is a need for an SNP detection and / or SNP discrimination system that enables one or more of the following: · No post-amplification manipulations (e.g., enzymatic digestion or probe annealing) are required; - A clear and optionally unbiased distinction between wild-type (WT) and mutant sequences; No need to compare amplification times or baseline fluorescence levels or perform complex statistical analyses to obtain results; No need to repeat the test to obtain unbiased and clear results; and / or -Suitable for use in clinics where samples of various concentrations are collected. [Means for solving the problem]

[0013] According to a first aspect of the present invention, there is provided a method for detecting a single nucleotide polymorphism (SNP) in a target nucleic acid sequence in a sample. The method includes: a) providing a first oligonucleotide probe complementary to the wild-type target sequence, the first oligonucleotide probe including a fluorescent dye label attached to an internal cytosine base, and the oligonucleotide probe lacking a terminator at its 3' end; b) amplifying the target nucleic acid sequence in the sample by loop-mediated isothermal amplification in a reaction vessel containing the first oligonucleotide probe and a second probe or intercalator dye, providing an amplified nucleic acid, and probing the amplified nucleic acid sequence; c) detecting the presence of the target wild-type nucleic acid sequence and / or mutant nucleic acid sequence; and d) identifying the presence of the target wild-type nucleic acid sequence and / or mutant nucleic acid sequence based on the fluorescent label. In another configuration, the first oligonucleotide probe is complementary to a mutant sequence of the wild-type target sequence.

[0014] The fluorescent probe is present during the amplification process, allowing it to bind to the target sequence and be incorporated into the amplicon by BST DNA polymerase. The fluorescence of the added fluorescent label allows the presence of the amplified target nucleic acid sequence to be clearly detected in real time while the reaction is proceeding in the reaction vessel. This method is particularly advantageous because fluorescence detection is possible during the reaction, eliminating the need for post-reaction manipulation of the amplified nucleic acid. Therefore, more convenient and efficient detection of the target nucleic acid sequence can be achieved.

[0015] Additionally, the use of a second probe or intercalator dye allows for real-time detection of additional amplified target nucleic acid sequences and / or the amplified nucleic acid of the reaction as a whole.

[0016] The simultaneous use of a first and second labeled probe in a single LAMP reaction allows for the detection and discrimination of multiple sequences, including one or more SNPs or wild-type sequences and their corresponding mutant sequences, in a single assay. Furthermore, the use of a competing second probe (mutant probe) in a single reaction with a first probe (wild-type probe) increases the specificity of detection because the first and second probes compete for binding sites during the reaction. The presence of another probe in the reaction reduces the likelihood of false-positive results due to probe binding to a nucleic acid sequence that is not perfectly complementary. In the absence of a competing probe (second probe), the first probe (wild-type probe) tends to bind nonspecifically to a mutant sequence that differs from the wild-type sequence by only a single nucleotide. A competing probe that perfectly matches the mutant sequence binds to a sequence containing a point mutation (SNP) with higher affinity than the wild-type probe. The competing mutant probe blocks the binding site of the mutant sequence, preventing non-specific annealing of the wild-type probe and preventing the generation of false amplification signals in the presence of the mutant sequence. The oligonucleotide probe of the present invention does not have a terminator at its 3' end. This non-existent 3'-end terminator may be, for example, ddNTP. The absence of a terminator at its 3' end allows the labeled oligonucleotide to be incorporated into the amplicon. In this way, the 3' end of the probe is not "blocked."

[0017] In one embodiment of the present invention, the first probe is complementary to the target nucleic acid sequence. Any suitable target sequence can be used. The target sequence can be selected from the wild-type target sequence of any organism. In one configuration, the first probe can be a wild-type DNA or RNA sequence, optionally with a single point mutation at the opposite nucleotide at or near the 3' end of the probe. This configuration is particularly advantageous because it can reduce the potential cost and complexity of the assay when there is no competing probe, such as a second probe complementary to a mutant sequence of the wild-type target sequence, or when there is no competing sequence (e.g., a so-called "blank oligo").

[0018] In one configuration, the target nucleic acid sequence may be a virus. Any suitable virus may be used. For example, the virus may be selected from SARS-CoV-2 or a variant thereof.

[0019] In one embodiment of the present invention, the second probe may be selected from a probe complementary to a mutant sequence of the wild-type target sequence, or a universal probe, such as a universal probe capable of detecting both the wild-type target sequence and a mutant sequence of the wild-type target sequence. In one embodiment, the second probe may be selected from a probe complementary to a mutant sequence of the wild-type target sequence. In another embodiment, the second probe may be selected from a universal probe capable of detecting both the wild-type target sequence and a mutant sequence of the wild-type target sequence. In another configuration, the second probe may be selected from a probe complementary to the wild-type target sequence. This configuration is preferred when the first probe is selected from a probe complementary to a mutant sequence of the wild-type target sequence.

[0020] In one embodiment, step b) of the method of paragraph 1 includes, for example, providing an intercalator dye or a universal probe. The universal probe may be similar to the first probe, except that it targets a nucleic acid sequence common to both the wild-type target sequence and the mutant sequence. In yet another embodiment, the universal probe may not contain a nucleotide at which a SNP occurs. In yet another embodiment, there is no overlap between the sequence of the first probe and the sequence of the universal probe. In yet another embodiment, the universal probe targets a gene contained in the sample that is different from the first and / or second probes. Here, the different target gene has a more highly conserved sequence than the sequences targeted by the wild-type and / or mutant probes, and optionally, a different primer set is used. Such a universal probe can detect amplification of both the wild-type and mutant sequences, allowing for comparison of the amplification of the wild-type and / or mutant sequences with the overall amplification during the LAMP reaction.

[0021] In one or more embodiments of the present invention, at least one of the probes contains one or two point mutations. Optionally, each probe contains one or two point mutations. The probes containing one or two point mutations can detect the corresponding one or two point mutations in the nucleic acid sequence of a sample.

[0022] In some embodiments of the present invention, a second probe is used that is complementary to a mutant sequence of the wild-type target sequence, the second probe further comprising a fluorescent label attached to an internal cytosine base, no terminator at the 3' end, and at least one of the first and second probes comprising one or two point mutations at or near the 3' end.

[0023] In some embodiments of the present invention, one or more so-called "blank oligos" may be used. Any suitable blank oligo may be used. The blank oligo does not have a fluorescent dye label and may optionally contain the same sequence as the first probe. The blank oligo may contain one or more SNP mutations, for example, at or near the 3' end or in the middle of the sequence. In one configuration, a 3'-terminal SNP may include a SNP at the terminal nucleotide base at the 3' end of the nucleic acid sequence, while a 3'-proximal SNP may include a SNP at the penultimate nucleotide base from the 3' end. In another configuration, the one or more blank oligos may be the same or different.

[0024] In some embodiments of the present invention, the blank oligo may be complementary to the wild-type target sequence. In this configuration, the first probe may contain one or more SNP mutations at or near the 3' end or in the center of the sequence. The first probe may be complementary to a mutant sequence of the wild-type sequence. In another configuration, one or more probes may contain one or more SNP mutations at or near the 3' end or in the center of the sequence. One or more probes may be complementary to one or more mutant sequences of the wild-type sequence.

[0025] The purpose of using blank oligos is to improve the specificity of the reaction by competing for binding sites with the fluorescent probe, thereby allowing oligonucleotides with higher similarity to the target sequence to be incorporated into the amplified nucleic acid even in the absence of a second probe. Blank oligos may be used when it is not possible to design or manufacture a functionally competitive second probe labeled with a fluorescent dye that can be distinguished from the first probe, or when a mutant contains multiple SNPs that cannot be covered by a single probe, but which are located at the same or close to each other and all express the same phenotype (e.g., antibiotic resistance). Furthermore, when a mutant sequence contains multiple different point mutations that cannot be covered by one or two fluorescent probes and are close to each other, multiple different blank oligos may be used simultaneously in a single reaction. In one configuration, the second probe may be selected from a universal probe, and the method includes providing an intercalator dye or universal probe and one or more blank oligos. In yet another configuration, the one or more blank oligos may contain one or more SNP mutations at or near the 3' end of the sequence, or may contain one or more SNPs in the middle of the sequence. For example, in some embodiments, a method includes providing an intercalator dye or universal probe and one or more blank oligos, where the one or more blank oligos have the same sequence as the first probe but lack a fluorescent label and contain one or more SNP mutations at or near the 3' end.

[0026] In one embodiment of the present invention, a blank oligo may be provided at an equimolar concentration relative to the first probe. In some configurations, the blank oligo may be provided at a concentration in excess of the first probe. Providing an excess of the blank oligo in the absence of a second probe that competes with the first probe may further enhance the specificity of the reaction. This may be particularly true when the target sequence of the blank oligo is present in the sample, as the excess blank oligo increases competition for access to the target binding site. For example, if a first probe complementary to a wild-type target sequence is present but no competing second probe is present, and blank oligos complementary to mutant sequences of the wild-type target sequence are present in excess, when only the wild-type mutant sequence is present, the fluorescent signal generated by the incorporation of the first probe into the amplicon being amplified will be weak or absent. In the same example, when only the wild-type sequence is present in the sample, the first fluorescent probe will emit a signal. Furthermore, when subjecting samples to detection by a real-time detection LAMP assay, the difference in C values ​​between a sample containing a wild-type sequence and a sample containing a mutant wild-type sequence can be more clearly determined by using a first probe together with an excess of blank oligos in the absence of a competing second probe. In some embodiments, the method includes providing an intercalator dye or a universal probe and one or more blank oligos, where at least one blank oligo has the same sequence as the first probe but is not fluorescently labeled and contains one or more SNPs in the center of the sequence. In another configuration, the method includes providing an intercalator dye or a universal probe and one or more blank oligos without a fluorescent label, where at least one blank oligo has the same sequence as the wild-type sequence and the first probe contains a mutant wild-type target sequence.

[0027] In some embodiments of the present invention, the method may be performed in the presence of a buffer. Any suitable buffer can be used. In one embodiment, the buffer may be Tris buffer. Tris buffer is one of the buffers that can be used with various LAMP reactions and nucleic acid samples. In another embodiment, when one or more blank oligos contain one or more SNPs in the center of their sequence, the buffer may be CHES CAPSO buffer. The use of a buffer, particularly CHES CAPSO buffer, in the method allows for the design of probes with one or two point mutations in the center of the probe sequence. This is advantageous when it is not possible to design probes with mutations at the 3' end. While Tris buffer is compatible with most LAMP assays, CHES CAPSO buffer may contribute to improving the specificity of primers that have the problem of proneness to primer-dimer formation.

[0028] In some embodiments, when the method does not use a blank oligo, the method may include providing an intercalator dye or universal probe, where a first probe is specific for a wild-type DNA or RNA sequence having a single point mutation opposite a nucleotide at or near the 3' end of the probe.

[0029] Any suitable fluorescent label or fluorescent dye label can be used in the present invention. In some embodiments, the fluorescent label, fluorescent dye label, and / or intercalator dye can include one or more of TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO, and V13, or any other dye suitable for nucleic acid detection. In one configuration, the fluorescent labels, fluorescent dye labels, or intercalator dyes can be different, allowing for discrimination with respect to detection. For example, the first and second probes can contain different labels, or the first probe and intercalator dye can contain different labels.

[0030] In some embodiments of the present invention, the first probe is configured to function as a loop-mediated isothermal amplification primer. In another embodiment of the present invention, the second probe is configured to function as a loop-mediated isothermal amplification primer. In another embodiment of the present invention, one or more blank oligos are configured to function as loop-mediated isothermal amplification primers. In yet another embodiment of the present invention, the first and / or second probe are configured to function as loop-mediated isothermal amplification primers. In yet another embodiment of the present invention, the first and / or second probe and / or one or more blank oligos are configured to function as loop-mediated isothermal amplification primers. In some embodiments of the present invention, the loop-mediated isothermal amplification primer is an LF loop primer or an LB loop primer.

[0031] In another embodiment of the present invention, the first probe, the second probe, and / or the target nucleic acid may be a DNA sequence or an RNA sequence. In yet another embodiment of the present invention, the first probe, the second probe, the blank oligo, and / or the target nucleic acid may be a DNA sequence or an RNA sequence. Any suitable DNA sequence or RNA sequence may be used. In one embodiment of the present invention, the first probe may be a DNA sequence or an RNA sequence. In yet another embodiment of the present invention, the second probe may be a DNA sequence or an RNA sequence. In yet another embodiment of the present invention, the first probe may be a DNA sequence or an RNA sequence, and the second probe may be a DNA sequence or an RNA sequence. In some embodiments of the present invention, the probe, primer, and / or blank oligo used in the LAMP reaction may each be a DNA sequence. In some other embodiments of the present invention, the probe, primer, and blank oligo used in the LAMP reaction may all be DNA sequences.

[0032] Optionally, loop-mediated isothermal amplification may be performed using RB(tris) buffer.

[0033] In some embodiments, the first or second probe, or the blank oligo, SEQ ID NO: 1: 5' GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3' (SARS-CoV-2 WT probe S gene to identify A23063T N501Y point mutation) SEQ ID NO: 2: 5' AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3' (SARS-CoV-2 WT probe S gene to identify E484K point mutation) SEQ ID NO: 3: 5' AAAGGAAAGTAACAATTAAAACCTTT 3' (SARS-CoV-2 mutant blank oligo to identify the E484K point mutation) The sequence may include one or more of the following:

[0034] In some embodiments of the present invention, the presence of target nucleic acid and / or mutant nucleic acid sequence can be detected by loop-mediated isothermal amplification (LAMP).Detection can be performed with or without any post-amplification manipulation, preferably without any post-amplification manipulation.This absence of post-amplification manipulation is particularly advantageous, since it reduces the complexity of this method and shortens the time required to detect SNPs in samples.

[0035] In some embodiments, the methods of the present invention allow for the detection of SNPs, and the target nucleic acid is derived from a virus, such as SARS-CoV-2 or a variant thereof.

[0036] Any suitable primer set can be used in the LAMP process. A suitable primer set includes at least a FIP primer, a BIP primer, an F3 primer, and a B3 primer, and may optionally include a loop F primer and / or a loop B primer. In some configurations, a loop F primer and / or a loop B primer may be used to improve the speed and / or sensitivity of the LAMP reaction. In some configurations, for example, when it is difficult to design a primer set including a loop F primer and / or a loop B primer and / or to reduce the possibility of false amplification, only a FIP primer, a BIP primer, an F3 primer, and a B3 primer may be used.

[0037] In some embodiments of the present invention, the LAMP reaction can be carried out in any suitable vessel. In yet another embodiment of the present invention, the detection of the amplified nucleic acid sequence can be carried out in any suitable vessel. In yet another embodiment of the present invention, the LAMP reaction and the detection of the amplified nucleic acid sequence can be carried out in the same reaction vessel. If the LAMP reaction and the detection of the amplified nucleic acid sequence are carried out in the same reaction vessel, the reaction can be analyzed in real time using the equipment required to carry out the method.

[0038] In another embodiment of the present invention, there is provided a kit for detecting a nucleotide polymorphism in a target nucleic acid sequence in a sample, the kit comprising: (a) a first oligonucleotide probe complementary to a wild-type target sequence, the first oligonucleotide probe comprising a fluorescent label bound to an internal cytosine base, and the oligonucleotide probe sequence having no terminator at its 3' end; and (b) a loop-mediated isothermal amplification reagent buffer, an enzyme, dNTPs, and loop-mediated isothermal amplification primers, the first probe configured to be used in a single reaction vessel.

[0039] In some embodiments of the present invention, the kit may further include an intercalator dye or a second oligonucleotide probe, where the second oligonucleotide probe is selected from a probe complementary to a mutant sequence of a wild-type target sequence or a universal probe capable of detecting both the wild-type and mutant target sequences; the second oligonucleotide probe and / or the intercalator dye include an additional fluorescent label that allows it to be distinguished from the first probe; and the first probe, the second probe, and / or the intercalator dye are configured to be used in a single reaction vessel. In some embodiments, the kit may further include one or more blank oligonucleotides. The kit may further include one or all of a loop-mediated isothermal amplification reagent buffer, an enzyme, deoxyribonucleoside 5'-triphosphates (dNTPs), and a loop-mediated isothermal amplification primer. Optionally, the kit may include a RB(tris) buffer.

[0040] In another configuration of the kit, a) a first oligonucleotide probe complementary to a wild-type mutant sequence, the first oligonucleotide probe containing a fluorescent label attached to an internal cytosine base, and the oligonucleotide probe sequence lacking a terminator at its 3' end; and b) a loop-mediated isothermal amplification reagent buffer, an enzyme, dNTPs, and loop-mediated isothermal amplification primers are provided, with the first probe configured for use in a single reaction vessel. The kit may further include an intercalator dye or a second oligonucleotide probe, the second oligonucleotide probe being selected from a probe complementary to the wild-type sequence or a universal probe capable of detecting both the wild-type target sequence and the mutant target sequence; the second oligonucleotide probe and / or the intercalator dye containing an additional fluorescent label that allows it to be distinguished from the first probe; and the first probe, the second probe, and / or the intercalator dye are configured for use in a single reaction vessel. In some embodiments, the kit may further include one or more blank oligonucleotides. One or more blank oligos may be complementary to the wild-type sequence.

[0041] Optionally, the kit may include additional labeled probes. For example, the kit may provide two or at least two labeled probes, three or at least three labeled probes, four or at least four labeled probes, five or at least five labeled probes, six or at least six labeled probes, or ten or at least ten labeled probes. In another configuration, the kit may provide two to ten labeled probes, two to nine labeled probes, two to eight labeled probes, three to seven labeled probes, or three to six labeled probes. In one configuration, any suitable number of labeled probes can be used. Such probes may be used to detect additional SNPs or wild-type sequences.

[0042] In some embodiments of the invention, the kit may include at least one probe that contains a mutation, for example, at least one probe may contain one or two point mutations, optionally at or near the 3' end.

[0043] In some further embodiments of the present invention, the kit may include a second probe complementary to a mutant sequence of the wild-type target sequence. In one configuration, the second probe may further include a fluorescent dye label. The label may be attached to an internal cytosine base, and optionally, the second probe does not have a terminator at its 3' end. In yet another configuration, at least one of the first and / or second probes includes one or two point mutations at or near the 3' end. In another configuration, the kit may include a second probe complementary to the wild-type target sequence. This configuration is preferred when the first probe is complementary to a mutant sequence of the wild-type target sequence.

[0044] In some embodiments of the present invention, the kit may include a second probe complementary to a mutant sequence of the wild-type target sequence. In one configuration, the second probe may include a fluorescent dye label attached to an internal cytosine base and does not have a terminator at its 3' end. Optionally, at least one of the first and second probes may include one or two point mutations at or near its 3' end.

[0045] In yet another embodiment of the present invention, the kit provides a second probe, which may be selected from a probe complementary to a mutant sequence of the wild-type target sequence or a universal probe capable of detecting both the wild-type target sequence and a mutant sequence of the wild-type target sequence. In one embodiment, the second probe may be selected from a probe complementary to a mutant sequence of the wild-type target sequence. In another embodiment, the second probe may be selected from a universal probe capable of detecting both the wild-type target sequence and a mutant sequence of the wild-type target sequence.

[0046] If the kit provides an intercalator dye or a universal probe, the kit may further provide one or more so-called "blank oligos" that can be used. Any suitable blank oligo can be used. The blank oligo does not have a fluorescent dye label. Optionally, the blank oligo may contain the same sequence as the first probe, but may also contain one or more SNP mutations at or near the 3' end or in the middle of the sequence. In one configuration, the 3'-end SNP includes a SNP at the terminal nucleotide base at the 3' end of the nucleic acid sequence, and the 3'-end-proximal SNP includes a SNP at the second nucleotide base from the 3' end. When more than one blank oligo is used, the one or more blank oligos may be the same or different. In another configuration, the blank oligo may contain a wild-type sequence, and the first probe may contain a wild-type mutant sequence containing one or more SNP mutations at or near the 3' end or in the middle of the sequence.

[0047] Alternatively or additionally, when the kit includes an intercalator dye or universal probe and one or more blank oligos, the one or more blank oligos may have the same sequence as the first probe but may not be labeled with a fluorescent dye. In yet another configuration, the one or more blank oligos may contain one or more SNP mutations at or near the 3' end of the sequence, or one or more SNPs in the center of the sequence. In yet another configuration, if the mutant sequence contains multiple different point mutations that cannot be covered by one or two fluorescent probes and are close to each other, multiple different blank oligos may be used simultaneously in a single reaction.

[0048] In some embodiments of the present invention, the kit may include a buffer. Any suitable buffer may be used. In one embodiment, the buffer may be RB(tris) buffer. RB(tris) buffer is one of the buffers that can be used with various LAMP reactions and nucleic acid samples. In another embodiment, when one or more blank oligos contain one or more SNPs in the center of their sequence, the buffer may be CHES CAPSO buffer. In the method, the use of a buffer, particularly a CHES CAPSO buffer, makes it possible to design probes with one or two point mutations in the center of the probe sequence. This is advantageous when it is not possible to design probes with mutations at the 3' end. In some embodiments, the second probe may be selected from a universal probe, and an intercalator dye or universal probe is provided in the kit. In some embodiments, the first probe may contain one or more SNPs in the center of its sequence, one or more blank oligos may be complementary to the wild-type target sequence, and the buffer may be CHES CAPSO buffer.

[0049] In some embodiments, the kit does not include a blank oligo, and the first probe is specific for a wild-type DNA or RNA sequence with a single point mutation opposite a nucleotide at or near the 3' end of the probe.

[0050] Any suitable fluorescent or fluorescent dye label can be used with the probe in the kit. The fluorescent label, fluorescent dye label, or intercalator dye can include one or more of TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO, and V13, or any other dye suitable for nucleic acid detection. In one configuration, the fluorescent labels, fluorescent dye labels, or intercalator dyes can be different. For example, the first and second probes can contain different labels, or the first probe and intercalator dye can contain different labels.

[0051] In some embodiments of the present invention, a kit may be provided in which the first probe can be configured to function as a loop-mediated isothermal amplification primer. In other embodiments of the present invention, the second probe is configured to function as a loop-mediated isothermal amplification primer. In other embodiments of the present invention, the blank oligo is configured to function as a loop-mediated isothermal amplification primer. In yet another embodiment of the present invention, the first and / or second probe are configured to function as loop-mediated isothermal amplification primers. In yet another embodiment of the present invention, the first probe, the second probe, and / or the blank oligo are configured to function as loop-mediated isothermal amplification primers. In some embodiments of the present invention, the isothermal amplification primer is an LF loop primer or an LB loop primer.

[0052] Additionally or alternatively, the first probe, the second probe, and / or the target nucleic acid may be a DNA sequence or an RNA sequence. Additionally or alternatively, the first probe, the second probe, the blank oligo, and / or the target nucleic acid may be a DNA sequence or an RNA sequence. Any suitable DNA sequence or RNA sequence may be used. In one embodiment of the present invention, the first probe may be a DNA sequence or an RNA sequence. In yet another embodiment of the present invention, the second probe may be a DNA sequence or an RNA sequence. In yet another embodiment of the present invention, the first probe may be a DNA sequence or an RNA sequence, and the second probe or the blank oligo may be a DNA sequence or an RNA sequence. In some embodiments of the present invention, the probe, the primer, and / or the blank oligo may each be a DNA sequence. In some other embodiments of the present invention, the probe, the primer, and the blank oligo may all be DNA sequences.

[0053] In a preferred embodiment, the first or second probe, or the blank oligo, SEQ ID NO:1: 5' GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3' (SARS-CoV-2 WT probe S gene to identify A23063T N501Y point mutation); SEQ ID NO:2: 5' AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3' (SARS-CoV-2 WT probe S gene to identify the E484K point mutation); and SEQ ID NO: 3: 5' AAAGGAAAGTAACAATTAAAACCTTT 3' (SARS-CoV-2 mutant blank oligo to identify the E484K point mutation) The sequence includes one or more of:

[0054] The kit may be configured to detect the presence of a target nucleic acid and / or a mutant nucleic acid sequence, and the presence of the target nucleic acid and / or a mutant nucleic acid sequence can be detected by loop-mediated isothermal amplification (LAMP). In some embodiments of the present invention, the kit may be configured to detect the presence of a target wild-type nucleic acid sequence and / or a mutant nucleic acid sequence during LAMP without the need for any post-amplification manipulations. Preferably, the kit may be suitable for detecting such nucleic acid sequences without the need for any post-amplification manipulations.

[0055] In some embodiments, the kit may be suitable for detecting target nucleic acids from a virus, such as the SARS-CoV-2 virus or a variant thereof.

[0056] The kit may be configured for use in a LAMP process, and any suitable primer set may be used in LAMP. A suitable primer set includes at least an FIP primer, a BIP primer, an F3 primer, and a B3 primer, and may optionally further include a loop F primer and / or a loop B primer. [Brief explanation of the drawings]

[0057]

Figure 1a-1b

Figure 2a-2c

Figure 3a-3d

Figure 4a-4d

Figure 5a-5d

Figure 6a-6c

Figure 7a-7d

Figure 8a-8d

Figure 9a-9d

Figure 10a-10d

Figure 11a-11d

[0058] According to one aspect of the present invention, a method and kit are provided for detecting SNPs using two fluorescently labeled oligonucleotide probes simultaneously in a single LAMP reaction. The first probe is an oligonucleotide containing a fluorescent dye label attached to an internal cytosine base and lacking a terminator at its 3' end. The first probe is complementary to a wild-type target sequence. The second probe is an oligonucleotide sequence containing a fluorescent dye label attached to an internal cytosine base that is distinguishable from the fluorescent label of the first probe and lacking a terminator at its 3' end. The second probe is complementary to a mutant sequence of the wild-type sequence and contains one or two point mutations at or near the 3' end of the oligonucleotide sequence. In some embodiments, the 3' end or near the 3' end includes the terminal nucleotide base and the penultimate nucleotide base of the 3' end.

[0059] A target nucleic acid sequence in a sample is amplified by LAMP, and the amplified nucleic acid is prepared in a reaction vessel containing a first oligonucleotide probe. The amplified nucleic acid sequence is then probed. The target nucleic acid sequence is amplified by the LAMP reaction in the presence of both the first and second probes. In some embodiments, the LAMP reaction is performed in a single vessel. The two probes compete for binding sites on the amplified nucleic acid sequence. Thus, amplified nucleic acid sequences containing wild-type sequences complementary to the first probe can be detected by detecting the fluorescence of the fluorescent label of the first probe, and amplified nucleic acid sequences containing mutant sequences complementary to the second probe can be detected by detecting the fluorescence of the fluorescent label of the second probe. Thus, the presence of the target wild-type and / or mutant nucleic acid sequences can be detected by the fluorescence of the probes and can be identified based on the fluorescent labels of the probes.

[0060] According to yet another aspect of the present invention, there is provided a method for detecting SNPs using a fluorescently labeled oligonucleotide probe and a blank oligonucleotide simultaneously in a single LAMP reaction. The fluorescently labeled oligonucleotide probe is an oligonucleotide probe (WT fluorescent probe) complementary to a WT target sequence. The blank oligo is an oligonucleotide sequence having the same sequence as the WT fluorescent probe but is not labeled with a fluorescent dye and contains one or more SNP mutations (i.e., one or two point mutations) at or near the 3' end of the oligonucleotide sequence. In some embodiments, the 3' end or near the 3' end includes the terminal nucleotide base and the penultimate nucleotide base of the 3' end.

[0061] The target nucleic acid sequence in a sample is amplified using a LAMP reaction, and the amplified nucleic acid is then prepared in a reaction vessel containing a first probe and a blank oligo. The amplified nucleic acid sequence is then probed using one or more fluorescent signals to detect the presence of the amplified wild-type sequence. In the presence of an intercalator dye or a universal probe, the presence of either the wild-type sequence or the SNP sequence can be discriminated.

[0062] According to yet another aspect of the present invention, there is provided a method for detecting SNPs using a fluorescently labeled oligonucleotide probe and a blank oligonucleotide simultaneously in a single LAMP reaction. The fluorescently labeled oligonucleotide probe is an oligonucleotide probe having a sequence identical to the WT target sequence but containing one or more SNP mutations (i.e., one or two point mutations) at or near the 3' end of the oligonucleotide sequence. In some embodiments, the mutations at or near the 3' end of the oligonucleotide sequence may include a SNP at the terminal nucleotide base at the 3' end and / or a SNP at the penultimate nucleotide base from the 3' end. The blank oligo is an oligonucleotide sequence having a sequence identical to the target WT sequence but not labeled with a fluorescent dye.

[0063] According to yet another aspect of the present invention, there is provided a method for detecting SNPs using a fluorescently labeled oligonucleotide probe and a blank oligo in a single LAMP reaction, wherein one or more SNPs are located substantially in the center of the blank oligo. The fluorescently labeled oligonucleotide probe is an oligonucleotide probe containing a fluorescent dye label attached to an internal cytosine base and lacking a terminator at the 3' end. The first probe is complementary to the WT target sequence. The blank oligo is an oligonucleotide having the same sequence as the WT fluorescent probe but is not labeled with a fluorescent dye and contains one or more SNP mutations (i.e., one or two point mutations) in the center of the blank oligo sequence. In some embodiments, the center of the sequence includes any nucleotide between the second nucleotide from the 3' end and the 5' end or sequence.

[0064] According to yet another aspect of the present invention, there is provided a method for detecting SNPs using a fluorescently labeled oligonucleotide probe and a blank oligonucleotide simultaneously in a single LAMP reaction, wherein one or more SNPs are located substantially in the center of the fluorescently labeled probe. The fluorescently labeled oligonucleotide probe contains a fluorescent dye label attached to an internal cytosine base and does not have a terminator at the 3' end. The blank oligonucleotide is complementary to the WT target sequence but is not labeled with a fluorescent dye. The fluorescently labeled probe has the same sequence as the blank oligo but contains one or more SNP mutations (i.e., one or two point mutations) in the center of the oligonucleotide probe sequence. In some embodiments, the mutations in the center of the oligonucleotide probe sequence may contain one or more SNPs at any nucleotide between the second nucleotide from the 3' end and the 5' end of the sequence. The reaction may further contain an intercalator fluorescent dye or a universal fluorescent probe, the fluorescence of which can be distinguished from that of the first probe. The universal fluorescent probe targets a nucleic acid sequence common to both the WT sample and the mutant (SNP) sample, but does not include the nucleotide at which the SNP occurs. The intercalator fluorescent dye or universal probe can provide detectable fluorescent control signals corresponding to both the wild-type and mutant target sequences present in the sample. In some configurations, the universal probe can be designed to target a different target gene than the first probe, where the different target gene has a more highly conserved sequence than the target sequence compared to the wild-type and mutant versions. In some configurations, when the universal probe targets a different target gene, a separate primer set can be used. In some configurations, there is no overlap between the sequence of the first probe and the sequence of the universal probe.

[0065] The target nucleic acid sequence in a sample is amplified using a LAMP reaction, and the amplified nucleic acid is then prepared in a reaction vessel containing a first probe and a blank oligo. The amplified nucleic acid sequence is then probed using one or more fluorescent signals to detect the presence of the amplified wild-type sequence. In the presence of an intercalator dye or a universal probe, the presence of either the wild-type sequence or the SNP sequence can be discriminated.

[0066] According to yet another aspect of the present invention, one or more blank oligos may be provided at a concentration equal to the concentration of the first fluorescently labeled probe. In another embodiment, the concentration of the one or more blank oligos is in excess of the concentration of the first probe. In some embodiments, the concentration of the one or more blank oligos is about 1.5 times or more, about 2 times or more, or about 4 times or more the concentration of the first probe. In some embodiments, the concentration of the one or more blank oligos is about 1.25 times to about 6 times, about 1.5 times to about 5 times, about 1.75 times to about 4.75 times, about 1.5 times to about 4.5 times, about 1.75 times to about 4.0 times, about 2 times to about 3.75 times, about 2.25 times to about 3.5 times, about 2.5 times to about 3.25 times, or about 2.75 times to about 3 times the concentration of the first probe. In some configurations, the concentration of the one or more blank oligos is about 2-fold greater, or about 4-fold greater, than the concentration of the first probe.

[0067] In a LAMP reaction containing a first probe and a blank oligo, providing an excess concentration of the blank oligo in the absence of a second probe to compete with the first probe is particularly advantageous because it further enhances the specificity of the reaction. This can be achieved, particularly when the target sequence of the blank oligo is present in the sample, by increasing competition for access to the target binding site with the excess blank oligo. For example, if a first probe complementary to the wild-type target sequence is present but no competing second probe is present, and an excess of blank oligos complementary to mutant sequences of the wild-type target sequence is present, when only the wild-type mutant sequence is present, the fluorescent signal generated by the incorporation of the first probe into the amplicon being amplified will be weak or absent. In the same example, when only the wild-type sequence is present in the sample, the first fluorescent probe will emit a signal. Furthermore, when samples are subjected to detection by a real-time detection LAMP assay, the difference in C values ​​between a sample containing only the wild-type sequence and a sample containing only the wild-type mutant sequence can be more clearly determined by using the first probe together with an excess of blank oligo in the absence of a competing second probe.

[0068] According to yet another embodiment of the present invention, there is provided a method for detecting SNPs using fluorescently labeled oligonucleotide probes in a LAMP reaction, wherein no blank oligo is used and a first probe is specific for a WT nucleic acid sequence having a single point mutation opposite a nucleotide at or near the 3' end of the probe.

[0069] The fluorescently labeled oligonucleotide probe is an oligonucleotide probe that contains a fluorescent dye label attached to an internal cytosine base and does not have a terminator at the 3' end. The first probe is complementary to the WT target sequence.

[0070] The reaction may further include an intercalator fluorescent dye or a universal fluorescent probe, the fluorescence of which is distinguishable from that of the first probe, and which can provide a detectable fluorescent control signal when both the WT and mutant target sequences are present in the sample.

[0071] The target nucleic acid sequence in a sample is amplified using a LAMP reaction, and the amplified nucleic acid is then placed in a reaction vessel containing a first probe. The amplified nucleic acid sequence is then probed using one or more fluorescent signals to detect the presence of the amplified wild-type sequence. In the presence of an intercalator dye or a universal probe, the presence of either the wild-type sequence or the SNP sequence can be identified.

[0072] This method is simpler, easier and cheaper to perform because it does not require competing probes or blank oligos.

[0073] In some embodiments, the LAMP reaction and detection of the amplified nucleic acid sequence are performed in the same vessel.

[0074] In some embodiments, the method of the present invention does not include a step of providing an intercalator dye or a second probe (selected from a probe complementary to a mutant sequence of a wild-type target sequence, or a universal probe capable of detecting both the wild-type target sequence and the mutant target sequence).

[0075] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art related to the methods and compositions described. The following terms and phrases, as used herein, have the following meanings unless defined otherwise:

[0076] The terms "a," "an," and "the" include plural references unless the context clearly indicates otherwise.

[0077] The term "nucleic acid" refers to a nucleotide polymer, unless otherwise specified. Nucleic acids include RNA, DNA, or chimeric DNA-RNA polymers or oligonucleotides, and analogs thereof.

[0078] As used herein, the term "nucleotide" refers to a nucleic acid subunit consisting of a phosphate group, a five-carbon sugar, and a nitrogenous base. In RNA, the five-carbon sugar is ribose. In DNA, the five-carbon sugar is 2'-deoxyribose.

[0079] The term "target sequence" as used herein refers to the specific nucleotide sequence of a target nucleic acid to be detected. The "target sequence" includes a complex formation sequence to which an oligonucleotide forms a complex during the detection process. The target sequence may also be part of a longer nucleic acid sequence.

[0080] The terms "oligomer," "oligo," and "oligonucleotide," which are interchangeable, generally refer to nucleic acids having fewer than 1,000 nucleotide residues, including nucleic acids of about 5, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, and / or 60 nucleotide residues, as well as nucleic acids ranging from about 200 or 500 to about 900 residues.

[0081] The term "probe" refers to a nucleic acid oligonucleotide that can specifically hybridize to a target sequence within a nucleic acid or amplified nucleic acid under conditions that promote hybridization, thereby allowing detection of the target sequence or amplified nucleic acid.

[0082] The term "blank oligo" refers to a nucleic acid oligonucleotide that is capable of specifically hybridizing to a target sequence within a nucleic acid or amplified nucleic acid under conditions that promote hybridization, but is not capable of detecting the target sequence or amplified nucleic acid.

[0083] The terms "label," "fluorescent label," "fluorochrome," and "fluorochrome label," which are interchangeable, refer to a moiety or compound that is detected or that provides a detectable signal.

[0084] The term "amplification" refers to any known procedure for obtaining multiple copies of a target nucleic acid sequence or its complement or fragments thereof, which may be referred to as amplicons or amplification products.

[0085] The term "amplicon," used interchangeably with "amplification product," refers to a nucleic acid molecule produced during an amplification procedure that has complementarity or homology to a sequence contained within a target sequence. These terms can be used to refer to a single-stranded amplification product, a double-stranded amplification product, or one strand of a double-stranded amplification product.

[0086] The interchangeable terms "single nucleotide polymorphism," "SNP," and "point mutation" refer to a substitution of a nucleotide at a single position in a nucleic acid sequence. As used herein, the terms can refer to one or more single nucleotide polymorphisms, and / or two-point or three-point polymorphisms.

[0087] As used herein, the term "wild-type" or "WT" refers to a starting nucleic acid sequence. This term is not limited to naturally occurring sequences, but can be meant to include any starting nucleic acid sequence from any source, such as an animal, plant, microorganism, fungus, virus, and / or artificial starting strain.

[0088] As used herein, the term "probing" means detecting a nucleic acid sequence using a probe.

[0089] Furthermore, in the accompanying drawings, it should be understood that one cycle corresponds to one minute. The term "Rn" corresponds to the normalized reporter value. The term "ΔRn" corresponds to the Rn signal value minus the baseline Rn signal generated by the instrument.

[0090] Fluorescent probes The probes used in the methods and kits of the present invention comprise an oligonucleotide probe sequence complementary to a region of a target nucleic acid sequence, which has only one fluorescent dye ligand attached to an internal cytosine base, and which does not have a terminator at its 3' end.

[0091] In some embodiments, the probe sequence is a DNA sequence. In some embodiments, the target nucleic acid sequence is a DNA sequence. An increase in fluorescence of the probe indicates the presence of the target nucleic acid in the sample.

[0092] The cytosine base is preferably located substantially centrally along the length of the oligonucleotide. "Centrally located" means located between the third nucleotide from the 3' end and the 5' end. Internally labeling the probe at the cytosine base offers special advantages. Since the probe is elongated and incorporated into a nucleic acid product, e.g., a DNA product, during isothermal amplification such as LAMP, melting curve analysis of the product is possible. In the probe, a fluorescent dye binds to an internal cytosine, which is complementary to a guanine in the antisense strand. Because guanine affects the excitation state of many fluorescent dyes, unique melting curve characteristics are formed, making it possible to distinguish between specific and nonspecific products generated under isothermal conditions.

[0093] The use of a fluorescent dye ligand located at an internal cytosine base on the probe sequence is particularly advantageous because the probe sequence is excited upon base pairing with a guanine in the target sequence, eliminating the need for a complex two-step reaction setup involving a fluorescent dye-conjugated sequence and a complementary quencher-conjugated sequence, which requires laborious design protocols and optimization, such as designing separate complementary regions for the fluorescent dye-conjugated sequence and the quencher-conjugated sequence. In the present disclosure, the fluorescent dye is located on a probe that is incorporated into an exponentially growing amplicon, resulting in increased fluorescence as the amplicon grows.

[0094] The oligonucleotide probe does not contain a ddNTP at the 3' end, which allows the labeled oligonucleotide to be incorporated into the amplicon. Thus, the 3' end of the probe is not "blocked."

[0095] The fluorescent dyes may include any one or more selected from FAM, JOE, TET, HEX, TAMRA, ROX, ALEXA, and ATTO, or any other suitable fluorescent dyes.

[0096] The probe may comprise the following sequence: 5'Xn C* Xm 3' wherein n is greater than 1, m is greater than 3, X is a nucleotide base, and * is a fluorescent dye. Preferably, the nucleotide base may be selected from A, T, C, and G. Preferably, n is greater than 1 and less than or equal to 20, more preferably greater than 1 and less than or equal to 10. Preferably, m is greater than 3 and less than or equal to 20, more preferably greater than 3 and less than or equal to 10. It is contemplated that all combinations of probe lengths covered by the number of nucleotides that n or m can take within the above ranges are disclosed. For example, n can be greater than 1 and less than 20, greater than 2 and less than 19, greater than 3 and less than 18, greater than 4 and less than 17, greater than 5 and less than 16, greater than 6 and less than 15, greater than 7 and less than 14, greater than 8 and less than 13, greater than 9 and less than 12, greater than 10 and less than 11, or any combination thereof, and n can also be linked with m, where m is greater than 3 and less than 20, greater than 4 and less than 19, greater than 5 and less than 18, greater than 6 and less than 17, greater than 7 and less than 16, greater than 8 and less than 15, greater than 9 and less than 14, greater than 10 and less than 13, greater than 11 and less than 12, or any combination thereof.

[0097] Fluorescence increases when the oligonucleotide probe is incorporated into the target nucleic acid sequence, resulting in a conformational change in the amplicon-probe complex and a change in the excitation state of the fluorescent dye.

[0098] The cytosine bound to the fluorescent dye ligand is not located at the 5'-end or 3'-end or adjacent thereto. More preferably, the cytosine bound to the fluorescent dye ligand is not located within 3 bases from the 5'-end or 3'-end, respectively. The cytosine bound to the fluorescent dye is preferably located at least 3 bases away from the 3'-end. It is particularly preferred that the cytosine bound to the fluorescent dye is located at the central base of the probe.

[0099] target nucleic acid The target nucleic acid may be a sequence obtained from a microorganism, fungus, yeast, virus, human, animal, or plant, or any part or variant thereof. It is known that the target nucleic acid used in LAMP allows the synthesis of LAMP primers and appropriate specific probes. Therefore, the presence or absence of the microorganism, fungus, yeast, virus, human, animal, or plant sequence in a sample can be determined.

[0100] An increase in fluorescence indicates the presence of the target nucleic acid in the sample.

[0101] buffer Reactions can be performed using buffer systems such as 0.1 M Tris pH 7-9 (e.g., RB buffer or RB Tris buffer); 0.25 M CHES / CAPSO (95 / 5) pH 7-9; and 0.01 M Tris pH 7-9 (MELT) containing 0.1% Tween 20. Other similar buffers, or TE buffer with a pH of about 8, can also be used. [Example]

[0102] Example 1 method Detection of the wild-type (WT) sequence and the mutant (SNP) sequence was performed using two fluorescent probes in one reaction tube as follows: the first probe was complementary to the WT sequence, and the second probe was directed against the mutant sequence containing the SNP (SNP end sequence). The probes were labeled with different fluorescent dyes: the WT probe was labeled with TAMRA (WT-TAMRA), and the second probe was labeled with Cy5 (SNP end-Cy5). The probes were designed based on one of the LAMP loop primer sequences (LF or LB), with the point mutation located at the 3' end of one probe. The reaction was performed in standard RB (0.1 M Tris buffer, pH 8) buffer.

[0103] Assay preparation Experiments were performed using an artificial DNA sequence (gBlock™; WT) and a pre-validated IC (internal control) LAMP primer set (DNA sequence shown below). The artificial DNA sequence (gBlock™) with a single point mutation (A → C) located at the 3' end of the LB primer was ordered from Integrated DNA Technologies™ (IDT). The IC primer mix was prepared without loop primers (Table 1). The assay was prepared using a standard LAMP duplex pellet containing 16 units of BST DNA polymerase per reaction, dNTPs, and buffer.

[0104] Assay procedure The reaction master mix was prepared by reconstituting the 10x LAMP duplex pellet with 20 μL of 5x buffer (0.5 M Tris, pH 8), 38 μL of primer-probe mix, and 32 μL of H2O.

[0105] Each reaction contained 9 μL of master mix and 1 μL of either WT or SNP-end DNA (1 pg / μL). For no-template control (NTC) reactions, 1 μL of molecular biology-grade water was added to the reaction mix. WT and SNP-end DNA samples were run in duplicate in separate reactions or simultaneously in a single tube at a constant temperature of 63°C for 60 minutes using an ABI 7500 instrument.

[0106] [Table 1]

[0107] [Table 2]

[0108] The LAMP master mix used in the assay was as follows: 1 duplicate pellet (enough for 10 reactions) 38 μL primer + probe 20 μL 5x RB buffer (0.5 M Tris, pH 8) 32μL H2O.

[0109] result Simultaneous use of the WT-TAMRA and SNP-Cy5 probes in a single reaction allowed for discrimination between WT and SNP sequences that differ by a single nucleotide. WT and SNP end sequences could be discriminated using the corresponding WT or SNP end probes even when run in the same vessel (multiplex).

[0110] Figure 1 a shows amplification plots showing the change in fluorescence in the Cy5 channel for each LAMP reaction containing DNA samples that were either the SNP end sequence complementary to the SNP end probe (SNP end), a WT sample complementary to the WT probe (which differs by one nucleotide from the SNP end sample), a sample containing both the WT and SNP end sequences, or an NTC reaction.

[0111] As shown in Figure 1a, when DNA containing the SNP end sequence was present in the sample, a significant increase in fluorescence was observed during the LAMP reaction. On the other hand, when only the WT sequence was present, no significant increase in fluorescence was observed. Thus, the DNA sequence containing the SNP could be distinguished from the WT DNA sequence.

[0112] Figure 1 b shows the change in fluorescence in the TAMRA channel in each LAMP reaction containing DNA samples that were either the WT sequence complementary to the WT probe (WT), the SNP end sequence complementary to the SNP probe (which differs by one nucleotide from the WT sequence), a sample containing both the WT and SNP end sequences, or an NTC reaction.

[0113] As shown in Figure 1b, when a DNA sample containing the WT sequence was present in the sample, a significant increase in fluorescence occurred during the LAMP reaction. On the other hand, when only the SNP end sequence was present, no significant increase in fluorescence was observed. Thus, the SNP-containing DNA sequence could be distinguished from the WT DNA sequence. Table 3 shows the amplification time, or CT value (cycle threshold), for each experiment, defined as the number of cycles required for the fluorescent signal to exceed a threshold (i.e., exceed background levels).

[0114] [Table 3]

[0115] array: C -Position of fluorescent dye A -3' end SEQ ID NO: 4: WT sequence: AGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGAT TGTACGCTATTCAGGGATTGA CTGATACCGGAAGACATCTCAAATGAAGTGGTTCTATGCGACAGAGAC SEQ ID NO: 5: WT probe label: 5' TGTACGCTATT / [Synthetic construct] / AGGGATTG A 3’ SEQ ID NO: 44: WT probe labeled with TAMRA: 5' TGTACGCTATT / i6-TAMN-dC / AGGGATTG A 3’ SEQ ID NO: 6: SNP end (end A→C) sequence: AGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGAT TGTACGCTATTCAGGGATTGC CTGATACCGGAAGACATCTCAAATGAAGTGGTTCTATGCGACAGAGAC SEQ ID NO: 7: SNP end (A→C) probe label: TGTACGCTATT / [Synthetic construct] / CAGGGATTG C SEQ ID NO: 45: Cy5 labeled SNP end (A→C) probe: TGTACGCTATT / iCy5 / CAGGGATTG C

[0116] Wild-type IC LAMP primers: SEQ ID NO: 8: F3 GAGACCACTGACCGATCTA SEQ ID NO: 9: B3 GAAGTGGTCTATGCGACAG SEQ ID NO: 10: Loop F CGGAGAGATAACTACGGTGC SEQ ID NO: 11: Loop B TGTACGCTATTCAGGGATTGAC SEQ ID NO: 12: FIP GACAGAGGGGCTGTAAGCGGACCATCTGTGTGGTACTG SEQ ID NO: 13: BIP CGCTGACGTCTGTAGTCTAGCTGAGATGTCTTCCGGTATCA

[0117] Example 2 method Using the first fluorescent probe and a blank oligo, the method for distinguishing between the WT sequence and the SNP sequence in one reaction tube was carried out as follows.

[0118] The probes used were the same as those described in Example 1. Three types of experiments (Experiments 2a, 2b, and 2c) were performed. Each experiment used a fluorescent dye-labeled probe (WT-TAMRA) complementary to the WT DNA sequence and an intercalator dye (SybrGreen) that detects both the WT and SNP sequences. The WT-TAMRA probe emitted a fluorescent signal only when the WT sequence was present in the sample, whereas the intercalator dye (SybrGreen) served as a control to detect both the WT and SNP sequences. The WT probe was designed based on the sequence of one of the loops (LF or LB), with point mutations located opposite the following positions: a) 3' end of probe (Experiment 2a) - SNP end (A → C) probe b) The second base from the 3' end of the probe (Experiment 2b) -BO S1 T probe (G → T) c) Two mutations: one at the 3' end of the probe and one at the second base from the 3' end of the probe (Experiment 2c) -BO S1 SNP2 C blank oligo.

[0119] The reaction included a DNA blank oligo, which had the same sequence as the fluorescent probe but was not labeled with a fluorescent dye and contained one or more SNP mutations. During the LAMP reaction, the blank oligo competed with the fluorescent probe for binding sites on the amplified nucleic acid, thereby increasing the specificity of detection.

[0120] Assay preparation: The LAMP primer mix was the same as that described in Example 1, prepared as described in Tables 1 and 2, and diluted 1:10. The composition of the LAMP master mix was as follows: 1 duplicate pellet (enough for 10 reactions) 20 μL 5xRB tris buffer 12.6 μL WT-TAMRA probe (1 μM) 12.6 μL blank oligo (1 μM) · SNP end (A→C) blank oligo; BO S1 T(G→T) blank oligo; or ·BO S1 SNP2 C blank oligo; · 3.56 μL IC primer mix (1:10); · 1 μL SybrGreen (1:200); 40.24μL H2O.

[0121] Assay Procedure: Test samples for each experiment were prepared by adding 1 μL of 1 pg / μL template DNA (WT, SNP end, S1 T, or SNP2 C) to 9 μL of LAMP master mix. Reactions were run in triplicate at 63°C for 60 minutes using an ABI7500 instrument. TAMRA and SybrGreen signals were detected in single-tube reactions.

[0122] result Control - no blank oligo Figures 2a–2c show amplification plots for a LAMP assay containing a WT fluorescent probe (WT-TAMRA), SybrGreen intercalator dye, and a WT sample (Figure 2a), or an NTC (no template control) reaction (Figure 2b). Neither reaction contained blank oligo or mutant DNA. Figures 2a–2c show that in the presence of a WT DNA sample, both the WT probe and SybrGreen increased in fluorescence signal as the amplification reaction progressed, whereas no signal increase was observed in the absence of a sample. Figure 2a shows the output of the SybrGreen and TAMRA channels for a positive control sample (WT DNA) on the same graph, while Figure 2c shows the output of only the TAMRA channel for the positive control and NTC.

[0123] [Table 4]

[0124] Experiment 2a-SNP end (A→C) blank oligo Figures 3a-3d show LAMP experiments performed according to the method of the present invention in the presence of the fluorescent WT probe, intercalator dye, and SNP-end blank oligo (with a SNP at the 3' end) described above. As shown in Figure 3a, in the presence of a sample containing the WT sequence, both the probe and intercalator dye showed an increase in signal as the LAMP reaction progressed. This is because both fluorescent components were able to bind to the amplified DNA.

[0125] However, as shown in Figure 3b, in the presence of a sample containing only the SNP end sequence (which differs from the WT sequence by one nucleotide), only the intercalator dye showed a significant increase in signal. Thus, by combining the probe and blank oligo, we were able to distinguish and detect the WT sequence from the SNP-containing sequence. Figure 3c shows a no-template control (NTC) experiment, which demonstrates that in the absence of sample, there is no significant increase in fluorescence. Figure 3d shows a comparison of the output signal of the TAMRA channel in the presence of the WT sequence and the SNP-containing sequence.

[0126] [Table 5]

[0127] Experiment 2b-S1 T(G→T) blank oligo Figures 4a-4d show LAMP experiments performed according to the method of the present invention in the presence of the fluorescent WT probe described above, an intercalator dye, and an S1 T (G→T) blank oligo (containing a SNP at the penultimate nucleotide of the 3' end). As shown in Figure 4a, when the WT sequence was present in the sample, both the probe and the intercalator dye showed an increase in signal as the LAMP reaction progressed. This is because both fluorescent components were able to bind to the amplified DNA.

[0128] However, as shown in Figure 4b, in the presence of a sample containing only the S1 T (G → T) sequence (which differs from the WT sequence by one nucleotide), only the intercalator dye showed a significant increase in signal. Thus, by combining the probe and blank oligo, we were able to distinguish and detect the WT sequence and the SNP-containing sequence, regardless of whether the SNP was located at the 3'-terminal nucleotide or the penultimate nucleotide. Figure 4c shows a no-template control (NTC) experiment, which demonstrates that in the absence of sample, there is no significant increase in fluorescence. Figure 4d shows a comparison of the output signal of the TAMRA channel in the presence of the WT sequence and the SNP-containing sequence.

[0129] [Table 6]

[0130] Experiment 2c-S1 SNP2 C Blank Oligo Figures 5a-5d show LAMP experiments performed according to the method of the present invention in the presence of the fluorescent WT probe described above, an intercalator dye, and the S1 SNP2 blank oligo (containing two point mutations at the first and second nucleotides from the 3' end). As shown in Figure 5a, when the WT sequence was present in the sample, both the probe and the intercalator dye showed an increase in signal as the LAMP reaction progressed. This is because both fluorescent components were able to bind to the amplified DNA.

[0131] However, as shown in Figure 5b, in the presence of a sample containing only the S1 SNP2 C sequence (which differs from the WT sequence by two consecutive nucleotides), only the intercalator dye showed a significant increase in signal. Thus, by combining the probe and blank oligo, we were able to distinguish and detect the WT sequence from the SNP-containing sequence, regardless of whether the mutation involved one or two nucleotides in the sequence. Figure 5c shows a no-template control (NTC) experiment, which demonstrates that in the absence of sample, there is no significant increase in fluorescence. Figure 5d shows a comparison of the output signal of the TAMRA channel in the presence of the WT sequence and the SNP-containing sequence.

[0132] [Table 7]

[0133] Control - no blank oligo Example 2d Experiments 2a–2c were repeated using artificial DNA sequences (SNP end DNA, S1 T DNA, and S1 SNP2 C DNA) in the absence of blank oligos (Figures 6a–6c). These experiments revealed that omitting blank oligos from the reactions adversely affected reaction specificity. For example, Figures 6a–6c show that the SNP sequence could be detected by the fluorescent WT probe in the absence of blank oligos. This contrasts with the results obtained in Experiments 2a–2c, where blank oligos were part of the assay, and the increased signal from the fluorescent WT probe was observed only in the presence of WT DNA, but not in the presence of SNP-containing mutant DNA. These results demonstrate that incorporating one or more blank oligos into the reaction enables the detection of specific point mutations using fluorescent probe technology.

[0134] array: C -Position of fluorescent dye A -SNP mutations at or near the 3' end SEQ ID NO: 14: WT sequence: AGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGAT TGTACGCTATTCAGGGATTGA CTGATACCGGAAGACATCTCAAATGAAGTGGTTCTATGCGACAGAGAC SEQ ID NO: 15: WT probe: TGTACGCTATTCAGGGATTGA TGTACGCTATT / i6-TAMN-dC / AGGGATTG A

[0135] Experiment 1 SEQ ID NO: 16: SNP end (A→C) sequence: AGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGAT TGTACGCTATTCAGGGATTGC CTGATACCGGAAGACATCTCAAATGAAGTGGTTCTATGCGACAGAGAC SEQ ID NO: 17: SNP end (A→C) blank oligo: TGTACGCTATTCAGGGATTGC

[0136] Experiment 2 SEQ ID NO: 18: S1 T (control) AGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGAT TGTACGCTATTCAGGGATTTA CTGATACCGGAAGACATCTCAAATGAAGTGGTTCTATGCGACAGAGAC SEQ ID NO: 19: BO S1 T (G→T) blank oligo: TGTACGCTATTCAGGGATTTA

[0137] Experiment 3 SEQ ID NO: 20: S1 SNP2 C AGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGAT TGTACGCTATTCAGGGATTTC CTGATACCGGAAGACATCTCAAATGAAGTGGTTCTATGCGACAGAGAC SEQ ID NO: 21: BO S1 SNP2 C blank oligo TGTACGCTATTCAGGGATTTC

[0138] Example 3 method The method for distinguishing between WT and SNP sequences in a single reaction tube using a fluorescent probe and a blank oligo was carried out as follows (here, the fluorescent probe and blank oligo were designed so that the SNP was located in the center of the sequence).

[0139] The LAMP master mix and reaction conditions were the same as those described in Example 2. Experiments were performed using two sets of DNA, samples, probes containing SNPs in the center of the probe sequence, and blank oligos containing SNPs in the center of the blank oligo sequence. The SNP internal A → T set and the SNP internal C → T set were used in experiments using RB (Tris) buffer (Experiments 3a and 3b) and CHES CAPSO buffer (Experiments 3c and 3d). The difference between these two sets was that the SNP mutation in the SNP internal C → T set was located at the nucleotide complementary to the cytosine residue labeled with TAMRA fluorescent dye on the fluorescent probe, whereas the SNP in the SNP internal A → T set was located at a different position.

[0140] Assay preparation and procedure The LAMP primer mix and LAMP master mix were prepared and the assay was performed as described above for Example 2.

[0141] result Experiment 3a RB(tris) buffer (SNP internal C→T) Figure 7a shows the amplification plots for the LAMP reaction using the WT fluorescent probe, the SNP internal C→T blank oligo, the SybrGreen intercalator dye, and the WT DNA sample. Both the probe and the dye showed a significant increase in signal as the reaction progressed. Figure 7b shows the corresponding plots for the SNP internal C→T DNA sample. Although the signal from the WT probe was weaker than that from the WT sample, both the WT probe and the intercalator dye showed a significant increase in signal in Figure 7b. This suggests that there was a significant level of binding between the WT probe and the binding site during amplification of the SNP internal C→T DNA sample in this case. Figure 7c shows the NTC experiment, which, like the previous experiment, showed no significant increase in signal for either fluorescent dye. Figure 7d shows a comparison of the output signal of the TAMRA channel in the presence of the WT sequence and the SNP-containing sequence.

[0142] [Table 8]

[0143] Experiment 3b RB(tris) buffer (SNP internal A→T) Figure 8a shows the amplification plots for the LAMP reaction using the WT fluorescent probe, the SNP internal A→T blank oligo, the SybrGreen intercalator dye, and the WT DNA sample. Both the probe and the dye showed a significant increase in signal as the reaction progressed. Figure 8b shows the corresponding plots for the SNP internal A→T DNA sample. Although the signal from the WT probe was weaker than that from the WT sample, both the WT probe and the intercalator dye showed a significant increase in signal in Figure 8b. This suggests that there was a significant level of binding between the WT probe and the binding site during amplification of the SNP internal A→T DNA sample in this case. Figure 8c shows an NTC experiment, which, like the previous experiment, showed no significant increase in signal for either fluorescent dye. Figure 8d shows a comparison of the output signal of the TAMRA channel in the presence of the WT sequence and the SNP-containing sequence.

[0144] [Table 9]

[0145] Experiment 3c - CHES CAPSO buffer (SNP internal C→T) When the SNP is located in the center of the blank oligo, the specificity of SNP detection decreases in the RB(tris) buffer environment (see Experiments 3a and 3b), but we unexpectedly found that this specificity can be improved by changing the buffer conditions.

[0146] Specifically, experiments using the SNP internal C→T and A→T samples and blank oligo sets were performed under the same conditions as in Experiment 3a in the presence of CHES CAPSO buffer, which has previously been shown to improve assay specificity.

[0147] Figures 9a-9d show LAMP experiments performed according to the method of the present invention in the presence of a fluorescent WT probe, an intercalator dye, and an SNP-internal C→T blank oligo. As shown in Figure 9a, when the WT sequence was present in the sample, both the probe and the intercalator dye showed an increase in fluorescence signal as the LAMP reaction progressed. This is because both fluorescent components were able to bind to the amplified DNA. However, as shown in Figure 9b, when a sample containing only an SNP-internal C→T (which differs from the WT sequence by one nucleotide) was present, only the intercalator dye showed a significant increase in signal. Thus, by combining a probe with a single point mutation in the middle of the sequence with a blank oligo, we were able to distinguish and detect the WT sequence and the SNP-containing sequence with high specificity in the CHES CAPSO buffer environment. Figure 9c shows an NTC control experiment, which showed no significant increase in fluorescence. Figure 9d shows a comparison of the output signal of the TAMRA channel in the presence of the WT sequence or the SNP-containing sequence.

[0148] [Table 10]

[0149] Experiment 3d-CHES CAPSO buffer (SNP internal A→T) Experiment 3b was repeated using CHES CAPSO instead of RB (Tris) buffer, the SNP internal A→T sample, the WT-TAMRA probe, and the SNP internal A→T blank oligo. Figures 10a-10d show plots of the fluorescent signals obtained in LAMP amplification performed according to the method of the present invention in the presence of the fluorescent WT probe, the intercalator dye, and the SNP internal A→T blank oligo. As shown in Figure 10a, in the presence of the WT sample sequence, the fluorescent signals of both the probe and the intercalator dye increased as the LAMP reaction progressed, suggesting that both fluorescent components were able to bind to the amplified DNA.

[0150] When amplification was performed on a sample containing the internal SNP A → T mutation, only the intercalator dye showed a significant increase in signal, as shown in Figure 10b. Thus, when the SNP was located in the center of the blank oligo, changing the buffer from RB(tris) to CHES CAPSO improved assay specificity. Figure 7c shows the control NTC reaction, which did not show any signal. Figure 10d shows a comparison of the output signal of the TAMRA channel in the presence of the WT sequence or the SNP-containing sequence.

[0151] The amplification time using CHES CAPSO buffer was longer than that using RB buffer. However, the above experiments demonstrated that the CHES CAPSO buffer environment enabled the detection of point mutations located in the center of the blank oligo sequence with high specificity. Therefore, this approach may provide a viable means of detecting SNPs located in the center of the blank oligo sequence, especially when a large amount of DNA is present in the sample (e.g., confirmation tests performed on cultures).

[0152] array: C -Position of fluorescent dye A -SNP mutations at or near the 3' end SEQ ID NO: 22: WT sample: AGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGAT TGTACGCTATTCAGGGATTGA CTGATACCGGAAGACATCTCAAATGAAGTGGTTCTATGCGACAGAGAC SEQ ID NO: 23: WT probe: TGTACGCTATTCAGGGATTG A TGTACGCTATT / i6-TAMN-dC / AGGGATTGA SEQ ID NO: 24: SNP internal C→T sample: AGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGAT TGTACGCTATTTAGGGATTGA CTGATACCGGAAGACATCTCAAATGAAGTGGTTCTATGCGACAGAGAC SEQ ID NO: 25: SNP internal C→T blank oligo: TGTACGCTATTTAGGGATTGA SEQ ID NO: 26: IC SNP internal A→T sample: AGCCCACGGAGACCACTGACCGATCTACCTGAACGGCGACCATCTGTGTGGTACTGGGGCGGAGAGATAACTACGGTGCCGCTTACAGCCCCTCTGTCGTCGCTGACGTCTGTAGTCTAGCCTCATTATGAT TGTACGCTTTTCAGGGATTGA CTGATACCGGAAGACATCTCAAATGAAGTGGTTCTATGCGACAGAGAC SEQ ID NO: 27: SNP internal A to T blank oligo: TGTACGCTTTTCAGGGATTGA

[0153] Example 4 Examples 1 to 3, which used probes and artificial DNA sequences with point mutations, demonstrate that SNPs can be detected by LAMP by using a sequence with a point mutation and competing probes and / or blank oligos (one WT probe together with one mutant SNP probe or one mutant SNP blank oligo) that cover the SNP located at the 3' end or central part of each probe.

[0154] However, if the probe itself emits a sufficiently specific signal, it is possible to detect the SNP without the use of competing probes or blank oligos.

[0155] method This method was used to detect the A23063T (N501Y) mutation in the B1.1.7 SARS-CoV-2 mutant. The A23063T (N501Y) mutation occurs in the S gene of the B1.1.7 variant of SARS-CoV-2 virus, but not in the wild-type virus. The assay described here used two DNA primer sets and probes: an S gene primer set covering the region harboring the A23063T (N501Y) mutation, and an RdRp gene that does not harbor a mutation in the B1.1.7 variant. The assay also included two probes labeled with two different fluorescent dyes: a WT-FAM probe compatible with the S gene primer set and an RdRp-TAMRA probe compatible with the RdRp primer set. The WT-FAM probe was based on the wild-type SARS-CoV-2 sequence (without mutations), but the 3' end of one loop primer was designed to locate the A23063T (N501Y) site in the B1.1.7 SARS-CoV-2 mutant, whereas the RdRp-TAMRA probe was used as a universal probe that emitted fluorescent signals in both the wild-type and B1.1.7 mutants. Tests were performed using 10x RT pellets containing BST polymerase and RTX reverse transcriptase, and 5x MELT buffer (0.01M Tris buffer, pH 8, containing 0.1M Tween 20). The WT-FAM probe (for the S gene) and the RdRp-TAMRA probe were tested together at the same concentration: 2.4 μL of 10 μM probe per 10x RT pellet (WT RNA (Figure 11a) or B1.1.7 RNA obtained from two different sources—ATCC (Figure 11b) or VIRCELL (Figure 11c)—yielding 1,000 copies per reaction) or 2.4 μL of molecular biology-grade water—NTC (Figure 11d). No blank oligo was used in the preparation of this assay.

[0156] result The generic RdRp-TAMRA control probe emitted a fluorescent signal in the presence of any of the RNA samples tested (Figures 11a, b, and c), but not in the absence of the no-template control (Figure 11d), whereas the WT-FAM probe emitted a fluorescent signal only in the presence of WT SARS-CoV-2 RNA (Figure 11a), but not in the presence of the B 1.1.7 mutant RNA sample (Figures 11b and c).

[0157] These results demonstrate that SNPs can be detected even in the absence of blank oligos or competing probes, provided the first probe emits a sufficiently specific signal.

[0158] array: C -Position of fluorescent dye A-3' end or nearby SNP mutation site SEQ ID NO: 28: WT S gene sequence: 21541 CTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAG 21601 TCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCTGCATACACTAATTCTTTAC 21661 ACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGA 21721 CTTGTTCTTACCTTTCTTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGAC 21781 CAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGC 21841 TTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAA 21901 GACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATT 21961 TCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAACAACACAAGTTGGAT 22021 GGAAAGTGAGTTCAGAGTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCA 22081 GCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGT 22141 GTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGT 22201 GCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTAT 22261 TAACATCACTAGGTTTCAAACTTTACTTGCTTTTACATAGAAGTTATTTGACTCCTGGTGA 22321 TTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAG 22381 GACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACT 22441 TGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTA 22501 TCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTAC 22561 AAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTG 22621 GAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATC 22681 ATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTAC 22741 TAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGG 22801 GCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGT 22861 TATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTA 22921 TAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTA 22981 TCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACA 23041 ATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACT 23101 TTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTT 23161 GGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTAC 23221 TGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTAC 23281 TGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGG 23341 TGGTGTCAGTGTTATAACACAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCA 23401 GGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTG 23461 GCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGC 23521 TGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAG 23581 TTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCAT 23641 TGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGC 23701 CATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAA 23761 GACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTT 23821 GTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGA 23881 ACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACC 23941 AATTAAAGATTTTGGTGGTTTTAATTTTCACAAATTACCAGATCCATCAAAACCAAG 24001 CAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAGTGACACTTGCAGATGCTGGCTT 24061 CATCAAACAATATGGTGATTGCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACA 24121 AAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATA 24181 CACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGC 24241 ATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACA 24301 GAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAA 24361 AATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAA 24421 CCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAAT 24481 TTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAAT 24541 TGATAGGTTGATCACAGGCAGACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAAT 24601 TAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCTACTAAAATGTCAGAGTGTGT 24661 ACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCC 24721 TCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAA 24781 GAACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGG 24841 TGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACA 24901 AATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGT 24961 CAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGA 25021 TAAATATTTTAAGAATCATACATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAA 25081 TGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTT 25141 AAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCC 25201 ATGGTACATTTGGCTAGGTTTTATAGCTGCTTGATTGCCATAGTAATGGTGACAATTAT 25261 GCTTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTG 25321 CTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACWT-

[0159] FAM probe design: 5' AATGGTGTTGGTTACCAACCATAC 3 reverse complement (SEQ ID NO: 29) 5' GTATGGTTGGTAACCAACACCATT 3' (SEQ ID NO: 30) SEQ ID NO: 31: WT-FAM probe: 5' GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3' SEQ ID NO: 32: RdRp-TAMRA probe: 5’ TGTTTTTAACAAAG / i6-TAMN-dC / TTGGCGT 3

[0160] Primer sequences:

[0161] [Table 11]

[0162] [Table 12]

[0163] term Item 1. A method for detecting a single nucleotide polymorphism (SNP) of a target nucleic acid sequence in a sample, the method comprising: a) providing a first oligonucleotide probe complementary to a wild-type target sequence, the first oligonucleotide probe comprising a fluorescent label attached to an internal cytosine base, the oligonucleotide probe having no terminator at its 3' end; b) amplifying a target nucleic acid sequence in the sample by loop-mediated isothermal amplification in a reaction vessel containing a first oligonucleotide probe and a second probe or an intercalator dye, providing an amplified nucleic acid, and probing the amplified nucleic acid sequence; c) detecting the presence of the target wild-type and / or mutant nucleic acid sequences; and d) identifying the presence of the target wild-type and / or mutant nucleic acid sequences based on the fluorescent label; A method comprising:

[0164] Section 2. providing an intercalator dye or providing a second probe, wherein the second probe is selected from a probe complementary to a mutated sequence of a wild-type target sequence or a universal probe capable of detecting both the wild-type target sequence and the mutated sequence of the wild-type target sequence; The second probe and / or the intercalator dye comprises an additional fluorescent label that allows it to be distinguished from the first probe; and The target nucleic acid sequence is amplified in a reaction vessel containing a second probe or intercalator dye; thing, The method of claim 1, further comprising:

[0165] Item 3. The method of any one of Items 1 and 2, wherein at least one of the probes contains one or two point mutations.

[0166] Item 4. The method includes providing a second probe, wherein the second probe is complementary to a mutant sequence of the wild-type target sequence; i) further comprising a fluorescent label attached to an internal cytosine base and having no terminator at the 3' end; and ii) at least one of the first and second probes contains one or two point mutations at or near the 3' end; 5. The method of any one of the preceding clauses.

[0167] An intercalator dye or a universal probe is prepared according to the method of Section 5. a) the method further comprises providing a blank oligo, the blank oligo having the same sequence as the first probe but lacking a fluorescent label and comprising one or more SNP mutations at or near the 3' end; or b) the method further provides a blank oligo, the blank oligo having the same sequence as the first probe but lacking a fluorescent label and containing one or more SNPs in the middle of the sequence, optionally using CHES CAPSO buffer; or c) the method does not use a blank oligo and the first probe is specific for a wild-type DNA or RNA sequence with a single point mutation opposite a nucleotide at or near the 3' end of the probe; The method according to any one of items 1 to 3.

[0168] Clause 6. The method of any one of the preceding clauses, wherein the fluorescent label and / or intercalator dye comprises one or more of TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO, and v13, or any other dye suitable for nucleic acid detection.

[0169] Section 7. a) the first probe and / or the second probe are configured to function as loop-mediated isothermal amplification primers, optionally configured to function as LF loop primers or LB loop primers; and / or b) the first probe, the second probe, and / or the target nucleic acid sequence are: i) a DNA sequence, or ii) RNA sequences That is, 5. The method of any one of the preceding clauses.

[0170] Clause 8. The method of any one of the preceding clauses, wherein the loop-mediated isothermal amplification is carried out using RB(tris) buffer.

[0171] Item 9. The first or second probe is SEQ ID NO:1: 5' GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3' (SARS-CoV-2 WT probe S gene to identify A23063T N501Y point mutation); SEQ ID NO:2: 5' AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3' (SARS-CoV-2 WT probe S gene to identify the E484K point mutation); or SEQ ID NO: 3: 5' AAAGGAAAGTAACAATTAAAACCTTT 3' (SARS-CoV-2 mutant blank oligo to identify the E484K point mutation) Item 10. The method of any one of the preceding items, comprising one or more of the sequences:

[0172] Section 10. i) during the course of loop-mediated isothermal amplification, and / or ii) without any post-amplification manipulations; Item 11. The method of any one of the preceding items, wherein the presence of a target wild-type and / or mutant nucleic acid sequence can be detected.

[0173] Clause 11. The method of any one of the preceding clauses, wherein the target nucleic acid is derived from a virus, and optionally the virus is SARS-CoV-2 or a mutant thereof.

[0174] 12. The method of any one of the preceding clauses, wherein the loop-mediated isothermal amplification uses FIP primers, BIP primers, F3 primers, and B3 primers, and optionally further uses Loop F primers and / or Loop B primers in the amplification.

[0175] Item 13. The method according to any one of the preceding items, wherein the LAMP reaction and detection of the amplified nucleic acid sequence are carried out in the same vessel.

[0176] Item 14. A kit for detecting a nucleotide polymorphism in a target nucleic acid sequence in a sample, comprising: a) a first oligonucleotide probe complementary to a wild-type target sequence, the first oligonucleotide probe comprising a fluorescent label attached to an internal cytosine base, the oligonucleotide probe sequence not having a terminator at its 3' end; and b) Loop-mediated isothermal amplification reagent buffer, enzyme, dNTPs, and loop-mediated isothermal amplification primers Including, the first probe is configured for use in one reaction vessel; kit.

[0177] Section 15. an intercalator dye or a second oligonucleotide probe, wherein the second oligonucleotide probe is selected from a probe complementary to a mutant sequence of a wild-type target sequence or a universal probe capable of detecting both the wild-type target sequence and the mutant target sequence; further including; The second oligonucleotide probe and / or the intercalator dye comprises an additional fluorescent label that allows it to be distinguished from the first probe; and The first probe, the second probe, and / or the intercalator dye are configured to be used in one reaction vessel; Item 15. The kit according to Item 14.

[0178] Item 16. The kit according to any one of Items 14 and 15, wherein at least one of the probes contains one or two point mutations.

[0179] Item 17. The kit provides a second probe, wherein the second probe is complementary to a mutant sequence of the wild-type target sequence; i) further comprising a fluorescent label attached to an internal cytosine base and having no terminator at the 3' end; and ii) at least one of the first and second probes contains one or two point mutations at or near the 3' end; Item 17. The kit according to any one of Items 15 and 16.

[0180] Item 18. The kit provides an intercalator dye or a universal probe; a) the kit further comprises a blank oligo, the blank oligo having the same sequence as the first probe but lacking a fluorescent label and containing one or more SNP mutations at or near the 3' end; or b) the kit further comprises a blank oligo, the blank oligo having the same sequence as the first probe but lacking a fluorescent label and containing one or more SNPs in the center of the sequence, and optionally, the method employing CHES CAPSO buffer; or c) the kit does not include a blank oligo, and the first probe is specific for a wild-type DNA or RNA sequence having one point mutation at a position opposite a nucleotide at or near the 3' end of the probe; Item 17. The kit according to any one of items 15 and 16.

[0181] Item 19. The kit of any one of Items 14 to 18, wherein the fluorescent label and / or intercalator dye comprises one or more of TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO, and v13, or any other dye suitable for nucleic acid detection.

[0182] Section 20. a) the first probe and / or the second probe are configured to function as loop-mediated isothermal amplification primers; and / or b) the first probe, the second probe, and / or the target nucleic acid sequence are: i) a DNA sequence, or ii) RNA sequences That is, Item 20. The kit according to any one of Items 14 to 19.

[0183] Item 21. The kit according to any one of Items 14 to 20, wherein the buffer is RB (tris) buffer.

[0184] Item 22. The first or second probe is SEQ ID NO:1: 5' GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3' (SARS-CoV-2 WT probe S gene to identify A23063T N501Y point mutation); SEQ ID NO:2: 5' AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3' (SARS-CoV-2 WT probe S gene to identify the E484K point mutation); and SEQ ID NO: 3: 5' AAAGGAAAGTAACAATTAAAACCTTT 3' (SARS-CoV-2 mutant blank oligo to identify the E484K point mutation) 22. The kit according to any one of items 14 to 21, comprising one or more of the sequences listed above.

[0185] Section 23. i) during the course of loop-mediated isothermal amplification, and / or ii) without any post-amplification manipulations; 23. The kit according to any one of Items 14 to 22, wherein the kit is configured to detect the presence of a target wild-type nucleic acid sequence and / or a mutant nucleic acid sequence.

[0186] Item 24. A kit according to any one of items 14 to 23, wherein the target nucleic acid is derived from a virus, optionally SARS-CoV-2 or a mutant thereof.

[0187] Item 25. The kit according to any one of Items 14 to 24, wherein the loop-mediated isothermal amplification uses an FIP primer, a BIP primer, an F3 primer, and a B3 primer, and optionally further uses a loop F primer and / or a loop B primer in the amplification.

Claims

1. 1. A method for detecting and / or identifying single nucleotide polymorphisms (SNPs) in a target nucleic acid sequence in a sample, the method comprising: a) providing a first oligonucleotide probe complementary to a wild-type target sequence, said first oligonucleotide probe comprising a fluorescent label attached to an internal cytosine base, said oligonucleotide probe having no terminator at its 3' end; and providing a second oligonucleotide probe containing an additional fluorescent label distinguishable from the first probe, or a blank oligo containing no fluorescent label, wherein the second oligonucleotide probe or blank oligo is complementary to a mutant sequence of the wild-type target sequence and contains one or two point mutations that distinguish the mutation; b) the first oligonucleotide probe; and i) the second oligonucleotide probe, or ii) the blank oligo and an intercalator dye or universal probe amplifying a target nucleic acid sequence in the sample by loop-mediated isothermal amplification in a reaction vessel comprising: and probing the amplified nucleic acid sequence; c) detecting the presence of said target wild-type and / or mutant nucleic acid sequences; and d) identifying the presence of said target wild-type and / or mutant nucleic acid sequences based on said fluorescent label; A method comprising:

2. the universal probe is capable of detecting both the wild-type target sequence and the mutant sequence of the wild-type target sequence; the universal probe or the intercalator dye comprises an additional fluorescent label that is distinguishable from the first probe; and the target nucleic acid sequence is amplified in the reaction vessel containing the universal probe or the intercalator dye; The method of claim 1.

3. The method further comprises providing the second probe; i) the second probe further comprises a fluorescent label attached to an internal cytosine base and does not have a terminator at the 3' end; and ii) the first and second probes contain one or two point mutations at or near the 3' end; 10. A method according to any one of the preceding claims.

4. The method provides the intercalator dye or the universal probe, a) the blank oligo contains one or more SNP mutations at or near the 3' end; or b) the blank oligo contains one or more SNP mutations in the center of the sequence, optionally using CHES CAPSO buffer; The method of any of claims 1-2.

5. 10. The method of any one of the preceding claims, wherein the fluorescent label and / or intercalator dye comprises one or more of TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO, and v13, or any other dye suitable for nucleic acid detection.

6. a) the first probe and / or the second probe or the blank oligo is configured to function as a loop-mediated isothermal amplification primer, and optionally as an LF loop primer or an LB loop primer; and / or b) the first probe, the second probe, the blank oligo, and / or the target nucleic acid sequence are i) a DNA sequence, or ii) RNA sequences That is, 10. A method according to any one of the preceding claims.

7. 10. The method of any one of the preceding claims, wherein the loop-mediated isothermal amplification is carried out using RB (tris) buffer.

8. The first or second probe is SEQ ID NO:1: 5' GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3' (SARS-CoV-2 WT probe S gene to identify A23063T N501Y point mutation); SEQ ID NO:2: 5' AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3' (SARS-CoV-2 WT probe S gene to identify the E484K point mutation); or SEQ ID NO: 3: 5' AAAGGAAAGTAACAATTAAAACCTTT 3' (SARS-CoV-2 mutant blank oligo to identify the E484K point mutation) 10. The method of any one of the preceding claims, comprising one or more of the sequences:

9. i) during the course of loop-mediated isothermal amplification, and / or ii) without any post-amplification manipulations; 10. A method according to any one of the preceding claims, which is capable of detecting the presence of said target wild-type nucleic acid sequence and / or said mutant nucleic acid sequence.

10. 10. The method of any one of the preceding claims, wherein the target nucleic acid is derived from a virus, optionally wherein the virus is SARS-CoV-2 or a mutant thereof.

11. 10. The method of any one of the preceding claims, wherein the loop-mediated isothermal amplification uses FIP primers, BIP primers, F3 primers, and B3 primers, and optionally further uses Loop F primers and / or Loop B primers in the amplification.

12. 10. The method of any one of the preceding claims, wherein the LAMP reaction and the detection of the amplified nucleic acid sequence are carried out in the same vessel.

13. 10. The method of any one of the preceding claims, wherein the blank oligo is provided at a concentration equal to or in excess of the concentration of the first oligonucleotide probe.

14. 14. The method of claim 13, wherein the blank oligo is provided at a concentration that is at least twice the concentration of the first oligonucleotide probe, and optionally, the blank oligo is provided at a concentration that is at least four times the concentration of the first oligonucleotide probe.

15. A kit for identifying a nucleotide polymorphism in a target nucleic acid sequence in a sample, the kit comprising: a) a first oligonucleotide probe complementary to a wild-type target sequence, said first oligonucleotide probe comprising a fluorescent label attached to an internal cytosine base, said oligonucleotide probe sequence not having a terminator at its 3' end; and i) a second oligonucleotide probe comprising an additional fluorescent label distinguishable from the first probe, the second oligonucleotide probe being complementary to a mutant sequence of the wild-type target sequence and comprising one or two point mutations at or near the 3' end that distinguish the mutation; or ii) a blank oligo, which is complementary to the mutant sequence of the wild-type target sequence and contains one or two point mutations that distinguish the mutation, and an intercalator dye or universal probe; and b) Loop-mediated isothermal amplification reagent buffer, enzyme, dNTPs, and loop-mediated isothermal amplification primers Including, The first probe and the second probe or the blank oligo are configured to be used in one reaction vessel. kit.

16. the universal probe is capable of detecting both the wild-type target sequence and the mutant target sequence; the universal probe or the intercalator dye comprises an additional fluorescent label that is distinguishable from the first probe; and The first probe and the universal probe or the intercalator dye are configured to be used in one reaction vessel. The kit of claim 15.

17. the second probe is provided in the kit; i) the second probe further comprises a fluorescent label attached to an internal cytosine base and does not have a terminator at the 3' end; and ii) the first probe contains one or two point mutations at or near the 3' end; The kit of claim 15.

18. the kit provides the intercalator dye or the universal probe; a) the blank oligo contains one or more SNP mutations at or near the 3' end; or b) the blank oligo contains one or more SNP mutations in the center of the sequence, optionally using CHES CAPSO buffer; 17. The kit of claim 16.

19. 19. The kit of any of claims 15 to 18, wherein the fluorescent label and / or the intercalator dye comprises one or more of TAMRA, FAM, Cy5, SYBR Green, EvaGreen, JOE, TET, HEX, ROX, ALEXA, ATTO, and v13, or any other dye suitable for nucleic acid detection.

20. a) the first probe, the blank oligo, and / or the second probe are optionally configured to function as loop-mediated isothermal amplification primers; and / or b) the first probe, the blank oligo, the second probe, and / or the target nucleic acid sequence are i) a DNA sequence, or ii) RNA sequences That is, The kit according to any one of claims 15 to 19.

21. The kit according to any one of claims 15 to 20, wherein the buffer is RB (tris) buffer.

22. The first or second probe is SEQ ID NO:1: 5' GTATGGTTGGTAACCAACA / IFAMdCN / CATT 3' (SARS-CoV-2 WT probe S gene to identify A23063T N501Y point mutation); SEQ ID NO:2: 5' AAAGGAAAGTAACAATTAAAAC / i6-TAMN-dC / TTC 3' (SARS-CoV-2 WT probe S gene to identify the E484K point mutation); and SEQ ID NO: 3: 5' AAAGGAAAGTAACAATTAAAACCTTT 3' (SARS-CoV-2 mutant blank oligo to identify the E484K point mutation) 22. The kit according to any one of claims 15 to 21, comprising one or more of the sequences:

23. i) during the course of loop-mediated isothermal amplification, and / or ii) without any post-amplification manipulations; A kit according to any one of claims 15 to 22, configured to detect the presence of the target wild-type nucleic acid sequence and / or the mutant nucleic acid sequence.

24. 24. The kit of any of claims 15 to 23, wherein the target nucleic acid is derived from a virus, optionally wherein the virus is SARS-CoV-2 or a mutant thereof.

25. The kit according to any one of claims 15 to 24, wherein the loop-mediated isothermal amplification uses FIP primers, BIP primers, F3 primers, and B3 primers, and optionally further uses Loop F primers and / or Loop B primers in the amplification.

26. 26. The kit of any of claims 15 to 25, wherein the blank oligo is provided at a concentration equal to or in excess of the concentration of the first oligonucleotide probe.

27. 27. The kit of claim 26, wherein the blank oligo is provided at a concentration that is at least twice the concentration of the first oligonucleotide probe, and optionally, the blank oligo is configured at a concentration that is at least four times the concentration of the first oligonucleotide probe.