Polynucleotide-modifying enzymes containing peptide recognition sequences
The PNME with a nuclease and display domain addresses the diffusion limitations of CRISPR platforms by enabling targeted and efficient delivery into tissues, including tumor cores, through reduced size and enhanced bioavailability.
Patent Information
- Application Number
- JP2025532062
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-08-11
- Filing Date
- 2023-08-09
- Publication Date
- 2025-08-26
AI Technical Summary
Existing CRISPR-based gene editing platforms are limited by their size due to the addition of receptor binding domains, which impede diffusion into tissues, particularly the core of tumors, necessitating improvements in bioavailability and diffusion capacity.
A polynucleotide modifying enzyme (PNME) with a functional nuclease domain and a display domain comprising a peptide recognition sequence that targets cell receptors, allowing internalization, and optionally an endosomal escape domain for enhanced delivery, reducing the overall size and improving tissue penetration.
The PNME achieves improved bioavailability and diffusion into tissues, particularly tumor cores, by minimizing platform size and enhancing specific cell targeting, thereby optimizing gene editing efficacy.
Smart Images

Figure 2025528282000094 
Figure 2025528282000095 
Figure 2025528282000096
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This disclosure claims priority to U.S. Provisional Application No. 63 / 397,145, filed August 11, 2022, and incorporated herein by reference in its entirety.
[0002] Technical Field The present disclosure relates generally to the field of nucleases and delivery platforms for nucleases, as well as methods and their uses for performing gene editing. [Background technology]
[0003] CRISPR (clustered regularly interspaced short palindromic repeats) RNA-directed DNA nucleases have been firmly established as a major gene editing methodology with potential applications in research, drug development, and therapeutics. Prior to CRISPR-programmable nucleases, less versatile programmable nucleases that relied on protein engineering (e.g., zinc finger nucleases, TALENs, and meganucleases, such as natural and engineered derivatives of I-Cre1 and others) or nucleases requiring the insertion of targeting sites (e.g., RAD52 / 51, CRE) were used to achieve double-strand breaks in DNA. However, the rapid design and programmability of CRISPR nucleases with guide RNAs creates an addressable gene editing solution that omits the experimental workflow for testing hypotheses at the genome level. Because the only engineered component required for CRISPR genome targeting is the guide RNA, which can be synthesized according to predictable rules, genomic regions can be targeted with much less unpredictable experiments. Furthermore, CRISPR nucleases active in mammalian cells offer a new avenue for programmable nuclease therapy, allowing targeting of genomic locations that are difficult to reach by other methodologies.
[0004] Recent developments in the delivery of gene editing compositions (such as compositions containing nucleases) are described in International Publication No. 2021152402. In International Publication No. 2021152402, the composition has a cell recognition domain, an endosomal escape domain, and a polynucleotide-modifying enzyme domain. The endosomal escape domain is covalently linked to the cell recognition domain. The cell-specific cell recognition domain can be used to target specific target cells, such as cancerous cells.
[0005] More specifically, the nucleases in WO2021152402 focused on the fusion of immunoglobulin domains, or nanobodies or stable scaffold immunoglobulin mimics ("Nab") of camelid origin, to CRISPR nucleases. The fusion proteins were generated by expressing CRISPR nuclease fusion proteins in which the nanobody was placed at the N- or C-terminus of the nuclease using a short peptide linker in a protein expression system (such as E. coli, mammalian, or insect). The proteins were purified and complexed with guide nucleic acids to obtain gene editing platforms. Delivery into cells was achieved by receptor-mediated transfection, where the "Nab" domain has affinity for target cell receptors.
[0006] The resulting gene editing platform has a significant size due to the addition of receptor binding domains (Nab), which increases the overall molecular weight of the resulting complex. Size can limit its ability to diffuse in biological tissues, for example, into the core of a tumor. Smaller immunoglobulins Although globulin mimetics may be able to reduce the size of the complex, this may not be sufficient to improve diffusion in tissues due to the contributions of both increased mass and larger hydrodynamic radius.
[0007] Therefore, further improvements are desirable to increase the bioavailability and diffusion capacity of gene editing platforms. Summary of the Invention
[0008] In one embodiment, a polynucleotide modifying enzyme is provided, comprising: a functional nuclease domain comprising a nuclease catalytic pocket; and a display domain comprising a peptide recognition sequence of 3 to 20 amino acids in a loop, alpha helix, or extension from the end of the alpha helix located on the outer surface of the polynucleotide modifying enzyme, wherein the peptide recognition sequence recognizes a target cell receptor of a target cell, thereby enabling internalization of the polynucleotide modifying enzyme into the target cell. The nuclease catalytic pocket is preferably a Cas nuclease catalytic pocket, a recombinase catalytic pocket, or a meganuclease catalytic pocket. The nuclease catalytic pocket can comprise or be a RuvC nuclease domain.
[0009] In some embodiments, the Cas is a Type II Cas, a functional analog thereof, a variant thereof, or a derivative thereof. The Type II Cas can be a Cas9, a functional analog thereof, a variant thereof, or a derivative thereof. In such embodiments, the nuclease catalytic pocket can comprise an HNH nuclease domain.
[0010] In some embodiments, the Cas is a Type V Cas, a functional analog thereof, a variant thereof, or a derivative thereof. The Type V Cas can be a Cas12, a functional analog thereof, a variant thereof, or a derivative thereof.
[0011] In some embodiments, the Cas is a Type VI Cas, a functional analog thereof, a variant thereof, or a derivative thereof. The Type VI Cas can be Cas13, a functional analog thereof, a variant thereof, or a derivative thereof.
[0012] In some embodiments, the Cas is Cas14, a functional analog thereof, a variant thereof, or a derivative thereof.
[0013] In some embodiments, the display domain binds to one or more epitopes on a cell surface antigen of a target cell. The peptide recognition sequence can be 3 to 18 amino acids in length.
[0014] In some embodiments, the polynucleotide modifying enzyme further comprises a second display domain comprising a second peptide recognition sequence of 3 to 20 amino acids in a second loop, a second alpha helix, or an extension from the end of the second alpha helix located on the outer surface of the polynucleotide modifying enzyme, thereby enabling the polynucleotide modifying enzyme to be bispecific, and the second display domain recognizing a second target cell receptor.
[0015] In some embodiments, the polynucleotide modifying enzyme further comprises a third display domain comprising a third peptide recognition sequence of 3 to 20 amino acids in a third loop, a third alpha helix, or an extension from the end of the third alpha helix located on the outer surface of the polynucleotide modifying enzyme, such that the polynucleotide modifying enzyme is trispecific, and the third display domain recognizes a third target cell receptor.
[0016] In some embodiments, the display domain, optionally the second display domain, and optionally the third display domain are positioned at least 25 amino acids after the N-terminus and at least 25 amino acids before the C-terminus of the polynucleotide modifying enzyme.
[0017] In some embodiments, the polynucleotide modifying enzyme has at least 80% sequence identity to SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, or 46.
[0018] In some embodiments, the display domain begins at residue 204, 534, 558, 738, 826, 945, 995, 1026, 1154, or 1207. In further embodiments, the peptide recognition sequence is a complementarity determining region (CDR).
[0019] In a further aspect, a fusion polypeptide is provided comprising a polynucleotide-modifying enzyme of the present disclosure covalently linked to an endosomal escape domain, and optionally further comprising a hapten-binding domain. The hapten-binding domain can bind to a hapten covalently attached to a peptide, protein, oligonucleotide, aptamer, or polynucleotide. The oligonucleotide may be complementary to a target gene in a target cell.
[0020] In some embodiments, the polynucleotide is a donor DNA polynucleotide comprising a 5' homology region and a 3' homology region, wherein the 5' homology region comprises a nucleotide sequence having sequence identity to a nucleotide sequence 5' of the target nucleotide sequence, and the 3' homology region comprises a nucleotide sequence having sequence identity to a nucleotide sequence 3' of the target nucleotide sequence.
[0021] In yet a further aspect, a vector is provided that includes a nucleotide sequence encoding a polynucleotide modifying enzyme of the present disclosure.
[0022] In an even further aspect, there is provided a vector comprising a nucleotide sequence encoding any one of the fusion polypeptides of the present disclosure.
[0023] In an additional aspect, a host cell comprising a vector of the present disclosure is provided.
[0024] Many further features and combinations of the present improvement will be apparent to those skilled in the art upon reading this disclosure. [Brief explanation of the drawings]
[0025] [Figure 1] Figure 1 is a ribbon diagram of the C9 CRISPR nuclease, with the arrow pointing to position Ala725. [Figure 2A] Figure 2A is a fleshed-out diagram of the C9 CRISPR nuclease, with the arrow pointing to position Ser1154. [Figure 2B] Figure 2B is a ribbon diagram of the C9 CRISPR nuclease, with the arrow pointing to position Ser1154. [Figure 3] FIG. 3 is an image of a gel showing protein expression of a polynucleotide modifying enzyme (PNME) according to the present disclosure. [Figure 4] FIG. 4 is an image of a gel showing in vitro cleavage of C9m5m, C9m6m, and C9ET. [Figure 5A] FIG. 5A is a bright field microscopy image showing C9m5m binding to and internalizing into A549 cells. [Figure 5B] FIG. 5B is a fluorescence microscopy image using a pH-sensitive dye showing the internalization of C9m5m into A549 cells. [Figure 6A] Figure 6A is a fluorescence microscope image showing live A549 cells 24 hours after the initiation of the gene editing process. [Figure 6B] Figure 6B is a fluorescence microscope image showing dead A549 cells 24 hours after the start of the gene editing process. [Figure 6C] Figure 6C is a fluorescence microscope image showing live A549 cells 72 hours after the initiation of the gene editing process. [Figure 6D] Figure 6D is a fluorescence microscope image showing dead A549 cells 72 hours after the start of the gene editing process. [Figure 6E] FIG. 6E is a fluorescence microscopy image showing live H2228 cells (control at 72 hours). [Figure 6F] FIG. 6F is a fluorescent microscopy image showing dead H2228 cells (control at 72 hours). [Figure 7] FIG. 7 is an image of a gel showing the results of a T7 endonuclease assay. [Figure 8] Figure 8 is a graph showing the results of next-generation sequencing (NGS) of three independent DNA repeats extracted from A549 cells edited by PNME (percentage of wild-type (WT) vs. indels). [Figure 9A] FIG. 9A is an image of a gel showing gel electrophoresis of fractions of C9C4 expression. [Figure 9B] Figure 9B is a graph showing a comparison of mean counts for tumor accumulation of each PNME at 48 hours as assessed by in vivo accumulation of Cy5.5-labeled nuc-nab. Where subscript A is used, these are PNMEs to which an additional modulator anti-a549 aptamer was added to create a bispecific PNME. The Y-axis is mean fluorescence per count. The X-axis indicates the different arms of the in vivo evaluation. [Figure 10] FIG. 10 is a graph showing tumor fluorescence when C9m5mA, C9m6mA, C9m5m, C9m6m, FNM7, C9mAur, or C9mAurA was localized in the tumor. [Figure 11] FIG. 11 is a graph showing the percentage difference between bispecific PNMEs (C9m5mA, C9m6mA, and C9mAurA) compared to the corresponding monospecific PNMEs (C9m5m, C9m6m, and C9mAur, respectively). [Figure 12] FIG. 12 is a graph showing serum clearance (fluorescence) over time for administered vehicle, C9mAur, C9m5m, C9m6m or FNM7 in an animal model. [Figure 13]FIG. 13 is a graph showing serum clearance (fluorescence) over time for administered C9mAurA, C9m5mA, C9m6mA or FNM7 2sg in an animal model. [Figure 14] FIG. 14 is a graph showing tumor retardation as assessed by bioluminescence in an in vivo animal model administered vehicle, C9mAurA, C9m5m, C9m6m, C9m5mA, C9m6mA and FNM7. [Figure 15] FIG. 15 is a bioluminescence image of an in vivo animal model administered a control vehicle or a polynucleotide modifying enzyme according to the present disclosure. [Figure 16] FIG. 16 is a graph showing the localization (liver, lung, kidney, spleen, lymph, and tumor) in an animal model for administered vehicle, C9mAur, C9m5m, C9m6m, and FNM7. [Figure 17] FIG. 17 is a graph showing the localization (liver, lung, kidney, heart, spleen, lymph, and tumor) in an animal model for administered vehicle, C9mAurA, C9m5mA, C9m6mA, and FNM7. [Figure 18] Figure 18 is an image of a gel showing the results of an on-target first-pass assessment of editing by T7 endonuclease assay. [Figure 19] Figure 19 is an image of a gel showing the results of off-target first-pass assessment of editing by T7 endonuclease assay (in five off-target sites: Off 1, Off 2, Off 3, Off 4, and Off 5). [Figure 20] FIG. 20 is a photograph of a cross section of a tumor treated with C9m5m, showing 4 sample sites where samples 1-4 were extracted. [Figure 21] FIG. 21 is a fluorescent image of the cross section of FIG. [Figure 22A] FIG. 22A is a fluorescent image of the tumor in the animal model before any injection of PNME. [Figure 22B] FIG. 22B is a fluorescence image 6 days after injection of C9m5m in the animal model of FIG. 22A. [Figure 22C] FIG. 22C is a bioluminescence image 6 days after injection of C9m5m in the animal model of FIG. 22A. [Figure 22D] FIG. 22D is a fluorescence image 8 days after injection of C9m5m in the animal model of FIG. 22A. [Figure 22E] FIG. 22E is a bioluminescence image 8 days after injection of C9m5m in the animal model of FIG. 22A. [Figure 23] FIG. 23 is an image of a gel showing the results of Kras G12s amplification from DNA in samples 1, 2, 3, and 4 extracted from the tumors shown in FIG. [Figure 24] Figure 24 is an image of a gel showing the results of amplification of five off-target sites by PCR amplification (lanes 1-5) or T7 endonuclease assay (lanes 1b-5b). DETAILED DESCRIPTION OF THE INVENTION
[0026] Detailed Description definition As used herein, the term "polynucleotide modifying enzyme" (or "PNME") refers to a peptide enzyme that has the ability to cleave the phosphodiester backbone of a nucleic acid (e.g., DNA or RNA) or to alter the identity of one or more nitrogenous bases within a nucleic acid.
[0027] As used herein, the term "functional nuclease domain" refers to a peptide sequence of a PNME having at least one nuclease catalytic pocket capable of cleaving the phosphodiester backbone of a nucleic acid or altering the identity of one or more nitrogenous bases within a nucleic acid. A functional nuclease domain can be derived from a nuclease enzyme or can be synthetic. The catalytic pocket has a three-dimensional conformation and protein fold that allows it to accept a nucleic acid sequence and perform cleavage of the phosphodiester backbone of a nucleic acid. In some embodiments, the catalytic pocket comprises a RuvC nuclease domain.
[0028] As used herein, the term "display domain" refers to a peptide sequence capable of specific, non-covalent association with a cell surface antigen or receptor. The display domain is incorporated into a PNME and does not interfere with the activity of a functional nuclease domain. The display domain can be sized and / or positioned in the sequence of a PNME so that the nuclease catalytic pocket is unobstructed and retains at least 50%, at least 60%, at least 70%, preferably at least 80%, and more preferably at least 90% of its cleavage activity. For example, the three-dimensional conformation of the nuclease catalytic pocket can substantially correspond to the three-dimensional conformation that would be obtained without the insertion of the display domain into the PNME. (e.g., the same alpha helix and the same beta sheet).
[0029] As used herein, the term "endosomal escape domain" (or "EE domain") refers to a peptide sequence that, when associated with a molecular cargo, facilitates diffusion of the cargo from the endosomal compartment to the cytosol and / or alters the steady-state distribution of the cargo between the endosomal compartment and the cytosol in favor of the cytosol.
[0030] As used herein, the term "hapten" refers to a small molecule that, when combined with a larger carrier, such as a protein, has the ability to bind with high affinity to an antibody or antibody mimic (the "hapten-binding domain"). In some embodiments, the molecular weight of the organic compound is less than 500 daltons. In some embodiments, the affinity (K) of the hapten for the hapten-binding domain is D ) is 10 -6 In some embodiments, the affinity (K) of the hapten for the peptide or nucleic acid aptamer D ) is 10 -7 In some embodiments, the affinity (K) of the hapten for the peptide or nucleic acid aptamer D ) is 10 -8 In some embodiments, the affinity (K) of the hapten for the peptide or nucleic acid aptamer D ) is 10 -9 It is less than molar.
[0031] As used herein, the term "linker," "linker group," or "linker domain" refers to a group that can link one chemical moiety to another chemical moiety. In some embodiments, the linker is a chemical bond. In some embodiments, the linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, the linker is a cleavable linker, e.g., the linker includes a linkage that can be cleaved upon exposure to a cleavage activity, such as UV light or a hydrolase, e.g., a lysosomal protease. In some embodiments, the linker may include 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 20 or more, 25 or more, 30 or more, 40 or more, 50 or more amino acids. In some embodiments, the peptide linker includes, for example, the sequence (GGS) n(n is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more repeats). In some embodiments, the linker can comprise at least two polyethylene glycol (PEG) residues. In some embodiments, the PEG linker comprises 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more PEG residues. In some embodiments, the PNME described herein comprises a linker joining two or more domains described herein, e.g., any combination of two or more of an endosomal escape domain, a nuclear localization sequence, or a PNME domain.
[0032] The term "tracrRNA" or "tracr sequence," as used herein, generally refers to a nucleic acid having at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity and / or sequence similarity to a wild-type exemplary tracrRNA sequence (e.g., a tracrRNA from S. pyogenes, S. aureus, etc.). A tracrRNA can refer to a nucleic acid having up to about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity and / or sequence similarity to a wild-type exemplary tracrRNA sequence. A tracrRNA can also refer to modified forms of a tracrRNA, which can include nucleotide changes, such as deletions, insertions, or substitutions, variants, mutations, or chimeras. A tracrRNA may refer to a nucleic acid that can be at least about 60% identical to a wild-type exemplary tracrRNA sequence over a stretch of at least six contiguous nucleotides. For example, a tracrRNA sequence can be at least about 60% identical, at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100% identical to a wild-type exemplary tracrRNA sequence over a stretch of at least six contiguous nucleotides.
[0033] As used herein, "guide nucleic acid" can refer to a nucleic acid that can hybridize to another nucleic acid. The guide nucleic acid may preferably be RNA or DNA. The guide nucleic acid may be programmed to specifically bind to a nucleic acid having a unique sequence. The targeted nucleic acid, or target nucleic acid, may comprise nucleotides. The guide nucleic acid may comprise nucleotides. A portion of the target nucleic acid may be complementary to a portion of the guide nucleic acid. A strand of a double-stranded target polynucleotide that is complementary to and hybridizes with a guide nucleic acid may be referred to as a complementary strand. A strand of a double-stranded target polynucleotide that is complementary to a complementary strand and therefore may not be complementary to the guide nucleic acid may be referred to as a non-complementary strand. A guide nucleic acid may comprise one polynucleotide strand and may be referred to as a "single guide nucleic acid." A guide nucleic acid may comprise two polynucleotide strands and may be referred to as a "double guide nucleic acid." Unless otherwise specified, the term "guide nucleic acid" may be inclusive and refer to both single guide nucleic acids and double guide nucleic acids. The guide nucleic acid may include a nucleic acid targeting segment (e.g., crRNA) and a protein-binding sequence. The guide nucleic acid may include a nucleic acid targeting segment (e.g., crRNA), a protein-binding sequence, and a transactivating RNA (e.g., tracrRNA). In some cases, the guide RNA described herein includes a sequence of n nucleotides, counting from the first nucleotide at the 5' end to the nth nucleotide at the 3' end, wherein one or more of the nucleotides at positions 1, 2, n-1, and n are phosphorothioate-modified nucleotides. The guide nucleic acid may include one or more bridged nucleotides in the seed region of the guide oligonucleotide.
[0034] The guide nucleic acid may include a segment that may be referred to as a "nucleic acid targeting segment," "nucleic acid targeting sequence," or "seed sequence." In some embodiments, the sequence is 19-21 nucleotides in length. In some embodiments, the "nucleic acid targeting segment" or "nucleic acid targeting sequence" comprises a crRNA. The nucleic acid targeting segment may include a subsegment that may be referred to as a "protein binding segment," "protein binding sequence," or "Cas protein binding segment."
[0035] A "host cell" generally includes an individual cell or cell culture that can be or has been a recipient for a subject vector, such as a vector described herein, into which exogenous nucleic acid has been introduced. A host cell includes the progeny of a single host cell. The progeny may not necessarily be completely identical (in morphology or in genomic representation of the entire DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation. A host cell includes cells transfected in vivo with a vector of the invention.
[0036] The term "derivative", when referring to a protein, means that the protein has been modified by adding or removing sequences while retaining its function. The term "functional analog" of a protein means a different sequence that performs the same function. The term "variant", when referring to a protein, means that the protein has been mutated (e.g., adding, deleting, or substituting amino acids) while retaining or enhancing its function.
[0037] Polynucleotide-modifying enzymes Polynucleotide modifying enzymes (PNMEs), e.g., nucleases, have positions in their amino acid sequences that can be modified without affecting or severely impairing the function of the PNME. It has been found that the PNMEs of the present disclosure have a display domain in a sequence that allows them to be displayed on the external surface of the PNME. The display domain enables the PNME to target cell surface antigens or receptors. The PNME can therefore be considered a single protein delivery platform. In some embodiments, "single protein" means that the entire sequence of a single protein is contained between the N-terminus and C-terminus, and no linkage or fusion occurs at the N- or C-terminus. In some embodiments, the display domain of the present disclosure is positioned at least 25 amino acids after the N-terminus or at least 25 amino acids before the C-terminus of the polynucleotide modifying enzyme. In some embodiments, the display domain is positioned at least 30, at least 40, at least 50, at least 75, or at least 100 amino acids after the N-terminus or at least 30, at least 40, at least 50, at least 75, or at least 100 amino acids before the C-terminus.
[0038] Therefore, the single-protein PNME described herein, which has a nuclease domain and a display domain, differs from other compositions that combine nucleic acid domains using N- or C-terminal fusions. The concept of protein fusion is to add an additional domain external to the PNME at either end (N- or C-terminus). Protein fusions can be used to affect some additional epigenetic / editing / transcriptional inhibition / activation function or affinity recognition.
[0039] The combination of a display domain and a functional nuclease domain in a single PNME protein allows for a reduction in the size of the gene editing platform. Thus, in some embodiments, a cell recognition domain (e.g., an antibody, an antigen-binding fragment, or an antibody mimetic) is not required in the gene editing platform described herein. The combination of a display domain and a functional nuclease domain provides improved bioavailability (e.g., longer blood circulation time, reduced kidney clearance, etc.). By using PNME as a display scaffold, there is no longer a need to add a stable protein scaffold, such as scfv, vhh, or affibody, as a display. This is one of the factors that contribute to the reduction in the overall size of the delivery platform. Size minimization allows for the use of small expression vectors. Furthermore, smaller proteins improve diffusion kinetics in vivo. For example, the reduced overall size allows for improved targeting of cells, particularly tumor cells found in the tumor core and that would otherwise be difficult for larger delivery platforms to reach.
[0040] Cell-penetrating peptides have been used as a platform for the delivery of biomolecules.However, cell-penetrating peptides generally do not have the same specificity and success as delivery platforms, including immunoglobulin approaches.An exemplary immunoglobulin approach can be that antibodies or antibody mimics are first screened against a defined biological target, such as a receptor, and then verified for target recognition.CRISPR proteins are fused with peptides, such as RGB, SV40NLS, at the C- and N-termini of the protein, or are charged-associated with CRISPR RNPs, which affect nonspecific cell entry.To affect organ tropism or preferential tissue accumulation, receptor-specific binding is preferably a feature of PNMEs that act as cell-penetrating peptides.This feature is achieved by the display domain of PNMEs.
[0041] The PNMEs of the present disclosure and platform delivery systems incorporating them have one or more of the following advantages: They can be expressed in high yields in common protein expression systems; They can be expressed and are scalable. They allow specific delivery and / or enhanced accumulation in specific cell types or tissues by interacting with biomarkers, receptors, or extracellular domains that identify and enable cellular internalization. They do not require multiple chemical synthesis steps for the attachment of ligands for receptor recognition or ligand / receptor binding molecules. They minimize the overall size of the platform delivery system. They avoid the separate delivery of multiple components. They achieve tailorable exposure-response relationships (pharmacodynamics (PD), pharmacokinetics (PK), PD / PK).
[0042] The polynucleotide modifying enzymes described herein include enzymes that cleave the phosphodiester backbone of a nucleic acid or change the identity of one or more nitrogenous bases within a nucleic acid. PNMEs that cleave the phosphodiester backbone of a nucleic acid can cleave double-stranded or single-stranded polynucleotides. PNMEs that cleave the phosphodiester backbone of a double-stranded nucleic acid can result in blunt-ended or staggered cuts. PNMEs preferably have the ability to associate with nucleic acids (e.g., DNA or RNA).
[0043] In some cases, PNME enzyme is a programmable nuclease.Such nuclease is preferably engineered to target specific DNA or RNA sequence for cleavage.Nuclease is for example CRISPR endonuclease, for example Cas9, Cas12a (Cpf1), Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b and Cas14.In some embodiments, CRISPR endonuclease is class II CRISPR endonuclease.In some cases, CRISPR endonuclease is class II, type II, V or VI endonuclease.In some cases, such nuclease comprises at least one nuclease-deficient nuclease domain. In some embodiments, the CRIPSR endonuclease is encoded by a sequence having at least at least 75% identity, at least 78% identity, at least 80% identity, at least 81% identity, at least 82% identity, at least 83% identity, at least 84% identity, at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to any one of SEQ ID NOs: 1, 3, 5, 7, or 9.In some embodiments, the CRIPSR endonuclease has at least 75% identity, at least 78% identity, at least 80% identity, at least 81% identity, at least 82% identity, at least 83% identity, at least 84% identity, at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to any one of SEQ ID NOs: 2, 4, 6, 8 or 10.
[0044] Table 1: Examples of nucleases [Table 1-1]
[0045] [Table 1-2]
[0046] [Table 1-3]
[0047] [Table 1-4]
[0048] [Table 1-5]
[0049] [Table 1-6]
[0050] [Table 1-7]
[0051] [Table 1-8]
[0052] [Table 1-9]
[0053] [Table 1-10]
[0054] CRISPR endonucleases typically require the use of a guide RNA (gRNA) or guide nucleic acid complexed (e.g., non-covalently associated) with the CRISPR endonuclease (or "Cas enzyme") to target specific sequences of DNA for cleavage. Thus, compositions for gene editing involving PNMEs containing CRISPR / Cas endonucleases can also include the guide RNAs described herein. Guide nucleic acids generally direct cleavage of a target sequence when the target sequence is located within about 30 nucleotides of a protospacer adjacent sequence (PAM) sequence characteristic of the CRISPR endonuclease. In some embodiments, the guide nucleic acid can target an oncogene, such as EML4-ALK, or a tumor suppressor gene, such as BRCA. In other embodiments, the guide nucleic acid can target an immunological receptor, such as a chemokine receptor (e.g., CXCR4).
[0055] In some embodiments, the PNME is at least 75% identical, at least 78% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical to SEQ ID NO: 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 40, 41, 43, or 45. identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity. In some embodiments, the PNME is at least 75% identical, at least 78% identical, at least 80% identical, at least 81% identical, at least 82% identical, at least 83% identical, at least 84% identical, at least 85% identical, at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, to SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, or 46. 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity.
[0056] Table 2: Examples of PNMEs [Table 2-1]
[0057] [Table 2-2]
[0058]
Table 2-3
[0059]
Table 2-4
[0060]
Table 2-5
[0061]
Table 2-6
[0062]
Table 2-7
[0063]
Table 2-8
[0064]
Table 2-9
[0065]
Table 2-10
[0066]
Table 2-11
[0067]
Table 2-12
[0068]
Table 2-13
[0069]
Table 2-14
[0070]
Table 2-15
[0071]
Table 2-16
[0072]
Table 2-17
[0073]
Table 2-18
[0074]
Table 2-19
[0075]
Table 2-20
[0076]
Table 2-21
[0077]
Table 2-22
[0078]
Table 2-23
[0079]
Table 2-24
[0080]
Table 2-25
[0081]
Table 2-26
[0082]
Table 2-27
[0083]
Table 2-28
[0084]
Table 2-29
[0085]
Table 2-30
[0086]
Table 2-31
[0087]
Table 2-32
[0088]
Table 2-33
[0089]
Table 2-34
[0090]
Table 2-35
[0091]
Table 2-36
[0092]
Table 2-37
[0093]
Table 2-38
[0094]
Table 2-39
[0095]
Table 2-40
[0096]
Table 2-41
[0097]
Table 2-42
[0098]
Table 2-43
[0099]
Table 2-44
[0100]
Table 2-45
[0101]
Table 2-46
[0102]
Table 2-47
[0103]
Table 2-48
[0104]
Table 2-49
[0105]
Table 2-50
[0106]
Table 2-51
[0107]
Table 2-52
[0108]
Table 2-53
[0109]
Table 2-54
[0110]
Table 2-55
[0111]
Table 2-56
[0112]
Table 2-57
[0113]
Table 2-58
[0114]
Table 2-59
[0115]
Table 2-60
[0116]
Table 2-61
[0117]
Table 2-62
[0118]
Table 2-63
[0119]
Table 2-64
[0120]
Table 2-65
[0121]
Table 2-66
[0122]
Table 2-67
[0123]
Table 2-68
[0124]
Table 2-69
[0125]
Table 2-70
[0126]
Table 2-71
[0127]
Table 2-72
[0128] The display domain is a peptide recognition sequence of 3 to 20 amino acids. In some embodiments, the peptide recognition sequence is 3 to 19, 3 to 18, 3 to 17, 3 to 16, 3 to 15, 4 to 20, 4 to 19, 4 to 18, 5 to 20, 5 to 19, or 5 to 18 amino acids in length. The peptide recognition sequence is preferably a complementarity-determining region (CDR). The display domain, e.g., the CDR, can bind to one or more epitopes on a cell surface antigen of a target cell. The CDR can provide specific engagement with a target receptor to induce receptor-mediated endocytosis. In some embodiments, the peptide recognition sequence is selected from SEQ ID NOs: 47-63.
[0129] [Table 3]
[0130] The display domain can be inserted into the PNME in a loop, an alpha helix, or an extension from the alpha helix loop of the PNME so that amino acid packing is not disturbed. The term "loop," as used herein, generally refers to a non-beta sheet and non-alpha helix region of defined structure that connects two secondary structures (e.g., an alpha helix or a beta sheet). A protein loop is a patternless region that connects two regular secondary structures. Loops are generally located on the surface of the protein in a solvent-exposed compartment and can play important roles, such as interacting with other biological targets. An extension from the alpha helix loop can be defined as a region at the end of the alpha helix loop where the insertion of amino acids does not affect the position of the secondary structure connected to the alpha helix. In some embodiments, the insertion in the extension from the alpha helix loop occurs 5 amino acids upstream or downstream of the end of the loop. The insertion site for the display domain is a site that is on the outer surface of the PNME when the PNME is folded under physiological conditions. Indeed, to display a peptide sequence, the display domain must be sterically accessible to achieve recognition and binding to the target receptor of the target cell. Therefore, to provide for the presentation of the inserted display domain, the amino acid position at the insertion site should not be buried within the PNME structure.
[0131] In preferred embodiments, the loop, alpha helix, and extensions from the ends of the alpha helices are sites that allow insertion of a display domain without significantly interfering with the enzymatic function (i.e., cleavage) of the PNME. In some embodiments, the loop, alpha helix, and extensions from the ends of the alpha helices are selected so that insertion of the display domain does not significantly interfere with folding of the PNME. In this embodiment, the loop, the alpha helix, and the extension from the end of the alpha helix are selected so that insertion of the display domain does not interfere with the folding and three-dimensional conformation of the nuclease catalytic pocket of the PNME.
[0132] More than one display domain can be inserted into the PNME. For example, the PNME can be bispecific, having a first and second display domain that each recognize a different target cell receptor. The different target cell receptors can be found in the same cell or in different cells. In some embodiments, the PNME is a trispecific PNME, having three display domains that each recognize a different target cell receptor. When two or more display domains are inserted into the PNME, the display domains can be in different loops, alpha helices, or extensions from the end of an alpha helix, or in extensions from the end of the same loop, alpha helix, or alpha helix.
[0133] In some embodiments, a display domain is inserted into a Cas9 enzyme to obtain a PNME. In some embodiments, the display domain is inserted into the loop region of a Cas9 enzyme (e.g., SEQ ID NO: 2 or 8) at residues 204, 534, 558, 826, 945, 1026, or 1207. In some embodiments, the display domain is Cas9 (e.g., spCas9), and the residue for insertion of the display domain is A738, T995 (both located in extensions from the end of the alpha helix), or S1154 (located in the loop). S1154 is a preferred insertion residue site because it is well located within a loop in the unstructured segment of the PNME protein. Using Cas9 as an example, insertions can be made at ser1154 in the enzyme, which is in a loop region, without loss of function. In some embodiments, the loop region in the nuclease selected for insertion is an external loop located outside the PNME surface and facing outward.
[0134] Classical Cas9 was discovered to create blunt-ended double-strand breaks and was classified as a type II nuclease, while Cas12 or type V systems were later shown to create protruding overhanging double-strand breaks. Manipulation of the nuclease domain in types II and V created nickase systems that cleave one strand, and complete knockout of the nuclease domain resulted in a "dead" nuclease that acts as an RNA-guided DNA-binding protein. This can be further enhanced in function by adding additional "effectors" to enable base editing or transcriptional repression or activation. Additionally, CRISPR systems and effectors, such as Cas3, have been discovered that lead to large-scale DNA degradation, and the application of these systems to RNA editing has expanded with the discovery of multiple Cas13 or RNAse-type proteins guided by protein-complexed RNA molecules. This is not an exhaustive list of the natural and engineered forms of CRISPR effectors, but suggests that a great deal of progress has been observed in the CRISPR systems that fall into the above general categories, and these will continue to develop with further innovation.For all CRISPR-derived systems, it is essential that CRISPR effectors achieve the degree of intracellular delivery that can achieve the desired editing, modification or regulation of nucleic acid (DNA or RNA).This disclosure achieves this by incorporating a display domain into CRISPR enzyme, and endowing the resulting PNME with receptor binding properties.
[0135] Thus, CRISPR-Cas systems, such as the cas9 / cas12 RNA-guided nuclease and cas13 RNase systems, are repurposed herein as nucleic acid editing systems with cellular targeting capabilities. Common to all CRISPR-Cas systems is an enzymatic system that modifies nucleic acids, which can include: Enzymes that create double-strand breaks, such as cas9 and cas12; nick-creating enzymes, such as Cas9 nickase; · Enzymes that perform large-scale nucleic acid degradation, e.g., Cas3; Enzymes that perform base editing by fusing a dead non-catalytic CRISPR effector with an additional catalytic domain for cytosine deamination, e.g., dead-Cas9-rAPOBEC1; and Dead cas9 is a transcriptional modulator enzyme that binds to DNA and does one of the following: The sgRNA recruits transcriptional effectors, or The sgRNA recruits a fusion domain that achieves up- / down-regulation of mRNA transcripts.
[0136] In some embodiments, the PNME can comprise a nuclear localization sequence (NLS). The NLS can be located at the N- or C-terminus of the PNME, or both. The NLS can be separated from the PNME peptide sequence by a linker or fused directly to the PNME sequence without intervening amino acids. In embodiments, the PNME comprises at least one, at least two, at least three, at least four, at least five, or more NLSs. In some embodiments, the NLS comprises 7 to 25 amino acid residues. In some embodiments, the NLS is derived from a mammalian nuclear entry protein, such as a splicing factor or transcription factor. In some embodiments, the NLS interacts with an importin. In some embodiments, the NLS is a bipartite NLS, where the amino acids in the N-terminal portion of the NLS involved in importin recognition and the amino acids in the C-terminal portion of the NLS involved in importin recognition are separated by an amino acid sequence not involved in importin recognition. In some embodiments, the NLS comprises at least one sequence depicted in Table 4 below, or a combination of sequences from Table 4 (i.e., SEQ ID NOS: 64-79), a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to a sequence set forth in Table 4, or a sequence substantially identical to any of the sequences in Table 4. When more than one NLS is included in a PNME or PNME composition, the NLSs may comprise the same sequence or different sequences. In some embodiments, more than one NLS sequence is included (e.g., an SV40 NLS), and the NLS sequence may be disposed in a linker between the PNME and the monoavidin domain.
[0137] [Table 4]
[0138] In some embodiments, the PNME further comprises a hapten-binding domain for linking additional protein or nucleic acid ligands to the PNME. A "hapten-binding domain" is a peptide or oligonucleotide domain that binds to a hapten. A "hapten" refers to a small molecule that, when combined with a larger carrier, such as a protein, has the ability to bind with high affinity to an antibody or antibody mimetic (the "hapten-binding domain"). In some embodiments, the hapten / hapten-binding domain pair is derived from a natural protein or an engineered variant thereof, such as a biotin / avidin pair or an amylose / MBP pair. Engineered alternatives for biotin include D-desthiobiotin. Alternatives for avidin include streptavidin, neutravidin, and captAvidin. In some embodiments, the hapten / hapten-binding domain pair is a synthetically engineered pair, such as 3-methylindole / anti-3-methylindole monoclonal antibody (e.g., 14G8, 3F12, 4A1G, 8F2, or 8H1 monoclonal antibody), fumonisin B1 / anti-fumonisin antibody, 1,2-naphthoquinone / anti-1,2-naphthoquinone antibody, 15-acetyldeoxynivalenol / anti-15-acetyldeoxynivalenol antibody, (2-(2,4-dichlorophenyl)-3(1H-1,2,4-triazol-1-yl)propanol) / anti-(2-(2,4-dichlorophenyl)-3(1H-1,2,4-triazole-1-yl)propanol), or 3-methylindole / anti-3-methylindole monoclonal antibody (e.g., 14G8, 3F12, 4A1G, 8F2, or 8H1 monoclonal antibody). (yl)propanol) antibody, 22-oxacalcitriol / anti-22-oxacalcitriol antibody, (24,25(OH)2D3) / anti-(24,25(OH)2D3) antibody, 2,4,5-trichlorophenoxyacetic acid / anti-2,4,5-trichlorophenoxyacetic acid antibody, 2,4,6-trichlorophenol / anti-2,4,6-trichlorophenol antibody, 2,4,6-trinitrotoluene / anti-2,4,6-trinitrotoluene antibody, 2,4-dichlorophenoxyacetic acid / anti-2,4-dichlorophenoxyacetic acid antibody, 2-hydroxybiphenyl / anti-2-hydroxybiphenyl antibody, 3,5,6-trichloro-2-pyridinol / anti-3,5,6-trichloro The hapten-binding domain may be an -2-pyridinol antibody, 3-acetyldeoxynivalenol / anti-3-acetyldeoxynivalenol antibody, 3-phenoxybenzoic acid / anti-3-phenoxybenzoic acid antibody, digoxin / anti-digoxin antibody, fluorescein / anti-fluorescein antibody, or hexahistidine / Ni-NTA. The hapten-binding domain can be located N- or C-terminally to the PNME, or both. The hapten-binding domain can be separated from another domain described herein by a linker or can be fused directly to the domain sequence without intervening amino acids. In some cases, the hapten-binding domain is within a linker domain that separates two other domains of the PNME. In some cases, the PNME contains at least one, at least two, at least three, at least four, at least five, or more hapten-binding domains.
[0139] In some embodiments, a composition is provided comprising a PNME and a hapten-binding domain. The composition may further comprise a peptide, protein, oligonucleotide, or polynucleotide linked to a corresponding hapten. The oligonucleotide may comprise deoxyribonucleotides or ribonucleotides. The oligonucleotide may comprise a single-stranded or double-stranded oligonucleotide.
[0140] In some embodiments where the PNME comprises a hapten-binding domain and a programmable or site-directed nuclease, the PNME further comprises a nucleic acid (e.g., a repair template or donor DNA) having a homology arm complementary to a region adjacent to the target site for the programmable or site-directed nuclease. In this manner, the nuclease can be delivered to the cell in the vicinity of the site to be cleaved. In some cases, the repair template or donor DNA is a single-stranded or double-stranded DNA repair template or donor DNA, comprising, from 5' to 3', a first homology arm comprising a sequence of at least about 20 nucleotides 5' to the target sequence, an insert DNA sequence or a region of at least about 10 nucleotides, and a second homology arm comprising a sequence of at least about 20 nucleotides 3' to the target sequence. In some embodiments, the first or second homology arm comprises a sequence of at least about 20, 40, 50, 80, 120, 150, 200, 300, 500, or 1000 nucleotides. In some embodiments, the 5' and 3' homology regions have different lengths. In some embodiments, the 5' and 3' homology regions have the same length. In some embodiments, the repair template or donor DNA is a single-stranded polynucleotide, and the 5' homology region comprises 50-100 nucleotides, and the 3' homology region comprises 20-60 nucleotides. In some embodiments, the 3' end of the 5' homology region is homologous to a sequence within 5 nucleotides of the double-stranded break. In some embodiments, the 5' end of the 3' homology region is homologous to a sequence within 5 nucleotides of the double-stranded break. The insert region can include an exon, an intron, a transgene, a stop codon (e.g., a stop codon in-frame with the gene ORF into which it is inserted), the coding sequence of a gene containing at least one nonsense or missense mutation, or a mutation that eliminates the activity of a PAM site near the sequence targeted by the PNME CRISPR enzyme.Exemplary transgenes include selectable markers, such as BlaS, HSV-tk, puromycin N-acetyl-transferase, or Tn5 NEO genes, which can be used to select for cells that have undergone recombination with the donor DNA or repair template. Exemplary transgenes also include detectable labels, such as fluorescent enzymes, protein sequences that allow high-affinity detection with antibodies, epitope tags, or fluorescent proteins.
[0141] In one example, PNME is constructed on a C9m scaffold, Cas9 is fused with a monoavidin domain, and a peptide sequence is grafted onto the loop domain identified above. A peptide recognition sequence (e.g., CDR) can be selected as a binding agent that targets a specific receptor. Grafting of the peptide recognition sequence can be performed by grafting the peptide. This can be achieved by inserting the DNA sequence (C9m) into an expression vector encoding the sequence.
[0142] Additional receptor recognition elements can be introduced by using biotinylated peptides or nucleic acid aptamers in combination with PNME. For example, a monoavidin domain allows biotinylated ScFV / Nab structures to be bioconjugated to the PNME structure, expanding targeting capabilities through the recognition of the same or other receptors with other receptor-binding sequences. Aptamers can be selected based on specific functions or targets, such as cancer cell targeting. Exemplary aptamers that can be conjugated to PNME are listed in Table 5 below.
[0143] [Table 5]
[0144] In some embodiments, the PNMEs of the present disclosure can be combined with an endosomal escape domain to form a fusion polypeptide. The endosomal escape domain allows the fusion peptide to exit the endosome and enter the cytoplasm after endocytosis. The endosomal escape domain can be incorporated into the sequence of the PNME or can be linked at the N- or C-terminus of the PNME. Table 6 details non-limiting examples of endosomal escape (EE) domains.
[0145] [Table 6]
[0146] In some embodiments, a vector is provided that includes a nucleotide sequence encoding a PNME (including a display domain), optionally an EE domain, and optionally an NLS domain. In some cases, the vector further includes an endosomal escape domain and a hapten-binding domain in the same open reading frame (ORF) as the PNME. A "vector" is a nucleic acid sequence that has the ability to transfer other operably linked heterologous or recombinant nucleic acid sequences into target cells. In some examples, the vector is a minicircle, a plasmid, a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), a cosmid, a phagemid, a bacteriophage genome, or a baculovirus genome. Suitable vectors also include vectors derived from bacteriophages or plant, invertebrate, or animal (including human) viruses, such as CELiD vectors, adeno-associated virus vectors (e.g., AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or pseudotyped combinations thereof, such as AAV2 / 5, AAV2 / 2, AAV-DJ, or AAV-DJ8), retroviral vectors (e.g., MLV or its self-inactivating or SIN version, or a pseudotyped version thereof), herpesvirus (e.g., HSV- or EBV-based), lentiviral vectors (e.g., HIV-, FIV-, or EIAV-based, or a pseudotyped version thereof), adenoviral vectors (e.g., Ad5-based; including replication-deficient, replication-competent, or helper-dependent versions thereof), or baculoviral vectors (suitable for transfecting insect cells as described herein). In some embodiments, the vector is a replication-competent virus-derived vector.
[0147] Thus, in some aspects, the present disclosure also provides a host cell comprising any of the vectors described herein. In some embodiments, the host cell is an animal cell. "Animal cells" encompass any animal cell, including, but not limited to, invertebrate, non-mammalian vertebrate (e.g., avian, reptile, and amphibian), and mammalian cells. Many mammalian cell lines are suitable host cells for recombinant expression of a polypeptide of interest. Mammalian host cell lines include, for example, COS, PER.C6, TM4, VERO076, MDCK, BRL-3A, W138, Hep G2, MMT, MRC 5, FS4, CHO, 293T, A431, 3T3, CV-1, C3H10T1 / 2, Colo205, 293, HeLa, L cells, BHK, HL-60, FRhL-2, U937, HaK, Jurkat cells, Rat2, BaF3, 32D, FDCP-1, PC12, M1x, mouse myelomas (e.g., SP2 / 0 and NS0), and C2C12 cells, as well as transformed primate cell lines, hybridomas, normal diploid cells, and cell lines derived from in vitro culture of primary tissues and primary explants. Any eukaryotic cell capable of expressing recombinant and / or transgenic proteins may be used in the disclosed cell culture methods. Numerous cell lines are available from commercial sources, such as the American Type Culture Collection (ATCC). The host cell can be a CHO cell. In some embodiments, the host cell is a bacterial cell suitable for protein expression, such as a derivative of the Escherichia coli K12 strain. In some embodiments, the host cell includes a plant cell into which a gene has been introduced via a vector, the single-stranded RNA virus, tobacco mosaic virus. The "host cell" can be an insect cell, which is utilized to produce large quantities of polypeptides according to the present disclosure. In some embodiments, a baculovirus system, which offers all the advantages of higher eukaryotes, is utilized. Host cells for the baculovirus system include, but are not limited to, the Spodoptera frugiperda ovarian cell lines SF9 and SF21 and the Trichoplusia ni egg-derived cell line High Five.
[0148] In some embodiments, the PNMEs described herein are delivered to cells (e.g., in vitro or in a patient) via specially designed pharmaceutical compositions or dosage forms. Pharmaceutical compositions may include sterile water, along with pharmaceutically acceptable excipients and optional electrolytes to ensure the composition is isotonic. Because the PNMEs described herein and pharmaceutical compositions containing them do not require chemical transfection agents to enter cells, in some embodiments, the liquid formulations for delivery do not include polyetherimide (PEI), polyethylene glycol (PEG), polyamidoamine (PAMAM), or sugar (dextran) derivative polymers containing more than three subunits.
[0149] In some aspects, the present disclosure provides a kit for editing gene in cell.The kit can include instructions for performing gene editing.In some embodiments, the kit described herein comprises any of the vectors described herein together with donor DNA polynucleotide.In some cases, the kit further comprises suitable guide RNA (when PNME is CRISPR enzyme).
[0150] In some aspects, the present disclosure provides a method for gene editing in target cells. The method includes administering a PNME or pharmaceutical composition described herein to a subject in need of gene editing in the target cells. In some embodiments, the target cells are cancer cells, and the method is a method for treating cancer. The peptide recognition sequence can target specific receptors in breast, lung, prostate, ovarian, brain, heart, kidney, liver, blood-brain barrier (BBB) transcytosis, and other cancer types. Generally, cancer can be treated with the PNME of the present disclosure by targeting and knocking out specific oncogenes or synthetic lethal genes. Targeting lnRNA and mcRNA sites is also possible. When oncogenes are knocked out, cell signaling related to specific pathways that allow cancer persistence / apoptosis evasion is disrupted, leading to cell death. Other targets can be selected for ablation of genes encoding immunosuppressive functions, i.e., the classical pd1 / pdl1 axis between T cells and cancer cells. Alternative treatment options include ablation of susceptibility genes that induce synthetic vulnerability to combination treatment, i.e., loss of base excision repair / NHEJ gene products in the context of cisplatin / platinum-based treatment, which form DNA crosslinks that are normally repaired by DNA repair pathway effectors.
[0151] The PNME and pharmaceutical compositions described herein can also be used for cell therapy. Cell therapy can be performed in vitro by injecting PNME into cells, or in vivo by administering the PNME or pharmaceutical compositions described herein to a subject in need of cell therapy. Cell therapy can be performed by using PNME to modify immune cells for reimplantation, either by adding gain-of-function modifications (CAR, HLA) or by removing function. Gain of function, such as the production of new pharmaceutical products, can also be achieved. Cell therapy can also be applied in transgenic animal development, in the agri-food industry to modify plants to improve yield, and in stem reprogramming.
[0152] The embodiments described in this document provide non-limiting examples of possible implementations of the technology. Those skilled in the art who have reviewed this disclosure will recognize that modifications can be made to the embodiments described herein without departing from the scope of the technology. Still further modifications may be implemented by those skilled in the art in light of this disclosure, but such modifications would be within the scope of the technology. [Example]
[0153] material The following reagents were purchased from Wisent™: Dulbecco's Modified Eagle's Medium (DMEM), heat-inactivated fetal bovine serum (FBS) Premium, penicillin / streptomycin (Pen / Strep), F12, Luria Bertani (LB), peptone, yeast extract, and super broth. The following reagents were purchased from Biobasic: ethanol, isopropanol, phosphate-buffered saline (PBS), DNA ladder 1 kb, DNA ladder 100 bp, protein ladder 250 kda, 33:1 Acrylamide premix, N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid (HEPES), tris(hydroxymethyl)aminomethane (TRIS), glucose, arabinose, NaCl, KCl, HCl, ammonium hydroxide, calcium chloride, SOC broth, ethylenediaminetetraacetic acid (EDTA), agar, agarose, Tris-acetate-EDTA (TAE) 50X buffer, micropipette tips, serological pipettes (10 ml, 25 ml, 5 ml), 15 ml sterile tubes, 1.5 ml sterile tubes, 50 ml sterile tubes, PCR tubes, culture plates (6-well, 12-well, 24-well, 96-well flat-bottom, 96-well round-bottom, 10 cm plates), and plastic Petri dishes. The following Monarch RNA Cleanup Columns were purchased from BioLabs™: Monarch DNA, RNA, Plasmid Prep Kit and restriction enzymes, T7 endonuclease I (and buffer NEB 2.0), protease K, hifi assembly mix, and PCR enzymes. PCR enzymes were obtained from Transgen™, and primers from Biocorp™. Mutagenesis services were provided by ABM™. Primers and gblocks were obtained from IDT™. Large DNA synthesis was performed using TwistBio™. The following reagents were purchased: pierce dye removal columns, 4 ml bacterial culture tubes, PCR enzymes (DIrect Phire / Phusion), various fluorescent dyes (DAPI, NHS fluorescent) from Thermofischer™, and Cy5.5 NHS ester and TAMRA nhs ester from Luminoprobe.NiNTA beads and endotox kit were purchased from Genscript™.
[0154] Insertion site selection We localized externally located loop regions facing outward from the protein surface. Specifically, we identified three insertion sites (SP1, SP2, and SP3) at Cas9 positions SP1 (A728), SP2 (T995), and SP3 (S1154). The decision to select SP3 was made by homology modeling of SpCas9 in the SWISS-Model workspace and on Pymol, taking into account the freedom of loop movement. The homology model was achieved by submitting the amino acid sequence of the canonical nuclease to the SWISS model server and then comparing it with a mock insert at the sp3 position. Figures 1, 2A, and 2B were generated using the canonical sequence.
[0155] Alternative positions were explored. For example, Ala 725 in Cas9 (marked in red and with an arrow in Figure 1) was explored and found to be at the beginning of an alpha helix, partially hidden from display on the surface of the protein. In comparison, Ser 1154 (i.e., SP3) can be clearly seen to be part of the external, unhidden loop domain (marked in red and with an arrow in Figures 2A and 2B). The external surface is exposed and in contact with the solution in which the protein is placed, as well as molecules contained in the solution.
[0156] The selected insertion sites and the peptide recognition sequences inserted therein are summarized in Table 7. Eight different peptide recognition sequences of 5 to 18 amino acids were inserted at one of two sites (SP1 and SP3). The peptide recognition sequences targeted one of three different receptors: EGFR, CD4, and transferrin receptor.
[0157] [Table 7]
[0158] Vector Generation The protein expression vectors used are listed in SEQ ID NOs: 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, or 45. Proteins were expressed in E. coli using bacterial expression vectors employing the T7 promoter. Inserts were synthesized to encode the PNME and complementary sequences. The vectors contained a pB322 origin, a repressor of primer (ROP) element for low copy number, kanamycin or ampicillin resistance genes, and a nucleotide sequence encoding the PNME. Transcription is continued until isopropyl β-D-1-thiogalactopyranoside (IPTG) is introduced. The Lac repressor, T7 promoter, and ribosome binding site for inhibition were applied, completing the basic structure of the expression vector. Vectors plus inserts were either ordered through commercial suppliers or prepared from libraries of DNA segments for each component and assembled using either Golden Gate Assembly or Gibson Assembly. The base C9m and M7 bacterial expression vectors were synthesized by assembly cloning.
[0159] Site-directed mutagenesis services from commercial suppliers were used to graft inserts of less than 15 amino acids or less than 30 DNA base pairs into the vector sequence, where the base C9m and M7 nuclease expression vectors were the template vectors and the inserts were determined by the desired amino acid sequence required in SP1, SP2 or SP3 as required.
[0160] [Table 8]
[0161] Creation of a common backbone for insertion of all fragments The common C9mAur fragment was amplified using the following primers: C9m_fwd and C9m_rev. The template for amplification was the C9mAur vector. The product size was confirmed by gel electrophoresis. The fragment linearized the plasmid and cleaved C9mAur at the position of the loop domain we intended to clone into. A Dpn1 treatment was performed to digest the template plasmid. Dpn1 was first inactivated (PCR cleanup column and quantification of the fragment) and Dpn1 digestion was confirmed by DH5a transformation resulting in zero colonies.
[0162] Zero-linker insert: Creation of C4n1 C4n1 amplified fragments were performed using primers minC4n_fwd and commonC4n_rev, and the template for amplification was the C4n vector. Product size was confirmed by gel electrophoresis. Dpn1 treatment was performed to digest the template plasmid. Dpn1 was first inactivated (PCR cleanup column and quantification of the fragment), and Dpn1 digestion was confirmed by DH5a transformation resulting in zero colonies. The resulting fragments were purified and quantified, and then used for cloning.
[0163] Assembly Assembly was performed with the following steps: 1) PCR amplification, 2) Gibson assembly, and 3) colony screening. PCR amplification was performed with the following steps repeated for 32 cycles: a) 98°C for 30 seconds, b) 98°C for 8 seconds, c) 72°C for 30 seconds, followed by 72°C for 5:50 minutes and 82°C for 2 minutes. The PCR mix consisted of 10 μL of 5x Q5 buffer, 1 μL of 10 mM dNTPs, 2 μL of 5x Q5 enhancer, 2 μL of template (C9mAur-30 ng / μL), 0.5 μL of Q5 High-Fidelity Polymerase, 1 μL of forward and reverse primers (25 μL). The PCR product (11 kb) was treated with Dpn1 (Thermo Scientific™) twice by adding 1 μL of Dpn1 for 1 hour at 37°C, and then purified using a Qiagen™ purification kit.
[0164] To perform colony screening, PCR amplification was performed using 18.2 μL of water, 3 μL of Taq buffer, 2.4 μL of 25 mM MgCl, 3 μL of 2 mM dNTPs, 2.5 μL of 10× enhancer, 0.3 μL of T7 promoter (600 μg / mL), 0.3 μL of T7 terminator (600 μg / mL), and 0.3 μL of Taq polymerase (5 μL). The PCR program was 94°C for 2 minutes, followed by 29 cycles of 95°C for 30 seconds, 50°C for 30 seconds, and 68°C for 1 minute / kb, followed by a temperature hold at 72°C for 10 minutes, with a final temperature of 4°C. The resulting fragment was sequenced by Sanger sequencing using the c9mfwdscreen forward primer (CAAGAAAACAGAAGTACAGACAG) (SEQ ID NO: 105) and the c9mrevscreen reverse primer (CTAGCCAGCATCCGTTTACGAC) (SEQ ID NO: 106).
[0165] Protein Expression Test The sequence-characterized expression vector was transformed into chemically competent BL21(DE3). For transformation, either commercial chemically competent BL21, based on the calcium chloride method, or homemade competent cells were used. The transformation buffer was prepared by first preparing a 1 M calcium chloride solution by dissolving 1.1 g in 10 mL of water, then transferring 1 mL of this solution to a fresh tube and adding 9 mL of distilled water. It was then filter-sterilized into a fresh tube, labeled "Transformation Buffer." For improved results, pre-cool the buffer in a refrigerator for at least 1 hour before use.
[0166] The day before the transformation protocol, 10 mL of LB broth was inoculated with BL21 cells or any other E. coli species in a 15 mL tube. It was placed in a rotating / shaking incubator at 37°C and grown overnight. 100 μl of the overnight solution was inoculated into 10 mL of fresh LB and grown for 2 hours. The pelleted cells were harvested by centrifugation at 4,500 rpm for 2-3 minutes. The supernatant was discarded, and the pellet was resuspended in 1 mL of transformation buffer. The resuspension was transferred to a 1.5 mL tube and centrifuged again at 12,000 rpm for 30 seconds. The supernatant was discarded. The pellet was resuspended using 1 mL of transformation buffer by gentle pipetting. The centrifugation / resuspension process was repeated twice. 100 μl of transformation buffer was added to the resuspension for high-efficiency transformation. 50-400 ng of DNA was added, and the mixture was then incubated on ice for 30 minutes. A heat block was preheated to 42°C and a 45-second heat shock was performed for BL21 and derivatives, or a 30-second heat shock for T7. The heat-shocked solution was immediately cooled on ice for 2 minutes. 650 μL of fresh SOC was added and incubated at 37°C for 4 hours with shaking / rotation at 250 rpm (especially for Kan resistance vectors). When using DH5, 100 μl was plated onto the appropriate antibiotic selection plate. When using BL21 (shuffle and derivatives), pelleted cells were obtained by centrifugation at 12,000 rpm for 10 seconds. The entire pellet was plated with an additional 100 μL of medium. The pellet was spread using a sterile spreader or inoculation loop. The plate was incubated at 37°C for 2-3 days until colonies emerged.
[0167] All vectors and constructs were expressed in BL21(DE3) in 2x yeast extract tryptone (2xYT) or Luria Bertani (LB) medium under 0.2–1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) induction. Initial protein expression studies were performed in 4 mL culture volumes prior to scale-up purification, as detailed below.
[0168] Up to 100 ng of vector was used to transform chemically competent BL21(DE3) E. coli with the protein expression vector. After plating the cells on the appropriate antibiotic-restrictive plates, single colonies were picked and confirmed by growing a 4 mL culture in 2xYT medium and inducing with 1 mM IPTG for 24 hours at 18°C with rotation at 150 rpm. Once confirmed, a starting culture was initiated based on the desired total volume of the scale-up culture. The scale-up culture was grown at 37°C until the optical density (OD) at 600 nm reached (0.6-0.8). The cells were then immediately cold-shocked by placing the culture vessel in ice water for 15 minutes to induce chaperone expression. Once complete, induction could be performed with IPTG at concentrations of 0.2-1 mM, and incubation was completed for 18-24 hours at 18°C. The cells were harvested by centrifugation at 5000 rpm at 4°C. Lysis was performed in 500 mM NaCl, 20 mM tris(hydroxymethyl)aminomethane (TRIS), 10 mM imidazole supplemented with 1 mg / mL lysozyme and 0.5% Triton X100. Lysozyme digestion was performed at 4°C with shaking for 1 hour, with the addition of non-ethylenediaminetetraacetic acid (EDTA)-containing protease inhibitors. After 1 hour, DNase 1 and RNase (both at 0.25 mg / mL) and MgCl2 up to 5 mM were added to disrupt bacterial nucleic acids. Lysis was completed by either freeze-thawing, sonication, or homogenization to increase the culture volume / pellet mass.
[0169] The lysate was clarified by centrifugation at 9000 rpm for 30 minutes at 4°C. All subsequent chromatography steps were performed at 4°C. Approximately 1.5 mL of the lysate was spun onto 2 x 5 mL HisTrap™ High Performance columns overnight at 4°C to ensure maximum binding. -1The clarified lysate was loaded in parallel using a peristaltic pump. The parallel columns, along with the bound protein, were attached to an AKTA FPLC™ liquid chromatography system. The columns were washed with 10 column volumes of wash buffer (20 mM Tris-Cl, pH 8.0, 250 mM NaCl, 5 mM imidazole, pH 8.0, 1.5 mL min) until the absorbance again nearly reached baseline. -1 After washing, the column was eluted with a 0-500 mM imidazole gradient (elution buffer: 20 mM Tris-Cl, pH 8.0, 250 mM NaCl, pH 8.0, 0-500 mM imidazole) and collected in 2 mL fractions. Fractions were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
[0170] Certain proteins require removal of maltose-binding protein (MBP), which is achieved using 0.5 mg of tobacco etch virus (TEV) protease per 50 mg of protein. The nuclease sample is then dialysis buffer (20 mM N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid (HEPES)-KOH, pH 7.5, 150 mM KCl, 10% (v / v) glycerol, 1 mM dithiothreitol (DTT), 1 mM EDTA) to approximately 1 mg mL. -1 The sample was diluted to 1000 kDa and dialyzed in dialysis tubing with a molecular weight cutoff (MWCO) of 12-14 kDa against 2 L of dialysis buffer overnight at 4 °C. Dialysis buffer (without DTT and glycerol) can be prepared as a 10x stock, but DTT should be added immediately before use. The collected dialyzed sample was centrifuged at 3900 rpm (approximately 3200 x g) for 5 min at 4 °C to remove any precipitate. TEV protease cleavage was confirmed using SDS-PAGE.
[0171] All resulting proteins (with or without TEV cleavage) were then analyzed by 30,0 The protein was concentrated into size-exclusion chromatography (SEC) buffer (20 mM HEPES-KOH, pH 7.5, 500 mM KCl, 1 mM DTT) using a 0.00 MWCO ultracentrifugal filter to a volume of less than 1.5 mL and filtered through a 0.22 μm filter prior to loading into an injection column for gel filtration on a HiLoad™ 26 / 600 Superdex 200 prep-grade gel filtration column (GE Healthcare) equilibrated with SEC buffer. The concentrated SEC buffer solution was injected into the column using a 10 mL sample loop. The column was run for 1 mL min. -1 The protein was eluted with 320 mL of SEC buffer at a flow rate of 100 s, and 2 mL fractions were collected. Peak fractions were analyzed using SDS-PAGE. SDS-PAGE was also performed on concentrated fractions. The final sample was exchanged into a storage buffer with the following composition: 25 mM Na phosphate, pH 7.25, 300 mM NaCl, and 200 mM trehalose (with or without DTT or glycerol, depending on short- or long-term storage requirements). Protein was aliquoted and stored at a concentration of 10 mg / mL. Expression of the synthesized C9m5m, C9m6m, C96SP, C96x2, C9ET, and C9C4 is shown in Figure 3. All PNMEs in Table 7 were successfully expressed, and the resulting proteins folded properly. Thus, it was successfully demonstrated that peptide recognition sequences of 5 to 18 amino acids can be expressed and inserted without interfering with PNME function as a nuclease.
[0172] Synthesis of sgRNA / gRNA sgRNAs (Cas9 derivatives) and gRNAs (Cas12a derivatives) were purchased as single-piece guides from commercial suppliers or synthesized in-house by in vitro synthesis (IVT). The IVT synthesis method for synthesizing sgRNAs involves the synthesis of ssDNA in the following format (following the NEB sgRNA guide synthesis method): The T7 polymerase promoter sequence was followed by a cr DNA sequence with an overlap for the reverse complement encoding the tr:RNA backbone as DNA.
[0173] The NEB™ EnGen™ Synthesis Kit was used for IVT synthesis. DNA strands were added to the premixed reaction mixture according to the manufacturer's instructions (recommended 2 micrograms of template DNA in the form: T7 promoter-GG-XXXXXXXX seed sequence and backbone) and incubated at 37°C for 12 hours for maximum yield of short templates. Bleach agarose gel or urea polyacrylamide gel electrophoresis was used to verify the RNA. The Zymo™ Clean and Concentrate Kit was used to remove impurities from the RNA according to the manufacturer's instructions. Quantification was performed by UV / VIS and, after adding RNas inhibitors (various manufacturers), the samples were stored at -80°C.
[0174] Guide RNA for Cas12 was purchased as a single guide from Horizon™ or IDT™ or synthesized by overlap PCR to generate a double-stranded DNA template. The double-stranded template contained a T7 promoter sequence followed by the tr gRNA backbone for Cas12a and terminated with cr RNA (as the DNA sequence for the guide). The sequence was converted to RNA using the NEB™ T7 Transcription Kit, and all subsequent steps of purification, quantification, and storage were identical to those for the synthesis of the Cas9 derivative sgRNA guide described above.
[0175] Fluorescent labeling with pHab dye Fluorescent labeling was performed to visualize the localization, binding, and cellular internalization of PNME. pHab is a pH-sensitive dye manufactured by Promega™ in both N-hydroxysuccinimide ester (NHS) or maleimide formats for bioconjugation. Bioconjugation to PNME proteins was achieved by following the manufacturer's instructions for amide coupling of the N-succinimide pHaB dye to primary amines on the protein. Briefly, protein (5–10 mg) was aliquoted into a 1.5 ml tube, and the dye was dissolved in DMSO (200 microliters per mg) to obtain 24 microliters to provide an excess of dye:protein of at least 5:1, depending on the protein molecular weight. The reaction mixture was incubated on ice for 4 hours, protected from light. Purification of the protein from unconjugated dye involved a two-step quenching of remaining NHS groups (either 1 M Tris or ethanolamine) and gel extraction of remaining small molecules (Pierce G25 spin column). The purified protein was then tagged with a pH-sensitive dye. When internalized into cells, a decrease in pH leads to an increase in fluorescence. Protocols for the attachment of other NHS ester dyes, such as Cy5.5 NHS or Tamra NHS, were accomplished in the same way.
[0176] Figures 5A and 5B show cellular binding of PNME to A549 cells after 12 hours of incubation with A549 cells. Concomitant with internalization, the fluorescent signal of the dye turned on as the pH became more acidic, verifying intracellular PNME delivery, since the signal (Figure 5B) localized to the cytoplasmic compartment as defined by brightfield microscopy (Figure 5A). Fluorescence imaging was achieved using an Olympus™ BX fluorescent microscope with a CY3 filter and brightfield microscopy with phase contrast.
[0177] Generalized fusion protein preparation For functional CRISPR nucleases, a ratio of 1:1 to 1:9 (nuclease:sgRNA) can be used. If the protein is of good quality and has been stored properly, an equimolar formulation is generally appropriate. For example, 1 μM PNME protein was pipetted into a 0.2 mL polymerase chain reaction (PCR) tube, 1 μM guide RNA was added, and gentle pipetting was performed. Complexation was complete within 15–20 minutes at room temperature. All PNMEs followed this sgRNA complexation method.
[0178] When PNME was used in combination with either a biotinylated donor or a biotinylated aptamer or a biotinylated scFv or a biotinylated peptide, the biotin-modified components were added to the protein complex in equimolar ratios.
[0179] In vitro cleavage protocol Cleavage (i.e., nuclease function) was first assessed in vitro to confirm that the insertion of the display domain did not affect nuclease cleavage function. PNME and sgRNA / gRNA were first thawed on ice. PCR product cleavage template (Kras g12s amplicon synthesized by PCR from A549 cells) was thawed. The PCR composition detailed in Table 9 was prepared, mixed by pipetting, and then incubated at 37°C for 45 minutes. To prepare the PCR composition, gRNA and nuclease were first mixed in buffer and allowed to complex at room temperature for 20 minutes, after which the template was added.
[0180] [Table 9]
[0181] Blank reactions were prepared as described above, but without the primer to prevent template cleavage. The template was added (and mixed by pipetting) to both the blank and test reactions (with the primer). The resulting mixture was incubated at 37°C for 45 minutes in a thermocycler. After incubation, 1 microliter of proteinase K (10-20 mg / mL) was added, mixed, and incubated at 37°C for 15 minutes. A 4 μL loading of fluorescent DNA dye (i.e., Sybr) was added to all reactions in the wells. Results were analyzed by running a 1.5-2% agarose gel to confirm cleavage. All reactions were run with a negative control to compare the template. The negative control did not contain any nuclease; the nuclease was replaced with an additional volume of HO.
[0182] The gel was used to calculate the guiding efficiency (in vitro). Quantification was based on relative band intensity. The indel percentage was determined by the following formula:
[0183]
number
[0184] (where a is the integrated intensity of the undigested PCR product, and b and c are the integrated intensities of each cleavage product.) Figure 4 shows a gel demonstrating in vitro cleavage for C9m5m, C9m6m, and C9ET.
[0185] T7 endonuclease assay for evaluating gene editing The principle of the T7 endonuclease I assay is to demonstrate indel formation in gene-edited loci. The first step was PCR amplification from extracted genomic DNA, followed by purification of the PCR amplicon. According to the NEB protocol, the amplicon was heated to 95°C for 2–5 min and then gradually cooled to allow heteroduplex formation between the wild-type and edited strands. This mismatch causes a bulge in the DNA that is recognized by T7 endonuclease I, which cleaves the strand. Incubation is typically at 37°C for 20–30 min. After removal of the endonuclease by 1 M EDTA or, preferably, proteinase K treatment at 56°C for 5 min, the sample was ready for gel analysis on a 1.5% agarose gel in TAE buffer, run at 100 V for 20 min.
[0186] The goal was to demonstrate indel formation in a rapid and cost-effective manner: the formation of truncated products or, in the case of large indel formation, degradation of the original amplicon are clear determinants of achieved gene editing.
[0187] All T7 assays were preceded by DNA extraction from sample cells using a silica column DNA extraction and purification method as per the manufacturer's instructions (Biobasic Genomic DNA extraction kit) or alternatively using Thermofisher direct PCR with Protease K & detergent cell lysis.
[0188] PCR amplification was performed using Kras G12s primers, which also amplify the WT Ras sequence, and was used in DNA samples from A549 and H2228. Thermofisher™ Direct PCR or KDplus™ (transgen) PCR amplifications could be used with either silica column-purified DNA or direct PCR samples; reactions were set up according to the respective manufacturer's specifications, and the temperature setting for the primers was 58°C.
[0189] The amplicons can be used directly in T7 endonuclease assays, but a PCR cleanup is preferred. Quantification of the purified products was achieved by UV / VIS spectroscopy.
[0190] To prepare the T7 reaction, add 200 ng of PCR product, 2 μL of 10x NEB™ Buffer 2.0, and HO to a volume of 19 μL. The reaction was performed in a 0.2 mL PCR tube.
[0191] The PCR products were annealed to form heteroduplexes using a PCR thermocycler by the following steps: Initial denaturation was performed at 95°C for 5 minutes. Annealing was performed from 95 to 85°C with a temperature ramp of 2°C / s to 85°C and then at a rate of 0.1°C / s to 25°C.
[0192] T7 was added to the annealed DNA sample (1 μL of T7 endonuclease) and incubation was carried out at 37°C for 1 hour. The reaction was stopped by the addition of proteinase K and incubated at 37°C for 20 minutes to remove the T7 endonuclease from the cleaved DNA product. The product was run on a 1.5-2% gel with the addition of 4 μL of a fluorescent DNA dye (sybr) and imaged using a ChemiDoc™.
[0193] cell culture A549 and H2228 cells were cultured at 37°C and 5% CO2 in Dulbecco's Modified Eagle's Medium (DMEM) (10% fetal bovine serum (FBS), penicillin / streptomycin (Pen / Strep) with sodium pyruvate and glutamate) and Roswell Park Memorial Institute (RPMI) medium (Pen / Strep with 10% FBS, sodium pyruvate and glutamate), respectively. Media was purchased from Wisent™. Cultures were passaged when they reached 90% confluence.
[0194] Live / dead cell assay Live / dead staining was used to evaluate the ability of the PNME synthesized in this example to selectively target and kill cancerous cells. Cell death was assessed at 24, 48, and 72 hours using an acridine orange (AO) / propidium iodide (PI) assay. The principle of the assay is that acridine orange is lipid-soluble and stains healthy cells bright green (approximately 520 nm). When cells are apoptotic or necrotic, membrane integrity allows propidium iodide to pass into the cytoplasm and thus access nuclear DNA. Apoptotic cells stain red-amber, and completely necrotic cells exhibit red nuclear staining due to PI. To perform the assay in a 96-well plate, 1 μL of each stain was added to the medium in each well. The AO stock concentration was 50 μg / mL, and the PI stock concentration was 1 μg / mL. Cells were incubated at 37°C for 15 minutes to allow diffusion of the dye into the cells. The medium was removed and replaced with PBS supplemented with 10% FBS, and the plates were imaged using a fluorescent microscope.
[0195] Microscopy: Brightfield & Fluorescence Imaging Brightfield and fluorescent images were collected using an upright Olympus™ BX51 fluorescent microscope. Fluorescent imaging for pHab was performed using a Cy3 filter set. Image acquisition was accomplished using an adapted Canon EOS Rebel T6i.
[0196] For the live / dead fluorescence assay using AO / PI, which yields green fluorescence from live cells and red fluorescence from dead cells that have lost membrane integrity, a USB fluorescence imager was used with GFP and RFP long-pass filters. AO / PI was added at equal concentrations of 1 μg / ml to the medium in 96-well plates for 10 minutes to allow intracellular diffusion, after which the medium was removed and replaced with fresh PBS + 5% FBS to maintain cells during imaging and reduce background signal.
[0197] Figures 6A-6F show live / dead staining of A549 cells during the gene editing process with KrasG12s at 24 hours (Figures 6A-6B) and 72 hours (Figures 6C-6D) compared to control H2228 cells (Figures 6E-6F). Figures 6A-6F demonstrate the impact of KrasG12s gene ablation. While more than 99% of cells were found to be viable in the control, 7% of A549 cells were dead at 24 hours, and 76% were dead and 15% were apoptotic at 72 hours.
[0198] Figure 7 shows gel quantification of a T7 endonuclease assay assessing editing in A549 G12s cells compared to control H2228 WT Ras cells at 72 hours. T7 endonuclease is identified as a heteroduplex in PCR products amplified from DNA extracted from targeted cells. If editing was achieved, a small molecule product / smear was produced on the gel; if editing was not achieved, the PCR product remained intact. Estimates of editing percentage were performed semiquantitatively as shown in Figure 7 and then further quantified by next-generation sequencing (NGS) assay. Figure 8 shows NGS sequencing results of DNA from cells gene-edited with PNME. Figure 8 shows three independent biological replicates of A549 cells with DNA extraction and PCR amplification of the G12s locus after PNME treatment at 72 hours. Three independent biological replicates. In each experiment, experiments were performed in triplicate. Amplicons were sent for Illumina amplicon sequencing to identify WT and indel sequences. The minimum reads per sample was 50,000.
[0199] Figures 9A and 9B show the expression of C9C4 (alternative name C9m4m), which is the top band in the fractions above 130 kda on the protein MW ladder. As shown in Figure 9B, it was possible to improve targeting of C9m5m or C8mAur to higher uptake PNMEs using the addition of an additional ligand via a biotin-conjugation strategy to MAV. In some cases where effective accumulation was already high, such as C9m6m, no significant improvement was observed with the bispecific strategy. Purification of C9C4 was performed by fast protein liquid chromatography (FLPC). Gel images are used to show the protein content and molecular weight of fractions collected from FLPC gel filtration. The fraction labeled "1" in Figure 9A is the eluted fraction. The fraction labeled "2" is the fraction obtained after TEV protease treatment. Fractions labeled "3" or higher were obtained from FLPC on Superdex200™ using 0.5 M KCl, 20 mM HEPES, pH 7.5. Briefly, proteins were expressed in E. coli (De3 BL21 strain) using the common IPTG or autoinduction method for T7 promoter-controlled expression. Overnight expression at 18°C was followed by cell lysis using sonication and mild detergent lysis, followed by the first step of his-tag purification using a Ni-nitriloacetic acid (NTA) column. After TEV cleavage of the MBP domain and buffer exchange, the concentrated protein fractions were loaded onto a Superdex200™ gel filtration column for size-based purification and cleanup.
[0200] Animal models The goal of the animal model study was to determine the maximum tolerated dose of the PNME gene editing complex to allow for dose range selection for the study. Tolerability was assessed using single and repeated intravenous (IV) dose administration along with pharmacokinetic (PK) fluorescence imaging. Nude or NOD / SCID female mice were used. Animal groups are summarized in Table 10.
[0201] [Table 10]
[0202] Treatment was initiated on day 1 with the lowest dose. After injection in one animal, the animal showed physiological changes. The animals were observed for 1 hour to ensure normal physiological activity. The remaining animals in the group were then injected. On day 2, all animals were observed to have good vital signs and were physiologically normal. The procedure was then repeated with the next higher dose group. On day 7, the still active group was administered a fluorescently labeled compound and "PK" imaging data was acquired. In this experiment, PNME was fluorescently labeled to track its progression through the animal's body. The study continued for 30 days, after which the animal's weight and survival were assessed.
[0203] Biodistribution and primary / efficacy experiments were performed to determine compound dose and dosing frequency. This was done by monitoring the presence of compound in tumors over time. Experimental conditions (arms) are summarized in Table 11. Two doses were given to each arm, on days 0 and 10. The study lasted 22 days, after which tumors were assessed by bioluminescence. Tumor accumulation of PNME was assessed via tumor uptake of Cy5.5-labeled protein. Serum clearance assay evaluation was performed by blood collection and serum centrifugation and fluorescent quantification of PNME remaining in the serum over a 7-day period. Necropsy was performed at the completion of the study to compare uptake in various organs.
[0204] [Table 11]
[0205] The inoculated tumor was approximately 200 mm 3Tumors were allowed to grow until tumor size was reached, and the animals were then assigned to groups in Table 10, matched for tumor size. The animals were then administered an agent in Table 11 and monitored from day 0 to day 7 by whole animal fluorescence imaging, with blood sampling to estimate clearance rates using the fluorescence of the agents in Table 11. Tumor accumulation was assessed at 48 hours. The animals were euthanized on day 7, and blood and tissue samples were collected. Blood and tissue samples were imaged, as well as the whole carcass. Plasma (or serum) and tumors were frozen for further analysis. Organs were also imaged to assess the persistence of the agents in Table 11 in each organ.
[0206] Blood / plasma / serum and tumor drug concentrations were monitored over time. Tumor reduction as a result of gene editing using PNME was also observed. Gene editing was assessed by T7 endonuclease assay.
[0207] Bispecific PNME with biotinylated ligands To characterize the animal xenograft model, a baseline of growth rate and variability was established in untreated animals to avoid the risk of efficacy studies and to better understand the impact of therapeutic PNME injections. 6 A549 cells were used The tumor was inoculated using a 3 Tumors were allowed to grow until 10 days after the initial incubation period. Tumors were measured for bioluminescence two to three times weekly until the end of the study and euthanasia as described above. Tumor volume, growth rate, and body weight were measured. Tumors were sized using inducible luminescence imaging.
[0208] C9m5m, C9m6m, and C9mAur (non-targeted CRISPR scaffolds) were modified to yield bispecific C9m5mA, C9m6mA, and C9mAurA, respectively, with biotinylated moieties that target A549 cells.
[0209] Figure 10 shows tumor fluorescence 48 hours after administration of PNME, and Figure 11 shows the percentage improvement of bispecific biotinylated PNME compared to the corresponding unmodified monospecific PNME. PhAB dye was used for its turn-on fluorescent signal based on the acidic pH of cancer cells. Figure 11 describes the percentage improvement of a system with the ability to conjugate an additional modulator, defined as the biotinylated a549 aptamer, to create a bispecific Nuc-Nab conjugate, or, in the case of C9mAur, a simply targeted PNME (single target).
[0210] Serum clearance assay Serum clearance was measured by fluorescence of Cy5.5 conjugated to PNME. Briefly, serum samples were obtained from tail vein blood at 0-168 hours (7 days); serum samples were prepared from whole blood by centrifugation at 14,000 rpm for 4 minutes, and serum was transferred to 0.2 ml tubes. All tubes were placed in an IVIS™ fluorescent imager and evaluated for Cy5.5 fluorescence (exposure 1 second, fstop: 1, bin: 8). Counts were determined using IVIS™ analysis software, and data analysis was performed in Excel.
[0211] Figure 12 shows the serum clearance of the administered compositions over a 180 hour period. C9m5m, C9m6m, and C9mAur all showed better serum retention compared to the control vehicle and the larger protein complex of FNM7 (partial guide complexation, 1:1 molar ratio of sgRNA:protein).
[0212] Figure 13 shows the serum clearance of the bispecific C9mAurA, C9m5mA, and C9m6mA (biotinylated with an EGFR-targeting moiety) as well as FnM7 2sg (fully guide complexed sgRNA:protein at a 2:1 molar ratio). Similar serum clearance was observed for C9mAurA, C9m5mA, C9m6mA, and FnM7 2sg.
[0213] In vivo luciferase bioluminescence Luciferase bioluminescence was used to determine size and assess tumor availability. Briefly, luciferase was administered via intraperitoneal injection of 100 μl (1.5 mg luciferase in 100 microliters). Mice were anesthetized and placed in an IVIS™ fluorescent imager, with the channel opened to allow bioluminescence. Conditions were 5 minutes post-injection, 1 second exposure, fstop setting 1, and binning 8. Imaging was performed every two weeks throughout the course of the experiment. The ability to acquire a bioluminescent signal was conferred by the presence of the luciferase gene in the cancer cell line of the xenografted cells, in this case A549-Luc. Tumors were automatically sized within the IVIS™ software environment, and counts for each tumor were transferred from the IVIS™ acquisition to Excel for spreadsheet preparation and graphing.
[0214] Luciferase expression and the resulting bioluminescent signal were used to monitor the administered vehicle. The tumor targeting efficiency of C9m5m (control, PBS injection), C9m6m, FNM7, C9mAurA, C9m5mA, and C9m6mA was evaluated. When tumor growth slowed and tumor cells became nonviable, reduced bioluminescence was observed compared to untreated controls. Bioluminescence signals were normalized for tumor volume and plotted in Figure 14. The first measurement was performed 72 hours after the first intravenous injection at 1 / 3 the MTD. From the tolerability study, it was determined that the maximum tolerated dose should be set at 100 mg / kg equivalent for mice, since no deaths were observed in the tolerability study. 100 mg / kg was determined to be the maximum that could be feasibly injected into animals based on protein solubility and injection volume. This is surrogately referred to as the MTD. 1 / 3 mTD is equivalent to 600 micrograms per injection for mice, which, adjusted for mouse mass, gives a dosage of 30 mg / kg. A second injection was administered on day 10 (240 hours). Control of tumor growth and survival was maintained through day 22 (528 hours), when all animals were euthanized for necropsy. Tumor numbers were completely eliminated in the treated (but not control) cases.
[0215] Figure 15 shows tumor reduction observed by bioluminescence or Cy5.5 fluorescence. C9m5m and C9m6m demonstrated the ability to reduce and eliminate tumors. FNM7 2sg was effective in eliminating tumors due to increased gRNA. The bioluminescence observed in Figure 15 is an indicator of cell health and correlates with tumor size and tumor elimination.
[0216] Accumulation of the administered compositions was measured in various organs and tissues (liver, lung, kidney, spleen, lymph, and target tumor). Figures 16 and 17 show that tumors had the second highest accumulation of C9m5m, C9m6m, C9mAur, C9m5mA, C9m6mA, C9mAurA, and FNM7. Bisected tumors demonstrated complete penetration into the tumor core after two injections.
[0217] T7 endonuclease assay The principle of the T7 endonuclease I assay is to demonstrate indel formation at gene-edited loci. The first step is PCR amplification from extracted genomic DNA, followed by purification of the PCR amplicon. According to the NEB protocol, the amplicon is heated to 95°C for 2–5 min and then gradually cooled to allow heteroduplex formation between the wild-type and edited strands. This mismatch causes a bulge in the DNA that is recognized by T7 endonuclease I, which cleaves the strand. Incubation is typically at 37°C for 20–30 min. After removal of the endonuclease by treatment with 1M EDTA or, preferably, proteinase K at 56°C for 5 min, the sample is ready for gel analysis on a 1.5% agarose gel in TAE buffer, run at 100 V for 20 min.
[0218] Figure 18 shows the gel of on-target first-pass evaluation for C9mAurA, C9m5m, C9m6m, C9m5mA, C9m6mA, and FNM7. After two injections, the editing percentage of T7 was found to be higher than 90% for all of C9mAurA, C9m5m, C9m6m, C9m5mA, C9m6mA, and FNM7. Gene editing with C9m and modulators results in higher tumor accumulation.
[0219] Figure 19 shows a gel of off-target first-pass assessment by T7 endonuclease assay across the top five off-target sites (Table 12). With the exception of C9mAur, no other T7 bands were formed, suggesting no significant cleavage in the first pass.
[0220] [Table 12]
[0221] Direct injection of C9m5m into tumors in vivo Direct injection of C9m5m into tumors was performed to evaluate the ability of the synthesized PNEM to reduce and eliminate tumor mass and cells. C9m5m was injected directly into A549 tumors in an animal model grown to a volume of 1000 m3. The amount of C9m5m was 150 μg. Fluorescence was used to assess the presence of Cy5.5-labeled Nuc-Nab, and bioluminescence was assessed using a luciferase reporter gene in A549 xenografts. Luciferase signal was an indicator of cell health, as cell death leads to a lack of expression, and therefore could be used to immediately assess tumor viability in vivo and ex vivo from necrosis. Figure 11 shows a tumor bisected longitudinally at necrosis. It is evident from the large areas of necrosis that the injected nuclease nab caused extensive degradation of the tumor's internal architecture. Bioluminescence was monitored over 8 days. The greatest decrease in bioluminescence was evident on day 6, and the experiment was continued to day 8 to determine whether cell proliferation recovered. Cell proliferation recovered, but not to the initial bioluminescence on day 0, suggesting a significant effect on cell survival.
[0222] Tumors were removed during necropsy and bisected along their longitudinal axis, revealing extensive necrosis (Figure 20), which correlated with bioluminescence assessment (Figure 21). Four sample locations were selected (samples 1, 2, 3, and 4), as shown in Figure 20. Regrowth in the lower lobe was observed in the preceding days, as verified by luminescence signals from viable cells. Cell survival was determined by luciferase expression and luciferin bioluminescence reaction. Figure 22A shows the in vivo tumor prior to any injection of C9m5m. Figure 22B shows the retained fluorescence in the tumor 6 days after injection. Fluorescence was also distributed throughout the animal body. Figure 22C shows decreased tumor bioluminescence compared to Figure 22A, indicating a decrease in the number of viable tumor cells. Similar observations were made on day 8 for fluorescence (Figure 22D) and bioluminescence (Figure 22E).
[0223] DNA was extracted from samples 1-4 (Figure 20) and PCR amplification of the Kras G12s locus was performed. A T7 endonuclease assay was used to provide a semi-quantitative assessment of gene editing / indel formation caused by C9m5m. As shown in Figure 23, the T7 assay confirmed cleaved products, which correlated with low cell survival by bioluminescence, and indel formation, which correlated with high C9m5m tumor fluorescence.
[0224] Preliminary analysis of the top five predicted off-target sites was performed by PCR amplification and T7 endonuclease assay. No indels were observed through this screening analysis (Figure 24). PCR lanes 1-5 show amplicons from the top five off-target sequences. T7 assay lanes 1b-5b show T7 digestion products of the five top sequence amplicons. None of the digests from 2b-5b, PCR, or digestion for lane 1 produced any specific products.
Claims
1. A polynucleotide modifying enzyme, a functional nuclease domain comprising a nuclease catalytic pocket; and A display domain comprising a peptide recognition sequence of 3 to 20 amino acids in length in a loop, an alpha helix, or an extension from the end of the alpha helix located on the outer surface of the polynucleotide modifying enzyme, wherein the peptide recognition sequence recognizes a target cell receptor of a target cell, thereby enabling cellular internalization of the polynucleotide modifying enzyme into the target cell. The polynucleotide modifying enzyme comprising:
2. The polynucleotide modifying enzyme of claim 1, wherein the nuclease catalytic pocket is a Cas nuclease catalytic pocket, a recombinase catalytic pocket, or a meganuclease catalytic pocket.
3. The polynucleotide modifying enzyme of claim 2, wherein the Cas is a type II Cas, a functional analog thereof, a variant thereof, or a derivative thereof.
4. The polynucleotide modifying enzyme of claim 3, wherein the type II Cas is Cas9, a functional analog thereof, a variant thereof, or a derivative thereof.
5. The polynucleotide modifying enzyme of claim 4 , wherein the nuclease catalytic pocket comprises an HNH nuclease domain.
6. The polynucleotide modifying enzyme of claim 2, wherein the Cas is a type V Cas, a functional analog thereof, a variant thereof, or a derivative thereof.
7. The polynucleotide modifying enzyme of claim 6, wherein the type V Cas is Cas12, a functional analog thereof, a variant thereof, or a derivative thereof.
8. The polynucleotide modifying enzyme of claim 2, wherein the Cas is a type VI Cas, a functional analog thereof, a variant thereof, or a derivative thereof.
9. The polynucleotide modifying enzyme of claim 8, wherein the Type VI Cas is Cas13, a functional analog thereof, a variant thereof, or a derivative thereof.
10. The polynucleotide modifying enzyme according to claim 2, wherein the Cas is Cas14, a functional analog thereof, a variant thereof or a derivative thereof.
11. The polynucleotide modifying enzyme of any one of claims 1 to 10, wherein the nuclease catalytic pocket comprises a RuvC nuclease domain.
12. The polynucleotide modifying enzyme according to any one of claims 1 to 11, wherein the display domain binds to one or more epitopes on a cell surface antigen of the target cell.
13. The polynucleotide modifying enzyme according to any one of claims 1 to 12, wherein the peptide recognition sequence is 3 to 18 amino acids in length.
14. a second peptide recognition of 3 to 20 amino acids in a second loop, a second alpha helix, or an extension from the end of the second alpha helix located on the outer surface; The polynucleotide modifying enzyme of any one of claims 1 to 13, further comprising a second display domain comprising the sequence:
15. 15. The polynucleotide modifying enzyme of claim 14, wherein the polynucleotide modifying enzyme is bispecific and the second display domain recognizes a second target cell receptor.
16. The polynucleotide modifying enzyme of claim 14 or 15, further comprising a third display domain comprising a third peptide recognition sequence of 3 to 20 amino acids in a third loop, a third alpha helix, or an extension from the end of the third alpha helix located on the outer surface.
17. 17. The polynucleotide modifying enzyme of claim 16, wherein the polynucleotide modifying enzyme is trispecific and the third display domain recognizes a third target cell receptor.
18. The polynucleotide modifying enzyme according to any one of claims 1 to 17, wherein the display domain, optionally the second display domain, and optionally the third display domain are positioned at least 25 amino acids after the N-terminus and at least 25 amino acids before the C-terminus of the polynucleotide modifying enzyme.
19. The polynucleotide modifying enzyme of any one of claims 1 to 18, having at least 80% sequence identity to SEQ ID NO: 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, or 46.
20. 20. The polynucleotide modifying enzyme of claim 19, wherein the display domain begins at residue 204, 534, 558, 738, 826, 945, 995, 1026, 1154, or 1207.
21. The polynucleotide modifying enzyme according to any one of claims 1 to 20, wherein the peptide recognition sequence is a complementarity determining region (CDR).
22. A fusion polypeptide comprising the polynucleotide modifying enzyme of any one of claims 1 to 21 covalently linked to an endosomal escape domain.
23. 23. The fusion polypeptide of claim 22, further comprising a hapten-binding domain.
24. 24. The fusion polypeptide of claim 22 or 23, wherein the hapten-binding domain binds to a hapten covalently attached to a peptide, protein, oligonucleotide, aptamer, or polynucleotide.
25. 25. The fusion polypeptide of claim 24, wherein the oligonucleotide is complementary to a target gene of the target cell.
26. 25. The fusion polypeptide of claim 24, wherein the polynucleotide is a donor DNA polynucleotide comprising a 5' homology region and a 3' homology region, wherein the 5' homology region comprises a nucleotide sequence having sequence identity to a nucleotide sequence 5' to the target nucleotide sequence, and the 3' homology region comprises a nucleotide sequence having sequence identity to a nucleotide sequence 3' to the target nucleotide sequence.
27. A vector comprising a nucleotide sequence encoding the polynucleotide modifying enzyme according to any one of claims 1 to 21.
28. A vector comprising a nucleotide sequence encoding the fusion polypeptide of any one of claims 22 to 26.
29. A host cell comprising the vector of claim 27 or 28.