Folding Oligonucleotides

Abstract

The present invention provides folding oligonucleotides and their use to correct genetic mutations in target RNA molecules or to bind specific motifs to target RNA molecules.

Description

[Technical Field]

[0001] This disclosure is in the field of nucleic acid-based therapeutics engineering. [Background technology]

[0002] During the natural transcription process that occurs in the cell nucleus, RNA (ribonucleic acid) is transcribed from a DNA (deoxyribonucleic acid) template. During this process, pre-mRNA (pre-messenger RNA) transcripts are produced. The pre-mRNA is then processed into mature mRNA. RNA processing includes 5' capping, 3' polyadenylation, and splicing, including alternative splicing. The splicing process splices together all introns (non-coding regions of RNA) and exons (coding regions).

[0003] Splicing of pre-mRNA occurs at consensus sequences near the 5' and 3' ends of introns known as the 5' (donor) and 3' (acceptor) splice sites by a large, dynamic RNA-protein complex called the spliceosome (Nelson KK, and Green MR Genes Dev. 1989;3:1562-1571). The splice donor site contains the nearly invariant sequence GU at the 5' end of the intron within a larger, less highly conserved region. The splice donor site at the 3' end of the intron terminates the intron with the nearly invariant AG sequence. Upstream (5' direction) from the AG is a pyrimidine-rich region (C and U) called the polypyrimidine tract (PTT). The consensus sequence for an intron (IUPAC nucleic acid annotation) is GG-[cleavage]-GURAGU (donor site)...intron sequence...YURAC (branch sequence 20–50 nucleotides upstream of the acceptor site)...Y-rich-NCAG-[cleavage]-G (acceptor site). The branchpoint sequence is a cis-acting intron motif required for mRNA splicing.

[0004] Mutations in the 5'ss, 3'ss, BP sequences, and polypyrimidine tracts (PPTs) can cause genetic diseases due to altered splicing efficiency (Faustino NA, and Cooper TA Genes Dev. 2003;17:419-437). Cryptic 5'ss or 3'ss instead of the canonical splice site can also be activated (Buratti E., et al. Nucleic Acids Res. 2011;39:D86-D91).

[0005] Eukaryotic genomes contain "authentic" splice sites (present in wild-type pre-mRNAs) as well as numerous cryptic splice sites (css) that are generally considered to be dormant (or undetectably used) unless activated by mutation of a nearby authentic splice site. That is, point mutations in the underlying DNA or errors during transcription can activate cryptic splice sites in portions of the transcript that are not normally spliced. This can result in mature mRNAs with missing sections of exons, which can manifest as deletions or truncations in the final protein, or sequences added to exons that disrupt the reading frame, resulting in different proteins or truncated protein sequences by including stop codons.

[0006] Trans-splicing is a splicing reaction that ligates two exons from two different RNA molecules. This mechanism occurs naturally in eukaryotic cells, including human cells.

[0007] A review article by Berger et al. (2016 WIREs RNA, 7:487-498) describes spliceosome-mediated RNA trans-splicing (SMaRT) as a strategy for designing gene therapy solutions for genetic diseases. SMaRT relies on post-transcriptional correction of mutations by altering mRNA sequences. To achieve this, exogenous RNA is typically introduced into target cells via gene transfer, triggering a trans-splicing event between the exogenous RNA and the target endogenous pre-mRNA. This produces a chimeric mRNA consisting partly of the exons of the latter and partly of the former, encoding the mutation-free sequence. The primary challenge of SMaRT technology is achieving as complete a response as possible, i.e., 100% repair of the endogenous mRNA target. Summary of the Invention

[0008] In one embodiment, the present invention provides a method for producing a nucleotide sequence comprising, in the 5' to 3' direction: a first sequence of nucleic acid that is complementary in its 3' to 5' direction to a region in a pre-mRNA or mRNA target molecule; a second sequence of nucleic acid comprising a heterologous sequence; a third sequence of nucleic acid that is complementary, in the 3' to 5' direction, to a sequence of nucleic acid in said pre-mRNA or mRNA target molecule that is located upstream relative to the hybridization site of said first sequence of nucleic acid; An oligonucleotide comprising: the first and third sequences of the nucleic acid hybridize to the same intron, or to the same exon, or to consecutive introns and exons, or to consecutive exons and introns; An oligonucleotide is provided.

[0009] In one embodiment, the heterologous sequence comprises a sequence that is the same as, and in the same 5' to 3' orientation as, an exon, intron, splice site, 5' UTR, 3' UTR, or a fragment or portion thereof of the wild-type pre-mRNA or mRNA target molecule.

[0010] In one embodiment, the heterologous sequence encodes a portion of an exon.

[0011] In one embodiment, the heterologous sequence is an antisense oligonucleotide.

[0012] In one embodiment, the oligonucleotide is synthesized as a linear single-stranded molecule that forms an open circular structure upon hybridization with a pre-mRNA target molecule.

[0013] In one embodiment, the second sequence of nucleic acid is arranged such that hybridization of the oligonucleotide with the target pre-mRNA or mRNA molecule masks a mutation in the pre-mRNA or mRNA molecule, and the mutated sequence of the pre-mRNA is replaced by the sequence of the wild-type pre-mRNA.

[0014] In one embodiment, hybridization of the oligonucleotide with the target pre-mRNA or mRNA molecule introduces a heterologous motif into the endogenous pre-mRNA or mRNA molecule.

[0015] In one embodiment, said second sequence of nucleic acid binds to a cellular complex.

[0016] In one embodiment, the nucleic acid is a ribonucleotide.

[0017] In one embodiment, the mutation site comprises a single base mutation, a substitution, a deletion mutation, an insertion mutation, or an InDel mutation.

[0018] In one embodiment, the second sequence of nucleic acid comprises (i) a portion of an intron ending in an acceptor site; (ii) a heterologous sequence that is trans-spliced ​​into the target pre-mRNA molecule; (iii) a portion of an intron that includes a donor site, and optionally a PPT sequence that ends proximal to the branch point and the acceptor site sequence in the wild-type exon.

[0019] In one embodiment, the oligonucleotide is selected from the group consisting of Ocirc1 (SEQ ID NO: 12), Ocirc2 (SEQ ID NO: 13), Ocirc3 (SEQ ID NO: 14), Ocirc4 (SEQ ID NO: 15), Ocirc5 (SEQ ID NO: 16), Ocirc6 (SEQ ID NO: 17), Ocirc7 (SEQ ID NO: 18), and Ocirc8 (SEQ ID NO: 19).

[0020] In another aspect, the present invention provides a method for producing a nucleotide sequence comprising, in the 5' to 3' direction: a first sequence of nucleic acid that is complementary in its 3' to 5' direction to a region in a pre-mRNA target molecule; A second sequence: (i) a portion of the intron ending in an acceptor site; (ii) a heterologous sequence that is trans-spliced ​​into the target pre-mRNA molecule; (iii) a portion of an intron comprising an acceptor site and, optionally, a branch point and PPT sequence, the portion of the intron ending proximal to the acceptor site sequence in the wild-type exon; and a second sequence comprising: a third sequence of nucleic acids that hybridizes in a 3' to 5' direction to a sequence of nucleic acids located upstream with respect to the hybridization site of the first sequence of nucleic acids in the pre-mRNA target molecule that precedes the complete or partial acceptor site sequence; The present invention provides an oligonucleotide comprising:

[0021] In one embodiment, the heterologous sequence comprises a sequence that is the same as, and in the same 5' to 3' orientation as, an exon, intron, splice site, or fragment or portion thereof of the wild-type pre-mRNA that terminates in a YAG acceptor site following the second complementary sequence at the 3' end of the oligonucleotide.

[0022] In one embodiment, the heterologous sequence encodes a portion of an exon.

[0023] In another embodiment, the present invention provides a delivery vector or isolated cell comprising an oligonucleotide of the present invention.

[0024] In another aspect, the present invention provides a method for replacing an endogenous nucleic acid sequence, said method comprising contacting an oligonucleotide, or a delivery vector of the present invention, with a target cell containing said endogenous nucleic acid sequence.

[0025] In another aspect, the present invention provides a method for treating Rett Syndrome, said method comprising administering to a patient in need thereof an oligonucleotide, or a delivery vector, or an isolated cell of the present invention.

[0026] In another aspect, the invention provides an oligonucleotide, or a delivery vector, or an isolated cell of the invention for use in a method of treating Rett Syndrome. [Brief explanation of the drawings]

[0027] For a better understanding of the subject matter disclosed herein, and to illustrate how it may be carried out in practice, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which: [Figure 1] Figure 1 is a schematic diagram of a point mutation (C to G) between an exon and an intron in a pre-mRNA transcript, which alters the original splice position and leads to the use of a cryptic splice site. [Figure 2] 2 is a diagram of an open circle folding oligonucleotide according to an embodiment of the present disclosure. The folding oligonucleotide is shown in brief. The folding oligonucleotide hybridizes to and masks the original mutation site. [Figure 3] FIG. 3 is a diagram of an open circle folding oligonucleotide according to an embodiment of the present disclosure, in which the length of the second sequence of nucleic acid exposed upward is the same as the cumulative length of the flap. [Figure 4]FIG. 4 is a diagram of an open circle folding oligonucleotide according to an embodiment of the present disclosure, in which the length of the second sequence of nucleic acid exposed upward is shorter than the cumulative length of the flap, thereby correcting for an insertion mutation. [Figure 5] FIG. 5 is a diagram of an open circle folding oligonucleotide according to an embodiment of the present disclosure, in which the length of the second sequence of nucleic acid exposed upward is longer than the cumulative length of the flap, thereby correcting the deletion mutation. [Figure 6] FIG. 6 is a diagram of an open circle folding oligonucleotide according to an embodiment of the present disclosure, in which the second sequence of nucleic acid exposed upward comprises a heterologous motif, e.g., a sequence motif that functions as a recognition site for an RNA binding protein. [Figure 7] FIG. 7 is a diagram of an open circle folding oligonucleotide according to an embodiment of the present disclosure, in which the G mutation is masked by hybridizing a C. [Figure 8] FIG. 8 is a diagram of an open circle folding oligonucleotide according to an embodiment of the present disclosure, in which an inverted C nucleotide is located at the end of the exposed portion of the open circle folding oligonucleotide sequenced with a mutated G. [Figure 9] FIG. 9 is a diagram of an open circle folding oligonucleotide according to an embodiment of the present disclosure, in which the mutated GAG acceptor site sequence is masked and the correct CAG sequence is exposed at the end of the exposed portion of the open circle folding oligonucleotide. [Figure 10] FIG. 10 is a diagram of a folding oligonucleotide according to an embodiment of the present disclosure, which mediates a trans-splicing event and fixes a mutation at the acceptor site. [Figure 11] FIG. 11 is a diagram of a folding oligonucleotide according to an embodiment of the present disclosure, which mediates a trans-splicing event to fix a mutation in an exon. [Figure 12]FIG. 12 is a diagram of a folding oligonucleotide according to an embodiment of the present disclosure, which mediates a trans-splicing event and fixes a mutation at the acceptor site. [Figure 13] FIG. 13 shows exemplary sequences of folding oligonucleotides of the invention. [Figure 14] FIG. 14 shows the results of the splicing simulation. [Figure 15] Figure 15 is a diagram of the pCMV-Green Renilla Luc plasmid. The black arrow indicates the insertion point of the human β-globin 5'UTR (hBB) in the derived plasmid. The open arrow indicates the Green Renilla Luc gene as a whole, which underwent further changes in the derived plasmid. [Figure 16] FIG. 16 is a diagram of the binding of an ordered RNA oligonucleotide to the 3′ region of the third intron of the human MECP2 gene, forming an Ocirc structure upon binding. [Figure 17] Figure 17 shows the results of electrophoresis of various samples on a polyacrylamide gel: lane 1 - Ocirc template alone incubated at 70°C; lane 2 - Ocirc template alone without incubation at 70°C; lane 3 - Ocirc template + Ocirc1; lane 4 - Ocirc1 without template and without incubation at 70°C; lane 5 - Ocirc1 without template and incubated at 70°C; lane 6 - RNA ladder; lane 7 - Ocirc template alone without incubation at 70°C; lane 8 - Ocirc template + Ocirc4; lane 9 - Ocirc4 without template and without incubation at 70°C; lane 10 - Ocirc4 without template and incubated at 70°C; and lane 11 - RNA ladder. Numbers on the right hand side of the gel indicate the size (number of nucleotides) of the mRNA ladder. [Figure 18]Figure 18 shows the results of electrophoresis of various samples on a polyacrylamide gel: Lane 1 - Ocirc template alone; Lane 2 - Ocirc5; Lane 3 - Ocirc template + Ocirc5; Lane 4 - RNA ladder; Lane 5 - Ocirc6; Lane 6 - Ocirc template + Ocirc6; Lane 7 - Ocirc7; Lane 8 - Ocirc template + Ocirc7; Lane 9 - Ocirc template alone; Lane 10 - Ocirc8; Lane 11 - Ocirc template + Ocirc8; Lane 12 - RNA ladder. Numbers on the right hand side of the gel indicate the size of the mRNA ladder. [Figure 19] Figures 19A and 19B show the results of electrophoresis of various samples on a polyacrylamide gel. Figure 19A: Lane 1—Ocirc template alone; Lane 2—Ocirc1; Lane 3—Ocirc template + Ocirc1; Lane 4—Ocirc template + Ocirc1 + recombinant U2AF2 protein; Lane 5—RNA ladder; Lane 6—Ocirc2; Lane 7—Ocirc template + Ocirc2. Figure 19B: Lane 1—Ocirc template alone; Lane 2—Ocirc3; Lane 3—Ocirc template + Ocirc3; Lane 4—Ocirc template + Ocirc3 + recombinant U2AF2 protein; Lane 5—RNA ladder; Lane 6—Ocirc4; Lane 7—Ocirc template + Ocirc4; Lane 8—Ocirc template + Ocirc4 + recombinant U2AF2 protein; Lane 9—Ocirc control; Lane 10—Ocirc template + Ocirc control. [Figure 20] Figure 20 is a diagram of the binding of pH1-Ocirc-AS to the 3' region of the third intron of the human MECP2 gene. DETAILED DESCRIPTION OF THE INVENTION

[0028] The present disclosure provides novel folding oligonucleotides.

[0029] As used herein, the term "oligonucleotide" refers to a molecule that consists of several repeating units (i.e., monomers) of nucleic acid. In an embodiment, the oligonucleotide is a recombinant nucleic acid. In the context of the present invention, the oligonucleotide is designed to be foldable, and is referred to herein as a folding oligonucleotide.

[0030] As used herein, the term "folding oligonucleotide" refers to a molecule comprising a sequence of nucleotides that is partially complementary to the nucleic acid sequence of a target RNA molecule, such that upon binding to the target RNA, the oligonucleotide folds to expose the heterologous sequence of nucleic acid, thereby forming a chimeric molecule comprising endogenous and heterologous nucleic acid sequences.

[0031] As used herein, the term "heterologous" refers to a nucleic acid sequence that is derived from a non-endogenous source, i.e., outside the cell in which it is expressed. The heterologous sequence may be identical to the wild-type sequence of the target mRNA, thereby correcting a mutation in the endogenous sequence, and / or may contain an exogenous motif, such as a recognition site for an RNA binding protein or other desired sequence that may interact with a cellular complex.

[0032] Thus, the present disclosure provides methods for replacing an original endogenous nucleic acid sequence with a novel sequence using the folding oligonucleotides of the present invention.

[0033] The novel folding oligonucleotides of the present invention may be used for at least the following: (i) Correction / replacement of a genetic mutation in a target RNA. Thus, the folding oligonucleotides of the invention can mask the nucleic acid mutation in the target RNA, exposing a corrected, non-mutated sequence (also referred to herein as a "wild-type" sequence) in place of the mutation, thereby allowing normal expression of the target gene; and / or (ii) Binding of elements to target RNA. Thus, the folding oligonucleotide of the present invention can bind to target nucleic acid-specific motifs that can function as binding sites for various RNA-binding proteins (RBPs), thereby promoting translation, splicing and / or silencing processes. For example, the folding oligonucleotide of the present invention can bind to wild-type sequences in UTRs and attract RBPs.

[0034] As used herein, the term "RNA-binding protein" or "RBP" refers to a protein that contains an RNA-binding domain and binds to single- or double-stranded RNA molecules through specific sequence motifs. Such sequence motifs are typically located in untranslated regions (UTRs) of transcripts, but are also present in introns and exons, e.g., splicing enhancers / suppressors. RBPs contain various structural elements, such as RNA recognition motifs (RRMs), dsRNA-binding domains, zinc fingers, and others.

[0035] RBPs regulate most, if not all, RNA functions in gene expression, including pre-mRNA splicing, mRNA trafficking (localization), RNA processing (e.g., polyadenylation), modification, stabilization, silencing, and regulation of protein synthesis (translation) through the formation of ribosomes, spliceosomes, and RNA-induced silencing complexes (RISCs).

[0036] There are thousands of genes that encode RBPs in humans, and a list of RBPs can be found in the Eukaryotic RBP Database (EuRBPDB). Thus, without limitation, the folding oligonucleotides of the present disclosure may be used to correct genetic mutations by complexing with a pre-mRNA or mRNA that has the mutation so that the cell's translation machinery "leads" the corrected mature mRNA sequence that results in the synthesis of a functional protein.

[0037] The methods and compounds of the invention may be used to correct mutations in one or both of the introns and exons of a pre-mRNA molecule, and may also be used to correct mutations in the exons of a mature mRNA molecule.

[0038] As used herein, the term "mutation" refers to the substitution of one or more nucleotides as well as the insertion or deletion of one or more nucleotides, including Indel mutations. The term also encompasses point mutations in which a single wild-type nucleotide is replaced by another nucleotide (e.g., a C to G mutation as illustrated in Figure 1).

[0039] In one aspect, the present disclosure relates to compositions and methods for correcting a mutant MeCP2 gene in a cell or a subject. The MeCP2 gene stands for methyl-CpG-binding protein 2 gene. The MeCP2 protein plays an important role in neural cells, such as mature neurons (e.g., functions as a transcriptional repressor or transcriptional activator). One example of the MeCP2 gene is represented by GenBank accession number NM_001110792 (MeCP2-e1). Another example of the MeCP2 gene is represented by GenBank accession number NM_001110792 (MeCP2-e2).

[0040] Mutations in MeCP2 are the leading cause of Rett syndrome, a neurodevelopmental disorder. Various types of mutations in the gene can cause disease, including mutations in the splice site between the third intron and the fourth exon, and C to G mutations that abolish the normal splice site, resulting in aberrant splicing events.

[0041] Thus, in one aspect, the present invention provides a method for treating Rett syndrome, said method comprising administering to a patient in need thereof a folding oligonucleotide of the present invention, or a vector comprising a folding oligonucleotide.

[0042] Folding oligonucleotides may be used to correct any mutation in the MeCP2 gene, including but not limited to, a C to G point mutation that causes an aberrant splicing event.

[0043] As used herein, "treatment" of Rett Syndrome means administering to an individual any appropriate dosing regimen, procedure and / or route of administration of a composition comprising the oligonucleotide of the invention for the purpose of achieving a desired clinical / medical endpoint, including, but not limited to, halting or slowing the progression of the disease, or ameliorating or reducing the symptoms of the disease.

[0044] Open circle folding oligonucleotides The present disclosure relates to a method for complementing nucleic acid mutations in a target nucleic acid sequence using folding oligonucleotides and oligonucleotides that can fold into an open circle structure (also referred to herein as Ocirc oligonucleotides).The open circle structure formed by the folding oligonucleotides of the present invention by hybridizing with a target molecule is similar to the structure of circular RNA (circRNA), except that it is open (does not form a closed circle).In some embodiments, the folding oligonucleotides of the present invention are synthesized as circular RNA.However, it should be emphasized that the assumed role of circRNA in reality is different from the proposed use of the folding oligonucleotides of the present invention.

[0045] The folding oligonucleotides of the invention may be synthetically produced and administered to cells using methods known in the art, or may be natural RNA, in which case the oligonucleotide is produced, for example, by a gene / plasmid that is inserted into the cell nucleus.

[0046] In embodiments, the folding oligonucleotide is an antisense molecule (also referred to herein as an "open circle antisense oligonucleotide (ASO)" or OcircASO).

[0047] The folding oligonucleotide is produced as a linear single-stranded molecule that folds into an open circle structure upon interaction with the target sequence.

[0048] The folding oligonucleotides can be composed of ribonucleotides, deoxyribonucleotides, nucleic acid analogs, or any combination thereof.

[0049] In one embodiment, the folding oligonucleotide comprises three parts in the 5' to 3' direction: a first sequence of nucleic acid that is complementary in its 3' to 5' direction to a pre-mRNA or mRNA target molecule; a heterologous sequence, i.e., a second sequence of nucleic acid comprising a sequence that mimics and is in the same 5' to 3' orientation as an exon, intron, splice site, 5' UTR, 3' UTR, or fragment thereof, of said wild-type pre-mRNA or mRNA target molecule; a third sequence of nucleic acid that is complementary, in the 3' to 5' direction, to a sequence of nucleic acid in said pre-mRNA or mRNA target molecule that is located upstream relative to the hybridization site of said first sequence of nucleic acid; Includes.

[0050] As used herein, the term "from 5' to 3'" refers to the direction or orientation of the nucleotides in a single strand of DNA or RNA. 5' and 3' specifically refer to the fifth and third carbon atoms in the deoxyribose / ribose that form the 5' and 3' ends.

[0051] The first and third sequences of nucleic acid that hybridize to the target mRNA or pre-mRNA are also referred to herein as "binding sites" or "flaps."

[0052] According to the present invention, the first and third sequences of nucleic acid do not hybridize to consecutive introns, i.e., in distinction to trans-splicing methods known in the art, the first and third sequences of nucleic acid may hybridize to the same intron, the same exon, or consecutive introns and exons or exons and introns.

[0053] In one embodiment, the first and third nucleic acid sequences are designed and synthesized so that they are complementary and therefore hybridize with a stretch of contiguous nucleic acid in a target molecule, i.e., the 3' to 5' sequence of the first and third sequences is complementary to the 5' to 3' contiguous sequence of the target molecule.

[0054] In another embodiment, the first and third nucleic acid sequences are designed and synthesized to be complementary and therefore hybridize to stretches of nucleic acid in the target molecule that are not consecutive or contiguous, i.e., the hybridization sites of the first and third nucleic acid sequences on the target pre-mRNA or RNA molecule are separated by a stretch of nucleic acid.

[0055] Because the first and third sequences are complementary (either contiguously or separated by a stretch of nucleic acid) to a stretch of nucleic acid in the target molecule in an upstream-to-downstream direction, hybridization of these sequences with the target molecule causes the oligonucleotide of the present invention to fold back on itself at both the 5' and 3' ends. Steric interactions cause the structure of the folded oligonucleotide to spatially expand into an open-circle structure. In this open-circle structure, the first and third sequences of nucleic acid face toward and complement the target sequence, while the second sequence of nucleic acid faces upward, away from the target. This second sequence of nucleic acid may correct a mutation by presenting a sequence identical to the wild-type sequence, or alternatively or additionally, it may contain a heterologous sequence different from the sequence of the wild-type pre-mRNA or RNA target molecule, thereby introducing a heterologous element or motif into the endogenous molecule, for example, a sequence motif that functions as a recognition site for an RNA-binding protein. The second sequence of nucleic acid may generate a tertiary structure based on the sequence of nucleotides.

[0056] One embodiment of a folding oligonucleotide of the present invention is illustrated in Figure 2, which shows an open circle folding oligonucleotide in a condensed form.

[0057] According to this embodiment of the invention, the folding oligonucleotide hybridizes with a sequence of the downstream cryptic region and comprises a first sequence of a nucleic acid that is part of the PPT; a second sequence of nucleic acid that is oriented upward and has a sequence that mimics the PPT sequence of the wild-type pre-mRNA and is in the same 5' to 3' orientation; and A third sequence of nucleic acid that hybridizes with and masks the upstream cryptic region (see annotation of the upstream cryptic region in Figure 1).

[0058] In embodiments, at least one of the sequences of nucleic acid that is complementary to the target pre-mRNA or mRNA is of a length that determines high specificity and strong hybridization capacity (a non-limiting example is a sequence of about 15 nucleotides), and the second sequence of nucleic acid that is complementary to the target pre-mRNA or mRNA can be either a shorter, less specific sequence or a length that also determines high specificity and strong hybridization capacity.

[0059] In one embodiment, the length of the second sequence of the upwardly exposed nucleic acid is the same as the cumulative length of the flap, and the heterologous sequence is the same as the wild-type sequence, thereby correcting the mutation. This embodiment is illustrated in Figure 3, which shows the correction of a point mutation as an example.

[0060] In another embodiment, the folding oligonucleotide of the present invention is used to correct an insertion mutation. In such a case, the length of the second sequence of the upwardly exposed nucleic acid is shorter than the cumulative length of the flap, and the heterologous sequence is the same as the wild-type sequence, thereby correcting the mutation. This embodiment is illustrated in Figure 4.

[0061] In another embodiment, the folding oligonucleotides of the present invention are used to correct a deletion mutation. In such cases, the length of the second sequence of the upwardly exposed nucleic acid is longer than the cumulative length of the flap, and the heterologous sequence is the same as the wild-type sequence, thereby correcting the mutation. This embodiment is illustrated in Figure 5.

[0062] In another embodiment, the folding oligonucleotides of the present invention are used to introduce heterologous motifs into target mRNA or pre-mRNA molecules, together with or instead of amending the mutation. In such cases, the length of the second sequence of the exposed nucleic acid can be longer or shorter than the cumulative length of the flap, and the heterologous sequence contains a sequence motif that functions as a recognition site for an RNA-binding factor, such as an RNA-binding protein, which can function as a recognition site for various enzymes or ribozymes that can affect the translation process. This embodiment is illustrated in Figure 6.

[0063] An open circle folding oligonucleotide represents an unclosed circular structure, however, in one embodiment, the folding oligonucleotide is chemically closed to create a fully circular molecule.

[0064] In one embodiment, the folding oligonucleotide is about 40 to about 200 bases in length.

[0065] 7-9 show schematic diagrams of various embodiments of open circle folding oligonucleotides of the invention. In these particular exemplary embodiments, the folding oligonucleotide corrects the C to G mutation by replacing G back with a wild-type C. The figures show, in a schematic fashion, the spatial circular structure formed by the folding oligonucleotide.

[0066] FIG. 7 is a schematic diagram of one embodiment of the present invention, showing an open circle folding oligonucleotide in which the G mutation is masked by a hybridizing C.

[0067] A C is added to the end of the exposed portion of the Ocirc folding oligonucleotide, preceding the AG of the original acceptor site.

[0068] FIG. 8 is a schematic diagram of another embodiment of the invention showing an open circle folding oligonucleotide in which the G mutation is retained but an inverted C nucleotide sequenced with the mutated G is located at the end of the exposed portion of the Ocirc folding oligonucleotide.

[0069] Inverted base oligonucleotides are 5'-5' or 3'-3' linked or a combination of these in the same oligo.

[0070] FIG. 9 is a schematic diagram of another embodiment of the invention, showing an open circle folding oligonucleotide in which the mutant GAG acceptor site sequence is masked.

[0071] The correct CAG sequence is located at the end of the exposed part of the Ocirc folding oligonucleotide.

[0072] Example 1 below provides the sequences of three representative folding oligonucleotide molecules (1, 2, and 3) that correspond respectively to the folding oligonucleotides depicted diagrammatically in Figures 7-9.

[0073] The alternative splice acceptor site may be designed using a dedicated tool, such as NetGene2, as shown in Example 1 below, and the NetGene2 simulation results are presented to determine the reliability of potential splice acceptor sites. In one embodiment, the alternative splice acceptor site is represented by SEQ ID NO: 31.

[0074] The sequences are designed to achieve optimal results while attempting to minimize "stacking" of the folded oligonucleotides with each other, or undesired hybridization of moieties in the folded oligonucleotide molecules.

[0075] Various solutions can be used to reduce stacking, all of which involve introducing nucleic acid changes into the sequence to prevent further binding of folding oligonucleotides to each other. For example, one solution may involve the introduction of small changes, i.e., one or more nucleic acid substitutions, so that the selected PPT exhibits a slightly different PPT from the natural wild-type sequence, while still maintaining the strong PPT characteristics. When the mutation is in an exon, another solution would be to introduce nucleic acid substitutions that change the nucleic acid sequence but still maintain the codon reading. This solution is based on codon degeneracy, i.e., different sets of codons can code for the same amino acid. This allows the nucleic acid sequence to be changed, but the correct amino acid sequence to be maintained.

[0076] In another embodiment, the open circle folding oligonucleotide may further comprise a binding site for an RNA binding protein.

[0077] In an embodiment of the present invention, the folding oligonucleotide may act by a trans-splicing mechanism.

[0078] The Ocirc molecules of the present invention may contain one or more modified nucleotides to increase molecular stability. Modified nucleotides include, but are not limited to, 2'-O-methyl modified nucleotides, LNA (locked nucleic acid) modified nucleotides, or 2'MOE (2'-O-methoxyethyl / phosphorothioate) modified nucleotides. One, two, three, four, five, or six nucleotides can be incorporated at either end of the Ocirc arm. Furthermore, the entire arm can be composed of modified nucleotides, and nucleotides selected from the remainder of the Ocirc can also be modified nucleotides.

[0079] Folding oligonucleotides for trans-splicing In known methods of trans-splicing, antisense oligomers (also called antisense oligonucleotides) (ASOs) must encompass an entire exon, usually several hundred nucleotides in length, to achieve a trans-splicing event, because the trans-splicing event relies on natural splicing cues located at intron-exon junctions.

[0080] In contrast, folding oligonucleotides according to the present invention may be shorter and do not necessarily contain the complete exon sequence, and in certain embodiments may be about 100-200 nucleotides in length.

[0081] Trans-splicing according to the present invention will not occur at the original true splice site, but rather will use "pseudo" acceptor and donor sequences present within the relevant exon.

[0082] Thus, the folding oligonucleotide of the invention contains an alternative splice acceptor site followed by a sequence identical to the target exon (also called an "artificial exon" or "synthetic exon"). If the mutation is in an intron, the folding oligonucleotide of the invention will mask the mature region, generate a new splice point, and further contain a sequence identical to the "null" sequence of the wild-type target exon.

[0083] Figure 10 shows a schematic diagram of an embodiment of the invention. Thus, if a mutation is in an intron (e.g., in an acceptor site), a trans-splicing event will replace the mutated sequence with an artificial exon having a wild-type sequence. According to this embodiment, the folding oligonucleotide comprises: a first sequence that hybridizes with the pre-mRNA and, if necessary, masks possible cryptic sites; a portion of the artificial intron that includes the acceptor site; an artificial exon that replaces a portion of the original exon; a portion of the artificial intron whose acceptor site is derived from the original exon; and another sequence that hybridizes with the pre-mRNA.

[0084] If the mutation is in an exon, a trans-splicing event will replace the mutated sequence with an artificial exon having the wild-type sequence. According to this embodiment, both the donor and acceptor sites are derived from the nucleic acid sequence of the original mutated exon. A schematic diagram of this embodiment is shown in Figure 11.

[0085] To illustrate a trans-splicing event according to the present invention, Figure 1 shows a schematic diagram of an exemplary intron mutation showing a C to G mutation in a pre-mRNA transcript. This mutation causes activation of a cryptic splice site, two nucleotides upstream of the correct true splice site. Activation of the cryptic splice site causes a frameshift, resulting in a mutant mRNA transcript.

[0086] As shown in Figure 10, the folding oligonucleotide of the present invention contains an alternative splice acceptor site in place of the mutant acceptor site (e.g., the GAG ​​cryptic site shown in Figure 1) followed by an artificial exon identical to the relevant portion of the targeted exon.

[0087] The folding oligonucleotide further contains an artificial intron sequence ending in a polypyrimidine tract (PPT) adjacent to a YAG acceptor site (a conserved 3' splice site essential for pre-mRNA splicing) that is part of the original exon sequence.

[0088] Thus, the present invention provides, in the 5' to 3' direction: a first complementary sequence of about 10 to 15 bases (e.g., about 12 bases) in length that is complementary to and can hybridize with the mutation region, the mutation region including the mutation site, a downstream potential site, and an upstream potential site; Selective trans-splicing alternative acceptor sites containing strong PPTs; a sequence identical to the original exon sequence between the end of the first complementary sequence at the 5' end of the folding oligonucleotide and three nucleotides (the YAG acceptor site) after the second complementary sequence (at the 3' end of the folding oligonucleotide); an artificial intron containing a donor site, branch point, and PPT as the proximal end of the YAG sequence, which is part of the original exon; a second complementary sequence of about 10-15 bases (e.g., about 12 bases) in length that is complementary to and capable of hybridizing with the sequence preceding the YAG acceptor site; The present invention provides a folding oligonucleotide comprising:

[0089] As used herein, the term "potent PPT" refers to a polypyrimidine tract (PPT) that can strongly attract (e.g., have a competitive advantage in attracting) spliceosomes that perform splicing at splice sites adjacent to the PPT. PPTs are important cis-acting sequence elements that direct intron removal in pre-mRNA splicing. There appears to be great flexibility in the specific sequence of PPTs, with each having different levels of functional competitive efficiency in directing spliceosomes to splice points. There are known methods for preparing potent PPTs; for example, a pyrimidine tract containing 11 consecutive uridines has been found to be a very potent pyrimidine tract (Coolidge et al., (1997) Nucleic Acid Res. 25(4):888-896).

[0090] In embodiments, at least one of the sequences of nucleic acid that is complementary to the target pre-mRNA or mRNA is of a length that determines high specificity and strong hybridization capacity (a non-limiting example is a sequence of about 15 nucleotides), and the second sequence of nucleic acid that is complementary to the target pre-mRNA or mRNA can be a shorter, less specific sequence, or can be of a length that also determines high specificity and strong hybridization capacity. This embodiment is illustrated diagrammatically in Figure 12, which shows the construction of a mutation in the acceptor site.

[0091] In general, the GURAGU donor site can also be placed in an exon and continue into the first artificial intron inside the folding oligonucleotide. Since the chance of finding a GU or GUR sequence in an exon is much higher than in the complete donor sequence, the required sequence can be split between the exon and the folding oligonucleotide. This applies to the acceptor site (following the second artificial intron), whose complete sequence is YNCAG (R: A or G, Y: C or T, N: any nucleotide). The folding oligonucleotide retains the original sequence encoded by the endogenous gene, replacing the 5' and / or 3' splice sites with a strength that must be equal to or even stronger than that of the pre-mRNA.

[0092] The folding oligonucleotide may be introduced into cells by any method known in the art, including, but not limited to, transformation of a plasmid carrying a gene expressing the folding oligonucleotide, use of a recombinant viral vector expressing the folding oligonucleotide (e.g., adeno-associated virus (AAV)), lipid encapsulation, and the like. If correction of mRNA or pre-mRNA is required in the brain, a specific delivery vehicle is selected to introduce the folding oligonucleotide into the brain. Such a vehicle is selected based on its ability to cross the blood-brain barrier (BBB) ​​and is injected via the spinal cord.

[0093] A recombinant AAV (rAAV) according to the present invention typically consists of at least a transgene (i.e., a folding oligonucleotide of the present invention) operably linked to regulatory sequences that allow its expression in the cells of the target tissue, and 5' and 3' AAV inverted terminal repeats.

[0094] As used herein, the term "about" indicates a value that may deviate by up to 1%, more particularly 5%, more particularly 10%, more particularly 15%, and in some cases up to 20% above or below the stated value, and the deviation range includes integer values, and, where applicable, non-integer values ​​as well, constituting a continuous range. As disclosed and described, the present invention is not limited to the specific examples, and it should be understood that the method steps and compositions disclosed herein, such as method steps and compositions, may vary somewhat. It should also be understood that the terminology used herein is used for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention is limited only by the appended claims and equivalents thereof.

[0095] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0096] Throughout this specification and the examples and claims that follow, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising" are understood to imply the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of other integers or steps or groups of integers or steps. [Example]

[0097] Example 1: Simulation of a representative folding oligonucleotide Representative exemplary folding oligonucleotide molecules designed, Ocirc1, Ocirc2, and Ocirc3 (corresponding to SEQ ID NOS: 12-14, respectively), were constructed as shown in Figure 13 (options 1, 2, and 3). These oligonucleotide molecules correspond to the folding oligonucleotides represented schematically in Figures 7-9, respectively.

[0098] The "arms" of these folding oligonucleotide molecules were designed to combine sequences bridging the end of the third intron and the start of the fourth exon of MECP2.

[0099] The folding oligonucleotide contains a PPT portion, as shown in Figures 7 to 9. According to these options, the original PPT sequence in intron 4 is replaced by a new sequence that is part of the Ocirc molecule.

[0100] To design the optimal PPT portion, splicing simulations were performed using Netgene2, a software tool that predicts splicing points based on given sequences of introns and exons.

[0101] To search for sequences containing potential splice sites, the following sequence (referred to as SEQ ID NO: 27) from Homo sapiens chromosome X, GRCh38.p13,NC_000023.11:c154031955-154030936 was used for the simulations:

[0102] The following sequences (which are fragments of the above sequence) were selected by the simulation tool as possible splice sites: AATGTTCTAG^ATGGTGACTC (SEQ ID NO: 28) GGTGACTCAG^GCCCAGGCAC (SEQ ID NO: 29) TCAGGCCCAG^GCACCAACCA (SEQ ID NO: 30) GTCCCCGCAG^TCCCCAGGGA (SEQ ID NO: 31) CAGTCCCCAG^GGAAAAGCCT (SEQ ID NO: 32) CAGGGAAAAG^CCTTTCGCTC (SEQ ID NO: 33) CGCTCTAAAG^TGGAGTTGAT (SEQ ID NO: 34) TAAAGTGGAG^TTGATTGCGT (SEQ ID NO: 35) ATCCACCCAG^GTCATGGTGA (SEQ ID NO: 36) GCCCCGGCAG^GAAGCGAAAA (SEQ ID NO: 37) CGGCAGGAAG^CGAAAAGCTG (SEQ ID NO: 38) AAGCGAAAAG^CTGAGGCCGA (SEQ ID NO: 39)

[0103] The symbol ^ represents the intersection between an intron (left hand side) and an exon (right hand side).

[0104] The results of the analysis are shown in Figure 14. The confidence score is a number that typically ranges from 0 to 1, with higher values ​​indicating a higher level of confidence in the prediction; i.e., a higher confidence score suggests that the predicted splice site is more likely to be accurate. "Phase" can have one of three values: 0, 1, or 2.

[0105] Phase 0 splice sites indicate that the predicted splice site corresponds to the canonical phase of splicing. In other words, the intron-exon boundary is correctly aligned with the reading frame, ensuring that the protein-coding sequence is not interrupted during translation. Phase 0 splice sites are the most common and preferred phase in many genes.

[0106] Phase 1 splice sites suggest that the intron-exon boundary is shifted by one nucleotide compared to the canonical phase, which can result in a slight disruption of the reading frame and a different amino acid sequence in the protein product.

[0107] Phase 2 splice sites indicate that the intron-exon boundary is shifted by two nucleotides relative to the canonical phase, which can result in a more significant disruption of the reading frame, resulting in a different amino acid sequence and often the introduction of a premature stop codon that can affect protein functionality.

[0108] Understanding the phase of predicted splice sites is important for accurate gene annotation and prediction of the functional consequences of splice site variants. Researchers and biologists can use the information to assess how a given mutation or alternative splice site affects the final protein product and its function.

[0109] Based on the confidence value, the highlighted sequence in Figure 14 (SEQ ID NO: 31) was selected as having the highest probability of being a splice site (indicated by the letter H).

[0110] Example 2: Preparation of a template plasmid that serves as a target for Ocirc oligonucleotides All plasmids were constructed based on the same original plasmid: pCMV-Green Renilla Luc. This plasmid was purchased from ThermoFisher scientific, catalog number: 16153. A map of this plasmid is shown in Figure 15.

[0111] The following features are present in the plasmid based on that nucleotide sequence, referred to herein as SEQ ID NO: 1: Cytomegalovirus (CMV) promoter: 8-635 Green Renilla luciferase gene: 646-1581 BGH poly(A) signal: 1590-1715 SV40 origin / promoter: 1716-2280 Puromycin resistance gene: 2281-2880 SV40 poly(A) signal: 3042-3075 β-lactamase (Amp R ) Gene: 3184-4044 pUC origin of replication (pUC Ori):4223-5027 Transcription terminator (Ter): 5028-5635 Lac Operator 1 (Lac O1): 5636-5656 Transcription pause site (TPS): 5789-5860

[0112] The sequence of the plasmid (referred to as SEQ ID NO:1) is as follows: CTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTCTGTGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCCTGGGCGGTTCTGATAACGAGTAATCGTTAATCCGCAAATAACGTAAAAACCCGCTTCGGCGGGTTTTTTTATGGGGGGAGTTTAGGGAAAGAGCATTTGTCAGAAT ATTTAAGGGCGCCTGTCACTTTGCTTGATATATGAGAATTTAACCTTATAAATGAGAAAAAAGCAACGCACTTTAAATAAGATACGTTGCTTTTTCGATTGATGAACACCTATAATTAAACTATTCATCTATTATTTATGATTTTTTGTATATACAATATTTCTAGTTTGTTAAAGAGAATT AAGAAAATAAATCTCGAAAATAATAAAGGGAAAATCAGTTTTTGATATCAAAATTATACATGTCAACGATAATACAAAATATAATACAAACTATAAGATGTTATCAGTATTTATTATCATTTAGAATAAATTTTGTGTCGCCCTTAATTGTGAGCGGATAACAATTACGAGCTTCATGCACAGTG GCGTTGACATTGATTATTGACTAGCATGTTCTTTCCTGCGTTATCCCTGATTCTGTGGATAACCGTATTACCGCCATGCATTAGTTATTAATAACATACGCTCTCCATCAAAACAAAACGAAACAAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCT

[0113] Several derivative plasmids were prepared from a base plasmid (GeneScript, Singapore).

[0114] All derived plasmids had the following region of the human β-globin 5′UTR (hBB) inserted between the CMV promoter and the Green Renilla Luc gene (designated SEQ ID NO: 2): As can be seen in Figure 15, the black arrow indicates the insertion point.

[0115] SEQ ID NO:2: 5'ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC-3'

[0116] In addition, an intron sequence was inserted into the plasmid in the Green Renilla luciferase (Luc) gene as defined below.

[0117] Plasmid pCMV-RLuc-Int_WT An intron was inserted into the Green Renilla Luc gene at the following position: GATCTGAT AG -"Intron"- GT ATGGGCAA

[0118] This insertion point was chosen because it contains sequences characterized by an exon end (AG) and an exon start (GT), which are shown in bold and underlined in the sequence above.

[0119] The following "intron" sequence (designated SEQ ID NO:3) was inserted at the position indicated above: GTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTCTGA GAGAGGCCTGGGGGGGTCAGCGGCAGGCAGACGAGTGAGTGGCTTTGGTGACAGGTCCTCAGGGGCAGCCAGGCAGTGTGACTCTCGTTCAATAGTAACGTTTGTCAGAGCGTTGTCACCACCATCCGCTCTGCCCTATCTCTGACATTGCTATGGAGAGCCTCTAATTGTTCCTTGTGTCTTTCTGTTTGTCCCACAG

[0120] The first part of the inserted intron (underlined) consists of 84 nucleotides from the 5' end of the first intron of the human β-globin gene (sequence from the human genome shown on the UCSC genome website).

[0121] The second part of the intron (bold) consists of 200 nucleotides from the 3' region of the third intron of the human MECP2 gene.

[0122] After insertion, the derived plasmid, called "plasmid pCMV-RLuc-Int_WT", had the following sequence (called SEQ ID NO: 4):

[0123] Plasmid pCMV-RLuc-Int_Mut Another derivative plasmid was constructed that carried a mutation in the splice acceptor site similar to the mutation in the MECP2 gene that causes Rett syndrome in patients with the disease. The mutation (C to G substitution) located two nucleotides before the end of the sequence below is shown in italics and underlined.

[0124] In this case, the following mutated "intron" sequence (designated SEQ ID NO:5) was inserted at the position shown above: GTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTCTGA GAGAGGCCTGGGGGGGTCAGCGGCAGGCAGACGAGTGAGTGGCTTTGGTGACAGGTCCTCAGGGGCAGCCAGGCAGTGTGACTCTCGTTCAATAGTAACGTTTGTCAGAGCGTTGTCACCACCATCCGCTCTGCCCTATCTCTGACATTGCTATGGAGAGCCTCTAATTGTTCCTTGTGTCTTTCTGTTTGTCCCCA G AG

[0125] After insertion, the derived plasmid, called "plasmid pCMV-RLuc-Int_Mut", had the following sequence (called SEQ ID NO: 6):

[0126] Plasmid pCMV-RLuc-AltInt_WT Another derivative plasmid was made by inserting the same WT intron as above (SEQ ID NO:3) at a different position within the plasmid to more closely mimic the start of exon 4 of the MECP2 gene. The insertion point is shown in bold in SEQ ID NO:7, shown below: GAGCGGCA AG --Intron-- TCC GGCAACG

[0127] After insertion, the derived plasmid, called "plasmid pCMV-RLuc-AltInt_WT", had the following sequence (called SEQ ID NO: 7): TCC

[0128] Plasmid pCMV-RLuc-AltInt_Mut This derivative plasmid is like the alternative plasmid above, but contains a mutated intron insert (SEQ ID NO: 5) in place of the WT intron: in this plasmid, the intron is the same as that in pCMV-RLuc-Int_Mut, containing a mutated splice acceptor site, but inserted at the alternative site.

[0129] After insertion, the derived plasmid, called "plasmid pCMV-RLuc-AltInt_Mut", had the following sequence (called SEQ ID NO: 8):

[0130] Plasmid pCMV-RLuc-AltInt_WTBPMut An additional derivative plasmid was then prepared which contained the WT intron sequence in which the splice branchpoint signal sequence had been mutated to a sequence that was not recognized as a branchpoint (shown in bold and underlined). This intron sequence is designated SEQ ID NO:9. GTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGAGAGAGGCCTGGGGGGGTCAGCGGCAGGCAGACGAGTGAG TGGCTTTGGTGACAGGTCCTCAGGGGCAGCCAGGCAGTGTGACTCTCGTTCAATAGTAACGTTTGTCAGAGCGTTGTCACCACCATCCGCTCTGCCCTATCTCTGACATTGCTATGGAGAGCCT GCCTG TGTTCCTTGTGTCTTTCTGTTTGTCCCCACAG

[0131] After insertion, the derived plasmid, called "plasmid pCMV-RLuc-AltInt_WTBPMut", had the following sequence (called SEQ ID NO: 10):

[0132] Example 3: Production of OcircRNA oligonucleotides All RNA oligonucleotides were synthesized by IDT. A standard RNA oligonucleotide was designed to match a specific sequence in the 3' region of the third intron of human MECP2. Figure 16 is a schematic diagram showing the structure of the RNA oligonucleotide after binding. The start of the fourth exon of MECP2 is shown. The splice acceptor is shown in bold (GAG), and the mutant nucleotide (G instead of C) is italicized. The Ocirc sequence is shown at the top: the highlighted sequence is the 5' antisense arm, and the unhighlighted sequence is the 3' antisense arm. The dashed line represents the RNA sequence found between the arms of the Ocirc molecule. Overall, any optimal sequence may be used. In this particular example, it contains a PPT sequence and is designed to bind to spliceosomal proteins. The black line indicates the contact region of the two arms of Ocirc on the MECP2 sequence template. The underlined region is the PPT sequence of the human MECP2 gene. The Ocirc sequence binds to this by base pairing.

[0133] The following oligonucleotides were used (uracil nucleotides (U) were replaced by thymine nucleotides (T) in the sequence listing): Ocirc-temp (referred to as SEQ ID NO: 11): 5'-AGAGCCUCUAAUUGUUCCUUGUGUCUUUCUGUUUGUCCCCA GAG UCCCCAUGGAAAAGCC 3' Ocirc-1 (referred to as SEQ ID NO: 12): 5'-ACAGAAAGACGCCCCCUUAUUCGUCCCCGCCUGGGGACAA-3' Ocirc-2 (referred to as SEQ ID NO: 13): 5'-ACAGAAAGACCGCCCCCUUAUUCGUCCCCG[3'-3'-C-5'-5']UGGGGACAA-3' Ocirc-3 (referred to as SEQ ID NO: 14): 5'-AAACAGAAAGCCCCCUUAUUCGUCCCCCAGCUCUGGGGAC-3' Ocirc-4 (referred to as SEQ ID NO: 15): 5'-AGAAAGACACAAUCUCUGCCUAGCCCCCUUAUUCGUCCCCGCCUGGGGACAAAC-3' Ocirc-5 (referred to as SEQ ID NO: 16): 5'-AGAAAGACACAAUCUCUGCCUACGCCCCCUUAUUCGUCCCCG[3'-3'-C-5'-5']UGGGGACAAAC-3' Ocirc-6 (referred to as SEQ ID NO: 17): 5'-ACAGAAAGACACUCUCUGCCUACCCCCUUAUUCGUCCCCCAGCUCUGGGGACAA-3' Ocirc-7 (referred to as SEQ ID NO: 18): 5'-GACAAACAGAAAGACGCCCCCUUAUUCGUCCCCGCCUGGG-3' Ocirc-8 (referred to as SEQ ID NO: 19): 5'-GACAAACAGAAAGACACAAUCUCUGCCUAGCCCCCUUAUUCGUCCCCGCCUGGG-3' Ocirc-Cont (referred to as SEQ ID NO: 20): 5'-GCUCGUCACAGGCCCCCUUAUUCGUCCCCGCUAGCAGCGAU-3'

[0134] Example 4: In-vitro binding of Ocirc oligonucleotides to RNA templates To test whether Ocirc RNA oligonucleotides can bind to the template (Ocirc-Temp), Ocirc oligonucleotides were each mixed with the template using the concentrations listed in Table 1 below.

[0135] TIFF2025530419000001.tif59170

[0136] The stock concentration of each test oligonucleotide was 20 μM, and the final concentration was 10 μM. The final reaction volume was 40 μl, consisting of 20 μl of oligonucleotide plus 20 μl of hybridization buffer (2 mM MgCl in phosphate-buffered saline (PBS)) (PBS is 137 mM NaCl, 2.7 mM KCl, 10 mM NaHPO, and 1.8 mM KHPO) for samples 1–3, and 20 μl of each oligonucleotide for samples 4 and 5.

[0137] The samples were incubated at 70°C for 5 minutes, cooled slowly (over 30 minutes) to room temperature, and placed on ice. The samples were then prepared for electrophoresis on an acrylamide gel by adding running buffer (50 μl SBx2 - 0.025 M Tris, 0.192 M glycine pH: 8.3). For each sample, the amount loaded was 0.15 μg / lane in a volume of 20 μl / lane. As detailed in Table 2 below, the loading sample concentration was 0.008 μg / μl, and the final volume was 100 μl.

[0138] TIFF2025530419000002.tif54170

[0139] Samples were loaded onto an acrylamide gel and separated by electrophoresis under standard conditions.

[0140] As shown in Figure 17, mixing template RNA (Ocirc-temp) with Ocirc1 (see lane 3—Ocirc template + Ocirc1) or Ocirc4 (see lane 8—Ocirc template + Ocirc4) resulted in slower-migrating material, indicating binding of Ocirc1 and Ocirc4 to the template RNA. See also Figures 19A and 19B.

[0141] Similar experiments were carried out using Ocirc 5, 6, 7 and 8 under the same conditions, as detailed in Table 3 below.

[0142] TIFF2025530419000003.tif91170

[0143] As shown in Figure 18, mixing of template RNA (Ocirc-temp) with each of Ocirc5 (see lane 3—Ocirc template + Ocirc5), Ocirc6 (see lane 6—Ocirc template + Ocirc6), Ocirc7 (see lane 8—Ocirc template + Ocirc7), and Ocirc8 (see lane 11—Ocirc template + Ocirc8) resulted in slower migrating material, indicating binding of Ocirc5, 6, 7, and 8 template RNAs.

[0144] Similar experiments were carried out using Ocirc2 and Ocirc3 under the same conditions, as detailed in Table 4 below.

[0145] TIFF2025530419000004.tif64170

[0146] U2AF2 is a protein that binds to PPT and splice acceptor sequences, contributing to splicing events. To test the possible binding of U2AF2 protein to the Ocirc+ template RNA complex, Ocirc+ template RNA oligonucleotides were first hybridized as described above. They were then mixed with U2AF2 protein (ACRIS) in binding buffer (final concentrations: HEPES-KOH (pH 7.6) 20 mM, KCl 100 mM, EDTA 0.2 mM, DTT 0.5 mM). The sample was incubated at 4°C for 1 hour. Preparation for gel loading was as described above. The results were inconclusive.

[0147] As found for other Ocirc molecules, mixing Ocirc2 (see Figure 19A lane 7—Ocirc template + Ocirc2) or Ocirc3 (see Figure 19B lane 3—Ocirc template + Ocirc3) with template RNA results in a slower-migrating material, indicating binding to the template RNA. Control Ocirc RNA oligonucleotides containing arms that do not match the template RNA do not show binding to the template RNA.

[0148] Example 5: Testing of Ocirc RNA oligonucleotides in cells The set of plasmids described in Example 2 above, namely: pCMV-Rluc-Int-WT, pCMV-Rluc-Int-Mut, pCMV-Rluc-AltInt-WT, pCMV-Rluc-AltInt-Mut, were used in the following examples (as used herein, Rluc stands for Renilla luciferase).

[0149] As mentioned above, all plasmids contain the 3' region of the third intron of the MECP2 gene. In the pCMV-Rluc-Int-WT and pCMV-Rluc-Int-Mut sets, the intron was inserted between the AG-GT sequences of the Renilla luciferase gene, so that the intron starts after AG and ends before GT. This insertion site is very convenient for experimental purposes.

[0150] As an alternative to more closely represent the MECP2 gene in vivo, in the pCMV-Rluc-AltInt-WT and pCMV-Rluc-AltInt-Mut sets, an intron was inserted between the AG-TCC nucleotides of the Renilla luciferase gene. TCC forms the start of the fourth exon of the MECP2 gene, a noncanonical and rare exon start site.

[0151] Experimental Protocol: The cell line HEK293 (human embryonic kidney 293) was used in all experiments. 24 wells were seeded with 100,000 cells per well.

[0152] Lipofectamine MessengerMAX reagent (Invitrogen) was used for transfection, as it is suitable for both DNA and RNA. Experiments were set up to determine that 0.75 μl Lipofectamine and a plasmid concentration of 0.5 μg / well gave the best results.

[0153] The entire protocol was carried out according to the manufacturer's instructions.

[0154] Cells were harvested 48 hours after transfection with either the plasmid alone or the plasmid plus oligonucleotide (Ocirc). Cells were lysed in the buffer supplemented with the Renilla luciferase assay kit (Renilla-Glo Luciferase Assay System, Promega), and Renilla luciferase activity was determined according to the manufacturer's protocol. Readings were performed in a luminometer using a 96-well plate.

[0155] Table 5 shows the results obtained for the two plasmid sets.

[0156] TIFF2025530419000005.tif65170

[0157] Although both pCMV-Rluc-Int-WT and pCMV-Rluc-AltInt-WT gave similar results (and approximately 20% higher than the starting plasmid pCMV-Green Renilla Luc), the activity of the pCMV-Rluc-Int-Mut plasmid was only 10-fold lower than that of pCMV-Rluc-Int-WT. In comparison, the activity of the pCMV-Rluc-AltInt-Mut plasmid was 100-fold lower than that of the WT plasmid. Therefore, the pCMV-Rluc-AltInt-WT and pCMV-Rluc-AltInt-Mut sets were selected as target model systems for further experiments. This setup can serve to test the ability of various Ocirc RNA oligonucleotides in restoring normal splicing of the MECP2 third intron, whereby restoration of normal splicing of the mutant third MECP2 intron by Ocirc oligonucleotides would be reflected by an increase in Renilla luciferase (Rluc) activity of the pCMV-Rluc-AltInt-Mut plasmid.

[0158] Example 6: Activity of Ocirc RNA antisense oligonucleotides in cells To test the activity of Ocirc RNA antisense oligonucleotides, HEK293 cells were grown in 96-well plates at 20,000 cells / well.

[0159] Plasmids were transfected as described above using 0.1 μg plasmid / well. The template plasmid was pCMV-RLuc-AltInt-WT. Cells were cotransfected with the template plasmid and either the pH1-Ocirc-AS (antisense) or pH1-Ocirc-control additional plasmid.

[0160] The pH1-Ocirc-AS plasmid was constructed by ligating an Ocirc RNA oligonucleotide, herein referred to as Ocirc-AS (SEQ ID NO: 21), with the H1 promoter.

[0161] Ocirc-AS has the following sequence (referred to as SEQ ID NO: 21): 5'ACAAACAGAAAGACACAAGGTCTCTGCCTAGCCCCCTTATTCGTCCTCCCCTTTTCCCTGGGGACTGTGG 3'

[0162] The bolded sequence represents the Ocirc-AS arm that matches the target sequence (shown in Figure 20), resulting in the envelopment of the oligonucleotide upon binding. The boundary between the intron and exon 4 of MECP2 is indicated. The splice acceptor is shown in bold (CAG). The Ocirc sequence is shown at the top: the highlighted sequence is the 5' antisense arm, and the unhighlighted sequence is the 3' antisense arm. RNA produced by the H1 promoter ends with TT. These TT nucleotides do not match the template RNA, so they do not bind and are therefore shown as overhanging in Figure 20. The dashed line represents the RNA sequence found between the arms. The black line indicates the contact region of the two arms of Ocirc on the MECP2 sequence template. The underlined region is the PPT sequence of the human MECP2 gene.

[0163] The pH1-Ocirc-control plasmid was constructed by combining a control sequence designated Ocirc-control with the H1 promoter. Ocirc-control has the following sequence (designated SEQ ID NO: 22): 5'GTGCCGTATGCATCTCTGCCTAGCCCCCTTATTCGTCTCCCACAACTTGCTTG 3'

[0164] The bolded sequence represents the Ocirc-control arm that does not match the target sequence; therefore, this Ocirc-control oligonucleotide should not be able to bind to the target.

[0165] In both Ocirc-AS and Ocirc-control, the sequences between the "arms" are the same.

[0166] These sequences were combined with the H1 promoter as described above. pH1-Ocirc-AS has the following sequence (referred to as SEQ ID NO: 23): ACTAGTATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCTTTCCC ACAAACAGAAAGACACAAGGTCTCTGCCTAGCCCCCTTATTCGTCCTCCCCTTTTCCCTGGGGACTGTGGTTTTTTGCGGCCGC

[0167] pH1-Ocirc-control has the following sequence (referred to as SEQ ID NO: 24): ACTAGTATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAAACGTGAAATGTCTT TGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCTTTCCC GTGCCGTATGCATCTCTGCCTAGCCCCCTTATTCGTCTCCCACAACTTGCTTGTTTTTTGCGGCCGC

[0168] The H1 promoter sequence is underlined, the Ocirc sequence is in bold, and the sequences in italics are restriction enzyme sites.

[0169] The sequence of plasmid pH1-Ocirc-AS (referred to as SEQ ID NO: 25) is:

[0170] The sequence of the plasmid pH1-Ocirc-control (referred to as SEQ ID NO: 26) is:

[0171] 48 hours after transfection, cells were harvested and analyzed by Renilla luciferase assay. All experiments were performed in quadruplicate.

[0172] result TIFF2025530419000006.tif61170

[0173] The results of the experiment, corrected for extremes, are presented below: TIFF2025530419000007.tif59170

[0174] Approximately 33%–43% reduction in Renilla luciferase activity was observed after addition of the pH1-Ocirc-AS plasmid expressing Ocirc-AS RNA compared to parallel transfection with the pH1-Ocirc-control plasmid expressing Ocirc-control RNA.

[0175] These results indicate that the plasmid contains Ocirc RNA, which can enter the cell nucleus at the RNA level, bind to its target sequence, and successfully reduce the expression of the target gene.

Claims

1. From 5' to 3', a first sequence of nucleic acid that is complementary in its 3' to 5' direction to a region in a pre-mRNA or mRNA target molecule; a second sequence of nucleic acid comprising a heterologous sequence; a third sequence of nucleic acid that is complementary, in the 3' to 5' direction, to a sequence of nucleic acid in the pre-mRNA or mRNA target molecule that is located upstream relative to the hybridization site of the first sequence of nucleic acid; An oligonucleotide comprising: the first and third sequences of nucleic acid hybridize to the same intron, or to the same exon, or to consecutive introns and exons, or to consecutive exons and introns in the target molecule; Oligonucleotides.

2. 2. The oligonucleotide of claim 1, wherein the heterologous sequence comprises a sequence that is the same as, and in the same 5' to 3' orientation as, an exon, intron, splice site, 5' UTR, 3' UTR, or a fragment or portion thereof of the wild-type pre-mRNA or mRNA target molecule.

3. The oligonucleotide of claim 1 or 2, wherein the heterologous sequence encodes a portion of an exon.

4. The oligonucleotide according to any one of claims 1 to 3, wherein the oligonucleotide is an antisense oligonucleotide.

5. The oligonucleotide of any one of claims 1 to 4, wherein the oligonucleotide is synthesized as a linear single-stranded molecule and forms an open circular structure upon hybridization with a pre-mRNA target molecule.

6. 6. The oligonucleotide of any one of claims 1 to 5, wherein the second sequence of nucleic acid is arranged such that hybridization of the oligonucleotide with the target pre-mRNA or mRNA molecule masks a mutation in the pre-mRNA or mRNA molecule and the mutated sequence of the pre-mRNA is replaced by the sequence of the wild-type pre-mRNA.

7. The oligonucleotide of any one of claims 1 to 6, wherein hybridization of the oligonucleotide with the target pre-mRNA or mRNA molecule introduces a heterologous motif into the endogenous pre-mRNA or mRNA molecule.

8. The oligonucleotide of any one of claims 1 to 7, wherein the second sequence of nucleic acid binds to a cellular complex.

9. The oligonucleotide according to any one of claims 1 to 8, wherein the nucleic acid is a ribonucleotide.

10. The oligonucleotide according to any one of claims 1 to 9, wherein the mutation site comprises a single base mutation, a substitution, a deletion mutation, an insertion mutation, or an InDel mutation.

11. The second sequence of nucleic acid is (i) a portion of the intron ending in an acceptor site; (ii) a heterologous sequence that is trans-spliced ​​into the target pre-mRNA molecule; (iii) a portion of the intron containing a donor site, and optionally a PPT sequence ending proximal to the branch point and the acceptor site sequence in the wild-type exon; The oligonucleotide according to any one of claims 1 to 10, comprising:

12. An oligonucleotide comprising: In the 5' to 3' direction, a first sequence of nucleic acid that is complementary in its 3' to 5' direction to a region in a pre-mRNA target molecule; A second sequence: (i) a portion of the intron ending in an acceptor site; (ii) a heterologous sequence that is trans-spliced ​​into the target pre-mRNA molecule; (iii) a portion of an intron comprising an acceptor site and, optionally, a branch point and PPT sequence, the portion of the intron ending proximal to the acceptor site sequence in the wild-type exon; and a second sequence comprising: a third sequence of nucleic acids that hybridizes in a 3' to 5' direction to a sequence of nucleic acids located upstream with respect to the hybridization site of the first sequence of nucleic acids in the pre-mRNA target molecule preceding the complete or partial acceptor site sequence; Including, the first and third sequences of the nucleic acid hybridize to the same intron, or to the same exon, or to consecutive introns and exons, or to consecutive exons and introns; Oligonucleotides.

13. 13. The oligonucleotide of claim 12, wherein the heterologous sequence comprises a sequence that is the same as, and in the same 5' to 3' orientation as, an exon, intron, splice site, or fragment or portion thereof of the wild-type pre-mRNA that terminates in a YAG acceptor site following the second complementary sequence at the 3' end of the oligonucleotide.

14. The oligonucleotide of any one of claims 11 to 13, wherein the heterologous sequence encodes a portion of an exon.

15. The oligonucleotide of claim 1, wherein the oligonucleotide is selected from the group consisting of Ocirc1 (SEQ ID NO: 12), Ocirc2 (SEQ ID NO: 13), Ocirc3 (SEQ ID NO: 14), Ocirc4 (SEQ ID NO: 15), Ocirc5 (SEQ ID NO: 16), Ocirc6 (SEQ ID NO: 17), Ocirc7 (SEQ ID NO: 18), and Ocirc8 (SEQ ID NO: 19).

16. A delivery vector comprising the oligonucleotide of any one of claims 1 to 15.

17. An isolated cell comprising an oligonucleotide according to any one of claims 1 to 16.

18. 17. A method for replacing an endogenous nucleic acid sequence, the method comprising contacting a target cell containing the endogenous nucleic acid sequence with an oligonucleotide according to any one of claims 1 to 15, or a delivery vector according to claim 16.

19. 18. A method for treating Rett Syndrome, said method comprising administering to a patient in need thereof an oligonucleotide according to any one of claims 1 to 15, a delivery vector according to claim 16 or an isolated cell according to claim 17.

20. An oligonucleotide according to any one of claims 1 to 15, a delivery vector according to claim 16 or an isolated cell according to claim 17 for use in a method for the treatment of Rett Syndrome.

Images