siRNA compositions and methods targeting alpha synuclein nucleic acids

SiRNA molecules targeting the SNCA gene with modified nucleosides are developed to address the limited treatment options for neurodegenerative synucleinopathies by reducing SNCA expression in the central nervous system.

JP2025531512APending Publication Date: 2025-09-19ATALANTA THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025518447
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-09-29
Filing Date
2023-09-28
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Current treatments for neurodegenerative synucleinopathies such as Parkinson's disease, Alzheimer's disease, and multiple system atrophy are limited, and there is a need for therapeutic agents that can selectively reduce alpha-synuclein (SNCA) activity to provide effective treatment.

Method used

Development of single- or double-stranded interfering RNA molecules, specifically siRNA molecules, targeting the SNCA gene with modified nucleosides and internucleoside linkages, delivered to the central nervous system to reduce SNCA expression.

Benefits of technology

The siRNA molecules effectively reduce SNCA mRNA and protein levels in transgenic mice, providing a potential therapeutic approach for neurodegenerative synucleinopathies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025531512000001_ABST
    Figure 2025531512000001_ABST
Patent Text Reader

Abstract

The present application is directed to single- or double-stranded interfering RNA molecules (e.g., siRNAs) that target the alpha synuclein (SNCA) gene. Interfering RNA molecules, as well as pharmaceutical compositions containing them, may contain specific patterns of nucleoside and internucleoside linkage modifications. The siRNA molecules may also be branched siRNA molecules, such as biantennary, triantennary, or tetraantennary siRNA molecules. The disclosed siRNA molecules may further feature a 5' phosphorus-stabilizing moiety and / or a hydrophobic moiety. Furthermore, the present disclosure provides methods for delivering the disclosed siRNA molecules to the central nervous system of a subject, such as a subject identified as having a synucleinopathy.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present application relates to siRNA compositions and methods that target alpha synuclein nucleic acids. 1. Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated herein by reference in its entirety. The XML copy was created on September 27, 2023, has the filename "51436-042WO2_Sequence_Listing_9_27_23", and is 820,156 bytes in size. [Background technology]

[0002] 2.Background technology Expression of the alpha-synuclein (SNCA) gene produces the protein alpha-synuclein. While alpha-synuclein is normally a soluble monomer localized in the presynaptic region of axons, this protein can form filamentous aggregates, the major component of intracellular inclusions in neurodegenerative synucleinopathies. For example, mutations and amplifications of the SNCA gene are associated with the formation of filamentous aggregates, a hallmark of familial Parkinson's disease. Other neurodegenerative synucleinopathies associated with alpha-synuclein aggregation include sporadic Parkinson's disease, Alzheimer's disease, multiple system atrophy, and dementia with Lewy bodies. Currently, treatment options for neurodegenerative synucleinopathies are limited. Therefore, there remains a need for therapeutic agents that can selectively reduce SNCA activity to provide effective treatment for neurodegenerative synucleinopathies. Summary of the Invention

[0003] 3. Summary of the Invention The present application is directed to single- or double-stranded interfering RNA molecules (e.g., siRNA molecules) targeting the SNCA gene. The interfering RNA molecules may contain specific patterns of nucleoside and internucleoside linkage modifications. The present disclosure also features pharmaceutical compositions comprising the same. The siRNA molecules may be branched siRNA molecules, such as bi-, tri-, or tetra-branched siRNA molecules. The disclosed siRNA molecules may further feature a 5' phosphorus-stabilizing moiety and / or a hydrophobic moiety. Furthermore, the present disclosure provides methods for delivering the siRNA molecules of the present disclosure to the central nervous system of a subject, such as a subject identified as having a synucleinopathy. In certain embodiments, the interfering RNA molecules of the present disclosure are bi-branched siRNA molecules. In certain embodiments, the bi-branched siRNA molecules of the present disclosure comprise: a) a sense strand comprising the sequence (mU)#(mA)#(mC)(fC)(mA)(fC)(mU)(fU)(mA)(fU)(mU)(mC)(fU)#(mA)#(mA)-DIO (SEQ ID NO: 841), and an antisense strand comprising the sequence V(mU)#(fU)#(mA)(fG)(fA)(fA)(mA)(fU)(mA)(fA)(mG)(fU)(mG)(fG)(mU)(fA)#(mG)#(mU)#(mC)#(mA)#(mC) (SEQ ID NO: 842); b) a sense strand comprising the sequence (mC)#(mA)#(mA)(fG)(mU)(fG)(mC)(fU)(mC)(fA)(mG)(mU)(mU)(fC)#(mC)#(mA)-DIO (SEQ ID NO: 843), and an antisense strand comprising the sequence V(mU)#(fG)#(mG)(fA)(fA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)(mU)(fG)#(mU)#(mA)#(mC)#(mA)#(mG) (SEQ ID NO: 844); c) a sense strand comprising the sequence (mA)#(mG)#(mU)(fG)(mG)(fU)(mG)(fC)(mA)(fU)(mG)(mG)(mU)(fG)#(mU)#(mA)-DIO (SEQ ID NO: 845), and an antisense strand comprising the sequence V(mU)#(fA)#(mC)(fA)(fC)(fC)(mA)(fU)(mG)(fC)(mA)(fC)(mC)(fA)(mC)(fU)#(mC)#(mC)#(mC)#(mU)#(mC) (SEQ ID NO: 846); d) a sense strand comprising the sequence (mC)#(mA)#(mA)(fU)(mG)(fA)(mG)(fG)(mC)(fU)(mU)(mA)(mU)(fG)#(mA)#(mA)-DIO (SEQ ID NO: 847), and an antisense strand comprising the sequence V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 848); e) a sense strand comprising the sequence (mU)#(mC)#(mA)(fG)(mU)(fU)(mC)(fC)(mA)(fA)(mU)(mG)(mU)(fG)#(mC)#(mA)-DIO (SEQ ID NO: 849), and an antisense strand comprising the sequence V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 850); f) a sense strand comprising the sequence (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 851), and an antisense strand comprising the sequence V(mU)#(fG)#(mC)(fA)(fC)(fA)(mU)(fU)(mG)(fG)(mA)(fA)(mC)(fU)(mG)(fA)#(mG)#(mC)#(mA)#(mC)#(mU) (SEQ ID NO: 852); or g) a sense strand comprising the sequence (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 853), and an antisense strand comprising the sequence V(mU)#(fG)#(mU)(fU)(fU)(mA)(fA)(mC)(fA)(mU)(fC)(mG)(fU)(mA)(fG)#(mA)#(mU)#(mU)#(mG)#(mA) (SEQ ID NO: 854); where m represents a 2'-O-Me ribonucleoside, f represents a 2'-F ribonucleoside, # represents a phosphorothioate internucleoside linkage, -DIO represents a divalent oligonucleotide (DIO) linker, and V represents a vinyl phosphonate.

[0004] In some embodiments, the siRNA molecule comprises: a) a sense strand comprising the sequence (mU)#(mA)#(mC)(fC)(mA)(fC)(mU)(fU)(mA)(fU)(mU)(mC)(fU)#(mA)#(mA)-DIO (SEQ ID NO: 841), and an antisense strand comprising the sequence V(mU)#(fU)#(mA)(fG)(fA)(fA)(mA)(fU)(mA)(fA)(mG)(fU)(mG)(fG)(mU)(fA)#(mG)#(mU)#(mC)#(mA)#(mC) (SEQ ID NO: 842); b) a sense strand comprising the sequence (mC)#(mA)#(mA)(fG)(mU)(fG)(mC)(fU)(mC)(fA)(mG)(mU)(mU)(fC)#(mC)#(mA)-DIO (SEQ ID NO: 843), and an antisense strand comprising the sequence V(mU)#(fG)#(mG)(fA)(fA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)(mU)(fG)#(mU)#(mA)#(mC)#(mA)#(mG) (SEQ ID NO: 844); c) a sense strand comprising the sequence (mA)#(mG)#(mU)(fG)(mG)(fU)(mG)(fC)(mA)(fU)(mG)(mG)(mU)(fG)#(mU)#(mA)-DIO (SEQ ID NO: 845), and an antisense strand comprising the sequence V(mU)#(fA)#(mC)(fA)(fC)(fC)(mA)(fU)(mG)(fC)(mA)(fC)(mC)(fA)(mC)(fU)#(mC)#(mC)#(mC)#(mU)#(mC) (SEQ ID NO: 846); d) a sense strand comprising the sequence (mC)#(mA)#(mA)(fU)(mG)(fA)(mG)(fG)(mC)(fU)(mU)(mA)(mU)(fG)#(mA)#(mA)-DIO (SEQ ID NO: 847), and an antisense strand comprising the sequence V(mU)#(fU)#(mC)(fA)(fU)(fA)(mA)(fG)(mC)(fC)(mU)(fC)(mA)(fU)(mU)(fG)#(mU)#(mC)#(mA)#(mG)#(mG) (SEQ ID NO: 855); e) a sense strand comprising the sequence (mA)#(mG)#(mU)(fG)(mC)(fU)(mC)(fA)(mG)(fU)(mU)(mC)(mC)(fA)#(mA)#(mA)-DIO (SEQ ID NO: 856), and an antisense strand comprising the sequence V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 850); f) a sense strand comprising the sequence (mU)#(mC)#(mA)(fG)(mU)(fU)(mC)(fC)(mA)(fA)(mU)(mG)(mU)(fG)#(mC)#(mA)-DIO (SEQ ID NO: 857), and an antisense strand comprising the sequence V(mU)#(fG)#(mC)(fA)(fC)(fA)(mU)(fU)(mG)(fG)(mA)(fA)(mC)(fU)(mG)(fA)#(mG)#(mC)#(mA)#(mC)#(mU) (SEQ ID NO: 852); or g) a sense strand comprising the sequence (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 853), and an antisense strand comprising the sequence V(mU)#(fG)#(mU)(fU)(fU)(mA)(fA)(mC)(fA)(mU)(fC)(mG)(fU)(mA)(fG)#(mA)#(mU)#(mU)#(mG)#(mA) (SEQ ID NO: 854); where m represents a 2'-O-Me ribonucleoside, f represents a 2'-F ribonucleoside, # represents a phosphorothioate internucleoside linkage, -DIO represents a divalent oligonucleotide (DIO) linker, and V represents a vinyl phosphonate.

[0005] In another aspect, the disclosure features a small interfering RNA (siRNA) molecule including an antisense strand and a sense strand complementary to the antisense strand. The antisense strand can be, for example, 10-30 nucleotides in length and can be sufficiently complementary to hybridize to a region within an alpha synuclein (SNCA) mRNA transcript having a nucleic acid sequence set forth in any one of SEQ ID NOs: 421-840.

[0006] In some embodiments, the antisense strand has at least 70% complementarity to a region of 21 contiguous nucleobases within an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In some embodiments, the antisense strand has at least 75% complementarity to a region of 21 contiguous nucleobases within an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In some embodiments, the antisense strand has at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to a region of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0007] In some embodiments, the antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 consecutive nucleotides that are completely complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs:421-840.

[0008] In some embodiments, the antisense strand comprises 10 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0009] In some embodiments, the antisense strand comprises 12 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0010] In some embodiments, the antisense strand comprises 15 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0011] In some embodiments, the antisense strand comprises 18 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0012] In some embodiments, the antisense strand comprises 21 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0013] In some embodiments, the antisense strand comprises 24 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0014] In some embodiments, the antisense strand comprises 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0015] In some embodiments, the antisense strand contains no more than 9 nucleotide mismatches to a region of 21 contiguous nucleobases of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In some embodiments, the antisense strand contains no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or only 1 mismatch to a region of an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0016] In some embodiments, the region of the SNCA mRNA transcript has the nucleic acid sequence of any one of SEQ ID NOs: 459, 535, 551, 599, 631, 663, 664, 666, 667, 671, 748, 750, 751, 752, 760, 762, and 777.

[0017] In some embodiments, the region of the SNCA mRNA transcript has the nucleic acid sequence of any one of SEQ ID NOs: 535, 599, 664, 666, 671, 750, 752, 760, and 762.

[0018] In some embodiments, the antisense strand has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1-420.

[0019] In some embodiments, the antisense strand has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1-420.

[0020] In some embodiments, the antisense strand has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NOs: 1-420. In some embodiments, the antisense strand has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1-420.

[0021] In some embodiments, the antisense strand has the nucleic acid sequence of any one of SEQ ID NOs: 1-420.

[0022] In some embodiments, the nucleic acid sequence is any one of SEQ ID NOs: 39, 115, 131, 179, 211, 243, 244, 246, 247, 251, 328, 330, 331, 332, 340, 342, and 357.

[0023] In some embodiments, the nucleic acid sequence is any one of SEQ ID NOs: 115, 179, 244, 246, 251, 330, 332, 340, and 342.

[0024] In some embodiments, the sense strand has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0025] In some embodiments, the sense strand has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0026] In some embodiments, the sense strand has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NOs: 421-840. In some embodiments, the sense strand has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0027] In some embodiments, the sense strand has the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0028] In some embodiments, the nucleic acid sequence is any one of SEQ ID NOs: 459, 535, 551, 599, 631, 663, 664, 666, 667, 671, 748, 750, 751, 752, 760, 762, and 777.

[0029] In some embodiments, the nucleic acid sequence is any one of SEQ ID NOs: 535, 599, 664, 666, 671, 750, 752, 760, and 762.

[0030] In some embodiments, the antisense strand comprises a structure represented by Formula I, which, in the 5' to 3' direction, is: AB-(A') j -CP 2 -DP 1 -(C'-P 1 ) k -C' Formula I; where A is a compound of formula CP 1 -DP 1 Represented by; Each A' is of the formula CP 2 -DP 2 Represented by; B is the formula CP 2 -DP 2 -DP 2 -DP 2 Represented by; each C is a 2'-O-methyl (2'-O-Me) ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-fluoro (2'-F) ribonucleoside; each D is a 2'-F ribonucleoside; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; k is an integer from 1 to 7.

[0031] In some embodiments, the antisense strand comprises a structure represented by Formula A1, which, in the 5' to 3' direction, is: ASBSAOBOBOBOAOBOAOBOA-OBOAOBOAOBSASASASBSA Formula A1; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0032] In some embodiments, the antisense strand comprises a structure represented by Formula II, which, in the 5' to 3' direction, is: AB-(A') j -CP 2 -DP 1 -(CP 1 ) k -C' Formula II; where A is a compound of formula CP 1 -DP 1 Represented by; Each A' is of the formula CP 2 -DP 2 Represented by; B is the formula CP 2 -DP 2 -DP 2 -DP 2 Represented by; each C is a 2'-O-methyl (2'-O-Me) ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-fluoro (2'-F) ribonucleoside; each D is a 2'-F ribonucleoside; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; k is an integer from 1 to 7.

[0033] In some embodiments, the antisense strand comprises a structure represented by Formula A2, which, in the 5' to 3' direction, is: ASBSAOBOBOBOAOBOAOBOA-OBOAAOBOAOBSASASASASA Formula A2; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0034] In some embodiments, the sense strand comprises a structure represented by Formula III, which, in the 5' to 3' direction, is: E-(A') m -F Formula III; where E is a group represented by the formula (CP 1 )2; F is the formula (CP 2 )3-DP 1 -CP 1 -C, (CP 2 )3-DP 2 -CP 2 -C, (CP 2 )3-DP 1 -CP 1 -D, or (CP 2 )3-DP 2 -CP 2 - represented by D; A', C, D, P 1 , and P 2 is as defined in formula II; m is an integer of 1 to 7.

[0035] In some embodiments, the sense strand comprises a structure represented by formula S1, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBBSASA Formula S1; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0036] In some embodiments, the sense strand comprises a structure represented by formula S2, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBOAOA Formula S2; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0037] In some embodiments, the sense strand comprises a structure represented by formula S3, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBSASB formula S3; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0038] In some embodiments, the sense strand comprises a structure represented by formula S4, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBOAOB Equation S4; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0039] In some embodiments, the antisense strand comprises a structure represented by Formula IV, which, in the 5' to 3' direction, is: A-(A') j -CP 2 -B-(CP 1 ) k -C' Formula IV; where A is a compound of formula CP 1 -DP 1 Represented by; Each A' is of the formula CP 2 -DP 2 Represented by; B is the formula DP 1 -CP 1 -DP 1 Represented by; each C is a 2'-O-Me ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-F ribonucleoside; each D is a 2'-F ribonucleoside; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; k is an integer from 1 to 7.

[0040] In some embodiments, the antisense strand comprises a structure represented by Formula A3, which, in the 5' to 3' direction, is: ASBSAOBOAOBOAOBOAOBOA-OBOAOBOAOBSASASASA formula A3; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0041] In some embodiments, the sense strand comprises a structure represented by Formula V, where Formula V is, in the 5' to 3' direction: E-(A') m -CP 2 -F formula V; where E is a group represented by the formula (CP 1 )2; F is the formula DP 1 -CP 1 -C, DP 2 -CP 2 -C, DP 1 -CP 1 -D, or DP 2 -CP 2 - represented by D; A', C, D, P 1 , and P 2 is as defined in formula IV; m is an integer of 1 to 7.

[0042] In some embodiments, the sense strand comprises a structure represented by Formula S5, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBSASA Formula S5; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0043] In some embodiments, the sense strand comprises a structure represented by formula S6, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBOAOA Formula S6; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0044] In some embodiments, the sense strand comprises a structure represented by formula S7, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBSASB formula S7; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0045] In some embodiments, the sense strand comprises a structure represented by formula S8, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBOAOB formula S8; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0046] In some embodiments, the antisense strand comprises a structure represented by Formula VI, which, in the 5' to 3' direction, is: AB j -EB k -EFG l -DP 1 -C' Formula VI; where A is a compound of formula CP 1 -DP 1 Represented by; Each B is a function of the formula CP 2 Represented by; each C is a 2'-O-Me ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-F ribonucleoside; each D is a 2'-F ribonucleoside; Each E is the formula DP 2 -CP 2 Represented by; F is the formula DP 1 -CP 1 Represented by; Each G is a function of the formula CP 1 Represented by; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; k is an integer from 1 to 7; l is an integer from 1 to 7.

[0047] In some embodiments, the antisense strand comprises a structure represented by Formula A4, which, in the 5' to 3' direction, is: ASBSAOAOAOBOAOAOAOAOA-OAOAOBOAOBSASASASBSA formula A4; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0048] In some embodiments, the sense strand comprises a structure represented by Formula VII, which, in the 5' to 3' direction, is: HB m -I n -A'-B o -HC Formula VII; where A' is a compound of the formula CP 2 -DP 2 Represented by; Each H is a function of the formula (CP 1 )2; Each I is expressed as 2 ) is represented by; B, C, D, P 1 , and P 2 is as defined in formula VI; m is an integer from 1 to 7; n is an integer from 1 to 7; o is an integer from 1 to 7.

[0049] In some embodiments, the sense strand comprises a structure represented by formula S9, which, in the 5' to 3' direction, is: ASASAOAOAOBOBOBOAOBOA-OAOAOAASASA Formula S9; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0050] In some embodiments, the antisense strand further comprises a 5' phosphorus stabilizing moiety at the 5' end of the antisense strand.

[0051] In some embodiments, the sense strand further comprises a 5' phosphorus stabilizing moiety at the 5' end of the sense strand.

[0052] In some embodiments, each 5' phosphorus stabilizing moiety is independently represented by any one of Formulas IX-XVI: [ka] wherein Nuc represents a nucleobase selected from the group consisting of adenine, uracil, guanine, thymine, and cytosine, and R represents optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, phenyl, benzyl, hydroxy, or hydrogen.

[0053] In some embodiments, the nucleobase is adenine, uracil, guanine, thymine, or cytosine.

[0054] In some embodiments, the 5' phosphorus stabilizing moiety is an (E)-vinyl phosphonate represented by formula XI.

[0055] In some embodiments, the siRNA molecule further comprises a hydrophobic moiety at the 5' or 3' end of the siRNA molecule.

[0056] In some embodiments, the hydrophobic moiety is selected from the group consisting of cholesterol, vitamin D, or tocopherol.

[0057] In some embodiments, the length of the sense strand is between 12 and 30 nucleotides.

[0058] In some embodiments, the siRNA molecule is a branched siRNA molecule.

[0059] In some embodiments, the branched siRNA molecule is biantennary, triantennary, or tetraantennary.

[0060] In some embodiments, the siRNA molecule is a biantennary siRNA molecule. In some embodiments, the biantennary siRNA molecule is represented by any one of Formulas XVII-XIX: [ka] wherein each RNA is independently an siRNA molecule, L is a linker, and each X independently represents a branch point moiety.

[0061] In some embodiments, the siRNA molecule is a three-antennary siRNA molecule, optionally the three-antennary siRNA molecule is represented by any one of Formulas XX-XXIII: [ka] wherein each RNA is independently an siRNA molecule, L is a linker, and each X independently represents a branch point moiety.

[0062] In some embodiments, the siRNA molecule is a four-branched siRNA molecule, optionally the four-branched siRNA molecule is represented by any one of Formulas XXIV-XXVIII: [ka] wherein each RNA is independently an siRNA molecule, L is a linker, and each X independently represents a branch point moiety.

[0063] In some embodiments, the linker is selected from the group consisting of one or more consecutive subunits of ethylene glycol, alkyl, carbohydrate, block copolymer, peptide, RNA, and DNA.

[0064] In some embodiments, the one or more consecutive subunits is between 2 and 20 consecutive subunits.

[0065] In another aspect, the disclosure features a pharmaceutical composition including an siRNA molecule of any of the preceding aspects or embodiments of the disclosure in combination with a pharmaceutically acceptable excipient, carrier, or diluent.

[0066] In another aspect, the disclosure features a method of delivering an siRNA molecule to a subject diagnosed with a synucleinopathy, the method including administering to the subject a therapeutically effective amount of the siRNA molecule of any of the preceding aspects or embodiments of the disclosure, optionally in combination with a pharmaceutically acceptable excipient, carrier, or diluent.

[0067] In another aspect, the disclosure features a method of treating synucleinopathy in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an siRNA molecule of any of the preceding aspects or embodiments of the disclosure, optionally in combination with a pharmaceutically acceptable excipient, carrier, or diluent.

[0068] In some embodiments, the synucleinopathy is Parkinson's disease. In some embodiments, the synucleinopathy is Alzheimer's disease. In some embodiments, the synucleinopathy is dementia with Lewy bodies. In some embodiments, the synucleinopathy is multisymptomatic atrophy.

[0069] In another aspect, the disclosure features a method of reducing SNCA expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an siRNA molecule of any of the preceding aspects or embodiments of the disclosure, optionally in combination with a pharmaceutically acceptable excipient, carrier, or diluent.

[0070] In some embodiments, the siRNA molecule or pharmaceutical composition is administered to the subject by intracerebroventricular, intrastriatal, intraparenchymal or intrathecal injection.In some embodiments, the siRNA molecule or pharmaceutical composition is administered to the subject by intravenous, intramuscular or subcutaneous injection.

[0071] In some embodiments, the subject is a human.

[0072] In a further aspect, the present disclosure features a kit including (a) an siRNA molecule of any of the foregoing aspects or embodiments of the present disclosure, optionally in combination with a pharmaceutically acceptable excipient, carrier, or diluent, and (b) a package insert. In some embodiments, the package insert instructs a user of the kit to perform the method of any of the foregoing aspects or embodiments of the present disclosure.

[0073] 4. Brief description of the drawings [Brief explanation of the drawings]

[0074] [Figure 1] 1 is a graph showing the reduction of SNCA mRNA in hSNCA transgenic mice administered siRNA molecules of the present disclosure having a sense strand with SEQ ID NO: 664 and an antisense strand with SEQ ID NO: 244. mRNA was quantified in the frontal cortex (fCTx), striatum (Cpu), hippocampus (Hp), temporal cortex (tCTx), midbrain, pons, medulla oblongata, and cerebellum (Cb) at 1, 2, 3, or 4 months after di-siRNA treatment at a dose level of 30 nmol. [Figure 2] 1 is a graph showing the reduction of SNCA mRNA in hSNCA transgenic mice administered siRNA molecules of the present disclosure having a sense strand with SEQ ID NO: 664 and an antisense strand with SEQ ID NO: 244. mRNA was quantified in the cervical spinal cord (SC-C), thoracic spinal cord (SC-T), and lumbar spinal cord (SC-L) at 1 month, 2 months, 3 months, or 4 months after di-siRNA treatment at a dose level of 30 nmol. [Figure 3]1 is a graph showing the reduction of human SNCA protein in hSNCA transgenic mice administered siRNA molecules of the present disclosure having a sense strand with SEQ ID NO: 664 and an antisense strand with SEQ ID NO: 244. Protein was quantified in the frontal cortex (fCTx), striatum (Cpu), hippocampus (Hp), temporal cortex (tCTx), midbrain, and cerebellum (Cb) at 1, 2, 3, or 4 months after di-siRNA treatment at a dose level of 30 nmol. [Figure 4] 1 is a graph showing the reduction of human SNCA protein in hSNCA transgenic mice administered siRNA molecules of the present disclosure having a sense strand with SEQ ID NO: 664 and an antisense strand with SEQ ID NO: 244. Protein was quantified in the cervical spinal cord (SC-C), thoracic spinal cord (SC-T), and lumbar spinal cord (SC-L) at 1 month, 2 months, 3 months, or 4 months after di-siRNA treatment at a dose level of 30 nmol. [Figure 5] 1 is a graph showing the reduction of mouse Snca mRNA in hSNCA transgenic mice administered siRNA molecules of the present disclosure having a sense strand with SEQ ID NO: 664 and an antisense strand with SEQ ID NO: 244. mRNA was quantified in the frontal cortex, striatum, hippocampus, and temporal cortex 3 or 4 months after di-siRNA treatment at dose levels of 2.5 nmol, 5 nmol, 15 nmol, or 20 nmol. [Figure 6] 1 is a graph showing the reduction of human SNCA mRNA in hSNCA transgenic mice administered siRNA molecules of the present disclosure having a sense strand with SEQ ID NO: 664 and an antisense strand with SEQ ID NO: 244. mRNA was quantified in the frontal cortex, striatum, hippocampus, and temporal cortex 3 or 4 months after di-siRNA treatment at dose levels of 2.5 nmol, 5 nmol, 15 nmol, or 20 nmol. [Figure 7]1 is a graph showing the reduction of human SNCA protein in hSNCA transgenic mice administered siRNA molecules of the present disclosure having a sense strand with SEQ ID NO: 664 and an antisense strand with SEQ ID NO: 244. Protein was quantified in the frontal cortex, striatum, hippocampus, and temporal cortex 3 or 4 months after di-siRNA treatment at dose levels of 2.5 nmol, 5 nmol, 15 nmol, or 20 nmol. DETAILED DESCRIPTION OF THE INVENTION

[0075] 5. MODE FOR CARRYING OUT THE INVENTION The present application is directed to single- or double-stranded interfering RNA molecules (e.g., siRNAs) targeting the SNCA gene. Interfering RNA molecules, as well as pharmaceutical compositions containing them, may contain specific patterns of nucleoside and internucleoside linkage modifications. The siRNA molecules may also be branched siRNA molecules, such as bi-, tri-, or tetra-antennary siRNA molecules. The disclosed siRNA molecules may further feature a 5' phosphorus-stabilizing moiety and / or a hydrophobic moiety. Furthermore, the present disclosure provides methods for delivering the disclosed siRNA molecules to the central nervous system of a subject, such as a subject identified as having a synucleinopathy.

[0076] 5.1.Definition Unless otherwise defined herein, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In the event of any possible ambiguity, the definitions provided herein take precedence over any dictionary or extrinsic definitions. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. The use of "or" means "and / or" unless otherwise stated. The use of the term "including" and other forms such as "includes" and "included" is not limiting.

[0077] As used herein, the term "nucleic acid" refers to an RNA or DNA molecule consisting of a chain of ribonucleotides or deoxyribonucleotides, respectively. As used herein, the term "therapeutic nucleic acid" refers to a nucleic acid molecule (e.g., ribonucleic acid) that has partial or complete complementarity with a disease-related target mRNA, interacts with it, and mediates the silencing of mRNA expression.

[0078] As used herein, the term "carrier nucleic acid" refers to a nucleic acid molecule (e.g., a ribonucleic acid) that has sequence complementarity with and hybridizes to a therapeutic nucleic acid. As used herein, the term "3' end" refers to the end of a nucleic acid that contains an unmodified hydroxyl group on the 3' carbon of the ribose ring.

[0079] As used herein, the term "nucleoside" refers to a molecule consisting of a heterocyclic base and its sugar.

[0080] As used herein, the term "nucleotide" refers to a nucleoside having a phosphate group on its 3' or 5' sugar hydroxyl group.

[0081] As used herein, the term "siRNA" refers to a small interfering RNA duplex that induces the RNA interference (RNAi) pathway. siRNA molecules can be of various lengths (generally 18-30 base pairs) and contain various degrees of complementarity to their target mRNA. The term "siRNA" includes duplexes of two separate strands, and single strands that optionally form a hairpin structure containing the duplex region.

[0082] As used herein, the term "antisense strand" refers to the strand of the siRNA duplex that contains a degree of complementarity to a target gene.

[0083] As used herein, the term "sense strand" refers to the siRNA duplex that contains complementarity to the antisense strand.

[0084] As used herein, the term "chemically modified nucleotide" refers to a non-standard nucleotide, including non-naturally occurring ribonucleotides or deoxyribonucleotides. Exemplary chemically modified nucleotides are modified at any position to alter certain chemical properties of the nucleotide while retaining the ability of the chemically modified nucleotide to perform its intended function.

[0085] As used herein, the term "metabolically stabilized" refers to an RNA molecule comprising ribonucleotides that have been chemically modified to replace a 2'-hydroxyl group with a 2'-O-methyl group, a 2' fluoro group, or other modification known in the art to stabilize RNA against enzymatic and / or non-enzymatic degradation.

[0086] As used herein, the term "phosphorothioate" refers to a phosphate group of a nucleotide that is modified by replacing one or more of the oxygens of the phosphate group with sulfur.

[0087] As used herein, the term "ethylene glycol chain" refers to a carbon chain having the formula ((CH2OH)2).

[0088] As used herein, "alkyl" refers to a saturated hydrocarbon group. An alkyl group can be acyclic or cyclic and, if unsubstituted, contains only C and H. When an alkyl residue having a specific number of carbon atoms is named, all geometric isomers having that number of carbon atoms are intended to be encompassed and described. Thus, for example, "butyl" is meant to include n-butyl, sec-butyl, and iso-butyl. Examples of alkyl include ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like. In some embodiments, alkyl can be substituted. Suitable substituents that can be introduced into alkyl groups include, for example, hydroxy, alkoxy, amino, alkylamino, and halo, among others.

[0089] As used herein, "alkenyl" refers to an acyclic or cyclic unsaturated hydrocarbon group having at least one site of olefinic unsaturation (i.e., having at least one moiety of the formula C=C). When unsubstituted, an alkenyl group contains only C and H. When an alkenyl residue having a specific number of carbons is named, all geometric isomers having that number of carbons are intended to be encompassed and described. Thus, for example, "butenyl" is meant to include n-butenyl, sec-butenyl, and iso-butenyl. Examples of alkenyl include -CH=CH, -CH-CH=CH, and -CH-CH=CH-CH=CH. In some embodiments, alkenyl can be substituted. Suitable substituents that can be introduced into alkenyl groups include, for example, hydroxy, alkoxy, amino, alkylamino, and halo, among others.

[0090] As used herein, "alkynyl" refers to an acyclic or cyclic unsaturated hydrocarbon group having at least one site of acetylenic unsaturation (i.e., having at least one moiety of the formula C≡C). When unsubstituted, an alkynyl group contains only C and H. When an alkynyl residue having a specific number of carbons is named, all geometric isomers having that number of carbons are intended to be encompassed and described. Thus, for example, "pentynyl" is meant to include n-pentynyl, sec-pentynyl, iso-pentynyl, and tert-pentynyl. Examples of alkynyl include -C≡CH and -C≡C-CH3. In some embodiments, alkynyl can be substituted. Suitable substituents that can be introduced into alkynyl groups include, for example, hydroxy, alkoxy, amino, alkylamino, and halo, among others.

[0091] As used herein, the term "phenyl" refers to a monocyclic arene in which one hydrogen atom has been removed from a carbon atom of the ring. Phenyl groups can be unsubstituted or substituted with one or more suitable substituents, which replace the H of the phenyl group.

[0092] As used herein, the term "benzyl" refers to the monovalent radical obtained when the hydrogen atom attached to the methyl group of toluene is removed. Benzyl generally has the formula phenyl-CH2-.

[0093] A benzyl group can be unsubstituted or substituted with one or more suitable substituents. For example, substituents can replace an H in the phenyl moiety and / or an H in the methylene (—CH—) moiety.

[0094] As used herein, the term "amide" refers to an alkyl, alkenyl, alkynyl, or aromatic group attached to an aminocarbonyl functional group.

[0095] As used herein, the terms "internucleoside" and "internucleotide" refer to linkages between nucleosides and between nucleotides, respectively.

[0096] As used herein, the term "triazole" refers to a heterocyclic compound having the formula (C2H3N3) that has a five-membered ring of two carbons and three nitrogens, the positions of which can vary to give rise to multiple isomers.

[0097] As used herein, the term "end group" refers to the group at which a carbon chain or nucleic acid terminates.

[0098] As used herein, the term "lipophilic amino acid" refers to an amino acid that contains a hydrophobic moiety (eg, an alkyl chain or an aromatic ring).

[0099] As used herein, the term "delivery target" refers to an organ or part of the body to which it is desired to deliver a branched oligonucleotide composition.

[0100] As used herein, the term " branched siRNA " refers to a compound that contains two or more double-stranded siRNA molecules that are covalently linked to each other.Branched siRNA molecule can be " bibranched ", also referred to herein as " di-siRNA ", where this siRNA molecule comprises two siRNA molecules that are covalently linked to each other, for example, via a linker.Branched siRNA molecule can be " tribranched ", also referred to herein as " tri-siRNA ", where this siRNA molecule comprises three siRNA molecules that are covalently linked to each other, for example, via a linker.Branched siRNA molecule can be " four-branched ", also referred to herein as " tetra-siRNA ", where this siRNA molecule comprises four siRNA molecules that are covalently linked to each other, for example, via a linker.

[0101] As used herein, the term "branch point moiety" refers to the chemical moiety of the branched siRNA structure of the present disclosure, which can be covalently linked to the 5'-end or 3'-end of the antisense or sense strand of siRNA molecule, and can support the binding of additional single-stranded or double-stranded siRNA molecules.Non-limiting examples of branch point moieties suitable for use in conjunction with the disclosed methods and compositions include, for example, phosphoramidite, tosylated solketal, 1,3-diaminopropanol, pentaerythritol, and any one of the branch point moieties described in US Patent No. 10,478,503.

[0102] As used herein, the term "5' phosphorus stabilizing moiety" refers to a terminal phosphate group, including phosphate and modified phosphates (e.g., phosphorothioates, phosphodiesters, phosphonates). The phosphate moiety can be located at either terminus, for example, the 5'-terminal nucleoside. In one aspect, the terminal phosphate has the formula -OP(=O)(OH)OH and is unmodified. In another aspect, the terminal phosphate is modified such that one or more of the O and OH groups are replaced with H, O, S, N(R'), or an alkyl where R' is H, an amino protecting group, or an unsubstituted or substituted alkyl. In some embodiments, the 5' and / or 3' terminal groups can each independently contain one to three phosphate moieties that are unmodified (diphosphate or triphosphate) or modified.

[0103] As used herein, the term "between X and Y" is inclusive of values ​​of X and Y. For example, "between X and Y" refers to a range of values ​​between the value of X and the value of Y, as well as the value of X and the value of Y.

[0104] As used herein, "amino acid" refers to a molecule containing an amine and a carboxyl functional group as well as a side chain characteristic of an amino acid.

[0105] In some embodiments, the amino acid is selected from the group of proteinogenic amino acids. In some embodiments, the amino acid is an L-amino acid or a D-amino acid. In some embodiments, the amino acid is a synthetic amino acid (e.g., a beta-amino acid).

[0106] For example, it is understood that certain internucleotide linkages provided herein, including phosphodiesters and phosphorothioates, contain a formal charge of −1 at physiological pH, which formal charge is balanced by a cationic moiety, e.g., an alkali metal such as sodium or potassium, an alkaline earth metal such as calcium or magnesium, or an ammonium or guanidinium ion.

[0107] The phosphate group of a nucleotide can also be modified, for example, by substituting one or more oxygen atoms of the phosphate group with sulfur (e.g., phosphorothioate), or by other substitutions that allow the nucleotide to perform its intended function, as described, for example, in Eckstein, Antisense Nucleic Acid Drug Dev. 10: 117-21, 2000; Rusckowski et al., Antisense Nucleic Acid Drug Dev. 10: 333-45, 2000; Stein, Antisense Nucleic Acid Drug Dev. 11: 317-25, 2001; Vorobjev et al., Antisense Nucleic Acid Drug Dev. 11: 77-85, 2001; and US 5,684,143. Some of the above-referenced modifications (e.g., phosphate group modifications), for example, reduce the hydrolysis rate of polynucleotides containing the modifications in vivo or in vitro.

[0108] As used herein, the term "complementary" refers to two nucleotides that form a canonical Watson-Crick base pair. For the avoidance of doubt, in the context of the present disclosure, Watson-Crick base pairs include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs. In this context, proper Watson-Crick base pairs are referred to as "matches," while unpaired and improperly paired nucleotides are referred to as "mismatches." Alignment for purposes of determining percent nucleic acid sequence complementarity can be achieved in a variety of ways within the capabilities of those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software.

[0109] "Percent sequence complementarity (%)" to a reference polynucleotide sequence is defined as the percentage of nucleic acids in a candidate sequence that are complementary to nucleic acids in the reference polynucleotide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence complementarity. A given nucleotide is considered "complementary" to a reference nucleotide, as described herein, if the two nucleotides form a standard Watson-Crick base pair. For the avoidance of doubt, in the context of the present disclosure, Watson-Crick base pairs include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs. In this context, proper Watson-Crick base pairs are referred to as "matches," while unpaired and improperly paired nucleotides are referred to as "mismatches." Alignment for purposes of determining percent nucleic acid sequence complementarity can be achieved in a variety of ways within the capabilities of those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal complementarity over the full length of the sequences being compared. By way of illustration, the percent sequence complementarity of a given nucleic acid sequence A to a given nucleic acid sequence B (which can alternatively be referred to as a given nucleic acid sequence A having a particular percent complementarity to a given nucleic acid sequence B) is calculated as follows: 100×(fraction X / Y) where X is the number of complementary base pairs in a programmed alignment of A and B (e.g., as performed by computer software such as BLAST), and Y is the total number of nucleic acids in B. It is understood that if the length of nucleic acid sequence A is not equal to the length of nucleic acid sequence B, the percent sequence complementarity of A to B will not be equal to the percent sequence complementarity of B to A. As used herein, a query nucleic acid sequence is considered to be "fully complementary" to a reference nucleic acid sequence if the query nucleic acid sequence has 100% sequence complementarity to the reference nucleic acid sequence.

[0110] The term "gene silencing" refers to the suppression of gene expression, for example, transgene, heterologous gene and / or endogenous gene expression, which can be mediated through processes that affect transcription and / or processes that affect post-transcriptional mechanisms. In some embodiments, gene silencing occurs when RNAi molecules initiate the inhibition or degradation of mRNA transcribed from a gene of interest in a sequence-specific manner through RNA interference, thereby preventing the translation of the gene's product.

[0111] As used herein, the term "overactive disease driver gene" refers to a gene with increased activity and / or expression that contributes to or causes a disease state in a subject (e.g., a human). The disease state may be caused or exacerbated by the overactive disease driver gene directly or through an intermediary gene(s).

[0112] The term "negative regulator," as used herein, refers to a gene that negatively regulates (eg, reduces or inhibits) the expression and / or activity of another gene or set of genes.

[0113] The term "positive regulator," as used herein, refers to a gene that positively regulates (eg, increases or saturates) the expression and / or activity of another gene or set of genes.

[0114] As used herein, the term "phosphate moiety" refers to a terminal phosphate group, including phosphate and modified phosphates. The phosphate moiety can be located at either terminus, for example, the 5'-terminal nucleoside. In one aspect, the terminal phosphate has the formula -OP(=O)(OH)OH and is unmodified. In another aspect, the terminal phosphate is modified such that one or more of the O and OH groups are replaced with H, O, S, N(R'), or an alkyl where R' is H, an amino protecting group, or an unsubstituted or substituted alkyl. In some embodiments, the 5'- and / or 3'-terminal groups can each independently contain one to three phosphate moieties that are unmodified (diphosphate or triphosphate) or modified.

[0115] In the context of this disclosure, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or other nucleic acid. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars, and covalent internucleoside (backbone) linkages, as well as oligonucleotides having non-naturally occurring (e.g., chemically modified) portions that function similarly. Such chemically modified oligonucleotides can exhibit desirable properties, such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid targets, and increased stability in the presence of nucleases.

[0116] The term "treatment" refers to a clinical intervention designed to alter the natural history of the patient or cell being treated during the course of clinical pathology. Desirable effects of treatment include slowing the rate of disease progression, ameliorating or alleviating the disease state, and achieving remission or improving prognosis. For example, a patient is successfully "treated" if one or more symptoms associated with a synucleinopathy described herein are reduced or eliminated, including, but not limited to, a decrease in symptoms attributable to the disease, an improvement in the quality of life of a patient suffering from the disease, a reduction in the dose of other medications required to treat the disease, and / or an increase in the patient's survival.

[0117] The term "delaying progression" of a disease means delaying, preventing, slowing, inhibiting, stabilizing, and / or postponing the onset of a cancer as described herein. This delay may be of varying duration depending on the synucleinopathy being treated and / or the patient's medical history. As will be apparent to one of skill in the art, a sufficient or significant delay may, in effect, encompass prevention, in that the patient will not develop or relapse into a synucleinopathy.

[0118] 5.2. Anti-alpha-synuclein siRNA The present application is directed to the single-stranded or double-stranded interfering RNA molecule (for example, siRNA) that targets SNCA gene.For example, but not limited to, the siRNA molecule that targets SNCA gene can be designed to target SNCA mRNA sequence.

[0119]

[0120]

[0121]

[0122]

[0123] In certain embodiments, the present disclosure is directed to siRNA molecules comprising an antisense strand and a sense strand complementary to the antisense strand, wherein the antisense strand is 10-30 nucleotides in length and has sufficient complementarity to hybridize to a region within an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In certain embodiments, the antisense strand has at least 70% complementarity to a region of 21 contiguous nucleobases within an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In certain embodiments, the antisense strand has at least 75% complementarity to a region of 21 contiguous nucleobases within an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. For example, and without limitation, the antisense strand can have at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to a region within an SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0124] In certain embodiments, the antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In certain embodiments, the antisense strand comprises 10-30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In certain embodiments, the antisense strand comprises 12 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In certain embodiments, the antisense strand comprises 15 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In certain embodiments, the antisense strand comprises 18 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In certain embodiments, the antisense strand comprises 21 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. In certain embodiments, the antisense strand comprises 24 to 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.In certain embodiments, the antisense strand comprises 30 contiguous nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within a region of an SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0125] In certain embodiments, the antisense strand contains no more than nine nucleotide mismatches to a region of 21 contiguous nucleobases of an SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840. For example, without limitation, the antisense strand can contain no more than eight, no more than seven, no more than six, no more than five, no more than four, no more than three, no more than two, or only one mismatch to a region of an SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0126] In certain embodiments, the siRNA molecule of the present disclosure targets a region of the SNCA RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 459, 535, 551, 599, 631, 663, 664, 666, 667, 671, 748, 750, 751, 752, 760, 762, and 777.

[0127] In certain embodiments, the present disclosure is directed to siRNA molecules comprising a sense strand that comprises an unmodified sense strand of Table 1A. In certain embodiments, the present disclosure relates to siRNA molecules comprising an antisense strand that comprises an unmodified antisense strand of Table 1A. In certain embodiments, the sense strand is UACCACUUAUUUCUAA (SEQ ID NO: 760) and the antisense strand is UUAGAAAUAAGUGGUAGUCAC (SEQ ID NO: 340). In certain embodiments, the sense strand is CAAGUGCUCAGUUCCA (SEQ ID NO: 664) and the antisense strand is UGGAACUGAGCACUUGUACAG (SEQ ID NO: 244). In certain embodiments, the sense strand is AGUGGUGCAUGGUGUA (SEQ ID NO: 535) and the antisense strand is UACACCAUGCACCACUCCCUC (SEQ ID NO: 115). In certain embodiments, the sense strand is CAAUGAGGCUUAUGAA (SEQ ID NO: 599) and the antisense strand is UUCAUAAGCCUCAUUGUCAGG (SEQ ID NO: 179). In certain embodiments, the sense strand is AGUGCUCAGUUCCAAA (SEQ ID NO: 666) and the antisense strand is UUUGGAACUGAGCACUUGUAC (SEQ ID NO: 246). In certain embodiments, the sense strand is UCAGUUCCAAUGUGCA (SEQ ID NO: 671) and the antisense strand is UGCACAUUGGAACUGAGCACU (SEQ ID NO: 251). In certain embodiments, the sense strand is CUACGAUGUUAAAACA (SEQ ID NO: 748) and the antisense strand is UGUUUUAACAUCGUAGAUUGA (SEQ ID NO: 328).

[0128] In certain embodiments, the present disclosure is directed to siRNA molecules comprising a sense strand that includes a modified sense strand of Table 1B. In certain embodiments, the present disclosure relates to siRNA molecules comprising an antisense strand that includes a modified antisense strand of Table 1B. In certain embodiments, the sense strand is (mU)#(mA)#(mC)(fC)(mA)(fC)(mU)(fU)(mA)(fU)(mU)(mC)(fU)#(mA)#(mA)-DIO (SEQ ID NO: 841), and the antisense strand is V(mU)#(fU)#(mA)(fG)(fA)(fA)(mA)(fU)(mA)(fA)(mG)(fU)(mG)(fG)(mU)(fA) #(mG)#(mU)#(mC)#(mA)#(mC) (SEQ ID NO: 842) where m=2'Ome, f=2'F, #=phosphorothioate, -DIO=bivalent oligonucleotide (DIO) linker, V=vinylphosphonate. In certain embodiments, the sense strand is (mC)#(mA)#(mA)(fG)(mU)(fG)(mC)(fU)(mC)(fA)(mG)(mU)(mU)(f In certain embodiments, the sense strand is (mA)#(mG)#(mU)(fG)(mA)#(mG)-DIO (SEQ ID NO: 843), and the antisense strand is V(mU)#(fG)#(mG)(fA)(fA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)(mU)(fG)#(mU)#(mA)#(mC)#(mA)#(mG) (SEQ ID NO: 844). and the antisense strand is V(mU)#(fA)#(mC)(fA)(fC)(fC)(mA)(fU)(mG)(fC)(mA)(fC)(mC)(fA)(mC)(fU)#(mC)#(mC)#(mC)#(mU)#(mC) (SEQ ID NO: 846).In certain embodiments, the sense strand is (mC)#(mA)#(mA)(fU)(mG)(fA)(mG)(fG)(mC)(fU)(mU)(mA)(mU)(fG)#(mA)#(mA)-DIO (SEQ ID NO: 847) and the antisense strand is V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 848). In certain embodiments, the sense strand is (mU)#(mC)#(mA)(fG)(mU)(fU)(mC)(fC)(mA)(fA)(mU)(mG)(mU)(fG)#(mC)#(mA)-DIO (SEQ ID NO: 849) and the antisense strand is V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 850). In certain embodiments, the sense strand is (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 851) and the antisense strand is V(mU)#(fG)#(mC)(fA)(fC)(fA)(mU)(fU)(mG)(fG)(mA)(fA)(mC)(fU)(mG)(fA)#(mG)#(mC)#(mA)#(mC)#(mU) (SEQ ID NO: 852). In certain embodiments, the sense strand is (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 853) and the antisense strand is V(mU)#(fG)#(mU)(fU)(fU)(mA)(fA)(mC)(fA)(mU)(fC)(mG)(fU)(mA)(fG)#(mA)#(mU)#(mU)#(mG)#(mA) (SEQ ID NO: 854).In certain embodiments, the sense strand is (mC)#(mA)#(mA)(fU)(mG)(fA)(mG)(fG)(mC)(fU)(mU)(mA)(mU)(fG)#(mA)#(mA)-DIO (SEQ ID NO: 847) and the antisense strand is V(mU)#(fU)#(mC)(fA)(fU)(fA)(mA)(fG)(mC)(fC)(mU)(fC)(mA)(fU)(mU)(fG)#(mU)#(mC)#(mA)#(mG)#(mG) (SEQ ID NO: 855). In certain embodiments, the sense strand is (mA)#(mG)#(mU)(fG)(mC)(fU)(mC)(fA)(mG)(fU)(mU)(mC)(mC)(fA)#(mA)#(mA)-DIO (SEQ ID NO: 856) and the antisense strand is V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 850). In certain embodiments, the sense strand is (mU)#(mC)#(mA)(fG)(mU)(fU)(mC)(fC)(mA)(fA)(mU)(mG)(mU)(fG)#(mC)#(mA)-DIO (SEQ ID NO: 857) and the antisense strand is V(mU)#(fG)#(mC)(fA)(fC)(fA)(mU)(fU)(mG)(fG)(mA)(fA)(mC)(fU)(mG)(fA)#(mG)#(mC)#(mA)#(mC)#(mU) (SEQ ID NO: 852). [Table 1] [Table 2]

[0129] 5.3. siRNA Structure The siRNA molecules of the present disclosure may be in the form of a single-stranded (ss) or double-stranded (ds) oligonucleotide structure. In some embodiments, the siRNA molecules may be biantennary, triantennary, or tetraantennary molecules. Furthermore, the siRNA molecules of the present disclosure may contain one or more phosphodiester internucleoside linkages and / or their analogs, such as phosphorothioate internucleoside linkages. The siRNA molecules of the present disclosure may further contain chemically modified nucleosides with 2' sugar modifications.

[0130] The simplest siRNAs consist of ribonucleic acids containing either a single strand or double strand structure, formed by a first strand (i.e., antisense strand) and, in the case of ds-siRNA, a second strand (i.e., sense strand). The first strand contains a stretch of consecutive nucleotides that is at least partially complementary to the target nucleic acid. The second strand also contains a stretch of consecutive nucleotides, and the second stretch is at least partially identical to the target nucleic acid. The first and second strands can hybridize to each other to form a double-stranded structure. Hybridization typically occurs via Watson-Crick base pairing.

[0131] Depending on the sequences of the first and second strands, hybridization or base pairing is not necessarily perfect or complete, which means that the first and second strands are not 100% base-paired due to mismatches.One or more mismatches can also exist within the double strand, without necessarily affecting the RNAi activity of siRNA.

[0132] The first strand contains a stretch of contiguous nucleotides that is essentially complementary to the target nucleic acid. Typically, the target nucleic acid sequence is ss-RNA, e.g., mRNA, in accordance with the mode of action of interfering ribonucleic acids. Such hybridization most likely occurs via Watson-Crick base pairing, but is not necessarily limited to this. The degree to which the first strand has a stretch of contiguous nucleotides complementary to the target nucleic acid sequence can be 80% to 100%, e.g., 80%, 85%, 90%, 95%, or 100% complementary.

[0133] The siRNA molecules described herein may employ modifications to the nucleobases, phosphate backbone, ribose core, 5' and 3' ends, and branching, where multiple strands of the siRNA can be covalently linked.

[0134] The siRNA molecules described herein may be siRNAs in which the oxyanion moiety is Ba 2+ , Be 2+ , Ca 2+ , Cu 2+ , Mg 2+ , Mn 2+ , Ni 2+ , or Zn 2+ In certain embodiments, the one or more divalent cations may include one or more phosphodiester internucleoside linkages, such as phosphorothioate internucleoside linkages, and / or analogs thereof, that are electrostatically neutralized by ionic bonding with a divalent metal cation, such as Ca. 2+ and Mg 2+ and optionally, Ca 2+ and Mg 2+ The ratio of Ca to Ca is 1:100 to 100:1 (e.g., 1:75, 1:50, 1:25, 1:10, 1:5, 1:1, 5:1, 10:1, 25:1, 50:1, 75:1, or 100:1). 2+ and Mg 2+are present in a 1:1 ratio. In certain embodiments, the one or more divalent cations displace water from the cationic binding sites of the siRNA molecule. In certain embodiments, the saturation of the cationic binding sites with the one or more divalent cations is about 10% to about 100% (e.g., about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, or about 90% to about 100%). In certain embodiments, the cationic binding site is located within an internucleoside bond, such as a phosphodiester bond and / or a phosphorothioate bond. For example, the cationic binding site can be the oxyanion moiety within a phosphodiester or phosphorothioate bond. In certain embodiments, the one or more divalent cations are characterized by an ionic radius in the range of about 30 picometers to about 150 picometers (e.g., about 30 picometers to about 140 picometers, about 40 picometers to about 130 picometers, about 50 picometers to about 120 picometers, about 60 picometers to about 110 picometers, about 60 picometers to about 100 picometers, or about 60 picometers to about 90 picometers).

[0135] 5.3.1. Length of siRNA Molecule Within the scope of the present invention, any length known in the art and previously unknown can be employed for the present invention. As described herein, the potential length of the antisense strand of the siRNA molecule of the present disclosure is between 10 and 30 nucleotides (e.g., 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides), between 15 and 25 nucleotides (e.g., 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or 25 nucleotides), or between 18 and 23 nucleotides (e.g., 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, or 23 nucleotides). In some embodiments, the antisense strand is 20 nucleotides. In some embodiments, the antisense strand is 21 nucleotides. In some embodiments, the antisense strand is 22 nucleotides. In some embodiments, the antisense strand is 23 nucleotides. In some embodiments, the antisense strand is 24 nucleotides. In some embodiments, the antisense strand is 25 nucleotides. In some embodiments, the antisense strand is 26 nucleotides. In some embodiments, the antisense strand is 27 nucleotides. In some embodiments, the antisense strand is 28 nucleotides. In some embodiments, the antisense strand is 29 nucleotides. In some embodiments, the antisense strand is 30 nucleotides.

[0136] In some embodiments, the sense strand of an siRNA molecule of the present disclosure is between 12 and 30 nucleotides (e.g., 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides), or between 14 and 23 nucleotides (e.g., 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, or 23 nucleotides). In some embodiments, the sense strand is 15 nucleotides in length. In some embodiments, the sense strand is 16 nucleotides in length. In some embodiments, the sense strand is 17 nucleotides in length. In some embodiments, the sense strand is 18 nucleotides in length. In some embodiments, the sense strand is 19 nucleotides in length. In some embodiments, the sense strand is 20 nucleotides in length. In some embodiments, the sense strand is 21 nucleotides in length. In some embodiments, the sense strand is 22 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length. In some embodiments, the sense strand is 24 nucleotides in length. In some embodiments, the sense strand is 25 nucleotides in length. In some embodiments, the sense strand is 26 nucleotides in length. In some embodiments, the sense strand is 27 nucleotides in length. In some embodiments, the sense strand is 28 nucleotides in length. In some embodiments, the sense strand is 29 nucleotides in length. In some embodiments, the sense strand is 30 nucleotides in length.

[0137] 5.3.2.2' Sugar modification The present disclosure may include ss- and ds-siRNA molecular compositions containing at least one (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) nucleoside with a 2' sugar modification. Possible 2'-modifications include OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or all possible orientations of O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl can be substituted or unsubstituted C1-C10 alkyl or C2-C10 alkenyl and alkynyl. In some embodiments, the modification includes a 2'-O-methyl (2'-O-Me) modification. Other potential sugar substituents include C1-C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, groups for improving the pharmacokinetic properties of oligonucleotides, or groups for improving the pharmacodynamic properties of oligonucleotides, and other substituents with similar properties. In some embodiments, the modification comprises 2'-methoxyethoxy (2'-O-CH2CHOCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE). In some embodiments, modifications include the group O(CH)ON(CH), also known as 2'-dimethylaminooxyethoxy, i.e., 2'-DMAOE, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylamino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O-CHOCHN(CH). Other potential sugar substituents include, for example, aminopropoxy (-OCHCHCHNH), allyl (-CH-CH=CH), -O-allyl (-O-CH-CH=CH), and fluoro (F). The 2'-sugar substituent can be in the arabino (up) or ribo (down) position. In some embodiments, the 2'-arabino modification is 2'-F.Similar modifications may also be made elsewhere in the siRNA molecule, particularly the 3' position of the sugar in the 3'-terminal nucleoside or 2'-5'-linked oligonucleotides and the 5' position of the 5'-terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.

[0138] Nucleobase Modifications The siRNA molecules of the present disclosure can also comprise nucleosides or other surrogate or mimic monomer subunits that contain nucleobases (often referred to in the art simply as "bases" or "heterocyclic base moieties").Nucleobases are other moieties that can be extensively modified or substituted, and such modified and / or substituted nucleobases can be in accordance with the present invention.As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Chemically modified nucleobases, also referred to herein as heterocyclic base moieties, include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3) uracil and cytosine, and other alkynyl groups of pyrimidine bases. Derivatives include 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaguanine and 3-deazaguanine. Nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Other nucleobases include those disclosed in US3,687,808, those disclosed in Kroschwitz, JI, ed. The Concise Encyclopedia of Polymer Science and Engineering, New York, John Wiley & Sons, 1990, pp.858-859; those disclosed in Englisch et al., Angewandte Chemie, International Edition 30:613, 1991; and those disclosed in Sanghvi, YS, Chapter 16, Antisense Research and Applications, CRC Press, Gait, MJ ed., 1993, pp.289-302.The siRNA molecule of the present disclosure can also comprise polycyclic heterocyclic compounds instead of one or more heterocyclic base moieties.Many tricyclic heterocyclic compounds have been reported so far.These compounds are routinely used in antisense applications to increase the binding properties of modified strand to target strand.

[0139] Representative cytosine analogs that form three hydrogen bonds with guanosine in the second strand include 1,3-diazaphenoxazine-2-one (Kurchavov et al., Nucleosides and Nucleotides, 16:1837-46, 1997), 1,3-diazaphenothiazine-2-one (Lin et al., Am. Chem. Soc., 117:3873-4, 1995), and 6,7,8,9-tetrafluoro-1,3-diazaphenoxazine-2-one (Wang et al., Tetrahedron Lett., 39:8385-8, 1998). These base modifications have been shown to hybridize with complementary guanine when incorporated into oligonucleotides, and guanine has also been shown to hybridize with adenine, improving the thermal stability of the helix through extended stacking interactions (see also US 10 / 155,920 and US 10 / 013,295, both of which are incorporated herein by reference in their entireties). Further helix-stabilizing properties have been observed when cytosine analogs / substitutes have aminoethoxy moieties attached to a rigid 1,3-diazaphenoxazin-2-one scaffold (Lin et al., Am. Chem. Soc., 120:8531-2, 1998).

[0140] 5.3.4. Internucleoside bond modifications Another variable in the design of the present invention is the internucleoside bond that constitutes the phosphate backbone of siRNA molecules.Natural RNA phosphate backbone can be used herein, but its derivative can also be used to improve the desirable properties of siRNA molecules.In certain embodiments, siRNA molecules are modified to reduce hydrolysis compared with unmodified siRNA.One example of the modification that reduces hydrolysis rate is phosphorothioate.Any part or the entire backbone can contain phosphate substitution (for example, phosphorothioate). For example, the internucleoside linkages may be between 0 and 100% phosphorothioate, e.g., between 0 and 100%, 10 and 100%, 20 and 100%, 30 and 100%, 40 and 100%, 50 and 100%, 60 and 100%, 70 and 100%, 80 and 100%, 90 and 100%, 0 and 90%, 0 and 80%, 0 and 70%, 0 and 60%, 0 and 50%, 0 and 40%, 0 and 30%, 0 and 20%, 0 and 10%, 10 and 90%, 20 and 80%, 30 and 70%, 40% and 60%, 10 and 40%, 20 and 50%, 30 and 60%, 40 and 70%, 50 and 80%, or 60 and 90% phosphorothioate linkages. Similarly, the internucleoside linkages may be between 0 and 100% phosphodiester bonds, for example, between 0 and 100%, 10 and 100%, 20 and 100%, 30 and 100%, 40 and 100%, 50 and 100%, 60 and 100%, 70 and 100%, 80 and 100%, 90 and 100%, 0 and 90%, 0 and 80%, 0 and 70%, 0 and 60%, 0 and 50%, 0 and 40%, 0 and 30%, 0 and 20%, 0 and 10%, 10 and 90%, 20 and 80%, 30 and 70%, 40% and 60%, 10 and 40%, 20 and 50%, 30 and 60%, 40 and 70%, 50 and 80%, or 60 and 90% phosphodiester bonds.

[0141] Specific examples of some potential siRNA molecules useful in the present invention include the oligonucleotide that contains modified, for example, non-naturally occurring internucleoside bond.As defined herein, the oligonucleotide that has modified internucleoside bond includes the internucleoside bond that retains phosphorus atom and the internucleoside bond that does not have phosphorus atom.For the purpose of this specification and as sometimes referred to in the art, the modified oligonucleotide that does not have phosphorus atom in internucleoside backbone can also be considered as oligonucleoside.An exemplary modified internucleoside bond that contains phosphorus is phosphorothioate internucleoside bond. In some embodiments, modified oligonucleotide backbones comprising a phosphorus atom therein include, for example, phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates, phosphinates, phosphoramidates including 3'-aminophosphoramidate and aminoalkylphosphoramidates, thinophosphoramidates, thinoalkylphosphonates, thinoalkylphosphotriesters, selenophosphates, boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs thereof, and those with reversed polarity where one or more internucleotide linkages are 3'-3', 5'-5', or 2'-2' linkages.Exemplary United States patents describing the preparation of phosphorus-containing linkages include, but are not limited to, U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; Same No. 5,321,131; Same No. 5,399,676; Same No. 5,405,939; Same No. 5,453,496; Same No. 5,455,233; Same No. 5,466,677; Same No. 5,476, No. 925; No. 5,519,126; No. 5,536,821; No. 5,541,316; No. 5,550,111; No. 5,563,253; No. 5,571,799; No. 5, No. 587,361; No. 5,625,050; No. 6,028,188; No. 6,124,445; No. 6,160,109; No. 6,169,170; No. 6,172,209 ; Same No. 6,239,265; Same No. 6,277,603; Same No. 6,326,199; Same No. 6,346,614; Same No. 6,444,423; Same No. 6,531,590; Same No. 6,534, 6,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Patent No. RE39464, the entire contents of each of which are incorporated herein by reference.

[0142] In some embodiments, modified oligonucleotide backbones that do not contain a phosphorus atom have backbones formed by short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatom or heterocyclic internucleoside linkages, including morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, riboacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH moieties. Non-limiting examples of U.S. patents that teach the preparation of non-phosphorus scaffolds include, but are not limited to, U.S. Patent Nos. 5,034,506, 5,166,315, 5,185,444, 5,214,134, 5,216,141, 5,235,033, 5,64,562, 5,264,564, 5,405,938, 5,434,257, 5,466,677, 5,470,967, 5,480,968, 5,490,970, 5,510,106, 5,520,108, 5,530,109, 5,540,110, 5,550,112, 5,561,114, 5,570,116, 5,580,118, 5,590,120, 5,591,122, 5,592,124, 5,593,126, 5,594,128, 5,595,129, 5,596,130, 5,597,140, ​​5,598,141, 5,599,150, 5,599,151, 5,599,152, 5,599,153, 5,599,160, 5,599,161, 5,599,162, 5,599,163, 5,599,170, 5,599,171, 5,599,182, 5,599,1 ,489,677, 5,541,307, 5,561,225, 5,596,086, 5,602,240, 5,608,046, 5,610,289, 5,618,704, 5,623,070, 5,663,312, 5,633,360, 5,677,437, and 5,677,439, the entire contents of each of which are incorporated herein by reference.

[0143] 5.4. Modification patterns of siRNA molecules The following section provides a set of exemplary scaffolds into which the siRNA molecules of the present disclosure can be incorporated.

[0144] In some embodiments of the present disclosure, the siRNA may contain an antisense strand comprising a region represented by Formula I, wherein Formula I is, in the 5' to 3' direction, the following: AB-(A') j -CP 2 -DP 1 -(C'-P 1 ) k -C' Formula I; where A is a compound of formula CP 1 -DP 1 Each A' is represented by the formula CP 2 -DP 2 B is represented by the formula CP 2 -DP 2 -DP 2 -DP 2 each C is a 2'-O-methyl (2'-O-Me) ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-fluoro (2'-F) ribonucleoside; each D is a 2'-F ribonucleoside; and each P 1 is a phosphorothioate internucleoside linkage; each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7); and k is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7). In some embodiments, j is 4. In some embodiments, k is 4. In some embodiments, j is 4 and k is 4. The antisense is complementary (e.g., fully or partially complementary) to a target nucleic acid sequence.

[0145] In some embodiments, the antisense strand comprises a structure represented by Formula A1, which, in the 5' to 3' direction, is: ASBSAOBOBOBOAOBOAOBOA-OBOAOBOAOBSASASASBSA Formula A1; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0146] In some embodiments of the present disclosure, the siRNA may contain an antisense strand comprising a region represented by Formula II, wherein Formula II is, in the 5' to 3' direction, AB-(A') j -CP 2 -DP 1 -(CP 1 ) k -C' Formula II; where A is a compound of formula CP 1 -DP 1 Each A' is represented by the formula CP 2 -DP 2 B is represented by the formula CP 2 -DP 2 -DP 2 -DP 2 each C is a 2'-O-methyl (2'-O-Me) ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-fluoro (2'-F) ribonucleoside; each D is a 2'-F ribonucleoside; and each P 1 is a phosphorothioate internucleoside linkage; each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7); and k is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7). In some embodiments, j is 4. In some embodiments, k is 4. In some embodiments, j is 4 and k is 4. The antisense is complementary (e.g., fully or partially complementary) to a target nucleic acid sequence.

[0147] In some embodiments, the antisense strand comprises a structure represented by Formula A2, which, in the 5' to 3' direction, is: ASBSAOBOBOBOAOBOAOBOA-OBOAAOBOAOBSASASASASA Formula A2;

[0148] wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0149] In some embodiments of the present disclosure, the sense strand comprises a structure represented by Formula III, which, in the 5' to 3' direction, is: E-(A') m -F Formula III; where E is the formula (CP 1 )2; F is represented by the formula (CP 2 )3-DP 1 -CP 1 -C, (CP 2 )3-DP 2 -CP 2 -C, (CP 2 )3-DP 1 -CP 1 -D, or (CP 2 )3-DP 2 -CP 2 -D; A', C, D, P 1 , and P 2 is as defined in Formula I; and m is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7). In some embodiments, m is 4. The sense strand is complementary (e.g., fully or partially complementary) to the antisense strand.

[0150] In some embodiments of the present disclosure, the sense strand comprises a structure represented by formula S1, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBBSASA Formula S1; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0151] In some embodiments of the present disclosure, the sense strand comprises a structure represented by formula S2, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBOAOA Formula S2; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0152] In some embodiments of the present disclosure, the sense strand comprises a structure represented by formula S3, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBSASB formula S3; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0153] In some embodiments of the present disclosure, the sense strand comprises a structure represented by formula S4, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBOAOB Equation S4; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0154] In some embodiments of the present disclosure, the siRNA may contain an antisense strand comprising a region represented by Formula IV, wherein Formula IV is, in the 5' to 3' direction, A-(A') j -CP 2 -B-(CP 1 ) k -C' Formula IV; where A is a compound of formula CP 1 -DP 1 Each A' is represented by the formula CP 2 -DP 2 B is represented by the formula DP 1 -CP 1 -DP 1 each C is a 2'-O-Me ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-F ribonucleoside; each D is a 2'-F ribonucleoside; and each P 1 is a phosphorothioate internucleoside linkage; each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7); and k is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7). In some embodiments, j is 6. In some embodiments, k is 4. In some embodiments, j is 6 and k is 4. The antisense is complementary (e.g., fully or partially complementary) to a target nucleic acid.

[0155] In some embodiments, the antisense strand comprises a structure represented by Formula A3, which, in the 5' to 3' direction, is: ASBSAOBOAOBOAOBOAOBOA-OBOAOBOAOBSASASASA formula A3; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0156] In some embodiments of the present disclosure, the siRNA of the present disclosure can have a sense strand represented by Formula V, where Formula V is, in the 5' to 3' direction, E-(A') m -CP 2 -F formula V;

[0157] where E is the formula (CP 1 )2; F is represented by the formula DP 1 -CP 1 -C, DP 2 -CP 2 -C, DP 1 -CP 1 -D, or DP 2 -CP 2 -D; A', C, D, P 1 , and P 2 is as defined in Formula IV; and m is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7). In some embodiments, m is 5. The sense strand is complementary (e.g., fully or partially complementary) to the antisense strand.

[0158] In some embodiments of the present disclosure, the sense strand comprises a structure represented by formula S5, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBSASA Formula S5; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0159] In some embodiments of the present disclosure, the sense strand comprises a structure represented by formula S6, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBOAOA Formula S6; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0160] In some embodiments of the present disclosure, the sense strand comprises a structure represented by formula S7, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBSASB formula S7; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0161] In some embodiments of the present disclosure, the sense strand comprises a structure represented by formula S8, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBOAOB formula S8; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0162] In some embodiments of the present disclosure, the siRNA may contain an antisense strand comprising a region represented by Formula VI, wherein Formula VI is, in the 5' to 3' direction, 2- B j -EB k-EFG l -DP 1 -C' Formula VI; where A is a compound of formula CP 1 -DP 1 Each B is represented by the formula CP 2 each C is a 2'-O-Me ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-F ribonucleoside; each D is a 2'-F ribonucleoside; and each E is represented by the formula DP 2 -CP 2 F is represented by the formula DP 1 -CP 1 Each G is represented by the formula CP 1 Each P 1 is a phosphorothioate internucleoside linkage; each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7); k is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7); and l is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7). In some embodiments, j is 3. In some embodiments, k is 6. In some embodiments, l is 2. In some embodiments, j is 3, k is 6, and l is 2. The antisense strand is complementary (e.g., fully or partially complementary) to a target nucleic acid.

[0163] In some embodiments, the antisense strand comprises a structure represented by Formula A4, which, in the 5' to 3' direction, is: ASBSAOAOAOBOAOAOAOAOA-OAOAOBOAOBSASASASBSA formula A4; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0164] In some embodiments of the present disclosure, the siRNA may contain a sense strand comprising a region represented by Formula VII, wherein Formula VII is, in the 5' to 3' direction, HB m -I n -A'-B o -HC Formula VII; where A' is a compound of the formula CP 2 -DP 2 Each H is represented by the formula (CP 1 )2; each I is represented by the formula (DP 2 ) are represented by B, C, D, P 1 , and P 2 is as defined in Formula VI; m is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7); n is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7); and o is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7). In some embodiments, m is 3. In some embodiments, n is 3. In some embodiments, o is 3. In some embodiments, m is 3, n is 3, and o is 3. The sense strand is complementary (e.g., fully or partially complementary) to the antisense strand.

[0165] In some embodiments of the present disclosure, the sense strand comprises a structure represented by formula S9, which, in the 5' to 3' direction, is: ASASAOAOAOBOBOBOAOBOA-OAOAOAASASA Formula S9; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0166] In some embodiments of the present disclosure, the siRNA may contain an antisense strand comprising a region represented by Formula VIII: Z-((AP-) n(BP-) m ) q ; Formula VIII wherein Z is a 5' phosphorus stabilizing moiety; each A is a 2'-O-methyl (2'-O-Me) ribonucleoside; each B is a 2'-fluoro-ribonucleoside; each P is independently an internucleoside linkage selected from a phosphodiester linkage and a phosphorothioate linkage; n is an integer from 1 to 5 (e.g., 1, 2, 3, 4, or 5); m is an integer from 1 to 5 (e.g., 1, 2, 3, 4, or 5); and q is an integer between 1 and 30 (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30).

[0167] 5.5. siRNA synthesis method The siRNA molecules of the present disclosure can be synthesized by standard methods well known in the art, for example, by use of an automated DNA synthesizer such as those commercially available from Biosearch, Applied Biosystems, Inc., as discussed further below.

[0168] siRNA agent can be prepared by liquid phase organic synthesis or solid phase organic synthesis or both.Organic synthesis has the advantage that it can easily prepare the oligonucleotide that contains non-natural nucleotide or chemically modified nucleotide.The siRNA molecule of the present disclosure can be prepared by liquid phase organic synthesis or solid phase organic synthesis or both.

[0169] Furthermore, it is contemplated that further optimization can be achieved for any siRNA agent disclosed herein by systematically adding or removing linked nucleosides to generate longer or shorter sequences. Furthermore, such optimized sequences can be adjusted by introducing chemically modified nucleosides and / or modified internucleoside linkages, as described herein or known in the art, including, for example, alternative nucleosides, alternative sugar moieties, and / or alternative internucleoside linkages, as known in the art and / or discussed herein, to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, and / or targeting to specific locations or cell types).

[0170] 5.6.5' Phosphorus Stabilizing Moiety To further protect the siRNA molecules of the present disclosure from degradation, 5'-phosphorus stabilizing moieties can be employed.The 5'-phosphorus stabilizing moiety replaces the 5'-phosphate, preventing the hydrolysis of the phosphate.The hydrolysis of the 5'-phosphate prevents binding to RISC, which is a necessary step in gene silencing.Any phosphate substitution that does not prevent binding to RISC is contemplated in the present disclosure.In some embodiments, the 5'-phosphate substitution is also stable against hydrolysis in vivo.Each strand of the siRNA molecule can independently and optionally employ any suitable 5'-phosphorus stabilizing moiety. [ka]

[0171] Some exemplary end caps are shown in Formulas IX-XVI. Nuc in Formulas IX-XVI represents a nucleobase or nucleobase derivative or substitute as described herein. X in Formulas IX-XVI represents a 2'-modification as described herein. Some embodiments employ hydroxy as in Formula IX, phosphate as in Formula X, vinyl phosphonate as in Formulas XI and XIV, 5'-methyl substituted phosphate as in Formulas XII, XIII, and XVI, methylene phosphonate as in Formula XV, or vinyl 5'-vinyl phosphonate as the 5'-phosphorus stabilizing moiety as shown in Formula XI.

[0172] The present disclosure further provides siRNA molecules that are linked with one or more hydrophobic moieties.The hydrophobic moiety can be covalently linked to the 5'-end or 3'-end of the siRNA molecule of the present disclosure.Non-limiting examples of the hydrophobic moiety that is suitable for use in the siRNA molecule of the present disclosure can include cholesterol, vitamin D, tocopherol, phosphatidylcholine (PC), docohexaenoic acid, docosanoic acid, PC-docosanoic acid, eicosapentaenoic acid, lithocholic acid, or any combination of the aforementioned hydrophobic moieties and PC.

[0173] 5.7. siRNA Branching The siRNA molecules of the present disclosure may be branched. For example, the siRNA molecules of the present disclosure may have one of several branching patterns, as described herein.

[0174] According to the present disclosure, the siRNA molecule disclosed herein can be a branched siRNA molecule.The siRNA molecule can be unbranched, or can be bi-, tri-, or tetra-branched, connected via a linker.Each main branch can be further branched to allow 2, 3, 4, 5, 6, 7, or 8 separate RNA single-strands or double-strands.The branching points on the linker can originate from the same atom, or can originate from separate atoms along the linker.Some exemplary embodiments are listed in Table 2. [Table 3]

[0175] In some embodiments, the siRNA molecule is a branched siRNA molecule. In some embodiments, the branched siRNA molecule is biantennary, triantennary, or tetraantennary. In some embodiments, the biantennary siRNA molecule is represented by any one of Formulas XVII to XIX, wherein each RNA is independently an siRNA molecule, L is a linker, and each X independently represents a branch point moiety (e.g., phosphoramidite, tosylated solketal, 1,3-diaminopropanol, pentaerythritol, or any one of the branch point moieties described in US 10,478,503).

[0176] In some embodiments, the three-branched siRNA molecule is represented by any one of Formulas XX-XXIII, wherein each RNA is independently an siRNA molecule, L is a linker, and each X independently represents a branch point moiety.

[0177] In some embodiments, the four-branched siRNA molecule is represented by any one of Formulas XXIV-XXVIII, wherein each RNA is independently an siRNA molecule, L is a linker, and each X independently represents a branch point moiety.

[0178] The multiple strands of the siRNAs described herein may be covalently linked by a linker. This branching effect, among other things, improves cell permeability, allowing for better access to cells within the CNS (e.g., neurons or glial cells). Any linker moiety that is not incompatible with the siRNAs of the present invention can be employed. Linkers include ethylene glycol chains of 2 to 10 subunits (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 subunits), alkyl chains, carbohydrate chains, block copolymers, peptides, RNA, DNA, and others. In some embodiments, the carbon or oxygen atoms of the linker are optionally replaced with nitrogen atoms and have hydroxyl or oxo substituents. In some embodiments, the linker is a polyethylene glycol (PEG) linker. PEG linkers suitable for use in the disclosed compositions and methods include linear or non-linear PEG linkers. Examples of non-linear PEG linkers include branched PEG, linear forked PEG, or branched forked PEG.

[0179] PEG linkers of various weights may be used in the disclosed compositions and methods. For example, the PEG linker may have a weight between 5 and 500 daltons. In some embodiments, a PEG linker having a weight between 500 and 1,000 daltons may be used. In some embodiments, a PEG linker having a weight between 1,000 and 10,000 daltons may be used. In some embodiments, a PEG linker having a weight between 200 and 20,000 daltons may be used. In some embodiments, the linker is covalently attached to the sense strand of the siRNA. In some embodiments, the linker is covalently attached to the antisense strand of the siRNA. In some embodiments, the PEG linker is a triethylene glycol (TrEG) linker. In some embodiments, the PEG linker is a tetraethylene glycol (TEG) linker.

[0180] In some embodiments, the linker is an alkyl chain linker. In some embodiments, the linker is a peptide linker. In some embodiments, the linker is an RNA linker. In some embodiments, the linker is a DNA linker.

[0181] The linker may covalently link two, three, four, or five unique siRNA strands. The linker may be covalently attached to any portion of the siRNA oligomer. In some embodiments, the linker is attached to the 3'-end of a nucleoside in each siRNA strand. In some embodiments, the linker is attached to the 5'-end of a nucleoside in each siRNA strand. In some embodiments, the linker is attached to a nucleoside in an siRNA strand (e.g., a sense strand or an antisense strand) via a covalent bond-forming moiety. In some embodiments, the covalent bond-forming moiety is selected from the group consisting of alkyl, ester, amide, carbonate, carbamate, triazole, urea, formacetal, phosphonate, phosphate, and phosphate derivatives (e.g., phosphorothioate, phosphoramidate, etc.). In certain embodiments, the linker is a bivalent oligonucleotide (DIO) linker.

[0182] In some embodiments, the linker has the structure of formula L1: [ka]

[0183] In some embodiments, the linker has the structure of formula L2: [ka]

[0184] In some embodiments, the linker has the structure of formula L3: [ka]

[0185] In some embodiments, the linker has the structure of formula L4: [ka]

[0186] In some embodiments, the linker has the structure of formula L5: [ka]

[0187] In some embodiments, the linker has the structure of formula L6: [ka]

[0188] In some embodiments, the linker has the structure of formula L7, as shown below: [ka]

[0189] In some embodiments, the linker has the structure of formula L8. [ka]

[0190] In some embodiments, the linker has the structure of formula L9: [ka]

[0191] In some embodiments, the selection of a linker for use in one or more of the branched siRNA molecules disclosed herein may be based on the hydrophobicity of the linker, e.g., to achieve a desired hydrophobicity for one or more of the branched siRNA molecules of the present disclosure. For example, a linker containing an alkyl chain may be used to increase the hydrophobicity of the branched siRNA molecule compared to a branched siRNA molecule having a less hydrophobic or hydrophilic linker.

[0192] The siRNA agents disclosed herein can be synthesized and / or modified by methods well established in the art, such as those described in Beaucage, SLet et al. (eds.), Current Protocols in Nucleic Acid Chemistry, John Wiley & Sons, Inc., New York, NY, 2000, which is incorporated herein by reference.

[0193] 5.8. Treatment method The SNCA-targeting siRNA molecule of the present disclosure can be delivered to a subject to treat a synucleinopathy. In certain embodiments, the synucleinopathy is Parkinson's disease, Alzheimer's disease, dementia with Lewy bodies, multipathological atrophy, or other medical risk(s) associated with the SNCA gene. For example, delivering an siRNA molecule to a subject can treat a synucleinopathy and / or alleviate a phenotype associated with a synucleinopathy. Exemplary synucleinopathies include Parkinson's disease, Alzheimer's disease, dementia with Lewy bodies, multipathological atrophy, or other medical risk(s) associated with the SNCA gene. Furthermore, the siRNA molecule of the present disclosure can be delivered to a subject with a variant of the SNCA gene, and siRNA-mediated gene silencing of the variant SNCA gene can reduce the expression level of the SNCA transcript, thereby treating a synucleinopathy such as Parkinson's disease, Alzheimer's disease, dementia with Lewy bodies, multipathological atrophy, or other medical risk(s) associated with the SNCA gene.

[0194] The present disclosure provides a method for treating a subject by silencing the SNCA gene with one or more of the siRNA molecules described herein. Gene silencing can be performed in a subject to silence wild-type SNCA transcripts, mutant SNCA transcripts, splice isoforms of SNCA transcripts, and / or overexpressed SNCA transcripts compared to healthy subjects. The method can include delivering a siRNA molecule of the present disclosure or a pharmaceutical composition containing the same to the CNS or affected tissue of a subject (e.g., a human) by any appropriate administration route (e.g., intracerebroventricular, intrathecal, intrastriatal, intracisternal via catheter insertion, intraparenchymal, intravenous, subcutaneous, or intramuscular). The active compound can be administered at any suitable dose. The actual dosage of the composition of the present disclosure administered to a patient can be determined by physical and physiological factors, such as body weight, severity of the condition, prior or concurrent therapeutic interventions, the patient's idiopathic disease, and the route of administration. Depending on the dosage and administration route, exemplary dosage and / or the number of administrations of effective amount can vary depending on the response of the subject.The practitioner in charge of administration will in any case determine the concentration of active ingredient(s) in the composition and the appropriate dose(s) for each subject.Administration can be carried out any suitable number of times per day for the required period.Subjects can be adults or children with or without coexisting diseases.

[0195] 5.8.1.Selecting the target Subjects that can be treated with the siRNA molecules disclosed herein are those in need of treatment, for example, for synucleinopathy. In certain embodiments, the synucleinopathy is Parkinson's disease, Alzheimer's disease, dementia with Lewy bodies, multipathy atrophy, or other medical risk(s) associated with the SNCA gene. Subjects that can be treated with the siRNA molecules disclosed herein can include, for example, humans, monkeys, rats, mice, pigs, and other mammals that contain at least one orthologous copy of the SNCA gene. Subjects can be adults or children with or without co-morbidities.

[0196] Pharmaceutical Compositions The siRNA molecule of the present disclosure can be formulated in pharmaceutical compositions for administering to subjects in a biologically compatible form suitable for in vivo administration.Therefore, the present disclosure provides pharmaceutical compositions that contain the siRNA molecule of the present disclosure mixed with suitable diluent, carrier or excipient.For example, siRNA molecule can be directly administered to subject CNS or affected tissue (for example, by intracerebroventricular, intrastriatal, intrathecal injection, intracisternal injection by catheter insertion, intraparenchymal injection, intravenous injection, subcutaneous injection or intramuscular injection).

[0197] Conventional procedures and ingredients for selecting and preparing suitable formulations are described, for example, in Remington, J.P. The Science and Practice of Pharmacy, Easton, PA. Mack Publishers, 2012, 22 nd ed. and The United States Pharmacopeial Convention, The National Formulary, United States Pharmacopeial, 2015, USP 38 NF 33).

[0198] Under normal conditions of storage and use, pharmaceutical compositions may contain preservatives, for example, to prevent the growth of microorganisms. Pharmaceutical compositions include sterile aqueous solutions, sterile dispersions, or powders for the extemporaneous preparation of sterile solutions or dispersions. In all cases, the articles can be sterilized using techniques known in the art and can be fluidized to the extent that they can be easily administered to a subject in need of treatment.

[0199] Pharmaceutical compositions may be administered to a subject, e.g., a human subject, alone or in combination with pharmaceutically acceptable carriers, as provided herein, the proportions of which may be determined by the solubility and / or chemical properties of the compound, the selected route of administration, and standard pharmaceutical practice.

[0200] Dosing regimen A physician of ordinary skill in the art can easily determine the effective amount of siRNA molecules to be administered to a mammalian subject (e.g., human) in need thereof. For example, a physician can begin by prescribing a dose of one of the siRNA molecules of the present disclosure at a level lower than that required to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved. Alternatively, a physician can begin a treatment regimen by administering one of the siRNA molecules of the present disclosure at a high dose, and then administer gradually decreasing doses until the minimum dosage that achieves the therapeutic effect (e.g., reduction in the expression of the target gene sequence) is reached. Generally, the suitable daily dose of one of the siRNA molecules of the present disclosure is the amount of the lowest dose of the siRNA molecule that is effective in producing a therapeutic effect. The ss- or ds-siRNA molecules of the present disclosure can be administered by injection, for example, intrathecal, intracerebroventricular, intracisternal injection by catheter insertion, intraparenchymal, intravenous, subcutaneous, or intramuscular injection. The daily dosage of the therapeutic composition of the siRNA molecule of the present disclosure can be administered as a single dose, or as two, three, four, five, six or more doses administered separately at appropriate intervals throughout the day, week, month or year, optionally in unit dosage form.The siRNA molecule of the present disclosure can be administered alone, but can also be administered as a pharmaceutical formulation in combination with an excipient, a carrier and optionally an additional therapeutic agent.

[0201] 5.8.4. Route of Administration The disclosed methods contemplate any route of administration tolerated by the therapeutic composition, some embodiments of which include intrathecal, intracerebroventricular, intrastriatal, intraparenchymal, or intracisternal infusion via catheterization.

[0202] Intrathecal injection is a direct injection into the spinal column or subarachnoid space. By injecting directly into the CSF of the spinal column, the siRNA molecules of the present disclosure have direct access to cells in the spinal column (e.g., neurons and glial cells) and have a route to bypass the blood-brain barrier and access cells in the brain.

[0203] Intracerebroventricular (ICV) injection is a method of injection directly into the CSF in the ventricles of the brain. Like intrathecal injection, ICV is an injection method that bypasses the blood-brain barrier. ICV has the advantage of allowing therapeutic agents to access cells in the brain and spinal column without the risk of degradation in the blood.

[0204] Intrastriatal injection is a direct injection into the striatum (or corpus striatum), a subcortical basal ganglia region of the brain. Injection into the striatum bypasses the blood-brain barrier, avoiding the pharmacokinetic challenges of injection into the bloodstream and allowing direct access to brain cells.

[0205] Intraparenchymal administration is direct injection into the parenchyma (e.g., brain parenchyma). Injection into the brain parenchyma allows for direct injection into the brain region affected by the disease or disorder, bypassing the blood-brain barrier.

[0206] Intracisternal injection via catheterization is a direct injection into the cisterna magna, a region of the brain located between the cerebellum and the dorsal aspect of the medulla oblongata. Injection into the cisterna magna provides more direct delivery to cells in the cerebellum, brainstem, and spinal cord.

[0207] In some embodiments of the methods described herein, the therapeutic composition can be delivered to the subject by systemic administration, for example, intravenous, intramuscular, or subcutaneous administration.

[0208] Intravenous (IV) injection is a method of injection directly into a subject's bloodstream. IV administration may be in the form of a bolus dose, by continuous infusion, or any other method acceptable to the therapeutic composition.

[0209] Intramuscular (IM) injections are injections into a muscle of the subject, such as the deltoid or gluteal muscles. IM may allow for rapid absorption of the therapeutic composition.

[0210] Subcutaneous injections are injections into the subcutaneous tissue. Absorption of compositions delivered subcutaneously may be slower than IV or IM injections, which may be beneficial for compositions that require continuous absorption.

[0211] 6. Enumerated Embodiments of the Disclosure The compositions, methods, and kits described herein include the following non-limiting, exemplary enumerated embodiments of the present disclosure: In some embodiments, the present disclosure provides:

[0212] Embodiment 1. A small interfering RNA (siRNA) molecule comprising an antisense strand and a sense strand that is complementary to the antisense strand, wherein the antisense strand is 10 to 30 nucleotides in length and has sufficient complementarity to hybridize to a region within an alpha synuclein (SNCA) mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0213] Embodiment 2. The siRNA molecule of embodiment 1, wherein the antisense strand has at least 70% complementarity to a region of 21 contiguous nucleobases within the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0214] Embodiment 3. The siRNA molecule of embodiment 2, wherein the antisense strand has at least 75% complementarity to a region of 21 consecutive nucleobases within the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840, and optionally, the antisense strand has at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the region within the 421-840 mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0215] Embodiment 4. The siRNA molecule of any one of embodiments 1 to 3, wherein the antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 consecutive nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0216] Embodiment 5. The siRNA molecule of embodiment 4, wherein the antisense strand comprises 10 to 30 contiguous nucleotides that are completely complementary to a contiguous polynucleotide segment of equal length within the region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0217] Embodiment 6. The siRNA molecule of embodiment 5, wherein the antisense strand comprises 12 to 30 contiguous nucleotides that are completely complementary to a contiguous polynucleotide segment of equal length within the region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0218] Embodiment 7. The siRNA molecule of embodiment 6, wherein the antisense strand comprises 15 to 30 contiguous nucleotides that are completely complementary to a contiguous polynucleotide segment of equal length within the region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0219] Embodiment 8. The siRNA molecule of embodiment 7, wherein the antisense strand comprises 18 to 30 contiguous nucleotides that are completely complementary to a contiguous polynucleotide segment of equal length within the region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0220] Embodiment 9. The siRNA molecule of embodiment 8, wherein the antisense strand comprises 21 to 30 contiguous nucleotides that are completely complementary to a contiguous polynucleotide segment of equal length within the region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0221] Embodiment 10. The siRNA molecule of any one of embodiments 1 to 9, wherein the antisense strand comprises 24 to 30 contiguous nucleotides that are completely complementary to a contiguous polynucleotide segment of equal length within the region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0222] Embodiment 11. The siRNA molecule of embodiment 10, wherein the antisense strand comprises 30 consecutive nucleotides that are perfectly complementary to a contiguous polynucleotide segment of equal length within the region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0223] Embodiment 12. The siRNA molecule of any one of embodiments 1 to 11, wherein the antisense strand contains no more than 9 nucleotide mismatches to a region of 21 consecutive nucleobases of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840, and optionally the antisense strand contains no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or only 1 mismatch to said region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0224] Embodiment 13. The siRNA molecule of any one of embodiments 1 to 12, wherein the region of the SNCA mRNA transcript has the nucleic acid sequence of any one of SEQ ID NOs: 459, 535, 551, 599, 631, 663, 664, 666, 667, 671, 748, 750, 751, 752, 760, 762, and 777.

[0225] Embodiment 14. The siRNA molecule of embodiment 13, wherein said region of said SNCA mRNA transcript has the nucleic acid sequence of any one of SEQ ID NOs: 535, 599, 664, 666, 671, 750, 752, 760, and 762.

[0226] Embodiment 15. The siRNA molecule of any one of embodiments 1 to 14, wherein the antisense strand has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1 to 420.

[0227] Embodiment 16. The siRNA molecule of embodiment 15, wherein the antisense strand has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1 to 420.

[0228] Embodiment 17. The siRNA molecule of embodiment 16, wherein the antisense strand has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NOs: 1-420, and optionally the antisense strand has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1-420.

[0229] Embodiment 18. The siRNA molecule of embodiment 17, wherein the antisense strand has a nucleic acid sequence of any one of SEQ ID NOs: 1 to 420.

[0230] Embodiment 19. The siRNA molecule of any one of embodiments 15 to 18, wherein the nucleic acid sequence is any one of SEQ ID NOs: 39, 115, 131, 179, 211, 243, 244, 246, 247, 251, 328, 330, 331, 332, 340, 342, and 357.

[0231] Embodiment 20. The siRNA molecule of embodiment 19, wherein the nucleic acid sequence is any one of SEQ ID NOs: 115, 179, 244, 246, 251, 330, 332, 340, and 342.

[0232] Embodiment 21. The siRNA molecule of any one of embodiments 1 to 20, wherein the sense strand has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0233] Embodiment 22. The siRNA molecule of embodiment 21, wherein the sense strand has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0234] Embodiment 23. The siRNA molecule of embodiment 22, wherein the sense strand has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NOs: 421-840, and optionally the sense strand has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

[0235] Embodiment 24. The siRNA molecule of embodiment 23, wherein the sense strand has a nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

[0236] Embodiment 25. The siRNA molecule of any one of embodiments 21 to 24, wherein the nucleic acid sequence is any one of SEQ ID NOs: 459, 535, 551, 599, 631, 663, 664, 666, 667, 671, 748, 750, 751, 752, 760, 762, and 777.

[0237] Embodiment 26. The siRNA molecule of embodiment 25, wherein the nucleic acid sequence is any one of SEQ ID NOs: 535, 599, 664, 666, 671, 750, 752, 760, and 762.

[0238] Embodiment 27. The antisense strand comprises a structure represented by Formula I, which, in the 5' to 3' direction, is: AB-(A') j -CP 2 -DP 1 -(C'-P 1 ) k -C' Formula I; where A is a compound of formula CP 1 -DP 1 Represented by; Each A' is of the formula CP 2 -DP 2 Represented by; B is the formula CP 2 -DP 2 -DP 2 -DP 2 Represented by; each C is a 2'-O-methyl (2'-O-Me) ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-fluoro (2'-F) ribonucleoside; each D is a 2'-F ribonucleoside; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; 27. The siRNA molecule of any one of embodiments 1 to 26, wherein k is an integer of 1 to 7.

[0239] Embodiment 28. The antisense strand comprises a structure represented by formula A1, which, in the 5' to 3' direction, is: ASBSAOBOBOBOAOBOAOBOA-OBOAOBOAOBSASASASBSA Formula A1; 28. The siRNA molecule of embodiment 27, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0240] Embodiment 29. The antisense strand comprises a structure represented by Formula II, which, in the 5' to 3' direction, is: AB-(A') j -CP 2 -DP 1 -(CP 1 ) k -C' Formula II; where A is a compound of formula CP 1 -DP 1 Represented by; Each A' is of the formula CP 2 -DP 2 Represented by; B is the formula CP 2 -DP 2 -DP 2-DP 2 Represented by; each C is a 2'-O-methyl (2'-O-Me) ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-fluoro (2'-F) ribonucleoside; each D is a 2'-F ribonucleoside; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; 27. The siRNA molecule of any one of embodiments 1 to 26, wherein k is an integer of 1 to 7.

[0241] Embodiment 30. The antisense strand comprises a structure represented by formula A2, which, in the 5' to 3' direction, is: ASBSAOBOBOBOAOBOAOBOA-OBOAAOBOAOBSASASASASA Formula A2; 30. The siRNA molecule of embodiment 29, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0242] Embodiment 31. The sense strand comprises a structure represented by Formula III, which, in the 5' to 3' direction, is: E-(A') m -F Formula III; where E is a group represented by the formula (CP 1 )2; F is the formula (CP 2 )3-DP 1 -CP 1 -C, (CP 2 )3-DP 2 -CP 2 -C, (CP2 )3-DP 1 -CP 1 -D, or (CP 2 )3-DP 2 -CP 2 - represented by D; A', C, D, P 1 , and P 2 is as defined in formula II; The siRNA molecule of any one of embodiments 1 to 30, wherein m is an integer of 1 to 7.

[0243] Embodiment 32. The sense strand comprises a structure represented by formula S1, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBBSASA Formula S1; 32. The siRNA molecule of embodiment 31, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0244] Embodiment 33. The sense strand comprises a structure represented by formula S2, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBOAOA Formula S2; 32. The siRNA molecule of embodiment 31, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0245] Embodiment 34. The sense strand comprises a structure represented by formula S3, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBSASB formula S3; 32. The siRNA molecule of embodiment 31, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0246] Embodiment 35. The sense strand comprises a structure represented by formula S4, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OAOAOBOAOB Equation S4; 32. The siRNA molecule of embodiment 31, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0247] Embodiment 36. The antisense strand comprises a structure represented by Formula IV, which, in the 5' to 3' direction, is: A-(A') j -CP 2 -B-(CP 1 ) k -C' Formula IV; where A is a compound of formula CP 1 -DP 1 Represented by; Each A' is of the formula CP 2 -DP 2 Represented by; B is the formula DP 1 -CP 1 -DP 1 Represented by; each C is a 2'-O-Me ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-F ribonucleoside; each D is a 2'-F ribonucleoside; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; The siRNA molecule according to any one of embodiments 1 to 26 and 31 to 35, wherein k is an integer of 1 to 7.

[0248] Embodiment 37. The antisense strand comprises a structure represented by formula A3, which, in the 5' to 3' direction, is: ASBSAOBOAOBOAOBOAOBOA-OBOAOBOAOBSASASASA formula A3; 37. The siRNA molecule of embodiment 36, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0249] Embodiment 38. The sense strand comprises a structure represented by Formula V, wherein Formula V is, in the 5'-3' direction: E-(A') m -CP 2 -F formula V; where E is a group represented by the formula (CP 1 )2; F is the formula DP 1 -CP 1 -C, DP 2 -CP 2 -C, DP 1 -CP 1 -D, or DP 2 -CP 2 - represented by D; A', C, D, P 1 , and P 2 is as defined in formula IV; The siRNA molecule of any one of embodiments 1 to 30, 36, and 37, wherein m is an integer of 1 to 7.

[0250] Embodiment 39. The sense strand comprises a structure represented by formula S5, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBSASA Formula S5; 39. The siRNA molecule of embodiment 38, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0251] Embodiment 40. The sense strand comprises a structure represented by formula S6, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBOAOA Formula S6; 39. The siRNA molecule of embodiment 38, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0252] Embodiment 41. The sense strand comprises a structure represented by formula S7, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBSASB formula S7; 39. The siRNA molecule of embodiment 38, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0253] Embodiment 42. The sense strand comprises a structure represented by formula S8, which, in the 5' to 3' direction, is: ASASAOBOAOBOAOBOAOBOA-OBOAOBOAOB formula S8; 39. The siRNA molecule of embodiment 38, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0254] Embodiment 43. The antisense strand comprises a structure represented by Formula VI, which, in the 5' to 3' direction, is: AB j -EB k -EFG l -DP 1 -C' Formula VI; where A is a compound of formula CP 1 -DP 1 Represented by; Each B is a function of the formula CP 2 Represented by; each C is a 2'-O-Me ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-F ribonucleoside; each D is a 2'-F ribonucleoside; Each E is the formula DP 2 -CP 2 Represented by; F is the formula DP 1 -CP 1 Represented by; Each G is a function of the formula CP 1 Represented by; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; k is an integer from 1 to 7; The siRNA molecule according to any one of embodiments 1 to 26, 31 to 35, and 38 to 42, wherein 1 is an integer from 1 to 7.

[0255] Embodiment 44. The antisense strand comprises a structure represented by formula A4, which, in the 5' to 3' direction, is: ASBSAOAOAOBOAOAOAOAOA-OAOAOBOAOBSASASASBSA formula A4; 44. The siRNA molecule of embodiment 43, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0256] Embodiment 45. The sense strand comprises a structure represented by Formula VII, which, in the 5' to 3' direction, is: HB m -I n -A'-B o -HC Formula VII; where A' is a compound of the formula CP 2 -DP 2 Represented by; Each H is a function of the formula (CP 1 )2; Each I is expressed as 2 ) is represented by; B, C, D, P 1 , and P 2 is as defined in formula VI; m is an integer from 1 to 7; n is an integer from 1 to 7; 45. The siRNA molecule of any one of embodiments 1 to 30, 36, 37, 43, and 44, wherein o is an integer from 1 to 7.

[0257] Embodiment 46. The sense strand comprises a structure represented by formula S9, which, in the 5' to 3' direction, is: ASASAOAOAOBOBOBOAOBOA-OAOAOAASASA Formula S9; 46. ​​The siRNA molecule of embodiment 45, wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

[0258] Embodiment 47. The siRNA molecule of any one of embodiments 1 to 46, wherein the antisense strand further comprises a 5' phosphorus-stabilizing moiety at the 5' end of the antisense strand.

[0259] Embodiment 48 The siRNA molecule of any one of embodiments 1 to 47, wherein the sense strand further comprises a 5' phosphorus-stabilizing moiety at the 5' end of the sense strand.

[0260] Embodiment 49. Each 5' phosphorus stabilizing moiety is independently represented by any one of Formulas IX-XVI: [ka] 49. The siRNA molecule of embodiment 47 or 48, wherein Nuc represents a nucleobase selected from the group consisting of adenine, uracil, guanine, thymine, and cytosine, and R represents optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, phenyl, benzyl, hydroxy, or hydrogen.

[0261] Embodiment 50. The siRNA molecule of embodiment 49, wherein the nucleobase is adenine, uracil, guanine, thymine, or cytosine.

[0262] Embodiment 51. The siRNA molecule of any one of embodiments 47 to 50, wherein the 5' phosphorus stabilizing moiety is an (E)-vinyl phosphonate represented by Formula XI.

[0263] Embodiment 52. The siRNA molecule of any one of embodiments 1 to 51, wherein the siRNA molecule further comprises a hydrophobic moiety at the 5' end or 3' end of the siRNA molecule.

[0264] Embodiment 53 The siRNA molecule of embodiment 52, wherein the hydrophobic moiety is selected from the group consisting of cholesterol, vitamin D, or tocopherol.

[0265] Embodiment 54. The siRNA molecule of any one of embodiments 1 to 53, wherein the length of the sense strand is 12 to 30 nucleotides.

[0266] Embodiment 55. The siRNA molecule of any one of embodiments 1 to 54, wherein the siRNA molecule is a branched siRNA molecule.

[0267] Embodiment 56 The siRNA molecule of embodiment 55, wherein the branched siRNA molecule is biantennary, triantennary, or tetraantennary.

[0268] Embodiment 57. The siRNA molecule is a biantennary siRNA molecule, optionally wherein the biantennary siRNA molecule is represented by any one of Formulas XVII to XIX: [ka] 57. The siRNA molecule of embodiment 56, wherein each RNA is independently an siRNA molecule, L is a linker, and each X independently represents a branch point moiety.

[0269] Embodiment 58. The siRNA molecule is a three-antennary siRNA molecule, optionally wherein the three-antennary siRNA molecule is represented by any one of Formulas XX to XXIII: [ka] 57. The siRNA molecule of embodiment 56, wherein each RNA is independently an siRNA molecule, L is a linker, and each X independently represents a branch point moiety.

[0270] Embodiment 59. The siRNA molecule is a four-branched siRNA molecule, optionally wherein the four-branched siRNA molecule is represented by any one of Formulas XXIV to XXVIII: [ka] 57. The siRNA molecule of embodiment 56, wherein each RNA is independently an siRNA molecule, L is a linker, and each X independently represents a branch point moiety.

[0271] Embodiment 60. The siRNA molecule of any one of embodiments 57 to 59, wherein the linker is selected from the group consisting of one or more consecutive subunits of ethylene glycol, alkyl, carbohydrate, block copolymer, peptide, RNA, and DNA.

[0272] Embodiment 61. The siRNA molecule of embodiment 60, wherein the one or more consecutive subunits are 2 to 20 consecutive subunits.

[0273] Embodiment 62. An siRNA molecule comprising: (I) a) a sense strand comprising the sequence (mU)#(mA)#(mC)(fC)(mA)(fC)(mU)(fU)(mA)(fU)(mU)(mC)(fU)#(mA)#(mA)-DIO (SEQ ID NO: 841), and an antisense strand comprising the sequence V(mU)#(fU)#(mA)(fG)(fA)(fA)(mA)(fU)(mA)(fA)(mG)(fU)(mG)(fG)(mU)(fA)#(mG)#(mU)#(mC)#(mA)#(mC) (SEQ ID NO: 842); b) a sense strand comprising the sequence (mC)#(mA)#(mA)(fG)(mU)(fG)(mC)(fU)(mC)(fA)(mG)(mU)(mU)(fC)#(mC)#(mA)-DIO (SEQ ID NO: 843), and an antisense strand comprising the sequence V(mU)#(fG)#(mG)(fA)(fA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)(mU)(fG)#(mU)#(mA)#(mC)#(mA)#(mG) (SEQ ID NO: 844); c) a sense strand comprising the sequence (mA)#(mG)#(mU)(fG)(mG)(fU)(mG)(fC)(mA)(fU)(mG)(mG)(mU)(fG)#(mU)#(mA)-DIO (SEQ ID NO: 845), and an antisense strand comprising the sequence V(mU)#(fA)#(mC)(fA)(fC)(fC)(mA)(fU)(mG)(fC)(mA)(fC)(mC)(fA)(mC)(fU)#(mC)#(mC)#(mC)#(mU)#(mC) (SEQ ID NO: 846); d) a sense strand comprising the sequence (mC)#(mA)#(mA)(fU)(mG)(fA)(mG)(fG)(mC)(fU)(mU)(mA)(mU)(fG)#(mA)#(mA)-DIO (SEQ ID NO: 847), and an antisense strand comprising the sequence V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 848); e) a sense strand comprising the sequence (mU)#(mC)#(mA)(fG)(mU)(fU)(mC)(fC)(mA)(fA)(mU)(mG)(mU)(fG)#(mC)#(mA)-DIO (SEQ ID NO: 849), and an antisense strand comprising the sequence V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 850); f) a sense strand comprising the sequence (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 851), and an antisense strand comprising the sequence V(mU)#(fG)#(mC)(fA)(fC)(fA)(mU)(fU)(mG)(fG)(mA)(fA)(mC)(fU)(mG)(fA)#(mG)#(mC)#(mA)#(mC)#(mU) (SEQ ID NO: 852); or g) a sense strand comprising the sequence (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 853), and an antisense strand comprising the sequence V(mU)#(fG)#(mU)(fU)(fU)(mA)(fA)(mC)(fA)(mU)(fC)(mG)(fU)(mA)(fG)#(mA)#(mU)#(mU)#(mG)#(mA) (SEQ ID NO: 854); wherein m represents a 2'-O-Me ribonucleoside, f represents a 2'-F ribonucleoside, # represents a phosphorothioate internucleoside linkage, -DIO represents a divalent oligonucleotide (DIO) linker, and V represents a vinyl phosphonate; or (II) a) a sense strand comprising the sequence (mU)#(mA)#(mC)(fC)(mA)(fC)(mU)(fU)(mA)(fU)(mU)(mC)(fU)#(mA)#(mA)-DIO (SEQ ID NO: 841), and an antisense strand comprising the sequence V(mU)#(fU)#(mA)(fG)(fA)(fA)(mA)(fU)(mA)(fA)(mG)(fU)(mG)(fG)(mU)(fA)#(mG)#(mU)#(mC)#(mA)#(mC) (SEQ ID NO: 842); b) a sense strand comprising the sequence (mC)#(mA)#(mA)(fG)(mU)(fG)(mC)(fU)(mC)(fA)(mG)(mU)(mU)(fC)#(mC)#(mA)-DIO (SEQ ID NO: 843), and an antisense strand comprising the sequence V(mU)#(fG)#(mG)(fA)(fA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)(mU)(fG)#(mU)#(mA)#(mC)#(mA)#(mG) (SEQ ID NO: 844); c) a sense strand comprising the sequence (mA)#(mG)#(mU)(fG)(mG)(fU)(mG)(fC)(mA)(fU)(mG)(mG)(mU)(fG)#(mU)#(mA)-DIO (SEQ ID NO: 845), and an antisense strand comprising the sequence V(mU)#(fA)#(mC)(fA)(fC)(fC)(mA)(fU)(mG)(fC)(mA)(fC)(mC)(fA)(mC)(fU)#(mC)#(mC)#(mC)#(mU)#(mC) (SEQ ID NO: 846); d) a sense strand comprising the sequence (mC)#(mA)#(mA)(fU)(mG)(fA)(mG)(fG)(mC)(fU)(mU)(mA)(mU)(fG)#(mA)#(mA)-DIO (SEQ ID NO: 847), and an antisense strand comprising the sequence V(mU)#(fU)#(mC)(fA)(fU)(fA)(mA)(fG)(mC)(fC)(mU)(fC)(mA)(fU)(mU)(fG)#(mU)#(mC)#(mA)#(mG)#(mG) (SEQ ID NO: 855); e) a sense strand comprising the sequence (mA)#(mG)#(mU)(fG)(mC)(fU)(mC)(fA)(mG)(fU)(mU)(mC)(mC)(fA)#(mA)#(mA)-DIO (SEQ ID NO: 856), and an antisense strand comprising the sequence V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 850); f) a sense strand comprising the sequence (mU)#(mC)#(mA)(fG)(mU)(fU)(mC)(fC)(mA)(fA)(mU)(mG)(mU)(fG)#(mC)#(mA)-DIO (SEQ ID NO: 857), and an antisense strand comprising the sequence V(mU)#(fG)#(mC)(fA)(fC)(fA)(mU)(fU)(mG)(fG)(mA)(fA)(mC)(fU)(mG)(fA)#(mG)#(mC)#(mA)#(mC)#(mU) (SEQ ID NO: 852); or g) a sense strand comprising the sequence (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 853), and an antisense strand comprising the sequence V(mU)#(fG)#(mU)(fU)(fU)(mA)(fA)(mC)(fA)(mU)(fC)(mG)(fU)(mA)(fG)#(mA)#(mU)#(mU)#(mG)#(mA) (SEQ ID NO: 854); where m represents a 2'-O-Me ribonucleoside, f represents a 2'-F ribonucleoside, # represents a phosphorothioate internucleoside linkage, -DIO represents a divalent oligonucleotide (DIO) linker, and V represents a vinyl phosphonate.

[0274] Embodiment 63. A pharmaceutical composition comprising the siRNA molecule of any one of embodiments 1 to 62 and a pharmaceutically acceptable excipient, carrier, or diluent.

[0275] Embodiment 64. A method for delivering an siRNA molecule to a subject diagnosed with a disease, the method comprising administering to the subject a therapeutically effective amount of the siRNA molecule of any one of embodiments 1 to 62 or the pharmaceutical composition of embodiment 63.

[0276] Embodiment 65. A method for treating synucleinopathy in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an siRNA molecule described in any one of embodiments 1 to 62 or a pharmaceutical composition described in embodiment 63.

[0277] Embodiment 66. The method of embodiment 65, wherein the synucleinopathy is Parkinson's disease.

[0278] Embodiment 67. The method of embodiment 65, wherein the synucleinopathy is Alzheimer's disease.

[0279] Embodiment 68. The method of embodiment 65, wherein the synucleinopathy is dementia with Lewy bodies.

[0280] Embodiment 69. The method of embodiment 65, wherein the synucleinopathy is multisymptom atrophy.

[0281] Embodiment 70. A method for reducing SNCA expression in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an siRNA molecule described in any one of embodiments 1 to 62 or a pharmaceutical composition described in embodiment 63.

[0282] Embodiment 71. The method of any one of embodiments 64 to 70, wherein the siRNA molecule or the pharmaceutical composition is administered to the subject by intracerebroventricular, intrastriatal, intraparenchymal, or intrathecal injection.

[0283] Embodiment 72. The method of any one of embodiments 64 to 71, wherein the siRNA molecule or the pharmaceutical composition is administered to the subject by intravenous, intramuscular, or subcutaneous injection.

[0284] Embodiment 73. The method of any one of embodiments 64 to 72, wherein the subject is a human.

[0285] Embodiment 74. A kit comprising an siRNA molecule described in any one of embodiments 1 to 62, or a pharmaceutical composition described in embodiment 63, and an accompanying instruction, wherein the accompanying instruction instructs a user of the kit to carry out a method described in any one of embodiments 64 to 73. [Example]

[0286] 7. Working Example The following examples are put forth to provide one of ordinary skill in the art with a description of how the compositions and methods described herein can be used, made, and evaluated, and are intended to be purely exemplary of the disclosure and are not intended to limit the scope of what the inventors regard as their disclosure.

[0287] Example 1. In vitro screening In vitro screening was performed using human MeWo cells in a 96-well format. Briefly, cholesterol-conjugated mono-siRNA was passively administered to cells in culture for 72 hours at concentrations of 2 μM or 0.5 μM (single-point format) or in 1:2.5 serial dilutions from 3 μM to 0.00196608 μM (IC50 format). Cells were lysed using a Cells-to-Ct kit (Thermo), and quantitative reverse transcriptase polymerase chain reaction (QRT-PCR) was performed to assess target (SNCA) gene expression relative to housekeeping (ATP5B) gene expression using TaqMan primers / probes and Fast Advanced Master Mix (Thermo). Data are presented as the mean % SNCA target expression compared to untreated control cells (N = 2–3 biological replicates, each with two technical replicates), with 100% representing no knockdown and 0% representing complete target knockdown. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6]

Table 4-7

Table 4-8

Table 4-9

Table 4-10

Table 4-11

Table 4-12

Table 4-13

Table 4-14

Table 4-15

Table 4-16

Table 4-17

Table 4-18

Table 4-19

Table 4-20

Table 4-21

Table 4-22

Table 4-23

Table 4-24

Table 4-25

Table 4-26

Table 4-27

Table 4-28

Table 4-29

Table 4-30

Table 4-31

Table 4-32

Table 4-33

Table 4-34

Table 4-35

Table 4-36

Table 4-37

Table 4-38

Table 4-39

Table 4-40

[0288] Example 2. In vivo screening In vivo screening was performed using 12-week-old hSNCA transgenic mice. Briefly, PBS or bivalent siRNA was administered via bilateral stereotaxic ICV injection at a dose of 1 nmol or 5 nmol in a total volume of 5 μL. One week after compound administration, animals were euthanized, perfused, and brains were cut into 1 mm-thick cerebral cortical slices. Biopsy punches (1–2 mm diameter) were taken from the relevant brain regions (striatum = Cpu, hippocampus = HP, temporal cortex = tCTx) and snap-frozen. Tissue punches were homogenized in Trizol (Invitrogen) using a Qiagen TissueLyser, and total RNA was isolated using an RNeasy kit (Qiagen). Quantitative reverse transcriptase polymerase chain reaction (QRT-PCR) was performed to assess target (human SNCA) gene expression relative to housekeeping (mouse ATP5B) gene expression using TaqMan primers / probes and Fast Advanced Master Mix (Thermo). Data are presented as % SNCA target knockdown compared to PBS-treated control animals (N = 8 animals, 4 males, 4 females, 2 technical replicates each), with 100% representing complete target knockdown and 0% indicating no target knockdown. [Table 5-1] [Table 5-2] [Table 5-3]

[0289] Example 3. In vivo inhibition of SNCA gene expression in mice using di-siRNA sequences the purpose This example describes the results of a series of experiments conducted to examine the ability of siRNA molecules complementary to specific regions within the human SNCA transcript to result in down-regulation of the SNCA gene.

[0290] In vivo administration of di-siRNA The siRNA molecule of the present disclosure was synthesized as a biantennary siRNA molecule having the structure of formula XVII.The sense strand had the sequence of SEQ ID NO: 664, and had a chemical modification pattern with the general structure of formula III and the specific structure of formula S1.The antisense strand had the sequence of SEQ ID NO: 244, and had a chemical modification pattern with the general structure of formula II and the specific structure of formula A2.The antisense strand further contained a 5' vinyl phosphonate moiety of formula XI.

[0291] In vivo persistence was assessed in mice using a method similar to that described in Example 2. Briefly, PBS or the biantennary siRNA molecules described above were administered via bilateral stereotactic intracerebroventricular (ICV) injection at a dose of 30 nmol in a total volume of 10 μL.

[0292] After 1, 2, 3, or 4 months of compound administration, animals were euthanized, perfused, and brains were cut into 1-mm-thick cortical slices. Biopsy punches (1–2 mm diameter) were taken from relevant brain regions (frontal cortex = fCTx, striatum = Cpu, hippocampus = HP, temporal cortex = tCTx, midbrain = Mb, pons = Pons, medulla oblongata = Med, cerebellum = CB, cervical spinal cord = SC-C, thoracic spinal cord = SC-T, and lumbar spinal cord = SC-L) and snap-frozen.

[0293] RNA quantitative analysis mRNA quantification was performed as described in Example 2. Comparative analysis of SNCA mRNA quantification relative to samples collected from time-matched PBS control mice was performed, and the results are shown in Figures 1 and 2.

[0294] Protein expression analysis Human α-synuclein protein knockdown was quantified by colorimetric sandwich ELISA (Invitrogen KHB0061). Biological samples were lysed using tissue lysis buffer (CST Cell Lysis Buffer #9803) and bead beater homogenization in a Qiagen Tissuelyser II. ELISA was performed using the tissue lysates according to the manufacturer's instructions. ELISA uses an immunoassay plate coated with a target-specific antibody that binds to the analyte, which then binds to the capture antibody. An HRP-conjugated secondary detection antibody is used in combination with a substrate to generate a measurable signal, which is read using a colorimetric plate reader. Data are presented as % SNCA target knockdown (N = 8 animals, 4 males, 4 females, 2 technical replicates each), and each siRNA-treated group is normalized to time-matched PBS control animals. Results are shown in Figures 3 and 4.

[0295] Statistical evaluation Statistical analysis was performed using a two-tailed Mann-Whitney test. ****=p<0.0001, ***=p<0.001, **=p<0.01, *=p<0.05. BQL=value below the limit of quantitation but above the limit of detection in the ELISA; values ​​are included in the graph.

[0296] conclusion The results of this example demonstrate that an siRNA molecule of the present disclosure having a sense strand with SEQ ID NO: 664 and an antisense strand with SEQ ID NO: 244 was able to reduce SNCA expression in vivo.

[0297] Example 4: Dose response of SNCA knockdown in vivo the purpose This example describes the results of a series of experiments conducted to determine the in vivo dose response of siRNA molecules complementary to specific regions within the SNCA transcript to reduce expression of the SNCA gene.

[0298] Materials and Methods In vivo dose response was assessed in mice using a method similar to that described in Example 3. Briefly, PBS or the biantennary siRNA molecules described in Example 3 were administered via bilateral stereotactic ICV injection at doses of 2.5 nmol, 5 nmol, 10 nmol, 15 nmol, or 20 nmol in a total volume of 10 μL. Three months after compound administration, animals were euthanized, and tissue harvesting, mRNA quantification (human and mouse SNCA), and protein quantification (human SNCA) were performed as described in Examples 2 and 3.

[0299] result Statistical analysis was performed by two-way analysis of variance with Dunnett's multiple comparison test. ****=p<0.0001, ***=p<0.001, **=p<0.01, *=p<0.05. The results are shown in Figures 5, 6, and 7.

[0300] conclusion The results reported in this example demonstrate that the siRNA molecules of the present disclosure are capable of silencing SNCA in a dose-dependent manner in various regions of the brain.

Claims

1. 1. A small interfering RNA (siRNA) molecule comprising an antisense strand and a sense strand having complementarity to the antisense strand, wherein the antisense strand is 10 to 30 nucleotides in length and has sufficient complementarity to hybridize to a region within an alpha synuclein (SNCA) mRNA transcript having a nucleic acid sequence of any one of SEQ ID NOs: 421-840, and wherein the antisense strand has a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence of SEQ ID NOs: 1-420.

2. 2. The siRNA molecule of claim 1, wherein the antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 consecutive nucleotides that are completely complementary to a contiguous polynucleotide segment of equal length within the region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

3. 3. The siRNA molecule of claim 1, wherein the antisense strand comprises 15 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within said region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840, and optionally, the antisense strand comprises 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within said region of the SNCA mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 421-840.

4. The siRNA molecule of any one of claims 1 to 3, wherein the antisense strand contains no more than three nucleotide mismatches to a region of 21 contiguous nucleobases of the SNCA mRNA transcript having a nucleic acid sequence of any one of SEQ ID NOs: 421 to 840.

5. 5. The siRNA molecule of any one of claims 1 to 4, wherein the region of the SNCA mRNA transcript has the nucleic acid sequence of any one of SEQ ID NOs: 459, 535, 551, 599, 631, 663, 664, 666, 667, 671, 748, 750, 751, 752, 760, 762, and 777.

6. 6. The siRNA molecule of claim 5, wherein the region of the SNCA mRNA transcript has the nucleic acid sequence of any one of SEQ ID NOs: 535, 599, 664, 666, 671, 750, 752, 760, and 762.

7. The siRNA molecule of any one of claims 1 to 6, wherein the antisense strand has a nucleic acid sequence that is at least 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1 to 420.

8. 8. The siRNA molecule of any one of claims 1 to 7, wherein the sense strand has a nucleic acid sequence that is at least 95% identical to a nucleic acid sequence of SEQ ID NOs: 421-840, and optionally the sense strand has a nucleic acid sequence that is at least 96%, 97%, 98%, 99%, or 100% identical to a nucleic acid sequence of any one of SEQ ID NOs: 421-840.

9. 9. The siRNA molecule of any one of claims 1 to 8, wherein the antisense strand comprises: (a) A structure represented by Formula I, wherein Formula I is, in the 5' to 3' direction: A-B-(A’) j -C-P 2 -D-P 1 -(C’-P 1 ) k -C’ Formula I; wherein A is a compound of the formula C-P 1 -D-P 1 It is represented by; Each A' is of the formula C-P 2 -D-P 2 It is represented by; B is a compound of the formula C-P 2 -D-P 2 -D-P 2 -D-P 2 It is represented by; each C is a 2'-O-methyl (2'-O-Me) ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-fluoro (2'-F) ribonucleoside; each D is a 2'-F ribonucleoside; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; k is an integer from 1 to 7, Optionally, the antisense strand comprises a structure represented by Formula A1, wherein Formula A1 is in the 5' to 3' direction: A-S-B-SA Formula A1; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; (b) a structure represented by formula II, wherein formula II is, in the 5' to 3' direction: A-B-(A’) j -C-P 2 -D-P 1 -(C-P 1 ) k -C’ Formula II; wherein A is a compound of the formula C-P 1 -D-P 1 It is represented by; Each A' is of the formula C-P 2 -D-P 2 It is represented by; B is a compound of the formula C-P 2 -D-P 2 -D-P 2 -D-P 2 It is represented by; each C is a 2'-O-methyl (2'-O-Me) ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-fluoro (2'-F) ribonucleoside; each D is a 2'-F ribonucleoside; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; k is an integer from 1 to 7, Optionally, the antisense strand comprises a structure represented by Formula A2, wherein Formula A2 is in the 5' to 3' direction: A-S-B-SA Formula A2; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; (c) A structure represented by formula IV, wherein formula IV is, in the 5' to 3' direction: A-(A’) j -C-P 2 -B-(C-P 1 ) k -C’ Formula IV; wherein A is a compound of the formula C-P 1 -D-P 1 It is represented by; Each A' is of the formula C-P 2 -D-P 2 It is represented by; B is a compound of the formula D-P 1 -C-P 1 -D-P 1 It is represented by; each C is a 2'-O-Me ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-F ribonucleoside; each D is a 2'-F ribonucleoside; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; k is an integer from 1 to 7, Optionally, the antisense strand comprises a structure represented by Formula A3, wherein Formula A3 is, in the 5' to 3' direction: A-S-B-S-A-O-B-O-A-O-B-O-A-O-BO-A-O-B-O-A-O-BO-O-A-O-B-O-A-O-B-S-A-S-B-S-A-S-A Formula A3; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; or (d) A structure represented by formula VI, wherein formula VI is, in the 5' to 3' direction: A-B j -E-B k -E-F-G l -D-P 1 -C’ Formula VI; wherein A is a compound of the formula C-P 1 -D-P 1 It is represented by; Each B is of the formula C-P 2 It is represented by; each C is a 2'-O-Me ribonucleoside; each C' is independently a 2'-O-Me ribonucleoside or a 2'-F ribonucleoside; each D is a 2'-F ribonucleoside; Each E is of the formula D-P 2 -C-P 2 It is represented by; F is a compound of the formula D-P 1 -C-P 1 It is represented by; Each G is of the formula C-P 1 It is represented by; Each P 1 is a phosphorothioate internucleoside linkage; Each P 2 is a phosphodiester internucleoside linkage; j is an integer from 1 to 7; k is an integer from 1 to 7; l is an integer from 1 to 7; Optionally, the antisense strand comprises a structure represented by Formula A4, wherein Formula A4 is in the 5' to 3' direction: A-S-B-S-A-O-A-O-A-O-BO-A-O-A-O-A-O-A-O-A-O-A-O-A-O-B-O-A-O-B-S-A-S-A-S-A-S-B-S-A Formula A4; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

10. 10. The siRNA molecule of any one of claims 1 to 9, wherein the sense strand comprises: (a) A structure represented by formula III, wherein formula III is, in the 5' to 3' direction: E-(A') m -F Formula III; In the formula, E is a group represented by the formula (C-P 1 ) 2 It is represented by; F is represented by the formula (C-P 2 ), 3 -D-P 1 -C-P 1 -C, (C-P 2 ), 3 -D-P[[ID=一三]] 2 -C-P 2 -C, (C-P 2 ), 3 -D-P 1 -C-P 1 -D, or (C-P 2 ), 3 -D-P 2 -C-P 2 -D; A', C, D, P 1 , and P 2 is as defined in formula II; m is an integer from 1 to 7, Optionally, (i) the sense strand comprises a structure represented by formula S1, wherein formula S1 is as follows in the 5' to 3' direction: A-S-A-S-A-O-B-O-A-O-BO-A-O-BO-A-O-BO-O-A-O-A-O-A-O-B-S-A-S-A Formula S1; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; (ii) the sense strand comprises a structure represented by formula S2, and formula S2 is as follows in the 5' to 3' direction: A-S-A-S-A-O-BO-O-A-O-BO-A-O-BO-A-O-BO-O-A-O-A-O-A-O-BO-O-A-O-A Formula S2; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; (iii) the sense strand comprises a structure represented by formula S3, and formula S3 is as follows in the 5' to 3' direction: A-S-A-S-A-O-B-O-A-O-BO-A-O-BO-A-O-BO-O-A-O-A-O-A-O-B-S-A-S-B Formula S3; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; or (iv) the sense strand comprises a structure represented by formula S4, wherein formula S4 is as follows in the 5' to 3' direction: A-S-A-S-A-O-BO-O-A-O-BO-A-O-BO-A-O-BO-O-A-O-A-O-A-O-BO-O-A-O-B Formula S4; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; (b) a structure represented by formula V, wherein formula V is, in the 5' to 3' direction: E-(A’) m -C-P 2 -F Formula V; In the formula, E is a group represented by the formula (C-P 1 ) 2 It is represented by; F is represented by the formula D - P 1 -C - P 1 -C, D - P 2 -C - P 2 -C, D - P 1 -C - P 1 -D, or D - P 2 -C - P 2 -D; A', C, D, P 1 , and P 2 is as defined in formula IV; m is an integer from 1 to 7, Optionally, (i) the sense strand comprises a structure represented by formula S5, and formula S5 is as follows in the 5' to 3' direction: A-S-A-S-A-O-B-O-A-O-BO-A-O-BO-A-O-BO-O-A-O-B-O-A-O-B-S-A-S-A Formula S5; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; (ii) the sense strand comprises a structure represented by formula S6, and formula S6 is as follows in the 5' to 3' direction: A-S-A-S-A-O-BO-O-A-O-BO-A-O-BO-A-O-BO-O-A-O-BO-O-A-O-B-O-A-O-A Formula S6; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; (iii) the sense strand comprises a structure represented by formula S7, and formula S7 is as follows in the 5' to 3' direction: A-S-A-S-A-O-B-O-A-O-BO-A-O-BO-A-O-BO-O-A-O-B-O-A-O-B-S-A-S-B Formula S7; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; or (iv) the sense strand comprises a structure represented by formula S8, wherein formula S8 is, in the 5' to 3' direction, as follows: A-S-A-S-A-O-B-O-A-O-B-O-A-O-BO-A-O-BO-O-A-O-B-O-A-O-B-O-A-O-B Formula S8; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage; or (c) A structure represented by formula VII, which in the 5' to 3' direction is: H-B m -I n -A’-B o -H-C Formula VII; wherein A' is a compound of the formula C-P 2 -D-P 2 It is represented by; Each H is a member of the formula (C-P 1 ) 2 It is represented by; Each I is a function of the formula (D-P 2 ) is represented by; B, C, D, P 1 , and P 2 is as defined in formula VI; m is an integer from 1 to 7; n is an integer from 1 to 7; o is an integer from 1 to 7; Optionally, the sense strand comprises a structure represented by formula S9, where formula S9 is in the 5' to 3' direction: A-S-A-S-A-O-A-O-A-O-BO-BO-O-BO-A-O-BO-O-A-O-A-O-A-O-A-S-A-S-A Formula S9; wherein A represents a 2'-O-Me ribonucleoside, B represents a 2'-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.

11. The siRNA molecule of any one of claims 1 to 10, wherein the antisense strand further comprises a 5' phosphorus stabilizing moiety at the 5' end of the antisense strand and / or the sense strand further comprises a 5' phosphorus stabilizing moiety at the 5' end of the sense strand.

12. each 5' phosphorus stabilizing moiety is independently represented by any one of formulas IX-XVI: 【Chemical 1】 12. The siRNA molecule of claim 11, wherein Nuc represents a nucleobase selected from the group consisting of adenine, uracil, guanine, thymine, and cytosine, and R represents optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, phenyl, benzyl, hydroxy, or hydrogen.

13. The siRNA molecule of any one of claims 1 to 12, wherein the siRNA molecule is a branched siRNA molecule.

14. the branched siRNA molecule is a biantennary siRNA molecule, optionally the biantennary siRNA molecule is represented by any one of formulas XVII to XIX: 【Chemistry 2】 wherein each RNA is independently an siRNA molecule, L is a linker, and each X independently represents a branch point moiety.

15. 1. An siRNA molecule comprising: (I) a) a sense strand comprising the sequence (mU)#(mA)#(mC)(fC)(mA)(fC)(mU)(fU)(mA)(fU)(mU)(mC)(fU)#(mA)#(mA)-DIO (SEQ ID NO: 841), and an antisense strand comprising the sequence V(mU)#(fU)#(mA)(fG)(fA)(fA)(mA)(fU)(mA)(fA)(mG)(fU)(mG)(fG)(mU)(fA)#(mG)#(mU)#(mC)#(mA)#(mC) (SEQ ID NO: 842); b) a sense strand comprising the sequence (mC)#(mA)#(mA)(fG)(mU)(fG)(mC)(fU)(mC)(fA)(mG)(mU)(mU)(fC)#(mC)#(mA)-DIO (SEQ ID NO: 843), and an antisense strand comprising the sequence V(mU)#(fG)#(mG)(fA)(fA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)(mU)(fG)#(mU)#(mA)#(mC)#(mA)#(mG) (SEQ ID NO: 844); c) a sense strand comprising the sequence (mA)#(mG)#(mU)(fG)(mG)(fU)(mG)(fC)(mA)(fU)(mG)(mG)(mU)(fG)#(mU)#(mA)-DIO (SEQ ID NO: 845), and an antisense strand comprising the sequence V(mU)#(fA)#(mC)(fA)(fC)(fC)(mA)(fU)(mG)(fC)(mA)(fC)(fA)(mC)(fU)#(mC)#(mC)#(mC)#(mU)#(mC) (SEQ ID NO: 846); d) a sense strand comprising the sequence (mC)#(mA)#(mA)(fU)(mG)(fA)(mG)(fG)(mC)(fU)(mU)(mA)(mU)(fG)#(mA)#(mA)-DIO (SEQ ID NO: 847), and an antisense strand comprising the sequence V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 848); e) a sense strand comprising the sequence (mU)#(mC)#(mA)(fG)(mU)(fU)(mC)(fC)(mA)(fA)(mU)(mG)(mU)(fG)#(mC)#(mA)-DIO (SEQ ID NO: 849), and an antisense strand comprising the sequence V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 850); f) a sense strand comprising the sequence (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 851), and an antisense strand comprising the sequence V(mU)#(fG)#(mC)(fA)(fC)(fA)(mU)(fU)(mG)(fG)(mA)(fA)(mC)(fU)(mG)(fA)#(mG)#(mC)#(mA)#(mC)#(mU) (SEQ ID NO: 852); or g) a sense strand comprising the sequence (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 853), and an antisense strand comprising the sequence V(mU)#(fG)#(mU)(fU)(fU)(fU)(mA)(fA)(mC)(fA)(mU)(fC)(mG)(fU)(mA)(fG)#(mA)#(mU)#(mU)#(mG)#(mA) (SEQ ID NO: 854); wherein m represents a 2'-O-Me ribonucleoside, f represents a 2'-F ribonucleoside, # represents a phosphorothioate internucleoside linkage, -DIO represents a divalent oligonucleotide (DIO) linker, V represents a vinyl phosphonate, or (II) a) a sense strand comprising the sequence (mU)#(mA)#(mC)(fC)(mA)(fC)(mU)(fU)(mA)(fU)(mU)(mC)(fU)#(mA)#(mA)-DIO (SEQ ID NO: 841), and an antisense strand comprising the sequence V(mU)#(fU)#(mA)(fG)(fA)(fA)(mA)(fU)(mA)(fA)(mG)(fU)(mG)(fG)(mU)(fA)#(mG)#(mU)#(mC)#(mA)#(mC) (SEQ ID NO: 842); b) a sense strand comprising the sequence (mC)#(mA)#(mA)(fG)(mU)(fG)(mC)(fU)(mC)(fA)(mG)(mU)(mU)(fC)#(mC)#(mA)-DIO (SEQ ID NO: 843), and an antisense strand comprising the sequence V(mU)#(fG)#(mG)(fA)(fA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)(mU)(fG)#(mU)#(mA)#(mC)#(mA)#(mG) (SEQ ID NO: 844); c) a sense strand comprising the sequence (mA)#(mG)#(mU)(fG)(mG)(fU)(mG)(fC)(mA)(fU)(mG)(mG)(mU)(fG)#(mU)#(mA)-DIO (SEQ ID NO: 845), and an antisense strand comprising the sequence V(mU)#(fA)#(mC)(fA)(fC)(fC)(mA)(fU)(mG)(fC)(mA)(fC)(fA)(mC)(fU)#(mC)#(mC)#(mC)#(mU)#(mC) (SEQ ID NO: 846); d) a sense strand comprising the sequence (mC)#(mA)#(mA)(fU)(mG)(fA)(mG)(fG)(mC)(fU)(mU)(mA)(mU)(fG)#(mA)#(mA)-DIO (SEQ ID NO: 847), and an antisense strand comprising the sequence V(mU)#(fU)#(mC)(fA)(fU)(fA)(mA)(fG)(mC)(fC)(mU)(fC)(mA)(fU)(mU)(fG)#(mU)#(mC)#(mA)#(mG)#(mG) (SEQ ID NO: 855); e) a sense strand comprising the sequence (mA)#(mG)#(mU)(fG)(mC)(fU)(mC)(fA)(mG)(fU)(mU)(mC)(mC)(fA)#(mA)#(mA)-DIO (SEQ ID NO: 856), and an antisense strand comprising the sequence V(mU)#(fU)#(mU)(fG)(fG)(fA)(mA)(fC)(mU)(fG)(mA)(fG)(mC)(fA)(mC)(fU)#(mU)#(mG)#(mU)#(mA)#(mC) (SEQ ID NO: 850); f) a sense strand comprising the sequence (mU)#(mC)#(mA)(fG)(mU)(fU)(mC)(fC)(mA)(fA)(mU)(mG)(mU)(fG)#(mC)#(mA)-DIO (SEQ ID NO: 857), and an antisense strand comprising the sequence V(mU)#(fG)#(mC)(fA)(fC)(fA)(mU)(fU)(mG)(fG)(mA)(fA)(mC)(fU)(mG)(fA)#(mG)#(mC)#(mA)#(mC)#(mU) (SEQ ID NO: 852); or g) a sense strand comprising the sequence (mC)#(mU)#(mA)(fC)(mG)(fA)(mU)(fG)(mU)(fU)(mA)(mA)(mA)(fA)#(mC)#(mA)-DIO (SEQ ID NO: 853), and an antisense strand comprising the sequence V(mU)#(fG)#(mU)(fU)(fU)(fU)(mA)(fA)(mC)(fA)(mU)(fC)(mG)(fU)(mA)(fG)#(mA)#(mU)#(mU)#(mG)#(mA) (SEQ ID NO: 854); where m represents a 2'-O-Me ribonucleoside, f represents a 2'-F ribonucleoside, # represents a phosphorothioate internucleoside linkage, -DIO represents a divalent oligonucleotide (DIO) linker, and V represents a vinyl phosphonate.

16. A pharmaceutical composition comprising the siRNA molecule of any one of claims 1 to 15 and a pharmaceutically acceptable excipient, carrier, or diluent.

17. 17. A method of treating synucleinopathy in a human subject in need thereof, comprising administering to the subject a therapeutically effective amount of the siRNA molecule of any one of claims 1 to 15 or the pharmaceutical composition of claim 16.

18. 18. The method of claim 17, wherein the synucleinopathy is Parkinson's disease, Alzheimer's disease, dementia with Lewy bodies, or multipathological atrophy.

19. The method of claim 17 or 18, wherein the siRNA molecule or the pharmaceutical composition is administered to the subject by intracerebroventricular, intrastriatal, intraparenchymal, or intrathecal injection.

20. A kit comprising the siRNA molecule of any one of claims 1 to 15 or the pharmaceutical composition of claim 16, and a package insert, the package insert instructing a user of the kit to carry out the method of any one of claims 17 to 19.