Certain modified RNAi reagents and compositions

Optimized RNAi reagents with specific 2'-fluoro modifications in dsRNA strands enhance in vivo efficacy and stability, addressing metabolic issues and toxicity concerns, ensuring effective gene suppression.

JP2025531313APending Publication Date: 2025-09-19SHANGHAI ARGO BIOPHARMACEUTICAL CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025516274
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-09-20
Filing Date
2023-09-19
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Existing RNAi reagents face challenges with in vivo efficacy and stability due to metabolic issues, particularly related to the use of unnatural nucleotide analogs like 2'-F modifications, which can cause toxicity and interfere with RNA-protein binding, affecting gene silencing activity.

Method used

Design of RNAi reagents with specific 2'-fluoro modified nucleotides at optimized positions and numbers in the antisense strand of dsRNA, balancing stability, tolerance, and RNAi activity, using modified nucleotides such as 2'-O-methyl and other chemically modified nucleotides to enhance therapeutic efficacy.

Benefits of technology

The optimized RNAi reagents improve gene silencing activity and stability, reducing toxic side effects while maintaining effective gene suppression for therapeutic applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025531313000001_ABST
    Figure 2025531313000001_ABST
Patent Text Reader

Abstract

One aspect of the present invention relates to RNAi (dsRNA) double-stranded reagents capable of suppressing the expression of target genes. The dsRNA duplexes have F-modified nucleotides at specific positions in either the antisense or sense strand. Other aspects of the present invention relate to pharmaceutical compositions containing these dsRNA reagents suitable for therapeutic use and methods for suppressing the expression of target genes by administering these dsRNA reagents, e.g., to treat various diseases and conditions.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to RNAi reagents having specific motifs that can be used to suppress the expression of target genes and RNAi compositions that are applied to the treatment of diseases. In particular, the present invention provides methods for the treatment of various diseases in which the expression of target genes is suppressed by administering RNAi reagents. [Background technology]

[0002] RNA interference, or "RNAi," technology, first proposed by Fell et al., is an effective means of disease therapy known in the art. The RNAi mechanism begins with the Dicer enzyme-mediated generation of longer non-coding RNAs. These RNA molecules are loaded into the RNA-induced silencing complex (RISC), where the sense or passenger strand is discarded and the antisense or guide strand hybridizes to a fully or partially complementary mRNA sequence, inducing mRNA silencing via Ago2-mediated degradation or translational repression. Oligonucleotides that reduce gene expression through the RNA interference (RNAi) pathway have already been developed, including, but not limited to, RNAi oligonucleotides, such as double-stranded ribonucleic acid (dsRNA), including short interfering RNAs (siRNAs) consisting of 19-25 nucleotides, microRNAs (miRNAs), short hairpin RNAs (shRNAs), and antisense oligonucleotides (ASOs) consisting of 16-53 nucleotides. With the advancement of RNAi technology and delivery methods, RNAi-based therapy has increasingly shown positive results.This therapy represents a promising disease treatment direction, especially for targets that are considered "undruggable" by small molecules or biological methods.However, this technology cannot be widely applied due to the inherent metabolic problems of natural RNA, such as targeting and in vivo stability.

[0003] Over the last two decades, tremendous progress has been made in overcoming the inherent metabolic problems of natural RNA through the development of various chemical modifications and improved delivery methods applied to RNAi oligonucleotides. Chemical modifications of such RNAi oligonucleotides have important facilitating effects on the potential for full utilization of such therapeutic regimens, improving their pharmacokinetic and pharmacodynamic properties (Deleavey & Damha, Chem. Biol., 19:937-954, 2012) and preventing innate immune activation. For example, Choung et al. used siRNA duplexes containing alternative modifications, such as 2'-OMe (2'-O-methyl), 2'-F (2'-fluoro), and phosphorothioate-modified nucleotides, to obtain stable siRNA from serum (2006, Biochemical and Biophysical Research Communications, 342, 919-927), including methods in which other nucleotide positions are modified with LNA, UNA, etc. Recently, Nair et al. used chemically modified siRNA conjugated with N-acetylgalactamide (GalNAc) and demonstrated efficacy through delivery to hepatocytes in the liver in vivo (J. AM. Chem. Soc., 136:16958-16961, 2014). These chemically modified siRNAs have entered clinical development for the treatment of various human diseases.

[0004] Among these modifications, one of the most common chemical modifications is the substitution of the 2'-OH of the furanose of ribonucleotides, including, but not limited to, a combination of 2'-O-methyl (2'-OMe) and 2'-fluoro (2'-F) throughout the duplex of fully chemically modified siRNA. For example, Morrissey et al. used siRNA duplexes containing 2'-F modified residues at the Ago2 cleavage site in addition to other sites and modifications, and obtained compatible silencing compared to unmodified siRNA; however, the location of these 2'-F modifications has not been determined, nor has their substantial effect on gene silencing activity been determined. Meanwhile, Choung et al. suggested that 2'-OMe should not be used at certain sites to increase siRNA stability, and Janas et al. showed that there has been no evidence to date of regularity in 2'-F modified siRNAs (NUCLEIC ACID THER., 26:363-371, 2016; NUCLEIC ACID THER., 27:11-22, 2016). While modifications such as 2'-F siRNA have been well tolerated in clinical trials, chemically modified nucleoside analogs have proven to be a major problem in oligonucleotide therapeutics due to the potential toxicity associated with unnatural oligonucleotide analogs. It has been reported that 2'-F modified fully thiophosphorylated antisense oligonucleotides can reduce cellular proteins and cause double-stranded DNA breaks, resulting in acute liver toxicity in vivo (NUCLEIC ACID RES., 46:2204-2217, 2018). Furthermore, compared with the relatively small volume of the 2'-F modification, the naturally occurring 2'-OMe modification, which has a relatively large volume, is known to have better metabolic stability and tolerance. However, replacing 2'-F with 2'-OMe, which has a relatively small volume, is uncertain in interfering with RNA-protein binding and suppressing RNAi activity (Chiu et al., RNA, 9:1034-1048, 2003; Prakash et al., J. MED. CHEM., 48:4247-4253, 2005; Zheng et al., FASEB J., 27:4017-4026, 2013).

[0005] Therefore, in order to simultaneously improve stability and tolerance and reduce toxic side effects caused by non-natural nucleotide agents without affecting RNAi activity, prior art has disclosed further reduction of 2'-F content and 2'-OME adjustments, and these fine-tuning of 2'-OME and 2'-F positions have shown good efficacy and duration. A recent report attempted to optimize 21 / 23-length siRNAs and modify the Galnac conjugation platform ( Mol. Ther. 26:708-717, 2018 ). International patent application WO2021067744 investigated the effects of the 2'-F position and number in hairpin RNA (shRNA) and determined that specific 2'-F positions and numbers in shRNAs have a certain effect on RNAi activity. However, these studies did not actually recognize the reusability of specific 2'-F modification positions and numbers in terms of maintaining RNAi activity while favoring stability, tolerance, and reduced toxic side effects.

[0006] Although the development of improved delivery methods through chemical modification has made great progress in overcoming the inherent metabolic problems of natural RNA, there is still a need in the field for RNAi agents with enhanced in vivo efficacy and stability for therapeutic administration.However, there is still a need to minimize the use of unnatural nucleoside analogs, such as 2'-F modified nucleosides, in RNAi treatment, and in particular to determine the effectiveness of the specific position and number of RNAi in double-stranded ribonucleic acid and antisense oligonucleotides, etc., in terms of activity, stability, and toxic side effects. Summary of the Invention

[0007] The present invention provides methods for the in vivo detection of RNAi reagents based in part on the design of the chemical modification modes used in the RNAi reagents. Improve the efficacy and / or duration of gene silencing activity.The modification method described herein can be widely applied to various RNAi reagents with different sequences and targets.RNAi reagents can be used to suppress the expression of target genes in vivo, for example, to achieve therapeutic purposes.

[0008] Therefore, according to one aspect of the present invention, there is provided an RNAi reagent for suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprises a structure represented by formula (X) listed in the 3' to 5' direction: 3'-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5' expression(X) Of these, each N F represents a 2'-fluoro modified nucleotide, each N X each independently represents a modified or unmodified nucleotide, N X having three or fewer 2'-fluoro modified nucleotides, n may be an integer from 0 to 7.

[0009] In some embodiments, an RNAi reagent for inhibiting expression of a target gene is provided, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent includes a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand includes a structure represented by formula (I) listed in the 3' to 5' direction: 3'-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5' Formula (I) Of these, each N F represents a 2'-fluoro modified nucleotide, each N X each independently represents a modified or unmodified nucleotide, N X has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, n may be an integer from 0 to 7.

[0010] In some embodiments, an RNAi reagent for suppressing expression of a target gene is provided, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent includes a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand includes a structure represented by formula (I-1) listed in the 3' to 5' direction: 3'-(N L ) n N M1 NL N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (I-1) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0011] In some embodiments, the antisense strand of the dsRNA reagent represented by formula (I-1) contains N M1 , N M2 , N M3 , N M4 , N M6 , N M7 and N M8 There are only three 2'-fluoro modified nucleotides in N M5 is not a 2'-fluoro modified nucleotide.

[0012] In some specific embodiments, the antisense strand of the dsRNA reagent comprises, in a 3' to 5' direction, Formula (II): 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5' Formula (II) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 and N M4 There are only two 2'-fluoro modified nucleotides in N M5 , N M7 and N M8 is not a 2'-fluoro modified nucleotide, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0013] In some specific embodiments, the antisense strand of the dsRNA reagent comprises, in a 3' to 5' direction, Formula (III): 3'-(N L ) nN M1 N L N M2 N L N F N L N F N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (III) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M6 and N M7 There are only two 2'-fluoro modified nucleotides in N M4 , N M5 and N M8 is not a 2'-fluoro modified nucleotide, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0014] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) of the dsRNA reagent (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides. M1 , N M3 and N M7 The nucleotides are 2'-fluoro modified nucleotides.

[0015] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) of the dsRNA reagent (counting from the first paired nucleotide from the 5' end) are 2'-fluoro-modified nucleotides. M2 , N M3 and N M6 The nucleotides are 2'-fluoro modified nucleotides.

[0016] In some more specific embodiments, the nucleotides at positions 2, 4, 10, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent represented by formula (I-1) are 2'-fluoro modified nucleotides.

[0017] In some more specific embodiments, the nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides.

[0018] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 18 of the antisense strand of formula (I-1) of the dsRNA reagent (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides.

[0019] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 16 of the antisense strand of formula (I-1) of the dsRNA reagent (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides.

[0020] In some more specific embodiments, the nucleotides at positions 2, 5, 10, 14, and 16 of the antisense strand of formula (I-1) of the dsRNA reagent (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides.

[0021] In these examples, it should be understood that there are only five 2'-fluoro modified nucleotides in the antisense strand of the dsRNA reagent represented by Formula (I-1), Formula (II), or Formula (III).

[0022] In some embodiments, the antisense strand N of the dsRNA reagent represented by formula (I-1) M1 , N M2 , N M3 , N M5 , N M6 and N M8 There is only one 2'-fluoro modified nucleotide in N M4 , N M7 is not a 2'-fluoro modified nucleotide.

[0023] In some specific embodiments, the antisense strand of the dsRNA reagent comprises, in a 3' to 5' direction, Formula (IV): 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (IV) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , NM2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M5 , N M6 and N M8 There is only one 2'-fluoro modified nucleotide in N M4 , N M7 is not a 2'-fluoro modified nucleotide, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0024] In some more specific embodiments, the nucleotides at positions 2, 4, and 14 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent represented by formula (IV) are 2'-fluoro modified nucleotides.

[0025] In some more specific embodiments, the nucleotides at positions 2, 8, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides.

[0026] In some more specific embodiments, the nucleotides at positions 2, 7, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides.

[0027] In some more specific embodiments, the nucleotides at positions 2, 12, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides.

[0028] In some more specific embodiments, the nucleotides at positions 2, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides.

[0029] In some more specific embodiments, the nucleotides at positions 2, 14, and 18 of the antisense strand of the dsRNA reagent represented by Formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides.

[0030] In some more specific embodiments, the nucleotides at positions 2, 6, and 14 of the antisense strand of the dsRNA reagent (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides.

[0031] In these examples, it should be understood that there are only three 2'-fluoro modified nucleotides in the antisense strand of the dsRNA reagent represented by formula (I-1) or formula (IV).

[0032] In some embodiments, the method includes providing an RNAi reagent capable of suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent including a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand includes a structure represented by formula (I-2) listed in the 3' to 5' direction; 3'-(N L ) n N M1 NL N M2 N L N F N L N M3 N M9 N M4 N M10 N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (I-2) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N M10 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N M10 has only three 2'-fluoro modified nucleotides, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0033] In some more specific embodiments, the dsRNA reagent has an antisense strand represented by formula (I-2): N M6 and N M9 each independently represent a 2'-fluoro-modified nucleotide; N M1 and N M2 There is only one 2'-fluoro modified nucleotide in N M3 , NM4 , N M5 , N M7 , N M8 and N M10 As will be appreciated by those skilled in the art, none of N M6 and N M9 are both 2'-fluoro modified nucleotides, and N M1 and N M2 There is only one 2'-fluoro modified nucleotide in N M3 , N M4 , N M5 , N M7 and N M8 are not 2'-fluoro-modified nucleotides, and in these examples, the nucleotides at positions 2, 7, 11, 14, and 16 in the antisense strand are 2'-fluoro-modified nucleotides and the nucleotides at other positions are not 2'-fluoro-modified nucleotides, or the nucleotides at positions 2, 7, 11, 14, and 18 are 2'-fluoro-modified nucleotides and the nucleotides at other positions are not 2'-fluoro-modified nucleotides.

[0034] In some more specific embodiments, the dsRNA reagent has an antisense strand represented by formula (I-2): N M2 and N M3 each independently represent a 2'-fluoro-modified nucleotide; N M5 , N M6 and N M10 There is only one 2'-fluoro modified nucleotide in N M1 , N M4 , N M7 , N M8 and N M9 As will be appreciated by those skilled in the art, none of N M2 and N M3 are both 2'-fluoro modified nucleotides, and N M5 , N M6 and N M10 There is only one 2'-fluoro modified nucleotide in N M1 , N M4 , N M7 , NM8 and N M9 are not 2'-fluoro modified nucleotides, and in these examples, the nucleotides at positions 2, 7, 12, 14, and 16 in the antisense strand are 2'-fluoro modified nucleotides and the nucleotides at other positions are not 2'-fluoro modified nucleotides, or the nucleotides at positions 2, 8, 12, 14, and 16 are 2'-fluoro modified nucleotides and the nucleotides at other positions are not 2'-fluoro modified nucleotides, or the nucleotides at positions 2, 9, 12, 14, and 16 are 2'-fluoro modified nucleotides and the nucleotides at other positions are not 2'-fluoro modified nucleotides.

[0035] In some embodiments, the method includes providing an RNAi reagent capable of suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprises a structure represented by formula (I') listed in the 3' to 5' direction; 3'-(N L ) n N M1 N L N F N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5' Formula (I') Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M3 , N M4 , N M5 , N M7 and N M8each independently represents a modified or unmodified nucleotide, N M1 , N M3 , N M4 , N M5 , N M7 and N M8 has no more than one 2'-fluoro modified nucleotide, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0036] In some more specific embodiments, the dsRNA reagent comprises an antisense strand of formula (I'), wherein N M1 , N M3 , N M4 , N M5 , N M7 and N M8 There is only one 2'-fluoro modified nucleotide in N, and as will be understood by those skilled in the art, positions 2, 7, 14, and 16 in the antisense strand are 2'-fluoro modified nucleotides, and N M1 , N M3 , N M4 , N M5 , N M7 and N M8is a 2'-fluoro modified nucleotide, and no nucleotides at other positions are 2'-fluoro modified nucleotides, for a total of five 2'-fluoro modified nucleotides. Non-limiting examples include: positions 2, 5, 7, 14, and 16 are 2'-fluoro modified nucleotides and the nucleotides at other positions are not 2'-fluoro modified nucleotides; positions 2, 4, 7, 14, and 16 are 2'-fluoro modified nucleotides and the nucleotides at other positions are not 2'-fluoro modified nucleotides; positions 2, 7, 8, 14, and 16 are 2'-fluoro modified nucleotides and the nucleotides at other positions are not 2'-fluoro modified nucleotides; positions 2, 7, 10, 14, and 16 are 2'-fluoro modified nucleotides and the nucleotides at other positions are not 2'-fluoro modified nucleotides; positions 2, 7, 12, 14, and 16 are 2'-fluoro modified nucleotides and the nucleotides at other positions are not 2'-fluoro modified nucleotides; positions 2, 7, 14, 16, and 18 are 2'-fluoro modified nucleotides and the nucleotides at other positions are not 2'-fluoro modified nucleotides.

[0037] In some more specific embodiments, the dsRNA reagent comprises an antisense strand of formula (I'), wherein N M1 , N M3 , N M4 , N M5 , N M7 and N M8 None of the nucleotides in the antisense strand of Formula (I) and / or Formula (X) contain 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, the antisense strand contains 2'-fluoro modified nucleotides only at positions 2, 7, 14, and 16, with no nucleotides at other positions being 2'-fluoro modified nucleotides, for a total of four 2'-fluoro modified nucleotides. In some embodiments, the N XOne or more of the nucleotides are modified nucleotides independently selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides (MOEs), abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate-modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino-modified nucleotides, phosphoramidates, or unnatural bases including nucleotides. In some embodiments, the N of the antisense strand of the dsRNA reagent represented by Formula (I-1), Formula (I-2), Formula (I'), Formula (II), Formula (III), and / or Formula (IV) LOne or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides (MOEs), abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural bases including nucleotides. In some embodiments, the N in the dsRNA reagent L The nucleotide is a modified nucleotide selected from a 2'-O-methyl modified nucleotide, UNA, or Invab.

[0038] In some embodiments, the dsRNA reagent comprises an antisense strand of Formula (I) and / or Formula (I') that includes an E-vinyl phosphonate nucleotide at the 5' end of the antisense strand.

[0039] In some embodiments, the N in the antisense strand of the dsRNA reagent represented by Formula (I-1), Formula (I-2), Formula (I'), Formula (II), Formula (III), and / or Formula (IV) M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N M10are modified nucleotides independently selected from 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), open-ring nucleotides (UNAs), ethylene glycol nucleotides (GNAs), bicyclic nucleotides (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural bases including nucleotides. In some embodiments, N in the antisense strand of the dsRNA reagent represented by Formula (I) / or Formula (I') M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 is preferably a 2'-O-methyl modified nucleotide, if not a 2'-fluoro modified nucleotide.

[0040] In some embodiments, all or essentially all of the nucleotides in the sense and antisense strands of the dsRNA reagent are modified nucleotides.

[0041] In some embodiments, the dsRNA reagent has a sense strand that is complementary or essentially complementary to an antisense strand of Formula (X), Formula (I), Formula (I-1), Formula (I-2), Formula (I'), Formula (II), Formula (III), and / or Formula (IV), and the length of the complementary or essentially complementary region is between 18 and 25 nucleotides. In some embodiments, the dsRNA reagent has a sense strand that is complementary or essentially complementary to an antisense strand of Formula (I), and the length of the complementary or essentially complementary region is between 18 and 25 nucleotides. In some embodiments, the dsRNA reagent has a sense strand that is complementary or essentially complementary to an antisense strand of Formula (I'), and the length of the complementary or essentially complementary region is between 18 and 25 nucleotides. In some embodiments, the length of the complementary or essentially complementary region is between 18 and 23 nucleotides. In some embodiments, the length of the complementary or essentially complementary region is between 19 and 21 nucleotides. In some embodiments, the length of the complementary or essentially complementary region is 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the sense strand is perfectly complementary to the antisense strand of Formula (I). In some embodiments, the sense strand is perfectly complementary to the antisense strand of Formula (I').

[0042] It should be understood that in some embodiments, in the dsRNA reagent, n is 7 and the complementary pairing to the antisense strand is 25 nucleotides in length. In some specific embodiments, in the dsRNA reagent, n is 0, 1, 2, 3, 4, 5, or 6, respectively.

[0043] In one embodiment, the dsRNA reagent of the present invention may include one or more overhanging end regions at the 3'-end, 5'-end, or both ends of one strand, and the overhangs may be 1 to 5 nucleotides in length. In a specific embodiment, the dsRNA reagent of the present invention may have an overhanging end 1 to 5 nucleotides in length at the 3'-end of the antisense strand. In a specific embodiment, the dsRNA reagent of the present invention may have an overhanging end 1 to 5 nucleotides in length at the 5'-end of the sense strand. In a more specific embodiment, the dsRNA reagent of the present invention may have an overhanging end 1 or 2 nucleotides in length.

[0044] In one embodiment, the dsRNA reagents of the invention are blunt ended at the 5'-end of the antisense strand or the 3'-end of the sense strand.

[0045] In some embodiments, the sense strand of the dsRNA reagent is 40 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent is 30 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent is 25 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent is 23 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent is 19, 20, or 21 nucleotides in length.

[0046] In some embodiments, the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the sense strand of the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the antisense strand of the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the sense strand and / or antisense strand of the dsRNA reagent comprise 1, 2, 3, 4, 5, or 6 phosphorothioate internucleotide linkages. In some embodiments, the dsRNA reagent comprises 1 or 2 phosphorothioate internucleotide linkages at the 3'-end and / or 5'-end of the sense strand and / or antisense strand.

[0047] In some embodiments, the dsRNA reagent further comprises one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups described in the dsRNA reagent of the present invention are identical or different. The targeting group or linking group may be attached to the sense strand, antisense strand, or both strands at the 3' end, 5' end, or both ends. In some embodiments, the one or more targeting groups or linking groups described in the dsRNA reagent are conjugated to the sense strand.The targeting ligands can alter the distribution, targeting or lifetime, endosomolytic properties, improve trafficking, hybridization, and specificity of the dsRNA reagent into which they are incorporated, and include, by way of non-limiting example, lectins, glycoproteins, lipids or proteins, thyroid stimulating hormone, melanocyte stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, multivalent trehalose, glycosylated polyamino acids, and the like. Examples of suitable chemoattractants include: acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamates, polyaspartates, lipids, cholesterol, steroids, bile acids, folate, vitamin B12, biotin, RGD peptides, RGD peptidomimetics, or aptamers; other examples include dyes, intercalators (e.g., acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases, etc. cleases or chelating agents (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, camphor, menthol, 1,3-propylene glycol, heptadecyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, or phenoxazine), and peptide conjugates (e.g., Antennapedia Peptide Examples of suitable ribonucleases include: tides, Tat peptides), alkylating agents, phosphate, amino groups, mercapto groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino groups, alkyl groups, substituted alkyl groups, radiolabeled markers, enzymes, haptens (e.g., biotin), carriers / adsorption promoters (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole complexes, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl groups, HRP, or AP.In some embodiments, the targeting group or linking group comprises N-acetyl-galactosamine (GalNAc), a lipophilic molecule. The lipophilic molecule can be used for delivery to neuronal regions. In some embodiments, the targeting group or linking group in the dsRNA reagent is conjugated to the 3'-end and / or 5'-end of the sense strand. In some embodiments, the targeting group in the dsRNA reagent has the following structure: [ka]

[0048] In some embodiments, the antisense strand of the dsRNA reagent represented by Formula (I) and / or Formula (I') contains one inverted abasic residue at the 3'-end. In some embodiments, the sense strand of the dsRNA reagent contains one or two inverted abasic residues at the 3' and / or 5' ends.

[0049] In some embodiments, the dsRNA reagent inhibits expression of a Factor FXII (F12) gene sequence. In some embodiments, the dsRNA reagent has a sequence shown in Table 2 below.

[0050] In some embodiments, the dsRNA reagent is an siRNA.

[0051] According to another aspect of the present invention, there is provided an RNAi reagent for suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the sense strand having 18 to 40 nucleotides, and the sense strand comprises a structure represented by formula (V) listed in the 5' to 3' direction: 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N'N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' Formula (V) Of these, each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has at least two 2'-fluoro modified nucleotides present, in formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (V), there are no more than six total 2'-fluoro modified nucleotides; Each N' L represents independently a modified or unmodified nucleotide, n' may be an integer of 0-7.

[0052] In some embodiments, an RNAi reagent for suppressing expression of a target gene is provided, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent includes a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the sense strand having 18 to 40 nucleotides, and the sense strand includes a structure represented by formula (V') listed in the 5' to 3' direction: 5'-(N' L ) n’ N' L N' L N'L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' expression (V') Of these, each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has only two 2'-fluoro modified nucleotides, Each N' L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n' may be an integer of 0-7.

[0053] In some embodiments, the nucleotides at positions 9, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA reagent represented by formula (V') are 2'-fluoro-modified nucleotides. N3 and N' N5 The nucleotide in is a 2'-fluoro modified nucleotide.

[0054] In some embodiments, the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA reagent represented by formula (V') are 2'-fluoro-modified nucleotides. N3 and N' N6 The nucleotide in is a 2'-fluoro modified nucleotide.

[0055] In some embodiments, the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA reagent represented by formula (V') are 2'-fluoro modified nucleotides.

[0056] In some embodiments, the nucleotides at positions 11, 12, and 14 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA reagent represented by formula (V') are 2'-fluoro modified nucleotides.

[0057] In some embodiments, the nucleotides at positions 11, 12, and 15 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA reagent represented by formula (V') are 2'-fluoro modified nucleotides.

[0058] It should be understood that in these examples, there are only three 2'-fluoro modified nucleotides in the sense strand of the dsRNA reagent represented by formula (V').

[0059] In some embodiments, the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides. N3 and N' N5The nucleotide in is a 2'-fluoro modified nucleotide.

[0060] In some embodiments, the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides. N3 and N' N6 The nucleotide in is a 2'-fluoro modified nucleotide.

[0061] In some embodiments, the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA reagent represented by Formula (V) are 2'-fluoro modified nucleotides.

[0062] In some embodiments, the nucleotides at positions 11, 12, and 14 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA reagent represented by Formula (V) are 2'-fluoro modified nucleotides.

[0063] In some embodiments, the nucleotides at positions 11, 12, and 15 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) of the dsRNA reagent represented by Formula (V) are 2'-fluoro modified nucleotides.

[0064] In these examples, the sense strand of the dsRNA reagent represented by formula (V) contains three 2'-fluoro modified nucleotides, but it should be understood that the sense strand represented by formula (V) contains no more than six total 2'-fluoro modified nucleotides and does not contain a motif of three or more consecutive 2'-fluoro modified nucleotides.

[0065] According to another aspect of the present invention, there is provided an RNAi reagent for suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the sense strand having 18 to 40 nucleotides, and the sense strand comprises a structure represented by formula (IX) listed in the 5' to 3' direction: 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' N7 N' L N' L N' L N' L N' L N' L -3' expression (IX) Of these, each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and N' N7 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and N' N7 has at least two 2'-fluoro modified nucleotides present, in formula (IX), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (IX), there are no more than six total 2'-fluoro modified nucleotides; Each N' Lrepresents independently a modified or unmodified nucleotide, n' may be an integer of 0-7.

[0066] In some embodiments, N' in the sense strand of the dsRNA reagent represented by Formula (V) and / or Formula (IX) L One or more of the nucleotides are modified nucleotides independently selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides (MOEs), abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate-modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino-modified nucleotides, phosphoramidates, or unnatural bases including nucleotides. In some embodiments, the dsRNA reagent comprises N' of Formula (V) and / or Formula (IX). L The nucleotide is a modified nucleotide selected from a 2'-O-methyl modified nucleotide, UNA, or Invab.

[0067] In some embodiments, the dsRNA reagent comprises an E-vinyl phosphonate nucleotide at the 5' end of the antisense strand.

[0068] In some embodiments, N' in the sense strand of the dsRNA reagent represented by Formula (V) and / or Formula (IX) N1 , N' N2 , N'N3 , N' N4 , N' N5 , N' N6 and N' N7 are modified nucleotides independently selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), open-ring nucleotides (UNAs), ethylene glycol nucleotides (GNAs), bicyclic nucleotides (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate-modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino-modified nucleotides, phosphoramidates, or unnatural bases including nucleotides. In some embodiments, N' in the sense strand of the dsRNA reagent represented by formula (V) N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 is preferably a 2'-O-methyl modified nucleotide, if not a 2'-fluoro modified nucleotide.

[0069] In some embodiments, all or essentially all of the nucleotides in the sense and antisense strands of the dsRNA reagent are modified nucleotides.

[0070] In some embodiments, the dsRNA reagent has an antisense strand that is complementary or essentially complementary to a sense strand represented by Formula (V), and the length of the complementary region is between 18 and 25 nucleotides. In some embodiments, the length of the complementary or essentially complementary region is between 18 and 23 nucleotides. In some embodiments, the length of the complementary or essentially complementary region is between 19 and 21 nucleotides. In some embodiments, the length of the complementary or essentially complementary region is 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the antisense strand is completely complementary to a sense strand represented by Formula (V).

[0071] It should be understood that in some embodiments, in the dsRNA reagent, n' is 7 and the complementary pairing to the sense strand is 25 nucleotides in length. In some specific embodiments, in the dsRNA reagent, n' is 0, 1, 2, 3, 4, 5, or 6, respectively.

[0072] In one embodiment, the dsRNA reagent of the present invention may include one or more overhanging end regions at the 3'-end, 5'-end, or both ends of one strand of the dsRNA reagent, and the overhangs may be 1 to 5 nucleotides in length. These overhangs may be the result of one strand being longer than the other, or of two strands of the same length being interleaved. The overhangs may form mismatches with the target mRNA, may be complementary to the target gene sequence, or may be other sequences. In a specific embodiment, the dsRNA reagent of the present invention may have an overhang of 1 to 5 nucleotides at the 3'-end of the antisense strand. In a specific embodiment, the dsRNA reagent of the present invention may have an overhang of 1 to 5 nucleotides at the 5'-end of the sense strand. In a more specific embodiment, the dsRNA reagent of the present invention may have an overhang of 1 or 2 nucleotides in length.

[0073] In one embodiment, the dsRNA reagents of the invention are blunt ended at the 5'-end of the antisense strand or the 3'-end of the sense strand.

[0074] In some embodiments, the antisense strand of the dsRNA reagent is 30 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent is 30 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent is 25 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent is 23 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent is 19, 20, or 21 nucleotides in length.

[0075] In some embodiments, the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the sense strand of the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the antisense strand of the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the sense strand and / or antisense strand of the dsRNA reagent comprise 1, 2, 3, 4, 5, or 6 phosphorothioate internucleotide linkages. In some embodiments, the dsRNA reagent comprises 1 or 2 phosphorothioate internucleotide linkages at the 3'-end and / or 5'-end of the sense strand and / or antisense strand.

[0076] In some embodiments, the dsRNA reagent further comprises one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups described in the dsRNA reagent of the present invention are identical or different. The targeting group or linking group may be attached to the sense strand, antisense strand, or both strands at the 3' end, 5' end, or both ends. In some embodiments, the one or more targeting groups or linking groups described in the dsRNA reagent are conjugated to the sense strand.The targeting ligands can alter the distribution, targeting or lifetime, endosomolytic properties, improve trafficking, hybridization, and specificity of the dsRNA reagent into which they are incorporated, and include, by way of non-limiting example, lectins, glycoproteins, lipids or proteins, thyroid stimulating hormone, melanocyte stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, multivalent trehalose, glycosylated polyamino acids, and the like. Examples of suitable chemoattractants include: acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamates, polyaspartates, lipids, cholesterol, steroids, bile acids, folate, vitamin B12, biotin, RGD peptides, RGD peptidomimetics, or aptamers; other examples include dyes, intercalators (e.g., acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases, etc. cleases or chelating agents (e.g., EDTA), lipophilic molecules such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, camphor, menthol, 1,3-propylene glycol, heptadecyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, or phenoxazine), and peptide conjugates (e.g., Antennapedia Peptide Examples of suitable ribonucleases include: tides, Tat peptides), alkylating agents, phosphate, amino groups, mercapto groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino groups, alkyl groups, substituted alkyl groups, radiolabeled markers, enzymes, haptens (e.g., biotin), carriers / adsorption promoters (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole complexes, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl groups, HRP, or AP.In some embodiments, the targeting group or linking group comprises N-acetyl-galactosamine (GalNAc), a lipophilic molecule. The lipophilic molecule can be used for delivery to neuronal regions. In some embodiments, the targeting group or linking group in the dsRNA reagent is conjugated to the 5'-end of the sense strand. In some embodiments, the targeting group in the dsRNA reagent has the following structure: [ka]

[0077] In some embodiments, the sense strand of the dsRNA reagent represented by Formula (V) and / or Formula (IX) comprises an inverted abasic residue at the 3'-end. In some embodiments, the sense strand of the dsRNA reagent represented by Formula (V) and / or Formula (IX) comprises one or two inverted abasic residues at the 3'- and / or 5'-end.

[0078] In some embodiments, the dsRNA reagent inhibits expression of a Factor FXII (F12) gene sequence. In some embodiments, the dsRNA reagent has a sequence shown in Table 2 below.

[0079] In some embodiments, the dsRNA reagent is an siRNA.

[0080] In a further aspect of the present invention, there is provided an RNAi reagent for suppressing the expression of a target gene sequence, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides and the sense strand having 18 to 40 nucleotides, the dsRNA reagent comprising an antisense strand having a nucleotide sequence represented by formula (I) herein and a sense strand having a nucleotide sequence represented by formula (V) herein; The antisense strand comprises, in the 3' to 5' direction, Formula (I): 3'-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5' Formula (I) The sense strand comprises, in the 5' to 3' direction, the formula (V): 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' Formula (V) Of these, each N F represents a 2'-fluoro modified nucleotide, each N X each independently represents a modified or unmodified nucleotide, N X has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, Each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N'N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has at least two 2'-fluoro modified nucleotides present, In the sense strand of formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (V), there are no more than six total 2'-fluoro modified nucleotides; Each N' L represents independently a modified or unmodified nucleotide, Each n and n' may independently be an integer from 0 to 7.

[0081] It should be understood that the dsRNA reagents include specific example combinations of an antisense strand having any of the modifications described in formula (I) herein and a sense strand having any of the modifications described in formula (V) herein.

[0082] In some embodiments, including but not limited to the following, RNAi reagents for suppressing expression of a target gene sequence are provided, wherein the RNAi reagents are double-stranded ribonucleic acid (dsRNA) reagents, the dsRNA reagents comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18-30 nucleotides and the sense strand having 18-40 nucleotides, and the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by formula (I-1) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0083] The antisense strand comprises the following formula (I-1) listed in the 3' to 5' direction: 3'-(N L ) n N M1 N L N M2 N L NF N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (I-1) The sense strand comprises, in the 5' to 3' direction, the formula (V): 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' formula (V) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, each N Lindependently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; Each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has at least two 2'-fluoro modified nucleotides present, In the sense strand of formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (V), there are no more than six total 2'-fluoro modified nucleotides; Each N' L represents independently a modified or unmodified nucleotide, Each n and n' may independently be an integer from 0 to 7.

[0084] In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by Formula (I-1) herein and a sense strand having a nucleotide sequence represented by Formula (V') herein. In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by Formula (II) herein and a sense strand having a nucleotide sequence represented by Formula (V) herein. In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by Formula (III) herein and a sense strand having a nucleotide sequence represented by Formula (V) herein. In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by Formula (IV) herein and a sense strand having a nucleotide sequence represented by Formula (V) herein. In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by Formula (II) herein and a sense strand having a nucleotide sequence represented by Formula (V') herein. In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by Formula (III) herein and a sense strand having a nucleotide sequence represented by Formula (V') herein. In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by formula (IV) herein and a sense strand having a nucleotide sequence represented by formula (V') herein. In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by formula (I-2) herein and a sense strand having a nucleotide sequence represented by formula (V') herein. In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by formula (I') herein and a sense strand having a nucleotide sequence represented by formula (V') herein.

[0085] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 11, 12, and 14 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 11, 12, and 15 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0086] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 11, 12, and 14 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 11, 12, and 15 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0087] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0088] In some more specific embodiments, the nucleotides at positions 2, 4, 10, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.

[0089] In some more specific embodiments, the nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.

[0090] In some more specific embodiments, the nucleotides at positions 2, 4, and 14 of the antisense strand of formula (IV) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of formula (V) or formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0091] In some more specific embodiments, the nucleotides at positions 2, 8, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 7, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 12, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.In some more specific embodiments, the nucleotides at positions 2, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 6, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) or formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.

[0092] In a further aspect of the present invention, there is provided an RNAi reagent for suppressing the expression of a target gene sequence, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprises a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides and the sense strand having 18 to 40 nucleotides, the dsRNA reagent comprising an antisense strand having a nucleotide sequence represented by formula (I-2) herein and a sense strand having a nucleotide sequence represented by formula (V) herein; The antisense strand comprises the following formula (I-2) listed in the 3' to 5' direction: 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N M9 N M4 N M10 N M5 N M6 NL N M7 N M8 N L N F N L -5' Formula (I-2) The sense strand comprises, in the 5' to 3' direction, the formula (V): 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' Formula (V) Of these, each N F and N' F each independently represent a 2'-fluoro-modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N M10 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N M10 has only three 2'-fluoro modified nucleotides, N' N1 , N' N2 , N' N3 , N' N4 , N' N5and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has at least two 2'-fluoro modified nucleotides present, In the sense strand of formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (V), there are no more than six total 2'-fluoro modified nucleotides; each N L and N' L each independently represent a modified or unmodified nucleotide, Each n and n' may independently be an integer from 0 to 7.

[0093] In a further aspect of the present invention, there is provided an RNAi reagent for suppressing the expression of a target gene sequence, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides and the sense strand having 18 to 40 nucleotides, the dsRNA reagent comprising an antisense strand having a nucleotide sequence represented by formula (I') herein and a sense strand having a nucleotide sequence represented by formula (V) herein; the antisense strand comprises, in the 3' to 5' direction, the formula (I'): 3'-(N L ) n N M1 N L N F N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L NF N L -5' Formula (I') The sense strand comprises, in the 5' to 3' direction, the formula (V): 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' Formula (V) Of these, each N F and N' F each independently represent a 2'-fluoro-modified nucleotide, N M1 , N M3 , N M4 , N M5 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M3 , N M4 , N M5 , N M7 and N M8 has no more than one 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has at least two 2'-fluoro modified nucleotides present, In the sense strand of formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (V), there are no more than six total 2'-fluoro modified nucleotides; each N L and N' L each independently represent a modified or unmodified nucleotide, Each n and n' may independently be an integer from 0 to 7.

[0094] It should be understood that the dsRNA reagents include combinations of specific examples of an antisense strand having any of the modifications described herein in formula (X), formula (I), formula (I'), formula (I-1), formula (I-2), formula (II), formula (III), formula (IV) and a sense strand having any of the modifications described herein in formula (V), (IX) or formula (V'). It should further be understood that the dsRNA reagents include combinations of specific examples of an antisense strand having any of the modifications described herein in formula (X) and a sense strand having any of the modifications described herein in formula (V) or formula (IX).

[0095] According to another aspect of the present invention, there is further provided a composition comprising any of the above-described dsRNA embodiments of the present invention.

[0096] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. Such compositions typically comprise one or more RNAi and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., that are compatible with drug administration. The use of such media and agents in pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in these compositions is covered.

[0097] The compositions of the present invention can be administered in a variety of ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration can be topical (intraocular, intravaginal, rectal, intranasal, transdermal), oral, or parenteral. In some embodiments, parenteral administration includes subcutaneous administration, intravenous infusion, intraarterial, intralymphatic, intrabronchial, intrapleural, intraperitoneal, intracerebrospinal, or intramuscular injection, intrathecal, or intraventricular administration. In some embodiments, the route and site of administration can be selected to enhance targeting. For example, to target muscle cells, intramuscular injection into the muscle of interest is a logical choice. In some embodiments, lung cells can be targeted by administering RNAi in an aerosol form.

[0098] In some embodiments, the composition further comprises one or more additional therapeutic agents.

[0099] In some embodiments, the composition is packaged in a reagent kit, container, package, dispenser, pre-filled syringe, or vial.

[0100] In another aspect of the invention, there is provided a cell comprising any of the embodiments of the dsRNA reagent aspects of the invention described above in some embodiments.

[0101] In some embodiments, the cells are mammalian cells, optionally human cells.

[0102] In another aspect of the present invention, there is provided a method for suppressing expression of a target gene in a cell, the method comprising: and delivering any of the dsRNA reagent aspects of the present invention to the subject or object, such that the dsRNA reagent is delivered to a specific target in the subject. The dsRNA reagents of the present invention can be used to treat or alleviate symptoms, diseases, or disorders associated with abnormal target gene expression or activity, such as pathological phenotypes caused by overexpression of a gene product. Exemplary target genes include, but are not limited to, LPA, PNPLA3, ASGR1, F7, F12, FXI, APOCIII, APOB, APOL1, TTR, PCSK9, SCAP, KRAS, CD274, PDCD1, C5, ALAS1, HAO1, LDHA, ANGPTL3, SERPINA1, AGT, HAMP, LECT2, EGFR, VEGF, KIF11, AT3, CTNNB1, HMGB1, HIF1A, APP, ATXN2, C9orf72, TARDBP, MAPT(Tau), HTT, SNCA, FUS, ATXN3, SCN9A, SCN10A, CACNA1B, ATXN1, SCAl, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, and STAT3. Target genes can further include viral genes, such as hepatitis B and C virus genes, human immunodeficiency virus genes, herpes virus genes, etc. Exemplary diseases include, but are not limited to, viral diseases (e.g., HIV, HBV), neuromuscular diseases, bacterial infections, inflammatory and immune diseases, metabolic diseases, liver diseases, kidney diseases, cardiovascular diseases, ophthalmological diseases, pulmonary diseases, and rare diseases.

[0103] The composition comprising dsRNA can be delivered to subject by various routes.Exemplary routes are intraocular, intravaginal, intrarectal, intranasal, transdermal, subcutaneous administration, intravenous infusion, intraarterial, intralymphatic, intrabronchial, intrapleural, intraperitoneal, intracerebrospinal or intramuscular injection, intrapulmonary, intrathecal or intraventricular.The RNAi molecule of the present invention can be incorporated into pharmaceutical compositions suitable for administration.

[0104] In some embodiments, the subject is administered a dsRNA reagent subcutaneously to the subject in vivo.

[0105] In some embodiments, the subject in vivo is administered a dsRNA reagent intravenously to the subject. [Brief explanation of the drawings]

[0106] Sequence number 1 is FXII mRNA [NCBI Reference Sequence: NM_021489.3], the duplex AD# of the present invention is shown in Table 1 and shows its unmodified sense strand and antisense strand sequences, the duplex AD# of the present invention is shown in Table 2 and shows its modified sense strand and antisense strand sequences, the chemical modifications are represented as follows: uppercase letters represent 2'-fluoro modified nucleotides, lowercase letters represent 2'-OMe modified nucleotides, "*" represents a phosphorothioate inter-linkage, the delivery molecule used in in vivo studies is represented as "GLX-n" at the 3' or 5' end of each sense strand, and "Invab" represents an inverted abasic. [Figure 1] FIG. 1 is a schematic representation of the location of dsRNA sequences of the present invention. [Figure 2] FIG. 1 is a schematic representation of the location of a dsRNA sequence of the invention that contains one mismatched base. [Figure 3-1] FIG. 1 is a schematic representation of the location of dsRNA sequences of the invention containing one overhang. [Figure 3-2] FIG. 1 is a schematic representation of the location of dsRNA sequences of the invention containing one overhang. [Figure 4] This shows the FXII silencing effect of AD00127 of the present invention and positive controls AD00198 and AD00199 in mice after 14 days in vivo. DETAILED DESCRIPTION OF THE INVENTION

[0107] Some embodiments of the present invention, including but not limited to the following embodiments, include RNAi reagents capable of suppressing expression of a target gene, wherein the RNAi reagents are double-stranded ribonucleic acid (dsRNA) reagents, the dsRNA reagents comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprises a structure represented by formula (X) listed in the 3' to 5' direction: 3'-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5' expression(X) Of these, each N F represents a 2'-fluoro modified nucleotide, each N X each independently represents a modified or unmodified nucleotide, N X has no more than three 2'-fluoro modified nucleotides, n may be an integer from 0 to 7.

[0108] In some embodiments, an RNAi reagent for inhibiting expression of a target gene is provided, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent includes a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand includes a structure represented by formula (I) listed in the 3' to 5' direction: 3'-(N X ) n N X NX N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5' Formula (I) Of these, each N F represents a 2'-fluoro modified nucleotide, each N X each independently represents a modified or unmodified nucleotide, N X has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, n may be an integer from 0 to 7.

[0109] In some embodiments, the method includes providing an RNAi reagent capable of suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent including a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand includes a structure represented by formula (I-1) listed in the 3' to 5' direction; 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (I-1) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0110] In some embodiments, the dsRNA reagent comprises an antisense strand of formula (I-1) in which N M1 , N M2 , N M3 , N M4 , N M6 , N M7 and N M8 There are only three 2'-fluoro modified nucleotides in N M5 is not a 2'-fluoro modified nucleotide. As will be appreciated by those skilled in the art, by way of example and not limitation, in some non-limiting examples, N M1 , N M2 , N M3 are 2'-fluoro-modified nucleotides, and N M4 , N M5 , N M6 , N M7 and N M8means that none of the nucleotides in the antisense strand are 2'-fluoro modified nucleotides, and as can be understood by those skilled in the art, the nucleotides at positions 2, 12, 14, 16, and 18 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M2 , N M3 , N M6 are both 2'-fluoro modified nucleotides, and N M1 , N M4 , N M5 , N M7 and N M8 means that none of the nucleotides in the antisense strand are F-modified nucleotides, and as will be understood by those skilled in the art, the nucleotides at positions 2, 7, 12, 14, and 16 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M1 , N M3 , N M7 are both 2'-fluoro modified nucleotides, and N M2 , N M4 , N M5 , N M6 and N M8 means that none of the nucleotides in the antisense strand are F-modified nucleotides, and as can be understood by those skilled in the art, the nucleotides at positions 2, 5, 12, 14, and 18 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M1 , N M3 , N M6 are both 2'-fluoro modified nucleotides, and N M2 , N M4 , N M5 , N M7 and N M8 means that none of the nucleotides in the antisense strand are F-modified nucleotides, and as will be understood by those skilled in the art, positions 2, 7, 12, 14, and 18 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides in other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M2 , NM3 , N M7 are both 2'-fluoro modified nucleotides, and N M1 , N M4 , N M5 , N M6 and N M8 means that none of the nucleotides in the antisense strand are F-modified nucleotides, and as can be understood by those skilled in the art, the nucleotides at positions 2, 5, 12, 14, and 16 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M2 , N M4 , N M7 are both 2'-fluoro modified nucleotides, and N M1 , N M3 , N M5 , N M6 and N M8 indicates that none of the nucleotides are F-modified nucleotides, and as will be understood by those skilled in the art, positions 2, 5, 10, 14, and 16 in the antisense strand are 2'-fluoro-modified nucleotides, while nucleotides at other positions are not 2'-fluoro-modified nucleotides.

[0111] In some embodiments, the antisense strand of the dsRNA reagent comprises, in a 3' to 5' direction, Formula (II): 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5' Formula (II) Of these, each N F represents a 2'-fluoro modified nucleotide, NM1 , N M2 , N M3 , N M4 , N M5 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 and N M4 There are only two 2'-fluoro modified nucleotides in N M5 , N M7 and N M8 is not a 2'-fluoro modified nucleotide, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0112] In some non-limiting examples, the dsRNA reagent has an antisense strand represented by formula (II): M1 , N M2 , N M3 , N M4 , N M5 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 and N M4 There are only two 2'-fluoro modified nucleotides in N M5 , N M7 and N M8 is not a 2'-fluoro modified nucleotide. As will be appreciated by those skilled in the art, by way of example and not limitation, in some non-limiting examples, N M1 , N M2 are both 2'-fluoro modified nucleotides, and N M3 , N M4 , N M5 , N M7 and N M8means that none of the nucleotides in the antisense strand are 2'-fluoro modified nucleotides, and as can be understood by those skilled in the art, the nucleotides at positions 2, 7, 14, 16, and 18 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M2 , N M3 are both 2'-fluoro modified nucleotides, and N M1 , N M4 , N M5 , N M7 and N M8 means that none of the nucleotides in the antisense strand are 2'-fluoro modified nucleotides, and as can be understood by those skilled in the art, the nucleotides at positions 2, 7, 12, 14, and 16 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M1 , N M3 is a 2'-fluoro modified nucleotide, and N M2 , N M4 , N M5 , N M7 and N M8 means that none of the nucleotides in the antisense strand are 2'-fluoro modified nucleotides, and as can be understood by those skilled in the art, the nucleotides at positions 2, 7, 12, 14, and 18 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M2 , N M4 is a 2'-fluoro modified nucleotide, and N M1 , N M3 , N M5 , N M7 and N M8 indicates that none of the nucleotides are 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, positions 2, 7, 10, 14, and 16 in the antisense strand are 2'-fluoro modified nucleotides, while nucleotides at other positions are not 2'-fluoro modified nucleotides.

[0113] In some embodiments, the antisense strand of the dsRNA reagent comprises, listed in the 3' to 5' direction, Formula (III): 3'-(N L ) n N M1 N L N M2 N L N F N L N F N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (III) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M6 and N M7 There are only two 2'-fluoro modified nucleotides in N M4 , N M5 and N M8 is not a 2'-fluoro modified nucleotide, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0114] In some non-limiting examples, the dsRNA reagent has an antisense strand represented by formula (III): M1 , N M2 , N M4 , N M5 , N M6 , NM7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M6 and N M7 There are only two 2'-fluoro modified nucleotides in N M4 , N M5 and N M8 is not a 2'-fluoro modified nucleotide. As will be understood by those skilled in the art, by way of example and not limitation, in some non-limiting examples, N in the antisense strand of the dsRNA reagent represented by formula (III) M1 , N M7 are both 2'-fluoro modified nucleotides, and N M2 , N M4 , N M5 , N M6 and N M8 means that none of the nucleotides in the antisense strand represented by formula (III) of the dsRNA reagent are 2'-fluoro modified nucleotides. As can be understood by those skilled in the art, the nucleotides at positions 2, 5, 12, 14, and 18 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, the N M2 , N M6 are both 2'-fluoro modified nucleotides, and N M1 , N M4 , N M5 , N M7 and N M8 means that none of the nucleotides in the antisense strand represented by formula (III) of the dsRNA reagent are 2'-fluoro modified nucleotides. As can be understood by those skilled in the art, the nucleotides at positions 2, 7, 12, 14, and 16 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, the N M3 , N M7 are both 2'-fluoro modified nucleotides, and N M1 , N M4 , N M5 , N M6and N M8 means that none of the nucleotides in the antisense strand represented by formula (III) of the dsRNA reagent are 2'-fluoro modified nucleotides. As can be understood by those skilled in the art, the nucleotides at positions 2, 5, 12, 14, and 16 in the antisense strand are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, the N M4 , N M7 are both 2'-fluoro modified nucleotides, and N M1 , N M3 , N M5 , N M6 and N M8 indicates that none of the nucleotides are 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, positions 2, 5, 10, 14, and 16 in the antisense strand are 2'-fluoro modified nucleotides, while nucleotides at other positions are not 2'-fluoro modified nucleotides.

[0115] In some non-limiting examples, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent represented by formula (I-1) are 2'-fluoro-modified nucleotides, and it should be understood that the dsRNA reagent does not contain 2'-fluoro-modified nucleotides at other positions of the antisense strand.

[0116] As used herein, the position where counting starts from the first paired nucleotide from the 5' end of the antisense strand represented by formula (I-1) of the dsRNA reagent generally refers to the position where counting starts from the first paired nucleotide N L As a non-limiting example, as represented by formula (Ia), L ) n N M1 N L N F N L N F N L NF N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L (Position 1)-5' Formula (Ia), it should be further understood that the first mismatch in the dsRNA reagent is also one of the matches and is also referred to as position 1.

[0117] In some specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 2, 4, 10, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; as will be understood by those skilled in the art, in these specific embodiments, there are only five 2'-fluoro modified nucleotides in the antisense strand of the dsRNA reagent represented by formula (I-1).

[0118] In some embodiments, the dsRNA reagent comprises an antisense strand of formula (I-1) in which N M1 , N M2 , N M3 , N M5 , N M6 and N M8 There is only one 2'-fluoro modified nucleotide in N M4 , N M7 is not a 2'-fluoro modified nucleotide.

[0119] In some non-limiting examples, the dsRNA reagent has an antisense strand represented by formula (I-1), in which N M1 , N M2 , N M3 , N M5 , N M6 and N M8 There is only one 2'-fluoro modified nucleotide in N M4 , N M7 is not an F modified nucleotide. As will be appreciated by those skilled in the art, by way of example and not limitation, in some non-limiting examples, N M2 is a 2'-fluoro modified nucleotide, and N M1 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 means that none of the nucleotides is a 2'-F modified nucleotide. As can be understood by those skilled in the art, the nucleotides at positions 2, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5' end) represented by formula (I-1) of the dsRNA reagent are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M3 is a 2'-fluoro modified nucleotide, and N M1 , N M2 , N M4 , N M5 , N M6 , N M7 and N M8means that none of the nucleotides is a 2'-fluoro modified nucleotide. As can be understood by those skilled in the art, the nucleotides at positions 2, 12, and 14 of the antisense strand (counting from the first paired nucleotide from the 5' end) represented by formula (I-1) of the RNAi reagent are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M5 are both 2'-fluoro modified nucleotides, and N M1 , N M2 , N M3 , N M4 , N M6 , N M7 and N M8 means that none of the nucleotides is a 2'-fluoro modified nucleotide. As can be understood by those skilled in the art, the nucleotides at positions 2, 8, and 14 of the antisense strand (counting from the first paired nucleotide from the 5' end) represented by formula (I-1) of the dsRNA reagent are 2'-fluoro modified nucleotides, and the nucleotides at other positions are not 2'-fluoro modified nucleotides. In some other non-limiting examples, N M8 are both 2'-fluoro modified nucleotides, and N M1 , N M2 , N M3 , N M4 , N M5 , N M6 and N M7 means that none of the nucleotides are 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, the nucleotides at positions 2, 4, and 14 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides, while the nucleotides at other positions are not 2'-fluoro modified nucleotides. As will be understood by those skilled in the art, in specific examples of these dsRNA reagents, only three 2'-fluoro modified nucleotides are present in the antisense strand represented by formula (I-1).

[0120] In some embodiments, the antisense strand of the dsRNA reagent comprises, listed in the 3' to 5' direction, Formula (IV): 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (IV) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M5 , N M6 and N M8 There is only one 2'-fluoro modified nucleotide in N M4 , N M7 is not a 2'-fluoro modified nucleotide, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0121] In some specific embodiments, the nucleotides at positions 2, 4, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 2, 8, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 2, 12, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 2, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 2, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 2, 4, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro modified nucleotides. As will be understood by those skilled in the art, in these specific embodiments, there are only three 2'-fluoro modified nucleotides in the antisense strand of the dsRNA reagent represented by formula (IV). In some more specific embodiments, the nucleotides at positions 2, 6, and 14 of the antisense strand of the dsRNA reagent (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro modified nucleotides.

[0122] In some embodiments, the method includes providing an RNAi reagent capable of suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent including a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand includes a structure represented by formula (I-2) listed in the 3' to 5' direction; 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N M9 N M4 N M10 N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (I-2) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N M10 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N M10 has only three 2'-fluoro modified nucleotides, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0123] In some specific embodiments, the nucleotides at positions 2, 7, 11, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 11, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 11, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro modified nucleotides; In some specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 8, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 9, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides.

[0124] In some embodiments, the method includes providing an RNAi reagent capable of suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprises a structure represented by formula (I') listed in the 3' to 5' direction; 3'-(N L ) n N M1 N L N F N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5' Formula (I') Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M3 , N M4 , N M5 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M3 , N M4 , N M5 , N M7 and N M8 has no more than one 2'-fluoro modified nucleotide, each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7.

[0125] In some more specific embodiments, the antisense strand of the dsRNA reagent represented by formula (I') contains NM1 , N M3 , N M4 , N M5 , N M7 and N M8 has no more than one 2'-fluoro modified nucleotide, and as will be understood by those skilled in the art, N M1 , N M3 , N M4 , N M5 , N M7 and N M8has only one or no 2'-fluoro modified nucleotide, i.e., there are only four or five 2'-fluoro modified nucleotides in formula (I'), and positions 2, 7, 14 and 16 in the antisense strand of formula (I') have a common 2'-fluoro modified nucleotide. In some specific embodiments, the nucleotides at positions 2, 5, 7, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 4, 7, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 8, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 8, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; In some specific embodiments, the nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 14, 16, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides; in some specific embodiments, the nucleotides at positions 2, 7, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides.In some embodiments, N of the antisense strand of the dsRNA reagent represented by formula (X) and / or formula (I). X One or more of the nucleotides are modified nucleotides independently selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides (MOEs), abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate-modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino-modified nucleotides, phosphoramidates, or unnatural bases including nucleotides.

[0126] In some embodiments, the dsRNA reagents of the present invention comprise N-type nucleotides represented by formula (I-1), (I-2), (I'), (II), (III), and / or (IV). LOne or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural bases including nucleotides.

[0127] In some embodiments, the N in the antisense strand of the dsRNA reagent of the present invention represented by formula (I-1), (I-2), (I'), formula (II), formula (III) and / or formula (IV) L The nucleotide is a modified nucleotide selected from 2'-O-methyl modified nucleotides, GNA, LNA, UNA, or Invab. In some preferred embodiments, the N in the antisense strand of the dsRNA reagent of the present invention represented by formula (I) L One or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides.

[0128] In some embodiments, the N in the antisense strand of the dsRNA reagent of the present invention represented by formula (I-1), (I-2), (I'), formula (II), formula (III) and / or formula (IV) M1 , N M2 , N M3 , N M4 , N M5 , NM6 , N M7 , N M8 , N M9 and N M10 are modified nucleotides independently selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), open-ring nucleotides (UNAs), ethylene glycol nucleotides (GNAs), bicyclic nucleotides (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate-modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino-modified nucleotides, phosphoramidates, or unnatural bases including nucleotides. In some embodiments, N in the antisense strand of the dsRNA reagent of the present invention represented by formula (I-1) M1 , N M2 , N M4 , N M5 , N M6 , N M7 and / or N M8 is preferably a 2'-O-methyl modified nucleotide, UNA, GNA, LNA, rather than a 2'-fluoro modified nucleotide.

[0129] In some non-limiting examples, the dsRNA reagents of the present invention comprise an antisense strand of formula (III) in which N M1 , N M7 is a 2'-fluoro modified nucleotide, and N M2 , N M4 , N M5 , N M6 and / or N M8indicates that the modified or unmodified nucleotide is independently selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural bases including nucleotides. In some preferred embodiments, the N in the dsRNA reagent M2 , N M4 , N M5 , N M6 and / or N M8 indicates that one or more of the modified or unmodified nucleotides are independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, the N M2 , N M4 , N M5 , N M6 and / or N M8 indicates that, in a modified or unmodified nucleotide, it is more preferably a 2'-O-methyl modified nucleotide.

[0130] In some non-limiting examples, the dsRNA reagents of the present invention comprise an antisense strand of formula (III) in which N M2 , N M6 is a 2'-fluoro modified nucleotide, and N M1 , NM4 , N M5 , N M7 and / or N M8 indicates that the modified or unmodified nucleotide is independently selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural bases including nucleotides. In some preferred embodiments, the N M1 , N M4 , N M5 , N M7 and / or N M8 One or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, the N in the dsRNA reagent M1 , N M4 , N M5 , N M7 and / or N M8 The nucleotide is more preferably a 2'-O-methyl modified nucleotide.

[0131] N in the antisense strand of the dsRNA reagent of the present invention represented by formula (II) or (III) M1 , N M2 , N M3 , NM4 , N M5 , N M6 , N M7 and / or N M8 It should be understood that any of the above may have such modifying properties.

[0132] In some non-limiting examples, the N in the antisense strand of formula (IV) of the dsRNA reagent of the present invention M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 each independently represents a modified or unmodified nucleotide, N M1 is one 2'-fluoro modified nucleotide, and N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 is not a 2'-fluoro modification, but an N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8The nucleotide is a modified nucleotide selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural base containing nucleotides. In some preferred embodiments, the N in the antisense strand of the dsRNA reagent represented by formula (IV) M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 One or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, the dsRNA reagent comprises an N in the antisense strand of formula (IV): M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 The nucleotide is a 2'-O-methyl modified nucleotide.

[0133] In some non-limiting examples, the N in the antisense strand of formula (IV) of the dsRNA reagent of the present invention M1 , N M2 , NM3 , N M4 , N M5 , N M6 , N M7 and / or N M8 each independently represents a modified or unmodified nucleotide, N M2 is one 2'-fluoro modified nucleotide, and N M1 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 is not a 2'-fluoro modified nucleotide, but N M1 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 The nucleotide is a modified nucleotide selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural base containing nucleotides. In some preferred embodiments, the N in the antisense strand of the dsRNA reagent represented by formula (IV) M1 , N M3 , N M4 , N M5 , N M6 , N M7and / or N M8 One or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, the dsRNA reagent comprises an N in the antisense strand of formula (IV): M1 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 The nucleotide is a 2'-O-methyl modified nucleotide.

[0134] In some non-limiting examples, the N in the antisense strand of the dsRNA reagent represented by formula (IV) M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 each independently represents a modified or unmodified nucleotide, N M3 is one 2'-fluoro modified nucleotide, and N M1 , N M2 , N M4 , N M5 , N M6 , N M7 and / or N M8 is not a 2'-fluoro modified nucleotide, but N M1 , N M2 , N M4 , N M5 , N M6 , N M7 and / or N M8The nucleotide is a modified nucleotide selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural base containing nucleotides. In some preferred embodiments, the N in the antisense strand of the dsRNA reagent represented by formula (IV) M1 , N M2 , N M4 , N M5 , N M6 , N M7 and / or N M8 One or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, the dsRNA reagent comprises an N in the antisense strand of formula (IV): M1 , N M2 , N M4 , N M5 , N M6 , N M7 and / or N M8 The nucleotide is a 2'-O-methyl modified nucleotide.

[0135] In some non-limiting examples, the N in the antisense strand of the dsRNA reagent represented by formula (IV) M1 , N M2 , NM3 , N M4 , N M5 , N M6 , N M7 and / or N M8 each independently represents a modified or unmodified nucleotide, N M6 is one 2'-fluoro modified nucleotide, and N M1 , N M2 , N M3 , N M4 , N M5 , N M7 and / or N M8 is not a 2'-fluoro modified nucleotide, but N M1 , N M2 , N M4 , N M5 , N M6 , N M7 and / or N M8 The nucleotide is a modified nucleotide selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural base containing nucleotides. In some preferred embodiments, the N in the antisense strand of the dsRNA reagent represented by formula (IV) M1 , N M2 , N M4 , N M5 , N M6 , N M7and / or N M8 One or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, the dsRNA reagent comprises an N in the antisense strand of formula (IV): M1 , N M2 , N M4 , N M5 , N M6 , N M7 and / or N M8 The nucleotide is a 2'-O-methyl modified nucleotide.

[0136] N in the antisense strand of the dsRNA reagent of the present invention represented by formula (IV) M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 It should be understood that any of the above may have such modifying properties.

[0137] In some non-limiting examples, the N in the antisense strand of the dsRNA reagent of the present invention represented by formula (I-2) M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and / or N M10 each independently represents a modified or unmodified nucleotide, N M2 , N M6 , N M9 are each one 2'-fluoro modified nucleotide, and N M1 , N M3 , N M4 , N M5 , N M7 , N M8 and / or N M10is not a 2'-fluoro modified nucleotide, but is a modified nucleotide selected from a 2'-O-methyl modified nucleotide, a 2'-deoxynucleotide, a 2',3'-seco nucleotide mimic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a bicyclic nucleic acid (BNA), a 2'-F-arabinonucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxynucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate group modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, a 2'-amino modified nucleotide, a phosphoramidate, or a non-natural base containing nucleotide. In some preferred embodiments, the N in the antisense strand of the dsRNA reagent, represented by (I-2), M1 , N M3 , N M4 , N M5 , N M7 , N M8 and / or N M10 One or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, the dsRNA reagent is N in the antisense strand represented by (I-2). M1 , N M3 , N M4 , N M5 , N M7 , N M8 and / or N M108 The nucleotide is a 2'-O-methyl modified nucleotide. It should be understood that the dsRNA reagent of the present invention has such a modification characteristic in the antisense strand represented by formula (I-2). In some non-limiting examples, the N in the antisense strand of formula (I') of the dsRNA reagent of the present invention M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 each independently represent a modified or unmodified nucleotide, wherein the modified nucleotide is selected from a 2'-O-methyl modified nucleotide, a 2'-deoxynucleotide, a 2',3'-seco nucleotide mimic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a bicyclic nucleic acid (BNA), a 2'-F-arabinonucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxynucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate group modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, a 2'-amino modified nucleotide, a phosphoramidate, or a non-natural base containing nucleotide. In some preferred embodiments, the N in the antisense strand of the dsRNA reagent, represented by (I'), M1 , N M3 , N M4 , N M5 , N M7 and / or N M8 One or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, the dsRNA reagent is N in the antisense strand, represented by (I'). M1 , N M3 , N M4 , N M5 , N M7and / or N M8 In some non-limiting examples, the N in the antisense strand of the dsRNA reagent of the present invention represented by formula (I') is a 2'-O-methyl modified nucleotide. M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 each independently represent a modified or unmodified nucleotide, wherein the modified nucleotide is selected from a 2'-O-methyl modified nucleotide, a 2'-deoxynucleotide, a 2',3'-seco nucleotide mimic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a bicyclic nucleic acid (BNA), a 2'-F-arabinonucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxynucleotide, a 2'-amino modified nucleotide, a 2'-alkyl modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate group modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, a 2'-amino modified nucleotide, a phosphoramidate, or a non-natural base containing nucleotide. In some preferred embodiments, the N in the antisense strand of the dsRNA reagent, represented by (I'), M7 are each one 2'-fluoro modified nucleotide, and N M1 , N M2 , N M3 , N M4 , N M5 , N M6 and / or N M8 is not a 2'-fluoro modified nucleotide, but N M1 , N M2 , N M3 , N M4 , NM5 , N M6 and / or N M8 One or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, the dsRNA reagent comprises an N in the antisense strand, represented by (I'). M1 , N M2 , N M3 , N M4 , N M5 , N M6 and / or N M8 The nucleotide is a 2'-O-methyl modified nucleotide.

[0138] In some embodiments, the sense strand of the dsRNA reagent that is complementary or essentially complementary to the antisense strand of Formula (I) is entirely or essentially modified nucleotides. In some embodiments, the sense strand of the dsRNA reagent is entirely modified nucleotides. The nucleotide of the sense strand is a modified nucleotide selected from a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-deoxynucleotide, a 2',3'-seco nucleotide mimic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a bicyclic nucleic acid (BNA), a 2'-F-arabinonucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxynucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate-modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, a 2'-amino-modified nucleotide, a phosphoramidate, or a non-natural base containing nucleotide.

[0139] In some embodiments, the sense strand of the dsRNA reagent that is complementary or essentially complementary to the antisense strand of Formula (I') is entirely or essentially modified nucleotides. In some embodiments, the sense strand of the dsRNA reagent is entirely modified nucleotides. The nucleotide of the sense strand is a modified nucleotide selected from a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-deoxynucleotide, a 2',3'-seco nucleotide mimic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), a glycol nucleic acid nucleotide (GNA), a bicyclic nucleic acid (BNA), a 2'-F-arabinonucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxynucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate-modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, a 2'-amino-modified nucleotide, a phosphoramidate, or a non-natural base containing nucleotide.

[0140] In some embodiments, all or essentially all of the nucleotides of the sense and antisense strands described in the dsRNA reagents of the invention are modified nucleotides.

[0141] In some embodiments, the dsRNA reagent has a sense strand that is complementary or essentially complementary to the antisense strand of Formula (I), and the length of the complementary or essentially complementary region is between 18 and 25 nucleotides. In some embodiments, the length of the complementary or essentially complementary region of the dsRNA reagent is 18 to 23 nucleotides. In some embodiments, the length of the complementary or essentially complementary region of the dsRNA reagent is 19 to 21 nucleotides. In other examples, for example, the length of the complementary or essentially complementary region may be 18 to 25 nucleotides, 19 to 25 nucleotides, 19 to 23 nucleotides, or 19 to 21 nucleotides. In other examples, in some embodiments, the length of the complementary or essentially complementary region is 18, 19, 20, or 21 nucleotides.

[0142] In some embodiments, the dsRNA reagent has a sense strand that is complementary or essentially complementary to the antisense strand of Formula (X), and the length of the complementary or essentially complementary region is between 18 and 25 nucleotides. In some embodiments, the length of the complementary or essentially complementary region of the dsRNA reagent is 18 to 23 nucleotides. In some embodiments, the length of the complementary or essentially complementary region of the dsRNA reagent is 19 to 21 nucleotides. In other examples, for example, the length of the complementary or essentially complementary region may be 18 to 25 nucleotides, 19 to 25 nucleotides, 19 to 23 nucleotides, or 19 to 21 nucleotides. In other examples, in some embodiments, the length of the complementary or essentially complementary region is 18, 19, 20, or 21 nucleotides.

[0143] In some embodiments, the dsRNA reagent has a sense strand that is perfectly complementary to the antisense strand of Formula (X).

[0144] In some embodiments, the dsRNA reagent has a sense strand that is perfectly complementary to the antisense strand of Formula (I).

[0145] In some embodiments, the antisense strand of formula (X) of the dsRNA reagent is fully or essentially complementary to the target gene.

[0146] In some embodiments, the antisense strand of the dsRNA reagent of Formula (I) is fully or essentially complementary to the target gene.

[0147] In some embodiments, the dsRNA reagents of the present invention contain no mismatches. In certain embodiments, the target gene dsRNA reagents of the present invention contain no more than one mismatch (such mismatches do not affect the starting position for counting mismatches). In some embodiments, the dsRNA reagents of the present invention contain no more than two mismatches. In certain embodiments, the dsRNA reagents of the present invention contain no more than three mismatches. In some embodiments of the present invention, the antisense strand of the dsRNA reagent contains a mismatch with a target sequence that is not located in the center of the complementary region. In some embodiments, the antisense strand of the dsRNA reagent contains 1, 2, 3, 4, 5, or more mismatches located within the last 5, 4, 3, 2, or 1 nucleotide at either or both of the 5' or 3' ends of the complementary region.

[0148] In some embodiments, each strand of a dsRNA reagent of the invention is 30 nucleotides or less in length.

[0149] In some embodiments, each strand of a dsRNA reagent of the invention is 25 nucleotides or less in length.

[0150] In some embodiments, each strand of a dsRNA reagent of the invention is 23 nucleotides or less in length.

[0151] In some embodiments, each strand of a dsRNA reagent of the invention is 19, 20, or 21 nucleotides in length.

[0152] In one embodiment, both the sense and antisense strands of the dsRNA reagents of the invention have two blunt ends, e.g., each strand of the dsRNA reagent is perfectly paired to form a blunt-ended structure.

[0153] In one embodiment, the antisense strand of the dsRNA reagent, Formula (I), has an overhang of 1 to 5 unpaired nucleotides at its 3'-end, e.g., an overhang of 1, 2, 3, 4, or 5 unpaired nucleotides. These overhangs may be the result of one strand being longer than the other, or may be the result of two strands of the same length interleaved. The overhangs may form mismatches with the target mRNA, may be complementary to the target gene sequence, or may be other sequences. The first and second strands may be linked, for example, via additional bases to form a hairpin, or may be linked via other abasic linkers.

[0154] In certain embodiments, the sense strand complementary or partially complementary to the antisense strand of the dsRNA reagent formula (I) has a blunt end at the 3'-end and / or 5'-end.

[0155] In some embodiments, the sense strand complementary or partially complementary to the antisense strand of the dsRNA reagent Formula (I) has an overhang of 1 to 5 unpaired nucleotides at the 3'-end and / or 5'-end, e.g., an overhang of 1, 2, 3, 4, or 5 unpaired nucleotides. In certain embodiments, the sense strand complementary or partially complementary to the antisense strand of the dsRNA reagent Formula (I) has a blunt end at the 3'-end and / or 5'-end.

[0156] In some embodiments, the unpaired nucleotide overhangs of the sense strand and / or antisense strand of the dsRNA reagents of the invention are 2 to 5 nucleotides in length, 1 to 5 nucleotides in length, 2 to 5 nucleotides in length, 1 to 4 nucleotides in length, 2 to 4 nucleotides in length, 1 to 3 nucleotides in length, 2 to 3 nucleotides in length, or 1 to 2 nucleotides in length.

[0157] In one embodiment, the nucleotides in the overhanging end region of a dsRNA reagent of the invention may each be independently selected from one or more modified or unmodified nucleotides, and modified nucleotides include 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), and ethylene glycol nucleic acid nucleotides (glycol nucleic acid nucleotides). The bases include, but are not limited to, unnatural bases including nucleotides, GNAs, bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates or nucleotides.

[0158] In one embodiment, both ends of the overhang in the sense strand, the antisense strand, or both strands of the overhang region of the dsRNA reagent of the present invention may be phosphorylated.

[0159] In one embodiment, the overhang of the dsRNA reagent of the invention is present at the 3'-end or 5'-end of the sense strand, the antisense strand, or both strands. In one embodiment, the 3'-overhang is present on the antisense strand. In one embodiment, the 5'-overhang is present on the sense strand.

[0160] In one embodiment, the dsRNA reagent of the present invention can contain only one single overhang, which can enhance the interference activity of the dsRNA without affecting its overall stability. For example, the single-stranded overhang can be located at the 5'-end of the sense strand, or alternatively, at the 3'-end of the antisense strand, and the corresponding dsRNA can have a blunt end located at the 5'-end of the antisense strand (or the 3'-end of the sense strand), or vice versa.

[0161] In one embodiment, the dsRNA reagents of the invention are blunt ended at the 5'-end of the antisense strand or the 3'-end of the sense strand.

[0162] In some embodiments, the dsRNA reagents of the invention contain at least one phosphorothioate internucleotide linkage.

[0163] In some embodiments, the sense strand of a dsRNA reagent of the invention comprises at least one phosphorothioate internucleotide linkage.

[0164] In some embodiments, the antisense strand of a dsRNA reagent of the invention comprises at least one phosphorothioate internucleotide linkage.

[0165] In some embodiments, the sense strand and / or antisense strand described in the dsRNA reagents of the invention comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphorothioate internucleotide linkages.

[0166] In one embodiment, the sense strand of a dsRNA reagent of the invention comprises 1 to 10 blocks having 2 to 10 phosphorothioate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of these phosphorothioate internucleotide linkages is located at any position in the oligonucleotide sequence, and the sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or an antisense strand comprising phosphorothioate or phosphate linkages.

[0167] In one embodiment, the antisense strand of a dsRNA reagent of the invention comprises 1 to 10 blocks having 2 to 10 phosphorothioate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of these phosphorothioate internucleotide linkages is located at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand containing any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or a sense strand containing phosphorothioate or phosphate linkages.

[0168] In one example, the dsRNA reagents of the invention further comprise one or more phosphorothioate internucleotide linkage modifications in 1 to 10 double-stranded internal regions of each of the sense and / or antisense strands. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at positions 8 to 16 of the double-stranded region, counting from the 3' end of the sense strand, can be linked by phosphorothioate internucleotide linkages, and the dsRNA optionally further comprises one or more phosphorothioate internucleotide linkage modifications at 1 to 10 terminal positions.

[0169] In one embodiment, a dsRNA reagent of the invention further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modifications at positions 1-5 of the sense strand, and one to five phosphorothioate or methylphosphonate internucleotide linkage modifications at positions 18-23 (as used herein, counting from the 3' end paired with the sense strand), and one to two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand, and one to five at positions 18-23 (as used herein, counting from the blunt 5' end of the antisense strand). In one embodiment, a dsRNA reagent of the invention comprises one or two phosphorothioate internucleotide linkage modifications at the 3'-end and / or 5'-end of the sense strand or antisense strand. As is understood in the art, the 3'-end and / or 5'-end refer to a sense strand or an antisense strand of any length counted sequentially from the first nucleotide at the 3'-end or 5'-end. As a non-limiting example, when the 5'-end of an antisense strand has two phosphorothioate internucleotide linkage modifications, this means that the antisense strand has phosphorothioate internucleotide linkage modifications between the first and second nucleotides, and between the second and third nucleotides, which are paired from the 5'-end of the sense strand, respectively.

[0170] In one embodiment, the dsRNA reagent of the present invention comprises a phosphorothioate internucleotide bond modification in the overhanging end region. For example, the overhanging end region comprises two nucleotides with one phosphorothioate internucleotide bond between them. The overhanging end nucleotide may be linked to the terminal paired nucleotide in the double-stranded region by an internucleotide bond modification, and as understood in the art, unless otherwise specified, the linkage between the overhanging end nucleotide and the terminal paired nucleotide in the double-stranded region is the linkage between the overhanging end nucleotide and the terminal N L or N L" refers to a linkage with a '. For example, at least two, three, four, or all of the overhanging nucleotides can be linked by phosphorothioate internucleotide linkages, and optionally, there can be another phosphorothioate internucleotide linkage linking the overhanging nucleotide to the paired nucleotide adjacent to the overhanging nucleotide. For example, there can be at least two phosphorothioate internucleotide linkages between the three terminal nucleotides, two of which are overhanging nucleotides and the third is a paired nucleotide adjacent to the overhanging nucleotide. Preferably, the three terminal nucleotides can be located at the 3' end of the antisense strand. In one embodiment, the dsRNA reagent of the present invention also includes the phosphorothioate internucleotide linkage modification in the overhanging end region of the sense strand.

[0171] In some embodiments, the sense strand and / or antisense strand of a dsRNA reagent of the invention has one or two inverted abasic residue nucleotides. In some embodiments, the 3' and / or 5' ends of the sense strand and / or antisense strand of a dsRNA reagent of the invention contain one or two inverted abasic residues. In some embodiments, the sense strand of a dsRNA reagent of the invention contains one inverted abasic residue at the 3'-end.

[0172] In some embodiments, SEQ ID NO: 1 is FXII mRNA [NCBI Reference Sequence: NM_021489.3, the unmodified double-stranded AD00127.um sense strand is AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 2), the antisense strand is uUcaaAgcacuuuAuUgaguu (SEQ ID NO: 3), the complementary Pos(20) is at position 1938 in NM_021489.3, the unmodified double-stranded AD00549.um sense strand is GCCCAAGAAAGUGAAAGACCA (SEQ ID NO: 4), the antisense strand is uGgucuUucacUuUcUugggc (SEQ ID NO: 5), the complementary Pos(20) is at position 307 in NM_021489.3.

[0173] According to a further aspect of the present invention, there is further provided an RNAi reagent for suppressing the expression of another target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the sense strand having 18 to 40 nucleotides, and the sense strand comprises a structure represented by formula (V) listed in the 5' to 3' direction: 5'-(N' L ) n ' N ' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' Formula (V) Of these, each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has at least two 2'-fluoro modified nucleotides present, In formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and the total number of 2'-fluoro modified nucleotides is six or less; Each N' L represents independently a modified or unmodified nucleotide, n' may be an integer of 0-7.

[0174] In some embodiments, an RNAi reagent for suppressing expression of a target gene is provided, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent includes a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the sense strand having 18 to 40 nucleotides, and the sense strand includes a structure represented by formula (V') listed in the 5' to 3' direction: 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' expression (V') Of these, each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has only two 2'-fluoro modified nucleotides, Each N' L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n' may be an integer of 0-7.

[0175] In some non-limiting examples, N' in the sense strand of the dsRNA reagent represented by formula (V) N1 , N' N2 , N' N3 , N' N4 , N' N5 and / or N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 are all 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, the nucleotides at positions 11, 14, and 15 of the sense strand (counting from the first paired nucleotide from the 3' end) of the dsRNA reagent represented by formula (V) are 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, the dsRNA reagent may have 2'-fluoro modified nucleotides at other positions in the sense strand, but the total number of 2'-fluoro modified nucleotides is six or less, and there is no motif of three or more consecutive 2'-fluoro modified nucleotides. In some non-limiting examples, N' in the sense strand of the dsRNA reagent represented by formula (V') N1 , N' N2 , N' N3 , N' N4 , N' N5 and / or N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 are both 2'-fluoro modified nucleotides, and N' N3 , N' N4 , N' N5 and N' N6 are not 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, the nucleotides at positions 11, 14, and 15 of the sense strand (counting from the first paired nucleotide from the 3' end) of the dsRNA reagent represented by formula (V) are 2'-fluoro modified nucleotides, while the nucleotides at other positions are not 2'-fluoro modified nucleotides.

[0176] In some non-limiting examples, N' in the sense strand of the dsRNA reagent represented by formula (V) N3 , N' N6 are all 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end) of the dsRNA reagent represented by formula (V) are 2'-fluoro modified nucleotides, and the dsRNA reagent may have 2'-fluoro modified nucleotides at other positions in the sense strand, but the total number of 2'-fluoro modified nucleotides is six or less, and there is no motif of three or more consecutive 2'-fluoro modified nucleotides. In some non-limiting examples, N' in the sense strand of the dsRNA reagent represented by formula (V') N1 , N' N2 , N' N3 , N' N4 , N' N5 and / or N' N6 each independently represents a modified or unmodified nucleotide, and N' N3 , N' N6 are both 2'-fluoro modified nucleotides, and N' N1 , N' N2 , N' N4 and N' N5 are not 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, the nucleotides at positions 8, 11, and 13 of the sense strand (counting starting from the first paired nucleotide from the 3' end) of the dsRNA reagent represented by formula (V) are 2'-fluoro modified nucleotides, but the nucleotides at other positions are not 2'-fluoro modified nucleotides.

[0177] In some non-limiting examples, N' in the sense strand of the dsRNA reagent represented by formula (V) N1 , N' N2 , N' N3 , N' N4 , N' N5 and / or N' N6 each independently represents a modified or unmodified nucleotide, and N' N3, N' N5 are all 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, the nucleotides at positions 9, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end) of the dsRNA reagent represented by formula (V) are 2'-fluoro modified nucleotides, and the dsRNA reagent may have 2'-fluoro modified nucleotides at other positions in the sense strand, but the total number of 2'-fluoro modified nucleotides is six or less, and there is no motif of three or more consecutive 2'-fluoro modified nucleotides. In some non-limiting examples, N' in the sense strand of the dsRNA reagent represented by formula (V') N1 , N' N2 , N' N3 , N' N4 , N' N5 and / or N' N6 each independently represents a modified or unmodified nucleotide, and N' N3 , N' N5 are both 2'-fluoro modified nucleotides, and N' N1 , N' N2 , N' N4 and N' N6 are not 2'-fluoro modified nucleotides, and as will be understood by those skilled in the art, the nucleotides at positions 9, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end) of the dsRNA reagent represented by formula (V) are 2'-fluoro modified nucleotides, while the nucleotides at other positions are not 2'-fluoro modified nucleotides.

[0178] In some specific embodiments, the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides; it is understood that the dsRNA reagent may have 2'-fluoro-modified nucleotides at other positions in the sense strand, but the total number of 2'-fluoro-modified nucleotides is six or less, and there is no motif of three consecutive 2'-fluoro-modified nucleotides. In some specific embodiments, the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides; it is understood that the dsRNA reagent does not have 2'-fluoro-modified nucleotides at other positions in the sense strand.

[0179] It should be understood that the motif of three consecutive 2'-fluoro modified nucleotides means that three consecutive nucleotides in one strand of the dsRNA reagent are simultaneously modified with 2'-fluoro, e.g., in the sequence XYYYX, all Y's are 2'-fluoro modified nucleotides, but the X's may be differently modified.

[0180] As used herein, the position counting from the first paired nucleotide from the 3' end of the sense strand of the formula (V) of the dsRNA reagent generally refers to the first paired nucleotide N' from the 3' end of the sense strand. L As a non-limiting example, Np'-5'-(N' L ) n N L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' LN' L N' L N' L N' L N' L N' L (Position 1)-3' Formula (Va), and it should be understood that the first mismatch in the dsRNA reagent is also one of the mismatches, also referred to as position 1.

[0181] In some specific embodiments, the nucleotides at positions 9, 11, and 13 of the Formula (V') sense strand of the dsRNA reagent (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 9, 11, and 12 of the Formula (V') sense strand of the dsRNA reagent (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 8, 11, and 13 of the Formula (V') sense strand of the dsRNA reagent (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 11, 12, and 14 of the Formula (V') sense strand of the dsRNA reagent (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro modified nucleotides. In some specific embodiments, the nucleotides at positions 11, 12, and 15 of the sense strand of the dsRNA reagent of formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro modified nucleotides. As will be understood by those skilled in the art, in these specific embodiments, there are only three 2'-fluoro modified nucleotides in the sense strand of the dsRNA reagent of formula (V').

[0182] According to another aspect of the present invention, there is provided an RNAi reagent for suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the sense strand having 18 to 40 nucleotides, and the sense strand comprises a structure represented by formula (IX) listed in the 5' to 3' direction: 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' N7 N' L N' L N' L N' L N' L N' L -3' expression (IX) Of these, each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and N' N7 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and N' N7 has at least two 2'-fluoro modified nucleotides present, in formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (V), there are no more than six total 2'-fluoro modified nucleotides; Each N' Lrepresents independently a modified or unmodified nucleotide, n' may be an integer of 0-7.

[0183] In some specific embodiments, the nucleotides at positions 7, 9, 11, and 13 of the Formula (IX) sense strand of the dsRNA reagent (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro modified nucleotides. As will be understood by those skilled in the art, in these specific embodiments, there are only four 2'-fluoro modified nucleotides in the Formula (IX) sense strand of the dsRNA reagent.

[0184] In some embodiments, N' in the sense strand of the dsRNA reagent represented by Formula (V) and / or Formula (IX) L One or more of the nucleotides are modified nucleotides selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate-modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino-modified nucleotides, phosphoramidates, or unnatural base-containing nucleotides. In some embodiments, the N' in the dsRNA reagent L The nucleotide is a modified nucleotide selected from a 2'-O-methyl modified nucleotide, UNA, or Invab.

[0185] In some embodiments, the dsRNA reagent has a sense strand represented by Formula (V) and / or Formula (IX), and in some non-limiting embodiments, N' in the sense strand of the dsRNA reagent has a sense strand represented by Formula (V). N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and / or N' N7 each independently represent a modified or unmodified nucleotide, and the modified nucleotide is independently selected from a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-deoxynucleotide, a 2',3'-seco nucleotide mimic, a locked nucleotide (LNA), an open-ring nucleotide (UNA), an ethylene glycol nucleotide (GNA), a bicyclic nucleotide (BNA), a 2'-F-arabinonucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxynucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate-modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, a 2'-amino-modified nucleotide, a phosphoramidate, or an unnatural base-containing nucleotide. In some embodiments, N' in the sense strand of the dsRNA reagent of the present invention represented by formula (V') N1 , N' N2 , N' N3 , N' N4 , N' N5 and / or N' N6 is preferably a 2'-O-methyl modified nucleotide, UNA, GNA, LNA, rather than a 2'-fluoro modified nucleotide.

[0186] In some non-limiting examples, N' in the sense strand of the dsRNA reagent represented by formula (V') N3 , N'N6 are both 2'-fluoro modified nucleotides, and N' N1 , N' N2 , N' N4 and N' N5 are not 2'-fluoro modified nucleotides. N1 , N' N2 , N' N4 and N' N5 are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural bases including nucleotides. In some preferred embodiments, the N' in the dsRNA reagent N1 , N' N2 , N' N4 and N' N5 indicates that one or more of the modified or unmodified nucleotides are independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, N' in the dsRNA reagent N1 , N' N2 , N' N4 and N' N5 indicates that the modified or unmodified nucleotide is a 2'-O-methyl modified nucleotide.

[0187] In some non-limiting examples, N' in the sense strand of the dsRNA reagent represented by formula (V') N3 , N' N5 are both 2'-fluoro modified nucleotides, and N' N1 , N' N2 , N' N4 and N' N6 are not 2'-fluoro modified nucleotides. N1 , N' N2 , N' N4 and N' N6 are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural bases including nucleotides. In some preferred embodiments, the N' in the dsRNA reagent N1 , N' N2 , N' N4 and N' N6 indicates that one or more of the modified or unmodified nucleotides are independently selected from 2'-O-methyl modified nucleotides, UNA, GNA, and LNA. In some preferred embodiments, N' in the dsRNA reagent N1 , N' N2 , N' N4 and N' N6indicates that the modified or unmodified nucleotide is a 2'-O-methyl modified nucleotide.

[0188] In some embodiments, the antisense strand complementary or essentially complementary to the Formula (V) sense strand described in the dsRNA reagent is entirely or essentially modified nucleotides. In some embodiments, the antisense strand described in the dsRNA reagent is entirely modified nucleotides. The nucleotide of the antisense strand is a modified nucleotide selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNA), unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate-modified nucleotides, cholesterol derivatives, or terminal nucleotides linked to a dodecanoic acid bisdecanamide group, 2'-amino-modified nucleotides, phosphoramidates, or unnatural bases including nucleotides.

[0189] In some embodiments, all or essentially all of the nucleotides of the sense and antisense strands described in the dsRNA reagents of the invention are modified nucleotides.

[0190] In some embodiments, the phosphate-modified nucleotide in the sense strand of a dsRNA reagent of the invention represented by formula (V) is a phosphorothioate nucleotide, and in some embodiments, the phosphate-modified nucleotide in the sense strand of a dsRNA reagent of the invention represented by formula (V) is a 5'-phosphorothioate nucleotide.

[0191] In some embodiments, the dsRNA reagents of the present invention comprise an E-vinyl phosphonate nucleotide at the 5' end of the sense strand in the sense strand represented by formula (V).

[0192] In some embodiments, the dsRNA reagent of the present invention has an antisense strand that is complementary or essentially complementary to the sense strand represented by Formula (V), and the length of the complementary region is between 18 and 25 nucleotides. In some embodiments, the length of the complementary region is 18 to 23 nucleotides. In some embodiments, the length of the complementary region is 19 to 21 nucleotides. In other examples, for example, the length of the complementary region may be 18 to 25 nucleotides, 19 to 25 nucleotides, 19 to 23 nucleotides, or 19 to 21 nucleotides. In other examples, in some embodiments, the length of the complementary region is 18, 19, 20, or 21 nucleotides.

[0193] It should be understood that in some embodiments, in the dsRNA reagent, n' is 7 and the complementary pairing to the sense strand is 25 nucleotides in length. In some specific embodiments, in the dsRNA reagent, n' is 0, 1, 2, 3, 4, 5, 6, or 7.

[0194] In some embodiments, the dsRNA reagent has an antisense strand that is perfectly complementary to the Formula (V) sense strand.

[0195] In some embodiments, the dsRNA reagents of the present invention contain no mismatches. In certain embodiments, the target gene dsRNA reagents of the present invention contain no more than one mismatch (such mismatches do not affect the starting position for counting matches). In some embodiments, the dsRNA reagents of the present invention contain no more than two mismatches. In certain embodiments, the dsRNA reagents of the present invention contain no more than three mismatches. In some embodiments of the present invention, the antisense strand of the dsRNA reagent contains a mismatch with a target sequence that is not located in the center of the complementary region. In some embodiments, the antisense strand of the dsRNA reagent contains one, two, three, four, or more mismatches located within the last 5, 4, 3, 2, or 1 nucleotide at either or both of the 5' or 3' ends of the complementary region.

[0196] In some embodiments, the antisense strand of the dsRNA reagent of the present invention is 30 nucleotides or less in length. In some embodiments, the length of each strand of the dsRNA reagent of the present invention is 30 nucleotides or less. In some embodiments, the length of each strand of the dsRNA reagent of the present invention is 25 nucleotides or less. In some embodiments, the length of each strand of the dsRNA reagent of the present invention is 23 nucleotides or less. In some embodiments, the length of each strand of the dsRNA of the present invention is 19, 20, or 21 nucleotides.

[0197] In some embodiments, the dsRNA reagent has a blunt end at the 5'-end of the sense strand. In one embodiment, the dsRNA reagent of the invention has two blunt ends on both the sense and antisense strands. For example, each strand of the dsRNA reagent is perfectly paired to form a blunt-ended structure.

[0198] In some embodiments, the sense strand of the RNAi reagent represented by formula (V) has an overhang of 1 to 5 unpaired nucleotides at the 5' end, for example, an overhang of 1, 2, 3, 4, or 5 unpaired nucleotides.

[0199] In some embodiments, the complementary or partially complementary antisense strand of the dsRNA reagent represented by formula (V) has an overhang of 1 to 5 unpaired nucleotides at the 3'-end and / or 5'-end, e.g., an overhang of 1, 2, 3, 4, or 5 unpaired nucleotides. In some embodiments, the complementary or partially complementary antisense strand of the dsRNA reagent represented by formula (V) has a blunt end at the 3'-end and / or 5'-end.

[0200] In some embodiments, the unpaired nucleotide overhangs of the sense and / or antisense strands of the dsRNA reagents of the invention are 2 to 5 nucleotides, 1 to 5 nucleotides, 1 to 4 nucleotides, 2 to 4 nucleotides, 1 to 3 nucleotides, 2 to 3 nucleotides, or 1 to 2 nucleotides in length. These overhangs may be the result of one strand being longer than the other, or may be the result of two strands of the same length interleaved. These overhangs may form mispairs with the target mRNA, may be complementary to the target gene sequence, or may be other sequences. The first and second strands may be linked, for example, via additional bases to form a hairpin, or may be linked via other abasic linkers.

[0201] In one embodiment, the nucleotides in the overhanging end region of a dsRNA reagent of the invention may each be independently selected from one or more modified or unmodified nucleotides, and modified nucleotides include 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), and ethylene glycol nucleic acid nucleotides (glycol nucleic acid nucleotides). The bases include, but are not limited to, unnatural bases including nucleotides, GNAs, bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates or nucleotides.

[0202] In one embodiment, both ends of the overhang in the sense strand, the antisense strand, or both strands of the overhang region of the dsRNA reagent of the present invention may be phosphorylated.

[0203] In one embodiment, the overhanging end of the dsRNA reagent of the invention is present at the 5'-end or 3'-end of the sense strand, the antisense strand, or both strands. In one embodiment, the overhanging end is present at the 3'-end of the antisense strand. In one embodiment, the overhanging end is present at the 5'-end of the sense strand.

[0204] In one embodiment, the dsRNA reagent of the present invention can contain only one single overhang, which can enhance the interference activity of the dsRNA without affecting its overall stability. For example, the single-stranded overhang can be located at the 5'-end of the sense strand, or alternatively, at the 3'-end of the antisense strand, and the corresponding dsRNA can have a blunt end located at the 5'-end of the antisense strand (or the 3'-end of the sense strand), or vice versa.

[0205] In one embodiment, the dsRNA reagents of the invention are blunt ended at the 5'-end of the antisense strand or the 3'-end of the sense strand.

[0206] In some embodiments, the dsRNA reagents of the invention contain at least one phosphorothioate internucleotide linkage.

[0207] In some embodiments, the sense strand of a dsRNA reagent of the invention comprises at least one phosphorothioate internucleotide linkage.

[0208] In some embodiments, the antisense strand of a dsRNA reagent of the invention comprises at least one phosphorothioate internucleotide linkage.

[0209] In some embodiments, the sense strand and / or antisense strand described in the dsRNA reagents of the invention comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphorothioate internucleotide linkages.

[0210] In one embodiment, the sense strand of a dsRNA reagent of the invention comprises 1 to 10 blocks having 2 to 10 phosphorothioate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of these phosphorothioate internucleotide linkages is located at any position in the oligonucleotide sequence, and the sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or an antisense strand comprising phosphorothioate or phosphate linkages.

[0211] In one embodiment, the antisense strand of a dsRNA reagent of the invention comprises 1 to 10 blocks having 2 to 10 phosphorothioate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of these phosphorothioate internucleotide linkages is located at any position in the oligonucleotide sequence, and the antisense strand is paired with a sense strand containing any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or a sense strand containing phosphorothioate or phosphate linkages.

[0212] In one example, the dsRNA reagents of the invention further comprise one or more phosphorothioate internucleotide linkage modifications in 1 to 10 double-stranded internal regions of each of the sense and / or antisense strands. For example, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides at positions 8 to 16 of the double-stranded region, counting from the 3' end of the sense strand, can be linked by phosphorothioate internucleotide linkages, and the dsRNA optionally further comprises one or more phosphorothioate internucleotide linkage modifications at 1 to 10 terminal positions.

[0213] In one embodiment, a dsRNA reagent of the invention further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modifications at positions 1-5 of the sense strand, and one to five phosphorothioate or methylphosphonate internucleotide linkage modifications at positions 18-23 (as used herein, counting from the blunt 3' end of the sense strand), and one to two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand, and one to five at positions 18-23 (as used herein, counting from the blunt 5' end of the antisense strand). In one embodiment, a dsRNA reagent of the invention comprises one or two phosphorothioate internucleotide linkage modifications at the 3'-end and / or 5'-end of the sense or antisense strand.

[0214] In one embodiment, the dsRNA reagents of the present invention comprise such phosphorothioate internucleotide linkage modifications in the overhanging end region, and unless otherwise specified, as understood in the art, the dsRNA reagents of the present invention refer to the unpaired nucleotide motifs of the present application in the overhanging end region. For example, the overhanging end region comprises two nucleotides with one phosphorothioate internucleotide linkage between them. The overhanging end nucleotide may be linked to the terminal paired nucleotide in the double-stranded region by an internucleotide linkage modification, and as understood in the art, unless otherwise specified, the linkage between the overhanging end nucleotide and the terminal paired nucleotide in the double-stranded region is the terminal N-terminus. L or N L" refers to a linkage with a '. For example, at least two, three, four, or all of the overhanging nucleotides can be linked by phosphorothioate internucleotide linkages, and optionally, there can be another phosphorothioate internucleotide linkage linking the overhanging nucleotide to the paired nucleotide adjacent to the overhanging nucleotide. For example, there can be at least two phosphorothioate internucleotide linkages between the three terminal nucleotides, two of which are overhanging nucleotides and the third is a paired nucleotide adjacent to the overhanging nucleotide. Preferably, the three terminal nucleotides can be located at the 3' end of the antisense strand. In one embodiment, the dsRNA reagent of the present invention also includes the phosphorothioate internucleotide linkage modification in the overhanging end region of the sense strand.

[0215] In some embodiments, the sense strand and / or antisense strand of a dsRNA reagent of the invention has one or two inverted abasic residue nucleotides. In some embodiments, the 3'-end and / or 5'-end of the sense strand and / or antisense strand of a dsRNA reagent of the invention comprises one or two inverted abasic residue nucleotides. In some embodiments, the sense strand of a dsRNA reagent of the invention comprises one inverted abasic residue at the 3'-end.

[0216] In some embodiments, the dsRNA reagent of the present invention further comprises one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups described in the dsRNA reagent of the present invention are identical or different. The targeting group or linking group may be attached to the sense strand, antisense strand, or both strands at the 3' end, 5' end, or both ends. In some embodiments, the one or more targeting groups or linking groups described in the RNAi reagent are conjugated to the sense strand.The targeting ligands can alter the distribution, targeting or lifetime, endosomolytic properties, improve trafficking, hybridization, and specificity of the RNAi reagents into which they are incorporated, for example, but not limited to, lectins, glycoproteins, lipids or proteins, thyroid stimulating hormone, melanocyte stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, multivalent trehalose, glycosylated polyamino acids. , polyvalent galactose, transferrin, bisphosphonates, polyglutamates, polyaspartates, lipids, cholesterol, steroids, bile acids, folate, vitamin B12, biotin, RGD peptides, RGD peptidomimetics or aptamers; other examples are dyes, intercalators (e.g., acridine), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases. These include lipophilic molecules such as cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, camphor, menthol, 1,3-propylene glycol, heptadecyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, or phenoxazine, and peptide conjugates (such as antennapedia peptides). Examples of suitable nucleotides include nucleotides (e.g., nucleotides, Tat peptides), alkylating agents, phosphate, amino groups, mercapto groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino groups, alkyl groups, substituted alkyl groups, radiolabeled markers, enzymes, haptens (e.g., biotin), carriers / adsorption promoters (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole complexes, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl groups, HRP, or AP.In some embodiments, the targeting group or linking group comprises N-acetyl-galactosamine (GalNAc), a lipophilic molecule that can be used for delivery to neuronal regions. In some embodiments, the targeting group or linking group is conjugated to the 5'-end of the sense strand.

[0217] Another non-limiting example of a delivery agent that can be used to deliver the dsRNA reagents of the present invention to cells, tissues, and / or subjects according to embodiments of the present invention is a GalNAc-containing agent that is linked to the dsRNA reagents of the present invention to deliver the dsRNA reagents to cells, tissues, and / or subjects. PCT Application WO2020191183A1 discloses certain other examples of delivery agents containing GalNAc that can be used in certain embodiments of the methods and compositions of the present invention. Non-limiting examples of GalNAc targeting ligands that can be used to deliver dsRNA reagents to cells in the compositions and methods of the present invention are targeting ligand clusters. Examples of targeting ligand clusters proposed herein include, for example, GalNAc ligands with phosphodiester linkages (GLO) and GalNAc ligands with phosphorothioate linkages (GLS). The term "GLX-n" can be used herein to refer to a compound comprising GalNAC linked thereto, including, but not limited to, any one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, each of whose structures is as follows: It should be understood that any of the RNAi and dsRNA molecules of the present invention can be linked to GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. In some preferred embodiments, the targeting group is GLS-5 or GLS-15 as described herein. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0218] In some embodiments, the targeting group has the structure:

[0219] [ka]

[0220] In some embodiments, the sense strand of the dsRNA reagent represented by formula (V') comprises one inverted abasic residue at the 3'-end. In some embodiments, the sense strand of the dsRNA reagent represented by formula (V') comprises one or two inverted abasic residues at the 3'-end and / or 5'-end.

[0221] [Table 2]

[0222] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8] [Table 3-9] [Table 3-10] [Table 3-11]

[0223] In some embodiments, SEQ ID NO: 1 is FXII mRNA [NCBI Reference Sequence: NM_021489.3, for example, AD00540, AD00548, etc. are specific modified nucleotide sequences for the unmodified double-stranded AD00127.um sense strand, AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 2), and the antisense strand, uUcaaAgcacuuuAuUgaguu (SEQ ID NO: 3), with the complementary Pos(20) at position 1938 in NM_021489.3, and for example, AD00549, AD00558, etc. are specific modified nucleotide sequences for the unmodified double-stranded AD00549.um sense strand (SEQ ID NO: 4), GCCCAAGAAAGUGAAAGACCA, and the antisense strand, uGgucuUucacUuUcUugggc (SEQ ID NO: 5), with the complementary Pos(20) at position 307 in NM_021489.3.

[0224] In a further aspect of the present invention, there is provided an RNAi reagent for suppressing expression of a target gene sequence, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18-30 nucleotides and the sense strand having 18-40 nucleotides, the dsRNA reagent comprising an antisense strand having a nucleotide sequence represented by formula (X) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0225] the antisense strand comprises the formula (X) listed in the 3' to 5' direction, 3'-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5' expression(X) The sense strand comprises, in the 5' to 3' direction, the formula (V): 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N'L -3' Formula (V) Of these, each N F represents a 2'-fluoro modified nucleotide, each N X each independently represents a modified or unmodified nucleotide, N X has no more than three 2'-fluoro modified nucleotides, Each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has at least two 2'-fluoro modified nucleotides present, In the sense strand of formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (V), there are no more than six total 2'-fluoro modified nucleotides; Each N' L represents independently a modified or unmodified nucleotide, Each n and n' may independently be an integer from 0 to 7.

[0226] In some embodiments, RNAi reagents for suppressing expression of a target gene sequence are provided, wherein the RNAi reagents are double-stranded ribonucleic acid (dsRNA) reagents, the dsRNA reagents comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18-30 nucleotides and the sense strand having 18-40 nucleotides, and the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by formula (I) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0227] The antisense strand comprises, in the 3' to 5' direction, Formula (I): 3'-(N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5' Formula (I) The sense strand comprises, in the 5' to 3' direction, the formula (V): 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' Formula (V) Of these, each N F represents a 2'-fluoro modified nucleotide, each N X each independently represents a modified or unmodified nucleotide, N X has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, Each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N'N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has at least two 2'-fluoro modified nucleotides present, In the sense strand of formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (V), there are no more than six total 2'-fluoro modified nucleotides; Each N' L represents independently a modified or unmodified nucleotide, Each n and n' may independently be an integer from 0 to 7.

[0228] It should be understood that the dsRNA reagents include specific example combinations of an antisense strand having any of the modifications described in formula (I) herein and a sense strand having any of the modifications described in formula (V) herein.

[0229] In some embodiments, an RNAi reagent for suppressing the expression of a target gene sequence is provided, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprises a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides and the sense strand having 18 to 40 nucleotides, the dsRNA reagent comprising an antisense strand having a nucleotide sequence represented by formula (I-1) herein and a sense strand having a nucleotide sequence represented by formula (V) herein; The antisense strand comprises the following formula (I-1) listed in the 3' to 5' direction: 3'-(N L ) n N M1 N L N M2 N L NF N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (I-1) The sense strand comprises, in the 5' to 3' direction, the formula (V): 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' Formula (V) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, each N Lindependently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; Each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has at least two 2'-fluoro modified nucleotides present, In the sense strand of formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (V), there are no more than six total 2'-fluoro modified nucleotides; Each N' L represents independently a modified or unmodified nucleotide, Each n and n' may independently be an integer from 0 to 7.

[0230] In some embodiments, an RNAi reagent for suppressing the expression of a target gene sequence is provided, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprises a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides and the sense strand having 18 to 40 nucleotides, the dsRNA reagent comprising an antisense strand having a nucleotide sequence represented by formula (I-1) herein and a sense strand having a nucleotide sequence represented by formula (V') herein; The antisense strand comprises the following formula (I-1) listed in the 3' to 5' direction: 3'-(N L ) n N M1 N L N M2 N LN F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (I-1) the sense strand comprises, in the 5' to 3' direction, the structure of formula (V'): 5'-(N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L -3' expression (V') Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, each N Lindependently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; Each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide, and N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has only two 2'-fluoro modified nucleotides, Each N' L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; Each n and n' may independently be an integer from 0 to 7.

[0231] In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by Formula (II) herein and a sense strand having a nucleotide sequence represented by Formula (V) herein.

[0232] In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by formula (III) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0233] In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by formula (IV) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0234] In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by Formula (II) herein and a sense strand having a nucleotide sequence represented by Formula (V') herein.

[0235] In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by formula (III) herein and a sense strand having a nucleotide sequence represented by formula (V') herein.

[0236] In some embodiments, the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by formula (IV) herein and a sense strand having a nucleotide sequence represented by formula (V') herein.

[0237] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 13 of the sense strand represented by formula (V) (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides, and the sense strand does not have a motif of three or more consecutive 2'-fluoro-modified nucleotides, and the total number of 2'-fluoro-modified nucleotides is six or less. In some more specific examples, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 13 of the sense strand represented by formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides, and it should be understood that the sense strand represented by formula (V') does not contain 2'-fluoro-modified nucleotides at other positions.

[0238] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand represented by formula (V) (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides, and the sense strand does not have a motif of three or more consecutive 2'-fluoro-modified nucleotides, and the total number of 2'-fluoro-modified nucleotides is six or less. In some more specific examples, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand represented by formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides, and it should be understood that the sense strand represented by formula (V') does not contain 2'-fluoro-modified nucleotides at other positions.

[0239] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand represented by formula (V) (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides, and the sense strand does not have a motif of three or more consecutive 2'-fluoro-modified nucleotides, and the total number of 2'-fluoro-modified nucleotides is six or less. In some more specific examples, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand represented by formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides, and it should be understood that the sense strand represented by formula (V') does not contain 2'-fluoro-modified nucleotides at other positions.

[0240] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 11, 12, and 14 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.

[0241] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 11, 12, and 15 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.

[0242] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.

[0243] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V) (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides. In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 13 of the sense strand of the dsRNA reagent represented by formula (V') (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.

[0244] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0245] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0246] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of formula (V') (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0247] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 11, 12, and 14 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.

[0248] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 11, 12, and 15 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0249] In some more specific embodiments, the nucleotides at positions 2, 7, 12, 14, and 18 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0250] In some more specific embodiments, the nucleotides at positions 2, 4, 10, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5'-end) represented by formula (I-1) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3'-end of the sense strand) represented by formula (V) are 2'-fluoro-modified nucleotides.

[0251] In some more specific embodiments, the nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5'-end) represented by formula (I-1) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3'-end of the sense strand) represented by formula (V) are 2'-fluoro-modified nucleotides.

[0252] In some more specific embodiments, the nucleotides at positions 2, 5, 12, 14, and 16 of the antisense strand of formula (I-1) (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 9, 11, and 13 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3'-end of the sense strand) are 2'-fluoro-modified nucleotides.

[0253] In some embodiments, RNAi reagents for suppressing expression of a target gene sequence are provided, wherein the RNAi reagents are double-stranded ribonucleic acid (dsRNA) reagents, and the dsRNA reagents include a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides and the sense strand having 18 to 40 nucleotides, and the dsRNA reagent includes an antisense strand having a nucleotide sequence represented by formula (I-2) herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0254] In some embodiments, RNAi reagents for inhibiting expression of a target gene sequence are provided, wherein the RNAi reagents are double-stranded ribonucleic acid (dsRNA) reagents, the dsRNA reagents comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18-30 nucleotides and the sense strand having 18-40 nucleotides, and the dsRNA reagent comprises an antisense strand having a nucleotide sequence represented by formula (I') herein and a sense strand having a nucleotide sequence represented by formula (V) herein.

[0255] In some more specific embodiments, the nucleotides at positions 2, 4, and 14 of the antisense strand of formula (IV) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0256] In some more specific embodiments, the nucleotides at positions 2, 8, and 14 of the antisense strand (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent represented by formula (IV) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) represented by formula (V) are 2'-fluoro-modified nucleotides.

[0257] In some more specific embodiments, the nucleotides at positions 2, 7, and 14 of the antisense strand of formula (IV) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0258] In some more specific embodiments, the nucleotides at positions 2, 12, and 14 of the antisense strand (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent represented by formula (IV) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3'-end of the sense strand) represented by formula (V) are 2'-fluoro-modified nucleotides.

[0259] In some more specific embodiments, the nucleotides at positions 2, 14, and 16 of the antisense strand of formula (IV) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0260] In some more specific embodiments, the nucleotides at positions 2, 14, and 18 of the antisense strand (counting from the first paired nucleotide from the 5'-end) of the dsRNA reagent represented by formula (IV) are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3'-end of the sense strand) represented by formula (V) are 2'-fluoro-modified nucleotides.

[0261] In some more specific embodiments, the nucleotides at positions 2, 6, and 14 of the antisense strand of formula (IV) (counting from the first paired nucleotide from the 5' end) of the dsRNA reagent are 2'-fluoro-modified nucleotides, and the nucleotides at positions 8, 11, and 13 of the sense strand of formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand) are 2'-fluoro-modified nucleotides.

[0262] In some more specific embodiments, the dsRNA reagent has 2'-fluoro-modified nucleotides at positions 2, 7, 11, 14, and 16 of the antisense strand represented by formula (I-2) (counting from the first paired nucleotide from the 5' end), and 2'-fluoro-modified nucleotides at positions 9, 11, and 13 of the sense strand represented by formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand).

[0263] In some more specific embodiments, the dsRNA reagent has 2'-fluoro-modified nucleotides at positions 2, 7, 11, 14, and 18 of the antisense strand represented by formula (I-2) (counting from the first paired nucleotide from the 5' end), and 2'-fluoro-modified nucleotides at positions 9, 11, and 13 of the sense strand represented by formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand).

[0264] In some more specific embodiments, the dsRNA reagent has 2'-fluoro-modified nucleotides at positions 2, 9, 12, 14, and 16 of the antisense strand represented by formula (I-2) (counting from the first paired nucleotide from the 5' end), and 2'-fluoro-modified nucleotides at positions 9, 11, and 13 of the sense strand represented by formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand).

[0265] In some more specific embodiments, the dsRNA reagent has 2'-fluoro-modified nucleotides at positions 2, 8, 12, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5' end) represented by formula (I-2), and 2'-fluoro-modified nucleotides at positions 9, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) represented by formula (V).

[0266] In some more specific embodiments, the dsRNA reagent has 2'-fluoro-modified nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand represented by formula (I-2) (counting from the first paired nucleotide from the 5' end), and 2'-fluoro-modified nucleotides at positions 9, 11, and 12 of the sense strand represented by formula (V) (counting from the first paired nucleotide from the 3' end of the sense strand).

[0267] In some embodiments, the dsRNA reagent comprises a combination of an antisense strand having a nucleotide sequence represented by formula (X) herein and a sense strand having a nucleotide sequence represented by formula (V) herein with any of the techniques described herein, including, but not limited to, other methods for dsRNA modification described herein.

[0268] It should be understood that the dsRNA reagent herein comprises the combination of any technical solution of the antisense strand with the nucleotide sequence described herein and the sense strand with the nucleotide sequence described herein, and includes but is not limited to other methods for dsRNA modification described herein.For example, it includes but is not limited to the combination of formula (X) and formula (V), formula (V '), and formula (IX), and the combination of formula (IX) and formula (X), formula (I), formula (I '), formula (I-1), formula (I-2), formula (II), formula (III), and formula (IV).

[0269] In some embodiments, the dsRNA reagent comprises a combination of an antisense strand having a nucleotide sequence represented by formula (I) herein and a sense strand having a nucleotide sequence represented by formula (V) herein with any of the techniques described herein, including, but not limited to, other methods for dsRNA modification described herein.

[0270] In some embodiments, the antisense strand of the dsRNA reagent is N of Formula (I-1), Formula (I'), Formula (I-2), Formula (II), Formula (III), and / or Formula (IV). LOne or more of the nucleotides are modified nucleotides independently selected from 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or unnatural base containing nucleotides. In some embodiments, the N' in the dsRNA reagent L The nucleotide is a modified nucleotide selected from a 2'-O-methyl modified nucleotide, UNA, or Invab.

[0271] In some embodiments, the N' of Formula (V) and / or Formula (IX) of the sense strand of the dsRNA reagent LOne or more of the nucleotides are modified nucleotides independently selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate-modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino-modified nucleotides, phosphoramidates, or unnatural base-containing nucleotides. In some embodiments, the N' in the dsRNA reagent L The nucleotide is a modified nucleotide selected from a 2'-O-methyl modified nucleotide, UNA, or Invab.

[0272] In some embodiments, the N of Formula (I) of the antisense strand of the dsRNA reagent XOne or more of the nucleotides are modified nucleotides independently selected from 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), glycol nucleic acid nucleotides (GNAs), bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invabs), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate-modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino-modified nucleotides, phosphoramidates, or unnatural base-containing nucleotides. In some embodiments, the N' in the dsRNA reagent L The nucleotide is a modified nucleotide selected from a 2'-O-methyl modified nucleotide, UNA, or Invab.

[0273] In some non-limiting embodiments of the dsRNA reagent, N' in the sense strand of the dsRNA reagent N1 , N' N2 , N' N3 , N' N4 , N' N5 and / or N' N6 , and N in the antisense strand M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8are modified nucleotides independently selected from the following, each independently representing a modified or unmodified nucleotide, and the modified nucleotide is independently selected from a 2'-fluoro-modified nucleotide, a 2'-O-methyl-modified nucleotide, a 2'-deoxynucleotide, a 2',3'-seco nucleotide mimic, a locked nucleotide (LNA), an open-ring nucleotide (UNA), an ethylene glycol nucleotide (GNA), a bicyclic nucleotide (BNA), a 2'-F-arabinonucleotide, a 2'-methoxyethyl nucleotide, an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide (Invab), an inverted 2'-OMe nucleotide, an inverted 2'-deoxynucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a 3'-OMe nucleotide, a phosphate-modified nucleotide, a terminal nucleotide linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, a 2'-amino-modified nucleotide, a phosphoramidate, or an unnatural base-containing nucleotide. In some embodiments, the N' in the sense strand of formula (V) of the dsRNA reagent of the present invention N1 , N' N2 , N' N3 , N' N4 , N' N5 and / or N' N6 , and N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and / or N M8 is preferably a 2'-O-methyl modified nucleotide, UNA, GNA, LNA, rather than a 2'-fluoro modified nucleotide.

[0274] In some embodiments, the antisense strand of the dsRNA reagent of Formula (I) is complementary or essentially complementary to the sense strand of Formula (V). In some embodiments, all of the sense or antisense strands of the dsRNA reagent are modified nucleotides.

[0275] In some embodiments, the phosphate-modified nucleotides in the antisense strand of Formula (I) and the sense strand of Formula (V) of the dsRNA reagents of the present invention are phosphorothioate nucleotides.

[0276] In some embodiments, the dsRNA reagents of the invention include an E-vinyl phosphonate nucleotide at the 5' end of the antisense strand.

[0277] In some embodiments, the sense strand of a dsRNA reagent of the present invention is complementary or essentially complementary to the antisense strand. In some embodiments, the length of the complementary or essentially complementary region of a dsRNA reagent of the present invention is between 18 and 25 nucleotides. In some embodiments, the length of the complementary region is 18 to 23 nucleotides. In some embodiments, the length of the complementary region is 19 to 21 nucleotides. In other examples, for example, the length of the complementary region may be 18 to 25 nucleotides, 19 to 25 nucleotides, 19 to 23 nucleotides, or 19 to 21 nucleotides. In other examples, in some embodiments, the length of the complementary region is 18, 19, 20, or 21 nucleotides.

[0278] In some embodiments, the dsRNA reagent has an antisense strand that is perfectly complementary to the sense strand.

[0279] In some embodiments, the dsRNA reagents of the present invention contain no mismatches. In certain embodiments, the target gene dsRNA reagents of the present invention contain no more than one mismatch (such mismatches do not affect the starting position for counting matches). In some embodiments, the dsRNA reagents of the present invention contain no more than two mismatches. In certain embodiments, the dsRNA reagents of the present invention contain no more than three mismatches. In some embodiments of the present invention, the antisense strand of the dsRNA reagent contains a mismatch with a target sequence that is not located in the center of the complementary region. In some embodiments, the antisense strand of the dsRNA reagent contains one, two, three, four, or more mismatches located within the last 5, 4, 3, 2, or 1 nucleotide at either or both of the 5' or 3' ends of the complementary region.

[0280] In some embodiments, each strand of the dsRNA reagent of the present invention is 30 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent of the present invention is 25 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent of the present invention is 23 nucleotides or less in length. In some embodiments, each strand of the dsRNA reagent of the present invention is 19, 20, or 21 nucleotides in length.

[0281] In some embodiments, the dsRNA reagent has a blunt end at the 5'-end of the sense strand. In one embodiment, the dsRNA reagent of the invention has two blunt ends on both the sense and antisense strands. For example, each strand of the dsRNA reagent is perfectly paired to form a blunt-ended structure.

[0282] In some embodiments, the sense strand of the RNAi reagent represented by formula (V) has an overhang of 1 to 5 unpaired nucleotides at the 5' end, for example, an overhang of 1, 2, 3, 4, or 5 unpaired nucleotides.

[0283] In some embodiments, the complementary or partially complementary antisense strand of the dsRNA reagent represented by formula (V) has an overhang of 1 to 5 unpaired nucleotides at the 3'-end and / or 5'-end, e.g., an overhang of 1, 2, 3, 4, or 5 unpaired nucleotides. In some embodiments, the complementary or partially complementary antisense strand of the dsRNA reagent represented by formula (V) has a blunt end at the 3'-end and / or 5'-end.

[0284] In some embodiments, the unpaired nucleotide overhangs of the sense and / or antisense strands of the dsRNA reagents of the invention are 2 to 5 nucleotides, 1 to 5 nucleotides, 1 to 4 nucleotides, 2 to 4 nucleotides, 1 to 3 nucleotides, 2 to 3 nucleotides, or 1 to 2 nucleotides in length. These overhangs may be the result of one strand being longer than the other, or may be the result of two strands of the same length interleaved. These overhangs may form mispairs with the target mRNA, may be complementary to the target gene sequence, or may be other sequences. The first and second strands may be linked, for example, via additional bases to form a hairpin, or may be linked via other abasic linkers.

[0285] In one embodiment, the nucleotides in the overhanging end region of a dsRNA reagent of the invention may each be independently selected from one or more modified or unmodified nucleotides, and modified nucleotides include 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNAs), unlocked nucleic acid nucleotides (UNAs), and ethylene glycol nucleic acid nucleotides (glycol nucleic acid nucleotides). The bases include, but are not limited to, unnatural bases including nucleotides, GNAs, bicyclic nucleic acids (BNAs), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates or nucleotides.

[0286] In one embodiment, both ends of the overhang in the sense strand, the antisense strand, or both strands of the overhang region of the dsRNA reagent of the present invention may be phosphorylated.

[0287] In one embodiment, the overhanging end of the dsRNA reagent of the invention is present at the 5'-end or 3'-end of the sense strand, the antisense strand, or both strands. In one embodiment, the overhanging end is present at the 3'-end of the antisense strand. In one embodiment, the overhanging end is present at the 5'-end of the sense strand.

[0288] In one embodiment, the dsRNA reagents of the invention are blunt ended at the 5' end of the antisense strand or the 3' end of the sense strand.

[0289] In some embodiments, the dsRNA reagents of the invention contain at least one phosphorothioate internucleotide linkage.

[0290] In some embodiments, the sense strand of a dsRNA reagent of the invention comprises at least one phosphorothioate internucleotide linkage.

[0291] In some embodiments, the antisense strand of a dsRNA reagent of the invention comprises at least one phosphorothioate internucleotide linkage.

[0292] In some embodiments, the sense strand and / or antisense strand described in the dsRNA reagents of the invention comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphorothioate internucleotide linkages.

[0293] In one embodiment, the sense or antisense strand of a dsRNA reagent of the invention comprises 1 to 10 blocks having 2 to 10 phosphorothioate internucleotide linkages separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 phosphate internucleotide linkages, wherein one of these phosphorothioate internucleotide linkages is located at any position in the oligonucleotide sequence, and the sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate, and phosphate internucleotide linkages or an antisense strand comprising phosphorothioate or phosphate linkages.

[0294] In one embodiment, a dsRNA reagent of the invention further comprises one to five phosphorothioate or methylphosphonate internucleotide linkage modifications at positions 1-5 of the sense strand, and one to five phosphorothioate or methylphosphonate internucleotide linkage modifications at positions 18-23 (as used herein, counting from the blunt 3' end of the sense strand), and one to two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand, and one to five at positions 18-23 (as used herein, counting from the blunt 5' end of the antisense strand). In one embodiment, a dsRNA reagent of the invention comprises one or two phosphorothioate internucleotide linkage modifications at the 3'-end and / or 5'-end of the sense or antisense strand.

[0295] In one embodiment, the dsRNA reagents of the invention contain such interphosphorothioate linkage modifications in the cohesive end region.

[0296] In some embodiments, the sense strand and / or antisense strand of a dsRNA reagent of the invention has one or two inverted abasic residue nucleotides. In some embodiments, the 3' and / or 5' ends of the sense strand and / or antisense strand of a dsRNA reagent of the invention contain one or two inverted abasic residues. In some embodiments, the sense strand of a dsRNA reagent of the invention contains one inverted abasic residue at the 3'-end.

[0297] In some embodiments, the dsRNA reagent of the present invention further comprises one or more targeting groups or linking groups. In some embodiments, the one or more targeting groups or linking groups described in the RNAi reagent are conjugated to the sense strand. In some embodiments, the targeting group or linking group comprises N-acetyl-galactosamine (GalNAc). In some embodiments, the targeting group or linking group is conjugated to the 5'-end of the sense strand.

[0298] Another non-limiting example of a delivery agent that can be used to deliver the dsRNA reagents of the present invention to cells, tissues, and / or subjects, according to embodiments of the present invention, is a GalNAc-containing reagent that is linked to the dsRNA reagents of the present invention to deliver the dsRNA reagents to cells, tissues, and / or subjects. Examples of targeting ligand clusters proposed herein include, for example, GalNAc ligands with phosphodiester linkages (GLO) and GalNAc ligands with phosphorothioate linkages (GLS). The term "GLX-n" can be used herein to refer to the GalNAC-containing compound linked thereto, including, but not limited to, any one of the following compounds: GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, each of whose structures is as set forth herein. It should be understood that any of the RNAi and dsRNA molecules of the present invention can be linked to GLS-1, GLS-2, GLS-3, GLS-4, GLS-5, GLS-6, GLS-7, GLS-8, GLS-9, GLS-10, GLS-11, GLS-12, GLS-13, GLS-14, GLS-15, GLS-16, GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. In some preferred embodiments, the targeting group is GLS-5 or GLS-15 as described herein.

[0299] In some embodiments, the sense and antisense strands of the dsRNA reagents of the invention are partially or fully complementary.

[0300] According to another aspect of the present invention, there is further provided a composition comprising any embodiment of the dsRNA reagent aspects described herein.

[0301] Carrier In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of a dsRNA reagent or antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier used for administering a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs intended for oral administration, pharmaceutically acceptable carriers include pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavoring agents, coloring agents, and preservatives, but are not limited to these. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while cornstarch and alginic acid are suitable disintegrants. Binders may include starch and gelatin, while lubricants, if present, are typically magnesium stearate, stearic acid, or talc. If necessary, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. Agents included in drug formulations are further described below.

[0302] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, while other carriers are known to those skilled in the art. Such formulations typically contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable; however, non-pharmaceutically acceptable salts are suitable for use in preparing pharmaceutically acceptable salts without excluding the scope of the present invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, and succinic acid. Additionally, pharmaceutically acceptable salts can be prepared as alkali metal or alkaline earth metal salts, such as sodium, potassium, or calcium salts.

[0303] Therapeutic formulations of dsRNA reagents or target gene antisense polynucleotide reagents can be prepared for storage by mixing molecules or compounds having the desired purity and, optionally, pharmaceutically acceptable carriers, excipients, or stabilizers [Remington's Pharmaceutical Sciences 21st edition (2006)] in the form of a lyophilized formulation or aqueous solution. Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the amounts and concentrations used, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (e.g., benzyl dimethylstearyl ammonium chloride hydrate, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butanol, or benzyl alcohol; p-hydroxybenzoic acid esters such as methyl or propyl p-hydroxybenzoate; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues); ), proteins such as serum albumin, gelatin, or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine, monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins, chelating agents such as EDTA, sugars such as sucrose, mannitol, trehalose, or sorbitol, salt-forming counterions such as sodium, metal complexes (e.g., zinc-protein complexes), and / or non-ionic surfactants such as TWEEN®, PLURONICS®, or polyethylene glycol (PEG).

[0304] Administration method In some embodiments, the tissue to which the compound is administered is a tissue where a disease or condition associated with the target gene exists or may manifest, non-limiting examples of which are the liver or kidney. Direct tissue administration can be achieved by direct injection or other means. While many orally delivered compounds naturally enter and pass through the liver and kidney, some embodiments of the therapeutic methods of the present invention include orally administering one or more target gene dsRNA reagents to a subject. The dsRNA reagent or target gene antisense polynucleotide agent can be administered once, alone or in combination with other therapeutic agents, or they can be administered multiple times. When administered multiple times, the target gene dsRNA reagent or target gene antisense polynucleotide agent can be administered by different routes. For example, and not intended to be limiting, the first (or first few) administrations can be administered subcutaneously, and one or more additional administrations can be administered orally and / or systemically.

[0305] In embodiments of the present invention in which systemic administration of a target gene dsRNA reagent or a target gene antisense polynucleotide agent is desired, the target gene dsRNA reagent or the target gene antisense polynucleotide reagent can be prepared for parenteral administration by injection, for example, by bolus injection or continuous infusion. Injectable preparations can be in unit dosage forms such as ampoules or multi-dose containers, with or without added preservatives. The target gene dsRNA reagent formulation (also called a pharmaceutical composition) can take the form of a suspension, solution, or emulsion in an oily or aqueous carrier, and can contain formulatory agents such as suspending agents, stabilizers, and / or dispersing agents.

[0306] Formulations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions containing saline and buffered media. Parenteral carriers include sodium chloride solution, Ringer's dextrose solution, glucose and sodium chloride solution, lactated Ringer's solution, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (e.g., those based on Ringer's dextrose solution), and the like. Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, can also be present. Other forms of administration, such as intravenous administration, result in lower dosages. If a subject does not respond adequately to the initial dosage, a higher dosage can be used (or the dosage can be effectively increased by a different, more localized delivery route) within the limits of patient tolerance. If necessary, multiple doses per day can be administered to achieve appropriate systemic or local levels of one or more target gene dsRNA reagents or target gene antisense polynucleotide reagents to achieve an appropriate reduction in target gene activity.

[0307] In other embodiments, the methods of the present invention involve the use of a delivery vehicle, e.g., a biocompatible microparticle, nanoparticle, or implant suitable for implantation into the intended recipient, etc. PCT Publication WO 95 / 24929 (incorporated herein by reference) describes an exemplary biodegradable implant that can be used in accordance with the methods, which describes a biocompatible, biodegradable polymer matrix that includes a biopolymer.

[0308] Both non-biodegradable and biodegradable polymer matrices can be used in the methods of the present invention to deliver one or more target gene dsRNA reagents or target gene antisense polynucleotide reagents to a subject. In some embodiments, the matrix may be biodegradable. The matrix polymer may be a natural or synthetic polymer. The polymer can be selected based on the desired period of release, typically on the order of a few hours to a year or more. Release periods ranging from a few hours to 3-12 months are typically available. The polymer is optionally in the form of a hydrogel capable of absorbing up to about 90% of its weight in water and is optionally crosslinked with multivalent ions or other polymers.

[0309] Typically, in some embodiments of the present invention, target gene dsRNA reagents or target gene antisense polynucleotide reagents can be delivered via diffusion or degradation of the polymer matrix using biodegradable implants. Exemplary synthetic polymers for such use are known in the art. Using methods known in the art, biodegradable and non-biodegradable polymers can be used to deliver target gene dsRNA reagents or target gene antisense polynucleotide reagents. Bioadhesive polymers, such as bioerodible hydrogels (H.S. Sawhney, C.P. Pathak, and J.A. Hubbell in Macromolecules, 1993, 26, 581-587), can also be used to deliver target gene sRNA reagents or target gene antisense polynucleotide reagents to treat diseases or conditions associated with target genes. Other suitable delivery systems include timed-release, delayed-release, or sustained-release delivery systems. Such systems can avoid repeated administration of target gene dsRNA reagents or target gene antisense polynucleotide agents, thereby increasing convenience for patients and medical professionals. Many types of release delivery systems are available and known to those skilled in the art. See, for example, U.S. Patent Nos. 5,075,109, 4,452,775, 4,675,189, 5,736,152, 3,854,480, 5,133,974, and 5,407,686. Additionally, pump-based hardware delivery systems, some of which are also adaptable for implantation, can be used.

[0310] The use of long-term sustained release implants is suitable for prophylactic treatment of subjects and for subjects at risk of developing a disease or condition associated with a recurrent target gene. As used herein, long-term release refers to constructing and configuring the implant to deliver therapeutic levels of a target gene dsRNA reagent or a target gene antisense polynucleotide reagent for a period of at least 10, 20, 30, 60, 90 days, 6 months, 1 year, or more. Long-term sustained release implants are known to those skilled in the art and include some of the release systems described above.

[0311] Effective dose In some aspects, the methods of the invention include contacting cells with an effective amount of a dsRNA reagent or antisense polynucleotide reagent to reduce gene expression in the contacted cells. Certain embodiments of the methods of the invention include administering to a subject an amount of a dsRNA reagent or antisense polynucleotide agent effective to effectively reduce gene expression and treat the associated disease or condition in the subject. An "effective amount" for reducing expression and / or treating the associated disease or disorder refers to an amount necessary or sufficient to achieve a desired biological effect. For example, an effective amount of a dsRNA reagent or antisense polynucleotide agent for treating the associated disease or condition may be (i) an amount necessary to slow or halt the progression of the disease or condition, or (ii) an amount that reverses, reduces, or eliminates one or more symptoms of the disease or condition. In some aspects of the invention, an effective amount is the amount of a dsRNA reagent or antisense polynucleotide agent that, when administered to a subject in need of treatment for the associated disease or condition, results in a therapeutic response in preventing and / or treating the disease or condition. According to some aspects of the invention, an effective amount is an amount of a dsRNA or antisense polynucleotide reagent of the invention that, when combined or used in conjunction with another therapeutic treatment for the relevant disease or condition, results in a therapeutic response in preventing and / or treating the disease or condition. In some embodiments of the invention, the biological effect of treating a subject with a dsRNA or antisense polynucleotide reagent of the invention can be an improvement and / or complete elimination of symptoms caused by the relevant disease or condition. In some embodiments of the invention, the biological effect is complete elimination of the relevant disease or condition, as evidenced, for example, by a diagnostic test showing that the subject does not have the relevant disease or condition. In some embodiments, an effective amount is an amount that results in a desired response, such as, for example, an amount that reduces the relevant disease or condition in cells, tissues, and / or subjects with the disease or condition.Some embodiments of the present invention include methods for determining the effectiveness of a target gene dsRNA reagent or antisense polynucleotide reagent of the present invention administered to a subject to treat a target gene-associated disease or condition by assessing and / or monitoring one or more "physiological characteristics" of the target gene-associated disease or condition in the subject. A non-limiting example of a physiological characteristic of a target gene-associated disease or condition is a number of patients.

[0312] It should be understood that gene silencing can be achieved in any cell in which the gene is expressed, constitutively or by genome engineering, and can be determined by any appropriate measurement. In some embodiments of the present invention, administration of the dsRNA reagent of the present invention reduces target gene expression by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments of the present invention, administration of the dsRNA reagent of the present invention reduces target gene expression by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100%.

[0313] The dsRNA and antisense polynucleotide reagents of the present invention are delivered in pharmaceutical compositions at a dose sufficient to express the target gene. In certain embodiments of the present invention, the dose of the dsRNA or antisense polynucleotide agent is 0.01 to 200.0 milligrams per kilogram of recipient body weight per day, typically 1 to 50 mg / kg body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, or 4 to 15 mg / kg body weight per day, inclusive. For example, a single dose of a dsRNA reagent or antisense polynucleotide reagent may be administered in amounts of about 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg , 2mg / kg, 2.1mg / kg, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1 mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / k g, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3m g / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / k g, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / It can be administered in amounts ranging from 23mg / kg, 24mg / kg, 25mg / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 37mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg to 50mg / kg of body weight.

[0314] When determining the delivery dose and time of the dsRNA reagent of the present invention, various factors can be considered.The absolute amount of the dsRNA reagent or antisense polynucleotide agent to be delivered depends on various factors, including concurrent treatment, dosage, and individual subject parameters, including age, physical condition, body size and weight.These are factors known to those skilled in the art and can be solved by conventional experimentation.In some embodiments, the maximum dose based on sound medical judgment, i.e., the maximum safe dose, can be used.

[0315] In some embodiments, the methods of the present invention can include administering 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more doses of a reagent or antisense polynucleotide reagent to a subject. In some cases, a dose of a pharmaceutical compound can be administered to a subject at least daily, every other day, weekly, biweekly, monthly, etc., and can be administered once a day or more times a day, for example, two, three, four, five, or more times in a 24-hour period. The pharmaceutical compositions of the present invention can be administered once a day, or the dsRNA reagent or antisense polynucleotide reagent can be administered in two, three, or more subdoses at appropriate intervals throughout the day, or can be delivered using continuous infusion or via a sustained-release formulation. In some embodiments of the methods of the present invention, the pharmaceutical compositions of the present invention are administered to a subject at least once a day, once a week, once a month, or once a year.

[0316] Certain embodiments of the present invention include the use of pharmaceutical compositions comprising a dsRNA reagent or an antisense polynucleotide reagent and a pharmaceutically acceptable carrier. Pharmaceutical compositions comprising a dsRNA reagent or an antisense polynucleotide agent can be used in the methods of the present invention to reduce gene expression and activity in cells and to treat associated diseases or conditions. Such pharmaceutical compositions can be formulated based on the delivery method. Non-limiting examples of formulations for delivery methods include compositions formulated for subcutaneous delivery, compositions formulated for systemic administration via parenteral delivery, compositions formulated for intravenous (IV) delivery, compositions formulated for intrathecal delivery, and compositions formulated for direct delivery into the brain. To deliver a dsRNA reagent or an antisense polynucleotide reagent to cells, it can be administered using one or more methods, including topically (e.g., via a transdermal patch), pulmonary, e.g., by inhaling or blowing a powder or aerosol, via a nebulizer, intrarespiratory, intranasal, epidermal, transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, subcutaneous administration by an implanted device, or intracranial, intrathecal, or intraventricular administration by intraparenchymal administration. The dsRNA reagent or antisense polynucleotide agent can also be delivered directly to the target tissue, such as directly to the liver or directly to the kidney. It should be understood that "delivering" a "dsRNA reagent" or "antisense polynucleotide reagent" to a cell includes, respectively, delivering the dsRNA reagent or antisense polynucleotide agent, directly expressing the dsRNA reagent in the cell, expressing the dsRNA reagent from an encoding vector delivered in the cell, or any suitable means for causing the dsRNA reagent or antisense polynucleotide reagent to appear in the cell. The preparation and use of formulations and means for delivering inhibitory RNA are known and commonly used in the art.

[0317] In some embodiments, the composition further comprises one or more additional therapeutic agents. The compositions of the present invention may comprise one or more dsRNA reagents and, optionally, one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable labels, etc. A non-limiting example of a targeting agent that can be utilized by some embodiments of the methods of the present invention is an agent that allows the dsRNA reagent of the present invention to be introduced and / or enter the cells to be treated. The selection of a targeting agent depends on factors such as the nature of the associated disease or condition and the type of target cell. In a non-limiting example, some embodiments of the present invention may require targeting and / or entry of the dsRNA reagent into hepatocytes. It should be understood that in some embodiments of the methods of the present invention, the therapeutic agent includes a dsRNA reagent having only a delivery agent without any additional linking element, for example, a delivery agent containing N-acetylgalactosamine (GalNAc). For example, in some embodiments of the present invention, a dsRNA reagent may be linked to a delivery compound comprising GalNAc, included in a composition containing a pharmaceutically acceptable carrier, and administered to a cell or subject without any detectable label or targeting agent or the like linked to the dsRNA reagent.

[0318] When the dsRNA reagent of the present invention is administered together with and / or linked to one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art can recognize, select, and use the appropriate reagent for use in the method of the present invention. In certain methods of the present invention, labeling reagents can be used to determine the location of the dsRNA reagent in cells and tissues, and can be used to determine the location of cells, tissues, or organs to which a therapeutic composition containing a dsRNA reagent is administered in the method of the present invention. Means for attaching and using labeling reagents, such as enzyme labels, dyes, and radioactive labels, are known in the art. It should be understood that in some embodiments of the compositions and methods of the present invention, labeling reagents are linked to one or both of the sense polynucleotide and the antisense polynucleotide contained in the dsRNA reagent.

[0319] In some embodiments, the composition is packaged in a reagent kit, container, packaging, dispenser, pre-filled syringe, or vial. Reagent kits containing one or more target gene dsRNA reagents and / or target gene antisense polynucleotide reagents, as well as instructions for use in the methods of the present invention, are also within the scope of the present invention. The reagent kits of the present invention may include one or more target gene dsRNA reagents, target gene sense polynucleotides, and target gene antisense polynucleotide reagents that can be used to treat diseases or conditions associated with target genes. Reagent kits containing one or more target gene dsRNA reagents, target gene sense polynucleotides, and target gene antisense polynucleotide reagents can be manufactured for use in the therapeutic methods of the present invention. The components of the reagent kits of the present invention can be packaged in aqueous media or lyophilized form. The reagent kits of the present invention may include a separate carrier for tightly containing one or more container devices or a series of container devices (e.g., test tubes, vials, flasks, bottles, syringes, etc.) therein. The first container device or series of container devices can contain one or more compounds, such as a target gene) dsRNA reagent and / or a target gene sense or antisense polynucleotide reagent. The second container device or series of container devices can contain a targeting agent, labeling agent, delivery agent, etc., included as part of the target gene) dsRNA reagent and / or target gene antisense polynucleotide reagent administered in embodiments of the therapeutic methods of the invention.

[0320] The reagent kits of the present invention may further include instructions, which typically take written form and provide directions for administering the treatment embodied by the reagent kit and for making decisions based on that treatment.

[0321] Cells, subjects and controls The methods of the present invention can be used in conjunction with cells, tissues, organs, and / or subjects. In some embodiments of the present invention, the subject is a human or a vertebrate mammal, including, but not limited to, a dog, cat, horse, cow, goat, mouse, rat, and primate such as a monkey. Thus, the present invention can be used to treat a disease or condition associated with a target gene in human and non-human subjects.

[0322] In some aspects of the invention, the subject may be a farm animal, a zoo animal, a domestic animal, or a non-domestic animal, and the methods of the invention can be used in veterinary prophylactic and therapeutic methods. In some embodiments of the invention, the subject is a human, and the methods of the invention can be used in human prophylactic and therapeutic methods.

[0323] Non-limiting examples of subjects to which the present invention can be applied include subjects diagnosed with, suspected of having, or at risk for a disease or condition associated with higher than desired target gene expression and / or activity, also referred to as "elevated target gene expression levels." Non-limiting examples of diseases and conditions associated with higher than desired levels of target gene expression and / or activity are described elsewhere herein. The methods of the present invention can be applied to subjects who, upon treatment, have been diagnosed with a disease or condition, are associated with higher than desired target gene expression and / or activity, or are believed to be at risk for having or developing a disease or condition associated with higher than desired target gene expression and / or activity. In some embodiments of the present invention, the disease or condition associated with higher than desired target gene expression and / or activity is an acute disease or condition, and in certain embodiments of the present invention, the disease or condition associated with higher than desired target gene expression and / or activity is a chronic disease or condition.

[0324] In another non-limiting example, the target gene dsRNA reagents of the present invention are administered to treat diseases or disorders caused by or associated with target gene activation, or diseases or disorders whose symptoms or progression respond to target gene inactivation. The term "target gene-associated disease" includes diseases, disorders, or conditions that benefit from reduced target gene expression.

[0325] Cells to which the methods of the present invention can be applied include in vitro, in vivo, and ex vivo cells. Cells may be in a subject, in culture, and / or in suspension, or in any other suitable state or condition. Cells to which the methods of the present invention can be applied may be liver cells, hepatocytes, cardiac cells, pancreatic cells, cardiovascular cells, kidney cells, or other types of vertebrate cells, including human and non-human mammalian cells. In certain aspects of the present invention, cells to which the methods of the present invention can be applied are healthy, normal cells that are not known to be diseased cells. In certain embodiments of the present invention, the methods and compositions of the present invention are applied to liver cells, hepatocytes, cardiac cells, pancreatic cells, cardiovascular cells, and / or kidney cells. While in certain aspects of the present invention, the control cells are normal cells, it should be understood that cells with a disease or condition may also be used as control cells in certain cases, such as comparing treated cells with a disease or condition to untreated cells with the disease or condition.

[0326] According to the methods of the present invention, the activity level of a target gene polypeptide can be determined and compared to a control level of target gene polypeptide activity. The control can take various forms. It can be a single cutoff value, such as a median or mean value. It can be established based on comparative groups, for example, a group with normal levels of target gene polypeptide and / or target gene polypeptide activity and a group with elevated levels of target gene polypeptide and / or target gene polypeptide activity. Other non-limiting examples of comparative groups can be a population with one or more symptoms or a diagnosis of a disease or condition associated with the target gene and a population without one or more symptoms or a diagnosis of the disease or condition, or a group of subjects administered an siRNA treatment of the present invention and a group of subjects not administered an siRNA treatment of the present invention. Typically, the control can be based on apparently healthy normal individuals or apparently healthy cells of an appropriate age group. It should be understood that in addition to a predetermined value, a control according to the present invention can also be a material sample tested in parallel with the experimental material. Examples include samples from a control population or control samples produced by manufacturing for parallel testing with the experimental samples. In some embodiments of the invention, a control can include a cell or subject that has not been contacted or treated with a target gene dsRNA reagent of the invention, in which case the control level of target gene polypeptide and / or target gene polypeptide activity can be compared to the level of target gene polypeptide and / or target gene polypeptide activity in a cell or subject that has been contacted with a target gene dsRNA reagent or target gene antisense polynucleotide reagent of the invention.

[0327] In some embodiments of the present invention, the control level can be a target gene polypeptide level determined for a subject, where target gene polypeptide levels determined for the same subject at different time points are compared to the control level. In a non-limiting example, the level of the target gene is determined in a biological sample obtained from a subject who has not received treatment with a target gene of the present invention. In some embodiments, the biological sample is a serum sample. The target gene polypeptide level measured from a sample obtained from the subject can be used as the subject's baseline or control value. In the treatment methods of the present invention, after administering one or more target gene dsRNA reagents to the subject, one or more additional serum samples can be obtained from the subject, and the target gene polypeptide level in the subsequent sample or samples can be compared to the subject's control / baseline level. Such comparisons can be used to assess the onset, progression, or regression of a disease or condition associated with the target gene in the subject. For example, a higher level of target gene) polypeptide in a baseline sample obtained from a subject than the level obtained from the same subject after administering to the subject a target gene dsRNA reagent or a target gene) antisense polynucleotide reagent of the present invention indicates regression of the target gene-associated disease or condition and indicates the effectiveness of administering a target gene dsRNA reagent of the present invention to treat the target gene-associated disease or condition.

[0328] In certain embodiments of the present invention, one or more values ​​of target gene polypeptide and / or target gene polypeptide activity level determined for a subject can be used as a control value, which is then used to compare the target gene polypeptide and / or target gene activity level in the same subject, thereby making it possible to evaluate changes in the "baseline" target gene polypeptide activity in the subject. Thus, when an initial level is used as the control level for that subject, the initial target gene polypeptide level and / or initial target gene polypeptide activity level can be used as an indication and / or determination of the level in the subject of methods and compounds of the present invention that can reduce the target gene polypeptide and / or target gene polypeptide activity in the subject.

[0329] Using the methods of the present invention, a target gene dsRNA reagent and / or a target gene antisense polynucleotide reagent of the present invention can be administered to a subject. Such dsRNAi reagents include those that allow the effectiveness of the administration and treatment of the present invention to be evaluated by determining whether the level of the target gene polypeptide in a serum sample obtained from the subject after administration and treatment is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to the pre-administration level of the target gene polypeptide in a serum sample obtained from the subject at a previous time point, or compared to a non-exposed control level (e.g., the level of the target gene polypeptide in a control serum sample). It should be understood that both the level of the target gene polypeptide and the level of target gene polypeptide activity correlate with the level of target gene expression. A specific embodiment of the methods of the present invention includes administering a target gene dsRNA and / or a target gene antisense reagent of the present invention to a subject in an amount that effectively suppresses target gene expression, thereby reducing the level of the target gene polypeptide and reducing the level of target gene polypeptide activity in the subject.In some embodiments of the methods of the invention, contacting a cell with an siRNA reagent of the invention (also referred to herein as treating) results in suppression of target gene expression in the cell by at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 11 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or about 100%, e.g., below the level of detection of the test.

[0330] Some embodiments of the present invention involve determining the presence, absence, and / or amount (also referred to herein as level) of a target gene polypeptide from one or more biological samples obtained from one or more subjects. Such measurements can be used to assess the effectiveness of a treatment method of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of a target gene polypeptide in a biological sample obtained from a subject previously treated with the administration of a target gene dsNA reagent and / or a target gene antisense agent of the present invention. A decrease of at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more in the level of target gene polypeptide in a serum sample obtained from the subject after administration and treatment, compared to the pre-administration level of the target gene polypeptide in a serum sample obtained from the subject at a previous time point, or compared to a non-contact control level (e.g., the level of the target gene polypeptide in a control serum sample), indicates a level of effectiveness of the treatment administered to the subject.

[0331] In some embodiments of the present invention, physiological characteristics of a target gene-associated disease or condition determined for a subject can be used as a control result, and the results of determining physiological characteristics of the same subject at different time points can be compared with the control result. In a non-limiting example, the pathological characteristic of hemolysis is measured from a subject not receiving treatment with the target gene of the present invention, which is used as the subject's baseline or control value. In the treatment methods of the present invention, after one or more administrations of a target gene dsRNA reagent to the subject, blood cells are compared with the subject's control / baseline level, respectively. Such comparisons can be used to assess the onset, progression, or regression of a target gene-associated disease or condition in a subject. For example, if the baseline blood cells obtained from the subject have a higher thrombus count than those measured from the same subject after administration of the target gene dsRNA reagent or target gene antisense polynucleotide reagent of the present invention to the subject, this indicates regression of the target gene-associated disease or condition and indicates the effectiveness of administering the target gene dsRNA reagent of the present invention to treat the target gene-associated disease or condition.

[0332] Some embodiments of the present invention involve determining the presence, absence, and / or changes in physiological characteristics of a disease or condition associated with a target gene, for example, using methods such as, but not limited to, (1) measuring blood cells in a subject, (2) assessing physiological characteristics of one or more biological samples obtained from one or more subjects, or (3) physical examination of the subject, which measurements can be used to assess the effectiveness of the therapeutic methods of the present invention.

[0333] term As used herein, the term "RNAi" also refers to a short-chain "RNAi" known in the art and also referred to as "siRNA." As used herein, the term "RNAi" includes RNA and refers to a reagent that mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As known in the art, an RNAi target region refers to a continuous portion of the nucleotide sequence of an RNA molecule formed in the gene transcription process, including messenger RNA (mRNA), which is a processed product of primary transcript RNA. The target portion of the sequence is at least sufficiently long to be used as a substrate for RNAi-directed cleavage at or near the portion. The target sequence may be 8 to 30 nucleotides in length (inclusive), 10 to 30 nucleotides in length (inclusive), 12 to 25 nucleotides in length (inclusive), 15 to 23 nucleotides in length (inclusive), 16 to 23 nucleotides in length (inclusive), or 18 to 23 nucleotides in length (inclusive), including all relatively short lengths within each specified range. In some embodiments of the invention, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In certain embodiments, the length of the target sequence is between 9 and 26 nucleotides in length (inclusive), including all subranges and integers therebetween. For example, and not intended to be limiting, in certain embodiments of the invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, and the sequence is fully or at least essentially complementary to at least a portion of an RNA transcript of the target gene.

[0334] As used herein, "dsRNA reagent" refers to a composition comprising RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that can degrade or suppress the translation of target mRNA transcripts. Without wishing to be limited to a particular theory, the dsRNA reagent of the present invention can function by RNA interference mechanism (i.e., by interacting with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) of mammalian cells to induce the production of RNA interference), or can function by any alternative mechanism or pathway. Methods for achieving gene silencing in plant, invertebrate and vertebrate cells are known in the art (see, for example, Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188), the disclosures of which are incorporated herein by reference in their entirety.

[0335] As used herein, the dsRNA reagent disclosed herein consists of a sense strand and an antisense strand, and includes, but is not limited to, short interfering RNA (siRNA), RNAi reagent, microRNA (miRNA), short hairpin RNA (shRNA) and Dicer substrate. The antisense strand of the dsRNA reagent described herein is at least partially complementary to the target mRNA, and it should be understood in the art that dsRNA double-stranded structures of various lengths can be used to suppress the expression of target genes. For example, it is known that dsRNA double-stranded structures with 19, 20, 21, 22 and 23 base pairs can effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). It is also known in the art that relatively short or relatively long RNA double-stranded structures can effectively induce RNA interference.

[0336] As used herein, certain embodiments of the compositions and methods of the invention comprise single-stranded RNA in the composition and / or administer single-stranded RNA to a subject. Single-stranded antisense molecules comprised in certain compositions of the invention and / or administered in certain methods of the invention are referred to herein as "single-stranded antisense reagents" or "antisense polynucleotide reagents," and "antisense single-stranded nucleotide reagents" are also abbreviated as "ASOs." Single-stranded sense molecules comprised in certain compositions and / or administered in certain methods of the invention are referred to herein as "single-stranded sense reagents" or "sense polynucleotide reagents."

[0337] As used herein, the term "nucleotide sequence" refers to a polynucleotide sequence without chemical modification or compound attachment herein.

[0338] As used herein, the term "matching position" refers to the position where two strands are "paired" with each other in each strand when they are double-stranded.For example, in a 21-nucleobase sense strand and a 21-nucleobase antisense strand, the nucleobase at position 1 of the sense strand and the 21-position of the antisense strand are "matching positions".In another non-limiting example, in a 23-nucleobase sense strand and a 23-nucleobase antisense strand, the nucleobase at position 2 of the sense strand and the 22-position of the antisense strand are matching positions.In yet another non-limiting example, in an 18-nucleobase sense strand and an 18-nucleobase antisense strand, the nucleobase at position 1 of the sense strand and the nucleobase at position 18 of the antisense strand are matching positions, and the nucleobase at position 4 of the sense strand and the nucleobase at position 15 of the antisense strand are matching positions.Those skilled in the art will understand how to recognize the matching positions between the sense strand and the antisense strand of a paired double-stranded strand.

[0339] Mismatch As known to those skilled in the art, the effectiveness of dsRNA can tolerate mismatches, especially when the mismatches are located in the terminal regions of the dsRNA. Some mismatches are better tolerated, for example, mismatches with wobble base pairs G:U and A:C are better tolerated (Du et al., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21; 33(5): 1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005; 33(11): 3698).

[0340] Complementarity As used herein, unless otherwise specified, the term "complementarity" when used to describe the relationship between a first nucleotide sequence (e.g., a target gene dsRNA reagent sense strand or a target gene mRNA) and a second nucleotide sequence (e.g., a target gene dsRNA reagent antisense strand or a single-stranded antisense polynucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide comprising the second nucleotide sequence (forming inter-base pair hydrogen bonds under physiological conditions in mammals (or similar conditions in vitro)) and form a double helix or double helix structure under specific conditions. Other conditions, such as physiologically relevant conditions that may be encountered in vivo, may also be applicable. Those skilled in the art can determine the optimal set of conditions for testing the complementarity of two sequences based on the ultimate application of the hybridizing nucleotides. Complementary sequences may include Watson-Crick base pairs or non-Watson-Crick base pairs, and may include natural or modified nucleotides or nucleotide mimics, at least to the extent required for such hybridization. The sequence identity or complementarity is not relevant to the modifications.

[0341] For example, a complementary sequence within a target gene dsRNA described herein includes base pairing across the entire length of one or two nucleotide sequences between an oligonucleotide or polynucleotide comprising a first nucleotide sequence and an oligonucleotide or polynucleotide comprising a second nucleotide sequence. Such sequences may be referred to herein as "fully complementary" to each other. In embodiments in which two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, it should be understood that such overhangs are not considered mismatches as determined herein based on complementarity. For example, a target gene dsRNA reagent may include an oligonucleotide having a length of 19 nucleotides and another oligonucleotide having a length of 20 nucleotides, wherein the longer oligonucleotide comprises a 19-nucleotide sequence that is fully complementary to the shorter oligonucleotide; for purposes described herein, this case may be referred to as "fully complementary." Therefore, as used herein, "fully complementary" refers to hybridization of all (100%) of the bases in a contiguous sequence of a first polynucleotide with the same number of bases in a contiguous sequence of a second polynucleotide. The contiguous sequence can include all or part of the first or second nucleotide sequence.

[0342] As used herein, the term "essentially complementary" refers to a hybridization pair of nucleobase sequences in which at least about 85% (but not all) of the bases in a contiguous sequence of a first polynucleotide hybridize with the same number of bases in a contiguous sequence of a second polynucleotide. When the two sequences contain one or more mismatched base pairs upon hybridization, e.g., at least 1, 2, 3, 4, or 5 mismatched base pairs, the term "essentially complementary" can be used to refer to the first sequence forming a duplex of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp) relative to the second sequence, while retaining the ability to hybridize under conditions most relevant to its ultimate application, such as silencing gene expression of a target gene via the RISC pathway. The term "partially complementary" can be used herein to refer to a hybridization pair of nucleobase sequences in which at least 75% (but not all) of the bases in a contiguous sequence of a first polynucleotide hybridize to the same number of bases in a contiguous sequence of a second polynucleotide. In some embodiments, "partially complementary" refers to at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in a contiguous sequence of a first polynucleotide hybridize to the same number of bases in a contiguous sequence of a second polynucleotide.

[0343] The terms "complementary," "fully complementary," "essentially complementary," and "partially complementary," as used herein, can be used to refer to base matching between the sense and antisense strands of a dsRNA reagent, base matching between the antisense strand of a dsRNA reagent and a target mRNA sequence, or base matching between a single-stranded antisense oligonucleotide and a target mRNA sequence. It should be understood that the term "antisense strand of a dsRNA reagent" can refer to the same sequence as an "antisense polynucleotide reagent."

[0344] As used herein, the term "essentially the same" or "essentially identical" when referring to a nucleic acid sequence refers to a nucleic acid sequence that has at least about 85% or more sequence identity compared to a reference sequence, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity. The percentage of sequence identity is determined by comparing the optimal alignment of the two sequences over an alignment window. The percentage is calculated by determining the number of positions where the same nucleic acid base appears in the two sequences to generate the number of matching positions, dividing the number of matching positions by the total number of positions in the alignment window, and then multiplying the result by 100, thereby obtaining the percentage of sequence identity.

[0345] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a chain of nucleotides, described by a sequence designated using standard nucleotide nomenclature. As used herein, the term "double-stranded RNA" or "dsRNA" refers to a sequence comprising an RNA molecule or RNAi molecule complex, the molecule or complex having a hybridization double-stranded region comprising two antiparallel and essentially or completely complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations, respectively, relative to the target gene RNA. The double-stranded region can have any desired length that allows specific degradation of the target gene RNA by the RISC pathway, but is generally 9 to 30 base pairs in length, e.g., 15 to 30 base pairs in length. Considering a duplex between 9 and 30 base pairs, the duplex may be any length within this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs, and any subrange therein, including 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, The length of dsRNA reagents generated in cells by processing by Dicer and similar enzymes is typically in the range of 19-22 base pairs, including, but not limited to, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. One strand of the double-stranded region of the dsDNA agent contains a sequence that is essentially complementary to a region of the gene RNA.The two strands forming the double-stranded structure can be derived from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. When the double-stranded region is formed from a single molecule, the molecule can have a double-stranded structure (referred to herein as a "hairpin loop") formed from one strand at the 3'-end of the single-stranded nucleotide chain and another strand at the corresponding 5'-end. In some embodiments of the present invention, the hairpin configuration contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more unpaired nucleotides. When the essentially complementary duplex of a dsRNA reagent consists of a single RNA molecule, these molecules do not need to be covalently linked, although they may be. When the two strands are covalently linked by means other than a hairpin loop, the linking structure is referred to as a "linker."

[0346] base pairing The term "base pairing" may be used herein in several non-limiting interpretations, for example, a dsRNA reagent may include complementary or mismatched base pairs in the sense and antisense sequences.

[0347] Blunt or sticky ends In some embodiments of the present invention, a dsRNA reagent can comprise sense and antisense sequences with unpaired nucleotides or nucleotide mimics at one or two ends of the dsRNA reagent, resulting in an "overhang." An end without an unpaired nucleotide is called a "blunt end" and does not have an overhanging nucleotide. When both ends of a dsRNA reagent are blunt, the dsRNA is said to be "blunt-ended." In some embodiments of the present invention, the first end of the dsRNA reagent is blunt, in some embodiments, the second end of the dsRNA reagent is blunt, and in certain embodiments of the present invention, both ends of the dsRNA reagent are blunt.

[0348] In some embodiments of the dsRNA reagents of the present invention, the dsRNA does not have one or two blunt ends. In this case, the end of one strand of the dsRNA reagent has at least one unpaired nucleotide. For example, a nucleotide overhang exists when the 3'-end of one strand of the dsRNA extends beyond the 5'-end of another strand, or vice versa. The dsRNA can include an overhang of at least 1, 2, 3, 4, 5, 6, or more nucleotides. The nucleotide overhang can comprise or consist of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. In some embodiments, the nucleotide overhang exists in the sense strand of the dsRNA reagent, the antisense strand of the dsRNA reagent, or both ends of the dsRNA reagent. It should be understood that the overhanging nucleotides can be present at the 5'-end, 3'-end, or both ends of the antisense or sense strand of the dsRNA reagent.

[0349] As used herein, the term "antisense strand" or "guide strand" refers to the strand of a dsRNA reagent that contains a region that is essentially complementary to a target sequence. As used herein, the term "sense strand" or "passenger strand" refers to the strand of a dsRNA reagent that contains a region that is essentially complementary to a region of the antisense strand of the dsRNA reagent.

[0350] Modifications In some embodiments of the present invention, the RNA of the gene RNAi agent is chemically modified to obtain enhanced stability and / or one or more other beneficial properties. Nucleic acids in certain embodiments of the present invention can be synthesized and / or modified by methods known in the art, see, for example, "Current protocols in Nucleic Acid Chemistry," Beaucage, SLet et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that can be present in certain embodiments of the dsRNA reagent of the present invention include, for example, (a) terminal modifications such as 5'-end modifications (phosphorylation, conjugation, inverted linkage, etc.), 3'-end modifications (conjugation, DNA nucleotide, inverted linkage, etc.), (b) base modifications such as stable bases, unstable bases, or base substitutions that base pair with an expanded partner library, deleted bases (abasic nucleotides), or conjugated bases, (c) sugar modifications (e.g., at the 2'- or 4'-position) or sugar substitutions, and (d) backbone modifications, including modifications or substitutions that include phosphodiester bonds. Specific examples of RNA compounds that can be used in the specific embodiments of the dsRNA reagent, antisense polynucleotide and sense polynucleotide of the present invention include, but are not limited to, RNA that contains modified backbone or does not contain natural internucleotide bond.As a non-limiting example, RNA with backbone modification may not have phosphorus atom in backbone.RNA that does not have phosphorus atom in its internucleoside backbone can be called oligonucleotide.In certain embodiments of the present invention, modified RNA has phosphorus atom in its internucleotide backbone.

[0351] The term "RNA molecule" or "RNA" or "ribonucleic acid molecule" should be understood to include not only RNA molecules expressed or found in nature, but also RNA analogs and derivatives containing one or more ribonucleotide / ribonucleoside analogs or derivatives described herein or known in the art. The terms "ribonucleoside" and "ribonucleotide" are used interchangeably herein. RNA molecules can be modified in the nucleobase structure or the ribose-phosphate backbone structure (e.g., as described below), and molecules containing ribonucleoside analogs or derivatives must retain the ability to form double strands.

[0352] As used herein, the term "fluoro-modified nucleotide" refers to a nucleotide formed by substituting the hydroxy group at the 2'-position of the ribosyl group of a nucleotide with a fluoro group, and "non-fluoro-modified nucleotide" refers to a nucleotide or nucleotide analog formed by substituting the hydroxy group at the 2'-position of the ribosyl group of a nucleotide with a non-fluoro group. A "nucleotide analog" refers to a group that can substitute for a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleotides (abbreviated as BNA), and acyclic nucleotides. The methoxy-modified nucleotide refers to a nucleotide formed by substituting the 2'-hydroxy group of the ribosyl group with a methoxy group. An isonucleotide refers to a compound formed by changing the position of the base in the ribose ring of a nucleotide. In some embodiments, an isonucleotide may be a compound formed by moving the base from the 1'-position to the 2'-position or the 3'-position of the ribose ring. BNA refers to restricted or inaccessible nucleotides. BNAs can include 5-, 6-, or 7-membered rings, constricted bridge structures with a "locked" C3'-heparanase. Typically, the bridge is incorporated into the 2'-, 4'-position of the ribose to provide a single 2', 4'-BNA nucleotide. In some embodiments, BNAs can be LNAs, ENAs, cET BNAs, etc. Acyclic nucleotides are a type of nucleotide formed by opening the sugar ring of a nucleotide. In some embodiments, acyclic nucleotides can be unlocked nucleic acids (UNAs) or glycerol nucleic acids (GNAs).

[0353] By way of non-limiting example, the RNA molecule can further comprise at least one modified ribonucleoside, including, but not limited to, a 2'-O-methyl modified nucleoside, a nucleoside containing a 5' phosphorothioate group, a terminal nucleoside linked to a cholesterol derivative or a dodecanoic acid bisdecanamide group, a locked nucleoside, an abasic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino modified nucleoside, a 2'-alkyl modified nucleoside, a morpholino nucleoside, a phosphoramidate or non-natural base containing nucleoside, or any combination thereof. In some embodiments of the invention, the RNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 modified ribonucleosides spanning the entire length of the ribonucleoside of the dsRNA reagent molecule. The modifications need not be identical for each of the multiple modified ribonucleosides in such an RNA molecule.

[0354] In some embodiments, the dsRNA reagents, antisense polynucleotides, and / or sense polynucleotides of the present invention can contain one or more independently selected modified nucleotides and / or one or more independently selected non-phosphodiester linkages. As used herein, the term "independently selected" refers to selected elements, such as modified nucleotides and non-phosphodiester linkages, and indicates that two or more selected elements may, but are not necessarily, identical to each other. As used herein, "nucleotide base," "nucleotide," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a standard component of all nucleic acids and includes the bases that form nucleotides, such as adenine (a), guanine (g), cytosine (c), thymine (t), and uracil (u). Nucleobases can be further modified to include (but are not limited to) universal bases, hydrophobic bases, hybrid bases, size-extended bases, and fluorinated bases. The terms "ribonucleotide" or "nucleotide" can be used herein to refer to unmodified nucleotides, modified nucleotides, or alternative moieties. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil may be substituted by other moieties without significantly altering the base pairing properties of oligonucleotides containing nucleotides having such substituted moieties.

[0355] In one embodiment, the modified RNA used in the methods and compositions described herein is expected to be a peptide nucleic acid (PNA), which has the ability to form a desired double-stranded structure and enable or mediate the specific degradation of target RNA by the RISC pathway.In certain embodiments of the present invention, the gene RNA interference agent comprises a single-stranded RNA that interacts with the target gene RNA sequence to direct the cleavage of the target gene RNA.

[0356] Modified RNA backbones can include, for example, phosphorothioates, chiral phosphorothioates, diphosphorothioates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkyl phosphonates (including 3'-alkylene phosphonates and chiral phosphonates), phosphinates, phosphoramidates (3'-amino phosphoramidates and aminoalkyl phosphoramidates), thiophosphoramidates, thioalkyl phosphonates, thioalkyl phosphate triesters, and borate phosphates (normal 3'-5' linkages and their 2'-5' linked analogs, as well as those with reverse polarity, in which adjacent pairs of nucleoside units are linked in a 3'-5' to 5'-3' or 2'-5' to 5'-2' configuration). Also included are various salts, mixed salts, and free acid forms. Methods for producing phosphorus-containing linkages are common practice in the art, and such methods can be used to produce the specific modified dsRNA reagents, specific modified antisense polynucleotides and / or specific modified sense polynucleotides of the invention.

[0357] Modified RNA backbones that do not contain phosphorus atoms include those formed by short alkyl or cycloalkyl internucleotide linkages, mixed heteroatom and alkyl or cycloalkyl internucleotide linkages, or one or more short heteroatom or heterocyclyl internucleotide linkages. These include those with morpholine linkages (some formed from the sugar moiety of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, methylacetyl and thiomethylacetyl backbones, methylenemethylacetyl and thiomethylacetyl backbones, olefin-containing backbones, sulfamic acid backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other moieties containing a mixture of N, O, S, and CH2 moieties. Methods for producing modified RNA backbones that do not contain phosphorus atoms are commonly practiced in the art, and such methods can be used to produce specific modified dsRNA reagents, specific modified antisense polynucleotides, and / or specific modified sense polynucleotides of the present invention.

[0358] In certain embodiments of the present invention, RNA mimics are included in dsRNA, antisense polynucleotides, and / or sense polynucleotides, including, but not limited to, those in which the sugar and internucleotide linkage (i.e., backbone) of nucleotide units are replaced with novel groups. In such embodiments, the base units are maintained for hybridization with appropriate nucleic acid target compounds. Such oligomeric compounds (RNA mimics that have proven to have excellent hybridization properties) are called peptide nucleic acids (PNAs). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are linked directly or indirectly to the aza nitrogen atoms of the backbone amide moiety. Methods for producing RNA mimics are commonly practiced in the art, and such methods can be used to prepare certain modified dsRNA reagents of the present invention.

[0359] Some embodiments of the present invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, particularly -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- (referred to as methylene (methylimino) or MMI backbones), -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2- (wherein the natural phosphodiester backbone is represented as -OPO-CH2-). Methods for producing RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones are commonly practiced in the art, and such methods can be used to produce specific modified dsRNA reagents, specific antisense polynucleotides, and / or specific sense polynucleotides of the present invention.

[0360] The modified RNA may further comprise one or more substituted sugar moieties. The dsRNA, antisense polynucleotide and / or sense polynucleotide of the invention may comprise one of OH, F, O-, S- or N-alkyl, O-, S- or N-alkenyl, O-, S- or N-alkynyl, or O-alkyl-O-alkyl groups at the 2' position, wherein the alkyl, alkenyl and alkynyl groups are substituted or unsubstituted C1-C6. 10 Alkyl group or C2-C 10 It may be an alkenyl or alkynyl group. An exemplary suitable modification is O[(CH) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n CH3)]2, wherein n and m are from 1 to about 10. In other embodiments, the dsRNA comprises a C1 to C 10The modification may include a lower alkyl group, a substituted lower alkyl group, an alkylaryl group, an arylalkyl group, an O-alkylaryl group, or an O-aralkyl group, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, a heterocycloalkyl group, a heterocycloalkylaryl group, an aminoalkylamino group, a polyalkylamino group, a substituted silyl group, an RNA cleaving group, a reporter group, an intercalating agent, a group for improving the pharmacokinetic properties of a dsRNA reagent, or a group for improving the pharmacodynamic properties of a dsRNA reagent, an antisense polynucleotide, and / or a sense polynucleotide, and one of other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CH2CHOCH3, also known as 2'-O-(2-methoxyethyl)) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504). Another exemplary modification is the 2'-dimethylaminoethoxyethoxy group, also known as 2'-DMAOE, i.e., O(CH2)2ON(CH3)2, as described in the Examples below, and the 2'-dimethylaminoethoxyethoxy group (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. The methods for producing the described modified RNAs are commonly practiced in the art, and such methods can be used to produce certain modified dsRNA reagents of the present invention.

[0361] Similar modifications can also be made at other positions in the dsRNA reagents, antisense polynucleotides, and sense polynucleotides of the present invention, particularly at the 3'-position of the sugar of the 3'-terminal nucleotide or 2'-5'-linked dsRNA, antisense polynucleotide, or sense polynucleotide, and at the 5'-position of the 5'-terminal nucleotide. dsRNA reagents, antisense polynucleotides, and / or sense polynucleotides can also have sugar mimetics, such as cyclobutyl moieties instead of pentofuranosyl groups. For example, the methods for producing the modified RNAs described are commonly practiced in the art, and such methods can be used to produce specific modified dsRNA reagents, antisense polynucleotides, and / or sense polynucleotides of the present invention.

[0362] In some embodiments, dsRNA reagents, antisense polynucleotides, and / or sense polynucleotides can contain nucleobase (commonly abbreviated in the art as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine, and These include thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halogen, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-azaguanine and 7-azaadenine and 3-azaguanine and 3-azaadenine.Other nucleobases included in certain embodiments of the dsRNA reagents of the present invention are known in the art, see, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, JL, Ed. John Wiley & Sons, 1990; English et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Methods for producing nucleobase-modified and / or substituted dsRNAs, antisense strand polynucleotides and / or sense strand polynucleotides (e.g., those described herein) are commonly practiced in the art, and such methods can be used to produce certain modified dsRNA reagents, sense polynucleotides and / or antisense polynucleotides of the invention.

[0363] Certain embodiments of the dsRNA reagents, antisense polynucleotides, and / or sense polynucleotides of the present invention include RNAs modified to contain one or more locked nucleic acids (LNAs). Locked nucleic acids are nucleotides with a modified ribose moiety that contains an additional bridge connecting the 2' and 4' carbons. Such structures effectively "lock" the ribose in a 3'-internal conformation. Adding locked nucleic acids to the dsRNA reagents, antisense polynucleotides, and / or sense polynucleotides of the present invention can increase serum stability and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O. R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for producing dsRNA reagents, antisense polynucleotides, and / or sense polynucleotides, including locked nucleic acids, are commonly practiced in the art, and such methods can be used to produce certain modified dsRNA reagents of the present invention. Certain embodiments of the dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the present invention comprise at least one modified nucleotide, including 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-secomo nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, and 3'-Ome nucleotides, nucleotides containing 5'-phosphorothioate groups, or terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates, or nucleotides containing unnatural bases.In some embodiments, the dsRNA compound comprises an E-vinyl phosphonate nucleotide at the 5' end of the antisense strand (also referred to herein as the guide strand).

[0364] In certain embodiments of the present invention, the dsRNA compounds contain at least one modified nucleotide at the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide, including an abasic nucleotide, ribitol, an inverted nucleotide, an inverted abasic nucleotide, an inverted 2'-OMe nucleotide, or an inverted 2'-deoxynucleotide. Those skilled in the art are aware that the inclusion of an abasic or inverted abasic nucleotide at the end of an oligonucleotide can enhance stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003;31(11):2705-2716. doi:10.1093 / nar / gkg393).

[0365] In certain embodiments...

Claims

1. An RNAi reagent for suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the antisense strand having 18 to 30 nucleotides, and the antisense strand comprising a structure represented by formula (X) recited in the 3' to 5' direction; 3'- (N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5' Formula (X) Of these, each N F represents a 2'-fluoro modified nucleotide, Each N X each independently represents a modified or unmodified nucleotide, N X has no more than three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, n may be an integer from 0 to 7; RNAi reagents.

2. The antisense strand comprises the formula (I) listed in the 3' to 5' direction: 3'- (N X ) n N X N X N X N X N F N X N X N X N X N X N X N X N X N X N X N X N F N X -5' Formula (I) Of these, each N F represents a 2'-fluoro modified nucleotide, Each N X each independently represents a modified or unmodified nucleotide, N X has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, n may be an integer from 0 to 7; The dsRNA reagent of claim 1.

3. The antisense strand comprises the following formula (I-1) listed in the 3' to 5' direction: ......'). L ) n ! M1 ! L ! M2 ! L ! F ! L ! M3 ! L ! M4 ! L ! M5 ! M6 ! L ! M7 ! M8 ! L ! F ! L ____________________________ Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 has only three 2'-fluoro modified nucleotides or only one 2'-fluoro modified nucleotide, Each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7; The dsRNA reagent according to claim 1 or 2.

4. In the antisense strand represented by formula (I-1), N M1 , N M2 , N M3 , N M4 , N M6 , N M7 and N M8 There are only three 2'-fluoro modified nucleotides in N M5 is not a 2'-F modified nucleotide, The dsRNA reagent of claim 3 .

5. The antisense strand of the dsRNA reagent comprises, in the 3' to 5' direction, Formula (II): 3'-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N F N L N M7 N M8 N L N F N L -5' Formula (II) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 and N M4 There are only two 2'-fluoro modified nucleotides in N M5 , N M7 and N M8 is not a 2'-fluoro modified nucleotide, Each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7; The dsRNA reagent according to claims 1 to 3.

6. The antisense strand of the dsRNA reagent comprises, in the 3' to 5' direction, Formula (III): ......'). L ) n ! M1 ! L ! M2 ! L ! F ! L ! F ! L ! M4 ! L ! M5 ! M6 ! L ! M7 ! M8 ! L ! F ! L __________________________________ Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M6 and N M7 There are only two 2'-fluoro modified nucleotides in N M4 , N M5 and N M8 is not a 2'-fluoro modified nucleotide, Each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7; The dsRNA reagent according to claims 1 to 3.

7. The nucleotides at positions 2, 7, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides; The dsRNA reagent according to any one of claims 3 to 6.

8. The nucleotides at positions 2, 7, 12, 14, and 18 of the antisense strand (counting from the first paired nucleotide from the 5'-end) represented by formula (I-1) of the dsRNA reagent are 2'-fluoro-modified nucleotides; The dsRNA reagent according to any one of claims 3 to 6.

9. The nucleotides at positions 2, 5, 12, 14, and 18 of the antisense strand (counting from the first paired nucleotide from the 5'-end) represented by formula (I-1) of the dsRNA reagent are 2'-fluoro-modified nucleotides; The dsRNA reagent according to any one of claims 3 to 6.

10. The nucleotides at positions 2, 4, 10, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5'-end) represented by formula (I-1) of the dsRNA reagent are 2'-fluoro-modified nucleotides; The dsRNA reagent according to any one of claims 3 to 6.

11. The nucleotides at positions 2, 7, 10, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides; The dsRNA reagent according to any one of claims 3 to 6.

12. The nucleotides at positions 2, 5, 12, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (I-1) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides; The dsRNA reagent according to any one of claims 3 to 6.

13. The nucleotides at positions 2, 5, 10, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5'-end) represented by formula (I-1) of the dsRNA reagent are 2'-fluoro-modified nucleotides; The dsRNA reagent according to any one of claims 3 to 6.

14. The dsRNA reagent comprises an antisense strand represented by formula (I), wherein N M1 , N M2 , N M3 , N M5 , N M6 and N M8 There is only one 2'-fluoro modified nucleotide in N M4 , N M7 is not a 2'-fluoro modified nucleotide, The dsRNA reagent according to claim 1 or 2.

15. The antisense strand of the dsRNA reagent comprises, in the 3' to 5' direction, Formula (IV): 3'- (N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N L -5' Formula (IV) Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M5 , N M6 and N M8 There is only one 2'-fluoro modified nucleotide in N M4 , N M7 is not a 2'-fluoro modified nucleotide, Each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7; The dsRNA reagent of claim 14.

16. The nucleotides at positions 2, 4, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; The dsRNA reagent of claim 15.

17. The nucleotides at positions 2, 8, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; The dsRNA reagent of claim 15.

18. The nucleotides at positions 2, 12, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; The dsRNA reagent of claim 15.

19. The nucleotides at positions 2, 14, and 16 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; The dsRNA reagent of claim 15.

20. The nucleotides at positions 2, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; The dsRNA reagent of claim 15.

21. The nucleotides at positions 2, 6, and 14 of the antisense strand of the dsRNA reagent represented by formula (IV) (counting from the first paired nucleotide from the 5' end) are 2'-fluoro modified nucleotides; The dsRNA reagent of claim 15.

22. The antisense strand comprises the following formula (I-2) listed in the 3' to 5' direction: ......'). L ) n ! M1 ! L ! M2 ! L ! F ! L ! M3 ! M9 ! M4 ! M10 ! M5 ! M6 ! L ! M7 ! M8 ! L ! F ! L ______________________________ Of these, each N F represents a 2'-fluoro modified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N M10 each independently represents a modified or unmodified nucleotide, N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and N M10 has only three 2'-fluoro modified nucleotides, Each N L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n may be an integer from 0 to 7; The dsRNA reagent according to claim 1 or 2.

23. The nucleotides at positions 2, 7, 11, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5'-end) represented by formula (I-2) of the dsRNA reagent are 2'-fluoro-modified nucleotides; 23. The dsRNA reagent of claim 22.

24. The nucleotides at positions 2, 7, 11, 14, and 18 of the antisense strand of the dsRNA reagent represented by formula (I-2) (counting from the first paired nucleotide from the 5'-end) are 2'-fluoro-modified nucleotides; 23. The dsRNA reagent of claim 22.

25. The nucleotides at positions 2, 8, 12, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5'-end) represented by formula (I-2) of the dsRNA reagent are 2'-fluoro-modified nucleotides; 23. The dsRNA reagent of claim 22.

26. The nucleotides at positions 2, 9, 12, 14, and 16 of the antisense strand (counting from the first paired nucleotide from the 5'-end) represented by formula (I-2) of the dsRNA reagent are 2'-fluoro-modified nucleotides; 23. The dsRNA reagent of claim 22.

27. N of the antisense strand of the dsRNA reagent represented by formula (I-1), formula (I-2), formula (II), formula (III) and / or formula (IV) L One or more of the nucleotides may be a 2'-O-methyl modified nucleotide, a 2'-deoxynucleotide, a 2',3'-seco nucleotide mimic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), an ethylene glycol nucleic acid nucleotide (glycol nucleotide), or a 2'-O-methyl modified nucleotide (2'-deoxynucleotide). modified nucleotides independently selected from: nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates or unnatural bases including nucleotides, and preferably, the N-terminal nucleotides in the dsRNA reagent are L The nucleotide is a modified nucleotide selected from a 2'-O-methyl modified nucleotide, UNA, or Invab; The dsRNA reagent according to any one of claims 3 to 26.

28. N of the antisense strand represented by formula (I) and / or formula (X) of the dsRNA reagent X One or more of the nucleotides may be a 2'-fluoro modified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-deoxy nucleotide, a 2',3'-seco nucleotide mimic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), an ethylene glycol nucleic acid nucleotide (glycol nucleotide), modified nucleotides independently selected from: nucleotides (GNA), bicyclic nucleic acids (BNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates or unnatural bases including nucleotides, and preferably, the N-terminal nucleotides in the dsRNA reagent are L The nucleotide is a modified nucleotide selected from a 2'-O-methyl modified nucleotide, UNA, or Invab; The dsRNA reagent according to claim 1 or 2.

29. The dsRNA reagent comprises, in the antisense strand, an E-vinyl phosphonate nucleotide at the 5' end of the antisense strand; The dsRNA reagent according to any one of claims 1 to 28.

30. The dsRNA reagent is an antisense strand represented by formula (I-1), formula (I-2), formula (II), formula (III) and / or formula (IV), wherein N M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 , N M8 , N M9 and / or N M10 are modified nucleotides independently selected from 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNA), open ring nucleotides (UNA), ethylene glycol nucleotides (GNA), bicyclic nucleotides (BNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates or unnatural bases including nucleotides; The dsRNA reagent according to any one of claims 3 to 28.

31. N in the antisense strand of the dsRNA reagent represented by formula (I-1) M1 , N M2 , N M3 , N M4 , N M5 , N M6 , N M7 and N M8 are each independently selected from 2'-O-methyl modified nucleotides when not 2'-fluoro modified nucleotides; 31. The dsRNA reagent of claim 30.

32. The dsRNA reagent has a sense strand that is complementary or essentially complementary to the antisense strand, and the length of the complementary region is between 18 and 25 nucleotides, preferably the length of the complementary region is 18 to 23 nucleotides, preferably the length of the complementary region is 19 to 21 nucleotides, preferably the length of the complementary region is 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides; The dsRNA reagent according to any one of claims 1 to 31.

33. The dsRNA reagent has a sense strand that is perfectly complementary to the antisense strand. The dsRNA reagent according to any one of claims 1 to 32.

34. In the dsRNA reagent, n is 0, 1, 2, 3, 4, 5, 6, or 7; The dsRNA reagent according to any one of claims 1 to 33.

35. the sense strand of the dsRNA reagent is 40 nucleotides or less in length, preferably each strand of the dsRNA reagent is 30 nucleotides or less in length, preferably each strand of the dsRNA reagent is 25 nucleotides or less in length, preferably each strand of the dsRNA reagent is 23 nucleotides or less in length, preferably each strand of the dsRNA reagent is 19, 20 or 21 nucleotides in length; The dsRNA reagent according to any one of claims 1 to 34.

36. the 3'-end or 5'-end or both ends of any one strand of the dsRNA reagent comprise one or more overhanging end regions of the dsRNA reagent, and the overhangs may have a length of 1 to 5 nucleotides; The dsRNA reagent according to any one of claims 1 to 35.

37. The 3'-end of the antisense strand of the dsRNA reagent has a blunt end; The dsRNA reagent according to any one of claims 1 to 36.

38. the 3'-end of the antisense strand and / or the 5'-end of the sense strand of the dsRNA reagent have an overhang of 1, 2, 3, 4, or 5 unpaired nucleotides; The dsRNA reagent according to any one of claims 1 to 37.

39. the 3'-end of the sense strand and / or the 5'-end of the antisense strand of the dsRNA reagent have a blunt end; The dsRNA reagent according to any one of claims 1 to 38.

40. the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage, preferably the sense strand of the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage, preferably the antisense strand of the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage, preferably the sense strand and / or antisense strand of the dsRNA reagent comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleotide linkages, preferably the 3'-end and / or 5'-end of the sense strand and / or antisense strand of the dsRNA reagent comprises 1 or 2 phosphorothioate internucleotide linkages; The dsRNA reagent according to any one of claims 1 to 39.

41. The dsRNA reagent further comprises one or more targeting or linking groups. The dsRNA reagent according to any one of claims 1 to 40.

42. one or more targeting or linking groups of the dsRNA reagent are conjugated to the sense strand; 42. The dsRNA reagent of claim 41.

43. The targeting or linking group described in the dsRNA reagents includes N-acetyl-galactosamine (GalNAc), a lipophilic molecule.

42. The dsRNA reagent of claim 41.

44. The targeting group or linking group in the dsRNA reagent is conjugated to the 5'-end of the sense strand, and the targeting group in the dsRNA reagent has the structure: 【Table 1-1】 【Table 1-2】 【Table 1-3】 【Table 1-4】 42. The dsRNA reagent of claim 41.

45. The antisense strand of the dsRNA reagent contains one inverted abasic residue at the 3'-end, and preferably the sense strand of the dsRNA reagent contains one or two inverted abasic residues at the 3' and / or 5'-end. The dsRNA reagent according to any one of claims 1 to 44.

46. An RNAi reagent for suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the sense strand having 18 to 40 nucleotides, and the sense strand comprises a structure represented by formula (V) recited in the 5' to 3' direction: 5'- (N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L - 3' Formula (V) Among them, each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide; N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 wherein there are at least two 2'-fluoro modified nucleotides in formula (V), there are no motifs of three or more consecutive 2'-fluoro modified nucleotides, and in formula (V), there are no more than six total 2'-fluoro modified nucleotides; Each N' L represents independently a modified or unmodified nucleotide, n' may be an integer from 0 to 7; RNAi reagents.

47. the sense strand comprises, in the 5' to 3' direction, the structure of formula (V'): 5'- (N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' L N' L N' L N' L N' L N' L N' L - 3' Formula (V') Among them, each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 each independently represents a modified or unmodified nucleotide; N' N1 , N' N2 , N' N3 , N' N4 , N' N5 and N' N6 has only two 2'-fluoro modified nucleotides present, Each N' L independently represent a modified or unmodified nucleotide, the modification being other than a 2'-fluoro modified nucleotide; n' may be an integer from 0 to 7; 47. The dsRNA reagent of claim 46.

48. the nucleotides at positions 9, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) represented by formula (V') of the dsRNA reagent are 2'-fluoro-modified nucleotides; 48. The dsRNA reagent of claim 47.

49. the nucleotides at positions 9, 11, and 12 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) represented by formula (V') of the dsRNA reagent are 2'-fluoro-modified nucleotides; 48. The dsRNA reagent of claim 47.

50. the nucleotides at positions 8, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) represented by formula (V') of the dsRNA reagent are 2'-fluoro-modified nucleotides; 48. The dsRNA reagent of claim 47.

51. the nucleotides at positions 11, 12, and 14 of the sense strand (counting from the first paired nucleotide from the 3'-end of the sense strand) represented by formula (V') of the dsRNA reagent are 2'-fluoro-modified nucleotides; 48. The dsRNA reagent of claim 47.

52. the nucleotides at positions 11, 12, and 15 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) represented by formula (V') of the dsRNA reagent are 2'-fluoro-modified nucleotides; 48. The dsRNA reagent of claim 47.

53. An RNAi reagent for suppressing expression of a target gene, wherein the RNAi reagent is a double-stranded ribonucleic acid (dsRNA) reagent, the dsRNA reagent comprising a sense strand and an antisense strand complementary to at least a portion of an mRNA corresponding to the target gene, the sense strand having 18 to 40 nucleotides, and the sense strand comprises a structure represented by formula (IX) listed in the 5' to 3' direction; 5'- (N' L ) n’ N' L N' L N' L N' N1 N' N2 N' N3 N' N4 N' F N' L N' N5 N' N6 N' N7 N' L N' L N' L N' L N' L N' L -3' Formula (IX) Among them, each N' F represents a 2'-fluoro modified nucleotide, N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and N' N7 each independently represents a modified or unmodified nucleotide; N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and N' N7 wherein there are at least two 2'-fluoro modified nucleotides wherein there are no motifs of three or more consecutive 2'-fluoro modified nucleotides in formula (IX), and there are no more than six total 2'-fluoro modified nucleotides in formula (IX); Each N' L represents independently a modified or unmodified nucleotide, n' may be an integer from 0 to 7; RNAi reagents.

54. The nucleotides at positions 7, 9, 11, and 13 of the sense strand (counting from the first paired nucleotide from the 3' end of the sense strand) represented by formula (IX) of the dsRNA reagent are 2'-fluoro modified nucleotides; 54. The dsRNA reagent of claim 53.

55. N' of the sense strand represented by formula (V) or formula (IX) of the dsRNA reagent L One or more of the nucleotides may be a 2'-fluoro modified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-deoxy nucleotide, a 2',3'-seco nucleotide mimic, a locked nucleotide (LNA), an unlocked nucleic acid nucleotide (UNA), an ethylene glycol nucleic acid nucleotide (glycol nucleotide), nucleotide (GNA), bicyclic nucleic acid (BNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted abasic nucleotide (Invab), inverted 2'-OMe nucleotide, inverted 2'-deoxy nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, 3'-OMe nucleotide, phosphate group modified nucleotide, cholesterol derivative or terminal nucleotide linked to dodecanoic acid bisdecanamide group, 2'-amino modified nucleotide, phosphoramidate or modified nucleotide independently selected from non-natural base containing nucleotide, and preferably N' represented by formula (V) of the dsRNA reagent L The nucleotide is a modified nucleotide selected from a 2'-O-methyl modified nucleotide, UNA, or Invab; The dsRNA reagent according to any one of claims 46 to 54.

56. The dsRNA reagent comprises an E-vinyl phosphonate nucleotide at the 5' end of the antisense strand; The dsRNA reagent according to any one of claims 46 to 55.

57. The dsRNA reagent comprises N' in the sense strand represented by formula (V) and / or formula (IX). N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and N' N7 are modified nucleotides independently selected from 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-deoxynucleotides, 2',3'-seco nucleotide mimics, locked nucleotides (LNA), open ring nucleotides (UNA), ethylene glycol nucleotides (GNA), bicyclic nucleotides (BNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted abasic nucleotides (Invab), inverted 2'-OMe nucleotides, inverted 2'-deoxynucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, 3'-OMe nucleotides, phosphate group modified nucleotides, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bisdecanamide groups, 2'-amino modified nucleotides, phosphoramidates or unnatural bases including nucleotides; The dsRNA reagent according to any one of claims 46 to 56.

58. N' N1 , N' N2 , N' N3 , N' N4 , N' N5 , N' N6 and N' N7 are each independently selected from 2'-O-methyl modified nucleotides when not 2'-fluoro modified nucleotides; 58. The dsRNA reagent of claim 57.

59. The dsRNA reagent has an antisense strand that is complementary or essentially complementary to the sense strand, and the length of the complementary region is between 18 and 25 nucleotides, preferably the length of the complementary region is 18 to 23 nucleotides, preferably the length of the complementary region is 19 to 21 nucleotides, preferably the length of the complementary region is 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides; The dsRNA reagent according to any one of claims 46 to 58.

60. having an antisense strand that is completely complementary to the sense strand, The dsRNA reagent according to any one of claims 46 to 59.

61. In the dsRNA reagent, n' is 0, 1, 2, 3, 4, 5, 6, or 7; The dsRNA reagent according to any one of claims 46 to 60.

62. Each strand of the dsRNA antisense strand is 30 nucleotides or less in length, preferably each strand of the dsRNA reagent is 30 nucleotides or less in length, preferably each strand of the dsRNA reagent is 25 nucleotides or less in length, preferably each strand of the dsRNA reagent is 23 nucleotides or less in length, preferably each strand of the dsRNA reagent is 19, 20 or 21 nucleotides in length; 62. The dsRNA reagent according to any one of claims 46 to 61.

63. The sense strand of the dsRNA reagent represented by formula (V) or formula (IX) may have an unpaired nucleotide overhang at one or both of the 5'-ends.

63. The dsRNA reagent according to any one of claims 46 to 62.

64. The 5'-end of the sense strand of the dsRNA reagent represented by formula (V) or formula (IX) has a blunt end.

64. The dsRNA reagent according to any one of claims 46 to 63.

65. the 3'-end of the antisense strand of the dsRNA reagent has an overhang of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 unpaired nucleotides; 65. The dsRNA reagent according to any one of claims 46 to 64.

66. the 5'-end of the antisense strand and / or the 3'-end of the sense strand of the dsRNA reagent have a blunt end; 66. The dsRNA reagent according to any one of claims 46 to 65.

67. the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage, preferably the sense strand of the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage, preferably the antisense strand of the dsRNA reagent comprises at least one phosphorothioate internucleotide linkage, preferably the sense strand and / or antisense strand of the dsRNA reagent comprises 1, 2, 3, 4, 5 or 6 phosphorothioate internucleotide linkages, preferably the 3'-end and / or 5'-end of the sense strand and / or antisense strand of the dsRNA reagent comprises 1 or 2 phosphorothioate internucleotide linkages; 67. The dsRNA reagent according to any one of claims 46 to 66.

68. The dsRNA reagent further comprises one or more targeting groups or linking groups.

68. The dsRNA reagent according to any one of claims 46 to 67.

69. one or more targeting or linking groups of the dsRNA reagent are conjugated to the sense strand; 69. The dsRNA reagent of claim 68.

70. The targeting group or linking group in the dsRNA reagent comprises N-acetyl-galactosamine (GalNAc), a lipophilic molecule, and the targeting group or linking group in the dsRNA reagent is conjugated to the 5'-end of the sense strand, and the targeting group preferably has the structure: 【Table 2-1】 【Table 2-2】 【Table 2-3】 【Table 2-4】 、 69. The dsRNA reagent of claim 68.

71. the 3'-end of the sense strand of the dsRNA reagent contains a single inverted abasic residue; The dsRNA reagent according to any one of claims 46 to 70.

72. the 3' and / or 5' ends of the sense strand of the dsRNA reagent contain one or two inverted abasic residues; The dsRNA reagent according to any one of claims 46 to 70.

73. the dsRNA reagent is an siRNA; 73. The dsRNA reagent according to any one of claims 1 to 72.

74. RNAi reagents for suppressing expression of a target gene sequence, wherein the RNAi reagents are double-stranded ribonucleic acid (dsRNA) reagents, and the dsRNA reagents include any combination of an antisense strand having a nucleotide sequence according to any one of claims 1 to 45 and a sense strand having a nucleotide sequence according to any one of claims 46 to 72. RNAi reagents.

75. 75. A method for producing a dsRNA reagent comprising the steps of: composition.

76. further comprising a pharmaceutically acceptable carrier, 76. The composition of claim 75.

77. further comprising one or more additional therapeutic agents; 77. The composition of claim 76.

78. Packaged in a reagent kit, container, package, dispenser, pre-filled syringe or vial, 77. The composition of claim 76.

79. prepared for intraocular, intravaginal, intrarectal, intranasal, transdermal, subcutaneous administration, intravenous infusion, intraarterial, intralymphatic, intrabronchial, intrapleural, intraperitoneal, intracerebrospinal or intramuscular injection, intrapulmonary, intrathecal or intraventricular administration; 77. The composition of claim 76.

80. 75. A method for producing a dsRNA reagent comprising the steps of: cell.

81. 1. A method for suppressing expression of a target gene in a cell, comprising: delivering the dsRNA reagent of any one of claims 1 to 74 to the subject or object, such that the dsRNA reagent is delivered to a specific target in the subject; method.

82. The dsRNA reagent is administered to the subject in vivo and administered intraocularly, intravaginally, intrarectally, intranasally, transdermally, subcutaneously, by intravenous infusion, intraarterially, intralymphatically, intrabronchially, intrapleurally, intraperitoneally, intracerebrospinal or intramuscular injection, intrapulmonary, intrathecally or intraventricularly; 82. The method of claim 81.

83. The target genes include LPA, PNPLA3, ASGR1, F7, F12, FXI, APOCIII, APOB, APOL1, TTR, PCSK9, SCAP, KRAS, CD274, PDCD1, C5, ALAS1, HAO1, LDHA, ANGPTL3, SERPINA1, AGT, HAMP, LECT2, EGFR, VEGF, and KIF11. , AT3, CTNNB1, HMGB1, HIF1A, APP, ATXN2, C9orf72, TARDBP, MAPT (Tau), HTT, SNCA, FUS, ATXN3, SCN9A, SCN10A, CACNA1B, ATXN1, SCAl, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK and STAT3, 82. The method of claim 81.

84. In the manufacture of drugs for viral diseases, neuromuscular diseases, bacterial infections, inflammatory and immune disorders, metabolic diseases, liver diseases, kidney diseases, cardiovascular diseases, ophthalmological diseases, pulmonary diseases and rare diseases, 74. The application of the dsRNA reagent according to any one of claims 1 to 73.