Materials and processes for bioengineering cells to be hypoimmunogenic - Patent Application 20070122999

By genetically modifying immunogenic cells to reduce RFX protein expression and forming hypoimmunogenic cells, the method addresses immune response challenges in cell therapies, improving their safety and efficacy.

JP2025529211APending Publication Date: 2025-09-04JANSSEN BIOTECH INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025513001
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-03-08
Filing Date
2023-08-30
Publication Date
2025-09-04

AI Technical Summary

Technical Problem

Existing cell therapy approaches face challenges such as chemical and molecular interference, cell-cell interference, competition for nutrients, cell exhaustion, and manufacturing methodologies, leading to limited approval of cell therapies for complex diseases like neoplasia and tumors.

Method used

Genetically modifying regulatory factor X (RFX) and other genes in immunogenic cells to reduce protein expression, forming embryoid bodies, and subjecting these cells to the immune system to produce hypoimmunogenic cells with reduced immunogenicity, thereby minimizing immune responses in allogeneic or non-MHC-matched subjects.

Benefits of technology

The method produces hypoimmunogenic cells with reduced immunogenicity, eliciting lower immune responses and alloreactive T cell cytotoxicity, enhancing the efficacy and safety of cell therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025529211000001_ABST
    Figure 2025529211000001_ABST
Patent Text Reader

Abstract

Provided herein are methods of hypoimmunogenicity, such as, for example, genetically modifying and / or otherwise altering at least one target gene or gene product, processes for producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells), manufacturing hypoimmunogenic cell compositions (such as engineered hypoimmunogenic cell compositions), hypoimmunogenic cell lines (such as engineered hypoimmunogenic cell lines), and bioengineering methodologies and materials, including hypoimmunogenic (such as engineering hypoimmunogenic) methodologies and materials useful for their uses.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of U.S. Provisional Patent Application Nos. 63 / 403,608, filed September 2, 2023, 63 / 403,612, filed September 2, 2023, 63 / 403,617, filed September 2, 2023, 63 / 431,410, filed December 9, 2022, and 63 / 450,714, filed March 8, 2023, the disclosures of each of which are incorporated herein by reference in their entirety.

[0002] (Sequence Listing) This application contains a Sequence Listing that has been submitted electronically in XML file format, which is incorporated herein by reference in its entirety. The XML copy was created on August 29, 2023, is named 253505_000361_SL.xml, and is 352,323 bytes in size.

[0003] FIELD OF THE INVENTION Provided herein, inter alia, are methods of hypoimmunogenicity, such as, for example, genetically modifying and / or otherwise altering at least one target gene or gene product, processes for producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells), manufacturing hypoimmunogenic cell compositions (such as engineered hypoimmunogenic cell compositions), hypoimmunogenic cell lines (such as engineered hypoimmunogenic cell lines), and bioengineering methodologies and materials, including hypoimmunogenic (such as engineering hypoimmunogenic) methodologies and materials useful for their use. [Background technology]

[0004] Cell therapy approaches are emerging and evolving, in some cases to effectively target and neutralize complex diseases such as various types of neoplasia, cancer, and tumors, in various forms and at various locations within the host. See "Studies Test CAR T-Cell Therapies Designed to Overcome Key Limitations," by Sharon Reynolds, National Cancer Institute, available online February 8, 2023 (www.cancer.gov / news-events / cancer-currents-blog / 2023 / car-t-cell-therapies-overcoming-limitations). Challenges have also been reported, for example, from chemical and molecular interference with immune cells, cell-cell interference, competition for nutrients, cell exhaustion, apoptosis, and manufacturing methodologies. Nevertheless, approval of cell therapies remains lacking. See News & Analysis, 2022 FDA Approvals, Asher Mullard, Nature Reviews Drug Discovery, Volume 22, February 2023, pages 83-88. Summary of the Invention

[0005] The inventors provide herein, inter alia, methods of hypoimmunogenicity, such as, for example, genetically modifying and / or otherwise altering at least one target gene or gene product, processes for producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells), manufacturing hypoimmunogenic cell compositions (such as engineered hypoimmunogenic cell compositions), hypoimmunogenic cell lines (such as engineered hypoimmunogenic cell lines), and bioengineering methodologies and materials, including hypoimmunogenicity (such as engineering hypoimmunogenicity) methodologies and materials useful for their use. In one aspect, a method for hypoimmunogenicity (e.g., engineering hypoimmunogenicity) comprises: a) genetically modifying a regulatory factor X (RFX) gene of at least one immunogenic human cell, wherein genetically modifying the RFX gene reduces expression of an RFX protein in the immunogenic human cell; b) forming at least one embryoid body or multicellular body from the cells of a) to produce at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell); c) subjecting the hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell) to the immune system; and d) determining the immunogenicity of the hypoimmunogenic cell (e.g., the engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to an immunogenic human cell in which the RFX gene has not been genetically modified; optionally, step a) comprises genetically modifying a class II major histocompatibility complex transactivator (CCT) of the immunogenic human cell. Provided herein are methods further comprising genetically modifying one or more of the C1I transactivator (CIITA) gene, the beta-2-microglobulin (B2M) gene, and the CD58 gene.

[0006] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) is provided, comprising: a) reprogramming an immunogenic human cell, wherein the immunogenic human cell comprises a heterodimeric T cell receptor comprising a gamma chain and a delta chain, to produce an induced pluripotent stem cell (IPC) cell. b) genetically modifying a regulatory factor X (RFX) gene in the iPS human cells, wherein genetically modifying the RFX gene reduces expression of the RFX protein by the iPS human cells; c) forming at least one embryoid body from the cells of step b) to produce at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic cell); d) subjecting the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) to the immune system; and e) determining the immunogenicity of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to iPS human cells in which the RFX gene has not been genetically modified; optionally, step b) further comprises genetically modifying one or more of a class II major histocompatibility complex transactivator (CIITA) gene, a beta-2-microglobulin (B2M) gene, and a CD58 gene in the iPS human cells.

[0007] In one aspect, provided herein is a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity), comprising: a) genetically modifying a regulatory factor X (RFX) gene in an immunogenic human cell to produce a hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell), wherein genetically modifying the RFX gene reduces expression of the RFX protein by the immunogenic human cell; b) subjecting the hypoimmunogenic cell (e.g., the engineered hypoimmunogenic cell) to the immune system; and c) determining the immunogenicity of the hypoimmunogenic cell (e.g., the immunogenic engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to an immunogenic human cell in which the RFX gene has not been genetically modified; optionally, step a) further comprises genetically modifying one or more of a class II major histocompatibility complex transactivator (CIITA) gene, a beta-2-microglobulin (B2M) gene, and a CD58 gene of the immunogenic human cell.

[0008]

[0010] In one aspect, a method for producing a hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell) from an immunogenic cell includes: (i) genetically modifying a regulatory factor X (RFX) gene in an immunogenic cell, wherein genetically modifying the RFX gene reduces expression of an RFX protein in the cell; and (ii) optionally, further genetically modifying in the immunogenic cell one or more genes selected from a class II major histocompatibility complex transactivator (CIITA) gene, a beta-2-microglobulin (B2M) gene, and a CD58 gene, wherein genetically modifying the one or more genes reduces expression of a corresponding one or more proteins in the immunogenic cell, wherein the method has the following properties: a) compared to a corresponding immunogenic cell but not having the genetic modifications of (i) and (ii);

[0013] Provided herein are methods that result in the production of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) that have one or more of: a) reduced immunogenicity when present in an allogeneic or non-MHC-matched subject; b) eliciting a reduced immune response against the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject, compared to a corresponding immunogenic cell that does not have the genetic modifications of (i) and (ii); and c) eliciting reduced alloreactive T cell cytotoxicity against the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject, compared to a corresponding immunogenic cell that does not have the genetic modifications of (i) and (ii).

[0009]

[0010] In one aspect, a method for producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells) from immunogenic cells comprises: a) reprogramming the immunogenic cells to produce induced pluripotent stem (iPS) cells; b) (i) genetically modifying a regulatory factor X (RFX) gene in the iPS cells produced in step (a), wherein genetically modifying the RFX gene reduces expression of an RFX protein in the iPS cells; and (ii) optionally, further genetically modifying in the iPS cells one or more genes selected from a class II major histocompatibility complex transactivator (CIITA) gene, a beta-2-microglobulin (B2M) gene, and a CD58 gene, wherein genetically modifying the one or more genes reduces expression of a corresponding one or more proteins in the iPS cells; and c) optionally differentiating the cells produced in step (b), wherein the method has the following characteristics: 1) the iPS cells are capable of expressing the corresponding RFX protein; 1) have reduced immunogenicity in the presence of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to cells corresponding to iPS cells or cells produced in step (c), but without the genetic modification of step (b); 2) elicit a reduced immune response against hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in the presence of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to cells corresponding to iPS cells or cells produced in step (c), but without the genetic modification of step (b); 3) elicit a reduced immune response against hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to cells corresponding to iPS cells or cells produced in step (c), but without the genetic modification of step (b).Provided herein are methods that result in the production of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, that have one or more of the following effects: causing reduced alloreactive T cell cytotoxicity against hypoimmunogenic cells, such as engineered hypoimmunogenic cells;

[0010] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) comprise a T-cell receptor (TCR) that comprises a gamma chain and a delta chain.

[0011] In some embodiments, the immunogenic cell or human immunogenic cell is optionally an immune cell selected from a T cell, a natural killer (NK) cell, a B cell, and a hematopoietic stem cell (HSC).

[0012] In some embodiments, the reduced immunogenicity of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) can be measured by: i) a reduced or eliminated myeloid cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; ii) a reduced or eliminated T cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; iii) a reduced or eliminated natural killer (NK) cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; iv) an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification. The genetic modification may be achieved by one or more of the following: a) reduced or eliminated neutralizing antibody response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject; b) reduced or eliminated MHC class II-mediated cellular response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification; c) reduced or eliminated neutralizing MHC class I-mediated cellular response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification; and d) reduced or eliminated allogeneic host-versus-graft rejection to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification.

[0013] In some embodiments, the immunogenic cells are human cells.

[0014] In some embodiments, in hypoimmunogenic cells (such as engineered hypoimmunogenic cells), i) expression of HLA class II molecules is reduced or eliminated, ii) expression of HLA-A, HLA-B, and / or HLA-C is reduced, and iii) expression of HLA-E is reduced but remains detectable.

[0015] In some embodiments, the method includes forming at least one embryoid body or multicellular body from the genetically modified cells to produce hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0016] In some embodiments, the method further comprises determining the immunogenicity of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell).

[0017] In some embodiments, the methods further comprise administering hypoimmunogenic cells (such as engineered hypoimmunogenic cells) to an allogeneic or non-MHC-matched subject.

[0018] In some embodiments, the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) is altered compared to the immunogenic cells or immunogenic human cells or iPS human cells or iPS cells, and the only difference between the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and the immunogenic cells or immunogenic human cells or iPS human cells or iPS cells is that the RFX gene and optionally one or more of the CIITA gene, B2M gene, and CD58 gene have not been genetically modified in the immunogenic cells or immunogenic human cells or iPSC human cells or iPS cells.

[0019] In some embodiments, the immunogenic human cells or immunogenic cells are allogeneic or non-HLA- or non-MHC-matched to cells, receptors, or polypeptides of the recipient subject's immune system.

[0020] In some embodiments, altering immunogenicity comprises balancing, reducing, or neutralizing immunogenicity, such as reducing or neutralizing immunogenicity. In some embodiments, altering immunogenicity comprises reducing or neutralizing myeloid cell responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells). In some embodiments, altering immunogenicity comprises reducing or neutralizing T cell responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells). In some embodiments, altering immunogenicity comprises reducing or neutralizing natural killer cell responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells). In some embodiments, altering immunogenicity comprises reducing or neutralizing antibody responses to hypoimmunogenic (such as engineered hypoimmunogenic cells). In some embodiments, altering immunogenicity comprises reducing or neutralizing allogeneic host versus graft rejection.

[0021] In some embodiments, altering immunogenicity includes one or more of the following in the hypoimmunogenic cells (such as engineered hypoimmunogenic cells): a) reduced or eliminated expression of HLA class II molecules, b) reduced expression of HLA-A, HLA-B, and / or HLA-C, and c) reduced, but still detectable, expression of HLA-E.

[0022] In some embodiments, altering immunogenicity comprises reducing or eliminating MHC class II-mediated responses to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells). In some embodiments, altering immunogenicity comprises reducing or neutralizing MHC class I-mediated responses to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0023] In some embodiments, the RFX gene is RFX5, RFXANK, or RFXAP. In some embodiments, two or more of RFX5, RFXANK, or RFXAP are genetically modified. In some embodiments, each of RFX5, RFXANK, and RFXAP is genetically modified.

[0024] In some embodiments, the methods disclosed herein further comprise genetically modifying the CD58 gene, wherein genetically modifying the CD58 gene eliminates or reduces CD58 protein expression. In some embodiments, genetically modifying the CD58 gene reduces or eliminates costimulatory immune cell responses and / or impairs immune synapse formation.

[0025] In some embodiments, the methods disclosed herein further include genetically modifying the B2M gene, wherein genetically modifying the B2M gene results in reduced or eliminated expression of an HLA class I molecule on the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), and optionally the HLA class I molecule is selected from the group consisting of HLA-A, HLA-B, HLA-C, HLA-E, and combinations thereof.

[0026] In some embodiments, the methods disclosed herein further comprise genetically modifying the CIITA gene, wherein genetically modifying the CIITA gene results in reduced or eliminated expression of HLA class II molecules on the hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0027] In some embodiments, genetically modifying the RFX gene comprises (i) modifying the DNA sequence of the RFX gene, optionally via a CRISPR-Cas system; (ii) suppressing transcription or translation of RFX mRNA via an RNAi system, optionally wherein the RNAi system comprises an shRNA, siRNA, miR-compatible shRNA, or a combination thereof; or (iii) optionally reducing or eliminating transcription of the RFX gene via recruiting or directing a transcriptional repressor to the RFX gene.

[0028] In some embodiments, genetically modifying the CIITA gene and / or the B2M gene and / or the CD58 gene comprises (i) modifying the DNA sequence of the CIITA gene and / or the B2M gene and / or the CD58 gene, optionally via a CRISPR-Cas system; (ii) suppressing the transcription or translation of the CIITA gene and / or the B2M gene and / or the CD58 gene via an RNAi system, optionally wherein the RNAi system comprises an shRNA, an siRNA, an miR-compatible shRNA, or a combination thereof; or (iii) optionally reducing or eliminating the transcription of the CIITA gene and / or the B2M gene and / or the CD58 gene via recruiting or directing a transcriptional repressor to the CIITA gene and / or the B2M gene and / or the CD58 gene.

[0029] In some embodiments, the method further comprises genetically modifying at least one of the TNFRSF14 gene, the TNFRSF1A gene, the TNFRSF1B gene, the ICAM1 gene, and the herpesvirus entry mediator (HVEM) gene.

[0030] In one aspect, provided herein are non-naturally occurring, hypoimmunogenic human cells produced by the methods disclosed herein.

[0031] In one aspect, provided herein is a non-naturally occurring hypoimmunogenic human cell, the hypoimmunogenic human cell comprising a genetically modified regulatory factor X (RFX) gene, wherein the genetically modified RFX gene reduces expression of the RFX protein, the hypoimmunogenic human cell being produced from an embryoid body, and optionally, the hypoimmunogenic human cell further comprising one or more of a genetically modified class II major histocompatibility complex transactivator (CIITA) gene, a genetically modified beta-2-microglobulin (B2M) gene, and a genetically modified CD58 gene.

[0032] In one aspect, provided herein is a composition comprising the hypoimmunogenic human cells disclosed herein.

[0033] In one aspect, provided herein is an induced pluripotent stem (iPS) human cell derived from a γδ T cell, the iPS human cell comprising a genetically modified regulatory factor X (RFX) gene, wherein the genetically modified RFX gene reduces expression of the RFX protein, and optionally the iPS human cell further comprises one or more of a genetically modified class II major histocompatibility complex transactivator (CIITA) gene, a genetically modified beta-2-microglobulin (B2M) gene, and a genetically modified CD58 gene.

[0034] In one aspect, provided herein is a composition comprising the iPS human cells disclosed herein.

[0035] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) is provided, comprising: a) performing a function of genetically modifying a regulatory factor X (RFX) gene in at least one immunogenic cell (e.g., an immunogenic human cell), wherein genetically modifying the RFX gene reduces expression of the RFX protein in the immunogenic cell (e.g., the immunogenic human cell); b) performing a function of forming at least one embryoid body or multicellular body from the cells of a) to produce at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell); and c) performing a function of forming at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell) from the hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell). and d) performing a function of determining the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells), wherein the immunogenicity is altered compared to immunogenic cells (such as immunogenic human cells) in which the RFX gene has not been genetically modified, wherein optionally, step a) further comprises a step of performing a function of genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, beta-2-microglobulin (B2M) gene, and CD58 gene of the immunogenic human cells.

[0036] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) is provided, comprising: a) performing a function of reprogramming immunogenic human cells, wherein the immunogenic human cells comprise a heterodimeric T cell receptor comprising a gamma chain and a delta chain, to produce induced pluripotent stem (iPS) human cells; b) performing a function of genetically modifying a regulatory factor X (RFX) gene in the iPS human cells, wherein genetically modifying the RFX gene reduces expression of the RFX protein by the iPS human cells; and c) forming at least one embryoid body from the cells of step b) to produce at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell). Provided herein are methods comprising the steps of: d) performing the function of producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells) to the immune system; d) performing the function of subjecting hypoimmunogenic cells (such as engineered hypoimmunogenic cells) to the immune system; and e) performing the function of determining the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells), where the immunogenicity is altered compared to iPS human cells in which the RFX gene has not been genetically modified; and optionally, step b) further comprises the step of performing the function of genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, beta-2-microglobulin (B2M) gene, and / or CD58 gene of the iPS human cells.

[0037] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) is provided, comprising the steps of: a) genetically modifying a regulatory factor X (RFX) gene in an immunogenic human cell, wherein genetically modifying the RFX gene reduces expression of an RFX protein by the immunogenic human cell, to perform a function of genetically modifying the regulatory factor X (RFX) gene to produce a hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell); b) performing a function of subjecting the hypoimmunogenic cell (e.g., the engineered hypoimmunogenic cell) to the immune system; and c) genetically modifying the hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell) to the immune system. and performing a function to determine the immunogenicity of a cell (such as an engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to an immunogenic human cell in which the RFX gene has not been genetically modified; and optionally, step a) further comprises a step for performing a function to genetically modify one or more of the class II major histocompatibility complex transactivator (CIITA) gene, beta-2-microglobulin (B2M) gene, and / or CD58 gene of the immunogenic human cell.

[0038] In one aspect, provided herein are non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic cells) that comprise a means for reducing expression of an RFX protein via a genetic modification of the RFX gene and / or a means for altering the immunogenicity of the immune system to the hypoimmunogenic human cells (such as engineered hypoimmunogenic cells) compared to immunogenic human cells that have not been genetically modified with the RFX gene, and optionally, the hypoimmunogenic human cells (such as engineered hypoimmunogenic cells) further comprise a means for reducing expression of a CIITA protein, a B2M protein, and / or a CD58 protein via a genetic modification of a CIITA gene, a genetic modification of a B2M gene, and / or a genetic modification of CD58.

[0039] In one aspect, provided herein are induced pluripotent stem (iPS) human cells derived from γδ T cells, the iPS human cells comprising a means for reducing expression of an RFX protein via genetic modification of RFX and / or a means for altering the immunogenicity of the immune system to the iPS human cells compared to iPS human cells in which the RFX gene has not been genetically modified, and optionally the iPS human cells further comprising a means for reducing expression of a CIITA protein, a B2M protein, and / or a CD58 protein via genetic modification of a CIITA gene, a genetic modification of a B2M gene, and / or a genetic modification of CD58.

[0040] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) is provided, comprising: a) reprogramming immunogenic human cells to produce induced pluripotent (iPS) human cells, wherein the immunogenic human cells comprise a heterodimeric T cell receptor comprising a gamma chain and a delta chain; b) genetically modifying a beta-2-microglobulin (B2M) gene in the iPS human cells, wherein genetically modifying the B2M gene reduces expression of a B2M protein by the iPS human cells; and c) forming at least one embryoid body or multicellular body from the cells of step b). provided herein are methods comprising: d) generating at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) by subjecting the hypoimmunogenic cell (such as the engineered hypoimmunogenic cell) to the immune system; and e) determining the immunogenicity of the hypoimmunogenic cell (such as the engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to iPS human cells that have not been genetically modified in the B2M gene; and optionally, step b) further comprises genetically modifying the class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX) gene, and / or CD58 gene of the iPS human cells.

[0041] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) includes: a) genetically modifying a beta-2-microglobulin (B2M) gene in at least one immunogenic human cell, wherein genetically modifying the B2M gene reduces expression of B2M by the immunogenic human cell; b) forming at least one embryoid body or multicellular body from the cells of a) to produce at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell); and c) generating a hypoimmunogenic cell from the at least one embryoid body or multicellular body from the cells of a) to produce at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell). Provided herein are methods comprising: subjecting immunogenic cells (such as engineered hypoimmunogenic cells) to the immune system; and d) determining the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells), wherein the immunogenicity is altered compared to immunogenic human cells that have not been genetically modified in the B2M gene; and optionally, step a) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX), and CD58 gene of the immunogenic human cells.

[0042] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) includes: a) genetically modifying a beta-2-microglobulin (B2M) gene in an immunogenic human cell to produce a hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell), wherein genetically modifying the B2M gene reduces expression of a B2M protein by the immunogenic human cell; and b) administering the hypoimmunogenic cell (e.g., the engineered hypoimmunogenic cell) to the immune system. and c) determining the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells), wherein the immunogenicity is altered compared to immunogenic human cells that have not been genetically modified in the B2M gene, and optionally, step a) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX) gene, and CD58 gene of the immunogenic human cells.

[0043]

[0010] In one aspect, a method for producing a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) from an immunogenic cell comprises: (i) genetically modifying a beta-2-microglobulin (B2M) gene in the immunogenic cell, wherein genetically modifying the B2M gene reduces expression of a B2M protein in the cell; and (ii) optionally, further genetically modifying in the immunogenic cell one or more genes selected from a class II major histocompatibility complex transactivator (CIITA) gene, a regulatory factor X (RFX) gene, and a CD58 gene, wherein genetically modifying the one or more genes reduces expression of a corresponding one or more proteins in the immunogenic cell, wherein the method has the following characteristics: a) a hypoimmunogenic cell is differentiated from a corresponding immunogenic cell but does not have the genetic modifications of (i) and (ii).

[0013] Provided herein are methods that result in the production of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) that have one or more of: a) reduced immunogenicity in the presence of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) in an allogeneic or non-MHC-matched subject, compared to a corresponding immunogenic cell but without the genetic modifications of (i) and (ii); b) eliciting a reduced immune response against the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) in the presence of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) in an allogeneic or non-MHC-matched subject, compared to a corresponding immunogenic cell but without the genetic modifications of (i) and (ii); and c) eliciting reduced alloreactive T cell cytotoxicity against the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) in the presence of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) in an allogeneic or non-MHC-matched subject, compared to a corresponding immunogenic cell but without the genetic modifications of (i) and (ii).

[0044] In one aspect, a method for producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells) from immunogenic cells comprises: a) reprogramming the immunogenic cells to produce induced pluripotent stem (iPS) cells; b) (i) genetically modifying a beta-2-microglobulin (B2M) gene in the iPS cells, wherein genetically modifying the B2M gene reduces expression of a B2M protein in the iPS cells; and (ii) optionally, further genetically modifying in the iPS cells one or more genes selected from a class II major histocompatibility complex transactivator (CIITA) gene, a regulatory factor X (RFX) gene, and a CD58 gene, wherein genetically modifying the one or more genes reduces expression of a corresponding one or more proteins in the iPS cells; and c) optionally differentiating the cells produced in step (b), wherein the method has the following characteristics: 1) the iPS cells have a corresponding B2M protein; have reduced immunogenicity in the presence of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to cells corresponding to iPS cells or cells produced in step (c), but without the genetic modification of step (b); 2) elicit a reduced immune response against hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in the presence of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to cells corresponding to iPS cells or cells produced in step (c), but without the genetic modification of step (b); and 3) elicit a reduced immune response against hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to cells corresponding to iPS cells or cells produced in step (c), but without the genetic modification of step (b).Provided herein are methods that result in the production of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) that have one or more of the following effects: causing reduced alloreactive T cell cytotoxicity against the hypoimmunogenic cells, such as engineered hypoimmunogenic cells;

[0045] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) comprise a T cell receptor (TCR) that comprises a gamma chain and a delta chain.

[0046] In some embodiments, the immunogenic cell or human immunogenic cell is an immune cell optionally selected from a T cell, a natural killer (NK) cell, a B cell, and a hematopoietic stem cell (HSC).

[0047] In some embodiments, the reduced immunogenicity of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) can be measured by: i) a reduced or eliminated myeloid cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; ii) a reduced or eliminated T cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; iii) a reduced or eliminated natural killer (NK) cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; iv) an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification. The genetic modification may be achieved by one or more of the following: a) reduced or eliminated neutralizing antibody response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject; b) reduced or eliminated MHC class II-mediated cellular response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification; c) reduced or eliminated neutralizing MHC class I-mediated cellular response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification; and d) reduced or eliminated allogeneic host-versus-graft rejection to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification.

[0048] In some embodiments, the immunogenic cells are human cells.

[0049] In some embodiments, in hypoimmunogenic cells (such as engineered hypoimmunogenic cells), i) expression of HLA class II molecules is reduced or eliminated, ii) expression of HLA-A, HLA-B, and / or HLA-C is reduced, and iii) expression of HLA-E is reduced but remains detectable.

[0050] In some embodiments, the method includes forming at least one embryoid body or multicellular body from the genetically modified cells to produce hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0051] In some embodiments, the method further comprises determining the immunogenicity of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell).

[0052] In some embodiments, the methods further comprise administering hypoimmunogenic cells (such as engineered hypoimmunogenic cells) to an allogeneic or non-MHC-matched subject.

[0053] In some embodiments, the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) is altered compared to the immunogenic cells or immunogenic human cells or iPS human cells or iPS cells, and the only difference between the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and the immunogenic cells or immunogenic human cells or iPS human cells or iPS cells is that the B2M gene and optionally one or more of the RFX gene, CIITA gene, and CD58 gene have not been genetically modified in the immunogenic cells or immunogenic human cells or iPS human cells or iPS cells.

[0054] In some embodiments, the immunogenic human cells or immunogenic cells are allogeneic or non-HLA- or non-MHC-matched to cells, receptors, or polypeptides of the recipient subject's immune system.

[0055] In some embodiments, altering immunogenicity includes balancing, reducing, or neutralizing immunogenicity, such as reducing or neutralizing immunogenicity.

[0056] In some embodiments, altering immunogenicity comprises reducing or neutralizing the myeloid cell response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0057] In some embodiments, altering immunogenicity comprises reducing or neutralizing T cell responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0058] In some embodiments, altering immunogenicity comprises reducing or neutralizing the natural killer cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0059] In some embodiments, altering immunogenicity includes reducing or neutralizing the antibody response to a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell).

[0060] In some embodiments, altering immunogenicity comprises reducing or neutralizing allogeneic host-versus-graft rejection.

[0061] In some embodiments, altering immunogenicity comprises reducing or eliminating expression of HLA class I molecules on hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0062] In some embodiments, the methods disclosed herein further include genetically modifying an RFX gene, wherein the RFX gene is RFX5, RFXANK, or RFXAP. In some embodiments, two or more of RFX5, RFXANK, or RFXAP are genetically modified. In some embodiments, each of RFX5, RFXANK, and RFXAP is genetically modified.

[0063] In some embodiments, genetically modifying the RFX gene results in one or more of the following in the hypoimmunogenic cells (such as engineered hypoimmunogenic cells): a) reduced or eliminated expression of HLA class II molecules, and / or b) reduced expression of HLA-A, HLA-B, and / or HLA-C.

[0064] In some embodiments, genetic modification of the RFX gene results in reduced or eliminated expression of MHC class II-mediated responses against hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0065] In some embodiments, genetically modifying the RFX gene results in a reduction or neutralization of MHC class I-mediated responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0066] In some embodiments, the methods disclosed herein further comprise genetically modifying the CIITA gene, wherein genetically modifying the CIITA gene results in reduced or eliminated expression of HLA class II molecules on the hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0067] In some embodiments, the methods disclosed herein further comprise genetically modifying the CD58 gene, wherein genetically modifying the CD58 gene eliminates or reduces CD58 expression.

[0068] In some embodiments, genetically modifying the CD58 gene reduces or eliminates costimulatory immune cell responses and / or impairs immune synapse formation.

[0069] In some embodiments, genetically modifying the B2M gene comprises (i) modifying the DNA sequence of the B2M gene, optionally via a CRISPR-Cas system; (ii) suppressing transcription or translation of B2M mRNA via an RNAi system, optionally wherein the RNAi system comprises an shRNA, siRNA, or miR-compatible shRNA; or (iii) optionally reducing or eliminating transcription of the B2M gene via recruiting or directing a transcriptional repressor to the B2M gene.

[0070] In some embodiments, genetically modifying the CIITA gene and / or the RFX gene and / or the CD58 gene comprises (i) modifying the DNA sequence of the CIITA gene and / or the RFX gene and / or the CD58 gene, optionally via a CRISPR-Cas system; (ii) suppressing the transcription or translation of the CIITA gene and / or the RFX gene and / or the CD58 gene via an RNAi system, optionally wherein the RNAi system comprises an shRNA, an siRNA, an miR-compatible shRNA, or a combination thereof; or (iii) optionally reducing or eliminating the transcription of the CIITA gene and / or the RFX gene and / or the CD58 gene via recruiting or directing a transcriptional repressor to the CIITA gene and / or the RFX gene and / or the CD58 gene.

[0071] In some embodiments, the methods disclosed herein further comprise genetically modifying at least one of the TNFRSF14 gene, the TNFRSF1A gene, the TNFRSF1B gene, the ICAM1 gene, and the herpesvirus entry mediator (HVEM) gene.

[0072] In one aspect, provided herein are non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) produced by the methods disclosed herein.

[0073] In one aspect, provided herein is a non-naturally occurring hypoimmunogenic human cell (such as an engineered hypoimmunogenic human cell), the hypoimmunogenic human cell comprising a genetically modified B2M gene, wherein the genetically modified B2M gene reduces expression of a B2M protein, the hypoimmunogenic human cell (such as the engineered hypoimmunogenic human cell) is produced from an embryoid body, and optionally the hypoimmunogenic human cell (such as the engineered hypoimmunogenic human cell) further comprises one or more of a genetically modified CIITA gene, a genetically modified RFX gene, and a genetically modified CD58 gene.

[0074] In one aspect, provided herein is a composition comprising the hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) disclosed herein.

[0075] In one aspect, provided herein is an induced pluripotent stem (iPS) human cell derived from a γδ T cell, the iPS human cell comprising a genetically modified B2M gene, wherein the genetically modified B2M gene reduces expression of a B2M protein, and optionally the iPS human cell further comprises one or more of a genetically modified CIITA gene, a genetically modified RFX gene, and a genetically modified CD58 gene.

[0076] In one aspect, provided herein is a composition comprising the iPS human cells disclosed herein.

[0077] In one aspect, a method of hypoimmunogenicity (such as engineering hypoimmunogenicity) is provided, comprising the steps of: a) performing a function of genetically modifying a B2M gene in at least one immunogenic human cell, wherein genetically modifying the B2M gene reduces expression of a B2M protein in the immunogenic human cell; b) performing a function of forming at least one embryoid body or multicellular body from the cells of a) to produce at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic human cell); and c) performing a function of genetically modifying the hypoimmunogenic cell (such as an engineered hypoimmunogenic human cell). Provided herein are methods comprising the steps of: (a) performing a function of subjecting a hypoimmunogenic cell (such as an engineered hypoimmunogenic human cell) to the immune system; and (b) performing a function of determining the immunogenicity of the hypoimmunogenic cell (such as the engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to an immunogenic human cell that has not been genetically modified in the B2M gene; and optionally, step a) further comprises a step of performing a function of genetically modifying one or more of the RFX gene, the CIITA gene, and / or the CD58 gene of the immunogenic human cell.

[0078] In one aspect, a method of hypoimmunogenicity (such as engineering hypoimmunogenicity) is provided, comprising: a) performing a function of reprogramming immunogenic human cells, wherein the immunogenic human cells comprise a heterodimeric T cell receptor comprising a gamma chain and a delta chain, to produce induced pluripotent stem (iPS) human cells; b) performing a function of genetically modifying a B2M gene in the iPS human cells, wherein genetically modifying the B2M gene reduces expression of a B2M protein by the iPS human cells; and c) forming at least one embryoid body from the cells of step b) to produce at least one hypoimmunogenic cell. Provided herein are methods comprising: d) performing a function of producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells); d) performing a function of subjecting the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) to the immune system; and e) performing a function of determining the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells), wherein the immunogenicity is altered compared to iPS human cells in which the B2M gene has not been genetically modified; and optionally, step b) further comprises a step of performing a function of genetically modifying one or more of the RFX gene, the CIITA gene, and / or the CD58 gene of the iPS human cells.

[0079]

[0010] In one aspect, provided herein is a method of hypoimmunogenicity (such as engineering hypoimmunogenicity), comprising the steps of: a) genetically modifying a B2M gene in an immunogenic human cell to produce a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), wherein genetically modifying the B2M gene reduces expression of a B2M protein by the immunogenic human cell; b) performing the function of subjecting the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) to the immune system; and c) performing the function of determining the immunogenicity of the hypoimmunogenic cell (such as the engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to an immunogenic human cell in which the B2M gene has not been genetically modified; optionally, step a) further comprises the step of genetically modifying one or more of the RFX gene, the CIITA gene, and / or the CD58 gene of the immunogenic human cell.

[0080] In one aspect, provided herein are non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) that comprise a means for reducing expression of a B2M protein via a genetically modified B2M and / or a means for altering the immunogenicity of the immune system to the hypoimmunogenic human cell (such as the engineered hypoimmunogenic human cell) compared to an immunogenic human cell in which the B2M gene has not been genetically modified, and optionally the hypoimmunogenic human cell (such as the engineered hypoimmunogenic human cell) further comprises a means for reducing expression of an RFX protein, a CD58 protein, and / or a CIITA protein via a genetically modified RFX gene, a genetically modified CD58 gene, and / or a genetically modified CIITA.

[0081] In one aspect, provided herein are induced pluripotent stem (iPS) human cells derived from γδ T cells, the iPS human cells comprising a means for reducing expression of B2M protein via genetically modified B2M and / or a means for altering the immunogenicity of the immune system towards the iPS human cells compared to iPS human cells in which the B2M gene has not been genetically modified, and optionally the iPS human cells further comprising a means for reducing expression of RFX protein, CD58 protein, and / or CIITA protein via genetically modified RFX gene, genetically modified CD58 gene, and / or genetically modified CIITA gene.

[0082] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) is provided, comprising: a) genetically modifying the CD58 gene of at least one immunogenic human cell, wherein genetically modifying the CD58 gene reduces expression of CD58 protein by the immunogenic human cell; b) forming at least one embryoid body or multicellular body from the cells of a) to produce at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell); and c) forming at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell) from the cells of a) to produce at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell). and d) determining the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells), wherein the immunogenicity is altered compared to immunogenic human cells that are not genetically modified, wherein optionally, step a) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX), and beta-2-microglobulin (B2M) gene of the immunogenic human cells.

[0083] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) is provided, comprising: a) reprogramming immunogenic human cells, wherein the immunogenic human cells comprise a heterodimeric T cell receptor comprising a gamma chain and a delta chain, to produce induced pluripotent (iPS) human cells; b) genetically modifying a CD58 gene in the iPS human cells, wherein genetically modifying the CD58 gene reduces expression of CD58 protein by the iPS human cells; and c) forming at least one embryoid body from the cells of step b) to produce at least one hypoimmunogenic cell (e.g., engineered hypoimmunogenic cell). Provided herein are methods comprising: d) producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells) from iPS human cells; d) subjecting the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) to the immune system; and e) determining the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells), wherein the immunogenicity is altered compared to iPS human cells that have not been genetically modified in a CD58 gene; and optionally, step b) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX) gene, and beta-2-microglobulin (B2M) gene of the iPS human cells.

[0084]

[0010] In one aspect, provided herein is a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity), comprising: a) genetically modifying a CD58 gene in immunogenic human cells to produce hypoimmunogenic cells (e.g., engineered hypoimmunogenic cells), wherein genetically modifying the CD58 gene reduces expression of CD58 protein by the immunogenic human cells; b) subjecting the hypoimmunogenic cells (e.g., engineered hypoimmunogenic cells) to the immune system; and c) determining the immunogenicity of the hypoimmunogenic cells (e.g., engineered hypoimmunogenic cells), wherein the immunogenicity is altered compared to immunogenic human cells in which the CD58 gene has not been genetically modified; optionally, step a) further comprises genetically modifying one or more of a class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX), and beta-2-microglobulin (B2M) gene of the immunogenic human cells.

[0085]

[0013] In one aspect, a method for producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells) from immunogenic cells comprises: (i) genetically modifying a CD58 gene in an immunogenic cell, wherein genetically modifying the CD58 gene reduces expression of a CD58 protein in the cell; and (ii) optionally, further genetically modifying in the immunogenic cell one or more genes selected from a class II major histocompatibility complex transactivator (CIITA) gene, a regulatory factor X (RFX) gene, and a beta-2-microglobulin (B2M) gene, wherein genetically modifying the one or more genes reduces expression of corresponding one or more proteins in the immunogenic cell, wherein the method has the following properties: a) allogeneic immunogenicity compared to a corresponding immunogenic cell but not having the genetic modifications of (i) and (ii).

[0013] Provided herein are methods that result in the production of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) that have one or more of: a) reduced immunogenicity when present in an allogeneic or non-MHC-matched subject; b) eliciting a reduced immune response against the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject, compared to a corresponding immunogenic cell that does not have the genetic modifications of (i) and (ii); and c) eliciting reduced alloreactive T cell cytotoxicity against the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject, compared to a corresponding immunogenic cell that does not have the genetic modifications of (i) and (ii).

[0086] In one aspect, a method for producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells) from immunogenic cells includes: a) reprogramming immunogenic cells to produce induced pluripotent stem (iPS) cells; and b) (i) genetically modifying the CD58 gene in iPS cells, wherein genetically modifying the CD58 gene reduces expression of CD58 protein in the iPS cells; and (ii) optionally, genetically modifying the CD58 gene in the iPS cells to reduce expression of CD58 protein in the iPS cells. a) further genetically modifying one or more genes selected from the iPS cells of the present invention, ... 1) have reduced immunogenicity in the presence of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to iPS cells or cells corresponding to the cells produced in step (c) that do not have the genetic modification of step (b), or 2) have reduced immunogenicity in the presence of hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to the corresponding iPS cells or cells corresponding to the cells produced in step (c), but without the genetic modification of step (b). and 3) causing reduced immune response against hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in the presence of the hypoimmunogenic cells, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to corresponding iPS cells or cells corresponding to the cells produced in step (c), but without the genetic modification of step (b).Methods are provided herein that result in the production of hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0087] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) comprise a T cell receptor (TCR) that comprises a gamma chain and a delta chain.

[0088] In some embodiments, the immunogenic cell or human immunogenic cell is an immune cell optionally selected from a T cell, a natural killer (NK) cell, a B cell, and a hematopoietic stem cell (HSC).

[0089] In some embodiments, the reduced immunogenicity of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) can be measured by: i) a reduced or eliminated myeloid cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; ii) a reduced or eliminated T cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; iii) a reduced or eliminated natural killer (NK) cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; iv) an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification. The genetic modification may be achieved by one or more of the following: a) reduced or eliminated neutralizing antibody response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject; b) reduced or eliminated MHC class II-mediated cellular response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification; c) reduced or eliminated neutralizing MHC class I-mediated cellular response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification; and d) reduced or eliminated allogeneic host-versus-graft rejection to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification.

[0090] In some embodiments, the immunogenic cells are human cells.

[0091] In some embodiments, in hypoimmunogenic cells (such as engineered hypoimmunogenic cells), i) expression of HLA class II molecules is reduced or eliminated, ii) expression of HLA-A, HLA-B, and / or HLA-C is reduced, and iii) expression of HLA-E is reduced but remains detectable.

[0092] In some embodiments, the method includes forming at least one embryoid body or multicellular body from the genetically modified cells to produce hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0093] In some embodiments, the method further comprises determining the immunogenicity of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell).

[0094] In some embodiments, the methods further comprise administering hypoimmunogenic cells (such as engineered hypoimmunogenic cells) to an allogeneic or non-MHC-matched subject.

[0095] In some embodiments, the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) is altered compared to the immunogenic cells or immunogenic human cells or iPS human cells or iPS cells, and the only difference between the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and the immunogenic cells or immunogenic human cells or iPS human cells or iPS cells is that the CD58 gene and optionally one or more of the RFX gene, the CIITA gene, and the B2M gene have not been genetically modified in the immunogenic cells or immunogenic human cells or iPS human cells or iPS cells.

[0096] In some embodiments, the immunogenic human cells or immunogenic cells are allogeneic or non-HLA- or non-MHC-matched to cells, receptors, or polypeptides of the recipient subject's immune system.

[0097] In some embodiments, altering immunogenicity includes balancing, reducing, or neutralizing immunogenicity, such as reducing or neutralizing immunogenicity.

[0098] In some embodiments, altering immunogenicity comprises reducing or neutralizing the myeloid cell response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0099] In some embodiments, altering immunogenicity comprises reducing or neutralizing T cell responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0100] In some embodiments, altering immunogenicity comprises reducing or neutralizing the natural killer cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0101] In some embodiments, altering immunogenicity comprises reducing or neutralizing allogeneic host-versus-graft rejection.

[0102] In some embodiments, altering immunogenicity comprises reducing or eliminating costimulatory immune cell responses and / or impairing immune synapse formation.

[0103] In some embodiments, the methods disclosed herein further include genetically modifying an RFX gene, wherein the RFX gene is RFX5, RFXANK, or RFXAP. In some embodiments, two or more of RFX5, RFXANK, or RFXAP are genetically modified. In some embodiments, each of RFX5, RFXANK, and RFXAP is genetically modified.

[0104] In some embodiments, genetically modifying the RFX gene results in one or more of the following in hypoimmunogenic cells (such as engineered hypoimmunogenic cells): a) reduced or eliminated expression of HLA class II molecules, b) reduced expression of HLA-A, HLA-B, and / or HLA-C, and c) reduced, but still detectable, expression of HLA-E.

[0105] In some embodiments, genetically modifying the RFX gene results in reduced or eliminated expression of MHC class II-mediated responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells). In some embodiments, genetically modifying the RFX gene results in reduced or neutralized MHC class I-mediated responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells).

[0106] In some embodiments, the methods disclosed herein further comprise genetically modifying the B2M gene, wherein genetically modifying the B2M gene results in reduced or eliminated expression of an HLA class I molecule.

[0107] In some embodiments, the methods disclosed herein further comprise genetically modifying the CIITA gene, wherein genetically modifying the CIITA gene results in reduced or eliminated expression of HLA class II molecules.

[0108] In some embodiments, genetically modifying the CD58 gene comprises (i) modifying the DNA sequence of the CD58 gene, optionally via a CRISPR-Cas system; (ii) suppressing transcription or translation of CD58 mRNA via an RNAi system, optionally wherein the RNAi system comprises an shRNA, siRNA, or miR-compatible shRNA; or (iii) optionally reducing or eliminating transcription of the CD58 gene via recruiting or directing a transcriptional repressor to the CD58 gene.

[0109] In some embodiments, genetically modifying the CIITA gene and / or the B2M gene and / or the RFX gene comprises (i) modifying the DNA sequence of the CIITA gene and / or the B2M gene and / or the RFX gene, optionally via a CRISPR-Cas system; (ii) suppressing the transcription or translation of the CIITA gene and / or the B2M gene and / or the RFX gene via an RNAi system, optionally wherein the RNAi system comprises an shRNA, an siRNA, an miR-compatible shRNA, or a combination thereof; or (iii) optionally reducing or eliminating the transcription of the CIITA gene and / or the B2M gene and / or the RFX gene via recruiting or directing a transcriptional repressor to the CIITA gene and / or the B2M gene and / or the RFX gene.

[0110] In some embodiments, the methods disclosed herein further comprise genetically modifying at least one of the TNFRSF14 gene, the TNFRSF1A gene, the TNFRSF1B gene, the ICAM1 gene, and the herpesvirus entry mediator (HVEM) gene.

[0111] In one aspect, provided herein are non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) produced by the methods disclosed herein.

[0112] In one aspect, provided herein is a non-naturally occurring hypoimmunogenic human cell (such as an engineered hypoimmunogenic human cell), which comprises a genetically modified CD58 gene, wherein the genetically modified CD58 gene reduces expression of CD58 protein, wherein the hypoimmunogenic human cell (such as the engineered hypoimmunogenic human cell) is produced from an embryoid body, and optionally the hypoimmunogenic human cell (such as the engineered hypoimmunogenic human cell) further comprises one or more of a genetically modified CIITA gene, a genetically modified RFX gene, and a genetically modified B2M gene.

[0113] In one aspect, provided herein is a composition comprising the hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) disclosed herein.

[0114] In one aspect, provided herein is an induced pluripotent stem (iPS) human cell derived from a γδ T cell, the iPS human cell comprising a genetically modified CD58 gene, wherein the genetically modified CD58 gene reduces expression of CD58 protein, and optionally the iPS human cell further comprises one or more of a genetically modified CIITA gene, a genetically modified RFX gene, and a genetically modified B2M gene.

[0115] In one aspect, provided herein is a composition comprising the iPS human cells disclosed herein.

[0116] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) is provided, comprising the steps of: a) performing a function of genetically modifying the CD58 gene of at least one immunogenic human cell, wherein genetically modifying the CD58 gene reduces expression of CD58 protein in the immunogenic human cell; b) performing a function of forming at least one embryoid body or multicellular body from the cells of a) to produce at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell); and c) performing a function of genetically modifying the CD58 gene of at least one immunogenic human cell, wherein genetically modifying the CD58 gene reduces expression of CD58 protein in the immunogenic human cell. and d) performing a function of determining the immunogenicity of the hypoimmunogenic cells (such as the engineered hypoimmunogenic cells), wherein the immunogenicity is altered compared to immunogenic human cells that have not been genetically modified in the CD58 gene; and optionally, step a) further comprises a step of performing a function of genetically modifying one or more of the RFX gene, the CIITA gene, and / or the B2M gene of the immunogenic human cells.

[0117] In one aspect, a method of hypoimmunogenicity (e.g., engineering hypoimmunogenicity) is provided, comprising: a) performing a function of reprogramming immunogenic human cells to produce induced pluripotent stem (iPS) human cells, wherein the immunogenic human cells comprise a heterodimeric T cell receptor comprising a gamma chain and a delta chain; b) performing a function of genetically modifying the CD58 gene in the iPS human cells, wherein genetically modifying the CD58 gene reduces expression of CD58 protein by the iPS human cells; and c) forming at least one embryoid body from the cells of step b) to produce at least one hypoimmunogenic human cell. Provided herein are methods comprising: d) performing a function of producing iPS human cells (such as engineered hypoimmunogenic cells); d) performing a function of subjecting the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) to the immune system; and e) performing a function of determining the immunogenicity of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells), wherein the immunogenicity is altered compared to iPS human cells in which the B2M gene has not been genetically modified; and optionally, step b) further comprises a step of performing a function of genetically modifying one or more of the RFX gene, the CIITA gene, and / or the B2M gene of the iPS human cells.

[0118]

[0013] In one aspect, provided herein is a method of hypoimmunogenicity (such as engineering hypoimmunogenicity), comprising the steps of: a) performing the functions of genetically modifying the CD58 gene of an immunogenic human cell to produce a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), wherein genetically modifying the CD58 gene reduces expression of CD58 protein by the immunogenic human cell; b) performing the functions of subjecting the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) to the immune system; and c) performing the functions of determining the immunogenicity of the hypoimmunogenic cell (such as the engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to an immunogenic human cell in which the CD58 gene has not been genetically modified; optionally, step a) further comprises the steps of genetically modifying one or more of the RFX gene, CIITA gene, and / or B2M gene of the immunogenic human cell.

[0119] In one aspect, provided herein is a non-naturally occurring hypoimmunogenic human cell (such as an engineered hypoimmunogenic human cell), which comprises a means for reducing expression of a CD58 protein via a genetically modified CD58 and / or a means for altering the immunogenicity of the immune system to the hypoimmunogenic human cell (such as the engineered hypoimmunogenic human cell) compared to an immunogenic human cell in which the CD58 gene has not been genetically modified, and optionally the hypoimmunogenic human cell (such as the engineered hypoimmunogenic human cell) further comprises a means for reducing expression of a CIITA protein, a B2M protein, and / or an RFX protein via a genetically modified CIITA gene, a genetically modified B2M gene, and / or a genetically modified RFX.

[0120] In one aspect, provided herein is an induced pluripotent stem (iPS) human cell derived from a γδ T cell, the iPS human cell comprising a means for reducing expression of CD58 protein via a genetically modified CD58 and / or a means for altering the immunogenicity of the immune system towards the iPS human cell compared to an iPS human cell in which the CD58 gene has not been genetically modified, and optionally the iPS human cell further comprises a means for reducing expression of CIITA protein, B2M protein, and / or RFX protein via a genetically modified CIITA gene, a genetically modified B2M gene, and / or a genetically modified RFX gene. [Brief explanation of the drawings]

[0121] [Figure 1]Gene knockout strategies for preventing HLA surface expression are shown. The top panel shows a summary of the process for generating HLA-altered T cells. The bottom panel shows results in human donor D149399 for HLA class I and HLA class II expression measured by flow cytometry for CD4+ T cells with the indicated gene knockouts by CRISPR / Cas9 editing. Knockout of B2M resulted in cells lacking HLA class I expression with unchanged HLA class II expression. Knockout of CIITA resulted in cells lacking HLA class II expression with unchanged HLA class I expression. Knockout of RFX5, RFXANK, or RFXAP individually resulted in cells lacking HLA class II surface expression and with reduced, but not absent, HLA class I expression. Combined knockout of B2M and RFX5, B2M and RFXANK, B2M and RFXAP, or B2M and CIITA resulted in cells completely lacking HLA class I and II expression. Primary T cells were analyzed 14-15 days after CRISPR editing and CD3 / CD28 activation. Similar results were obtained with CD8+ T cells. The bottom right panel shows HLA-E expression on unedited, B2M-deficient, and RFX5-deficient pan-T cells from human donor D149399. Similar results for HLA-E expression were obtained with RFXANK- and RFXAP-edited T cells. [Figure 2] Figure 1 shows that RFX knockout T cells from additional human donors also had downregulation of HLA class I and II molecules. The left and right panels show results for HLA class I and HLA class II expression measured by flow cytometry on CD4+ and CD8+ T cells, respectively, with knockout of the indicated genes by CRISPR / Cas9 editing. Results from two human donors are shown (D151100, top row, and D144786, bottom row). NTC = unedited T cells. [Figure 3]This shows that RFX5 knockout T cells using CRISPR / Cas12a had down-regulation of HLA class I and II molecules. The experimental scheme is shown in the top panel of Figure 1. Shown are results for HLA class I and HLA class II expression measured by flow cytometry on D147297 pan T cells (combined CD4+ and CD8+) with knockout of the indicated genes by CRISPR / Cas12a editing. NTC = unedited. [Figure 4] Figure 1 shows the stability of reduced HLA surface expression on CD4+ T cells after stimulation. Fourteen days after generation of HLA class I and II-altered T cells from two human donors (D151100 and D144786), cells were cryopreserved, thawed, and then stimulated with IFN-γ or CD3 / CD28 stimulation (TransAct) as indicated. After 24 hours, cells were analyzed for pan-HLA class I (top) and class II (bottom) surface expression on CD4+ T cells. The upper left panel shows HLA class I expression on D151100-CD4+ T cells. The upper right panel shows HLA class I expression on D144786-CD4+ T cells. The lower left panel shows HLA class II expression on D151100-CD4+ T cells. The lower right panel shows HLA class II expression on D144786-CD4+ T cells. [Figure 5] Figure 1 shows the stability of reduced HLA surface expression on CD8+ T cells after stimulation. Fourteen days after generation of HLA class I and II-altered T cells from two human donors (D151100 and D144786), cells were cryopreserved, thawed, and then stimulated with IFN-γ or CD3 / CD28 stimulation (TransAct) as indicated. After 24 hours, cells were analyzed for pan-HLA class I (upper panel) and class II (lower panel) surface expression on CD8+ T cells. The upper left panel shows HLA class I expression on D151100-CD8+ T cells. The upper right panel shows HLA class I expression on D144786-CD8+ T cells. The lower left panel shows HLA class II expression on D151100-CD8+ T cells. The lower right panel shows HLA class II expression on D144786-CD8+ T cells. [Figure 6]This shows that HLA-altered T cells evaded allogeneic effector T cell responses. The top panel shows the methodology for generating allogeneic effector T cells. The bottom panel shows degranulation (CD107aHigh) of allogeneic effector CD8+ and CD4+ T cells in response to 4 hours of stimulation with pan-T cells with the indicated genetic modifications. The positive control was CD3 / CD28 stimulation. [Figure 7] Figure 1 shows that RFX knockout T cells provided moderate protection from both allogeneic T cells and NK cells. Figure 2 shows survival of pan-T cells with the indicated gene modifications after coculture with allogeneic effector T cells (upper panel) or resting primary NK cells (lower panel). Compared to unedited (NTC) T cells, HLA-altered T cells (D151100) show an enhanced ability to survive challenge with allogeneic effector T cells. Among HLA-altered T cells, RFX knockout T cells showed the greatest ability to survive challenge with primary NK cells. [Figure 8] Figure 6 shows the expansion of allogeneic primed effector cells against human donor 147297 (donor 297). Figure 6 shows the methodology for generating allogeneic effector T cells from two human donors (500 and 996, top panel) generated against stimulator donor 297 (bottom panel) and the profiling of these cells. The panels show the HLA class I and HLA class II surface profiles of HLA-altered pan T cells from human donor 297 used in subsequent coculture assays. [Figure 9]The RFX5 knockout survived better or equally well against all allogeneic effector cells tested than the B2M knockout from human donor 297. Figure 9 shows the survival of pan-T cells with the indicated gene modifications after coculture with unpurified allogeneic effector cells (upper left and upper center panels), purified allogeneic effector T cells (lower left), purified allogeneic effector NK cells (lower center), or resting primary NK cells from two human donors (upper right and lower right panels). The viability of all coculture samples was normalized to effector-free target cells (dotted line = 1). Effectors: T-297-500R mixture = PBMCs from donor 500 expanded for 2 weeks by priming with irradiated donor 297 PBMCs (87% T cells, 10% NKT cells, <2% NK cells); T-297-996R mixture = PBMCs from donor 996 expanded for 2 weeks by priming with irradiated donor 297 PBMCs (72% T cells, 3% NKT cells, 22% NK cells); T-297-996R mixture was separated into T-297-996R isolated T cells (97% T cells and <2% NK and NKT cells) and isolated NK cells (94% NK cells, 3% NKT cells, 3% T cells). EN021 and NK697 naive NK cells = unprimed NK cells isolated from PBMCs of two random human donors. [Figure 10] Figure 10 shows that RFX5 knockout limited allogeneic-induced activation of T cells (CD3+CD8+ and CD3+CD4+ allogeneic effector cells). Figure 10 shows the activation (41BB+) of allogeneic effector CD8+ T cells (left panel) and CD4+ T cells (right panel) from two human donors (donor 500 and donor 996) in response to 24-hour stimulation with pan T cells with the indicated genetic modifications at various E:T ratios (from left to right: 1:10, 1:5, 1:2, 1:1, 2:1, 5:1, 10:1, 20:1). The negative control was autologous pan T cells from the effector human donor. [Figure 11]Figure 1 shows T cell proliferation of D149399 after CRISPR knockout, without the deleterious effects of RFX, CIITA, or B2M knockout. Data show viability, mean diameter, and fold expansion of HLA-altered T cells during the generation and expansion process. CRISPR editing and CD3 / CD28 activation occurred on day 1. [Figure 12] Figure 1 shows T cell proliferation of D151100 after CRISPR knockout, without the deleterious effects of RFX or B2M knockout. Data show viability, mean diameter, and fold expansion of HLA-altered T cells during the generation and expansion process. CRISPR editing and CD3 / CD28 activation occurred on day 1. [Figure 13] Figure 1 shows T cell proliferation of D144786 after CRISPR knockout, without the deleterious effects of RFX or B2M knockout. Data show viability, mean diameter, and fold expansion of HLA-altered T cells during the generation and expansion process. CRISPR editing and CD3 / CD28 activation occurred on day 1. [Figure 14] This shows that PGP1 iPSCs were edited with B2M-2 crRNA using CRISPR / Cas12a to generate B2M-disrupted cells. Expression of B2M is shown compared to control, unedited iPSCs. Combined with Table 2, this shows that CRISPR / Cas12a can be used to edit B2M, RFX5, RFXANK, RFXAP, or CIITA in PGP1 iPSCs, and B2M or RFX5 in γδ T cell-derived iPSCs. [Figure 15]

[0023] Figure 1 shows the generation and phenotype of B2M and costimulatory knockout T cells from human donor RD01000079 (donor 079). Results are shown for the gene editing process to generate B2M knockout pan T cells with an additional costimulatory gene knockout. Flow cytometry phenotyping was performed 11 days after CRISPR editing and expansion. [Figure 16]

[0023] Figure 1 shows the generation and phenotype of B2M and costimulatory knockout T cells (from human donor D327084, "Donor 084"). Results are shown for the gene editing process to generate B2M knockout pan T cells with an additional costimulatory gene knockout. Flow cytometry phenotyping was performed 11 days after CRISPR editing and expansion. [Figure 17] We show that CD58 knockout combined with B2M knockout results in lower specific lysis and improved cell viability when HLA-altered T cells are cocultured with resting NK cells compared to B2M knockout alone. Specific lysis (left panel) and normalized viability (right panel) of pan-T cells from two human donors (D327084 and RD01000079) with the indicated genetic modifications after coculture with resting primary NK cells are shown. Effector: NK079, target: D327084 and RD01000079. [Figure 18] Figure 1 shows that knockout of various costimulatory molecules in combination with B2M knockout in T cells reduced specific lysis from NK cells. E: Reduced specific lysis of pan T cells from one human donor (D327084) with the indicated genetic modifications after co-culture with resting primary NK cells at T=1. Reduction in specific lysis was normalized to pan T cells with B2M knockout only. Effector donors: NK021 and NK079. [Figure 19] Figure 19 shows the generation of RFX5 and CD58 knockout T cells. Figure 19 shows the results of the gene editing process to generate RFX5, CD58, and RFX5 / CD58 knockout T cells. Flow cytometry phenotyping performed 14 days after CRISPR editing and expansion is shown. NTC = unedited control. [Figure 20]Figure 1 shows that CD58 knockout improved survival compared to unedited T cells in co-culture with alloreactive effector T cells. Survival of pan T cells with the indicated gene modifications after 24 hours of co-culture with allogeneic effector T cells from two human donors (D146500 and D151200) is shown. The autologous indicated target cells were unedited expanded pan T cells from the same human donor used as effectors. [Figure 21] Figure 21 shows that RFX5 knockout plus CD58 knockout in T cells induced less activation of alloreactive CD4+ T cells (CD137+) than RFX5 knockout alone. Figure 21 shows activation of allogeneic effector CD4+ T cells from two human donors (D146500 and D151200) after 24 hours of coculture with pan-T cells containing the indicated gene modifications. The bars for each ratio condition, from left to right, represent RFX5 knockout, RFX knockout / CD58 knockout, CD58 knockout, and the non-targeting (unedited) control, NTC. Effector alone is shown at the end of the bar graph. [Figure 22] Figure 22 shows that RFX5 knockout plus CD58 knockout in T cells induced less activation of alloreactive CD8+ T cells (CD137+) than RFX5 knockout alone. Figure 22 shows the activation of allogeneic effector CD8+ T cells from two human donors (D146500 and D151200) after 24 hours of coculture with pan-T cells containing the indicated gene modifications. The bars for each ratio condition, from left to right, represent RFX5 knockout, RFX knockout / CD58 knockout, CD58 knockout, and the non-targeting (unedited) control, NTC. Effector alone is shown at the end of the bar graph. [Figure 23] Figure 23 shows that RFX5 knockout in T cells plus CD58 knockout improved survival compared to RFX5 knockout in coculture with NK cells. Figure 23 shows the survival of pan-T cells with the indicated gene modifications or K562 cells (positive control) after 24 hours of coculture with resting NK cells from two human donors (NK079 and NK567). [Figure 24] Figure 24 shows that RFX5 knockout plus CD58 knockout in T cells induces less NK cell (CD137+) activation compared to RFX5 knockout alone. Figure 24 shows the activation of NK cells (NK079 and NK567) from two donors after 24 hours of coculture with pan-T cells containing the indicated gene modifications. The bars for each ratio condition represent, from left to right, RFX5 knockout, RFX5 knockout / CD58 knockout, CD58 knockout, NTC, and K562. Effector alone is shown at the end of the bar graph. [Figure 25] Figure 25 shows that CD58 shRNAs tested in Jurkat cells and primary T cells demonstrated knockdown of CD58 surface protein. Figure 25 shows CD58 expression measured by flow cytometry in primary human pan-T cells (top) and Jurkat cells (bottom) transduced with lentivirus containing CD58 shRNA. Figure 25 discloses SEQ ID NOS: 60-67 and SEQ ID NOS: 60-67, respectively, in order of appearance. [Figure 26] Figure 1 shows B2M editing efficiency by Cas12a and WT MAD7 in iPSCs. Cas12a (top panel) or MAD7 (bottom panel) RNPs were formed with gRNA B2M_12A_2. Flow plots shown are gated on live single cells. Signal reference: E082949. [Figure 27] Figure 1 shows RFX5 gRNA tiling screening in iPSCs. The editing efficiency of each gRNA tested to knock out the RFX5 gene is shown. Signal reference: E085286. [Figure 28A] Figure 28 shows the optimization of the RFX5 gRNA structure. The editing efficiencies of the top two RFX5 gRNAs with optimization of the gRNA structure are shown. Specifically, Figure 28A shows the editing efficiency of the RFX5 exon 9 gRNA2 sequence, and Figure 28B shows the editing efficiency of the RFX5 exon 10 gRNA1 sequence. Three repeat sequences and spacer sequence lengths of 20 bp and 21 bp were tested. Signal reference: E110898. [Figure 28B]Figure 28 shows the optimization of the RFX5 gRNA structure. The editing efficiencies of the top two RFX5 gRNAs with optimization of the gRNA structure are shown. Specifically, Figure 28A shows the editing efficiency of the RFX5 exon 9 gRNA2 sequence, and Figure 28B shows the editing efficiency of the RFX5 exon 10 gRNA1 sequence. Three repeat sequences and spacer sequence lengths of 20 bp and 21 bp were tested. Signal reference: E110898. [Figure 29] Figure 1 shows CD58 gRNA tiling screening in iPSCs. The editing efficiency of each gRNA tested to knock out the CD58 gene is shown. Signal reference: E127262. [Figure 30] Pulse-code optimization of editing efficiency in three γδT-iPSC clones harboring gRNA RFX5_exon9_gRNA2 20 bp. Signal reference: E152036. [Figure 31] CAR knock-in into RFX5 with gRNA RFX5_exon10_gRNA1 20bp is shown. The editing efficiency of CAR knock-in is shown with gRNA RFX5_exon10_gRNA1 20bp. Four separate reactions were performed with and without M3814 using either 300bp or 500bp homology arms in the DNA donor template. The flow plots shown were gated on live single cells, and CAR-positive cells were determined by comparing the edited sample to a negative control without RNP. Signal reference: E145675. [Figure 32] CAR knock-in into RFX5 with gRNA RFX5_exon9_gRNA2 20bp is shown. The editing efficiency of CAR knock-in is shown with gRNA RFX5_exon9_gRNA2 20bp, with and without M3814, using 500bp homology arms in the DNA donor template. The flow plots shown are gated on live single cells, and CAR-positive cells were determined by comparing the edited sample to a negative control without RNP. Signal reference: E145675. [Figure 33]Pulse code optimization for CAR knock-in into RFX5 is shown. Editing efficiency of CAR knock-in is shown for gRNA RFX5_exon9_gRNA2 20bp, with and without M3814, achieved using two pulse codes on a Lonza Nucleofector. Flow plots shown are gated on live single cells. Signal reference: E150713. [Figure 34] iPSC HLA class I expression in cells edited with MAD7 and gRNA RFX5_exon9_gRNA2 20bp. Edited cells (left panel) showed reduced HLA class I expression compared to unedited cells (right panel). Flow plots shown are gated on live single cells. Signal reference: E154516. [Figure 35] iPSC CD58 expression in cells edited with MAD7 and gRNA CD58_exon2_gRNA9 21bp. Edited cells (left panel) showed reduced CD58 expression compared to unedited cells (right panel). Flow plots shown are gated on live single cells. Signal reference: E132854. [Figure 36] Figure 1 shows the generation of clonal cells with CAR knock-in into RFX5. CAR knock-in into RFX5 was achieved using gRNA RFX5_exon9_gRNA2 20bp. Bulk-edited cells were single-cell sorted to generate clonal CAR+ cells that maintained high expression of pluripotency markers SSEA-3, SSEA-4, OCT3 / 4, and SOX2. Surface markers SSEA-1 and CD34, which are not expressed in iPSCs, remain low after editing and cloning. Flow plots shown are gated on live single cells. A representative clone, clone D5, has nearly 100% CAR expression as determined by flow cytometry. Clone D5 has a 12bp deletion. Signal references: E150740 and E164103. [Figure 37]Figure 1 shows the generation of clonal cells with CAR knock-in into RFX5. CAR knock-in into RFX5 was achieved using gRNA RFX5_exon9_gRNA2 20bp. Bulk-edited cells were single-cell sorted to generate clonal CAR+ cells that maintained high expression of pluripotency markers SSEA-3, SSEA-4, OCT3 / 4, and SOX2. Surface markers SSEA-1 and CD34, which are not expressed in iPSCs, remain low after editing and cloning. Flow plots shown are gated on live single cells. A representative clone, clone C3, has nearly 100% CAR expression as determined by flow cytometry. Clone C3 has a 15bp deletion. Signal references: E150740 and E164103. [Figure 38] The editing efficiency of MAD7 gRNA split into crRNA and tracrRNA is shown. Split gRNAs were formed by adding an equimolar mixture of split tracrRNA and the associated crRNA and incubating for 15 minutes at room temperature before RNP formation. The indel frequencies of MAD7 with unmodified crRNA, ALtR-modified crRNA, and split gRNAs 3, 4, and 5 targeting the two RFX5 and CD58 loci are shown. Signal reference: E164852. [Figure 39A] Figure 39 shows that CD58 knockout improves the ability of RFX5 knockout cells to evade alloreactive effector T cells. Gene-edited or control T cells (targets) were co-cultured with alloreactive effector T cells at the indicated E:T in an overnight cytotoxicity assay. Normalized target viability was calculated as % live targets at E:T / % live targets alone, with a value of 1.0 indicating complete evasion of cytotoxicity. The top panel (Figure 39A) shows data from one representative experiment using a single donor. The bottom panel (Figure 39B) shows aggregated data at E:T=10 from multiple experiments using several target and effector human donors. [Figure 39B]Figure 39 shows that CD58 knockout improves the ability of RFX5 knockout cells to evade alloreactive effector T cells. Gene-edited or control T cells (targets) were co-cultured with alloreactive effector T cells at the indicated E:T in an overnight cytotoxicity assay. Normalized target viability was calculated as % live targets at E:T / % live targets alone, with a value of 1.0 indicating complete evasion of cytotoxicity. The top panel (Figure 39A) shows data from one representative experiment using a single donor. The bottom panel (Figure 39B) shows aggregated data at E:T=10 from multiple experiments using several target and effector human donors. [Figure 40A] Figure 40A shows that CD58 knockout improves the ability of RFX5 knockout cells to evade primary NK cells. Gene-edited or control T cells (targets) were co-cultured with primary NK cells at the indicated E:T in an overnight cytotoxicity assay. Normalized target viability was calculated as % live targets at E:T / % live targets alone, with a value of 1.0 indicating complete evasion of cytotoxicity. The top panel (Figure 40A) shows data from one representative experiment using a single human donor. The bottom panel (Figure 40B) shows aggregated data at E:T=10 from multiple experiments using several target and effector human donors. [Figure 40B] Figure 40A shows that CD58 knockout improves the ability of RFX5 knockout cells to evade primary NK cells. Gene-edited or control T cells (targets) were co-cultured with primary NK cells at the indicated E:T in an overnight cytotoxicity assay. Normalized target viability was calculated as % live targets at E:T / % live targets alone, with a value of 1.0 indicating complete evasion of cytotoxicity. The top panel (Figure 40A) shows data from one representative experiment using a single human donor. The bottom panel (Figure 40B) shows aggregated data at E:T=10 from multiple experiments using several target and effector human donors. [Figure 41]Figure 1 shows a diagram of the dual CAR and CD58 miR-shRNA expression system, a single vector in which a single Pol II promoter drives the expression of transcripts encoding both the CAR and the CD58 miR-shRNA-mediated knockdown of endogenous CD58. The CD58 miR-shRNA is processed by Drosha and Dicer for RNAi and then loaded into the RISC (RNA-induced silencing complex) for silencing of the endogenous CD58 gene. The CAR portion is translated into protein for CAR molecule expression. [Figure 42] 1 shows the FACs gating strategy for assessing CAR expression and knockdown of endogenous CD58 using 55 different dual CAR and CD58 miR-shRNA constructs. [Figure 43] Figure 1 shows the transduction of different CD58 miR-shRNA constructs and evaluation of CD58 knockdown. The top panel shows the initial round screening of 55 different miR-shRNA constructs and a control CAR (no miR-shRNA). CD58% is the CD58 MFI for each construct / CD58 MFI for the control CAR. The bottom panel shows the follow-up screening of the top five miR-shRNAs transduced into RFX5 knockout primary T cells, along with five control conditions. The percentage above the bar is the knockdown efficiency, calculated as (CAR+CD58 MFI of each construct / (CAR+CD58 MFI NTC CAR-CAR+CD58 MFI CD58 knockout_RFX5 knockout)). [Figure 44] Figure 2 shows that the top two dual CAR and CD58 miR-shRNA expression systems result in efficient CAR expression and knockdown of endogenous CD58 as measured by surface flow cytometry staining. CAR+ cells were enriched and gated on live cells before flow cytometry analysis. [Figure 45] FIG. 46 shows the flow cytometry gating strategy for the analysis of the co-culture experiments shown in FIGS. 46A-C. [Figure 46A] Figure 46 shows that CD58 knockdown improves survival of RFX5 knockout cells when challenged with alloreactive effector T cells or NK cells. The top panel (Figure 46A) shows data from one representative experiment using a single target donor cocultured with a single allogeneic effector T cell human donor. The bottom panels (Figures 46B-C) show aggregated data using area under the curve (AUC) calculations from multiple experiments using several target and effector human donors. [Figure 46B] Figure 46 shows that CD58 knockdown improves survival of RFX5 knockout cells when challenged with alloreactive effector T cells or NK cells. The top panel (Figure 46A) shows data from one representative experiment using a single target donor cocultured with a single allogeneic effector T cell human donor. The bottom panels (Figures 46B-C) show aggregated data using area under the curve (AUC) calculations from multiple experiments using several target and effector human donors. [Figure 46C] Figure 46 shows that CD58 knockdown improves survival of RFX5 knockout cells when challenged with alloreactive effector T cells or NK cells. The top panel (Figure 46A) shows data from one representative experiment using a single target donor cocultured with a single allogeneic effector T cell human donor. The bottom panels (Figures 46B-C) show aggregated data using area under the curve (AUC) calculations from multiple experiments using several target and effector human donors. DETAILED DESCRIPTION OF THE INVENTION

[0122] Cell-based therapies continue to face numerous challenges that limit their clinical application. Such challenges include, for example, those summarized in Bashor et al., Nature Reviews Drug Discovery (2022):21, 655-675, "Engineering the next generation of cell-based therapeutics." The present disclosure addresses these and other challenges in the field of cell therapy for the first time.

[0123] The inventors provide herein, inter alia, methods of hypoimmunogenicity, such as bioengineering methodologies and materials, including, for example, genetically modifying and / or otherwise altering at least one target gene or gene product, processes for producing engineered hypoimmunogenic cells, manufacturing engineered hypoimmunogenic cell compositions, and hypoimmunogenic (e.g., engineering hypoimmunogenicity) methodologies and materials useful for the manufacture and use of engineered hypoimmunogenic cell compositions. The present disclosure provides, in part, a method of engineering hypoimmunogenicity, comprising genetically modifying at least one target gene (e.g., regulatory factor X (RFX) gene, B2M gene, CD58 gene, CIITA gene) in a human cell or cells to reduce expression of a protein encoded by the target gene in the human cell or cells, and forming at least one embryoid body to produce at least one engineered hypoimmunogenic cell. In some embodiments, the human cell is an immunogenic human cell. In some embodiments, the human cell is an induced pluripotent stem (iPS) human cell, e.g., an iPS human cell generated by reprogramming an immunogenic γδ T cell. In some embodiments, the cell is a rodent, porcine, primate, monkey, ape, or human cell. In some embodiments, the cell is an immunogenic rodent, porcine, primate, monkey, ape, or human cell. In some embodiments, the cell is an immunogenic human cell. In some embodiments, the cell is an induced pluripotent stem (iPS) cell, e.g., an iPS cell generated by reprogramming an immunogenic γδ T cell. The present disclosure is based, in part, on the discovery that the engineered hypoimmunogenic cells of the present disclosure were able to circumvent an allogeneic host-versus-graft immune response.

[0124] 7.1 Definition As used herein, the term "about" or "approximately" refers to an amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%. A range for an amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length can be ±15%, ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1% of the amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length. The term "about" in connection with a reference numerical value can include the numerical value itself as well as a range of values, e.g., plus or minus 10% from the numerical value. In some embodiments, the amount "about 10" includes 10 and any amount between 9 and 11. In some instances, a numerical value disclosed throughout may be "about" that numerical value without specifically reciting the term "about."

[0125] Unless otherwise indicated, the terms "at least," "up to," or "about" preceding a series of elements should be understood to refer to every element in the series.

[0126] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0127] As used herein, unless expressly stated to the contrary, "or" refers to an inclusive "or" and not an exclusive "or." For example, condition A or B is satisfied by one of the following: A is true (or exists) and B is false (or does not exist), A is false (or does not exist) and B is true (or exists), and both A and B are true (or exist).

[0128] As used herein, the connective term "and / or" between multiple listed elements is understood to encompass both individual and combined alternatives. For example, when two elements are connected by "and / or," the first alternative refers to the first element being applicable without the second element. The second alternative refers to the second element being applicable without the first element. The third alternative refers to the first and second elements being applicable together. Any one of these alternatives is understood to be within the meaning and, therefore, meets the requirements of the term "and / or" as used herein. The simultaneous applicability of two or more of the alternatives is also understood to be within the meaning and, therefore, meets the requirements of the term "and / or."

[0129] As used herein, the term "MHC molecule" refers to a major histocompatibility complex (MHC) found on cell surfaces that presents peptide fragments of non-self proteins. MHC class I molecules and MHC class II molecules are two classes of MHC molecules typically found on antigen-presenting cells. MHC class I molecules consist of two polypeptide chains. The alpha chain consists of three polypeptides called alpha-1, alpha-2, and alpha-3 domains. The alpha chain is non-covalently linked to the beta chain, consisting of beta-2 microglobulin (B2M), via the alpha-3 domain. The alpha chain is polymorphic and, in humans, is encoded by HLA genes (i.e., HLA-A, HLA-B, and HLA-C), while beta-2 microglobulin is not polymorphic and is encoded by the B2M gene. MHC class II molecules are transmembrane αβ heterodimers. In humans, there are three MHC class II isotypes: HLA-DR, HLA-DP, and HLA-DQ, encoded by α and β chain genes within the human leukocyte antigen (HLA) locus on chromosome 6.

[0130] As used herein, the term "deletion" or "knockout" refers to a genetic modification in which a site or region of genomic DNA is removed by any molecular biological method, such as those described herein, for example, by delivering an endonuclease and at least one gRNA to the site of genomic DNA. The term "deletion" or "knockout" includes deleting all or a portion of a target polynucleotide sequence to interfere with the function of the target polynucleotide sequence. In some embodiments, a "deletion" or "knockout" can result in complete or partial loss of expression of a target gene. Any number of nucleotides can be deleted. In some embodiments, the deletion involves removal of at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, or more than at least 25 nucleotides. In some embodiments, the deletion involves removal of 10-50, 25-75, 50-100, 50-200, or more than 100 nucleotides. In some embodiments, the deletion involves removal of the entire target gene, e.g., the RFX gene. In some embodiments, deletion involves removal of all or part of a portion of the target gene, e.g., the promoter and / or coding sequence of the RFX gene. In some embodiments, deletion involves removal of a transcriptional regulator of the target gene, e.g., the promoter region. In some embodiments, deletion involves removal of all or part of a coding region, such that the product normally expressed by the coding region is no longer expressed, is expressed in a truncated form, or is expressed at a reduced level. In some embodiments, deletion results in decreased expression of the gene compared to an unmodified cell. In some embodiments, knockout can be achieved by altering the target polynucleotide sequence by introducing an indel into the target polynucleotide sequence within a functional domain (e.g., a DNA-binding domain) of the target polynucleotide sequence. The terms "disruption" or "disrupted" refer to an alteration that results in a gene product that does not exhibit wild-type function and / or activity levels.In some embodiments, disruption refers to a genetic alteration in which the disrupted gene results in the production of such a non-wild-type gene product. As used herein, "disruption" refers to RNA interference, which involves the disruption of a gene's mRNA transcript via expression of an introduced miR-compatible shRNA.

[0131] In some embodiments, the disruption truncates the gene, e.g., the B2M gene. In some embodiments, the disruption deletes the gene, e.g., the B2M gene. In some embodiments, the disruption results in the gene producing an inactive protein. In some embodiments, the disruption results in disruption of the B2M reading frame by multiple out-of-frame deletions. In some embodiments, the disruption results in disruption of the B2M reading frame by a single out-of-frame deletion. In some embodiments, the disruption results in an insertion of about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 nucleotides or nucleotide base pairs (e.g., an insertion that changes the reading frame of the gene (e.g., B2M)). In some embodiments, the disruption results in disruption of the B2M reading frame. In certain embodiments, the gene is a B2M gene and the disruption results in the B2M gene producing an inactive B2M protein. In some embodiments, the disruption results in the gene expressing a reduced amount of a gene product, e.g., a reduced amount of a B2M polypeptide. In certain embodiments, the gene is a B2M gene and the disruption results in the B2M gene expressing a reduced amount of B2M protein. In some embodiments, the disruption results in the gene not expressing a detectable amount of gene product, e.g., not expressing a detectable amount of B2M protein. In some embodiments, the gene is a B2M gene and the disruption results in the B2M gene not expressing a detectable amount of B2M protein. A disrupted gene, e.g., a disrupted B2M gene, may refer to a gene that includes an insertion, deletion, or substitution compared to the corresponding wild-type gene, such that the disrupted gene expresses a reduced, e.g., not detectable, amount of functional protein compared to expression of the wild-type gene. A gene may be disrupted, for example, via a method of inserting, deleting, or substituting at least one nucleotide / nucleic acid in the endogenous gene, such that expression of functional protein from the endogenous gene is reduced or inhibited.In some embodiments, the substitution is performed by a base editor, which converts one nucleotide to another by modifying the chemical structure of the nucleotide. In some embodiments, the terms "disruption," "disrupted," "knockout," or "deletion" are used interchangeably in this disclosure. In some embodiments, at least one gRNA is complementary to and / or hybridizes to a sequence on a target polynucleotide sequence, and the target polynucleotide sequence comprises a B2M gene. In some embodiments, the target polynucleotide sequence comprises the sequence set forth in SEQ ID NO: 253. In some embodiments, the gRNA comprises the repeat sequence set forth in SEQ ID NO: 129 (UAAUUUCUACUCUUGUAGAU), optionally combined with the spacer sequence set forth in SEQ ID NO: 251 (AGUGGGGGUGAAUUCAGUGUA). In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 252.

[0132] In some embodiments, the gRNA targeting B2M is a discontinuous or "split" RNA.

[0133] In some embodiments, the disruption truncates the gene, e.g., the RFX gene. In some embodiments, the disruption deletes the gene, e.g., the RFX gene. In some embodiments, the disruption results in the gene producing an inactive protein. In some embodiments, the disruption results in disruption of the RFX reading frame by multiple out-of-frame deletions. In some embodiments, the disruption results in disruption of the RFX reading frame by a single out-of-frame deletion. In some embodiments, the disruption results in an insertion of about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 nucleotides or nucleotide base pairs (e.g., an insertion that alters the reading frame of the gene (e.g., RFX)). In some embodiments, the disruption results in disruption of the RFX reading frame. In certain embodiments, the gene is the RFX gene and the disruption results in the RFX gene producing an inactive RFX protein. In some embodiments, the disruption results in the gene expressing a reduced amount of a gene product, e.g., a reduced amount of an RFX polypeptide. In certain embodiments, the gene is an RFX gene and the disruption results in the RFX gene expressing a reduced amount of RFX protein. In some embodiments, the disruption results in the gene not expressing a detectable amount of a gene product, e.g., not expressing a detectable amount of RFX protein. In some embodiments, the gene is an RFX gene and the disruption results in the RFX gene not expressing a detectable amount of RFX protein. A disrupted gene, e.g., a disrupted RFX gene, can refer to a gene that includes an insertion, deletion, or substitution relative to the corresponding wild-type gene such that the disrupted gene expresses a reduced, e.g., not detectable, amount of functional protein relative to expression of the wild-type gene. A gene can be disrupted, for example, via a method of inserting, deleting, or substituting at least one nucleotide / nucleic acid in the endogenous gene such that expression of the functional protein from the endogenous gene is reduced or inhibited. In some embodiments, the substitution is performed by a base editor, which converts one nucleotide to another by modifying the chemical structure of the nucleotide.In some embodiments, the terms "disruption," "disrupted," "knockout," or "deletion" are used interchangeably in this disclosure. In some embodiments, at least one gRNA is complementary to and / or hybridizes to a sequence on a target polynucleotide sequence, and the target polynucleotide sequence comprises an RFX gene. In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 184 (RFX5_exon9_gRNA2, AGGAUCCGCUCUGCCCAGUCA), SEQ ID NO: 193 (RFX5_exon10_gRNA1, GAUGACCGUUCCCGAGGUGCA), SEQ ID NO: 202 (RFX5_exon10_gRNA4, GAGAACCCAGAGGGUGGAGCC), SEQ ID NO: 205 (RFX5_exon10_gRNA5, GUACCUCUGCAGAAGAGGACG), SEQ ID NO: 223 (RFX5_exon11_gRNA8, AGGGCACCUGAAGAAAGCCUG), SEQ ID NO: 239 (RFX5_exon9_gRNA2, AGGAUCCGCUCUGCCCAGUC), or SEQ ID NO: 246 (RFX5_exon10_gRNA1, GAUGACCGUUCCCGAGGUGC). In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 239 or 246. In some embodiments, the target polynucleotide sequence comprises the sequence of SEQ ID NO: 132, 135, 138, 141, 144, 147, 150, 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, 225, 228, 231, 234, 241, 241, or 248. In some embodiments, the gRNA comprises the repeat sequence set forth in SEQ ID NO: 129, 235, or 237. In some embodiments, the gRNA further comprises a spacer sequence set forth in SEQ ID NO: 130, 133, 136, 139, 142, 145, 148, 151, 154, 157, 160, 163, 166, 169, 172, 175, 178, 181, 184, 187, 190, 193, 196, 199, 202, 205, 208, 211, 214, 217, 220, 223, 226, 229, 232, 239, or 246.In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 131, 134, 137, 140, 143, 146, 149, 152, 155, 158, 161, 164, 167, 170, 173, 176, 179, 182, 185, 188, 191, 194, 197, 200, 203, 206, 209, 212, 215, 218, 221, 224, 227, 230, 233, 236, 238, 240, 242, 243, 244, 245, 247, 249, or 250. In some embodiments, the target polynucleotide sequence comprises SEQ ID NO: 141, 186, 195, 204, 207, 225, 241, or 248. In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 129, 235, or 237. In some embodiments, the gRNA further comprises a spacer sequence set forth in SEQ ID NO: 139, 184, 193, 202, 205, 223, 239, or 246. In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 140, 185, 194, 203, 206, 224, 236, 238, 240, 242, 243, 244, 245, 247, 249, or 250.

[0134] In some embodiments, the gRNA targeting RFX5 is a discontinuous or "split" RNA. In some embodiments, the discontinuous or "split" gRNA comprises the sequence set forth in SEQ ID NO: 377, 378, 379, 380, 381, 382, ​​383, 384, or 385.

[0135] In some embodiments, the disruption truncates the gene, e.g., the CD58 gene. In some embodiments, the disruption deletes the gene, e.g., the CD58 gene. In some embodiments, the disruption results in the gene producing an inactive protein. In some embodiments, the disruption results in a disruption of the CD58 reading frame by multiple out-of-frame deletions. In some embodiments, the disruption results in a disruption of the CD58 reading frame by a single out-of-frame deletion. In some embodiments, the disruption results in an insertion of about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 nucleotides or nucleotide base pairs (e.g., an insertion that changes the reading frame of the gene (e.g., CD58)). In some embodiments, the disruption results in a disruption of the CD58 reading frame. In a specific embodiment, the gene is the CD58 gene and the disruption results in the CD58 gene producing an inactive CD58 protein. In some embodiments, the disruption results in the gene expressing a reduced amount of gene product, e.g., a reduced amount of CD58 polypeptide. In certain embodiments, the gene is a CD58 gene and the disruption results in the CD58 gene expressing a reduced amount of CD58 protein. In some embodiments, the disruption results in the gene not expressing a detectable amount of gene product, e.g., not expressing a detectable amount of CD58 protein. In some embodiments, the gene is a CD58 gene and the disruption results in the CD58 gene not expressing a detectable amount of CD58 protein. A disrupted gene, e.g., a disrupted CD58 gene, may refer to a gene that contains an insertion, deletion, or substitution compared to the corresponding wild-type gene, such that the disrupted gene expresses a reduced, e.g., not detectable, amount of functional protein compared to expression of the wild-type gene. A gene may be disrupted, for example, via a method of inserting, deleting, or substituting at least one nucleotide / nucleic acid in the endogenous gene, such that expression of functional protein from the endogenous gene is reduced or inhibited.In some embodiments, the substitution is performed by a base editor, which converts one nucleotide to another by modifying the chemical structure of the nucleotide. In some embodiments, the terms "disruption," "disrupted," "knockout," or "deletion" are used interchangeably in this disclosure. In some embodiments, at least one gRNA is complementary to and / or hybridizes to a sequence on a target polynucleotide sequence, and the target polynucleotide sequence comprises a CD58 gene. In some embodiments, the target polynucleotide sequence comprises SEQ ID NO: 256, 259, 262, 265, 268, 271, 274, 277, 280, 283, 286, 289, 292, 295, 298, 301, 304, 307, 310, 313, 316, 319, 322, 325, 328, 331, 334, 337, 340, 343, 346, 349, 352, 355, 358, 361, 364, 367, 370, 373, or 376. In some embodiments, the gRNA comprises a repeat sequence set forth in SEQ ID NO: 129. In some embodiments, the gRNA further comprises a spacer sequence comprising the sequence of SEQ ID NO: 254, 257, 260, 263, 266, 269, 272, 275, 278, 281, 284, 287, 290, 293, 296, 299, 302, 305, 308, 311, 314, 317, 320, 323, 326, 329, 332, 335, 338, 341, 344, 347, 350, 353, 356, 359, 362, 365, 368, 371, or 374. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, 309, 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375. In some embodiments, the target polynucleotide sequence comprises SEQ ID NO: 256, 271, 274, 280, 304, or 328. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 129.In some embodiments, the gRNA further comprises a spacer sequence comprising the sequence of SEQ ID NO: 254, 269, 272, 278, 302, or 326. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 255, 270, 273, 279, or 327.

[0136] In some embodiments, the gRNA targeting CD58 is a discontinuous or "split" RNA. In some embodiments, the discontinuous or "split" gRNA comprises the sequence set forth in SEQ ID NO: 377, 378, 379, 386, 387, or 388.

[0137] In some embodiments, the gRNA both disrupts a gene (e.g., via indel formation, resulting in non-functional expression of the gene) and introduces another polynucleotide, e.g., a gene for a chimeric antigen receptor (CAR) and / or a miR-compatible shRNA. In some embodiments, the gRNA targets RFX5. In some embodiments, the gRNA is used to knock-in a transgene containing a promoter and a CAR into a target gene (e.g., one or more of the RFX, CD58, CIITA, and / or B2M genes), resulting in CAR expression on the surface of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells that can be detected by flow cytometry. In some embodiments, the gRNA may be used to knock-in a miR-compatible shRNA targeting CD58. In some embodiments, the miRNA comprises the sequence set forth in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.

[0138] In some embodiments, shRNA may be used to disrupt the CD58 gene. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66, or 67. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 63, or 64.

[0139] As used herein, the term "endonuclease" generally refers to an enzyme that cleaves phosphodiester bonds in a polynucleotide. In some embodiments, the endonuclease specifically cleaves phosphodiester bonds in a DNA polynucleotide. In some embodiments, the endonuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a homing endonuclease (HE), a meganuclease, MegaTAL, or a CRISPR (clustered regularly interspaced short palindromic repeats)-related endonuclease. A CRISPR cluster comprises a spacer, a sequence complementary to the preceding mobile element, and a target invader nucleic acid. The CRISPR cluster is transcribed and processed into CRISPR RNA (CRISPR RNA, crRNA). In some embodiments, the endonuclease is an RNA-guided endonuclease. In certain embodiments, the RNA-guided endonuclease is a CRISPR nuclease, such as a type II CRISPR Cas9 endonuclease or a type V CRISPR Cpf1 (or Cas12a) endonuclease. CRISPR-Cas systems can be characterized as class 1 or class 2 systems. Class 1 systems are characterized by a multi-subunit effector, i.e., they contain multiple Cas proteins. Class 1 systems can be further characterized as types I, III, and IV. Class 2 systems are characterized by a single effector protein with multiple domains. Class 2 systems can be further characterized as types II, V, and VI. For example, a class 2 type II system includes Cas9, and a class 2 type V system includes Cpf1 (Cas12a).Further examples of Cas proteins include, but are not limited to, Cas9 proteins, Cas9-like proteins encoded by Cas9 orthologs, Cas9-like synthetic proteins, Cpf1 proteins, proteins encoded by Cpf1 orthologs, Cpf1-like synthetic proteins, C2c1 proteins, C2c2 proteins, C2c3 proteins, and variants and modifications thereof. In some embodiments, the endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6 , Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1 (also known as Cas12a), MAD7, MAD2 endonuclease, or homologs thereof, recombinant forms of these naturally occurring molecules, codon-optimized versions thereof, or modified versions thereof, or combinations thereof. Examples of Cas proteins include, but are not limited to, MAD7, MAD2, Cpf1, C2c1, C2c3, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, and Cas13c.Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4 , Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cpf1, C2c1, C2c3, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, and Cas13c. In some embodiments, the endonuclease may introduce one or more single-stranded breaks (SSBs) and / or one or more double-stranded breaks (DSBs).

[0140] As used herein, the term "Cas12" or "Cas12 protein" refers to any Cas12 protein, including, but not limited to, Cas12a, Cas12b, Cas12c, Cas12d, and Cas12e. In some embodiments, the Cas12 protein has an amino acid sequence that is at least 85% (or at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the amino acid sequence of a functional Cas12 protein. In some embodiments, the Cas12 protein can be a Cas12 polypeptide substantially identical to a protein found in nature, or a Cas12 polypeptide that has at least about 85% sequence identity (or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 96% sequence identity, or at least about 97% sequence identity, or at least about 98% sequence identity, or at least about 99% sequence identity) to a Cas12 protein found in nature and has substantially the same biological activity. Examples of Cas12a proteins include, but are not limited to, FnCas12a, AsCas12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, or Lb4Cas12a. Examples of Cas12b proteins include, but are not limited to, AacCas12b, Aac2Cas12b, AkCas12b, AmCas12b, AhCas12b, and AcCas12b.

[0141] In some embodiments, the term "Cpf endonuclease" refers to a CRISPR-associated RNA-guided DNA endonuclease that cleaves a target DNA sequence when bound to a guide RNA. Guided by a guide RNA, the Cpf endonuclease recognizes and cleaves a specific target site in double-stranded DNA in a cell's genome. In some embodiments, the CRISPR-Cpf system uses Acidaminococcus sp. Cpf1 endonuclease, Lachnospiraceae sp. Cpf1 endonuclease, or Francisella novicida Cpf1 endonuclease, or variants thereof. The Cpf1-crRNA cleaves by specifying the protospacer adjacent motif (PAM) 5'-TTTN of Acidaminococcus sp. Cpf1 endonuclease and Lachnospiraceae sp. Cpf1 endonuclease, and the PAM sequence 5'-TTN of Francisella novicida Cpf1. After PAM identification, Cpf1 introduces a 4-5 nucleotide overhanging cohesive-end DNA double-strand break distal to the 3' end of the targeted PAM, which is then repaired by either non-homologous end joining (NHEJ) or homology-directed repair (HDR). The term "Cpf1 endonuclease" is understood to encompass variants thereof.

[0142] As known to those skilled in the art, the term "Mad endonuclease" refers to a CRISPR-associated RNA-guided DNA endonuclease that cleaves a target DNA sequence when bound to a guide RNA. Guided by a guide RNA, Mad endonucleases recognize and cleave specific target sites in double-stranded DNA in a cell's genome. The CRISPR-Mad system is closely related to the class 2 family of CAS enzymes, type V (Cpf1-like). In some embodiments, the CRISPR-Mad system uses the Eubacterium rectale MAD7 endonuclease or a variant thereof. In some embodiments, MAD7 is a class 2 type VA CRISPR family identified in Eubacterium rectale. The MAD7-crRNA complex cleaves the target by identifying the protospacer adjacent motif (PAM) 5'-YTTN. After PAM identification, MAD7 introduces a 4-5 nucleotide overhanging cohesive-end DNA double-strand break at the 3' end of the targeted PAM, which is then repaired by either non-homologous end joining (NHEJ) or homology-directed repair (HDR). The term "Mad endonuclease" is understood to encompass variants thereof. In some embodiments, the B2M target motif identified or used in the CRISPR-Cpf1 (Cas12a) system is the same B2M target motif as when using MAD7. In some embodiments, the same guide nucleic acid or guide RNA can be used with Cpf1 (or Cas12a) and MAD7 nucleases.

[0143] As used herein, the term "guide RNA" or "gRNA" generally refers to a short ribonucleic acid that can interact with, e.g., bind to, an endonuclease and bind or hybridize to a target genomic site or region. In some embodiments, the gRNA is a single-molecule guide RNA (sgRNA). In some embodiments, the gRNA may include a spacer extension region. In some embodiments, the gRNA may include a tracrRNA extension region. In some embodiments, the gRNA is single-stranded. In some embodiments, the gRNA comprises naturally occurring nucleotides. In some embodiments, the gRNA is a chemically modified gRNA. In some embodiments, the chemically modified gRNA is a gRNA that includes at least one nucleotide with a chemical modification, e.g., a 2'-O-methyl sugar modification. In some embodiments, the chemically modified gRNA comprises a modified nucleic acid backbone. In some embodiments, the chemically modified gRNA comprises 2'-O-methyl-phosphorothioate residues. In some embodiments, the gRNA may be pre-complexed with a DNA endonuclease. In some embodiments, the gRNA sequence includes AltR1 and / or AltR2. In some embodiments, AltR1 and AltR2 are unique (IDT) modifications used to increase the stability of short RNAs (e.g., gRNAs). Modifications to nucleic acids, such as RNAs and gRNAs, can be found, for example, in U.S. Patent No. 9,840,702, incorporated herein by reference. A gRNA can be constructed as a single RNA oligonucleotide that is a combination of a repeat sequence followed by a spacer sequence, and specificity for a genomic target location is conferred by complementary binding of the spacer to genomic DNA. A split gRNA can be constructed as two RNA oligonucleotides composed of a tracrRNA and a crRNA, for example, the tracrRNA contains a portion of the repeat sequence and the crRNA contains a portion of the repeat sequence followed by a spacer sequence.

[0144] As used herein, the term "genetic modification" generally refers to genetically edited or manipulated genomic DNA of a gene, mRNA transcribed from a gene, or transcription of a gene in a cell, resulting in a reduced level of expression of a gene product, e.g., a protein encoded by the gene.

[0145] The terms "decrease," "reduction," and "lower" are all used interchangeably herein and refer to a decrease by a statistically significant amount (e.g., two standard deviations (2SD) below normal). In some embodiments, "decrease," "reduction," or "lower" refers to a decrease of at least about 5% compared to a reference level, e.g., at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a reference level. In some embodiments, "decrease," "reduction," or "lower" refers to any decrease between 10 and 100% compared to a reference level. In some embodiments, "decreased," "reduced," or "lower" refers to a decrease of at least about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold compared to a reference level. In some embodiments, the decrease or reduction in expression results in undetectable levels of the target gene or target polynucleotide sequence in a cell or population of cells, as determined by methods used by those of skill in the art or disclosed herein (e.g., FACS). In some embodiments, the reduction in expression of RFX is reduced relative to a reference. In some embodiments, the reference is an iPSC or population of iPSCs without a genetic modification of the gene (e.g., the RFX gene). In some embodiments, the reference is an immunogenic human cell or population of immunogenic human cells without a genetic modification of the gene.

[0146] In some embodiments, the terms "increase," "enhancement," and "elevation" are all used interchangeably herein and refer to an increase of at least about 5% compared to a reference level, e.g., an increase of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a reference level. In some embodiments, "increase," "enhancement," or "elevation" refers to any increase of 10-100% compared to a reference level. In some embodiments, "increase," "enhancement," or "elevation" refers to an increase of at least about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold compared to a reference level.

[0147] As used herein, the term "polynucleotide," which may be used interchangeably with the term "nucleic acid," generally refers to a biological molecule comprising two or more nucleotides. Typically, polynucleotides of the present disclosure are composed of nucleosides naturally found in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) linked by phosphodiester bonds. In some embodiments, a polynucleotide is a hybrid DNA / RNA molecule. In some embodiments, the term encompasses molecules comprising nucleosides or nucleoside analogs containing chemically or biologically modified bases, modified backbones, etc., whether or not found in naturally occurring nucleic acids; such molecules may be preferred for certain applications. When the present application refers to a polynucleotide, it is understood that both DNA and RNA, and in each case both single- and double-stranded forms (and the complement of each single-stranded molecule) are provided. As used herein, "polynucleotide sequence" can refer to the polynucleotide substance itself and / or sequence information (i.e., a sequence of letters used as shorthand for bases) that biochemically characterizes a particular nucleic acid. Polynucleotide sequences presented herein are presented in a 5' to 3' direction unless otherwise indicated. In some embodiments, a polynucleotide comprises at least 2, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 200, at least 250, at least 500, or any number of nucleotides. In some embodiments, a polynucleotide is a site or region of genomic DNA. In some embodiments, a polynucleotide is an endogenous gene contained within the genome of a cell. In some embodiments, a polynucleotide is an exogenous polynucleotide that is not integrated into genomic DNA. In some embodiments, a polynucleotide is an exogenous polynucleotide that is integrated into genomic DNA.In some embodiments, the polynucleotide is a plasmid or an adeno-associated viral vector. In some embodiments, the polynucleotide is a circular or linear molecule.

[0148] As used herein, a "cell culture medium" (also referred to herein as a "culture medium" or "culture" or "medium") is a medium for culturing cells that contains nutrients that maintain cell viability and support growth. Cell culture media may contain any of the following other components, such as salts, buffers, amino acids, glucose or other sugars, antibiotics, serum or serum substitutes, and peptide growth factors, in appropriate combinations. Cell culture media commonly used for particular cell types are known to those of skill in the art. Some non-limiting examples are provided herein.

[0149] As used herein, "cell line" refers to a population of largely or substantially identical cells, typically derived from a single ancestral cell or derived from a defined and / or substantially identical population of ancestral cells. A cell line may be maintained or capable of being maintained in culture for an extended period of time (e.g., months, years, indefinite period). It may have undergone a spontaneous or induced process of transformation that confers indefinite culture life to the cells. A cell line includes all cell lines recognized as such in the art. It will be understood that cells acquire mutations and possibly epigenetic changes over time such that at least some properties of individual cells of a cell line may differ from one another.

[0150] As used herein, the terms "differentiate," "differentiation," and the like refer to the process by which an unspecialized (or uncommitted) or relatively unspecialized cell acquires the characteristics of a specialized cell, such as a blood cell or a muscle cell. A differentiated cell or differentiation-induced cell is a cell that is at a more specialized (or committed) position within a cell lineage. A cell becomes committed when, under normal circumstances, it continues to differentiate into a specific cell type or subset of cell types and has progressed in the differentiation pathway to a point where, under normal circumstances, it is unable to differentiate into a different cell type or revert to a relatively undifferentiated cell type.

[0151] As used herein, the term "encode" refers to the inherent property of a particular sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes, having either a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and the biological properties that result therefrom. Thus, a gene encodes a protein if, in a cell or other biological system, transcription and translation of the mRNA corresponding to that gene produces the protein. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing, and the non-coding strand, which is used as a template for transcription of the gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

[0152] As used herein, the term "exogenous" is intended to mean that the referenced molecule or referenced activity is introduced into the host cell. The molecule can be introduced, for example, by introduction of an encoding nucleic acid into the host genetic material, such as by integration into a host chromosome, or as non-chromosomal genetic material such as a plasmid. Thus, when used in reference to expression of an encoding nucleic acid, the term refers to the introduction of the encoding nucleic acid in an expressible form into a cell. The term "endogenous" refers to a referenced molecule or activity that is present in the host cell. Similarly, when used in reference to expression of an encoding nucleic acid, the term refers to expression of an encoding nucleic acid that is contained within the cell and is not exogenous.

[0153] As used herein, the term "induced pluripotent stem cells" or "iPSCs" refers to stem cells produced from differentiated adult cells that have been induced or modified (i.e., reprogrammed) into cells that can differentiate into tissues of all three embryonic or cortical germ layers: mesoderm, endoderm, and ectoderm.

[0154] As used herein, the term "isolated," when used in reference to a cell, is intended to mean a cell that is substantially free of at least one component as the referenced cell is found in nature. This term includes a cell that has been removed from some or all components as found in its natural environment. This term also includes a cell that has been removed from at least one, some, or all components as the cell is found in a non-naturally occurring environment. Thus, an isolated cell is partially or completely separated from other substances as it is found in nature or as it is grown, stored, or exists in a non-naturally occurring environment. Specific examples of isolated cells include partially pure cells, substantially pure cells, and cells cultured in a non-naturally occurring medium.

[0155] As used herein, the term "purify" or the like refers to increasing purity. For example, purity can be increased by at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% (e.g., compared to a reference).

[0156] As used herein, the term "pluripotency" refers to the ability of a cell to form all lineages of the body or cell body (i.e., the embryonic body). For example, embryonic stem cells are a type of pluripotent stem cell that can form cells from each of the three germ layers: ectoderm, mesoderm, and endoderm. Pluripotency is a continuum of developmental potential ranging from incompletely or partially pluripotent cells (e.g., epiblast stem cells or EpiSCs) that cannot give rise to a complete organism to more primitive, more pluripotent cells (e.g., embryonic stem cells) that can give rise to a complete organism.

[0157] As used herein, the term "population," when used with respect to T lymphocytes, refers to a group of cells containing two or more T lymphocytes. An isolated population of T lymphocytes can have only one type of T lymphocyte or two or more types of T lymphocytes. An isolated population of T lymphocytes can be a homogenous population of one type of T lymphocyte or a heterogeneous population of two or more types of T lymphocytes. An isolated population of T lymphocytes can also be a heterogeneous population containing T lymphocytes and at least other cells, such as B cells, macrophages, neutrophils, erythrocytes, hepatocytes, endothelial cells, epithelial cells, muscle cells, brain cells, etc. A heterogeneous population can have from 0.01% to about 100% T lymphocytes. Thus, an isolated population of T lymphocytes can have at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% T lymphocytes. An isolated population of T lymphocytes can contain only one type of T lymphocyte or a mixture of two or more types of T lymphocytes. The isolated population of T lymphocytes can contain one or more, or all, of the different types of T lymphocytes, including, but not limited to, those disclosed herein. The isolated population of T lymphocytes can contain all known types of T lymphocytes. In an isolated population of T lymphocytes containing two or more types of T lymphocytes, the proportion of each type of T lymphocyte can range from 0.01% to 99.99%. The isolated population can also be a clonal population of T lymphocytes, in which all T lymphocytes in the population are clones of a single T lymphocyte.

[0158] A "recombinant" polynucleotide is a polynucleotide that is not in its natural state, e.g., the polynucleotide contains a nucleotide sequence that is not found in nature, or the polynucleotide is in a context other than that in which it is found in nature, e.g., the polynucleotide is free from nucleotide sequences with which it is normally contiguous in nature, or the polynucleotide is adjacent (or contiguous) with nucleotide sequences with which it is not normally contiguous, etc. For example, the sequence of interest may be cloned into a vector or otherwise recombined with one or more additional nucleic acids.

[0159] As used herein, "reprogramming" refers to the process of changing or reversing the differentiation state of a somatic cell. Cells can be partially or terminally differentiated before reprogramming. Reprogramming encompasses the complete reversion of the differentiation state of a somatic cell (e.g., a T cell) to a pluripotent state. Reprogramming also encompasses the partial reversal of the differentiation state of a somatic cell to a state that makes the cell more susceptible to complete reprogramming to a pluripotent state when subjected to further manipulation as described herein. Such contact can result in the expression of specific genes by the cell, which contributes to reprogramming. In some embodiments of the present disclosure, reprogramming of a somatic cell places the somatic cell in a pluripotent and ES-like state. The resulting cell is referred to herein as a reprogrammed pluripotent somatic cell or an induced pluripotent stem cell (iPSC). In some embodiments, reprogramming also encompasses the partial reversal of the differentiation state of a somatic cell to a multipotent state.

[0160] Reprogramming is distinct from simply maintaining the existing undifferentiated state of a cell that is already pluripotent, or from maintaining the existing, less-fully differentiated state of a cell that is already a multipotent cell (e.g., a hematopoietic stem cell). Reprogramming is also distinct from promoting self-renewal or proliferation of a cell that is already pluripotent or multipotent. In some embodiments, the methods described herein contribute to establishing a pluripotent state by reprogramming. In some embodiments, the methods described herein may be performed on fully differentiated cells and / or specific types of cells (e.g., γδ T cells) rather than cells that are already multipotent or multipotent.

[0161] As used herein, "reprogramming factor" refers to a gene, RNA, or protein that promotes or contributes to cell reprogramming (e.g., in vitro). Examples of reprogramming factors of interest for reprogramming somatic cells to pluripotency in vitro are Oct3 / 4, Klf4, c-Myc, Nanog, Sox2, and Lin28, as well as any gene / protein that can replace one or more of these in methods of reprogramming somatic cells, e.g., in vitro.

[0162] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to a major type of white blood cell that completes maturation in the thymus and has various roles in the immune system, including identifying specific foreign antigens in the body and activating and deactivating other immune cells. T lymphocytes can be any T lymphocyte, such as cultured T lymphocytes, e.g., primary T lymphocytes, or T lymphocytes from cultured T cell lines, e.g., Jurkat, SupT1, etc., or T lymphocytes obtained from mammals. T lymphocytes are characterized by CD3 + The T lymphocytes can be any type of T lymphocyte, including CD4 + / CD8 + Double positive T cells, CD4 + Helper T cells (e.g., Th1 and Th2 cells), CD8 + T lymphocytes may be of any developmental stage, including, but not limited to, T cells (e.g., cytotoxic T cells), peripheral blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor infiltrating lymphocytes (TILs), memory T cells, naive T cells, regulatory T cells, gamma delta T cells (γδ T cells), etc. T lymphocytes may be of any developmental stage, including, but not limited to, nTregs (natural Tregs), iTregs (inducible Tregs), CD8 +They may be regulatory T cells, including Treg, regulatory Tr1 cells, and Th3 cells. Further types of helper T cells include cells such as Th3 (Treg), Th17, Th9, or T follicular helper (Tfh) cells. Further types of memory T cells include central memory T cells (T CM cells), effector memory T cells (T EM Cells and T EMRA T lymphocytes can also refer to genetically engineered T lymphocytes, such as T lymphocytes modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T lymphocytes can also include stem cells, definitive hemangioblasts, and CD34 + They can be differentiated from hematopoietic stem and progenitor cells, HSCs (hematopoietic stem and progenitor cells), hematopoietic multipotent progenitor cells, or T cell progenitor cells.

[0163] As used herein, the term "γδ T cells" refers to T cells that have a T cell receptor comprising a γ chain and a δ chain on their surface.

[0164] As used herein, the term "selectable marker" refers to a gene, RNA, or protein that, when expressed, confers on a cell a selectable phenotype, such as resistance to cytotoxic or cytostatic agents (e.g., antibiotic resistance), nutritional prototrophy, or expression of a specific protein that can be used as the basis for distinguishing cells that express the protein from cells that do not. Proteins whose expression can be easily detected ("detectable markers"), such as fluorescent or luminescent proteins or enzymes that act on a substrate to produce a colored, fluorescent, or luminescent substance, constitute a subset of selectable markers. The presence of a selectable marker linked to expression control elements native to genes that are normally expressed selectively or exclusively in pluripotent cells makes it possible to identify and select somatic cells that have been reprogrammed to the pluripotent state. A variety of selectable marker genes can be used, including the neomycin resistance gene (neo), puromycin resistance gene (puro), guanine phosphoribosyltransferase (gpt), dihydrofolate reductase (DHFR), adenosine deaminase (ada), puromycin-N-acetyltransferase (PAC), hygromycin resistance gene (hyg), multidrug resistance gene (mdr), thymidine kinase (TK), hypoxanthine-guanine phosphoribosyltransferase (HPRT), and hisD gene. Detectable markers include green fluorescent protein (GFP), blue, sapphire, yellow, red, orange, and cyan fluorescent proteins, and variants of any of these.Light-emitting proteins such as luciferase (e.g., firefly or Renilla luciferase) are also useful. As will be apparent to one of skill in the art, the term "selectable marker," as used herein, can refer to a gene or the expression product of a gene, e.g., the encoded protein.

[0165] In some embodiments, a selectable marker confers a growth and / or survival advantage to cells that express it compared to cells that do not express it or cells that express it at a significantly lower level. Such a growth and / or survival advantage typically occurs when cells are maintained under certain conditions, i.e., "selective conditions." To ensure effective selection, a population of cells can be maintained under conditions and for a sufficient period of time such that cells that do not express the marker do not grow and / or survive and are eliminated from the population or their numbers are reduced to only a very small percentage of the population. The process of selecting cells that express a marker that confers a growth and / or survival advantage by maintaining a population of cells under selective conditions to largely or completely eliminate cells that do not express the marker is referred to herein as "positive selection," and the marker is said to be "useful for positive selection." Negative selection and markers useful for negative selection are also of interest in certain methods described herein. Expression of such a marker confers a growth and / or survival disadvantage on cells that express the marker relative to cells that do not express the marker or cells that express it at a significantly lower level (or, considered another way, cells that do not express the marker have a growth and / or survival advantage relative to cells that express the marker). Thus, cells that express the marker can be largely or completely eliminated from a population of cells when maintained under selective conditions for a sufficient period of time.

[0166] As used herein, the term "feeder cells" refers to cells of one type co-cultured with cells of a second type, providing stimuli, growth factors, and nutrients for the support of the second cell type, thereby providing an environment in which the second cell type can grow, expand, or differentiate. Feeder cells are optionally derived from a different species than the cells they support. For example, certain types of human cells, including stem cells, can be supported by primary cultures of mouse embryonic fibroblasts or immortalized mouse embryonic fibroblasts. In another example, peripheral blood-derived cells or transformed leukemia cells support the growth and maturation of natural killer cells. Feeder cells can typically be inactivated by irradiation or treatment with antimitotic agents such as mitomycin to prevent outgrowth of the supporting cells when co-cultured with other cells. Feeder cells can include endothelial cells, stromal cells (e.g., epithelial cells or fibroblasts), and leukemia cells. Although not limited to the above, one specific cell type of feeder cells can be human feeder cells, such as human skin fibroblasts. Another cell type of feeder cells can be mouse embryonic fibroblasts (MEFs). In general, various feeder cells can be used in part to maintain pluripotency, direct differentiation toward specific lineages, enhance proliferation capacity, and promote maturation into specialized cell types, such as effector cells.

[0167] As used herein, a "feeder-free" (FF) environment refers to an environment, such as a culture condition, cell culture, or culture medium, that is essentially free of feeder cells or stromal cells and / or that has not been preconditioned by culturing feeder cells. A "preconditioned" medium refers to a medium that has been harvested after feeder cells have been cultured in the medium for a period of time, such as at least one day. Preconditioned medium contains many mediator substances, including growth factors and cytokines, secreted by feeder cells cultured in the medium. In some embodiments, a feeder-free environment is free of both feeder cells and stromal cells and is not preconditioned by culturing feeder cells.

[0168] The term "pluripotency-associated gene" refers to a gene whose expression under normal conditions (e.g., in the absence of genetic or other manipulations designed to alter gene expression) occurs in, and is typically restricted to, pluripotent stem cells and is important to their functional identity. It is understood that a polypeptide encoded by a gene functionally associated with pluripotency may be present as a maternal factor in an oocyte. The gene may be expressed by at least some cells of an embryo, for example, throughout at least a portion of the preimplantation period, and / or in germ cell precursors of an adult.

[0169] The term "pluripotency factor" is used to refer to the expression product of a pluripotency-associated gene, e.g., a polypeptide encoded by the gene. In some embodiments, the pluripotency factor is one that is not normally substantially expressed in somatic cell types (excluding germ cells or their precursors) that constitute the body of an adult animal. For example, the pluripotency factor can be one whose average level in ES cells is at least 50-fold or 100-fold greater than its average level in terminally differentiated cell types present in the body of an adult mammal. In some embodiments, the pluripotency factor is one that is essential for maintaining the viability or pluripotent state of ES cells in vivo and / or ES cells derived using conventional methods. Thus, if the gene encoding the factor is knocked out or inhibited (i.e., its expression is eliminated or substantially reduced), ES cells will not form, will die, or, in some embodiments, will differentiate. In some embodiments, inhibiting the expression of a gene having a function associated with pluripotency in ES cells (e.g., resulting in at least a 50%, 60%, 70%, 80%, 90%, 95%, or more reduction in the average steady-state levels of RNA transcripts and / or proteins encoded by the gene) results in cells that are viable but no longer pluripotent. In some embodiments, the gene is characterized in that its expression is reduced in ES cells (e.g., resulting in at least a 50%, 60%, 70%, 80%, 90%, 95%, or more reduction in the average steady-state levels of RNA transcripts and / or proteins encoded by the gene) when the cells differentiate into terminally differentiated cells.

[0170] As used herein, a "pluripotency-inducing gene" refers to a gene whose expression contributes to the reprogramming of somatic cells to a pluripotent state. A "pluripotency-inducing factor" refers to the expression product of a pluripotency-inducing gene. A pluripotency-inducing factor may, but need not, be a pluripotency factor. Expression of an exogenously introduced pluripotency-inducing factor may be transient, i.e., may be required during at least a portion of the reprogramming process to induce pluripotency and / or establish a stable pluripotent state, but may not be required thereafter to maintain pluripotency. For example, the factor may induce the expression of endogenous genes with functions associated with pluripotency. These genes may then maintain the reprogrammed cells in a pluripotent state.

[0171] A "polypeptide" refers to a polymer of amino acids. The terms "protein" and "polypeptide" are used interchangeably herein. Peptides are relatively short polypeptides, typically about 2 to 60 amino acids in length. As used herein, a polypeptide typically contains amino acids, such as the 20 L-amino acids most commonly found in proteins. However, other amino acids and / or amino acid analogs known in the art can be used. One or more of the amino acids in a polypeptide may be modified, for example, by the addition of chemical moieties such as carbohydrate groups, phosphate groups, fatty acid groups, conjugation, or linkers for functionalization. A polypeptide can still be considered a "polypeptide" when covalently or noncovalently associated with a non-polypeptide moiety. Exemplary modifications include glycosylation and palmitoylation. Polypeptides can be purified from natural sources, produced using recombinant DNA technology, or synthesized through chemical means such as conventional solid-phase peptide synthesis. As used herein, the terms "polypeptide sequence" or "amino acid sequence" can refer to the polypeptide material itself and / or sequence information biochemically characterizing the polypeptide (i.e., the sequence of letters or three-letter codes used as abbreviations for amino acid names). Polypeptide sequences presented herein are presented in an N-terminal to C-terminal direction unless otherwise indicated.

[0172] 7.2 Abbreviations A list of abbreviations used in this disclosure is provided in Table 1 below.

[0173] [Table 1]

[0174] 7.3 Cells for engineering low immunogenicity Cells for the methods of the present disclosure may be derived from all cells and tissues, particularly mammalian cells and tissues. Suitable cells may be derived from humans, apes, monkeys, pigs, or rodents, and may be primary or cultured cells. In some embodiments, the cells modified using the methods of the present disclosure are human cells.

[0175] It should be noted that all cell types are contemplated herein, with preferred cell types including immune cells such as T cells, natural killer (NK) cells, and B cells, as well as induced pluripotent stem cells (iPSCs). Other suitable cells include bone marrow stem cells and adult reserve stem cells. In some embodiments, the cells modified using the methods of the present disclosure are T cells. In some embodiments, the cells modified using the methods of the present disclosure are NK cells. In some embodiments, the cells modified using the methods of the present disclosure are iPSCs. In some embodiments, the cells modified using the methods of the present disclosure are hematopoietic stem cells (HSCs).

[0176] In some embodiments, the T cells engineered using the methods of the present disclosure are alpha-beta T cells. In some embodiments, the T cells engineered using the methods of the present disclosure to engineer low immunogenicity are gamma-delta T cells. In some embodiments, the T cells are CD8 + T cells and / or CD4 + Contains T cells.

[0177] Donor cell isolation / enrichment In some embodiments, the cells used in the methods of the present disclosure are obtained from a donor. The cells may be allogeneic or non-autologous ("non-self") with respect to the recipient to whom the cells are administered. In some embodiments, the cells are obtained from a mammalian subject. In other embodiments, the cells are obtained from a primate subject. In some embodiments, the cells are obtained from a human subject.

[0178] In some embodiments, the cells used in the methods of the present disclosure are lymphocytes (e.g., T cells, NK cells). Lymphocytes can be obtained from sources such as, but not limited to, peripheral blood mononuclear cells (PBMCs), bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infection site, ascites, pleural effusion, spleen tissue, and tumors. Lymphocytes can also be generated by differentiation of stem cells. In some embodiments, lymphocytes can be obtained from blood drawn from a subject using techniques generally known to those skilled in the art, such as sedimentation, e.g., FICOLL™ separation.

[0179] Cells from a subject's circulating blood can be obtained by apheresis. Apheresis devices typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. Cells collected by apheresis can be washed to remove the plasma fraction and place the cells in an appropriate buffer or medium for subsequent processing. Cells can be washed with PBS or another suitable solution lacking calcium, magnesium, and most, if not all, other divalent cations. The washing step can be accomplished by methods known to those skilled in the art, such as, but not limited to, a semi-automated flow-through centrifuge, using a Cobe 2991 cell processing device or a Baxter CytoMate. After washing, the cells can be resuspended in various biocompatible buffers, cell culture media, or other saline solutions, with or without buffers.

[0180] T cells can be isolated from PBMCs by lysing red blood cells and depleting monocytes. As an example, T cells can be sorted by centrifugation through a PERCOLL™ gradient. In some embodiments, after isolation of PBMCs, both cytotoxic and helper T lymphocytes can be sorted into naive, memory, and effector T cell subpopulations, either before or after activation, expansion, and / or genetic modification.

[0181] In some embodiments, T lymphocytes can be enriched for specific subpopulations of T lymphocytes expressing one or more markers, such as, but not limited to, CD3, CD4, CD8, CD14, CD15, CD16, CD19, CD27, CD28, CD34, CD36, CD45RA, CD45RO, CD56, CD62, CD62L, CD122, CD123, CD127, CD235a, CCR7, HLA-DR, or combinations thereof, using either positive or negative selection techniques.

[0182] In some embodiments, immune cells (T cells, NK cells) may also be differentiated from stem cells such as cord blood stem cells, progenitor cells, bone marrow stem cells, hematopoietic stem cells (HSCs), and induced pluripotent stem cells (iPSCs).

[0183] 7.4 Low immunogenicity methods The inventors provide herein, inter alia, methods of hypoimmunogenicity, such as, for example, genetically modifying and / or otherwise altering at least one target gene or gene product, processes for producing hypoimmunogenic cells (such as engineered hypoimmunogenic cells), manufacturing hypoimmunogenic cell compositions (such as engineered hypoimmunogenic cell compositions), hypoimmunogenic cell lines (such as engineered hypoimmunogenic cell lines), and bioengineering methodologies and materials, including hypoimmunogenicity (such as engineering hypoimmunogenicity) methodologies and materials useful for their use. In one aspect, provided herein are methods of hypoimmunogenicity (such as engineering hypoimmunogenicity).

[0184] In some embodiments, the immunogenic cells are rodent, porcine, monkey, primate, ape, or human immunogenic cells, hi some embodiments, the immunogenic cells are immunogenic human cells.

[0185] In some embodiments, the method comprises genetically modifying (e.g., genetically modifying as disclosed in Section 7.5) at least one target gene (e.g., regulatory factor X (RFX) gene, B2M gene, CD58 gene, CIITA gene, TNFRSF14 gene, TNFRSF1A gene, TNFRSF1B gene, ICAM1 gene) of at least one human cell or cell. In some embodiments, genetically modifying the at least one target gene reduces expression of a protein encoded by the at least one target gene in the human cell or cells. In some embodiments, modifying the at least one target gene results in a cell or human cell with reduced immunogenicity.

[0186] In some embodiments, the method further comprises subjecting the genetically modified human cell or genetically modified cells to the immune system and determining the immunogenicity of the genetically modified human cell or genetically modified cells, wherein the immunogenicity is altered compared to a human cell or cells that have not been genetically modified in at least one gene.

[0187] In some embodiments, the method further comprises subjecting the genetically modified cell or genetically modified human cell to the immune system and determining the immunogenicity of the genetically modified cell or genetically modified human cell, wherein the immunogenicity is altered compared to an unmodified cell or unmodified human cell, and wherein the only difference between the genetically modified cell or such genetically modified human cell and the unmodified cell or unmodified human cell is that at least one gene in the cell or human cell has not been genetically modified.

[0188] In some embodiments, the method further comprises administering hypoimmunogenic cells, such as engineered hypoimmunogenic cells, to the subject.

[0189] In some embodiments, the method further includes forming at least one embryoid body or multicellular body from the genetically modified human cell or the genetically modified cell to produce at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), subjecting the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) to the immune system, and determining the immunogenicity of the hypoimmunogenic cell (such as the engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to an unmodified human cell or an unmodified cell that has not been genetically modified in at least one target gene.

[0190] In some embodiments, the method further includes forming at least one embryoid body or multicellular body from the genetically modified cell or genetically modified human cell to produce at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic cell); subjecting the genetically modified cell or genetically modified human cell to the immune system; and determining the immunogenicity of the genetically modified cell or genetically modified human cell, wherein the immunogenicity is altered compared to an unmodified cell or unmodified human cell, and the only difference between the genetically modified cell, such as the genetically modified human cell, and the unmodified cell or unmodified human cell is that at least one gene has not been genetically modified in the unmodified cell or unmodified human cell.

[0191] In some embodiments, the embryoid bodies are made into a single-cell suspension before exposure to the immune system for immunogenicity testing. Embryoid bodies can be produced by any method known to those skilled in the art, such as the method disclosed in Pettinato et al., "Engineering Strategies for the Formation of Embryoid Bodies from Human Pluripotent Stem Cells," Stem Cells and Development, Volume 24, Number 14, 2015. Non-limiting exemplary methods include suspension culture (e.g., bacterial-grade dish culture or methylcellulose culture), hanging drop culture, conical tube culture, round-bottom 96-well plate culture (including low-adhesion multi-well plates), spinner bioreactor culture, low-speed horizontal vessel culture, and micromolded gel culture.

[0192] In some embodiments, the method further comprises introducing a chimeric antigen receptor (CAR) into the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells, optionally into an endogenous target gene such as RFX, CD58, CIITA, and / or B2M.

[0193] In some forms, the method further comprises introducing a CAR into a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) or iPS human cell described herein, such that the CAR is expressed on the surface of the cell (such as an engineered hypoimmunogenic cell) or iPS human cell and is detectable by flow cytometry. In some embodiments, the method further comprises using a gRNA to knock in a transgene containing a promoter and CAR into a target gene (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene), resulting in CAR expression on the surface of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) or iPS human cell that can be detected by flow cytometry.

[0194] In some embodiments, the method involves knocking out one or more target genes in hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells, e.g., via gRNA, and optionally further comprising knocking in a transgene containing a promoter and a CAR into the target gene (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene). In some embodiments, the method further involves introducing from a single vector a dual CAR and target gene miR-shRNA expression system described herein that allows expression of the CAR and knockdown of endogenous target genes (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene) such that the CAR is detectable on the surface of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) by flow cytometry. In some embodiments, gRNA is used to knock in miR-compatible shRNAs that target RFX5 and CD58. In some embodiments, the miRNA comprises the sequence set forth in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.

[0195] In some embodiments, the method further includes knocking out one or more target genes in the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells, e.g., via shRNA. In some embodiments, the shRNA may be used to disrupt the CD58 gene. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66, or 67. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 63, or 64.

[0196] In some embodiments, the human cells are immunogenic human cells. In some embodiments, the human cells are induced pluripotent stem (iPS) human cells reprogrammed from immunogenic human cells.

[0197] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are T cells. In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are T effector cells. In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are not regulatory T cells. In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are C45RA + CD27 - CD28 - CCR7 - CD62L - In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are not natural killer cells. In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells).

[0198] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells do not contain any of the following genes that have been genetically modified, e.g., disrupted or knocked out: a) the CISH (cytokine-inducible SH2-containing protein) gene, b) the adenosine A2A (ADORA2A) gene, c) the TGF beta receptor gene, d) an HLA class I gene, e.g., an HLA A, B, C, E, F, G, e) HLA class II gene, f) NLRC5 (NOD-like receptor family card domain containing 5) gene, g) CD38 gene, h) thioredoxin interacting protein (TXNIP) gene, i) ITGB3 (integrin subunit beta 3) gene, j) IL17A gene, k) DGKA (diacylglycerol kinase alpha) gene, l) DGKZ (diacylglycerol kinase zeta) gene, m) PD1 gene, n) TRGC1 (T cell receptor gamma constant 1) gene, o) TRGC1 (T cell receptor gamma constant 2) gene, and / or p) TRDC (T cell receptor delta constant) gene.

[0199] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells are not TCR null, e.g., not TCR alpha, beta, gamma, and / or delta null. For example, in certain embodiments, the TCR locus, e.g., the TCR alpha, beta, gamma, or delta locus, is not disrupted or knocked out, e.g., does not comprise an insertion, e.g., a CAR insertion.

[0200] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells do not comprise: a) an exogenous NICD (Notch intracellular domain) coding sequence, e.g., a NICD1 coding sequence; c) an exogenous CD47 coding sequence, or increased CD47 expression relative to wild-type (non-engineered) iPS human cells; d) an exogenous sequence encoding a cell surface protein that binds to the surface of phagocytic or cytolytic immune cells, such that the binding results in activation of the hypoimmunogenic cells (such as engineered hypoimmunogenic cells), e.g., T cells. exogenous sequence, e) exogenous CR1 coding sequence, f) exogenous CD24 coding sequence, g) exogenous DUX4 (double homeobox 4) coding sequence, h) exogenous nucleotide sequence operably linked to a promoter derived from the human FOXP3 gene, i) exogenous CD3 complex cell surface coding sequence, or increased expression of CD3 complex cell surface genes relative to wild-type (unmanipulated) iPS human cells, j) exogenous NKG2C (natural killer receptor group 2, member C) coding sequence, or increased expression of CD3 complex cell surface genes relative to wild-type (unmanipulated) iPS human cells. k) increased expression of NKG2C relative to exogenous NKG2D (natural killer receptor group 2, member D) coding sequence or wild-type (unmanipulated) iPS human cells; l) increased expression of PD-L1 relative to exogenous PD-L1 coding sequence or wild-type (unmanipulated) iPS human cells; m) increased expression of CTLA-4 relative to exogenous CTLA-4 coding sequence or wild-type (unmanipulated) iPS human cells; n) increased expression of CD16 relative to exogenous CD16 coding sequence or wild-type (unmanipulated) iPS human cells. S increased expression of CD16 on human cells, o) exogenous HLA-A coding sequence, p) exogenous HLA-B coding sequence, q) exogenous HLA-C coding sequence, r) exogenous HLA-D coding sequence, s) exogenous HLA-E coding sequence, t) exogenous HLA-F coding sequence, u) exogenous HLA-G coding sequence, v) exogenous C1 inhibitor coding sequence, x) exogenous IL35 coding sequence, and / or y) an IL15 / IL15 receptor alpha (IL15Rα) fusion protein, e.g., an IL15 / IL15Rα fusion protein, wherein the IL15Rα portion lacks the intracellular domain.

[0201] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells comprise a CAR knock-in into one or more of the endogenous target genes, e.g., the RFX gene, the CD58 gene, the CIITA gene, and / or the B2M gene. In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells comprise a transgene containing a promoter and a CAR knocked into one or more of the RFX gene, the CD58 gene, the CIITA gene, and / or the B2M gene, resulting in CAR expression on the cell surface such that the CAR can be detected by flow cytometry. In some embodiments, the transgene can be knocked in by using a gRNA described herein.

[0202] In some embodiments, hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells comprise a knockout of an endogenous target gene, i.e., a knockout of one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene, and a knockin of a CAR. In some embodiments, the CAR knockin and target gene knockout are achieved by introduction of a dual CAR and target gene miR-shRNA expression system described herein, which allows expression of the CAR from a single vector and knockdown of endogenous target genes (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene). In some embodiments, a gRNA is used to target RFX5 and knock in a miR-compatible shRNA that targets CD58. In some embodiments, the miRNA comprises the sequence set forth in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.

[0203] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells comprise a knockout of one or more target genes in the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells, for example, via shRNA. In some embodiments, shRNA may be used to disrupt the CD58 gene. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66, or 67. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 63, or 64.

[0204] 7.4.1 Target Gene In some embodiments, the target gene is the regulatory factor X (RFX) gene. In some embodiments, the RFX gene is genetically modified to eliminate or reduce RFX protein expression.

[0205] Regulatory factor X (also known as RFX) refers to a member of the regulatory factor X (RFX) family of transcription factors. Human RFX proteins are encoded by the RFX gene. Members of the RFX gene family include, but are not limited to, RFX5, RFXANK, and RFXAP. Human regulatory factor X5 or RFX5 is encoded by the RFX5 gene (e.g., NCBI Entrez Gene:5993). Human regulatory factor X-related ankyrin-containing protein or RFXANK is encoded by the RFXANK gene (e.g., NCBI Entrez Gene:8625). Human regulatory factor X-related protein or RFXAP is encoded by the RFXAP gene (e.g., NCBI Entrez Gene:5994). In some embodiments, the methods disclosed herein comprise genetically modifying an RFX gene selected from the group consisting of RFX5, RFXANK, and RFXAP.

[0206] In some embodiments, the present disclosure provides methods comprising genetically modifying a regulatory factor X (RFX) gene in at least one human cell or at least one cell. In some embodiments, genetically modifying the RFX gene reduces expression of the RFX protein in the human cell or cells. In some embodiments, genetically modifying the RFX gene results in a cell with reduced immunogenicity. In some embodiments, the method further comprises subjecting the genetically modified human cell or genetically modified cell to the immune system and determining the immunogenicity of the genetically modified human cell or genetically modified cell, wherein the immunogenicity is altered compared to a human cell or cells that has not been genetically modified in at least one gene. In some embodiments, the only difference between the genetically modified human cell or genetically modified cell and a human cell or cells that has not been genetically modified in at least one gene is that the unmodified human cell or unmodified cell has not been genetically modified in one or more of the RFX gene, B2M gene, CD58 gene, and / or CIITA gene.

[0207] In some embodiments, the method further includes forming at least one embryoid body or multicellular body from the genetically modified human cell or genetically modified cells to produce at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell), subjecting the hypoimmunogenic cell (e.g., the engineered hypoimmunogenic cell) to the immune system, and determining the immunogenicity of the hypoimmunogenic cell (e.g., the engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to a human cell or cells that have not been genetically modified in the RFX gene. In some embodiments, the only difference between the hypoimmunogenic cell (e.g., the engineered hypoimmunogenic cell) and a human cell or cells that have not been genetically modified in at least one gene is that the unmodified human cell or unmodified cell has not been genetically modified in one or more of the RFX gene, B2M gene, CD58 gene, and / or CIITA gene.

[0208] In some embodiments, the method further comprises genetically modifying at least one of the B2M gene, the CD58 gene, or the CIITA gene (e.g., genetically modifying the RFX gene and the B2M gene, genetically modifying the RFX gene and the CD58 gene, or genetically modifying the RFX gene and the CIITA gene). In some embodiments, the method further comprises genetically modifying at least one of the TNFRSF14 (also known as HVEM) gene, the TNFRSF1A (also known as TNFR1) gene, the TNFRSF1B (also known as TNFR2) gene, and the ICAM1 gene.

[0209] In some embodiments, the target gene is the B2M gene. In some embodiments, the B2M gene is genetically modified to eliminate or reduce B2M protein expression.

[0210] The terms "beta-2 microglobulin," "B2M," or "β2m" refer to the beta chain component of an MHC class I molecule. Human beta-2 microglobulin is encoded by the B2M gene (e.g., NCBI Gene ID 567). Expression of beta-2 microglobulin is required for the assembly and function of MHC class I molecules on the cell surface.

[0211] In some embodiments, the present disclosure provides methods comprising genetically modifying a B2M gene in at least one human cell or at least one cell. In some embodiments, genetically modifying the B2M gene reduces expression of the B2M protein in the human cell or cells. In some embodiments, genetically modifying the B2M gene results in cells with reduced immunogenicity. In some embodiments, the method further comprises subjecting the genetically modified human cell or genetically modified cells to the immune system and determining the immunogenicity of the genetically modified human cell or genetically modified cells, wherein the immunogenicity is altered compared to a human cell or cells that has not been genetically modified in at least one gene. In some embodiments, the only difference between the genetically modified human cell or genetically modified cells and a human cell or cells that has not been genetically modified in at least one gene is that the unmodified human cell or unmodified cell has not been genetically modified in one or more of the RFX gene, the B2M gene, the CD58 gene, and / or the CIITA gene.

[0212] In some embodiments, the method further includes forming at least one embryoid body or multicellular body from the genetically modified human cell or genetically modified cells to produce at least one hypoimmunogenic cell (such as an engineered hypoimmunogenic cell), subjecting the hypoimmunogenic cell (such as the engineered hypoimmunogenic cell) to the immune system, and determining the immunogenicity of the hypoimmunogenic cell, wherein the immunogenicity is altered compared to a human cell or cells that have not been genetically modified in the B2M gene. In some embodiments, the only difference between the hypoimmunogenic cell (such as the engineered hypoimmunogenic cell) and a human cell or cells that have not been genetically modified in at least one gene is that the unmodified human cell or unmodified cell has not been genetically modified in one or more of the RFX gene, B2M gene, CD58 gene, and / or CIITA gene.

[0213] In some embodiments, the method further comprises genetically modifying at least one of the RFX gene, the CD58 gene, and the CIITA gene (e.g., genetically modifying the RFX gene and the B2M gene, genetically modifying the B2M gene and the CD58 gene, genetically modifying the B2M gene and the CIITA gene). In some embodiments, the method further comprises genetically modifying at least one of the TNFRSF14 (also known as HVEM) gene, the TNFRSF1A (also known as TNFR1) gene, the TNFRSF1B (also known as TNFR2) gene, and the ICAM1 gene.

[0214] In some embodiments, the target gene is the CD58 gene. In some embodiments, the CD58 gene is genetically modified to eliminate or reduce CD58 protein expression.

[0215] As used herein, the term "CD58" or "LFA-3" refers to a ligand for the T lymphocyte CD2 protein, which functions in T lymphocyte adhesion and activation. Human CD58 is encoded by the CD58 gene (e.g., NCBI Entrez Gene:965). Cd2 (the CD58 receptor) is known to be important for monocyte and dendritic cell function (see, e.g., Crawford et al., J Immunol, 1999 Dec 1;163(11):5920-8. and Crawford et al., Blood. 2003 Sep 1;102(5):1745-52.).

[0216] In some embodiments, the present disclosure provides methods comprising genetically modifying the CD58 gene of at least one human cell or at least one cell. In some embodiments, genetically modifying the CD58 gene reduces expression of CD58 protein in the human cell or cells. In some embodiments, genetically modifying the CD58 gene results in cells with reduced immunogenicity. In some embodiments, the method further comprises subjecting the genetically modified human cell or genetically modified cells to the immune system and determining the immunogenicity of the genetically modified human cell or cells, wherein the immunogenicity is altered compared to a human cell or cells that has not been genetically modified in at least one gene. In some embodiments, the only difference between the genetically modified human cell or genetically modified cells and a human cell or cells that has not been genetically modified in at least one gene is that the unmodified human cell or unmodified cell has not been genetically modified in one or more of the RFX gene, B2M gene, CD58 gene, and / or CIITA gene.

[0217] In some embodiments, the method further includes forming at least one embryoid body or multicellular body from the genetically modified human cell or genetically modified cells to produce at least one hypoimmunogenic cell (e.g., an engineered hypoimmunogenic cell), subjecting the hypoimmunogenic cell (e.g., the engineered hypoimmunogenic cell) to the immune system, and determining the immunogenicity of the hypoimmunogenic cell (e.g., the engineered hypoimmunogenic cell), wherein the immunogenicity is altered compared to a human cell that has not been genetically modified in the CD58 gene. In some embodiments, the only difference between the hypoimmunogenic cell (e.g., the engineered hypoimmunogenic cell) and a human cell or cells that have not been genetically modified in at least one gene is that the unmodified human cell or unmodified cell has not been genetically modified in one or more of the RFX gene, B2M gene, CD58 gene, and / or CIITA gene.

[0218] In some embodiments, the method further comprises genetically modifying at least one of the RFX gene, the B2M gene, and the CIITA gene (e.g., genetically modifying the CD58 gene and the B2M gene, genetically modifying the CD58 gene and the RFX gene, genetically modifying the CD58 gene and the CIITA gene). In some embodiments, the method further comprises genetically modifying at least one of the TNFRSF14 (also known as HVEM) gene, the TNFRSF1A (also known as TNFR1) gene, the TNFRSF1B (also known as TNFR2) gene, and the ICAM1 gene.

[0219] In some embodiments, the methods disclosed herein further comprise genetically modifying the CIITA gene in addition to at least one of the target genes (e.g., the RFX gene, the B2M gene, and / or the CD58 gene). In some embodiments, genetically modifying the CIITA gene eliminates or reduces CIITA protein expression. In some embodiments, the methods further comprise genetically modifying at least one of the TNFRSF14 (also known as HVEM) gene, the TNFRSF1A (also known as TNFR1) gene, the TNFRSF1B (also known as TNFR2) gene, and the ICAM1 gene.

[0220] As used herein, the term "class II major histocompatibility complex transactivator" or "CIITA" refers to the CIITA protein, which is essential for the transcriptional activity of the HLA class II promoter. Human CIITA is encoded by the CIITA gene (e.g., NCBI Entrez Gene:4261). Mutations in the CIITA gene are associated with bare lymphocyte syndrome type II (also known as hereditary MHC class II deficiency or HLA class II deficiency combined immunodeficiency).

[0221] 7.4.2 Immunogenic cells and immunogenic human cells In some embodiments, the immunogenic cells are rodent, porcine, primate, monkey, ape, or human immunogenic cells, hi some embodiments, the immunogenic cells are immunogenic human cells.

[0222] In some embodiments, the immunogenic cells are allogeneic or non-MHC-matched to the cells, receptors, or polypeptides of the immune system to which the engineered hypoimmunogenic cells are administered or subjected.

[0223] In some embodiments, the immunogenic human cells are allogeneic or non-HLA-matched to the cells, receptors, or polypeptides of the immune system to which the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are administered or subjected.

[0224] In some embodiments, the immunogenic cells induce and / or provide an immune response. In one aspect, the immunogenic cells provide an innate immune response, a specific or adaptive immune response, or a combination thereof. In another aspect of the invention, the immunogenic cells are allogeneic or non-HLA-matched to the cells, receptors, or polypeptides of the immune system that they induce or provide. In some embodiments, the immune system is an in vitro immune system. In some embodiments, the immune system is an in vivo immune system. In some embodiments, the immune system is the in vivo immune system of a human subject.

[0225] In some embodiments, the immunogenic cells or immunogenic human cells are non-immune effector cells. In some embodiments, the immunogenic cells or immunogenic human cells are immune effector cells.

[0226] An "immune effector cell" is an immune cell capable of performing an immune effector function. In some embodiments, the immune effector cell expresses at least FcγRIII and performs ADCC effector function. Examples of immune effector cells that mediate ADCC include peripheral blood mononuclear cells (PBMCs), natural killer (NK) cells, monocytes, cytotoxic T cells, neutrophils, and eosinophils.

[0227] In some embodiments, the immune effector cells are T cells. In some embodiments, the T cells are CD4 + / CD8 - , CD4 - / CD8 + , CD4 + / CD8 + , CD4 - / CD8 - In some embodiments, the T cells produce IL-2, TFN, and / or TNF upon binding to the target cells. In some embodiments, the CD8 + Upon binding to a target cell, T cells lyse the antigen-specific target cell.

[0228] In some embodiments, the immune effector cells are NK cells. In other embodiments, the immune effector cells can be an established cell line, e.g., NK-92 cells.

[0229] In some embodiments, the immune effector cells are differentiated from stem cells, such as hematopoietic stem cells, pluripotent stem cells, iPS cells, or embryonic stem cells.

[0230] 7.4.3 iPS cells and iPS human cells In some embodiments, the cells are induced pluripotent stem (iPS) cells. In some embodiments, the iPS cells are reprogrammed from immunogenic cells (e.g., immunogenic cells disclosed herein).

[0231] In some embodiments, the human cells are induced pluripotent stem (iPS) human cells. In some embodiments, the iPS human cells are reprogrammed from immunogenic human cells (e.g., immunogenic human cells disclosed herein).

[0232] Any suitable method known in the art can be used to reprogram immunogenic cells into iPS cells or immunogenic human cells into iPS human cells. In some embodiments, iPS cells or iPS human cells are produced by the methods disclosed in International Publication No. WO 2021 / 257679 (International Application No. PCT / US2021 / 037594) or U.S. Patent Application Publication No. 2021 / 0395697, each of which is incorporated herein by reference in its entirety.

[0233] In some embodiments, the iPS cells or iPS human cells are reprogrammed from immunogenic human cells comprising a heterodimeric T cell receptor comprising a gamma chain and a delta chain. In some embodiments, the iPS cells or iPS human cells are reprogrammed from a gamma delta T cell. In some embodiments, the iPS cells or iPS human cells have rearranged genes at the TRG and TRD loci. In some embodiments, the iPS cells or iPS human cells do not produce PCR products from the TCRG and TCRD loci.

[0234] In some embodiments, the iPS cells or iPS human cells are not derived from αβ T cells. In some embodiments, the iPS cells or iPS human cells do not have rearranged genes at the TRA and TRB loci. In some embodiments, the iPS cells or iPS human cells do not produce PCR products from the TCRA and TCRB loci.

[0235] In some embodiments, the iPS cells or iPS human cells are negative for Sendai virus (SeV) vectors.

[0236] In some embodiments, the iPS cells or iPS human cells are genomically stable without chromosomal loss. In some embodiments, the genomic stability of the iPS cells or iPS human cells is determined by karyotyping.

[0237] In some embodiments, iPS cells or iPS human cells can be grown and maintained in feeder-free medium after conditioning.

[0238] In some embodiments, the iPS cells or iPS human cells express one or more reprogramming factors and comprise nucleotide sequences encoding rearrangements of the TRG and TRD genes. In some embodiments, the reprogramming factors are selected from the group consisting of Oct3 / 4, Sox2, Klf4, c-Myc, and Lin28. In some embodiments, the reprogramming factors comprise Oct3 / 4, Sox2, Klf4, and c-Myc. In some embodiments, the reprogramming factors are Oct3 / 4, Sox2, Klf4, c-Myc, and Lin28. In some embodiments, the reprogramming factors are Oct3 / 4, Sox2, Klf4, c-Myc, and Lin28.

[0239] In some embodiments, the iPS cells or iPS human cells are pluripotent cells that express one or more reprogramming factors, wherein (i) the pluripotent cells comprise a nucleotide sequence encoding a rearrangement of the TRG and TRD genes or have rearranged genes at the TRG and TRD loci, (ii) the reprogramming factors are selected from the group consisting of Oct3 / 4, Sox2, Klf4, c-Myc, and Lin28, and (iii) the iPS cells or iPS human cells are induced in response to a Sendai virus (SeV) vector. (iv) the iPS cells or iPS human cells are reprogrammed from γδ T cells but not from αβ T cells; (v) the iPS cells or iPS human cells do not produce PCR products from the TCRA and TCRB loci; (vi) the iPS cells or iPS human cells are genomically stable with no chromosomal loss as determined, for example, by karyotype analysis; and / or (vii) the iPS cells or iPS human cells can be grown and maintained in feeder-free medium after acclimation.

[0240] Methods for identifying reprogrammed mammalian somatic cells having a less differentiated or pluripotent state are known in the art. For example, in some embodiments, reprogrammed somatic cells are identified by selecting cells that express an appropriate selectable marker. In some embodiments, the reprogrammed somatic cells are further evaluated for pluripotent characteristics. The presence of pluripotent characteristics indicates that the somatic cells have been reprogrammed to a pluripotent state.

[0241] The differentiation state of a cell is a continuous spectrum, with a terminally differentiated state at one end and a dedifferentiated state (pluripotent state) at the other end. Reprogramming, as used herein, refers to the process of changing or reversing the differentiation state of a somatic cell, which may be partially or terminally differentiated. Reprogramming includes complete as well as partial reversal of the differentiation state of a somatic cell. In other words, the term "reprogramming," as used herein, encompasses any transition to a less differentiated state along the spectrum of a cell's differentiation state. For example, reprogramming includes reverting a multipotent cell to a pluripotent cell, or reverting a terminally differentiated cell to either a multipotent or pluripotent cell. In some embodiments, somatic cell reprogramming completely reverts the somatic cell to a pluripotent state. In some embodiments, somatic cell reprogramming reverts the somatic cell to a pluripotent state. Thus, as used herein, the term "less differentiated state" is a relative term and includes a completely dedifferentiated state and a partially differentiated state.

[0242] The term "pluripotent properties" refers to many of the properties associated with pluripotency, including, for example, the ability to differentiate into all cell types, and expression patterns characteristic of pluripotent cells, including expression of pluripotency genes, expression of other ES cell markers, and, at a global level, a characteristic expression profile known as a "stem cell molecular signature" or "stemness."

[0243] Therefore, to evaluate the pluripotency characteristics of reprogrammed somatic cells, such cells may be analyzed for various growth characteristics and ES cell-like morphology. In some embodiments, cells may be subcutaneously injected into immunocompromised SCID mice to induce teratomas (a standard assay for ES cells). ES-like cells can differentiate into embryoid bodies (another ES-specific characteristic). Furthermore, ES-like cells can be differentiated in vitro by adding certain growth factors known to drive differentiation into specific cell types. Self-renewal capacity, marked by the induction of telomerase activity, is another pluripotency characteristic that can be monitored.

[0244] In some embodiments, functional assays of reprogrammed somatic cells may be performed by introducing the reprogrammed somatic cells into blastocysts to determine whether the cells can give rise to all cell types. If reprogrammed cells can form some cell types of the body, they are multipotent; if reprogrammed cells can form all cell types of the body, including germ cells, they are pluripotent.

[0245] In other embodiments, the expression of individual pluripotency genes in reprogrammed somatic cells may be examined to assess their pluripotency properties.

[0246] Additionally, the expression of other ES cell markers may be assessed. Stage-specific embryonic 1 5 antigens-1, -3, and -4 (SSEA-1, SSEA-3, SSEA-4) are glycoproteins specifically expressed during early embryonic development and are markers of ES cells (Solter and Knowles, 1978, Proc. Natl. Acad. Sci. USA 75:5565-5569; Kannagi et al., 1983, EMBO J 2:2355-2361).

[0247] High expression of the enzyme alkaline phosphatase (AP) is another marker associated with undifferentiated embryonic stem cells (Wobus et al., 1984, Exp. Cell 152:212-219; Pease et al., 1990, Dev. Biol. 141:322-352). Other stem / progenitor cell markers include the intermediate neurofilament nestin (Lendahl et al., 1990, Cell 60:585-595; Dah-Istrand et al., 1992, J. Cell Sci. 103:589-597), the membrane glycoprotein prominin / AC133 (Weigmann et al., 1997, Proc. Natl. Acad. USA 94:12425-12430; Corbeil et al., 1998, Blood 91:2625-22626), the transcription factor Tcf-4 (Korinek et al., 1998, Nat. Genet. 19:379-383; Lee et al., 1999, J. Biol. Chem. 274:1566-1572), and the transcription factor Cdx1 (Duprey et al., 1999, J. Cell Sci. 274:1566-1572). al., 1988, Genes Dev. 2:1647-1654; Subramaniam et al., 1998, Differentiation 64:11-18).

[0248] In some embodiments, expression profiling of reprogrammed somatic cells may be used to assess their pluripotent properties. Pluripotent cells, such as embryonic stem cells, and multipotent cells, such as adult stem cells, are known to have characteristic patterns of global gene expression profiles. This characteristic pattern is referred to as a "stem cell molecular signature" or "stemness." See, e.g., Ramalho-Santos et al., Science 298:597-600 (2002); Ivanova et al., Science 298:601-604.

[0249] Somatic cells can be reprogrammed to acquire either the full set of pluripotent characteristics and are therefore pluripotent. Alternatively, somatic cells can be reprogrammed to acquire only a subset of pluripotent characteristics. In another alternative, somatic cells can be reprogrammed to be multipotent.

[0250] 7.4.4 Low immunogenicity In some embodiments, the immunogenicity of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) is determined by subjecting the cells to the immune system. In some embodiments, the immunogenicity is altered compared to human cells (e.g., immunogenic cells or iPS human cells) or cells in which at least one target gene has not been genetically modified. In some embodiments, the only difference between genetically modified human cells or cells and unmodified human cells or cells is that at least one target gene has not been genetically modified in the unmodified human cells or cells.

[0251] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are administered to an allogeneic or non-MHC-matched subject. In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are administered to an allogeneic or non-HLA-matched subject.

[0252] In some embodiments, altering immunogenicity includes balancing, reducing, or neutralizing the immunogenicity or immune response (such as reducing or neutralizing immunogenicity) compared to unmodified cells or a population of unmodified cells (e.g., compared to immunogenic human cells or iPS cells that have not been genetically modified for at least one target gene). In some embodiments, the only difference between the genetically modified cells or a genetically modified population of modified cells and the unmodified cells or a population of unmodified cells is that at least one target gene has not been genetically modified in the unmodified cells or population of unmodified cells (e.g., compared to immunogenic cells or iPS cells that have not been genetically modified for at least one target gene).

[0253] In some embodiments, the reduced immunogenicity of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) can be measured by: i) a reduced or eliminated myeloid cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; ii) a reduced or eliminated T cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; iii) a reduced or eliminated natural killer (NK) cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; iv) an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification. The genetic modification may be achieved by one or more of the following: a) reduced or eliminated neutralizing antibody response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject; b) reduced or eliminated MHC class II-mediated cellular response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification; c) reduced or eliminated neutralizing MHC class I-mediated cellular response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification; and d) reduced or eliminated allogeneic host-versus-graft rejection to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification.

[0254] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure has about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (lower) reduced immunogenicity or reduced immune response compared to a population of unmodified cells (e.g., compared to cells in which at least one target gene has not been genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells (e.g., compared to cells in which at least one target gene has not been genetically modified).

[0255] In some embodiments, altering immunogenicity comprises reducing or neutralizing myeloid cell responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells that have been genetically modified with at least one target gene). In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells that have been genetically modified with at least one target gene) of the present disclosure has a myeloid cell response that is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (less) compared to a population of unmodified cells (e.g., compared to cells that have not been genetically modified with at least one target gene). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified).

[0256] In some embodiments, altering immunogenicity comprises reducing or neutralizing T cell responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells that have been genetically modified with at least one target gene). In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells that have been genetically modified with at least one target gene) of the present disclosure has a T cell response that is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (less) compared to a population of unmodified cells (e.g., cells that have not been genetically modified with at least one target gene). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified).

[0257] In some embodiments, altering immunogenicity comprises reducing or neutralizing the natural killer cell response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells that have been genetically modified with at least one target gene). In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells that have been genetically modified with at least one target gene) of the present disclosure has a natural killer cell response that is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (less) compared to a population of unmodified cells (e.g., cells that have not been genetically modified with at least one target gene). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified).

[0258] In some embodiments, altering immunogenicity comprises reducing or neutralizing the antibody response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells that have been genetically modified with at least one target gene). In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells that have been genetically modified with at least one target gene) of the present disclosure has an antibody response that is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (less) compared to a population of unmodified cells (e.g., cells that have not been genetically modified with at least one target gene). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified).

[0259] In some embodiments, altering immunogenicity comprises reducing or neutralizing allogeneic host-versus-graft rejection. In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells that have been genetically modified with at least one target gene) has about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or greater than 100% (less) reduced allogeneic host-versus-graft rejection compared to a population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified).

[0260] In some embodiments, the method comprises genetically modifying the RFX gene. In some embodiments, altering immunogenicity comprises reducing or eliminating an MHC class II-mediated response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells with a genetically modified RFX gene). In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells with a genetically modified RFX gene) of the disclosure has an MHC class II-mediated response that is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% (less) compared to a population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified), the RFX gene has not been genetically modified.

[0261] In some embodiments, altering immunogenicity comprises reducing or neutralizing MHC class I-mediated responses to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells with a genetically modified RFX gene). In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure has an MHC class I-mediated response that is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% (less) compared to a population of unmodified cells (e.g., cells that have not been genetically modified in at least one target gene). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified), the RFX gene has not been genetically modified.

[0262] In some embodiments, expression of HLA class II molecules (e.g., HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR) is reduced (e.g., partially or completely) or abolished in hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells with a genetically modified RFX gene). In some embodiments, expression of HLA class II molecules is undetectable (e.g., undetectable by conventional methods (e.g., FACS)) in a population of genetically modified cells of the present disclosure. In some embodiments, expression of HLA class II molecules in a population of genetically modified cells (e.g., cells with a genetically modified RFX gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to expression of HLA class II molecules in a population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified), the RFX gene has not been genetically modified.

[0263] In some embodiments, expression of HLA-A, HLA-B, and / or HLA-C is reduced (e.g., partially) in hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells with a genetically modified RFX gene). In some embodiments, HLA-A expression in a population of genetically modified cells (e.g., cells with a genetically modified RFX gene) is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% (lower) compared to HLA-A expression in a population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (e.g., engineered hypoimmunogenic cells) and a population of unmodified cells is that the RFX gene is not genetically modified in the population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene). In some embodiments, the expression of HLA-B in the population of genetically modified cells (e.g., cells having a genetically modified RFX gene) is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% (lower) compared to the expression of HLA-B in a population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified), the RFX gene has not been genetically modified.In some embodiments, expression of HLA-C in a population of genetically modified cells (e.g., cells having a genetically modified RFX gene) is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% (lower) compared to expression of HLA-C in a population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that the RFX gene has not been genetically modified in the population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene).

[0264] In some embodiments, HLA-E expression is reduced (e.g., partially) in hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells with a genetically modified RFX gene). In some embodiments, HLA-E expression remains detectable (e.g., by FACS). In some embodiments, HLA-E expression in a population of genetically modified cells (e.g., cells with a genetically modified RFX gene) is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% (lower) compared to HLA-E expression in a population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified), the RFX gene has not been genetically modified.

[0265] In some embodiments, the method comprises genetically modifying the B2M gene. In some embodiments, altering immunogenicity comprises reducing or eliminating an MHC class I-mediated response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells with a genetically modified B2M gene). In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells with a genetically modified B2M gene) of the present disclosure has an MHC class I-mediated response that is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% (less) compared to a population of unmodified cells (e.g., cells that have not been genetically modified in at least one target gene). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that in the population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene), at least the B2M gene has not been genetically modified.

[0266] In some embodiments, expression of HLA class I molecules (e.g., HLA-A, HLA-B, HLA-C, or HLA-E) is reduced (e.g., partially or completely), abolished, or undetectable (e.g., by FACS) in genetically modified hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells with a genetically modified B2M gene). In some embodiments, expression of HLA-A in a population of genetically modified cells (e.g., cells with a genetically modified B2M gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to expression of HLA-A in a population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least the B2M gene has not been genetically modified in the population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene). In some embodiments, the expression of HLA-B in the population of genetically modified cells (e.g., cells with a genetically modified B2M gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to the expression of HLA-B in a population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least the B2M gene has not been genetically modified in the population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene).In some embodiments, expression of HLA-C in a population of genetically modified cells (e.g., cells having a genetically modified B2M gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (down) compared to expression of HLA-C in a population of unmodified cells. In some embodiments, expression of HLA-E in a population of genetically modified cells (e.g., cells having a genetically modified B2M gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (down) compared to expression of HLA-E in a population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that in the population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene), at least the B2M gene has not been genetically modified.

[0267] In some embodiments, the method comprises genetically modifying the CD58 gene. In some embodiments, genetically modifying the CD58 gene alters immunogenicity in the cell. In some embodiments, genetically modifying the CD58 gene reduces or eliminates costimulatory immune cell responses. In some embodiments, genetically modifying the CD58 gene impairs immune synapse formation. In some embodiments, genetically modifying the CD58 gene results in impaired recognition by patient (host) T cells, NK cells, and myeloid cells. In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having a genetically modified CD58 gene) has a costimulatory immune cell response that is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (less) compared to a population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least the CD58 gene has not been genetically modified in the population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene). In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having a genetically modified CD58 gene) has about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (less) reduced immune synapse formation compared to a population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene).In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that in the population of unmodified cells (e.g., cells that have not been genetically modified for at least one target gene), at least the CD58 gene has not been genetically modified.

[0268] In some embodiments, the method further comprises genetically modifying the CIITA gene in combination with genetically modifying at least one of the RFX gene, the B2M gene, and the CD58 gene. In some embodiments, genetically modifying the CIITA gene further alters immunogenicity in the cells. In some embodiments, altering immunogenicity comprises reducing or eliminating an MHC class II-mediated response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells having a genetically modified CIITA gene). In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure has an MHC class II-mediated response that is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% (lower) compared to a population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified). In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified), the CIITA gene has not been genetically modified.

[0269] In some embodiments, expression of HLA class II molecules (e.g., HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR) is further reduced (e.g., partially or completely) or eliminated in hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having a genetically modified CIITA gene). In some embodiments, expression of HLA class II molecules is undetectable (e.g., undetectable by conventional methods (e.g., FACS)) in a population of genetically modified cells of the present disclosure. In some embodiments, expression of HLA class II molecules in a population of genetically modified cells (e.g., cells having a genetically modified CIITA gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to expression of HLA class II molecules in a population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified). In some embodiments, the only difference between the genetically modified cells and a population of unmodified cells is that in the population of unmodified cells (e.g., cells in which at least one target gene has not been genetically modified), the CIITA gene has not been genetically modified.

[0270] In some embodiments, the reduced immunogenicity of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) can be measured by: i) a reduced or eliminated myeloid cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; ii) a reduced or eliminated T cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; iii) a reduced or eliminated natural killer (NK) cell response to the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when present in an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification; iv) an allogeneic or non-MHC-matched subject compared to cells corresponding to the modified cells but without the genetic modification. The genetic modification may be achieved by one or more of the following: a) reduced or eliminated neutralizing antibody response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject; b) reduced or eliminated MHC class II-mediated cellular response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification; c) reduced or eliminated neutralizing MHC class I-mediated cellular response to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification; and d) reduced or eliminated allogeneic host-versus-graft rejection to hypoimmunogenic cells (such as engineered hypoimmunogenic cells) when the cells are present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have the genetic modification.

[0271] In some embodiments, in hypoimmunogenic cells (such as engineered hypoimmunogenic cells), i) expression of HLA class II molecules is reduced or eliminated, ii) expression of HLA-A, HLA-B, and / or HLA-C is reduced, and iii) expression of HLA-E is reduced but remains detectable.

[0272] In some embodiments, expression of HLA class I and II molecules is detected by FACS.

[0273] In some embodiments, cells are assessed for immunogenicity using any suitable method known to one of skill in the art. In some embodiments, cells are analyzed for the presence of antibodies on the cell surface, for example, by staining with anti-IgM antibodies. In some embodiments, immunogenicity is assessed by a PBMC cytolytic assay. In some embodiments, a population of cells is incubated with peripheral blood mononuclear cells (PBMCs) and then assessed for lysis of the cells by PBMCs. In some embodiments, immunogenicity is assessed by a natural killer (NK) cytolytic assay. In some embodiments, a population of cells is incubated with NK cells and then assessed for lysis of the cells by NK cells. In some embodiments, immunogenicity is assessed by CD8 + In some embodiments, the population of cells is assessed by a CD8 T cell lytic assay. + T cells and then incubated with CD8 +Cell lysis by T cells is assessed. In some embodiments, the genetically modified cells or populations thereof of the present disclosure have increased viability or increased survival rate compared to unmodified cells or a population of unmodified cells (e.g., compared to immunogenic human cells or immunogenic cells or iPS human cells or iPS cells that have not been genetically modified with the RFX gene). In some embodiments, the only difference between the genetically modified cells and the unmodified cells or a population of unmodified cells is that the RFX gene (and optionally the B2M gene and / or the CIITA gene and / or the CD58 gene) has not been genetically modified in the unmodified cells or a population of unmodified cells. In some embodiments, a population of genetically modified cells of the present disclosure has an increased viability or survival rate of about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or greater than 100% (higher) compared to a population of unmodified cells (e.g., cells that have not been genetically modified in at least one target gene). In some embodiments, the only difference between the genetically modified cells and unmodified cells or a population of unmodified cells is that in the population of unmodified cells, one or more of the RFX gene, B2M gene, CIITA gene, and / or CD58 gene have not been genetically modified. In some embodiments, the cells are assessed for increased viability or survival rate using any suitable method known to one of skill in the art. In some embodiments, cell viability or survival is determined using flow cytometry, high-content imaging, tetrazolium reduction (MTT) assay, resazurin reduction assay, protease viability marker assay, and / or ATP detection assay.

[0274] 7.4.5 Chimeric Antigen Receptor (CAR) Knock-in Systems In some embodiments, chimeric antigen receptors (CARs) can be introduced into hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells, optionally into endogenous target genes such as RFX, CD58, CIITA, and / or B2M.

[0275] In some forms, the method further includes introducing a CAR into a hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) described herein, such that the CAR is expressed on the surface of the hypoimmunogenic cell (such as an engineered hypoimmunogenic cell) and is detectable by flow cytometry. In some embodiments, the method further includes using a gRNA to knock in a transgene containing a promoter, CAR, and / or miR-compatible shRNA into an endogenous target gene (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene), resulting in CAR expression on the surface of the hypoimmunogenic cell (such as the engineered hypoimmunogenic cell) that can be detected by flow cytometry.

[0276] In some embodiments, the method further comprises knocking out one or more target genes, e.g., via gRNA, miRNA, shRNA, miR-compatible shRNA, or other RNA interference (RNAi)-based methods, in combination with knocking in the CAR. In some embodiments, the knockout comprises indel formation, which results in non-functional expression of the gene.

[0277] In some embodiments, the method further comprises introducing from a single vector a dual CAR and target gene miR-shRNA expression system described herein that allows for expression of the CAR and knockdown of endogenous target genes (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene) such that the CAR is detectable on the surface of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS cells or iPS human cells by flow cytometry. In some embodiments, a gRNA can be used to knock in a miR-compatible shRNA that targets CD58. In some embodiments, the gRNA targets RFX5. In some embodiments, the miRNA comprises the sequence set forth in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.

[0278] In some embodiments, the method further includes knocking out one or more target genes in the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells, e.g., via shRNA. In some embodiments, the shRNA may be used to disrupt the CD58 gene. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66, or 67. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 63, or 64.

[0279] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells comprise a CAR knock-in into one or more of the endogenous target genes, e.g., the RFX gene, the CD58 gene, the CIITA gene, and / or the B2M gene. In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells comprise a transgene containing a promoter and a CAR knocked into one or more of the RFX gene, the CD58 gene, the CIITA gene, and / or the B2M gene, resulting in CAR expression on the cell surface such that the CAR can be detected by flow cytometry. In some embodiments, the transgene can be knocked in by using a gRNA described herein.

[0280] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells comprise a knockout of an endogenous target gene, i.e., a knockout of one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene, and a knockin of a CAR. In some embodiments, the CAR knockin and target gene knockout are achieved by introduction of a dual CAR and target gene miR-shRNA expression system described herein, which allows expression of the CAR from a single vector and knockdown of endogenous target genes (e.g., one or more of the RFX gene, CD58 gene, CIITA gene, and / or B2M gene). In some embodiments, a gRNA may be used to knock in a miRNA targeting CD58. In some embodiments, the miRNA comprises the sequence set forth in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.

[0281] In some embodiments, the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells comprise a knockout of one or more target genes in the hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells, for example, via shRNA. In some embodiments, shRNA may be used to disrupt the CD58 gene. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66, or 67. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 63, or 64.

[0282] Challenges in chimeric antigen receptor engineering and several potential options for addressing such challenges are known to those skilled in the art, and the present engineering approaches include advances in engineering, including chimeric antigen receptor cell approaches. See, for example, Sotilo E. et al. Cancer Discov. 2015 5(12):1282-1295, Gardner R. et al. Blood 2016 127(20):2406-2410, and Majzner RG et al. Cancer Discov. 2020 May 10(5):702-723.

[0283] 7.5 Genetic Modification In some embodiments, the target gene (e.g., the RFX gene, the B2M gene, the CIITA gene, the CD58 gene) is genetically modified to eliminate or reduce expression of the protein encoded by the gene.

[0284] In some embodiments, genetic modification of a target gene eliminates expression of the protein encoded by the gene. In some embodiments, genetic modification of a target gene reduces (e.g., partially or completely) expression of the protein encoded by the gene. In some embodiments, expression of the protein encoded by the gene is not detectable in a population of genetically modified cells of the present disclosure. In some embodiments, expression of the protein encoded by the gene in a population of genetically modified cells is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to expression of the protein encoded by the gene in a population of unmodified cells.

[0285] Any suitable method known in the art can be used to genetically modify genes in the cells disclosed herein (e.g., cells disclosed in Sections 7.3 or 7.4), human cells disclosed herein (e.g., immunogenic human cells, or iPS human cells disclosed in Section 7.4).

[0286] In some embodiments, genetically modifying a target gene comprises reducing or eliminating transcription of the gene through modifying the genomic DNA sequence of the gene, suppressing transcription or translation of the gene's mRNA via an RNA interference (RNAi) system, or recruiting or inducing a transcriptional repressor to the gene.

[0287] 7.5.1 Modifying genomic DNA sequences In some embodiments, genetically modifying a target gene involves modifying the genomic DNA sequence of the target gene. In some embodiments, modifying the genomic DNA sequence of a gene involves using site-specific nucleases to cleave deoxyribonucleic acid (DNA) at precise target locations in the genome, thereby forming single- or double-stranded DNA breaks at specific locations within the genome. Such breaks can be, and usually are, repaired by natural endogenous cellular processes such as homology-directed repair (HDR) and non-homologous end joining (NHEJ). NHEJ directly joins the DNA ends resulting from the double-stranded break, sometimes accompanied by the loss or addition of nucleotide sequences that can disrupt gene expression. HDR utilizes a homologous or donor sequence as a template for inserting a defined DNA sequence at the breakpoint. The homologous sequence may be in the endogenous genome, such as a sister chromatid. Alternatively, the donor sequence may be an exogenous polynucleotide such as a plasmid, single-stranded oligonucleotide, double-stranded oligonucleotide, or virus that has regions of high homology with the nuclease cleavage locus (e.g., left and right homology arms) but may also contain additional sequences or sequence changes, including deletions, that can be integrated into the cleaved target locus. A third repair mechanism may be microhomology-mediated end joining (MMEJ), also referred to as "alternative NHEJ," in which the genetic outcome is similar to NHEJ in that small deletions and insertions can occur at the cleavage site. MMEJ can utilize homologous sequences a few base pairs away from the DNA break site to drive more favorable DNA end-joining repair outcomes (Cho and Greenberg, Nature, 2015, 518, 174-76; Kent et al., Nature Structural and Molecular Biology, 2015, 22(3):230-7; Mateos-Gomez et al., Nature, 2015, 518, 254-57; Ceccaldi et al., Nature, 2015, 528, 258-62).

[0288] Each of these genome editing mechanisms can be used to create the desired genetic modification. A step in the genome editing process can be to create one or two DNA breaks, the latter as a double-strand break, or two single-strand breaks, at the target locus near the site of the intended mutation or change. This can be achieved through the use of endonucleases, as described herein.

[0289] In some embodiments, a target gene of the present disclosure (e.g., RFX gene, B2M gene, CIITA gene, CD58 gene) is disrupted or at least partially deleted via a CRISPR-Cas system. In some embodiments, the CRISPR / Cas system used to alter a target polynucleotide sequence in a cell comprises an RNA-binding protein, an endosonuclease and exonuclease, a helicase, and / or a polymerase. In some embodiments, the CRISPR-endonuclease system comprises an endonuclease and at least one guide nucleic acid that directs DNA cleavage of the endonuclease by hybridizing to a recognition site in genomic DNA (or a target motif in the target polynucleotide). In some embodiments, the CRISPR-endonuclease system comprises an endonuclease and at least one ribonucleic acid (e.g., guide RNA (gRNA)) that directs DNA cleavage of the endonuclease by hybridizing to a recognition site in genomic DNA (or a target motif in the target polynucleotide). In some embodiments, the CRISPR system is a Type I, Type II, Type III, Type IV, Type V, and / or Type VI system. In some embodiments, the CRISPR system is a Type II CRISPR / Cas9 system. In some embodiments, the CRISPR system is a Type V CRISPR / Cpf1 (or Cas12a) system. In some embodiments, the CRISPR system is a CRISPR-MAD7 system. In some embodiments, the CRISPR system comprises an endonuclease, such as Cas9, Cpf1, or MAD7, and one or two non-coding RNAs—crisprRNA (crRNA) and trans-activating RNA (tracrRNA)—for targeting DNA cleavage.

[0290] CRISPR systems containing various guide designs are known to those skilled in the art, such as those described in the following publications: WO 2017 / 106569; WO 2015 / 139139; Zetsche B et al. Cpf1 is a single RNA-guided endonuclease of a Class 2 CRISPR system. Cell. 2015 Oct 22; 163(3):759-71; Jedrzejczyk DJ et al. CRISPR-Cas12a nucleases function with structurally engineered crRNAs: SynThetic trAcrRNA. Sci Rep. 2022 Jul. 16;12(1):12193, European Patent No. 3642334(A1), U.S. Patent No. 9,790,490, U.S. Patent No. 11,180,751, U.S. Patent Application Publication No. 20210348156, European Patent No. 3502253, European Patent No. 3283625, U.S. Patent No. 10337028, International Publication No. 2019 / 046540, and International Publication No. 2017 / 127807.

[0291] In some embodiments, the genome editing methods of the present disclosure use at least one and / or any ribonucleic acid (e.g., guide RNA, gRNA) that can direct and hybridize an endonuclease (Cas protein) to a target motif in a target polynucleotide sequence. In some embodiments, at least one of the ribonucleic acids comprises a tracrRNA. In some embodiments, at least one of the ribonucleic acids comprises a CRISPR RNA (crRNA). In some embodiments, the CRISPR RNA (crRNA) is or comprises a sequence of about 17-20 nucleotides complementary to the target DNA (the target motif in the target polynucleotide). In some embodiments, the tracrRNA serves as a binding scaffold for the endonuclease (e.g., Cas9, Cpfl, MAD7, or any other endonuclease of the present disclosure). In some embodiments, a single ribonucleic acid comprises a guide RNA (gRNA) that guides and hybridizes an endonuclease or Cas protein to a target motif in a target polynucleotide sequence in a cell. In some embodiments, at least one of the ribonucleic acids comprises a guide RNA that guides an endonuclease or Cas protein to and hybridizes with a target motif in a target polynucleotide sequence in a cell. In some embodiments, both of the one or two ribonucleic acids comprise a guide RNA that guides an endonuclease or Cas protein to and hybridizes with a target motif in a target polynucleotide sequence in a cell. In some embodiments, the at least one ribonucleic acid of the present disclosure can be selected to hybridize with a variety of different target motifs, e.g., different target motifs within a target polynucleotide. In some embodiments, the at least one ribonucleic acid of the present disclosure can be selected to hybridize with a variety of different target motifs, depending on the particular CRISPR / Cas system used and the sequence of the target polynucleotide, as will be understood by those of skill in the art. In some embodiments, the at least one ribonucleic acid (e.g., one or two ribonucleic acids) can also be selected to minimize hybridization with nucleic acid sequences other than the target polynucleotide sequence.In some embodiments, at least one ribonucleic acid (e.g., one to two ribonucleic acids) hybridizes to a target motif that contains at least two mismatches when compared to all other genomic nucleotide sequences in the cell. In some embodiments, at least one ribonucleic acid (e.g., one to two ribonucleic acids) hybridizes to a target motif that contains at least one mismatch when compared to all other genomic nucleotide sequences in the cell. In some embodiments, at least one ribonucleic acid (e.g., one to two ribonucleic acids) is designed to hybridize to a target motif that is immediately adjacent to a deoxyribonucleic acid motif recognized by an endonuclease or Cas protein. In some embodiments, at least one ribonucleic acid (e.g., one to two ribonucleic acids) is designed to hybridize to a target motif that is immediately adjacent to a deoxyribonucleic acid motif recognized by an endonuclease or Cas protein adjacent to a mutant allele located between the target motifs.

[0292] In some embodiments, the genome editing methods of the present disclosure can be used with tracr RNA. In some embodiments, the genome editing methods of the present disclosure can be used without tracr RNA. In some embodiments, the genome editing methods of the present disclosure can be used with discontinuous or split RNA, such as, but not limited to, discontinuous or split gRNA.

[0293] In some embodiments, at least one ribonucleic acid (e.g., guide RNA) is complementary to and / or hybridizes with a sequence on the same strand of a target polynucleotide sequence (e.g., RFX gene, B2M gene, CIITA gene, CD58 gene). In some embodiments, at least one ribonucleic acid (e.g., guide RNA) is complementary to and / or hybridizes with a sequence on the opposite strand of a target polynucleotide sequence. In some embodiments, at least one ribonucleic acid (e.g., guide RNA) is not complementary to and / or does not hybridize with a sequence on the opposite strand of a target polynucleotide sequence. In some embodiments, at least one ribonucleic acid (e.g., guide RNA) is complementary to and / or hybridizes with an overlapping target motif of a target polynucleotide sequence. In some embodiments, at least one ribonucleic acid (e.g., guide RNA) is complementary to and / or hybridizes with an offset target motif of a target polynucleotide sequence.

[0294] In some embodiments, the at least one ribonucleic acid is complementary to and / or hybridizes to a sequence on the same strand of a target polynucleotide sequence, wherein the target polynucleotide sequence comprises a B2M gene. In some embodiments, the at least one ribonucleic acid is a gRNA. In some embodiments, the target polynucleotide sequence comprises the sequence set forth in SEQ ID NO: 253. In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 129 (UAAUUUCUACUCUUGUAGAU), optionally in combination with the spacer sequence set forth in SEQ ID NO: 251 (AGUGGGGGUGAAUUCAGUGUA). In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 252.

[0295] In some embodiments, the at least one ribonucleic acid is complementary to and / or hybridizes to a sequence on the same strand of a target polynucleotide sequence, wherein the target polynucleotide sequence comprises an RFX gene. In some embodiments, the at least one ribonucleic acid is a gRNA. In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 184 (RFX5_exon9_gRNA2, AGGAUCCGCUCUGCCCAGUCA), SEQ ID NO: 193 (RFX5_exon10_gRNA1, GAUGACCGUUCCCGAGGUGCA), SEQ ID NO: 202 (RFX5_exon10_gRNA4, GAGAACCCAGAGGGUGGAGCC), SEQ ID NO: 205 (RFX5_exon10_gRNA5, GUACCUCUGCAGAAGAGGACG), SEQ ID NO: 223 (RFX5_exon11_gRNA8, AGGGCACCUGAAGAAAGCCUG), SEQ ID NO: 239 (RFX5_exon9_gRNA2, AGGAUCCGCUCUGCCCAGUC), or SEQ ID NO: 246 (RFX5_exon10_gRNA1, GAUGACCGUUCCCGAGGUGC). In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 239 or 246. In some embodiments, the gRNA targets a genomic region comprising the sequence of SEQ ID NO: 132, 135, 138, 141, 144, 147, 150, 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, 225, 228, 231, 234, 241, 241, or 248. In some embodiments, the gRNA comprises a repeat sequence set forth in SEQ ID NO: 129, 235, or 237. In some embodiments, the gRNA further comprises a spacer sequence set forth in SEQ ID NO: 130, 133, 136, 139, 142, 145, 148, 151, 154, 157, 160, 163, 166, 169, 172, 175, 178, 181, 184, 187, 190, 193, 196, 199, 202, 205, 208, 211, 214, 217, 220, 223, 226, 229, 232, 239, or 246.In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 131, 134, 137, 140, 143, 146, 149, 152, 155, 158, 161, 164, 167, 170, 173, 176, 179, 182, 185, 188, 191, 194, 197, 200, 203, 206, 209, 212, 215, 218, 221, 224, 227, 230, 233, 236, 238, 240, 242, 243, 244, 245, 247, 249, or 250. In some embodiments, the target polynucleotide sequence comprises SEQ ID NO: 141, 186, 195, 204, 207, 225, 241, or 248. In some embodiments, the gRNA comprises a repeat sequence set forth in SEQ ID NO: 129, 235, or 237. In some embodiments, the gRNA further comprises a spacer sequence set forth in SEQ ID NO: 139, 184, 193, 202, 205, 223, 239, or 246. In some embodiments, the gRNA comprises a sequence set forth in SEQ ID NO: 140, 185, 194, 203, 206, 224, 236, 238, 240, 242, 243, 244, 245, 247, 249, or 250.

[0296] In some embodiments, the gRNA targeting RFX5 is a discontinuous or "split" RNA. In some embodiments, the discontinuous or "split" gRNA comprises the sequence set forth in SEQ ID NO: 377, 378, 379, 380, 381, 382, ​​383, 384, or 385.

[0297] In some embodiments, at least one ribonucleic acid is complementary to and / or hybridizes to a sequence on the same strand of a target polynucleotide sequence, wherein the target polynucleotide sequence comprises a CD58 gene. In some embodiments, at least one ribonucleic acid is a gRNA. In some embodiments, the target polynucleotide sequence comprises SEQ ID NO: 256, 259, 262, 265, 268, 271, 274, 277, 280, 283, 286, 289, 292, 295, 298, 301, 304, 307, 310, 313, 316, 319, 322, 325, 328, 331, 334, 337, 340, 343, 346, 349, 352, 355, 358, 361, 364, 367, 370, 373, or 376. In some embodiments, the gRNA comprises the sequence set forth in SEQ ID NO: 129. In some embodiments, the gRNA further comprises a spacer sequence comprising the sequence of SEQ ID NO: 254, 257, 260, 263, 266, 269, 272, 275, 278, 281, 284, 287, 290, 293, 296, 299, 302, 305, 308, 311, 314, 317, 320, 323, 326, 329, 332, 335, 338, 341, 344, 347, 350, 353, 356, 359, 362, 365, 368, 371, or 374. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 255, 258, 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, 303, 306, 309, 312, 315, 318, 321, 324, 327, 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, 363, 366, 369, 372, or 375. In some embodiments, the target polynucleotide sequence comprises SEQ ID NO: 256, 271, 274, 280, 304, or 328. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 129. In some embodiments, the gRNA further comprises a spacer sequence comprising the sequence of SEQ ID NO: 254, 269, 272, 278, 302, or 326. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 255, 270, 273, 279, or 327.

[0298] In some embodiments, the gRNA targeting CD58 is a discontinuous or "split" RNA. In some embodiments, the discontinuous or "split" gRNA comprises the sequence set forth in SEQ ID NO: 377, 378, 379, 386, 387, or 388.

[0299] In some embodiments, the CRISPR endonuclease is Cas9 and / or Cpf1, e.g., Lachnospiraceae bacteria ND2006 Cpf1, and / or Acidaminococcus sp. BV3L6 Cpf1, and / or MAD7; in various embodiments, CRISPR / MAD7 is used. In some embodiments, MAD7 is a Cas12a-like endonuclease, and therefore the target motif and / or guide nucleic acid (e.g., gRNA) used or specified for Cpf1 or Cas-12a are the same as the target motif and / or guide nucleic acid (e.g., gRNA) used for MAD7. In some embodiments, the target motif used or specified for the CRISPR-Cpf1 system is the same target motif used for the CRISPR-MAD7 system. In some embodiments, the guide nucleic acid (e.g., gRNA) used or specified for the CRISPR-Cpf1 system is the same guide nucleic acid (e.g., gRNA) used for the CRISPR-MAD7 system. In some embodiments, the target motif and guide nucleic acid (e.g., gRNA) specified for or used in the CRISPR-Cpf1 system are the same target motif and guide nucleic acid (e.g., gRNA) used in the CRISPR-MAD7 system. In some embodiments, the CRISPR endonuclease is MAD7. In some embodiments, the nuclease used in the methods of the disclosure is Inscripta's MAD7™ nuclease. In some embodiments, the nuclease used in the methods of the disclosure is Inscripta's nuclease. In some embodiments, the method incorporating Inscripta MAD7™ nuclease is the method using MAD7™ disclosed in WO 2021 / 1186269, WO 2021 / 119563, WO 2022 / 146497, and WO 2022 / 150269, which are incorporated by reference in their entireties. In some embodiments, the CRISPR endonuclease is Cas9 (CRISPR-associated protein 9). In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes.In some embodiments, other Cas9 homologs are used, such as S. aureus Cas9, N. meningitis Cas9, S. thermophilus CRISPR 1 Cas9, S. thermophilus CRISPR 3 Cas9, or T. denticola Cas9. In some embodiments, the endonuclease is selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Cs m2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and / or Cpf1 endonuclease. In some embodiments, wild-type variants may be used. In some embodiments, modified versions of the endonuclease (e.g., homologs thereof, recombinant naturally occurring molecules thereof, codon-optimized versions thereof, or modified versions thereof) may be used. In some embodiments, the endonuclease is any one or more of the endonucleases disclosed herein. In some embodiments, the endonuclease is any one or more endonucleases known to those of skill in the art. In some embodiments, an exogenous Cas protein can be introduced into a cell in the form of a polypeptide. In some embodiments, the Cas protein can be conjugated or fused to a cell-penetrating polypeptide or cell-penetrating peptide. As used herein, "cell-penetrating polypeptide" and "cell-penetrating peptide" refer to a polypeptide or peptide, respectively, that facilitates the uptake of a molecule into a cell. In some embodiments, the cell-penetrating polypeptide can include a detectable label.

[0300] In some embodiments, the endonuclease or Cas protein can be conjugated or fused to a charged protein (e.g., having a positive charge, a negative charge, or an overall neutral charge). Such a linkage can be covalent. In some embodiments, the endonuclease or Cas protein can be fused to a superpositively charged GFP to greatly increase the ability of the Cas protein to enter cells (Cronican et al. ACS Chem Biol. 2010;5(8):747-52). In some embodiments, the endonuclease or Cas protein can be fused to a protein transduction domain (PTD) to facilitate its entry into cells. Exemplary PTDs include Tat, oligoarginine, and penetratin. In some embodiments, the endonuclease or Cas protein comprises a Cas polypeptide fused to a cell-penetrating peptide.

[0301] In some embodiments, the endonuclease is linked to at least one nuclear localization signal (NLS). The at least one NLS can be located at or within 50 amino acids of the amino terminus of the endonuclease, and / or the at least one NLS can be located at or within 50 amino acids of the carboxy terminus of the endonuclease.

[0302] In some embodiments, the CRISPR-endonuclease system comprises an RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease comprises an amino acid sequence having at least about 10%, at least about 15%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% amino acid sequence identity to a wild-type endonuclease, such as Cpfl, MAD7, Cas9, and / or any other endonuclease of the disclosure. In some embodiments, the endonuclease comprises about or at least about 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of this disclosure) over about or at least about 10 contiguous amino acids. In some embodiments, the endonuclease comprises up to about 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of this disclosure) over about or at least about 10 contiguous amino acids. In some embodiments, the endonuclease comprises at least about 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of this disclosure) over about or at least about 10 contiguous amino acids in the HNH nuclease domain of the endonuclease. In some embodiments, the endonuclease comprises up to about 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of this disclosure) over about or at least about 10 contiguous amino acids in the HNH nuclease domain of the endonuclease.In some embodiments, the endonuclease comprises at least about 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of this disclosure) over about or at least about 10 contiguous amino acids in the RuvC nuclease domain of the endonuclease. In some embodiments, the endonuclease comprises up to about 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type endonuclease (e.g., Cpf1, MAD7, Cas9, and / or any other endonuclease of this disclosure) over about or at least about 10 contiguous amino acids in the RuvC nuclease domain of the endonuclease. The present invention provides guide RNAs (gRNAs) that can direct the activity of an associated endonuclease to a specific target site within a polynucleotide. In some embodiments, the guide RNA comprises a spacer sequence that hybridizes with a target nucleic acid sequence of interest and a CRISPR repeat sequence. In some embodiments, for example, in a CRISPR type II system, the gRNA also comprises a second RNA called a tracrRNA sequence. In some embodiments, in a CRISPR type II guide RNA (gRNA), the CRISPR repeat sequence and the tracrRNA sequence hybridize with each other to form a duplex. In some embodiments, in a CRISPR type V system, the gRNA comprises a crRNA that forms a duplex. In some embodiments, the gRNA can bind to an endonuclease such that the gRNA and the endonuclease form a complex. The gRNA can provide target specificity to the complex through its association with the endonuclease.

[0303] In some embodiments, the tracrRNA sequence contains nucleotides that hybridize to a CRISPR repeat sequence in a cell. The tracrRNA sequence and the CRISPR repeat sequence can form a double-stranded, i.e., base-paired, duplex structure. Together, the tracrRNA sequence and the CRISPR repeat can bind to an RNA-guided endonuclease. In some embodiments, at least a portion of the tracrRNA sequence can hybridize to the CRISPR repeat sequence. In some embodiments, the tracrRNA sequence can be at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the CRISPR repeat sequence. In some embodiments, the tracrRNA sequence can have a length of about 7 nucleotides to about 100 nucleotides. For example, the tracrRNA sequence can be about 7 nucleotides (NT) to about 50 NT, about 7 NT to about 40 NT, about 7 NT to about 30 NT, about 7 NT to about 25 NT, about 7 NT to about 20 NT, about 7 NT to about 15 NT, about 8 NT to about 40 NT, about 8 NT to about 30 NT, about 8 NT to about 25 NT, about 8 NT to about 20 NT, about 8 NT to about 15 NT, about 15 NT to about 100 NT, about 15 NT to about 80 NT, about 15 NT to about 50 NT, about 15 NT to about 40 NT, about 15 NT to about 30 NT, or about 15 NT to about 25 NT in length. In some embodiments, the tracrRNA sequence can be approximately 9 nucleotides in length. In some embodiments, the tracrRNA sequence can be about 12 nucleotides in length.

[0304] In some embodiments, the tracrRNA sequence can be at least about 60% identical to a reference tracrRNA (e.g., wild-type, S. pyogenes-derived tracrRNA) sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the tracrRNA sequence can be at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identical to a reference tracrRNA sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides.

[0305] In some embodiments, the Cas protein or endonuclease may be introduced into a cell containing a target polynucleotide sequence in the form of a nucleic acid encoding the Cas protein or endonuclease (e.g., Cas9, Cpfl, MAD7, or any endonuclease or Cas protein of the present disclosure). In some embodiments, the method includes a technique for introducing a nucleic acid into a γδ iPSC cell. The process of introducing a nucleic acid into a cell can be accomplished by any suitable technique. Suitable techniques include, but are not limited to, transfection (e.g., neon transfection, calcium phosphate- or lipid-mediated transfection), electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid is introduced into the cell using a non-viral system (e.g., neon transfection). In some embodiments, the nucleic acid is introduced into the cell using a viral system (e.g., adeno-associated virus). In some embodiments, the methods involve electroporation of cells (e.g., those disclosed in Section 7.3 or Section 7.4) or human cells (e.g., immunogenic human cells disclosed in Section 7.4, iPS human cells) to introduce genetic material, including, for example, DNA, RNA, and / or mRNA. In some embodiments, techniques for introducing proteins or nucleic acids can include electroporation, microinjection, viral delivery, exosomes, liposomes, biolistics, jet injection, hydrodynamic injection, ultrasound, magnetic field-mediated gene transfer, electric pulse-mediated gene transfer, the use of nanoparticles, including lipid-based nanoparticles, incubation with endosomolytic agents, the use of cell-penetrating peptides, or any other suitable technique to introduce proteins or nucleic acids. In some embodiments, the methods involve electroporation of human cells, including, for example, using the Neon transfection system (Thermo Fisher Scientific Inc.).

[0306] In some embodiments, the nucleic acid comprises DNA. In some embodiments, the nucleic acid comprises modified DNA. In some embodiments, the nucleic acid comprises mRNA. In some embodiments, the nucleic acid comprises modified mRNA.

[0307] In some embodiments, the Cas protein or endonuclease is complexed with at least one ribonucleic acid (e.g., one to two ribonucleic acids). In some embodiments, the Cas protein or endonuclease is complexed with two ribonucleic acids. In some embodiments, the Cas protein or endonuclease is complexed with one ribonucleic acid. In some embodiments, the Cas protein or endonuclease is encoded by a modified nucleic acid.

[0308] In some embodiments, the endonuclease and gRNA can each be administered separately to a cell. In some embodiments, the endonuclease can be pre-complexed with one or more crRNAs together with one or more guide RNAs or tracrRNA. The pre-complexed material can then be administered to a cell. Such pre-complexed material is known as a ribonucleoprotein particle (RNP). The endonuclease in the RNP can be, for example, Cpf1 endonuclease, MAD7 endonuclease, Cas9 endonuclease, or any endonuclease disclosed herein. In some embodiments, the endonuclease can be flanked at the N-terminus, C-terminus, or both the N-terminus and C-terminus by one or more nuclear localization signals (NLS). In some embodiments, the weight ratio of genome-targeting nucleic acid to endonuclease in the RNP can be 1:1, 2:1, 1:2, or any suitable ratio.

[0309] In some embodiments, the gRNA can be a bimolecular guide RNA. In some embodiments, the gRNA can be a single-molecule guide RNA (sgRNA). In some embodiments, the gRNA can be constructed as a single RNA oligonucleotide that is a combination of a repeat sequence followed by a spacer sequence, and specificity for a genomic target location is conferred by complementary binding of the spacer to genomic DNA. A split gRNA can be constructed as two RNA oligonucleotides composed of a tracrRNA and a crRNA, where the tracrRNA contains a portion of the repeat sequence and the crRNA contains a portion of the repeat sequence followed by a spacer sequence.

[0310] In some embodiments, the gRNA comprises a sequence that hybridizes to a sequence in a target polynucleotide. In some embodiments, the nucleotide sequence of the gRNA can vary depending on the sequence of the target nucleic acid of interest. In some embodiments, the gRNA comprises a variable-length sequence having 17 to 30 nucleotides, at least a portion of which hybridizes to a sequence in the target polynucleotide. In some embodiments, the gRNA sequence can be designed to hybridize to a target polynucleotide located 5' of the PAM of the endonuclease used in the system.

[0311] In some embodiments, the gRNA comprises another moiety (e.g., a stability control sequence, an endoribonuclease binding sequence, or a ribozyme). This moiety can decrease or increase the stability of the nucleic acid targeting nucleic acid. In some embodiments, the moiety can be a transcription termination segment (i.e., a transcription termination sequence). In some embodiments, the moiety can function in eukaryotic cells. The moiety can function in prokaryotic cells. In some embodiments, the moiety can function in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties include a 5' cap (e.g., a 7-methylguanylate cap (m7G)), a riboswitch sequence (e.g., to allow for regulated stability and / or regulated accessibility by proteins and protein complexes), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets the RNA to a subcellular location (e.g., the nucleus, mitochondria, chloroplasts, etc.), a modification or sequence that provides tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.), and / or a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including a transcriptional activator, a transcriptional repressor, a DNA methyltransferase, a DNA demethylase, a histone acetyltransferase, a histone deacetylase, etc.).

[0312] In some embodiments, the portion of the gRNA that hybridizes to the sequence or target motif in the target polynucleotide is referred to as a spacer. In some embodiments, the portion of the gRNA that hybridizes to the sequence or target motif in the target polynucleotide (spacer) comprises more than about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or about 25 nucleotides. In some embodiments, the portion of the gRNA that hybridizes to the sequence or target motif in the target polynucleotide comprises fewer than about 25 nucleotides. In some embodiments, the portion of the gRNA that hybridizes to the sequence or target motif in the target polynucleotide, or the gRNA, comprises more than about 20 nucleotides. In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in the target polynucleotide, or the gRNA, comprises about or at least about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides. In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in the target polynucleotide, or the gRNA, comprises up to about 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides. In some embodiments, the sequence or target motif in the target polynucleotide sequence comprises about, at least about, or at most about 20 bases immediately 5' to the first nucleotide of the PAM.

[0313] In some embodiments, the portion of the gRNA that hybridizes to a sequence in a target polynucleotide or target motif has a length of at least about 6 nucleotides (NT). In some embodiments, the portion of the gRNA that hybridizes to a sequence in a target polynucleotide or target motif, or the gRNA, is about or at least about 6 NT, about or at least about 10 NT, about or at least about 15 NT, about or at least about 18 NT, about or at least about 19 NT, about or at least about 20 NT, about or at least about 21 NT, about or at least about 22 NT, about or at least about 23 NT, about or at least about 24 NT, about or at least about 25 NT, about or at least about 30 NT, about or at least about 35 NT, about or at least about 40 NT, about or at least about 45 NT, about or at least about 50 NT, or greater than about 50 NT.In some embodiments, the portion of the gRNA that hybridizes to a sequence or target motif in a target polynucleotide, or the gRNA, is from about 6 NT to about 40 NT, from about 6 NT to about 35 NT, from about 6 NT to about 30 NT, from about 6 NT to about 29 NT, from about 6 NT to about 28 NT, from about 6 NT to about 27 NT, from about 6 NT to about 26 NT, from about 6 NT to about 25 NT, from about 6 NT ~ about 24 NT, about 6 NT to about 23 NT, about 6 NT to about 22 NT, about 6 NT to about 21 NT, about 6 NT to about 20 NT, about 10 NT to about 50 NT, about 10 NT to about 40 NT, about 10 NT to about 35 NT, about 10 NT to about 30 NT, about 10 NT to about 30 NT, about 10 NT to about 29 NT, about 10 NT to about 28 NT, about 10 NT to about 27 NT, about 10 NT to about 26 NT, about 10 NT to about 25 NT, about 10 NT to about 24 NT, about 10 NT to about 23 NT, about 10 NT to about 22 NT, about 10 NT to about 21 NT, about 10 NT to about 20 NT, about 19 NT to about 23 NT, about 19 NT to about 24 NT, about 19 NT to about 25 NT, about 19 NT to about 30 NT, about 19 NT about 19 NT to about 35 NT, about 19 NT to about 40 NT, about 19 NT to about 45 NT, about 19 NT to about 50 NT, about 19 NT to about 60 NT, about 20 NT to about 25 NT, about 20 NT to about 30 NT, about 20 NT to about 35 NT, about 20 NT to about 40 NT, about 20 NT to about 45 NT, about 20 NT to about 50 NT, or about 20 NT to about 60 NT.

[0314] In some embodiments, the percent complementarity between the gRNA or a portion of the gRNA (e.g., the spacer or crRNA) and the target polynucleotide is about or at least about 30%, about or at least about 40%, about or at least about 50%, about or at least about 60%, about or at least about 65%, about or at least about 70%, about or at least about 75%, about or at least about 80%, about or at least about 85%, about or at least about 90%, about or at least about 95%, about or at least about 97%, about or at least about 98%, about or at least about 99%, or 100%. In some embodiments, the percent complementarity between the gRNA or portion of the gRNA and the target polynucleotide is at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 85%, at most about 90%, at most about 95%, at most about 97%, at most about 98%, at most about 99%, or 100%. In some embodiments, the length of the gRNA and portion of the target nucleic acid may differ by 1-6 nucleotides, which may be considered a bulge(s).

[0315] In some embodiments, the gRNA is modified or chemically modified. In some embodiments, the chemically modified gRNA is a gRNA that includes at least one nucleotide with a chemical modification, such as a 2'-O-methyl sugar modification. In some embodiments, the chemically modified gRNA includes a modified nucleic acid backbone. In some embodiments, the chemically modified gRNA includes 2'-O-methyl-phosphorothioate residues. In some embodiments, the chemical modification enhances stability, reduces the likelihood or severity of an innate immune response, and / or enhances other properties, as described in the art.

[0316] In some embodiments, the modified gRNA comprises a modified backbone, e.g., phosphorothioate, phosphotriester, morpholino, methylphosphonate, short chain alkyl or cycloalkyl intersugar linkages, or short chain heteroatom or heterocyclic intersugar linkages.

[0317] In some embodiments, the modified gRNA contains one or more substituted sugar moieties, for example, at the 2' position, one of the following: OH, SH, SCH, F, OCN, OCH, OCHO(CH)CH, O(CH)NH, or O(CH)CH (where n is 1 to about 10); C1-C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl, or aralkyl; Cl; Br; CN; CF; OCF; O-, S-, or N-alkyl; O The gRNA may be modified with one of the following: -, S-, or N-alkenyl; SOCH3; SO2CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; RNA cleaving group; reporter group; intercalator; 2'-O-(2-methoxyethyl); 2'-methoxy (2'-O-CH3); 2'-propoxy (2'-OCH2CH2CH3); and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the gRNA, such as the 3' position of the sugar on the 3'-terminal nucleotide and / or the 5' position of the 5'-terminal nucleotide. In some instances, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units may be replaced with different groups.

[0318] In some embodiments, the gRNA additionally or alternatively comprises a nucleobase (or "base") modification or substitution. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleobases include nucleobases that are found only rarely or occasionally in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-Me pyrimidine, 5-methylcytosine (also called 5-methyl-2'deoxycytosine or 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC, and gentobiosyl HMC, as well as synthetic nucleobases such as 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalkylamino)adenine, or other heterosubstituted alkyl adenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6(6-aminohexyl)adenine, and 2,6-diaminopurine.

[0319] In some embodiments, modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, and 6-aminoadenine. , cytosine, and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

[0320] In some embodiments, genetic modification of the genomic DNA sequence of a target gene can be carried out using zinc finger nuclease (ZFN). Zinc finger nuclease (ZFN) is a modular protein composed of an engineered zinc finger DNA binding domain linked to the catalytic domain of type II endonuclease FokI. Because FokI functions as a dimer, a pair of ZFNs are engineered to bind to cognate target "half-site" sequences on opposite DNA strands, with precise spacing between them, allowing catalytically active FokI dimers to form. Upon dimerization of the FokI domain, a DNA double-strand break is generated between the ZFN half-sites, as the initial step in genome editing.

[0321] In some embodiments, the DNA-binding domain of each ZFN consists of three to six zinc fingers with a Cys2-His2 rich structure, each of which primarily recognizes a triplet of nucleotides on one strand of the target DNA sequence, although cross-strand interactions with a fourth nucleotide are also possible. Amino acid modifications of the fingers at positions that make critical contacts with DNA alter the sequence specificity of a given finger. Thus, a four-finger zinc finger protein selectively recognizes a 12-bp target sequence; the target sequence is a composite of triplet preferences contributed by each finger, but triplet preferences can be influenced to varying degrees by adjacent fingers. ZFNs can be easily retargeted to almost any genomic address simply by modifying individual fingers. In some embodiments, proteins with four to six fingers, each recognizing 12 to 18 bp, are used. Thus, a pair of ZFNs will typically recognize a combined target sequence of 24 to 36 bp, not including the typical 5 to 7 bp spacer between half sites. The binding sites can be further separated by larger spacers, including 15-17 bp.

[0322] Various ZFN-based systems have been described in the art, and modifications are regularly reported, and numerous references describe the rules and parameters used to guide the design of ZFNs. See, for example, Segal et al., Proc Natl Acad Sci, 1999 96(6):2758-63; Dreier B et al., J Mol Biol., 2000, 303(4):489-502; Liu Q et al., J Biol Chem., 2002, 277(6):3850-6; Dreier et al., J Biol Chem., 2005, 280(42):35588-97; and Dreier et al., J Biol Chem. 2001, 276(31):29466-78.

[0323] In some embodiments, genetic modification of the genomic DNA sequence of a target gene can be performed using transcription activator-like effector nucleases (TALENs). TALENs, like ZFNs, represent another type of modular nuclease in which an engineered DNA-binding domain is linked to a FokI nuclease domain, and a pair of TALENs operates in tandem to achieve targeted DNA cleavage. The primary difference from ZFNs is the nature of the DNA-binding domain and the associated target DNA sequence recognition properties. TALEN DNA-binding domains are derived from TALE proteins originally described in the plant bacterial pathogen Xanthomonas sp. TALEs consist of a tandem array of 33-35 amino acid repeats, each of which recognizes a single base pair in the target DNA sequence, typically up to 20 bp in length, giving a total target sequence length of up to 40 bp. The nucleotide specificity of each repeat is determined by the repeat variable diresidue (RVD), which contains exactly two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine, and thymine are mainly recognized by four RVDs: Asn-Asn, Asn-Ile, His-Asp, and Asn-Gly, respectively.Various TALEN-based systems have been described in the art, and their modifications are regularly reported.For example, see Boch, Science, 2009 326(5959):1509-12; Mak et al., Science, 2012, 335(6069):716-9; and Moscou et al., Science, 2009, 326(5959):1501.The use of TALEN based on the "Golden Gate" platform or cloning scheme has been described by several groups.See, for example, Cermak et al., Nucleic Acids Res., 2011, 39(12):e82; Li et al., Nucleic Acids Res., 2011, 39(14):6315-25; Weber et al., PLoS One., 2011, 6(2):e16765; Wang et al., J Genet Genomics, 2014, 41(6):339-47; and Cermak T et al., Methods Mol Biol., 2015 1239:133-59.

[0324] In some embodiments, genetic modification of the genomic DNA sequence of a target gene can be performed using a homing endonuclease (HE). Homing endonucleases (HEs) are sequence-specific endonucleases that have long recognition sequences (14-44 base pairs) and cleave DNA with high specificity, often at unique sites in the genome. There are at least six known HE families, classified by their structure, including GIY-YIG, His-Cis box, HNH, PD-(D / E)xK, and Vsr-like, derived from a wide range of hosts, including eukaryotes, protists, bacteria, archaea, cyanobacteria, and phages. Similar to ZFNs and TALENs, HEs can be used to create DSBs at target loci as the first step in genome editing. Additionally, some natural and engineered HEs cleave only a single strand of DNA, thereby functioning as site-specific nickases. Various HE-based systems have been described in the art, and modifications are regularly reported. See, e.g., Steentoft et al., Glycobiology, 2014, 24(8):663-80; Belfort and Bonocora, Methods Mol Biol., 2014, 1123:1-26; and Hafez and Hausner, Genome, 2012, 55(8):553-69.

[0325] In some embodiments, genetic modification of the genomic DNA sequence of the target gene can be performed using the MegaTAL or Tev-mTALEN platform. The MegaTAL and Tev-mTALEN platforms utilize the fusion of a TALE DNA binding domain and a catalytically active HE, taking advantage of both the tunable DNA binding and specificity of TALEs and the cleavage sequence specificity of HEs. See, for example, Boissel et al., Nucleic Acids Res., 2014, 42:2591-2601; Kleinstiver et al., G3, 2014, 4:1155-65; and Boissel and Scharenberg, Methods Mol. Biol., 2015, 1239:171-96.

[0326] In some embodiments, the MegaTev construct is a fusion of a meganuclease (meganuclease, Mega) with a nuclease domain derived from the GIY-YIG homing endonuclease I-TeeI (Tev). The two active sites are spaced approximately 30 bp apart on the DNA substrate, generating two DSBs with incompatible cohesive ends. See, for example, Wolfs et al., Nucleic Acids Res., 2014, 42, 8816-29. It is expected that other combinations of existing nuclease-based approaches will be developed and useful for achieving the targeted genome modifications described herein.

[0327] 7.5.1 RNAi Technology and Transcriptional Silencing In some embodiments, genetically modifying the target gene includes reducing the mRNA of the target gene via an RNA interference (RNAi) system. RNA interference (RNAi) is a biological process of mRNA degradation induced by complementary double-stranded (ds) small interfering RNA (siRNA) and suppressing target gene expression. Any suitable RNAi system known in the art can be used to reduce the mRNA of the target gene. For example, see Xu et al., Comprehensive Biotechnology. 2019:560-575, for a review of RNAi technology.

[0328] In some embodiments, the RNAi system comprises synthetic siRNA, short hairpin RNA (shRNA), Dicer-produced siRNA, endoribonuclease-prepared short interfering RNA (esiRNA), microRNA and mimics, pro-siRNA, miR-compatible shRNA, or combinations thereof.

[0329] In some embodiments, genetically modifying the target gene comprises reducing or eliminating transcription of the target gene (e.g., transcriptional repression). In some embodiments, genetically modifying the target gene comprises recruiting or directing a transcriptional repressor to the target gene. A transcriptional repressor is a chromatin-modifying protein that can repress transcription of a gene. Repressor proteins act by binding to the promoter region of a gene, preventing the production of mRNA.

[0330] Any suitable transcriptional repressor known in the art can be used with the subject matter of the present disclosure. Non-limiting examples of transcriptional repressors include the Kruppel-associated box (KRAB) repressor domain and methyl-CpG binding protein 2 (MeCP2). Transcriptional repression can also occur through steric hindrance during the initiation or elongation phase of the RNA polymerase complex.

[0331] In some embodiments, a gRNA can be used to knock in a miR-compatible shRNA that targets CD58. In some embodiments, the miRNA comprises the sequence set forth in SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, or 128.

[0332] In some embodiments, the method includes knocking out one or more target genes in hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or iPS human cells or iPS cells, for example, via shRNA. In some embodiments, shRNA may be used to disrupt the CD58 gene. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 61, 62, 63, 64, 65, 66, or 67. In some embodiments, the shRNA comprises the sequence set forth in SEQ ID NO: 60, 63, or 64.

[0333] 7.6 Cell populations The present disclosure further provides non-naturally occurring hypoimmunogenic cells (such as engineered hypoimmunogenic cells) produced by the methods of the disclosure (e.g., the methods of engineering hypoimmunogenicity disclosed in Sections 7.4 and 7.5).

[0334] The present disclosure further provides non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) produced by the methods of the disclosure (e.g., the methods of engineering hypoimmunogenicity disclosed in Sections 7.4 and 7.5).

[0335] The present disclosure further provides non-naturally occurring hypoimmunogenic cells (e.g., engineered hypoimmunogenic cells) that comprise at least one genetically modified target gene (e.g., an RFX gene, a B2M gene, a CD58 gene, or a CIITA gene), where the genetically modified target gene reduces expression of a protein encoded by the at least one target gene. In some embodiments, the hypoimmunogenic cells (e.g., engineered hypoimmunogenic cells) are produced from embryoid bodies. In some embodiments, the hypoimmunogenic cells (e.g., engineered hypoimmunogenic cells) comprise genetically modified at least two, at least three, or at least four target genes (e.g., genetically modified RFX and B2M genes, genetically modified RFX and CD58 genes, genetically modified B2M and CIITA genes, genetically modified B2M and CD58 genes, genetically modified CD58 and CIITA genes, genetically modified RFX, B2M, and CD58 genes, genetically modified CIITA, B2M, and CD58 genes).

[0336] The present disclosure further provides non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) that comprise at least one genetically modified target gene (e.g., an RFX gene, a B2M gene, a CD58 gene, or a CIITA gene), where the genetically modified target gene reduces expression of a protein encoded by the at least one target gene. In some embodiments, the hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) are produced from embryoid bodies. In some embodiments, the hypoimmunogenic human cells (e.g., engineered hypoimmunogenic cells) comprise genetically modified at least two, at least three, or at least four target genes (e.g., genetically modified RFX and B2M genes, genetically modified RFX and CD58 genes, genetically modified B2M and CIITA genes, genetically modified B2M and CD58 genes, genetically modified CD58 and CIITA genes, genetically modified RFX, B2M, and CD58 genes, genetically modified CIITA, B2M, and CD58 genes).

[0337] The present disclosure further provides γδ T-cell-derived induced pluripotent stem (iPS) human cells comprising at least one genetically modified target gene (e.g., RFX gene, B2M gene, CD58 gene, CIITA gene), wherein the genetically modified target gene reduces expression of a protein encoded by the at least one target gene. In some embodiments, the iPS human cells comprise at least two, at least three, or at least four genetically modified target genes (e.g., genetically modified RFX gene and B2M gene, genetically modified RFX gene and CD58 gene, genetically modified B2M gene and CIITA gene, genetically modified B2M gene and CD58 gene, genetically modified CD58 gene and CIITA gene, genetically modified RFX gene, B2M gene, and CD58 gene, genetically modified CIITA gene, B2M gene, and CD58 gene).

[0338] In some embodiments, the present disclosure provides non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) derived from iPS human cells derived from γδ T cells.

[0339] In some embodiments, the non-naturally occurring hypoimmunogenic cells (such as engineered hypoimmunogenic cells) or non-naturally occurring hypoimmunogenic human cells (such as engineered hypoimmunogenic human cells) or induced pluripotent stem (iPS) human cells derived from γδ T cells disclosed herein further comprise at least one of a genetically modified TNFRSF14 (also known as HVEM) gene, a genetically modified TNFRSF1A (also known as TNFR1) gene, a genetically modified TNFRSF1B (also known as TNFR2) gene, and a genetically modified ICAM1 gene.

[0340] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having at least one genetically modified target gene) has, for example, about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (lower) reduced immunogenicity or reduced immune response compared to a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells.

[0341] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having at least one genetically modified target gene) has a myeloid cell response that is reduced, e.g., by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or greater than 100% (less) than a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells.

[0342] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having at least one genetically modified target gene) has a T cell response that is reduced, e.g., by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (less) than a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells.

[0343] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having at least one genetically modified target gene) has a natural killer cell response that is reduced, e.g., by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (less) than a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells.

[0344] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having at least one genetically modified target gene) has an antibody response that is reduced, e.g., by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100% (lower), compared to a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells.

[0345] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having at least one genetically modified target gene) has, for example, about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or greater than 100% (less) reduced allogeneic host-versus-graft rejection compared to a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that at least one target gene has not been genetically modified in the population of unmodified cells.

[0346] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells with a genetically modified RFX gene) has an MHC class II-mediated response that is reduced, e.g., by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower), compared to a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that the RFX gene has not been genetically modified in the population of unmodified cells.

[0347] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells with a genetically modified RFX gene) has an MHC class I-mediated response that is reduced, e.g., by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% (less) compared to a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that the RFX gene has not been genetically modified in the population of unmodified cells.

[0348] In some embodiments, expression of HLA class II molecules in a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells with a genetically modified RFX gene) is reduced, e.g., by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower), compared to expression of HLA class II molecules in a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that the RFX gene has not been genetically modified in the population of unmodified cells.

[0349] In some embodiments, expression of HLA class I molecules in a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having a genetically modified RFX gene) is reduced by about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% (lower) compared to expression of HLA class I molecules in a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that the RFX gene has not been genetically modified in the population of unmodified cells.

[0350] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells with a genetically modified B2M gene) has an MHC class I-mediated response that is about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) reduced compared to a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that the B2M gene has not been genetically modified in the population of unmodified cells.

[0351] In some embodiments, expression of HLA class I molecules in a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells with a genetically modified B2M gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to expression of HLA class I molecules in a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that the B2M gene has not been genetically modified in the population of unmodified cells.

[0352] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having a genetically modified CIITA gene) has an MHC class II-mediated response that is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that in the population of unmodified cells, the CIITA gene has not been genetically modified.

[0353] In some embodiments, the expression of HLA class II molecules in a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) of the present disclosure (e.g., cells having a genetically modified CIITA gene) is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% (lower) compared to the expression of HLA class II molecules in a population of unmodified cells. In some embodiments, the only difference between a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) and a population of unmodified cells is that the CIITA gene has not been genetically modified in the population of unmodified cells.

[0354] In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells with a genetically modified CD58 gene) of the present disclosure have reduced or abolished costimulatory immune cell responses. In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells with a genetically modified CD58 gene) of the present disclosure have impaired immune synapse formation. In some embodiments, a population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) (e.g., cells with a genetically modified CD58 gene) of the present disclosure have impaired recognition by patient (host) T cells, NK cells, and myeloid cells.

[0355] In some embodiments, the population of hypoimmunogenic cells (e.g., engineered hypoimmunogenic cells) are blood cells. In some embodiments, the blood cells are preferably peripheral blood mononuclear cells (PBMCs) and may include all types of blood cells present in the entire differentiation process from hematopoietic stem cells to terminal differentiation into peripheral blood. In some embodiments, blood cells include, for example, hematopoietic stem cells, lymphoid stem cells, lymphoid dendritic cell precursors, lymphoid dendritic cells, T lymphocyte precursors, T cells, B lymphocyte precursors, B cells, plasma cells, NK precursors, NK cells, monocytes, and macrophages.

[0356] In some embodiments, the population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) can be peripheral blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor infiltrating lymphocytes (TILs), or a combination thereof. In some embodiments, the population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are peripheral blood mononuclear (PBMC) cells.

[0357] In some embodiments, the population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are T cells. In some embodiments, the population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are CD4 + / CD8 + The cells may be selected from the group consisting of double positive T cells, cytotoxic T cells, Th3 (Treg) cells, Th9 cells, Thαβ helper cells, Tfh cells, stem memory TSCM cells, central memory TCM cells, effector memory TEM cells, effector memory TEMRA cells, gamma delta T cells, and any combination thereof.

[0358] In some embodiments, the population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) is derived from cell types that are easily accessible and require minimal invasion, such as fibroblasts, skin cells, umbilical cord blood cells, peripheral blood cells, and renal epithelial cells.

[0359] In some embodiments, the population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are terminally differentiated cells. In some embodiments, the population of hypoimmunogenic cells (such as engineered hypoimmunogenic cells) are terminally differentiated T cells. In some embodiments, the population of hypoimmunogenic cells...

Claims

1. A method of low immunogenicity, such as engineering low immunogenicity, comprising: a) reprogramming immunogenic human cells, wherein the immunogenic human cells comprise a heterodimeric T cell receptor comprising a gamma chain and a delta chain, to produce induced pluripotent (iPS) human cells; b) genetically modifying a beta-2-microglobulin (B2M) gene in iPS human cells, wherein genetically modifying the B2M gene reduces expression of B2M protein by the iPS human cells; c) forming at least one embryoid body or multicellular body from the cells of step b) to produce at least one hypoimmunogenic cell, such as at least one engineered hypoimmunogenic cell; d) subjecting said hypoimmunogenic cells, such as said engineered hypoimmunogenic cells, to the immune system; e) determining the immunogenicity of said hypoimmunogenic cells, such as said engineered hypoimmunogenic cells, wherein said immunogenicity is altered compared to iPS human cells that have not been genetically modified in the B2M gene; Optionally, step b) further comprises genetically modifying one or more of the class II major histocompatibility complex transactivator (CIITA) gene, regulatory factor X (RFX) gene, and CD58 gene of the iPS human cells.

2. A method of low immunogenicity, such as engineering low immunogenicity, comprising: a) genetically modifying a beta-2-microglobulin (B2M) gene of at least one immunogenic human cell, wherein genetically modifying the B2M gene reduces expression of B2M by the immunogenic human cell; b) forming at least one embryoid body or multicellular body from the cells of a) to produce at least one hypoimmunogenic cell, such as at least one engineered hypoimmunogenic cell; c) subjecting the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, to the immune system; d) determining the immunogenicity of said hypoimmunogenic cells, such as said engineered hypoimmunogenic cells, wherein said immunogenicity is altered compared to immunogenic human cells that have not been genetically modified in the B2M gene; Optionally, step a) further comprises genetically modifying one or more of a class II major histocompatibility complex transactivator (CIITA) gene, a regulatory factor X (RFX) gene, and a CD58 gene of the immunogenic human cells.

3. A method of low immunogenicity, such as engineering low immunogenicity, comprising: a) genetically modifying a beta-2-microglobulin (B2M) gene of an immunogenic human cell, wherein genetically modifying the B2M gene reduces expression of a B2M protein by the immunogenic human cell, to produce a hypoimmunogenic cell, such as an engineered hypoimmunogenic cell; b) subjecting the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, to the immune system; c) determining the immunogenicity of said hypoimmunogenic cells, such as said engineered hypoimmunogenic cells, wherein said immunogenicity is altered compared to immunogenic human cells that have not been genetically modified in the B2M gene; Optionally, the method wherein step a) further comprises genetically modifying one or more of a class II major histocompatibility complex transactivator (CIITA) gene, a regulatory factor X (RFX) gene, and CD58 of the immunogenic human cells.

4. 1. A method for producing hypoimmunogenic cells, such as engineered hypoimmunogenic cells, from immunogenic cells, comprising: (i) genetically modifying a beta-2-microglobulin (B2M) gene in the immunogenic cells, wherein genetically modifying the B2M gene reduces expression of a B2M protein in the cells; (ii) optionally, further genetically modifying in the immunogenic cells one or more genes selected from a class II major histocompatibility complex transactivator (CIITA) gene, a CD58 gene, and a regulatory factor X (RFX) gene, wherein genetically modifying the one or more genes reduces expression of a corresponding one or more proteins in the immunogenic cells, wherein the method comprises further genetically modifying one or more genes to reduce expression of a corresponding one or more proteins in the immunogenic cells, the method comprising: a) have reduced immunogenicity in the presence of said hypoimmunogenic cells, such as said engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to a corresponding immunogenic cell but without said genetic modifications of (i) and (ii); b) eliciting a reduced immune response against said hypoimmunogenic cells, such as said engineered hypoimmunogenic cells, in the presence of said hypoimmunogenic cells, such as said engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to a corresponding immunogenic cell but lacking said genetic modifications of (i) and (ii); and c) causing reduced alloreactive T cell cytotoxicity against the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, in the presence of the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to corresponding immunogenic cells that do not have the genetic modifications of (i) and (ii). The method of claim 1, wherein the method results in the production of said hypoimmunogenic cells, such as said engineered hypoimmunogenic cells, having one or more of:

5. 1. A method for producing hypoimmunogenic cells, such as engineered hypoimmunogenic cells, from immunogenic cells, comprising: a) reprogramming the immunogenic cells to produce induced pluripotent stem (iPS) cells; b) (i) genetically modifying a beta-2-microglobulin (B2M) gene in the iPS cells produced in step (a), wherein genetically modifying the B2M gene reduces expression of a B2M protein in the iPS cells, and (ii) optionally, further genetically modifying in the iPS cells one or more genes selected from a class II major histocompatibility complex transactivator (CIITA) gene, a CD58 gene, and a regulatory factor X (RFX) gene, wherein genetically modifying the one or more genes reduces expression of a corresponding one or more proteins in the iPS cells. c) optionally differentiating the cells produced in step (b); The method has the following characteristics: 1) have reduced immunogenicity in the presence of said hypoimmunogenic, such as said engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject compared to corresponding iPS cells or cells corresponding to the cells produced in step (c), but without the genetic modification of step (b); 2) eliciting a reduced immune response against the hypoimmunogenic, such as engineered hypoimmunogenic, cells in the presence of the hypoimmunogenic, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to corresponding iPS cells or cells corresponding to the cells produced in step (c), but without the genetic modification of step (b); and 3) causing reduced alloreactive T cell cytotoxicity against the hypoimmunogenic, such as engineered hypoimmunogenic, cells in the presence of the hypoimmunogenic, such as engineered hypoimmunogenic cells, in an allogeneic or non-MHC-matched subject, compared to corresponding iPS cells or cells corresponding to the cells produced in step (c), but without the genetic modification of step (b). The method of claim 1, wherein the method results in the production of said hypoimmunogenic cells, such as said engineered hypoimmunogenic cells, having one or more of:

6. 6. The method of any one of claims 1 to 5, wherein the hypoimmunogenic cell, such as the engineered hypoimmunogenic cell, comprises a T cell receptor (TCR) comprising a gamma chain and a delta chain.

7. 7. The method of any one of claims 1 to 6, wherein the immunogenic human cell or immunogenic cell is optionally an immune cell selected from a T cell, a natural killer (NK) cell, a B cell, and a hematopoietic stem cell (HSC).

8. The reduced immunogenicity of the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, can be achieved by: i) a reduced or abolished bone marrow cell response to said hypoimmunogenic, such as said engineered hypoimmunogenic, cells when present in an allogeneic or non-MHC-matched subject compared to corresponding cells that have been modified but do not have said genetic modification; ii) a reduced or abolished T cell response to the hypoimmunogenic, such as the engineered hypoimmunogenic, cells when present in an allogeneic or non-MHC-matched subject, compared to corresponding cells that have been modified but do not have the genetic modification; iii) a reduced or abolished natural killer (NK) cell response to the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, when present in an allogeneic or non-MHC-matched subject, compared to corresponding cells that have been modified but do not have the genetic modification; iv) a reduced or abolished neutralizing antibody response to the hypoimmunogenic, such as the engineered hypoimmunogenic, cells when present in an allogeneic or non-MHC-matched subject, compared to corresponding cells that have been modified but do not have the genetic modification; v) a reduced or abolished MHC class II-mediated cellular response to the hypoimmunogenic, such as the engineered hypoimmunogenic, cells when present in an allogeneic or non-MHC-matched subject, compared to corresponding cells that have been modified but do not have the genetic modification; vi) a reduced or abolished neutralizing MHC class I-mediated cellular response to the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, when present in an allogeneic or non-MHC-matched subject, compared to corresponding cells that have been modified but do not have the genetic modification; and vii) reduced or eliminated allogeneic host-versus-graft rejection of the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, in the presence of the engineered cells in an allogeneic subject, compared to corresponding cells that have been modified but do not have the genetic modification. The method of any one of claims 1 to 7, comprising one or more of:

9. The method of any one of claims 4 to 8, wherein the immunogenic cells are human cells.

10. In the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, i) reduced or abolished expression of HLA class II molecules; ii) reduced expression of HLA-A, HLA-B, and / or HLA-C; and 10. The method of claim 9, wherein iii) expression of HLA-E is reduced but remains detectable.

11. 11. The method of any one of claims 4 to 10, wherein the method comprises forming at least one embryoid body or multicellular body from the genetically modified cells to produce the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells.

12. The method of any one of claims 4 to 11, further comprising determining the immunogenicity of the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells.

13. 13. The method of any one of claims 1 to 12, further comprising administering the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, to an allogeneic or non-MHC-matched subject.

14. 14. The method of any one of claims 1 to 13, wherein the immunogenicity of the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, is altered compared to immunogenic cells or immunogenic human cells or iPS human cells or iPS cells, and the only difference between the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, and the immunogenic cells or immunogenic human cells or iPSC human cells or iPS cells is that the B2M gene and optionally one or more of the RFX gene, the CIITA gene, and the CD58 gene are not genetically modified in the immunogenic cells or the immunogenic human cells or the iPSC human cells.

15. 15. The method of any one of claims 1 to 14, wherein the immunogenic human cell or cells are allogeneic or non-HLA- or non-MHC-compatible with respect to a cell, receptor, or polypeptide of the recipient subject's immune system.

16. 16. The method of any one of claims 1 to 3 and 6 to 15, wherein altering the immunogenicity comprises balancing, reducing or neutralizing the immunogenicity.

17. 17. The method of any one of claims 1-3 and 6-16, wherein altering the immunogenicity comprises reducing or neutralizing a myeloid cell response to the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells.

18. 18. The method of any one of claims 1-3 and 6-17, wherein altering the immunogenicity comprises reducing or neutralizing T cell responses to the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells.

19. 19. The method of any one of claims 1-3 and 6-18, wherein altering the immunogenicity comprises reducing or neutralizing a natural killer cell response to the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells.

20. 20. The method of any one of claims 1-3 and 6-19, wherein altering the immunogenicity comprises reducing or neutralizing an antibody response to the hypoimmunogenic cell, such as the engineered hypoimmunogenic cell.

21. 21. The method of any one of claims 1-3 and 6-20, wherein altering the immunogenicity comprises reducing or neutralizing allogeneic host-versus-graft rejection.

22. 22. The method of any one of claims 1-3 and 6-21, wherein altering the immunogenicity reduces or eliminates expression of HLA class I molecules on the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells.

23. The method of any one of claims 1 to 3 and 6 to 22, further comprising genetically modifying the RFX gene, wherein the RFX gene is RFX5, RFXANK, or RFXAP.

24. 24. The method of claim 23, wherein two or more of RFX5, RFXANK, and RFXAP are genetically modified.

25. 25. The method of claim 23 or 24, wherein each of RFX5, RFXANK, and RFXAP is genetically modified.

26. Genetically modifying the RFX gene in the hypoimmunogenic cells, such as the engineered hypoimmunogenic cells, a) reduced or absent expression of HLA class II molecules, or b) reduced expression of HLA-A, HLA-B, and / or HLA-C; The method of any one of claims 23 to 25, wherein the method results in one or more of:

27. 27. The method of any one of claims 23 to 26, wherein genetically modifying the RFX gene results in reduced or eliminated expression of an MHC class II mediated response to the hypoimmunogenic cell, such as the engineered hypoimmunogenic cell.

28. 28. The method of any one of claims 23 to 27, wherein genetically modifying the RFX gene results in reducing or neutralizing the expression of an MHC class I-mediated response against the hypoimmunogenic cell, such as the engineered hypoimmunogenic cell.

29. 29. The method of any one of claims 1 to 28, further comprising genetically modifying a CIITA gene, wherein genetically modifying the CIITA gene results in reduced or eliminated expression of an HLA class II molecule on the hypoimmunogenic cell, such as the engineered hypoimmunogenic cell.

30. 30. The method of any one of claims 1 to 29, further comprising genetically modifying the CD58 gene, wherein genetically modifying the CD58 gene eliminates or reduces CD58 expression.

31. 31. The method of claim 30, wherein genetic modification of the CD58 gene reduces or eliminates the impairment of costimulatory immune cell responses and / or immune synapse formation.

32. Genetically modifying the B2M gene (i) optionally modifying the DNA sequence of the B2M gene via a CRISPR-Cas system; (ii) suppressing the transcription or translation of B2M mRNA via an RNAi system, optionally wherein the RNAi system comprises an shRNA, an siRNA, or an miR-matched shRNA; or (iii) optionally reducing or eliminating transcription of the B2M gene through recruiting or targeting a transcriptional repressor to the B2M gene.

33. Genetically modifying the CIITA gene and / or the CD58 gene and / or the RFX gene, (i) optionally modifying the DNA sequence of the CIITA gene and / or the CD58 gene and / or the RFX gene via a CRISPR-Cas system; (ii) suppressing the transcription or translation of the CIITA gene and / or the CD58 gene and / or the RFX gene via an RNAi system, optionally comprising an shRNA, an siRNA, an miR-matched shRNA, or a combination thereof; or (iii) optionally, reducing or eliminating transcription of the CIITA gene and / or the CD58 gene and / or the RFX gene by recruiting or directing a transcription repressor to the CIITA gene and / or the CD58 gene and / or the RFX gene.

33. The method of any one of claims 1 to 32, comprising:

34. 34. The method of any one of claims 1 to 33, wherein the method further comprises genetically modifying at least one of the TNFRSF14 gene, the TNFRSF1A gene, the TNFRSF1B gene, the ICAM1 gene, and the herpes virus entry mediator (HVEM) gene.

35. 35. A non-naturally occurring hypoimmunogenic human cell, comprising said hypoimmunogenic cell, such as said engineered hypoimmunogenic cell, produced by the method of any one of claims 1 to 34.

36. A non-naturally occurring hypoimmunogenic human cell, such as an engineered hypoimmunogenic human cell, comprising a genetically modified B2M gene, wherein the genetically modified B2M gene reduces expression of a B2M protein, wherein the hypoimmunogenic human cell, such as the engineered hypoimmunogenic cell, is produced from an embryoid body, and optionally the hypoimmunogenic human cell, such as the engineered hypoimmunogenic cell, further comprises one or more of a genetically modified CIITA gene, a genetically modified RFX gene, and a genetically modified CD58 gene.

37. 37. A composition comprising the hypoimmunogenic human cells of claim 35 or 36.

38. 1. An induced pluripotent stem (iPS) human cell derived from a γδ T cell, the iPS human cell comprising a genetically modified B2M gene, wherein the genetically modified B2M gene reduces expression of a B2M protein, and optionally the iPS human cell further comprises one or more of a genetically modified CIITA gene, a genetically modified RFX gene, and a genetically modified CD58 gene.

39. A composition comprising the iPS human cells of claim 38.

40. 1. A method for engineering low immunogenicity, comprising: a) genetically modifying a B2M gene in at least one immunogenic human cell, wherein genetically modifying the B2M gene reduces expression of a B2M protein in the immunogenic human cell; b) forming at least one embryoid body or multicellular body from the cells of a) to perform the function of producing at least one engineered hypoimmunogenic cell; c) performing the function of presenting the engineered hypoimmunogenic cells to the immune system; d) performing a function to determine the immunogenicity of said engineered hypoimmunogenic cells, said immunogenicity being altered compared to immunogenic human cells in which the B2M gene has not been genetically modified; Optionally, the method wherein step a) further comprises a step for performing the function of genetically modifying the RFX gene, the CIITA gene, and / or the CD58 gene of said immunogenic human cells.

41. 1. A method for engineering low immunogenicity, comprising: a) performing the function of reprogramming immunogenic human cells, said immunogenic human cells comprising a heterodimeric T cell receptor comprising a gamma chain and a delta chain, to produce induced pluripotent stem (iPS) human cells; b) genetically modifying the B2M gene in said iPS human cells, wherein genetically modifying said B2M gene reduces expression of a B2M protein by said iPS human cells; c) forming at least one embryoid body from the cells of step b) to perform the function of producing at least one engineered hypoimmunogenic cell; d) performing the function of presenting the engineered hypoimmunogenic cells to the immune system; e) performing a function to determine the immunogenicity of the engineered hypoimmunogenic cells, wherein the immunogenicity is altered compared to iPS human cells in which the B2M gene has not been genetically modified; Optionally, the method wherein step b) further comprises a step for performing the function of genetically modifying the RFX gene, the CIITA gene, and / or the CD58 gene of said iPS human cells.

42. 1. A method for engineering low immunogenicity, comprising: a) genetically modifying a B2M gene in an immunogenic human cell, wherein genetically modifying the B2M gene reduces expression of a B2M protein by the immunogenic human cell, to perform the function of producing an engineered hypoimmunogenic cell; b) performing the function of presenting the engineered hypoimmunogenic cells to the immune system; c) performing a function to determine the immunogenicity of said engineered hypoimmunogenic cells, said immunogenicity being altered compared to immunogenic human cells in which the B2M gene has not been genetically modified; Optionally, the method wherein step a) further comprises a step for performing the function of genetically modifying the RFX gene, the CIITA gene, and / or the CD58 gene of said immunogenic human cells.

43. A non-naturally occurring engineered hypoimmunogenic human cell, comprising a means for reducing expression of a B2M protein via a genetically modified B2M gene and / or a means for altering the immunogenicity of the immune system towards the engineered hypoimmunogenic human cell compared to an immunogenic human cell in which the B2M gene has not been genetically modified, and optionally the engineered hypoimmunogenic human cell further comprises a means for reducing expression of an RFX protein, a CD58 protein, and / or a CIITA protein via a genetically modified RFX gene, a genetically modified CD58 gene, and / or a genetically modified CIITA gene.

44. 1. An induced pluripotent stem (iPS) human cell derived from a γδ T cell, comprising a means for reducing expression of a B2M protein via a genetically modified B2M gene and / or a means for changing the immunogenicity of the immune system to the iPS human cell compared to an iPS human cell in which the B2M gene has not been genetically modified, and optionally the iPS human cell further comprises a means for reducing expression of an RFX protein, a CD58 protein, and / or a CIITA protein via a genetically modified RFX gene, a genetically modified CD58 gene, and / or a genetically modified CIITA gene.