Polynucleic acid molecules, pharmaceutical compositions and their uses for inhibiting the expression of FXI - Patent Application 20070122999

Polynucleic acid molecules targeting the FXI gene with modified nucleotides and receptor targeting moieties provide effective thrombosis prevention by regulating FXI expression, addressing the need for non-cytotoxic inhibitors.

JP2025532077APending Publication Date: 2025-09-29シリウスセラピューティクスインク
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025516962
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-09-26
Filing Date
2023-09-25
Publication Date
2025-09-29

AI Technical Summary

Technical Problem

There is a need for effective, non-cytotoxic inhibitors of coagulation factor XI (FXI) to prevent thrombosis without causing severe bleeding.

Method used

Polynucleic acid molecules, including double-stranded sequences with modified nucleotides and conjugates targeting the FXI gene, are developed to regulate FXI expression, utilizing specific nucleic acid sequences and asialoglycoprotein receptor targeting moieties for targeted delivery.

Benefits of technology

The polynucleic acid molecules effectively inhibit FXI expression, reducing thrombosis risk while minimizing bleeding risks, as demonstrated in vitro and in vivo.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025532077000001_ABST
    Figure 2025532077000001_ABST
Patent Text Reader

Abstract

Disclosed herein are polynucleic acid molecules, pharmaceutical compositions, and methods for inhibiting the expression of the coagulation factor XI (FXI) gene.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 410,084, filed September 26, 2022, which is incorporated herein by reference in its entirety. [Background technology]

[0002] The discovery of RNA interference (RNAi) as a cellular mechanism for selectively degrading mRNA allows for both the targeted manipulation of cell phenotype in cell culture and the potential for the development of directed therapeutics (Behlke, 2006, Mol. Ther. 13, pp. 644-670; Xie et al., 2006, Drug Discov. Today 11, pp. 67-73).

[0003] Thrombosis is the formation of a blood clot, known as a thrombus, within a blood vessel. This prevents the normal flow of blood through the circulatory system and can lead to death. Coagulation factor XI (FXI or F11) is a protein encoded by the FXI gene. FXI plays a key role in the coagulation cascade and is produced primarily by cells in the liver. Therefore, there is a need to develop effective FXI inhibitors that are non-cytotoxic. The polynucleic acid molecules, their conjugates, and methods described herein fulfill this need and provide related advantages.

[0004] Incorporation by Reference All publications, patents, and patent applications mentioned herein are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent the publications and patents or patent applications incorporated by reference conflict with the disclosure contained herein, the present specification is intended to supersede and / or replace any such conflicting material. Summary of the Invention

[0005] To address the need for more effective FXI inhibitors, one embodiment herein provides a polynucleic acid molecule for regulating expression of the coagulation factor XI (FXI) gene, the polynucleic acid molecule comprising a nucleic acid sequence at least 80%, at least 85%, or at least 90% identical to a nucleic acid sequence in Tables 1-2 and 7-9. In some examples, the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand (passenger strand) and an antisense strand (guide strand). In some examples, the sense strand comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220. In some examples, the antisense strand comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216.

[0006] In some examples, the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 contiguous sequences of a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220, with 1, 2, 3, or no more than 4 mismatches. In some examples, the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous sequences of a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216, with 1, 2, 3, or no more than 4 mismatches. In some examples, the sense strand comprises the nucleic acid sequence of SEQ ID NOs: 101-150 and 220, and the antisense strand comprises the nucleic acid sequence of SEQ ID NOs: 1-50 and 215-216. In some examples, the sense strand comprises a nucleic acid sequence at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220. In some examples, the antisense strand comprises a nucleic acid sequence at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216. In some examples, the sense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, and the antisense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216.

[0007] In some examples, the antisense strand comprises 5'-nNfnnnNfNfNfnnnnNfnNfnnnnnn-3', 5'-nNfnnnNfnnnnnnnNfnNfnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnn-3', or 5'-nNfnnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide. In some examples, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3', or 5'-nnnnnnNfnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', where "Nf" represents a 2'-fluoro-modified nucleotide, "n" represents a 2'-O-methyl-modified nucleotide, and "invdN" represents an inverted deoxynucleotide. In some examples, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', where "Nf" represents a 2'-fluoro-modified nucleotide, and "n" represents a 2'-O-methyl-modified nucleotide. In some examples, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0008] In some examples, the polynucleic acid molecule comprises a modified internucleotide linkage, optionally a phosphorothioate internucleotide linkage. In some examples, the modified internucleotide linkage comprises a stereochemically enriched phosphorothioate internucleotide linkage. In some examples, the modified internucleotide linkage is an SP chiral phosphorothioate internucleotide linkage. In some examples, the polynucleic acid molecule comprises a plurality of modified internucleotide linkages, and at least 1, 2, 3, or 4 of the plurality of modified internucleotide linkages are stereochemically enriched phosphorothioate internucleotide linkages. In some examples, the stereochemically enriched phosphorothioate internucleotide linkages comprise both R and S isomers. In some examples, the stereochemically enriched phosphorothioate is positioned between two consecutive nucleosides that are two of the six 5'- or 3'-terminal nucleosides of the sense strand or the antisense strand.

[0009] In some examples, the polynucleic acid molecule comprises a hypoxanthine nucleobase-containing nucleoside substitution.In some examples, the hypoxanthine nucleobase-containing nucleoside substitution is an inosine substitution, and optionally, the inosine substitution comprises 2'-O-methylinosine-3'-phosphate.In some examples, the inosine substitution is located within the seed region of the antisense strand.In some examples, the inosine substitution is located within 7 nucleotides from the 5' end of the antisense strand, and optionally, the inosine substitution is located within the first nucleotide from the 5' end of the antisense strand.

[0010] In some examples, the first nucleotide from the 5' end of the antisense strand is substituted with uridine or adenosine, optionally wherein the uridine comprises 2'-O-methyluridine-3'-phosphate, or optionally wherein the adenosine comprises 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0011] In some examples, the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 151-200, 214, and 221. In some examples, the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 51-100, 201-213, and 217-219. In some examples, the sense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 151-200, 214, and 221, and the antisense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 51-100, 201-213, and 217-219.

[0012] In another aspect, the present disclosure provides a polynucleic acid molecule for regulating expression of coagulation factor XI (FXI) gene, comprising: (a) an antisense strand comprising the nucleotide sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, and a sense strand comprising the nucleotide sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220; or (b) antisense strands containing the nucleotide sequences of SEQ ID NOs: 54, 56-57, 59-61, 63-64, 85, 100, 201-213, and 217-219, and sense strands containing the nucleotide sequences of SEQ ID NOs: 154, 156-157, 159-161, 163-164, 185, 200, 214, and 221 The polynucleic acid molecule comprises:

[0013] In some instances, the polynucleic acid molecule is (a) an antisense strand comprising the nucleotide sequence AUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 11), and a sense strand comprising the nucleotide sequence GCUUGCAACAAAGACAUUUAU (SEQ ID NO: 111); (b) an antisense strand comprising the nucleotide sequence AUGUCUUUGUUGCAAGCGCUUAU (SEQ ID NO: 9), and a sense strand comprising the nucleotide sequence AAGCGCUUGCAACAAAGACAU (SEQ ID NO: 109); (c) an antisense strand comprising the nucleotide sequence AAUGUCUUUGUUGCAAGCGCUUA (SEQ ID NO: 10), and a sense strand comprising the nucleotide sequence AGCGCUUGCAACAAAGACAUU (SEQ ID NO: 110); (d) an antisense strand comprising the nucleotide sequence UUAUAGUUUAUGCCCUUCAUGUC (SEQ ID NO: 13), and a sense strand comprising the nucleotide sequence CAUGAAGGGCAUAAACUAUAA (SEQ ID NO: 113); (e) an antisense strand comprising the nucleotide sequence AUAGGUAAAAAACUGGCAGCGGA (SEQ ID NO: 35), and a sense strand comprising the nucleotide sequence CGCUGCCAGUUUUUUACCUAU (SEQ ID NO: 135); (f) an antisense strand comprising the nucleotide sequence IUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 215) and a sense strand comprising the nucleotide sequence GCUUGCAACAAAGACAUUUAU (SEQ ID NO: 111); or (g) an antisense strand comprising the nucleotide sequence of UUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 216), and a sense strand comprising the nucleotide sequence of GCUUGCAACAAAGACAUUUAA (SEQ ID NO: 220); Includes.

[0014] In another aspect, the present disclosure provides a polynucleic acid molecule for regulating expression of coagulation factor XI (FXI) gene, comprising: (a) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 61), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (b) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcsaagcsgsc (SEQ ID NO: 211), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (c) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfsuGfcaagcsgsc (SEQ ID NO: 212), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (d) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaasgcsgsc (SEQ ID NO: 213), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (e) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 61), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau(invdT)(invdT) (SEQ ID NO: 214); (f) an antisense strand comprising the nucleotide sequence of asUfsgucuUfuguuGfcAfaGfcgcuusasu (SEQ ID NO: 204), and a sense strand comprising the nucleotide sequence of asasgcgcUfuGfcAfacaaagacau (SEQ ID NO: 159); (g) an antisense strand comprising the nucleotide sequence of asAfsugucUfuuguUfgCfaAfgcgcususa (SEQ ID NO: 205), and a sense strand comprising the nucleotide sequence of asgscgcuUfgCfaAfcaaagacauu (SEQ ID NO: 160); (h) an antisense strand comprising the nucleotide sequence of asUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 206), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (i) an antisense strand comprising the nucleotide sequence of usUfsauagUfuuauGfcCfcUfucaugsusc (SEQ ID NO: 207), and a sense strand comprising the nucleotide sequence of csasugaaGfgGfcAfuaaacuauaa (SEQ ID NO: 163); (j) an antisense strand comprising the nucleotide sequence of asUfsagguAfaaaaAfcUfgGfcagcgsgsa (SEQ ID NO: 209), and a sense strand comprising the nucleotide sequence of csgscugcCfaGfuUfuuuuaccuau (SEQ ID NO: 185); (k) an antisense strand comprising the nucleotide sequence of isUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 217), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (l) an antisense strand comprising the nucleotide sequence of usUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 218), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuaa (SEQ ID NO: 222); or (m) an antisense strand comprising the nucleotide sequence of a4sUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 219), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, and "C "f" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, and "U" refers to , uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, and "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate. "dT" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0015] In another aspect, the present disclosure includes a polynucleic acid molecule conjugate for regulating expression of the coagulation factor XI (FXI) gene, the polynucleic acid molecule conjugate comprising a polynucleic acid molecule disclosed herein and an asialoglycoprotein receptor targeting moiety.

[0016] In some examples, the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are linked via a linker. In some examples, the linker has the following formula (IV):

[0017] [ka] wherein at least one of Y1 and Y2 is a nucleotide in a polynucleic acid molecule. In some examples, Y1 is the last nucleotide on the 3'-end of the sense strand of the polynucleic acid molecule, or Y2 is the first nucleotide on the 5'-end of the sense strand of the polynucleic acid molecule. In some examples, Y1 and Y2 are two consecutive nucleotides in a polynucleic acid molecule.

[0018] In some examples, the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose.

[0019] In some instances, the linker and the asialoglycoprotein receptor targeting moiety, together with the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule,

[0020] [ka]

[0021] [ka] As shown in wherein Z in formula (V'), (V''"), (V'''"), or (V''''") is -H, -OH, -O-methyl, -F, or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or the like.

[0022] In another aspect, the present disclosure includes a pharmaceutical composition comprising a polynucleic acid molecule disclosed herein or a polynucleic acid molecule conjugate described herein and a pharmaceutically acceptable excipient.

[0023] In another aspect, the present disclosure includes a method for regulating mRNA expression of the coagulation factor XI (FXI) gene in a subject, the method comprising regulating mRNA expression of the FXI gene in the subject by administering to the subject a polynucleic acid molecule disclosed herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein.

[0024] In another aspect, the present disclosure includes a method for regulating FXI or FXIa protein levels or FXI or FXIa activity in a subject in need thereof, the method comprising regulating FXI or FXIa protein levels or FXI or FXIa activity in the subject by administering to the subject a polynucleic acid molecule disclosed herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein. In some examples, the subject in need thereof has been diagnosed with or is suffering from thrombosis or a symptom thereof. [Brief explanation of the drawings]

[0025] Various aspects of the present disclosure are set forth with particularity in the appended claims. The features and advantages of the present disclosure will be better understood by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings, in which:

[0026] [Figure 1] Figure 1 shows the in vitro efficacy of siRNAs targeting FXI, SRS-000579 to SRS-000602, in primary human hepatocytes. Each siRNA was tested at three concentrations: 100 nM, 30 nM, and 10 nM. The three bars for each siRNA in the bar graph represent the average percentage of inhibition at 100 nM, 30 nM, and 10 nM, respectively, from left to right. Three replicates were performed for each siRNA dose level. Error bars represent standard deviation. [Figure 2]Figure 1 shows the in vitro efficacy of siRNAs targeting FXI, SRS-000603 to SRS-000628, in primary human hepatocytes. Each siRNA was tested at three concentrations: 100 nM, 30 nM, and 10 nM. The three bars for each siRNA in the bar graph represent the average percentage of inhibition at 100 nM, 30 nM, and 10 nM, respectively, from left to right. Three replicates were performed for each siRNA dose level. Error bars represent standard deviation. [Figure 3]

[0023] Figure 1 shows the in vivo efficacy of SRS-000007 siRNA targeting FXI or saline control in cynomolgus monkeys. SRS-000007 was tested at two dose levels, 1 mg / kg and 5 mg / kg, by single subcutaneous injection. Results are shown as the % change in plasma FXI protein compared to pre-dose baseline. [Figure 4] FIG. 1 shows dose-response curves for SRS-000007 in three different donor lots of primary human hepatocytes. [Figure 5] FIG. 1 shows the % change in plasma FXI circulating protein levels compared to pre-dose baseline in cynomolgus monkeys treated with the siRNAs shown in Table 7. [Figure 6] FIG. 1 shows the % change in plasma FXI circulating protein levels compared to pre-dose baseline in cynomolgus monkeys treated with the siRNAs shown in Table 8. [Figure 7] FIG. 1 shows dose-response curves for SRS-000007 and SRS-002331 in two different donor lots of primary human hepatocytes. DETAILED DESCRIPTION OF THE INVENTION

[0027] The FXI gene is located at the distal end of the long arm of chromosome 4 (4q35.2). The FXI mRNA (NM_000128.4) contains 3053 bp, which is divided into 15 exons (exon 2 is the signal peptide, exons 3-10 are the apple domains, and exons 11-15 are the protease domain) (see, for example, Mohammed et al., Thromb Res. 2018;161:94-105 and NCBI Reference Sequence No: NM_000128.4).

[0028] Factor XI (FXI) is the zymogen of the coagulation protease factor XIa (FXIa) and consists of 625 amino acid residues containing four apple domains (or PAN domains, A1-A4, representing plasminogen-apple-nematode) and a trypsin-like catalytic domain. In some cases, FXI is also known as plasma thromboplastin precursor (PTA). Like other coagulation protease precursors, plasma FXI is primarily synthesized in hepatocytes. In some cases, FXI is also expressed in the islets of Langerhans in the pancreas and in renal tubular cells in the kidney. The FXI subunits can be converted to their active forms by thrombin (e.g., α-thrombin, β-thrombin, γ-thrombin, and meizothrombin) or factor XIIa, respectively. In some cases, FXI can be autoactivated by FXIa in the presence of polyanions. Regardless of protease activation, FXI action requires cleavage of the Arg369-Ile370 bond to yield active FXIa.

[0029] Therefore, targeting FXI can achieve a thrombus-inhibiting effect without causing severe bleeding, and further provides for the prevention or treatment of thrombosis.

[0030] Described herein are polynucleic acid molecules for regulating expression of the FXI gene. In some embodiments, the polynucleic acid molecule is a single-stranded nucleic acid molecule. In some embodiments, the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand. In some embodiments, the polynucleic acid molecule comprises a nucleic acid sequence in Tables 1-2 and 7-9. Accordingly, provided herein are various target regions of human FXI mRNA to which the polynucleic acid molecules described herein hybridize. Optionally, provided herein are sequences of the polynucleic acid molecules described herein. Optionally, provided herein are possible modifications of the polynucleic acid molecules described herein. Optionally, provided herein are possible conjugates of the polynucleic acid molecules described herein.

[0031] Also described herein are methods for modulating FXI mRNA or protein expression in a subject. Also described herein are methods for modulating FXI or FXIa activity levels in a subject in need thereof.

[0032] definition The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all of the following options: "A," "B," "A or B," and "A and B."

[0033] Where a range of values ​​is provided, it is understood that each intervening value, to the nearest tenth of the lower limit, between the upper and lower limits of that range, and any other stated or intervening value in that stated range, is encompassed within the disclosure unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where a stated range includes one or both of its limits, ranges excluding either or both of those included limits are also included in the disclosure, unless the context clearly dictates otherwise.

[0034] Certain ranges are presented herein with numerical values ​​preceded by the term "about." The term "about" is used herein to literally support the exact number preceded by the term, as well as a number that is near or approximately the number preceded by the term. When determining whether a number is near or approximately a specifically recited number, the unrecited near or approximate number may be a number that is substantially equivalent to the specifically recited number in the context in which it is presented.

[0035] "Percent sequence identity" or "percent identity" with respect to the nucleic acid sequences identified herein is defined as the percentage of nucleic acids in a candidate sequence that are identical to the nucleic acid sequence to which it is being compared, after aligning the sequences and taking into account any conservative substitutions as part of the sequence identity.

[0036] All ranges disclosed herein also encompass all possible subranges and combinations of subranges. Any recited range can be recognized as fully descriptive and allowing for the range to be divided into at least 2, 3, 4, 5, 10, etc. divisions. As a non-limiting example, each range discussed herein can be readily divided into a lower third, a middle third, and an upper third, etc. As one of ordinary skill in the art would understand, language such as "up to," "at least," "greater than," and "less than" all refer to ranges that are inclusive of the recited numbers and that can be subsequently divided into the subranges discussed above. Finally, as one of ordinary skill in the art would understand, ranges include each individual member. Thus, for example, a group having 1 to 3 items refers to a group having 1, 2, or 3 items. Similarly, a group having 1 to 5 items refers to a group having 1, 2, 3, 4, or 5, etc. items.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the polynucleic acid molecules, polynucleic acid molecule conjugates, pharmaceutical compositions, methods, and other aspects belong.

[0038] As used herein, the term "complementary" refers to a sufficient degree of complementarity between two nucleic acid molecules to stably and specifically bind so as to avoid non-specific binding.

[0039] As used herein, the terms "polynucleic acid" and "polynucleotide" are used interchangeably to refer to a chain of nucleotides. The term "nucleotide" includes the sequences "G," "C," "A," "T," and "U," and generally refers to nucleotides containing guanine, cytosine, adenine, thymidine, and uracil as bases, respectively. In some instances, "nucleotide" may refer to modified nucleotides (e.g., with modified sugar moieties, modified bases, modified internucleotide linkages, or combinations thereof, including, but not limited to, 2'-modified nucleotides, LNA, ENA, BNA, UNA, GNA, etc.). In some instances, "nucleotide" may refer to modified nucleotides with non-standard bases (e.g., including, but not limited to, 2-thiouridine, 2-thiothymidine, inosine, 2-aminopurine, 2,6-diaminopurine, dihydrouridine, 4-thiouridine, 4-thiothymidine, 2-thiocytidine).

[0040] As used herein, a "subject" can be any mammal, including humans and non-human primates.

[0041] The term "condition" as used herein includes diseases, disorders, and susceptibilities. In some cases, the condition is an FXI-associated disorder or a symptom thereof.

[0042] As used herein, the terms "treat," "treating," or "treatment" with respect to any disease or disorder refer, in one example, to ameliorating the disease or disorder (i.e., slowing, arresting, or reducing the progression of the disease or at least one of its clinical symptoms). In another example, "treat," "treating," or "treatment" refers to alleviating or ameliorating at least one physical parameter, including one that may not be discernible by the patient. In yet another example, "treat," "treating," or "treatment" refers to modulating the disease or disorder physically (e.g., stabilizing a discernible symptom), physiologically (e.g., stabilizing a physical parameter), or both.

[0043] The terms "prevent," "preventing," or "prevention," as used herein, refer to reducing the occurrence of symptoms of a condition in a subject who does not have the disease or condition but is at risk of or suspected of developing it. Prevention can be the complete, e.g., total, absence of symptoms of the condition in the subject. Prevention can also be partial, such that the occurrence of symptoms of the condition in the subject is less than would have occurred without the present disclosure.

[0044] "Administering" and its grammatical equivalents, as used herein, may refer to providing a subject or patient with a pharmaceutical composition described herein. Conventional methods known to those skilled in the pharmaceutical arts can be used to administer the composition to a subject, depending on the type of disease or site of disease being treated. For example, the composition can be administered, for example, orally, parenterally, by inhalation spray, topically, rectally, nasally, bucally, vaginally, via an implanted reservoir, or via injection. One or more such routes can be utilized.

[0045] The term "pharmaceutical composition," and its grammatical equivalents, as used herein, may refer to a mixture or solution containing a therapeutically effective amount of an active pharmaceutical ingredient together with one or more pharmaceutically acceptable excipients, carriers, and / or therapeutic agents to be administered to a subject, e.g., a human being in need thereof.

[0046] The term "pharmaceutically acceptable," and its grammatical equivalents, as used herein, may refer to attributes of a material that is generally safe, non-toxic, biologically or otherwise desirable, and useful in preparing pharmaceutical compositions that are acceptable for animal or human pharmaceutical use. "Pharmaceutically acceptable" refers to a material, such as a carrier or diluent, that does not abolish the biological activity or properties of the compound and is relatively non-toxic, i.e., the material may be administered to a subject without producing undesired biological effects or adversely interacting with any of the components of the pharmaceutical composition in which the compound is included.

[0047] A "pharmaceutically acceptable excipient" refers to an excipient that can be administered to a subject together with a drug, does not destroy its pharmacological activity, and is non-toxic when administered in a dose sufficient to deliver a therapeutic amount of the drug.

[0048] The term "therapeutic agent" may refer to an agent that provides a therapeutic, diagnostic, and / or prophylactic effect and / or induces a desired biological and / or pharmacological effect when administered to a subject. Therapeutic agents may also be referred to as "actives" or "active agents." Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

[0049] Certain features of polynucleic acid molecules and / or polynucleic acid molecule conjugates, pharmaceutical compositions comprising polynucleic acid molecules or polynucleic acid molecule conjugates, methods, and other aspects are described in the context of separate embodiments for clarity, but it is understood that they may also be provided in combination in a single embodiment. Conversely, various features of polynucleic acid molecules and / or polynucleic acid molecule conjugates, pharmaceutical compositions comprising polynucleic acid molecules or polynucleic acid molecule conjugates, methods, and other aspects are described in the context of a single embodiment for brevity, but may also be provided separately or in any suitable subcombination. All combinations of embodiments are specifically encompassed by the present disclosure and are disclosed herein as if each and every combination were individually and explicitly disclosed, to the extent that such combinations encompass viable processes and / or compositions. Furthermore, all subcombinations listed in embodiments describing such variables are also specifically encompassed by the polynucleic acid molecules and / or polynucleic acid molecule conjugates, pharmaceutical compositions comprising polynucleic acid molecules or polynucleic acid molecule conjugates of the present invention, methods, and other aspects, and are disclosed herein as if each and every such subcombination were individually and explicitly disclosed herein.

[0050] As used herein, the term "sense strand" can be used interchangeably with the term "passenger strand," and the term "antisense strand" can be used interchangeably with the term "guide strand."

[0051] As used herein, the term " contiguous sequence " refers to the sequence that contains some contiguous nucleotides from reference sequence.For example, if reference sequence is N1N2N3N4N5N6N7, contiguous sequence can be N1N2N3N4 or N3N4N5N6, but the sequence of N1N3N4N5 or N3N4N7 cannot be contiguous sequence.

[0052] As used herein, the term "negative control" refers to subjects or cells that receive neither treatment nor a placebo.

[0053] Polynucleic acid molecule Target region of the polynucleic acid molecule The present specification describes polynucleic acid molecules for regulating the expression of the FXI gene. In some examples, the polynucleic acid molecule comprises a single-stranded nucleic acid molecule that hybridizes to a specific mRNA region. In some examples, the polynucleic acid molecule is a double-stranded nucleic acid molecule. Also described herein is a polynucleic acid molecule for regulating the expression of the FXI gene, the polynucleic acid molecule being a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand, wherein the antisense strand hybridizes to a specific FXI mRNA region.

[0054] In some embodiments, the polynucleic acid molecules described herein hybridize to a specific region of FXI mRNA. In some examples, the human FXI mRNA is NM_000128.4. In some embodiments, the polynucleic acid molecules described herein hybridize to a specific region of non-human FXI mRNA.

[0055] In some embodiments, the polynucleic acid molecules described herein hybridize to the 5'UTR region of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to the coding region of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 1 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 2 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 3 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 4 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 5 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 6 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 7 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 8 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 9 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 10 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 11 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 12 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 13 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 14 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a portion of exon 15 of human FXI mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to the 3'UTR region of human FXI mRNA.

[0056] In some embodiments, the target site to which the polynucleic acid molecule described herein hybridizes is determined by FXI silencing efficacy and possible off-target effects. In some examples, the start position of the target region is between positions 1-10, 11-20, 21-30, 31-40, 41-50, 51-60, 61-70, 71-80, 81-90, or 91-100 of NM_000128.4. In some examples, the start position of the target region is between positions 101-110, 111-120, 121-130, 131-140, 141-150, 151-160, 161-170, 171-180, 181-190, or 191-200 of NM_000128.4. In some examples, the start position of the target region is between positions 201-210, 211-220, 221-230, 231-240, 241-250, 251-260, 261-270, 271-280, 281-290, or 291-300 of NM_000128.4. In some examples, the start position of the target region is between positions 301-310, 311-320, 321-330, 331-340, 341-350, 351-360, 361-370, 371-380, 381-390, or 391-400 of NM_000128.4. In some examples, the start position of the target region is between positions 401-410, 411-420, 421-430, 431-440, 441-450, 451-460, 461-470, 471-480, 481-490, or 491-500 of NM_000128.4. In some examples, the start position of the target region is between positions 501-510, 511-520, 521-530, 531-540, 541-550, 551-560, 561-570, 571-580, 581-590, or 591-600 of NM_000128.4. In some examples, the start position of the target region is between positions 601-610, 611-620, 621-630, 631-640, 641-650, 651-660, 661-670, 671-680, 681-690, or 691-700 of NM_000128.4.In some examples, the start position of the target region is between positions 701-710, 711-720, 721-730, 731-740, 741-750, 751-760, 761-770, 771-780, 781-790, or 791-800 of NM_000128.4. In some examples, the start position of the target region is between positions 801-810, 811-820, 821-830, 831-840, 841-850, 851-860, 861-870, 871-880, 881-890, or 891-900 of NM_000128.4. In some examples, the start position of the target region is between positions 901-910, 911-920, 921-930, 931-940, 941-950, 951-960, 961-970, 971-980, 981-990, or 991-1000 of NM_000128.4. In some examples, the start position of the target region is between positions 1001-1010, 1011-1020, 1021-1030, 1031-1040, 1041-1050, 1051-1060, 1061-1070, 1071-1080, 1081-1090, or 1091-1100 of NM_000128.4. In some examples, the start position of the target region is between positions 1101-1110, 1111-1120, 1121-1130, 1131-1140, 1141-1150, 1151-1160, 1161-1170, 1171-1180, 1181-1190, or 1191-1200 of NM_000128.4. In some examples, the start position of the target region is between positions 1201-1210, 1211-1220, 1221-1230, 1231-1240, 1241-1250, 1251-1260, 1261-1270, 1271-1280, 1281-1290, or 1291-1300 of NM_000128.4. In some examples, the start position of the target region is between positions 1301-1310, 1311-1320, 1321-1330, 1331-1340, 1341-1350, 1351-1360, 1361-1370, 1371-1380, 1381-1390, or 1391-1400 of NM_000128.4.In some examples, the start position of the target region is between positions 1401-1410, 1411-1420, 1421-1430, 1431-1440, 1441-1450, 1451-1460, 1461-1470, 1471-1480, 1481-1490, or 1491-1500 of NM_000128.4. In some examples, the start position of the target region is between positions 1501-1510, 1511-1520, 1521-1530, 1531-1540, 1541-1550, 1551-1560, 1561-1570, 1571-1580, 1581-1590, or 1591-1600 of NM_000128.4. In some examples, the start position of the target region is between positions 1601-1610, 1611-1620, 1621-1630, 1631-1640, 1641-1650, 1651-1660, 1661-1670, 1671-1680, 1681-1690, or 1691-1700 of NM_000128.4. In some examples, the start position of the target region is between positions 1701-1710, 1711-1720, 1721-1730, 1731-1740, 1741-1750, 1751-1760, 1761-1770, 1771-1780, 1781-1790, or 1791-1800 of NM_000128.4. In some examples, the start position of the target region is between positions 1801-1810, 1811-1820, 1821-1830, 1831-1840, 1841-1850, 1851-1860, 1861-1870, 1871-1880, 1881-1890, or 1891-1900 of NM_000128.4. In some examples, the start position of the target region is between positions 1901-1910, 1911-1920, 1921-1930, 1931-1940, 1941-1950, 1951-1960, 1961-1970, 1971-1980, 1981-1990, or 1991-2000 of NM_000128.4. In some examples, the start position of the target region is between positions 2001-2010, 2011-2020, 2021-2030, 2031-2040, 2041-2050, 2051-2060, 2061-2070, 2071-2080, 2081-2090, or 2091-2100 of NM_000128.4.In some examples, the start position of the target region is between positions 2101-2110, 2111-2120, 2121-2130, 2131-2140, 2141-2150, 2151-2160, 2161-2170, 2171-2180, 2181-2190, or 2191-2200 of NM_000128.4. In some examples, the start position of the target region is between positions 2201-2210, 2211-2220, 2221-2230, 2231-2240, 2241-2250, 2251-2260, 2261-2270, 2271-2280, 2281-2290, or 2291-2300 of NM_000128.4. In some examples, the start position of the target region is between positions 2301-2310, 2311-2320, 2321-2330, 2331-2340, 2341-2350, 2351-2360, 2361-2370, 2371-2380, 2381-2390, or 2391-2400 of NM_000128.4. In some examples, the start position of the target region is between positions 2401-2410, 2411-2420, 2421-2430, 2431-2440, 2441-2450, 2451-2460, 2461-2470, 2471-2480, 2481-2490, or 2491-2500 of NM_000128.4. In some examples, the start position of the target region is between positions 2501-2510, 2511-2520, 2521-2530, 2531-2540, 2541-2550, 2551-2560, 2561-2570, 2571-2580, 2581-2590, or 2591-2600 of NM_000128.4. In some examples, the start position of the target region is between positions 2601-2610, 2611-2620, 2621-2630, 2631-2640, 2641-2650, 2651-2660, 2661-2670, 2671-2680, 2681-2690, or 2691-2700 of NM_000128.4. In some examples, the start position of the target region is between positions 2701-2710, 2711-2720, 2721-2730, 2731-2740, 2741-2750, 2751-2760, 2761-2770, 2771-2780, 2781-2790, or 2791-2800 of NM_000128.4.In some examples, the start position of the target region is between positions 2801-2810, 2811-2820, 2821-2830, 2831-2840, 2841-2850, 2851-2860, 2861-2870, 2871-2880, 2881-2890, or 2891-2900 of NM_000128.4. In some examples, the start position of the target region is between positions 2901-2910, 2911-2920, 2921-2930, 2931-2940, 2941-2950, ​​2951-2960, 2961-2970, 2971-2980, 2981-2990, or 2991-3000 of NM_000128.4. In some examples, the start position of the target region is between positions 3001-3010, 3011-3020, 3021-3030, 3031-3040, 3041-3050, or 3051-3053 of NM_000128.4.

[0057] Polynucleic acid molecule structure single stranded nucleic acid molecule

[0058] Described herein is a polynucleic acid molecule for regulating expression of the FXI gene, which comprises a single-stranded nucleic acid molecule that is reverse complementary to the target region of the FXI mRNA described above.

[0059] In some embodiments, the polynucleic acid molecules described herein are not 100% complementary to the target region of FXI mRNA. Thus, in some examples, the polynucleic acid molecules described herein are about 95% complementary to the target region of FXI mRNA. In some examples, the polynucleic acid molecules described herein are about 90% complementary to the target region of FXI mRNA. In some examples, the polynucleic acid molecules described herein are about 85% complementary to the target region of FXI mRNA. In some examples, the polynucleic acid molecules described herein are about 80% complementary to the target region of FXI mRNA. In some examples, the polynucleic acid molecules described herein are about 75% complementary to the target region of FXI mRNA. In some examples, the polynucleic acid molecules described herein are about 70% complementary to the target region of FXI mRNA.

[0060] In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence in Tables 1-2 and 7-9. In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a sequence in Tables 1-2 and 7-9. In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220. In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220.

[0061] In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a sequence in Tables 1-2 and 7-9, excluding overhangs. In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220, excluding overhangs. In some examples, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, excluding overhangs.

[0062] In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14 contiguous nucleotides complementary to a sequence in Tables 1-2 and Tables 7-9, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 101-150 and 220, with no more than 1, 2, 3, or 4 mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 15 contiguous nucleotides complementary to a sequence in Tables 1-2 and Tables 7-9, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 15 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 101-150 and 220, with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 16 contiguous nucleotides complementary to a sequence in Tables 1-2 and Tables 7-9, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 16 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 101-150 and 220, with no more than 1, 2, 3, or 4 mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 17 contiguous nucleotides complementary to a sequence in Tables 1-2 and Tables 7-9, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 17 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 101-150 and 220, with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 18 contiguous nucleotides complementary to a sequence in Tables 1-2 and Tables 7-9, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 18 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 101-150 and 220, with 1, 2, 3, or no more than 4 mismatches.In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 19 contiguous nucleotides complementary to a sequence in Tables 1-2 and Tables 7-9, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 19 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 101-150 and 220, with no more than 1, 2, 3, or 4 mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 20 contiguous nucleotides complementary to a sequence in Tables 1-2 and Tables 7-9, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 20 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 101-150 and 220, with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 21 contiguous nucleotides complementary to a sequence in Tables 1-2 and Tables 7-9, with one, two, three, or four or fewer mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 21 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 101-150 and 220, with one, two, three, or four or fewer mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 22 contiguous nucleotides complementary to a sequence in Tables 1-2 and Tables 7-9, with one, two, three, or four or fewer mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 22 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 101-150 and 220, with one, two, three, or four or fewer mismatches.

[0063] In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 15 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 16 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 17 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 18 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 19 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 20 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with no more than 1, 2, 3, or 4 mismatches.In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 21 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 22 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with no more than 1, 2, 3, or 4 mismatches.

[0064] In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides complementary to a sequence in Tables 1-2 and 7-9, with no overhangs and no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides complementary to a nucleic acid sequence in SEQ ID NOs: 101-150 and 220, with no overhangs and no more than 1, 2, 3, or 4 mismatches. In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with no overhangs and no more than 1, 2, 3, or 4 mismatches.

[0065] In some embodiments, the polynucleic acid molecules described herein comprise strands of at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise strands of about 15-40, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise strands of about 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise strands of about 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise strands of about 26, 27, 28, 29, or 30 nucleotides in length.

[0066] In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids about 15-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids about 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids about 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids about 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise single-stranded nucleic acids about 21 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise a single-stranded nucleic acid about 23 nucleotides in length.

[0067] double stranded nucleic acid molecule

[0068] Further described herein is a polynucleic acid molecule for regulating expression of the FXI gene, which is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand, wherein the antisense strand is reverse complementary to the target region of the above-mentioned FXI mRNA.

[0069] In some embodiments, the antisense strands described herein are not 100% complementary to the target region of FXI mRNA. In other embodiments, the antisense strands described herein are not 100% complementary to the target region of FXI mRNA. Thus, in some examples, the antisense strands described herein are about 95% complementary to the target region of FXI mRNA. In some embodiments, the antisense strands described herein are about 90% complementary to the target region of FXI mRNA. In some embodiments, the antisense strands described herein are about 85% complementary to the target region of FXI mRNA. In some embodiments, the antisense strands described herein are about 80% complementary to the target region of FXI mRNA. In some embodiments, the antisense strands described herein are about 75% complementary to the target region of FXI mRNA. In some embodiments, the antisense strands described herein are about 70% complementary to the target region of FXI mRNA.

[0070] In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence in Tables 1-2 and 7-9. In other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence in Tables 1-2 and 7-9. In some embodiments, the sense strand described herein comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220. In some embodiments, the sense strand described herein comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216. In some examples, the sense strand described herein comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220. In some examples, the sense strand described herein comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216.

[0071] In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 14 contiguous sequences from the sequences of Tables 1-2 and Tables 7-9, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 14 contiguous sequences from SEQ ID NOS: 101-150 and 220, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 14 contiguous sequences from SEQ ID NOS: 1-50 and 215-216, with 1, 2, 3, or no more than 4 mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 15 contiguous sequences from the sequences of Tables 1-2 and Tables 7-9, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 15 contiguous sequences of SEQ ID NOs: 101-150 and 220 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 15 contiguous sequences of SEQ ID NOs: 1-50 and 215-216 with no more than 1, 2, 3, or 4 mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 16 contiguous sequences of the sequences in Tables 1-2 and 7-9 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 16 contiguous sequences of SEQ ID NOs: 101-150 and 220 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strands described herein comprise a nucleic acid sequence comprising at least 16 contiguous sequences of SEQ ID NOS: 1-50 and 215-216, with 1, 2, 3, or no more than 4 mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 17 contiguous sequences of the sequences in Tables 1-2 and Tables 7-9, with 1, 2, 3, or no more than 4 mismatches.In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 17 contiguous sequences of SEQ ID NOS: 101-150 and 220 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 17 contiguous sequences of SEQ ID NOS: 1-50 and 215-216 with no more than 1, 2, 3, or 4 mismatches. In other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 18 contiguous sequences of the sequences in Tables 1-2 and 7-9 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 18 contiguous sequences of SEQ ID NOS: 101-150 and 220 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 18 contiguous sequences of SEQ ID NOS: 1-50 and 215-216 with no more than 1, 2, 3, or 4 mismatches. In other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 19 contiguous sequences of the sequences in Tables 1-2 and 7-9 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 19 contiguous sequences of SEQ ID NOS: 101-150 and 220 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 19 contiguous sequences of SEQ ID NOS: 1-50 and 215-216 with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 20 contiguous sequences from the sequences of Tables 1-2 and Tables 7-9, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 20 contiguous sequences from SEQ ID NOs: 101-150 and 220, with 1, 2, 3, or no more than 4 mismatches.In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 20 contiguous sequences of SEQ ID NOS: 1-50 and 215-216 with no more than 1, 2, 3, or 4 mismatches. In other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 21 contiguous sequences of the sequences in Tables 1-2 and 7-9 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 21 contiguous sequences of SEQ ID NOS: 101-150 and 220 with no more than 1, 2, 3, or 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 21 contiguous sequences of SEQ ID NOS: 1-50 and 215-216 with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence comprising 22 contiguous sequences from the sequences of Tables 1-2 and Tables 7-9, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising at least 22 contiguous sequences from SEQ ID NOs: 101-150 and 220, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 22 contiguous sequences from SEQ ID NOs: 1-50 and 215-216, with 1, 2, 3, or no more than 4 mismatches.

[0072] In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising 15 contiguous sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with 1, 2, 3, or 4 or fewer mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 15 contiguous sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, with 1, 2, 3, or 4 or fewer mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising 16 contiguous sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with 1, 2, 3, or 4 or fewer mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 16 contiguous sequences of SEQ ID NOS: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising 17 contiguous sequences of SEQ ID NOS: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 17 contiguous sequences of SEQ ID NOS: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising 18 contiguous sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 18 contiguous sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, with 1, 2, 3, or no more than 4 mismatches.In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising 19 contiguous sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with 1, 2, 3, or 4 or fewer mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 19 contiguous sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, with 1, 2, 3, or 4 or fewer mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising 20 contiguous sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with 1, 2, 3, or 4 or fewer mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 20 contiguous sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, with 1, 2, 3, or 4 or fewer mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising 21 contiguous sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with 1, 2, 3, or 4 or fewer mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 21 contiguous sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, with 1, 2, 3, or 4 or fewer mismatches. In some embodiments, the sense strand described herein comprises a nucleic acid sequence comprising 22 contiguous sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, with 1, 2, 3, or no more than 4 mismatches. In some embodiments, the antisense strand described herein comprises a nucleic acid sequence comprising at least 22 contiguous sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, with 1, 2, 3, or no more than 4 mismatches.

[0073] In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands at least 10, 11, 12, 13, 14, or 15 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands about 15-40, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands about 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands about 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands about 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise a sense strand about 19 nucleotides in length and an antisense strand about 21 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise a sense strand about 21 nucleotides in length and an antisense strand about 23 nucleotides in length.

[0074] In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 3' overhang on the antisense strand.In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 5' overhang on the antisense strand.In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 3' overhang on the sense strand.In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 5' overhang on the sense strand.

[0075] Modification of polynucleic acid molecules In some aspects, the present specification describes polynucleic acid molecules described herein with modifications. In some aspects, the modifications described herein occur in one or more different structures of the polynucleotide molecules described herein (e.g., modifications to the sugar ring, backbone, or base). In some aspects, the modifications described herein include substitutions of one or more nucleotides in the polynucleic acid molecules described herein. In some aspects, different percentages of the polynucleic acid molecules described herein include the modifications described herein. In some aspects, different positions of the polynucleic acid molecules described herein include the modifications described herein. In some aspects, the modifications described herein include the modification patterns disclosed in WO2018 / 035380, the entire contents of which are incorporated herein by reference.

[0076] Modification Type In some embodiments, the polynucleotide molecules described herein comprise one or more sugar-modified nucleotides. In some embodiments, the sugar-modified nucleotide is a 2'-fluoro-modified nucleotide. In some examples, the sugar-modified nucleotide comprises a modification at the 2' hydroxyl group of the ribose moiety. In some examples, the sugar-modified nucleotide comprises a modification with H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is an alkyl moiety. In some embodiments, the sugar-modified nucleotide is a 2'-O-methyl-modified nucleotide or a 2'-alkoxy-modified nucleotide (e.g., a 2'-methoxy-modified nucleotide). In some examples, the 2' hydroxyl group modification includes 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA). In some examples, the 2' hydroxyl group of the ribose moiety includes a locked or bridged ribose modification (e.g., LNA), an unlocked ribose modification (e.g., UNA), or an ethylene nucleic acid (ENA). In some examples, the alkyl moiety includes a heterosubstitution. In some examples, the carbon of the heterocyclic group is replaced by nitrogen, oxygen, or sulfur. In some embodiments, the sugar-modified nucleotide is a 2'-amino-modified nucleotide. In some embodiments, the sugar-modified nucleotide is a 2'-azido-modified nucleotide. In some embodiments, the sugar-modified nucleotide is a 2'-deoxy-modified nucleotide. In some embodiments, the sugar-modified nucleotide is 2'-O-methoxythyl (2'-MOE). In some embodiments, the sugar-modified nucleotide is a locked nucleic acid (LNA). In some embodiments, the sugar-modified nucleotide is an ethylene-bridged nucleic acid (ENA). In some embodiments, the sugar-modified nucleotide is an (S)-constrained ethyl (cEt). In some embodiments, the sugar-modified nucleotide is tricyclo-DNA (tcDNA). In some embodiments, the sugar-modified nucleotide is a 2'-NH2 nucleic acid.

[0077] In some embodiments, the polynucleotide molecules described herein contain one or more sugar phosphate-modified nucleotides. In some embodiments, the modified sugar phosphate is a phosphorodiamidate morpholino (PMO). In some embodiments, the modified sugar phosphate is a phosphoramidate. In some examples, heterocyclic substitutions include imidazole and pyrrolidino. In some embodiments, the modified sugar phosphate is a thiophosphoramidate. In some embodiments, the modified sugar phosphate is a peptide nucleic acid (PNA).

[0078] In some embodiments, the polynucleotide molecules described herein contain one or more backbone-modified nucleotides. In some embodiments, the modified backbone is methyl phosphonate. In some embodiments, the modified backbone is phosphorothioate. In some embodiments, the modified backbone is guanidinopropyl phosphoramidate. In some embodiments, the modified backbone is a mesyl-phosphoramidate (MsPA) linkage. In some examples, the modified backbone includes one or more of phosphorodithioate, methyl phosphonate, 5'-alkylene phosphonate, 5'-methyl phosphonate, 3'-alkylene phosphonate, boron trifluoridate, 3'-5'-linked or 2'-5'-linked boranophosphate ester and selenophosphate, phosphotriester, thionoalkylphosphotriester, phosphonic acid hydrogen bond, alkyl phosphonate, alkyl phosphonothioate, aryl phosphonothioate, phosphoroselenoate, and phosphoramidate.

[0079] In some examples, one or more phosphorothioate internucleotide bonds are located at the 5'-end of the guide strand. Optionally, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 5'-end of the guide strand. Optionally, one or more phosphorothioate internucleotide bonds are located at the 3'-end of the guide strand. Optionally, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 3'-end of the guide strand. Optionally, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 5'-end of the guide strand, and two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 3'-end of the guide strand. In some cases, the guide strand contains phosphorothioate internucleotide linkages between nucleotides at positions 1, 2, 3, and 4 of the guide strand (between positions 1 and 2, between positions 2 and 3, and between positions 3 and 4) and between nucleotides at positions 1, 2, and 3 from the 3' end of the guide strand (between positions 1 and 2, and between positions 2 and 3).

[0080] In some examples, a plurality of phosphorothioate internucleotide bonds are located at the 5'-end of the passenger strand. Optionally, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 5'-end of the passenger strand. Optionally, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 5'-end of the passenger strand, two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 5'-end of the guide strand, and two phosphorothioate internucleotide bonds are located between the nucleotides at positions 1, 2, and 3 from the 3'-end of the guide strand.

[0081] In some examples, one or more phosphorothioate internucleotide bonds are located in the seed region of the guide strand. Optionally, the guide strand comprises a phosphorothioate internucleotide bond between the nucleotides at positions 5 and 6 from the 5' end of the guide strand. Optionally, the guide strand comprises a phosphorothioate internucleotide bond between the nucleotides at positions 6 and 7 from the 3' end of the guide strand. Optionally, the guide strand comprises a phosphorothioate internucleotide bond between the nucleotides at positions 9 and 10 from the 3' end of the guide strand. Optionally, the guide strand comprises a phosphorothioate internucleotide bond between the nucleotides at positions 5 and 6 from the 5' end of the guide strand and between the nucleotides at positions 6 and 7 from the 3' end of the guide strand. Optionally, the guide strand comprises a phosphorothioate internucleotide bond between the nucleotides at positions 5 and 6 from the 5' end of the guide strand and between the nucleotides at positions 9 and 10 from the 3' end of the guide strand. Optionally, the guide strand comprises phosphorothioate internucleotide linkages between nucleotides at positions 1, 2, and 3 from the 5' end of the guide strand, between positions 5 and 6, and between positions 1, 2, and 3 from the 3' end of the guide strand. Optionally, the guide strand comprises phosphorothioate internucleotide linkages between nucleotides at positions 1, 2, and 3 from the 5' end of the guide strand, between positions 5 and 6, and between nucleotides at positions 1, 2, and 3 from the 3' end of the guide strand, and between positions 9 and 10. Optionally, the guide strand comprises phosphorothioate internucleotide linkages between nucleotides at positions 1, 2, and 3 from the 5' end of the guide strand, between positions 5 and 6, and between nucleotides at positions 1, 2, and 3 from the 3' end of the guide strand, and between positions 6 and 7.

[0082] In some embodiments, the modified nucleotides include one or more modified guanines (eg, inosine), or any type of non-naturally occurring nucleic acid.

[0083] In some embodiments, the modified backbone is a phosphorothioate, and the phosphorothioate is a stereochemically enriched phosphorothioate. In certain embodiments, the chain comprises at least one stereochemically enriched phosphorothioate. In some embodiments, the chain comprises at least one, two, and three stereochemically enriched phosphorothioates. In some embodiments, the chain comprises only one, two, three, or four stereochemically enriched phosphorothioates. In further embodiments, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of the six 5'-terminal nucleosides in the chain. In yet further embodiments, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of the six 3'-terminal nucleosides in the chain. In still further embodiments, one stereochemically enriched phosphorothioate is covalently linked from the 5' end to the first and second nucleosides in the chain. In some embodiments, one stereochemically enriched phosphorothioate is covalently linked from the 5' end to the 21st and 22nd nucleosides in the chain. In certain embodiments, one stereochemically enriched phosphorothioate is covalently linked from the 5' end to the 22nd and 23rd nucleosides in the chain. In certain embodiments, the stereochemically enriched phosphorothioate is R P In a particular embodiment, the stereochemically enriched phosphorothioates have the same stereochemical identity. P They have the same stereochemical identity.

[0084] In some embodiments, the polynucleotide molecules described herein contain one or more (e.g., 1-20, 1-10, or 1-5) stereochemically enriched (e.g., internucleotide) phosphorothioates (e.g., at P-stereocenters, diastereomeric excess is at least 10%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%, e.g., up to about 99%). The polynucleotide molecules described herein contain one or more (e.g., 1-20, 1-10, or 1-5, e.g., internucleoside) phosphorothioates. The phosphorothioates may be non-P-stereomeric in the polynucleotide molecules described herein. Phosphorothioates and phosphorodithioates may improve the stability of the polynucleotide molecules described herein against serum exonuclease activity. Non-P-stereomeric phosphorothioates may simplify the synthesis of the polynucleotide molecules described herein by reducing the number of possible diastereomers. Typically, phosphorothioates or phosphorodithioates can connect two consecutive nucleosides within the six 3'-terminal nucleosides and six 5'-terminal nucleosides in the polynucleotide molecules described herein. In some embodiments, stereochemically enriched phosphorothioates (e.g., R P Stereochemically enriched phosphorothioates (e.g., S) can be covalently linked from the 5' end of the antisense strand to a first nucleoside (e.g., the 3' carbon atom of the first nucleoside) and a second nucleoside (e.g., the 5' carbon atom of the second nucleoside). Additionally or alternatively, stereochemically enriched phosphorothioates (e.g., S P Stereochemically enriched phosphorothioates (e.g., S) can be covalently linked to the 21st nucleoside (e.g., the 3' carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5' carbon atom of the 22nd nucleoside) from the 5' end of the antisense strand. P phosphorothioate or R pThe 22nd nucleoside (e.g., the 3' carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5' carbon atom of the 23rd nucleoside) from the 5' end of the antisense strand can be covalently linked.

[0085] 5'R from the 5' end of the antisense strand P R is covalently linked to a first nucleoside (e.g., the 3' carbon atom of the first nucleoside) and a second nucleoside (e.g., the 5' carbon atom of the second nucleoside). P (rich in phosphorothioates) and 3'S P a phosphorothioate (e.g., S) covalently linked to the 21st nucleoside (e.g., the 3' carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5' carbon atom of the 22nd nucleoside) P The combination of 5'R with 5'R-rich phosphorothioates is P is rich in phosphorothioates and 3'S P is rich in phosphorothioates, or 5'R p is rich in phosphorothioates and 3'S p and R p In some cases, the stereochemically enriched phosphorothioates can provide superior efficacy and / or duration of action as measured by reduced target activity compared to a reference guide strand lacking the R p R p S p S p (R at positions 1 and 2 of the guide strand p R p , and S at positions 21 and 22 of the guide strand p S p ) or R p R p S p R p (R at positions 1 and 2 of the guide strand p R p , and S at positions 21 and 22 of the guide strand p R pIn some embodiments, the polynucleotide molecules described herein may comprise four stereochemically enriched phosphorothioates: (1) an Rp-rich phosphorothioate covalently linked from the 5' end of the antisense strand to a first nucleoside (e.g., the 3' carbon atom of the first nucleoside) and a second nucleoside (e.g., the 5' carbon atom of the second nucleoside), and (2) an Rp-rich phosphorothioate covalently linked from the 5' end of the antisense strand to a second nucleoside (e.g., the 3' carbon atom of the second nucleoside) and a third nucleoside (e.g., the 5' carbon atom of the third nucleoside). (3) an Rp-rich phosphorothioate covalently linked to the 21st nucleoside (e.g., the 3' carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5' carbon atom of the 22nd nucleoside) from the 5' end of the antisense strand; and (4) an Sp-rich phosphorothioate covalently linked to the 22nd nucleoside (e.g., the 3' carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5' carbon atom of the 23rd nucleoside) from the 5' end of the antisense strand. In some embodiments, the polynucleotide molecules described herein comprise four stereochemically enriched phosphorothioates: (1) an Rp-rich phosphorothioate covalently linked from the 5' end of the antisense strand to a first nucleoside (e.g., the 3' carbon atom of the first nucleoside) and a second nucleoside (e.g., the 5' carbon atom of the second nucleoside), (2) an Rp-rich phosphorothioate covalently linked from the 5' end of the antisense strand to a second nucleoside (e.g., the 3' carbon atom of the second nucleoside) and a third nucleoside (e.g., the 5' carbon atom of the third nucleoside), (3) an Rp-rich phosphorothioate covalently linked to the 21st nucleoside (e.g., the 3' carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5' carbon atom of the 22nd nucleoside) from the 5' end of the antisense strand; and (4) an Rp-rich phosphorothioate covalently linked to the 22nd nucleoside (e.g., the 3' carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5' carbon atom of the 23rd nucleoside) from the 5' end of the antisense strand.

[0086] In some aspects, the stereochemically abundant phosphorothioate internucleotide linkages in polynucleic acids are R p R p S p (R at positions 1 and 2 of the guide strand p R p , and S at position 21 of the guide strand p ) or R p R p R p R p (R at positions 1, 2, and 3 of the guide strand p R p , and S at position 21 of the guide strand p ) is included.

[0087] In some embodiments, the polynucleotide molecules described herein contain one or more purine modifications. In some embodiments, the purine modification described herein is 2,6-diaminopurine. In some embodiments, the purine modification described herein is 3-deaza-adenine. In some embodiments, the purine modification described herein is 7-deaza-guanine. In some embodiments, the purine modification described herein is 8-azido-adenine.

[0088] In some embodiments, the polynucleotide molecules described herein comprise one or more pyrimidine modifications. In some embodiments, the pyrimidine modification described herein is 2-thio-thymidine. In some embodiments, the pyrimidine modification described herein is 5-carboxamido-uracil. In some embodiments, the pyrimidine modification described herein is 5-methyl-cytosine. In some embodiments, the pyrimidine modification described herein is 5-ethynyluracil.

[0089] In some cases, the polynucleic acid molecules described herein comprise abasic substitutions.When the hybridized polynucleotide construct is intended for use as siRNA, it is desirable to reduce miRNA-like off-target effects.By including one or more (for example, one or two) abasic substitutions in the hybridized polynucleotide construct, the miRNA-like off-target effects can be reduced or even eliminated, since the abasic substitutions lack a nucleic acid base that can engage in base-pairing interactions and relieve steric hindrance.Therefore, the polynucleotide molecules disclosed herein may comprise one or more (for example, one or two) abasic substitutions.In some embodiments, the abasic substitution is located at the fifth nucleotide from the 5'-end of the antisense strand described herein.In some embodiments, the abasic substitution is located at the seventh nucleotide from the 5'-end of the antisense strand described herein.

[0090] When a polynucleotide molecule disclosed herein contains two or more abasic substitutions, their structures may be the same or different. In certain embodiments, the sense strand contains one abasic substitution (e.g., the antisense strand may not contain an abasic substitution). In other embodiments, the antisense strand contains one abasic substitution (e.g., the sense strand may not contain an abasic substitution). In still other embodiments, the antisense strand contains one abasic substitution and the sense strand contains one abasic substitution. In a further embodiment, the sense strand contains an abasic substitution between nucleoside number (x) and nucleoside number (x+1), where x is an integer from 2 to 7. In a further embodiment, the antisense strand contains an abasic substitution between nucleoside number (x) and nucleoside number (x+1), where x is an integer from 2 to 7.

[0091] The abasic substitution is represented by formula (III):

[0092] [ka] wherein L is a sugar analog or substituted with a heteroaryl from A, U, C, G, or any other substituted nucleic acid (e.g., locked or unlocked nucleic acid, glycol nucleic acid, etc.); X 4 are each independently O or S, X 5 are each independently O, S, NH, or a bond; R 9 are each independently H, optionally substituted C 1-6 Alkyl, optionally substituted C 2-6 Alkenyl, optionally substituted C 2-6 Alkynyl, optionally substituted (C 1-9 Heterocyclyl)-C 1-6 -alkyl, optionally substituted (C 6-10 Aryl)-C 1-6 -alkyl, optionally substituted (C 3-8 Cycloalkyl)-C 1-6 -Alkyl, -LinkA(-T) p or a conjugation moiety, each LinkA is independently a polyvalent linker (e.g., comprising -C(O)-N(H)-); T are each independently an auxiliary moiety; R 10 is the bond to the 3' carbon atom of the nucleoside (x) in the chain, R 11 is the bond to the 5' oxygen atom of nucleoside (x+1) in the chain, p is an integer from 1 to 6, t is an integer of 1 to 6.

[0093] In some embodiments, the abasic substitutions described herein are attached to the antisense strand of the polynucleic acid molecule described herein. In certain embodiments, the abasic substitutions (e.g., the internucleotide abasic spacer of formula (III) where t is 1) can be included in the antisense strand described herein (e.g., in the seed region of the guide strand). In some embodiments, the abasic substitutions (e.g., the internucleotide abasic spacer of formula (III) where t is 1) can be attached to the 3' carbon atom of the second, third, fourth, or fifth nucleoside from the 5' end of the antisense strand described herein. In certain embodiments, the abasic substitutions (e.g., the internucleotide abasic spacer of formula (III) where t is 1) can be attached to the 3' carbon atom of the thirteenth, fourteenth, fifteenth, or sixteenth nucleoside from the 5' end of the antisense strand described herein. In some embodiments, the abasic substitution is at the 4th, 5th, 6th, 7th, 8th, and / or 9th nucleoside from the 5' end of the antisense strand described herein.

[0094] The polynucleotide molecules described herein can contain strands that include a seed region that includes nucleosides (eg, inosine) that contain hypoxanthine nucleobases.

[0095] In certain embodiments, the nucleoside containing the hypoxanthine nucleobase is the second nucleoside from the 5'-end of the chain. In further embodiments, the nucleoside containing the hypoxanthine nucleobase is the third nucleoside from the 5'-end of the chain. In even further embodiments, the nucleoside containing the hypoxanthine nucleobase is the fourth nucleoside from the 5'-end of the chain. In even further embodiments, the nucleoside containing the hypoxanthine nucleobase is the fifth nucleoside from the 5'-end of the chain. In certain embodiments, the nucleoside containing the hypoxanthine nucleobase is the sixth nucleoside of the chain. In certain embodiments, the nucleoside containing the hypoxanthine nucleobase is the seventh nucleoside of the chain.

[0096] In some examples, the polynucleotide molecule described herein comprises at least one inosine substitution. Optionally, at least one inosine substitution is in the seed region of antisense strand. Optionally, at least one inosine substitution is within 7 nucleotides from the 5' end of antisense strand. Optionally, at least one inosine substitution is in the first nucleotide from the 5' end of antisense strand (e.g., SRS-002331). Optionally, at least one inosine substitution comprises 2'-O-methylinosine-3'-phosphate.

[0097] In some embodiments, the polynucleotide molecule described herein comprises a sense strand and an antisense strand, wherein the first nucleotide from the 5' end of the antisense strand is replaced by uridine, and the last nucleotide from the 3' end of the sense strand is replaced by adenosine (e.g., SRS-002376). Optionally, uridine and / or adenosine are modified. Optionally, uridine comprises 2'-O-methyluridine-3'-phosphate, and adenosine comprises 2'-O-methyladenosine-3'-phosphate. Optionally, uridine comprises 2'-O-methyluridine-3'-phosphate, or adenosine comprises 2'-O-methyladenosine-3'-phosphate.

[0098] In some embodiments, the first nucleotide from the 5'-end of the antisense strand of the polynucleotide molecule described herein is replaced by adenosine.Optionally, adenosine is modified adenosine.Optionally, adenosine comprises 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0099] Amount and position of modification In some embodiments, the polynucleotide molecules described herein comprise one or more types of modifications described above. Thus, in some embodiments, about 10% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 20% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 30% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 40% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 50% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 60% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 70% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 80% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, about 90% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, 100% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above.

[0100] In some embodiments, one or more types of modifications described herein occur at different positions within a polynucleotide molecule described herein. In some embodiments, one or more types of modifications described herein occur in a seed region within a polynucleotide molecule described herein. In some embodiments, one or more types of modifications described herein occur at the 3' end of a polynucleotide molecule described herein. In some embodiments, one or more types of modifications described herein occur at the 5' end of a polynucleotide molecule described herein. In some embodiments, one or more types of modifications described herein occur dispersedly within a polynucleotide molecule described herein. In some embodiments, one or more types of modifications described herein occur in clusters within a polynucleotide molecule described herein.

[0101] Specific modification patterns In some embodiments, the present specification describes specific modification patterns for polynucleic acid molecules that are double-stranded nucleic acid molecules comprising a sense strand and an antisense strand. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 2 from the 5' end. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 14 from the 5' end. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at positions 2 and 14 from the 5' end. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 12 from the 5' end. In some embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 16 from the 5' end. In other embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 6 from the 5' end. In other embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 7 from the 5' end. In other embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 8 from the 5' end. In other embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 9 from the 5' end. In other embodiments, the antisense strand comprises a 2'-fluoro modified nucleotide at position 4 from the 5' end.

[0102] In some embodiments, the present specification describes specific modification patterns for polynucleic acid molecules that are double-stranded nucleic acid molecules comprising a sense strand and an antisense strand. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 9 from the 5' end. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 11 from the 5' end. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at positions 9 and 11 from the 5' end. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 7 from the 5' end. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 10 from the 5' end. In some embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at positions 9, 11, and 7 from the 5' end. The sense strand comprises a 2'-fluoro modified nucleotide at positions 9, 11, and 10 from the 5' end. The sense strand comprises a 2'-fluoro modified nucleotide at positions 9 and 7 from the 5' end. The sense strand comprises 2'-fluoro modified nucleotides at positions 9 and 10 from the 5' end. The sense strand comprises 2'-fluoro modified nucleotides at positions 9, 11, 7, and 10 from the 5' end. In other embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 8 from the 5' end. In other embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 12 from the 5' end. In other embodiments, the sense strand comprises a 2'-fluoro modified nucleotide at position 16 from the 5' end.

[0103] In some embodiments, the sense and antisense strands of the polynucleic acid molecule comprise any combination of two or more 2'-fluoro modified nucleotides at the positions described in the above two paragraphs.

[0104] In some embodiments, the antisense strand comprises 5'-nNfnnnNfNfnnnnNfnNfnnnnnn-3'. In some embodiments, the antisense strand comprises 5'-nNfnnnNfnnnnnnnNfnNfnnnnnnn-3'. In some embodiments, the antisense strand comprises 5'-nNfnnnnNfnnnnnnNfnNfnnnnnnn-3'. In some embodiments, the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnn-3'. In the above modification patterns, "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0105] In some embodiments, the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3'. In some embodiments, the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3'. In some embodiments, the sense strand comprises 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3'. In some embodiments, the sense strand comprises 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3'. In the above modification patterns, "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0106] In some aspects herein, specific modification patterns are described for polynucleic acid molecules that are double-stranded nucleic acid molecules comprising a sense strand and an antisense strand, where the sense strand comprises about 12 2'-fluoro modified nucleotides and about 9 2'-O-methyl modified nucleotides, and the antisense strand comprises about 9 2'-fluoro modified nucleotides and about 14 2'-O-methyl modified nucleotides.

[0107] In some embodiments herein, specific modification patterns are described, where the sense strand is fully modified and contains 12 2'-fluoro modified nucleotides, 9 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 9 2'-fluoro modified nucleotides and 14 2'-O-methyl modified nucleotides.

[0108] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3' and the antisense strand comprises 5'-nNfnNfnNfnNfnNfnNfnnnNfnNfnNfnNfn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0109] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3' and the antisense strand comprises 5'-nNfnNfnNfnNfnNfnNfnNfnnNfnNfnNfnNfn-3', wherein the sense strand and / or antisense strand comprise one or more phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide. In other aspects herein, specific modification patterns are described, where the sense strand comprises 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3' and the antisense strand comprises 5'-nNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0110] In some embodiments herein, specific modification patterns are described, where the sense strand and / or antisense strand is modified as Type I in Table 11.

[0111] [Table 1]

[0112] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220, and an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220, and an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216, wherein the sense strand and / or antisense strand are modified with a Type I modification pattern as set forth in Table 11. In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, and an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216. In other aspects, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequence of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, and an antisense strand comprising the nucleic acid sequence of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, wherein the sense strand and / or antisense strand are modified with a Type I modification pattern described in Table 11.

[0113] In some embodiments herein, specific modification patterns are described, where the sense strand contains about 4 2'-fluoro modified nucleotides and about 17 2'-O-methyl modified nucleotides, and the antisense strand contains about 6 2'-fluoro modified nucleotides and about 17 2'-O-methyl modified nucleotides.

[0114] In some embodiments herein, specific modification patterns are described, where the sense strand is fully modified and contains 4 2'-fluoro modified nucleotides, 17 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 6 2'-fluoro modified nucleotides and 17 2'-O-methyl modified nucleotides.

[0115] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0116] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnn-3', wherein the sense strand and / or antisense strand comprise one or more phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide. In other aspects herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0117] In some embodiments herein, specific modification patterns are described, where the sense and / or antisense strands are modified as Type II in Table 11.

[0118] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequences of SEQ ID NOs: 101-150 and 220, and / or an antisense strand comprising the nucleic acid sequences of SEQ ID NOs: 1-50 and 215-216, wherein the sense strand and / or antisense strand are modified with a Type II modification pattern described in Table 11. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, and / or an antisense strand comprising the nucleic acid sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, wherein the sense strand and / or antisense strand are modified with a Type I modification pattern described in Table 11.

[0119] In some embodiments herein, specific modification patterns are described, where the sense strand contains about 2 2'-fluoro modified nucleotides and about 19 2'-O-methyl modified nucleotides, and the antisense strand contains about 3 2'-fluoro modified nucleotides and about 20 2'-O-methyl modified nucleotides.

[0120] In some embodiments herein, specific modification patterns are described where the sense strand is fully modified and contains 2 2'-fluoro modified nucleotides and 19 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 3 2'-fluoro modified nucleotides and 20 2'-O-methyl modified nucleotides.

[0121] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnnn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0122] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnn-3', where the sense strand and / or the antisense strand comprises one or more phosphorothioate linkages, "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide. In other embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnnn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide.

[0123] In some embodiments herein, specific modification patterns are described, where the sense strand and / or antisense strand is modified as Type III in Table 11.

[0124] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequence of SEQ ID NOs: 101-150 and 220, and / or an antisense strand comprising the nucleic acid sequence of SEQ ID NOs: 1-50 and 215-216, wherein the sense strand and / or antisense strand are modified with a Type III modification pattern described in Table 11. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequence of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, and / or an antisense strand comprising the nucleic acid sequence of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, wherein the sense strand and / or antisense strand are modified with a Type III modification pattern described in Table 11.

[0125] In some embodiments herein, specific modification patterns are described, where the sense strand contains about 3 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides, and the antisense strand contains about 4 2'-fluoro modified nucleotides and about 19 2'-O-methyl modified nucleotides.

[0126] In some embodiments herein, specific modification patterns are described, where the sense strand is fully modified and contains 3 2'-fluoro modified nucleotides and 18 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 4 2'-fluoro modified nucleotides and 19 2'-O-methyl modified nucleotides.

[0127] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0128] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnn-3', wherein the sense strand and / or antisense strand comprise one or more phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide. In other aspects herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0129] In some embodiments herein, specific modification patterns are described, where the sense and / or antisense strands are modified as Type IV in Table 11.

[0130] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequence of SEQ ID NOs: 101-150 and 220, and / or an antisense strand comprising the nucleic acid sequence of SEQ ID NOs: 1-50 and 215-216, wherein the sense strand and / or antisense strand are modified with a Type IV modification pattern described in Table 11. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequence of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, and / or an antisense strand comprising the nucleic acid sequence of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, wherein the sense strand and / or antisense strand are modified with a Type IV modification pattern described in Table 11.

[0131] In some embodiments herein, specific modification patterns are described, where the sense strand contains about 3 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides, and the antisense strand contains about 5 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides.

[0132] In some embodiments herein, specific modification patterns are described, where the sense strand is fully modified and contains 3 2'-fluoro modified nucleotides and 18 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 5 2'-fluoro modified nucleotides and 18 2'-O-methyl modified nucleotides.

[0133] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnn-3', where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0134] In some embodiments herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnn-3', wherein the sense strand and / or antisense strand comprise one or more phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide, and "n" represents a 2'-O-methyl modified nucleotide. In other aspects herein, specific modification patterns are described, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0135] In some embodiments herein, specific modification patterns are described, where the sense and / or antisense strands are modified as Type V in Table 11.

[0136] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequence of SEQ ID NOs: 101-150 and 220, and / or an antisense strand comprising the nucleic acid sequence of SEQ ID NOs: 1-50 and 215-216, wherein the sense strand and / or antisense strand are modified with a Type V modification pattern described in Table 11. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising the nucleic acid sequence of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, and / or an antisense strand comprising the nucleic acid sequence of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, wherein the sense strand and / or antisense strand are modified with a Type V modification pattern described in Table 11.

[0137] In some embodiments herein, a specific modification pattern is described in which the sense strand contains about 3 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides, with one or more inverted deoxy-nucleotides present as an overhang at the 3' end.

[0138] In some embodiments herein, a specific modification pattern is described in which the sense strand is fully modified and contains 3 2'-fluoro modified nucleotides and 18 2'-O-methyl modified nucleotides, with two inverted deoxy-nucleotides as an overhang at the 3' end.

[0139] In some embodiments, specific modification patterns are described herein, where the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', where "Nf" represents a 2'-fluoro modified nucleotide, "n" represents a 2'-O-methyl modified nucleotide, and "invdN" represents an inverted deoxy-nucleotide. In some examples, invdN is an inverted deoxy-thymine. In some embodiments, a linker conjugated with one or more targeting moieties shown in formula (IV") or (IV'") is attached to the first nucleic acid on the 5' end. In some embodiments, a linker conjugated with one or more targeting moieties shown in formula (V") or (V'") is attached to the first nucleic acid on the 5' end. In some embodiments, the modification pattern comprises one or more phosphorothioate linkages. In some embodiments, the modification pattern is shown in formula (VII). In some embodiments, art-known 5' end modifications are applied to one or more inverted nucleotides.

[0140] [ka] wherein R is a moiety corresponding to a sugar modification described herein, and in some instances, R is -O-methyl, R' is thymine, abasic, or other, A is -O or -S, and A' is -O or -S.

[0141] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220, and / or an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216, wherein the sense and / or antisense strand is modified with a Type VI modification pattern described in Table 11 or described in the preceding paragraph. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, and / or an antisense strand comprising a nucleic acid sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, wherein the sense and / or antisense strand is modified with a Type VI modification pattern described in Table 11 or described in the preceding paragraph.

[0142] Described herein are polynucleic acid molecules, wherein the sense strand comprises a nucleic acid sequence at least 80% identical to a nucleic acid sequence selected from a nucleic acid sequence selected from SEQ ID NOs: 151-200, 214, and 221. Described herein are polynucleic acid molecules, wherein the sense strand comprises a nucleic acid sequence at least 85% identical to a nucleic acid sequence selected from a nucleic acid sequence selected from SEQ ID NOs: 151-200, 214, and 221. Described herein are polynucleic acid molecules, wherein the sense strand comprises a nucleic acid sequence at least 90% identical to a nucleic acid sequence selected from SEQ ID NOs: 151-200, 214, and 221. Described herein are polynucleic acid molecules, wherein the sense strand comprises a nucleic acid sequence at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 151-200, 214, and 221.

[0143] Described herein are polynucleic acid molecules whose antisense strand comprises a nucleic acid sequence at least 80% identical to a nucleic acid sequence selected from SEQ ID NOs: 51-100, 201-213, and 217-219. Described herein are polynucleic acid molecules whose antisense strand comprises a nucleic acid sequence at least 85% identical to a nucleic acid sequence selected from SEQ ID NOs: 51-100, 201-213, and 217-219. Described herein are polynucleic acid molecules whose antisense strand comprises a nucleic acid sequence at least 90% identical to a nucleic acid sequence selected from SEQ ID NOs: 51-100, 201-213, and 217-219. Described herein are polynucleic acid molecules whose antisense strand comprises a nucleic acid sequence at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 51-100, 201-213, and 217-219.

[0144] In a polynucleic acid molecule for regulating the expression of the FXI gene, the polynucleic acid molecule comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, and a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220.

[0145] In the polynucleic acid molecule for regulating the expression of the FXI gene, the polynucleic acid molecule comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:11 and a sense strand comprising the nucleotide sequence of SEQ ID NO:111.

[0146] In a polynucleic acid molecule for regulating the expression of the FXI gene, the polynucleic acid molecule comprises an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 54, 56-57, 59-61, 63-64, 85, 100, 201-213, and 217-219, and a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 154, 156-157, 159-161, 163-164, 185, 200, 214, and 221.

[0147] In the polynucleic acid molecule for regulating the expression of the FXI gene, the polynucleic acid molecule comprises an antisense strand comprising the nucleotide sequence of SEQ ID NO:61 and a sense strand comprising the nucleotide sequence of SEQ ID NO:161.

[0148] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 61), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate; "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 2 "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate; "dT" refers to 2'-deoxythymidine-3'-phosphate; "s" refers to 3'-phosphorothioate; "invdT" refers to 3'-inverted thymidine; "i" refers to 2'-O-methylinosine-3'-phosphate; and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0149] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence asUfsaaaugucuuUfgUfuGfcsaagcsgsc (SEQ ID NO: 211) and a sense strand comprising the nucleotide sequence gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. '-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 5-methyluridine-3'-phosphate. "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0150] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence asUfsaaaugucuuUfgUfsuGfcaagcsgsc (SEQ ID NO: 212) and a sense strand comprising the nucleotide sequence gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. '-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 5-methyluridine-3'-phosphate. "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0151] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence asUfsaaaugucuuUfgUfuGfcaasgcsgsc (SEQ ID NO: 213) and a sense strand comprising the nucleotide sequence gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. '-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 5-methyluridine-3'-phosphate. "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0152] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 61) and a sense strand comprising the nucleotide sequence gscsuugcAfaCfaAfagacauuuau(invdT)(invdT) (SEQ ID NO: 214), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3' "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t " refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0153] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence asUfsgucuUfuguuGfcAfaGfcgcuusasu (SEQ ID NO: 204) and a sense strand comprising the nucleotide sequence asasgcgcUfuGfcAfacaaagacau (SEQ ID NO: 159), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. '-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 5-methyluridine-3'-phosphate. "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0154] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence asAfsugucUfuuguUfgCfaAfgcgcususa (SEQ ID NO: 205) and a sense strand comprising the nucleotide sequence asgscgcuUfgCfaAfcaaagacauu (SEQ ID NO: 160), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. '-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 5-methyluridine-3'-phosphate. "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0155] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence asUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 206) and a sense strand comprising the nucleotide sequence gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. '-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 5-methyluridine-3'-phosphate. "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0156] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence usUfsauagUfuuauGfcCfcUfucaugsusc (SEQ ID NO: 207) and a sense strand comprising the nucleotide sequence csasugaaGfgGfcAfuaaacuauaa (SEQ ID NO: 163), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. '-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 5-methyluridine-3'-phosphate. "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0157] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence asUfsagguAfaaaaAfcUfgGfcagcgsgsa (SEQ ID NO: 209) and a sense strand comprising the nucleotide sequence csgscugcCfaGfuUfuuuuaccuau (SEQ ID NO: 185), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. '-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 5-methyluridine-3'-phosphate. "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0158] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence isUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 217) and a sense strand comprising the nucleotide sequence gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. where "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. '-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 5-methyluridine-3'-phosphate. "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0159] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence usUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 218) and a sense strand comprising the nucleotide sequence gscsuugcAfaCfaAfagacauuuaa (SEQ ID NO: 222), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine-3'-phosphate. '-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to 5-methyluridine-3'-phosphate. "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0160] Further provided herein is a polynucleic acid molecule for regulating expression of the FXI gene, the polynucleic acid molecule comprising an antisense strand comprising the nucleotide sequence a4sUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 219) and a sense strand comprising the nucleotide sequence gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161), wherein "A" refers to adenosine-3'-phosphate and "a" refers to 2'-O-methyladenosine-3'-phosphate. "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, and "g" refers to 2'-O-methylguanosine- "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, "U" refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, and "t" refers to "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0161] Conjugation targeting part In certain embodiments, the polynucleotide molecules described herein are linked or conjugated with one or more targeting moieties to form polynucleotide-targeting moiety conjugate molecules. In some examples, the targeting moiety is selected based on its ability to selectively or preferentially target the conjugate molecules described herein to a desired cell population, tissue, or organ. In some examples, the targeting moiety targets cells, tissues, or organs that express the targeting moiety's corresponding binding partner (e.g., either the corresponding receptor or ligand). For example, a polynucleotide molecule conjugated with N-acetylgalactosamine (GalNAc) can target hepatocytes that express asialoglycoprotein (ASGP-R). Any suitable GalNAc molecule known in the art to be used as a targeting moiety is contemplated. An exemplary GalNAc molecule includes a triantennary GalNAc (e.g., L96). Another example of a targeting moiety is galactose. The targeting moiety can also be a lipid, peptide, or small molecule.

[0162] A targeting moiety (i.e., an intracellular targeting moiety) that targets a desired site within a cell (e.g., the endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) may be included in the hybridized polynucleotide constructs disclosed herein. Non-limiting examples of intracellular targeting moieties are provided in WO 2015 / 069932 and WO 2015 / 188197, and the disclosures of intracellular targeting moieties in WO 2015 / 069932 and WO 2015 / 188197 are incorporated herein by reference.

[0163] Therefore, the polynucleotide molecules described herein can contain one or more targeting moieties selected from the group consisting of intracellular targeting moieties, extracellular targeting moieties, and combinations thereof.Therefore, one or more targeting moieties (e.g., extracellular targeting moieties comprising targeting moieties independently selected from the group consisting of folate, mannose, N-acetylgalactosamine, and prostate-specific membrane antigen) and one or more intracellular targeting moieties (e.g., moieties targeting the endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) can be included in the polynucleotide molecules described herein to facilitate the delivery of polynucleotides to specific sites in specific cell populations.In some embodiments, the targeting moiety contains one or more mannose hydrocarbons.Mannose targets the mannose receptor, which is a 175KDa cell membrane-associated receptor expressed on sinusoidal hepatocytes and antigen-presenting cells (e.g., macrophages and dendritic cells). It is a highly efficient endocytic / circulating receptor that binds and internalizes mannosylated pathogens and proteins (Lennartz et al., J. Biol. Chem. 262:9942-9944, 1987; Taylor et al., J. Biol. Chem. 265:12156-62, 1990).

[0164] Some targeting moieties are described herein. In some embodiments, the targeting moiety is selected from the group consisting of insulin, insulin-like growth factor receptor 1 (IGF1R), IGF2R, insulin-like growth factor (IGF, e.g., IGF1 or 2), mesenchymal epithelial transition factor receptor (c-met, also known as hepatocyte growth factor receptor (HGFR)), hepatocyte growth factor (HGF), epidermal growth factor receptor (EGFR), epidermal growth factor (EGF), heregulin, fibroblast growth factor receptor (FGFR), platelet-derived growth factor receptor (PDGFR), platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), and VEGF receptors. Factor receptor (VEGFR), vascular endothelial growth factor (VEGF), tumor necrosis factor receptor (TNFR), tumor necrosis factor alpha (TNF-α), TNF-β, folate receptor (FOLR), folate, transferrin, transferrin receptor (TfR), mesothelin, Fc receptor, c-kit receptor, c-kit, integrin (e.g., α4 integrin or β-1 integrin), P-selectin, sphingosine-1-phosphate receptor-1 (S1PR), hyaluronate receptor, leukocyte function antigen-1 (LFA) -1), CD4, CD11, CD18, CD20, CD25, CD27, CD52, CD70, CD80, CD85, CD95 (Fas receptor), CD106 (vascular cell adhesion molecule-1 (VCAM1), CD166 (activated leukocyte cell adhesion molecule (ALCAM)), CD178 (Fas ligand), CD253 (TNF-related apoptosis-inducing ligand (TRAIL)), ICOS ligand, CCR2, CXCR3, CCR5, CXCL12 (stromal cell-derived factor 1 (SDF-1)), interleukin 1 (IL-1), The antibody contains or specifically binds to a protein selected from the group including IL-1ra, IL-2, IL-3, IL-4, IL-6, IL-7, IL-8, CTLA-4, MART-1, gp100, MAGE-1, ephrin (Eph) receptor, mucosal addressin cell adhesion molecule-1 (MAdCAM-1), carcinoembryonic antigen (CEA), LewisY, MUC-1 epithelial cell adhesion molecule (EpCAM), cancer antigen 125 (CA125), prostate-specific membrane antigen (PSMA), TAG-72 antigen, and fragments thereof.In further embodiments, the targeting moiety contains an erythroblastic leukemia viral oncogene homolog (ErbB) receptor (e.g., ErbB1 receptor, ErbB2 receptor, ErbB3 receptor, and ErbB4 receptor). In some embodiments, the targeting moiety contains one or more (e.g., 1-6) N-acetylgalactosamine (GalNAc). In certain embodiments, the targeting moiety contains one or more (e.g., 1-6) galactose. In certain embodiments, the targeting moiety contains one or more (e.g., 1-6) mannose. In other embodiments, the targeting moiety contains a folate ligand. The folate ligand is:

[0165] [ka] Specific targeting moieties may include bombesin, gastrin, gastrin-releasing peptide, transforming growth factor (TGF) (e.g., TGF-α or TGF-β), or vaccinia virus growth factor (VVGF). Non-peptidyl targeting moieties may also be used for the targeting moiety, including, for example, steroids, carbohydrates, vitamins, and lectins. Some targeting moieties may include polypeptides, such as somatostatin or somatostatin analogs (e.g., octreotide or lanreotide), bombesin, or antibodies or antigen-binding fragments thereof. The antibodies may be of any recognized class or subclass, e.g., IgG, IgA, IgM, IgD, IgE. Typical are antibodies within the IgG class. The antibodies may be derived from any species according to techniques known in the art. However, typically, the antibodies are of human, murine, or rabbit origin. Furthermore, antibodies may be polyclonal or monoclonal, but are typically monoclonal. Human or chimeric (e.g., humanized) antibodies may be used as targeting moieties. The targeting moiety may comprise an antigen-binding fragment of an antibody. Such antibody fragments may include, for example, Fab', F(ab')2, Fv, Fab fragments, single-domain antibodies, ScFv, or other antigen-binding fragments. Fc fragments may also be used as targeting moieties. Such antibody fragments can be prepared, for example, by proteolytic enzyme digestion, e.g., pepsin or papain digestion, reductive alkylation, or recombinant techniques. Materials and methods for preparing antibody fragments are well known to those skilled in the art. See, for example, Parham, J. Immunology, 131:2895, 1983; Lamoyi et al., J. Immunological Methods, 56:235, 1983.

[0166] Other peptides that find use as targeting aid moieties in the polynucleotide molecules described herein include KiSS peptides and analogs, urotensin II peptides and analogs, GnRH I and II peptides and analogs, depreotide, vapreotide, vasoactive intestinal peptide (VIP), cholecystokinin (CCK), RGD-containing peptides, melanocyte-stimulating hormone (MSH) peptides, neurotensin, calcitonin, glutathione, YIGSR (platelet factor 4 (PF-4)), and leukocyte-binding peptide (leukocyte-avid peptide) containing a heparin-binding domain with a lysine-rich sequence. peptides, e.g., P483H), atrial natriuretic peptide (ANP), β-amyloid peptide, δ-opioid antagonists (such as ITIPP(psi)), annexin-V, endothelin, leukotriene B4 (LTB4), chemotactic peptides (e.g., N-formyl-methionyl-leucyl-phenylalanine-lysine (fMLFK)), GP IIb / IIIa receptor antagonists (e.g., DMP444), human neutrophil elastase inhibitors (EPI-HNE-2 and EPI-HNE-4), plasmin inhibitors, antimicrobial peptides, apticides (P280 and P274), thrombospondin receptors (including analogs such as TP-1300), bitistatin, pituitary adenylyl cyclase type I receptor (PAC1), fibrin α-chain, peptides derived from a phage display library, and conservative substitutions thereof.

[0167] One or more (e.g., 1 to 6) targeting moieties can be attached to MOIETY or X2 in formula (V', V'', V''', V'''', V''''', V'''''') by -LinkA-.

[0168] In some embodiments, the targeting moiety comprises one or more (e.g., 1-6 or 1-3) asialoglycoprotein receptor ligands (e.g., GalNAc). In some embodiments, the asialoglycoprotein receptor ligands (e.g., GalNAc) are linked to -LinkA- via their anomeric carbon (e.g., the anomeric carbon is a carbon atom in an acetal or hemiaminal). In some embodiments, the asialoglycoprotein receptor ligand (e.g., GalNAc) comprises an anomeric carbon linked to a trivalent, tetravalent, pentavalent, or hexavalent linker, where the anomeric carbon is part of a hemiaminal group. An asialoglycoprotein receptor ligand (e.g., GalNAc) linked to a linker via a hemiaminal may produce a hybridized polynucleotide construct with superior gene silencing efficacy compared to a hybridized polynucleotide construct having an asialoglycoprotein receptor ligand (e.g., GalNAc) linked to a linker via an acetal.

[0169] In some embodiments, the linker and three asialoglycoprotein receptor targeting moieties, each comprising GalNAc, are as shown in formula (V). In some examples, the conjugates described herein include only one asialoglycoprotein receptor targeting moiety, and thus the conjugates include the structure of formula (V) with any two of the targeting moieties removed. In some examples, the conjugates described herein include only two asialoglycoprotein receptor targeting moieties, and thus the conjugates described herein include the structure of formula (V) with any one of the targeting moieties removed.

[0170] [ka] wherein one of Y1 and Y2 is a nucleotide, or both Y1 and Y2 are nucleotides, and Y1 and Y2 are consecutive or adjacent nucleotides from a polynucleic acid molecule described herein.

[0171] In some embodiments, the linkers and targeting moieties described herein are conjugated to the 3'-end of the sense strand (e.g., as shown in formula (V', V'''', V''''', V''''''). In some embodiments, the linkers and targeting moieties described herein are conjugated to the 5'-end of the sense strand (e.g., as shown in formula (V'') or (V'''). In some embodiments, the linkers and targeting moieties described herein are conjugated to the 3'-end of the antisense strand (e.g., as shown in formula (V'), (V'''', (V''''', (V''''''). In some embodiments, the linkers and targeting moieties described herein are conjugated to the 5'-end of the antisense strand (e.g., as shown in formula (V'') or (V''').

[0172] [ka] Z in formula (V') corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or the like.

[0173] [ka] Z in formula (V'') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or others.

[0174] [ka] Z in formula (V''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.

[0175] [ka] Z in formula (V'''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.

[0176] [ka] Z in formula (V''''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V''''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.

[0177] [ka] Z in formula (V'''''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'''''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.

[0178] In some examples, the 3' end of the passenger / sense strand of a polynucleic acid molecule in Tables 1-2 and 7-9 is conjugated with X2-GalNAc (see formula (V), (V'), (V'''), (V''''), (V''''')). In some examples, the 5' end of the passenger / sense strand of a polynucleic acid molecule in Tables 1-2 and 7-9 is conjugated with X2-GalNAc (see formula (V), (V''), or (V''')). In some examples, a nucleic acid within the passenger / sense strand (not at the 5' or 3' end) in Table 1 or Table 2 is conjugated with X2-GalNAc (see formula (V)). In some examples, the 3' end of the guide / antisense strand of a polynucleic acid molecule in Tables 1-2 and 7-9 is conjugated with X2-GalNAc (see formula (V), (V'), (V'''), (V'''), (V'''')). In some examples, the 5' end of the guide / antisense strand of a polynucleic acid molecule in Tables 1-2 and 7-9 is conjugated with X2-GalNAc (see formula (V), (V''), or (V''')). In some examples, a nucleic acid within the guide / antisense strand (not at the 5' or 3' end) of a polynucleic acid molecule in Tables 1-2 and 7-9 is conjugated with X2-GalNAc (see formula (V)).

[0179] In some examples, one or more endosomal escape moieties (e.g., 1-6 or 1-3) can be attached as auxiliary moieties to the polynucleotide constructs or hybridized polynucleotide constructs disclosed herein. Exemplary endosomal escape moieties include chemotherapeutic drugs (e.g., quinolones such as chloroquine), fusogenic lipids (e.g., dioleoylphosphatidyl-ethanolamine (DOPE)), and polymers such as polyethyleneimine (PEI), poly(β-amino esters), polypeptides such as polyarginine (e.g., octaarginine) and polylysine (e.g., octalysine), proton sponges described herein, viral capsids, and peptide transduction domains. For example, lytic peptides can be derived from the influenza A virus M2 protein, peptide analogs of influenza virus hemagglutinin, influenza C virus HEF protein, filovirus transmembrane glycoproteins, rabies virus transmembrane glycoproteins, vesicular stomatitis virus transmembrane glycoprotein (G), Sendai virus fusion protein, Semliki Forest virus transmembrane glycoprotein, human respiratory syncytial virus (RSV) fusion protein, measles virus fusion protein, Newcastle disease virus fusion protein, Visna virus fusion protein, murine leukemia virus fusion protein, HTL virus fusion protein, and simian immunodeficiency virus (SIV) fusion protein. Other moieties that can be used to promote endosomal escape are described in Dominska et al., Journal of Cell Science, 123(8):1183-1189, 2010. Specific examples of endosomal escape moieties, including moieties suitable for conjugation to the hybridized polynucleotides disclosed herein, are provided, for example, in WO 2015 / 188197, the disclosure of which is incorporated herein by reference.

[0180] One or more endosomal escape moieties (e.g., 1-6 or 1-3) can be attached to MOIETY or X2 in formula (V', V'', V''', V'''', V''''', or V'''''') by -LinkA-, as described herein.

[0181] One or more cell-penetrating peptides (CPPs) (e.g., 1-6 or 1-3) can be attached as auxiliary moieties to the polynucleotide constructs or hybridized polynucleotide constructs disclosed herein. The CPPs, as disclosed herein, can be bioreversibly attached to the hybridized polynucleotide by disulfide bonds. Thus, upon delivery to a cell, the CPPs can be cleaved intracellularly by, for example, an intracellular enzyme (e.g., protein disulfide isomerase, thioredoxin, or thioesterase), thereby releasing the polynucleotide.

[0182] CPPs are known in the art (e.g., TAT or Arg8) (Snyder and Dowdy, 2005, Expert Opin. Drug Deliv. 2, pp. 43-51). Specific examples of CPPs containing moieties suitable for conjugation to the hybridized polynucleotides disclosed herein are provided, for example, in WO 2015 / 188197, the disclosures of which are incorporated herein by reference.

[0183] CPPs are positively charged peptides that can facilitate the delivery of biological cargo to cells. The cationic charge of CPPs is thought to be essential for their function. Furthermore, transduction of these proteins is not thought to be affected by cell type; they can efficiently transduce nearly all cells in culture without apparent toxicity (Nagahara et al., Nat. Med. 4:1449-52, 1998). In addition to full-length proteins, CPPs have also been shown to transduce DNA (Abu-Amer, as mentioned above), antisense polynucleotides (Astriab-Fisher et al., Pharm. Res. 19:744-54, 2002), small molecules (Polyakov et al., Bioconjug. Chem. 11:762-71, 2000), and even inorganic 40 nm iron particles (Dodd et al., J. Immunol. Methods 19:1449-52, 2000). 256:89-105, 2001; Wunderbaldinger et al., Bioconjug. Chem. 13:264-8, 2002; Lewin et al., Nat. Biotechnol. 18:410-4, 2000; Josephson et al., Bioconjug. Chem. 10:186-91, 1999), suggesting that there is considerable flexibility in particle size during this process.

[0184] In one example, a CPP useful in the methods and compositions described herein comprises a peptide characterized by substantial alpha helicity. It has been discovered that transfection is optimized when the CPP exhibits substantial alpha helicity. In another example, the CPP comprises a sequence containing basic amino acid residues substantially aligned along at least one face of the peptide. The CPPs described herein may be naturally occurring or synthetic peptides.

[0185] One or more cell-penetrating peptides (e.g., 1-6 or 1-3) can be attached to MOIETY or X2 in formula (V', V'', V''', V'''', V''''', or V'''''') by -LinkA-, as described herein.

[0186] The polynucleotide constructs and hybridized polynucleotide constructs disclosed herein can also include covalently attached neutral polymeric auxiliary moieties. The neutral polymer can be poly(C 1-6 alkylene oxides), such as poly(ethylene glycol) and poly(propylene glycol), and copolymers thereof, such as di- and triblock copolymers. Examples of other polymers include esterified poly(acrylic acid), esterified poly(glutamic acid), esterified poly(aspartic acid), poly(vinyl alcohol), poly(ethylene-co-vinyl alcohol), poly(N-vinylpyrrolidone), poly(ethyloxazoline), poly(alkyl acrylate), poly(acrylamide), poly(N-alkylacrylamide), poly(N-acryloylmorpholine), poly(lactic acid), poly(glycolic acid), poly(dioxane), poly(caprolactone), styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyurethane, N-isopropylacrylamide polymer, and poly(N,N-dialkylacrylamide). Exemplary polymeric auxiliary moieties can have molecular weights of less than 100, 300, 500, 1000, or 5000 Da (e.g., greater than 100 Da). Other polymers are known in the art.

[0187] One or more polymers (e.g., 1-6 or 1-3) can be attached to MOIETY or X2 in formula (V', V'', V''', V'''', V''''', or V'''''') by -LinkA-, as described herein.

[0188] Conjugation Linker In some aspects, the polynucleic acid molecules described herein have the formula (I):

[0189] [ka] or a salt thereof, or a stereoisomer thereof, wherein: X 1 are each independently O or S, X 2 are each independently O, S, NH, or a bond; MOIETY is an optionally substituted C 2-10 Alkane-tetrayl or group -M 1 -M 2 -M 3 - and each M 1 and each M 3 is independently absent or optionally substituted C 1-6 alkylene, and M 2 is an optionally substituted C 3-9 Heterocycle-tetrayl, optionally substituted C 6-10 arene-tetrayl, or optionally substituted C 3-8 is a cycloalkane-tetrayl; Each R 1 and each R 2 are independently H, optionally substituted C 1-16 Alkyl, optionally substituted C 2-16 Heteroalkyl, conjugation moiety, or -LinkA(-T) p but at least one R 1 or at least one R 2 is the conjugation moiety or -LinkA(-T) p It is assumed that R 3 are each independently H, optionally substituted C 1-16 Alkyl, optionally substituted C 2-16 Heteroalkyl, optionally substituted C 2-16 Alkenyl, optionally substituted C 2-16 Alkynyl, optionally substituted (C 1-9 Heterocyclyl)-C 1-6 -alkyl, optionally substituted (C 6-10 Aryl)-C1-6 -alkyl, optionally substituted (C 3-8 Cycloalkyl)-C 1-6 -Alkyl, conjugation moiety, or -LinkA(-T) p and R 4 is H, optionally substituted C 1-6 Alkyl, -LinkA(-T) p , or -Sol, LinkA are each independently a polyvalent linker (e.g., comprising —C(O)—N(H)— (e.g., at least one polyvalent linker comprising —C(O)—N(H)— attached to T)); T are each independently an auxiliary moiety; Sol is a solid support, m is an integer from 1 to 6, n is independently 0 or 1; p's are each independently an integer of 1 to 6, q is an integer of 0 to 3. At least one group of formula (I) can be attached to the 5'-terminus, 3'-terminus, internucleoside phosphate, internucleoside phosphorothioate, or internucleoside phosphorodithioate of the polynucleotide. At least one group of formula (I) is attached to the internucleoside phosphate, internucleoside phosphorothioate, or internucleoside phosphorodithioate, and q is 0. The polynucleotide construct contains no more than one Sol.

[0190] The group -LinkA- can include 0 to 3 polyvalent monomers (e.g., optionally substituted C1-6alkane-triyl and optionally substituted C1-6alkane-tetrayl, or a trivalent nitrogen atom), and one or more divalent monomers (e.g., 1 to 40), where the divalent monomers are each independently selected from optionally substituted C1-6alkylene; optionally substituted C2-6alkenylene; optionally substituted C2-6alkynylene; optionally substituted C2-6alkynylene; optionally substituted C3-8 cycloalkylene; optionally substituted C3-8 cycloalkenylene; optionally substituted C6-14 arylene; optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O, and S; optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O, and S; imino; optionally substituted N; O; or S(O)m (m is 0, 1, or 2). In some embodiments, each monomer is independently an optionally substituted C alkylene; an optionally substituted C cycloalkylene; an optionally substituted C cycloalkenylene; an optionally substituted C arylene; an optionally substituted C heteroarylene having 1 to 4 heteroatoms selected from N, O, and S; an optionally substituted C heterocyclylene having 1 to 4 heteroatoms selected from N, O, and S; an imino; an optionally substituted N; O; or S(O) (m is 0, 1, or 2 (e.g., m is 2)). In certain embodiments, the monomers are each independently an optionally substituted C alkylene; an optionally substituted C cycloalkylene; an optionally substituted C cycloalkenylene; an optionally substituted C arylene; an optionally substituted C heteroarylene having 1 to 4 heteroatoms selected from N, O, and S; an optionally substituted C heterocyclylene having 1 to 4 heteroatoms selected from N, O, and S; an optionally substituted N; O; or S(O) (m is 0, 1, or 2 (e.g., m is 2)).The non-bioreversible linker connecting the auxiliary moiety to the conjugate moiety or its reaction product can comprise 2 to 500 (e.g., 2 to 300 or 2 to 200) such monomers. The group -LinkA- can include poly(alkylene oxide) (e.g., polyethylene oxide, polypropylene oxide, poly(trimethylene) oxide), polybutylene oxide, poly(tetramethylene) oxide, and diblock or triblock copolymers thereof. In some embodiments, the non-bioreversible linker comprises polyethylene oxide (e.g., poly(ethylene oxide) having a molecular weight of less than 1 kDa).

[0191] The group -LinkA(-T) of formula (I) p may be prepared by the processes described in the section below. In some examples, -LinkA(-T) p is represented by formula (II) -Q 1 -Q 2 ([-Q 3 -Q 4 -Q 5 ] s -Q 6 -T) p (II) wherein each s is independently an integer from 0 to 20 (e.g., 0 to 10), and the repeat units are the same or different; Q 1 is a conjugation linker (e.g., [-Q 3 -Q 4 -Q 5 ] s -Q C -, in this case, Q C is optionally replaced by C 2-12 Heteroalkylene (e.g., heteroalkylene containing -C(O)-N(H)-, -N(H)-C(O)-, -S(O)-N(H)-, or -N(H)-S(O)-), optionally substituted C 1-12 Thioheterocyclylenes (e.g.,

[0192] [ka] ), optionally replaced by C 1-12 Heterocyclylene (e.g., 1,2,3-triazole-1,4-diyl or

[0193] [ka] ), cyclobut-3-ene-1,2-dione-3,4-diyl, or pyrid-2-ylhydrazone), Q 2 is a linear group (e.g., [-Q 3 -Q 4 -Q 5 ] s -), or a branched group when p is an integer from 2 to 6 (e.g., [-Q 3 -Q 4 -Q 5 ] s -Q 7 ([-Q 3 -Q 4 -Q 5 ] s -(Q 7 ) p1 ) p2 , p1 is 0 or 1, and p2 is 0, 1, 2, or 3), Each Q 3 and each Q 6 are independently absent, —CO—, —NH—, —O—, —S—, —SO—, —OC(O)—, —COO—, —NHC(O)—, —C(O)NH—, —CH—, —CHNH—, —NHCH—, —CHO—, or —OCH—; Q 4 are each independently absent or optionally substituted C 1-12 Alkylene, optionally substituted C 2-12 Alkenylene, optionally substituted C 2-12 Alkynylene, optionally substituted C 2-12 Heteroalkylene, optionally substituted C 6-10 Arylene, optionally substituted C 1-9 heteroarylene, or optionally substituted C1-9 is heterocyclylene, Q 5 are each independently absent, -CO-, -NH-, -O-, -S-, -SO2-, -CH2-, -C(O)O-, -OC(O)-, -C(O)NH-, -NH-C(O)-, -NH-CH(R a )-C(O)-, or -C(O)-CH(R a )-NH-, Q 7 each independently represents an optionally substituted C 1-6 Alkane-triyl, optionally substituted C 1-6 Alkane-tetrayl, optionally substituted C 2-6 Heteroalkane-triyl or optionally substituted C 2-6 heteroalkane-tetrayl, R a are each independently H or an amino acid side chain, However, Q 3 , Q 4 , and Q 5 It is assumed that at least one of the following exists:

[0194] In some embodiments, Q 4 are each independently absent or optionally substituted C 1-12 Alkylene, optionally substituted C 2-12 Alkenylene, optionally substituted C 2-12 Alkynylene, optionally substituted C 2-12 heteroalkylene, or optionally substituted C 1-9 In certain examples, s is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0195] Thus, in formula (II), LinkA can contain a single branch point when each p1 is 0, or multiple branch points when at least one p1 is 1.

[0196] In formula (II), Q1 Ha-OQ L -Q C -, wherein Q L is optionally replaced by C 2-12 Heteroalkylene, optionally substituted C 1-12 alkylene, or -(optionally substituted C 1-6 alkylene)-(optionally substituted C 6-10 In some embodiments, Q is L is an optionally substituted C 2-12 Heteroalkylene or optionally substituted C 1-12 In formula (II), Q is an alkylene. C teeth,

[0197] [ka] may be.

[0198] In formula (II), Q 2 is the formula [-Q 3 -Q 4 -Q 5 ] s -, where Q 3 , Q 4 , and Q 5 is as defined in formula (II). Alternatively, Q 2 is a branched group [-Q 3 -Q 4 -Q 5 ] s -Q 7 ([-Q 3 -Q 4 -Q 5 ] s -(Q 7 ) p1 ) p2 wherein Q 7 each independently represents an optionally substituted C 1-6 Alkane-triyl, optionally substituted C 1-6 Alkane-tetrayl, optionally substituted C 2-6 Heteroalkane-triyl or optionally substituted C2-6 heteroalkane-tetrayl, During the ceremony, p1 is 0 or 1, p2 is 0, 1, 2, or 3; where: when p1 is 0, LinkA is a trivalent or tetravalent linker; When p1 is 1, LinkA is a tetravalent, pentavalent, or hexavalent linker. In certain embodiments, p1 is 0. In some embodiments, Q 7 teeth,

[0199] [ka] is.

[0200] Compounds that can be used to prepare the group -LinkA(-T)p in formula (I) are described herein as well as in WO 2015 / 188197. Non-limiting examples of -LinkA include:

[0201] [ka]

[0202] [ka]

[0203] [ka] In the formula: R 18 is the bond to the MOIETY, R 19 are each independently a bond to an auxiliary moiety, m5 each independently represents an integer of 1 to 20; m6 each independently represents an integer of 1 to 10, m7 is an integer from 1 to 6, X 6 are each independently O or S. In formula (II), the conjugation linker has the formula [-Q 3 -Q 4 -Q 5 ] s -Q C -When -Q 2 ([-Q 3 -Q 4 -Q 5 ] s -Q 6 -T) p teeth,

[0204] [ka]

[0205] [ka] wherein R 20 Q 1 Q in C is a bond to R 19 are each independently a bond to an auxiliary moiety, m5 each independently represents an integer of 1 to 20; m6 each independently represents an integer of 1 to 10, m7 is an integer from 1 to 6, X 6 are each independently O or S.

[0206] In some aspects, the linkers described herein are cleavable. In some aspects, the linkers described herein are non-cleavable.

[0207] In some aspects, the polynucleic acid molecules described herein have the formula (IV):

[0208] [ka] and wherein the sense strand or the antisense strand is linked to at least one group of wherein at least one of Y1 or Y2 is a nucleotide from a polynucleic acid molecule.

[0209] In some examples, Y1 is the last nucleotide on the 3' end or the first nucleotide on the 5' end of one of the strands of the polynucleic acid molecule. In some examples, Y1 is the last nucleotide on the 3' end or the first nucleotide on the 5' end of the sense strand of the polynucleic acid molecule. In some examples, Y1 is the last nucleotide on the 3' end or the first nucleotide on the 5' end of the sense strand of the polynucleic acid molecule, and Y2 is a 3-hydroxy-propoxy group. In some examples, Y2 is the first nucleotide on the 5' end or the last nucleotide on the 3' end of one of the strands of the polynucleic acid molecule. In some examples, Y2 is the first nucleotide on the 5' end or the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule. In some examples, Y2 is the first nucleotide on the 5' end or the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule, and Y1 is a 3-hydroxy-propoxy group. In other examples, Y1 and Y2 are two consecutive nucleotides in one of the strands of the polynucleic acid molecule.

[0210] In some embodiments, a targeting moiety described herein is conjugated to the 3' end of the sense strand (e.g., Formula (IV') or (IV'''')). In some embodiments, a targeting moiety described herein is conjugated to the 5' end of the sense strand (e.g., Formula (IV') or (IV'''')). In some embodiments, a targeting moiety described herein is conjugated to the 3' end of the antisense strand (e.g., Formula (IV') or (IV'''')). In some embodiments, a targeting moiety described herein is conjugated to the 5' end of the antisense strand (e.g., Formula (IV') or (IV'''')).

[0211] [ka] Z in formula (IV') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or others.

[0212] [ka] Z in formula (IV'') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV'') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or others.

[0213] [ka] Z in formula (IV''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.

[0214] [ka] Z in formula (IV'''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV'''') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or other.

[0215] Pharmaceutical Composition Delivery of the polynucleotide molecules described herein can be achieved by contacting cells with the polynucleotide molecules described herein using a variety of methods, hi certain aspects, the polynucleotide molecules described herein are formulated with various excipients, vehicles, and carriers, as described in more detail elsewhere herein.

[0216] The pharmaceutical compositions described herein can be prepared by incorporating the hybridized polynucleotide constructs disclosed herein into a form suitable for administration to a subject using carriers, excipients, and vehicles. Frequently used excipients include magnesium carbonate, titanium dioxide, lactose, mannitol, and other sugars, talc, milk protein, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycol, and solvents such as sterile water, alcohol, glycerol, and polyhydric alcohols. Intravenous vehicles include fluid and nutritional supplements. Preservatives include antibacterial agents, antioxidants, chelating agents, and inert gases. Other pharmaceutically acceptable vehicles include aqueous solutions, non-toxic excipients containing salts, preservatives, buffers, etc., as described, for example, in Remington: The Science and Practice of Pharmacy, 21st Ed., Gennaro, Ed., Lippencott Williams & Wilkins (2005) and The United States Pharmacopeia: The National Formulary (USP 36 NF31), published in 2013. The pH and exact concentration of the various components of the pharmaceutical composition are adjusted according to routine techniques in the art. See Goodman and Gilman's, The Pharmacological Basis for Therapeutics.

[0217] The pharmaceutical composition described herein can be administered locally or systemically.The therapeutically effective amount will vary depending on factors such as the degree of infection of the subject, the age, sex and weight of the individual.Dosage regimen can be adjusted to achieve optimal therapeutic response.For example, several divided doses can be administered daily, or the dose can be reduced proportionally as indicated by the exigencies of the treatment situation.

[0218] Pharmaceutical compositions can be conventionally administered by injection (e.g., subcutaneous, intravenous, intraorbital, etc.), oral administration, ocular application, inhalation, topical application, or rectal administration. Depending on the route of administration, the pharmaceutical composition can be coated with a material to protect the pharmaceutical composition from the action of enzymes, acids, and other natural conditions that may inactivate the pharmaceutical composition. Pharmaceutical compositions can also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.

[0219] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The compositions will typically be sterile and fluid to the extent that easy syringability exists. Typically, the compositions will be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. The prevention of microbial action can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. Often, isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride, are used in the compositions. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0220] Sterile injectable solutions can be prepared by incorporating the required amount of the pharmaceutical composition in an appropriate solvent with one or a combination of the ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle containing a basic dispersion medium and the required other ingredients enumerated above.

[0221] For ease of administration and uniformity of dosage, it is particularly convenient to formulate parenteral compositions into unit dosage forms.As used herein, unit dosage form refers to a physically discrete unit suitable as a single dosage for a subject to be treated, each unit containing a predetermined amount of pharmaceutical composition calculated to produce a desired therapeutic effect associated with the necessary pharmaceutical vehicle.The specifications for unit dosage form relate to the characteristics of the pharmaceutical composition and the specific therapeutic effect to be achieved.The main pharmaceutical composition is formulated with a suitable and pharmaceutically acceptable vehicle in an acceptable dosage unit for convenient and effective administration in an effective amount.For compositions containing additional active ingredients, the dosage is determined by referring to the usual dosage and administration method of the ingredients.

[0222] The pharmaceutical composition can be orally administered in a unit dosage form with a carrier, for example, an enteric coating. The pharmaceutical composition and other ingredients can also be enclosed in a hard or soft shell gelatin capsule or compressed into a tablet. For oral therapeutic administration, the pharmaceutical composition can be incorporated with excipients and used in the form of ingestible tablets, troches, capsules, pills, wafers, etc. Such compositions and preparations should contain at least 1% by weight of the active compound. The percentage of the compositions and preparations can, of course, be varied and may preferably be between about 5% and about 80% by weight of the unit dosage form. Tablets, troches, pills, capsules, etc. may also contain binders such as tragacanth gum, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; disintegrating agents such as corn starch, potato starch, or alginic acid; lubricants such as magnesium stearate; and sweeteners such as sucrose, lactose, or saccharin, or flavorings such as peppermint, wintergreen oil, or cherry flavoring. When the unit-dosage form is a capsule, it may contain a liquid carrier in addition to the above-mentioned types of materials. Various other materials may be present as coatings or to otherwise modify the physical form of the unit-dosage form. For example, tablets, pills, or capsules may be coated with shellac, sugar, or both. Syrup or elixir may contain the drug, sucrose as a sweetener, methyl and propylparabens as preservatives, a dye, and a flavoring such as cherry or orange flavor. All materials used in preparing any unit dosage form should be of pharmaceutically acceptable purity and substantially non-toxic in the amounts employed. Moreover, pharmaceutical compositions can be incorporated into sustained-release preparations and formulations.

[0223] The pharmaceutical compositions described herein may include one or more penetration enhancers to enhance the bioavailability of the polynucleotide molecules described herein. International Publication No. WO 2000 / 67798, Muranishi, 1990, Crit. Rev. Ther. Drug Carrier Systems, 7, 1, and Lee et al., 1991, Crit. Rev. Ther. Drug Carrier Systems, 8, 91 are incorporated herein by reference in their entirety. In some embodiments, the penetration enhancer is for enteral use. In some embodiments, the penetration enhancer is for transdermal use. In some embodiments, the penetration enhancer is for promoting crossing of the blood-brain barrier. In some embodiments, the penetration enhancer improves permeability in oral, nasal, buccal, pulmonary, vaginal, or corneal delivery models. In some embodiments, the penetration enhancer is a fatty acid or a derivative thereof. In some embodiments, the penetration enhancer is a surfactant or a derivative thereof. In some embodiments, the penetration enhancer is a bile salt or a derivative thereof. In some embodiments, the penetration enhancer is a chelating agent or a derivative thereof. In some embodiments, the penetration enhancer is a non-chelating non-surfactant or a derivative thereof. In some embodiments, the penetration enhancer is an ester or a derivative thereof. In some embodiments, the penetration enhancer is an ether or a derivative thereof. In some embodiments, the penetration enhancer is arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, or a monoglyceride, diglyceride, or a pharmaceutically acceptable salt thereof. In one specific embodiment, the penetration enhancer is sodium caprate (C10).In some embodiments, the penetration enhancer is chenodeoxycholic acid (CDCA), ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycolic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate, or sodium glycodihydrofusidate. In some embodiments, the penetration enhancer is polyoxyethylene-9-lauryl ether or polyoxyethylene-20-cetyl ether.

[0224] With respect to the polynucleotide molecules described herein, suitable pharmaceutically acceptable salts include (i) salts formed with cations, e.g., sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, (ii) acid addition salts formed with inorganic acids, e.g., hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and (iii) salts formed with organic acids, e.g., acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like.

[0225] Although the hybridized polynucleotide constructs described herein do not require the use of excipients for delivery to target cells, the use of excipients can be advantageous in some embodiments. Thus, for delivery to target cells, the hybridized polynucleotide molecules described herein can be non-covalently bound to excipients to form complexes. Excipients can be used to modify biodistribution after delivery, improve uptake, increase the half-life or stability of the strands in the hybridized polynucleotide constructs (e.g., improve nuclease resistance), and / or increase targeting to specific cell or tissue types.

[0226] Exemplary excipients include condensing agents (e.g., agents capable of attraction to or binding to nucleic acids through ionic or electrostatic interactions), fusogenic agents (e.g., agents capable of fusion and / or transport across cell membranes), proteins that target specific cell or tissue types (e.g., thyrotropin, melanotropin, lectins, glycoproteins, surfactant protein A, or other proteins), lipids, lipopolysaccharides, lipid micelles or liposomes (e.g., phosphotidylcholine, fatty acids, glycolipids, ceramides, glycerides, cholesterol, or any of the foregoing). These include nanoparticles (e.g., silica, lipid, hydrocarbon, or other pharmaceutically acceptable polymer nanoparticles), cationic polymers, and anionic drugs (e.g., CROs), where typical cationic polymers include polyamines (e.g., polylysine, polyarginine, polyamidoamine, and polyethyleneimine), polyplexes, cholesterol, dendrimers (e.g., polyamidoamine (PAMAM) dendrimers), serum proteins (e.g., human serum albumin (HSA) or low-density lipoprotein (LDP)), and dendrimer-based vesicles (e.g., vesicles formed from phospholipids, such as any combination thereof). L), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), lipids, synthetic polymers (e.g., polylysine (PLL), polyethyleneimine, poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide) copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol poly(PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, pseudopeptide-polyamine, peptidomimetic polyamine, or polyamine), cationic moiety (e.g., cationic lipid, cationic porphyrin, polyamine quaternary salt, or alpha helical peptide), polyvalent sugar (e.g., polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, or polyvalent fucose), vitamin (e.g., vitamin A, vitamin E, vitamin K, vitamin B, folic acid,Vitamin B12, riboflavin, biotin, or pyridoxal), cofactors, or drugs that disrupt the cytoskeleton and increase uptake (e.g., taxol, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin).

[0227] Other therapeutic agents described herein may be included in the pharmaceutical compositions described herein in combination with the polynucleotide molecules described herein.

[0228] Treatment method In some aspects, the present specification describes a method for regulating mRNA expression of the FXI gene in a subject, the method comprising regulating mRNA expression of the FXI gene in a subject by administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein.

[0229] In some embodiments, the methods described herein reduce the expression of the FXI gene in a subject by about or at least 10% compared to a negative control. In some embodiments, the methods described herein reduce the expression of the FXI gene in a subject by about or at least 20% compared to a negative control. In some embodiments, the methods described herein reduce the expression of the FXI gene in a subject by about or at least 30% compared to a negative control. In some embodiments, the methods described herein reduce the expression of the FXI gene in a subject by about or at least 40% compared to a negative control. In some embodiments, the methods described herein reduce the expression of the FXI gene in a subject by about or at least 50% compared to a negative control. In some embodiments, the methods described herein reduce the expression of the FXI gene in a subject by about or at least 60% compared to a negative control. In some embodiments, the methods described herein reduce the expression of the FXI gene in a subject by about or at least 70% compared to a negative control. In some embodiments, the methods described herein reduce the expression of the FXI gene in a subject by about or at least 80% compared to a negative control. In some embodiments, the methods described herein reduce expression of the FXI gene in a subject by about or at least 90% compared to a negative control, hi some embodiments, the methods described herein reduce expression of the FXI gene in a subject by about 100% compared to a negative control.

[0230] In some embodiments, the methods described herein achieve an IC50 value of about 5 nM. In some embodiments, the methods described herein achieve an IC50 value of about 10 nM. In some embodiments, the methods described herein achieve an IC50 value of about 15 nM. In some embodiments, the methods described herein achieve an IC50 value of about 20 nM. In some embodiments, the methods described herein achieve an IC50 value of about 25 nM. In some embodiments, the methods described herein achieve an IC50 value of about 30 nM. In some embodiments, the methods described herein achieve an IC50 value of about 35 nM. In some embodiments, the methods described herein achieve an IC50 value of about 40 nM. In some embodiments, the methods described herein achieve an IC50 value of about 45 nM. In some embodiments, the methods described herein achieve an IC50 value of about 50 nM. In some embodiments, the methods described herein achieve an IC50 value of about 55 nM. In some embodiments, the methods described herein achieve an IC50 value of about 60 nM. In some embodiments, the methods described herein achieve an IC50 value of about 65 nM. In some embodiments, the methods described herein achieve an IC50 value of about 70 nM. In some embodiments, the methods described herein achieve an IC50 value of about 75 nM. In some embodiments, the methods described herein achieve an IC50 value of about 80 nM. In some embodiments, the methods described herein achieve an IC50 value of about 85 nM. In some embodiments, the methods described herein achieve an IC50 value of about 90 nM. In some embodiments, the methods described herein achieve an IC50 value of about 95 nM. In some embodiments, the methods described herein achieve an IC50 value of about 100 nM.

[0231] In some embodiments, the methods described herein achieve an IC50 value of about 1 μM. In some embodiments, the methods described herein achieve an IC50 value of about 1.1 μM. In some embodiments, the methods described herein achieve an IC50 value of about 1.2 μM. In some embodiments, the methods described herein achieve an IC50 value of about 1.3 μM. In some embodiments, the methods described herein achieve an IC50 value of about 1.4 μM. In some embodiments, the methods described herein achieve an IC50 value of about 1.5 μM. In some embodiments, the methods described herein achieve an IC50 value of about 2 μM. In some embodiments, the methods described herein achieve an IC50 value of about 4 μM. In some embodiments, the methods described herein achieve an IC50 value of about 6 μM. In some embodiments, the methods described herein achieve an IC50 value of about 8 μM. In some embodiments, the methods described herein achieve an IC50 value of about 10 μM. In some embodiments, the methods described herein achieve an IC50 value of about 12 μM. In some embodiments, the methods described herein achieve an IC50 value of about 13 μM. In some embodiments, the methods described herein achieve an IC50 value of about 14 μM. In some embodiments, the methods described herein achieve an IC50 value of about 15 μM. In some embodiments, the methods described herein achieve an IC50 value of about 30 μM. In some embodiments, the methods described herein achieve an IC50 value of about 35 μM. In some embodiments, the methods described herein achieve an IC50 value of about 40 μM. In some embodiments, the methods described herein achieve an IC50 value of about 50 μM. In some embodiments, the methods described herein achieve an IC50 value of about 60 μM. In some embodiments, the methods described herein achieve an IC50 value of about 80 μM. In some embodiments, the methods described herein achieve an IC50 value of about 100 μM. In some embodiments, the methods described herein achieve an IC50 value of about 120 μM. In some embodiments, the methods described herein achieve an IC50 value of about 160 μM.

[0232] In some aspects of the present specification, there is described a method for regulating FXI or FXIa protein levels or FXI or FXIa activity in a subject in need of such regulation, the method comprising administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, wherein the polynucleic acid molecule described herein, the polynucleic acid molecule conjugate described herein, or the pharmaceutical composition described herein regulates FXI or FXIa protein levels or FXI or FXIa activity in the subject.

[0233] In some other embodiments, the methods described herein reduce FXI or FXIa levels in a subject by about or at least 10% compared to a negative control. In some embodiments, the methods described herein reduce FXI or FXIa levels in a subject by about or at least 20% compared to a negative control. In some embodiments, the methods described herein reduce FXI or FXIa levels in a subject by about or at least 30% compared to a negative control. In some embodiments, the methods described herein reduce FXI or FXIa levels in a subject by about or at least 40% compared to a negative control. In some embodiments, the methods described herein reduce FXI or FXIa levels in a subject by about or at least 50% compared to a negative control. In some embodiments, the methods described herein reduce FXI or FXIa levels in a subject by about or at least 60% compared to a negative control. In some embodiments, the methods described herein reduce FXI or FXIa levels in a subject by about or at least 70% compared to a negative control. In some embodiments, the methods described herein reduce FXI or FXIa levels in a subject by about or at least 80% compared to a negative control. In some embodiments, the methods described herein reduce FXI or FXIa levels in a subject by about or at least 90% compared to a negative control. In some embodiments, the methods described herein reduce FXI or FXIa levels in a subject by about 100% compared to a negative control.

[0234] In some embodiments, the subject undergoing the methods described herein suffers from thrombosis. Optionally, the subject undergoing the methods described herein suffers from deep vein / venous thrombosis (DVT). In other embodiments, the subject undergoing the methods described herein suffers from ischemic stroke. In other embodiments, the subject undergoing the methods described herein suffers from atherosclerosis. In other embodiments, the subject undergoing the methods described herein suffers from myocardial infarction. In other embodiments, the subject undergoing the methods described herein suffers from venous thromboembolism (VTE). In other embodiments, the subject undergoing the methods described herein suffers from cardiovascular disease. In other embodiments, the subject undergoing the methods described herein suffers from ischemic heart disease (acute coronary syndrome). In other embodiments, the subject undergoing the methods described herein suffers from pulmonary embolism.

[0235] Illustrative Embodiments Embodiment 1. A polynucleic acid molecule for regulating expression of the coagulation factor XI (FXI) gene, comprising a nucleic acid sequence that is at least 80%, at least 85%, or at least 90% identical to a nucleic acid sequence in Tables 1-2 and 7-9.

[0236] Embodiment 2. The polynucleic acid molecule of embodiment 1, which is a single-stranded nucleic acid molecule.

[0237] Embodiment 3. The polynucleic acid molecule of embodiment 2, wherein the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, 18 contiguous nucleotides complementary to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220, with no more than 1, 2, 3, or 4 mismatches.

[0238] Embodiment 4. The polynucleic acid molecule of embodiment 2, wherein the single-stranded nucleic acid molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220.

[0239] Embodiment 5. The polynucleic acid molecule of embodiment 2, wherein the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, 18 consecutive nucleotides identical to a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216, with no more than 1, 2, 3, or 4 mismatches.

[0240] Embodiment 6. The polynucleic acid molecule of embodiment 2, wherein the single-stranded nucleic acid molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216.

[0241] Embodiment 7. The polynucleic acid molecule of embodiment 1, wherein the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand (passenger strand) and an antisense strand (guide strand).

[0242] Embodiment 8. The polynucleic acid molecule of embodiment 7, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220.

[0243] Embodiment 9. The polynucleic acid molecule of any one of embodiments 7 to 8, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1 to 50 and 215 to 216.

[0244] Embodiment 10. The polynucleic acid molecule of any one of embodiments 7 to 9, wherein the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 consecutive sequences of a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220, with no more than 1, 2, 3, or 4 mismatches.

[0245] Embodiment 11. The polynucleic acid molecule according to any one of embodiments 7 to 10, wherein the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive sequences of a nucleic acid sequence selected from SEQ ID NOs: 1-50 and 215-216, with 1, 2, 3, or 4 or fewer mismatches.

[0246] Embodiment 12. The polynucleic acid molecule according to any one of embodiments 7 to 11, wherein the sense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 101 to 150 and 220, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 1 to 50 and 215 to 216.

[0247] Embodiment 13. The polynucleic acid molecule according to any one of embodiments 7 to 12, wherein the sense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220.

[0248] Embodiment 14. The polynucleic acid molecule according to any one of embodiments 7 to 13, wherein the antisense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216.

[0249] Embodiment 15. The polynucleic acid molecule according to any one of embodiments 7 to 14, wherein the sense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, and the antisense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216.

[0250] Embodiment 16. The polynucleic acid molecule of any one of embodiments 5 to 15, wherein the antisense strand comprises 5'-nNfnnnnNfNfNfnnnnNfnNfnnnnnn-3', 5'-nNfnnnNfnnnnnnnNfnNfnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnn-3', or 5'-nNfnnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0251] Embodiment 17. The polynucleic acid molecule of any one of embodiments 1 to 16, comprising: (1) 2'-fluoro modified nucleotides; (2) 2'-O-methyl modified nucleotides; (3) 2'-deoxy modified nucleotides; or (4) a modified internucleotide linkage.

[0252] Embodiment 18. A polynucleic acid molecule according to any one of embodiments 1 to 17, comprising at least two consecutive modified internucleotide linkages at the 5'-end and / or the 3'-end.

[0253] Embodiment 19. The polynucleic acid molecule of any one of embodiments 7 to 18, wherein the antisense strand comprises at least two of the three internucleotide linkages at the 3' end replaced with modified internucleotide linkages.

[0254] Embodiment 20. The polynucleic acid molecule of any one of embodiments 7 to 19, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3', 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3', 5'-nnnnnnnnNfNfNfnnnnnnnnnn-3', or 5'-nnnnnnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', wherein "Nf" represents a 2'-fluoro modified nucleotide, "n" represents a 2'-O-methyl modified nucleotide, and "invdN" represents an inverted deoxynucleotide.

[0255] Embodiment 21. The polynucleic acid molecule of any one of embodiments 7 to 19, wherein the sense strand comprises 5'-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3' and the antisense strand comprises 5'-nNfnNfnNfnNfnNfnNfnnnNfnNfnNfnNfn-3', wherein "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0256] Embodiment 22. The polynucleic acid molecule of any one of embodiments 7 to 19, wherein the sense strand comprises 5'-nnnnnnNfnNfNfNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnNfnNfNfnnnnNfnNfnnnnnn-3', wherein "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0257] Embodiment 23. The polynucleic acid molecule of any one of embodiments 7 to 19, wherein the sense strand comprises 5'-nnnnnnnnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnnnnnnnnn-3', wherein "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0258] Embodiment 24. The polynucleic acid molecule of any one of embodiments 7 to 19, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0259] Embodiment 25. The polynucleic acid molecule of any one of embodiments 7 to 19, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnn-3', wherein "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

[0260] Embodiment 26. The polynucleic acid molecule of any one of embodiments 17 to 25, wherein the modified internucleotide linkage is a phosphorothioate internucleotide linkage.

[0261] Embodiment 27. The polynucleic acid molecule of embodiment 26, wherein the modified internucleotide linkage is a sterically enriched phosphorothioate internucleotide linkage.

[0262] Embodiment 28. A polynucleic acid molecule according to any one of claims 17 to 27, wherein the modified internucleotide linkage is an SP chiral internucleotide phosphorothioate linkage.

[0263] Embodiment 29. The polynucleic acid molecule of any one of embodiments 17 to 28, wherein the polynucleic acid comprises a plurality of modified internucleotide linkages, and at least 1, 2, 3, or 4 of the plurality of modified internucleotide linkages are stereochemically enriched phosphorothioate internucleotide linkages.

[0264] Embodiment 30. The polynucleic acid molecule of embodiment 29, wherein the stereochemically enriched phosphorothioate internucleotide linkages include both R and S isomers.

[0265] Embodiment 31. The polynucleic acid molecule of any one of embodiments 29 to 30, wherein the stereochemically enriched phosphorothioate is positioned between two consecutive nucleosides that are two of the six 5'- or 3'-terminal nucleosides of the sense strand or the antisense strand.

[0266] Embodiment 32. A polynucleic acid molecule according to any one of embodiments 1 to 31, comprising a hypoxanthine nucleobase-containing nucleoside substitution.

[0267] Embodiment 33 The polynucleic acid molecule of embodiment 32, wherein the hypoxanthine nucleobase-containing nucleoside substitution is an inosine substitution.

[0268] Embodiment 34 The polynucleic acid molecule of embodiment 33, wherein the inosine substitution is in the seed region of the antisense strand.

[0269] Embodiment 35. The polynucleic acid molecule of any one of embodiments 33-34, wherein the inosine substitution is within 7 nucleotides from the 5' end of the antisense strand.

[0270] Embodiment 36. The polynucleic acid molecule of any one of embodiments 33 to 35, wherein the inosine substitution is within the first nucleotide from the 5' end of the antisense strand.

[0271] Embodiment 37. The polynucleic acid molecule of embodiment 33, wherein the inosine substitution comprises 2'-O-methylinosine-3'-phosphate.

[0272] Embodiment 38. The polynucleic acid molecule of any one of embodiments 1 to 37, wherein the first nucleotide from the 5' end of the antisense strand is replaced by uridine or adenosine.

[0273] Embodiment 39. The polynucleic acid molecule of embodiment 38, wherein the uridine comprises 2'-O-methyluridine-3'-phosphate or the adenosine comprises 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0274] Embodiment 40. A polynucleic acid molecule according to any one of embodiments 1 to 39, comprising an abasic substitution.

[0275] Embodiment 41. The polynucleic acid molecule of embodiment 40, wherein the abasic substitution is at the fifth or seventh nucleotide from the 5' end.

[0276] Embodiment 42. The polynucleic acid molecule of any one of embodiments 1 to 41, wherein the cytotoxicity of the polynucleic acid molecule is reduced compared to the unmodified polynucleic acid.

[0277] Embodiment 43. The polynucleic acid molecule of any one of embodiments 7 to 42, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 151 to 200, 214, and 221.

[0278] Embodiment 44. The polynucleic acid molecule of any one of embodiments 7 to 43, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 51 to 100, 201 to 213, and 217 to 219.

[0279] Embodiment 45. A polynucleic acid molecule according to any one of embodiments 7 to 44, wherein the sense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 151 to 200, 214, and 221, and the antisense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 51 to 100, 201 to 213, and 217 to 219.

[0280] Embodiment 46. A polynucleic acid molecule according to any one of embodiments 1 to 45, which has a length of 19 to 25 base pairs.

[0281] Embodiment 47. A polynucleic acid molecule according to any one of embodiments 1 to 46, which has a length of 21 to 23 base pairs.

[0282] Embodiment 48. A polynucleic acid molecule for regulating the expression of the coagulation factor XI (FXI) gene, comprising: (a) an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, and a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220; or (b) an antisense strand comprising a nucleotide sequence selected from SEQ ID NOs: 54, 56 to 57, 59 to 61, 63 to 64, 85, 100, 201 to 213, and 217 to 219, and a sense strand comprising a nucleotide sequence selected from SEQ ID NOs: 154, 156 to 157, 159 to 161, 163 to 164, 185, 200, 214, and 221. A polynucleic acid molecule comprising:

[0283] Embodiment 49. (a) an antisense strand comprising the nucleotide sequence AUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 11), and a sense strand comprising the nucleotide sequence GCUUGCAACAAAGACAUUUAU (SEQ ID NO: 111); (b) an antisense strand comprising the nucleotide sequence AUGUCUUUGUUGCAAGCGCUUAU (SEQ ID NO: 9), and a sense strand comprising the nucleotide sequence AAGCGCUUGCAACAAAGACAU (SEQ ID NO: 109); (c) an antisense strand comprising the nucleotide sequence AAUGUCUUUGUUGCAAGCGCUUA (SEQ ID NO: 10), and a sense strand comprising the nucleotide sequence AGCGCUUGCAACAAAGACAUU (SEQ ID NO: 110); (d) an antisense strand comprising the nucleotide sequence UUAUAGUUUAUGCCCUUCAUGUC (SEQ ID NO: 13), and a sense strand comprising the nucleotide sequence CAUGAAGGGCAUAAACUAUAA (SEQ ID NO: 113); (e) an antisense strand comprising the nucleotide sequence AUAGGUAAAAAACUGGCAGCGGA (SEQ ID NO: 35), and a sense strand comprising the nucleotide sequence CGCUGCCAGUUUUUUACCUAU (SEQ ID NO: 135); (f) an antisense strand comprising the nucleotide sequence IUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 215) and a sense strand comprising the nucleotide sequence GCUUGCAACAAAGACAUUUAU (SEQ ID NO: 111); or (g) an antisense strand comprising the nucleotide sequence of UUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 216), and a sense strand comprising the nucleotide sequence of GCUUGCAACAAAGACAUUUAA (SEQ ID NO: 220); 49. The polynucleic acid molecule of embodiment 48, comprising:

[0284] Embodiment 50. A polynucleic acid molecule for regulating the expression of the coagulation factor XI (FXI) gene, comprising: (a) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 61), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (b) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcsaagcsgsc (SEQ ID NO: 211), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (c) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfsuGfcaagcsgsc (SEQ ID NO: 212), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (d) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaasgcsgsc (SEQ ID NO: 213), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (e) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 61), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau(invdT)(invdT) (SEQ ID NO: 214); (f) an antisense strand comprising the nucleotide sequence of asUfsgucuUfuguuGfcAfaGfcgcuusasu (SEQ ID NO: 204), and a sense strand comprising the nucleotide sequence of asasgcgcUfuGfcAfacaaagacau (SEQ ID NO: 159); (g) an antisense strand comprising the nucleotide sequence of asAfsugucUfuuguUfgCfaAfgcgcususa (SEQ ID NO: 205), and a sense strand comprising the nucleotide sequence of asgscgcuUfgCfaAfcaaagacauu (SEQ ID NO: 160); (h) an antisense strand comprising the nucleotide sequence of asUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 206), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (i) an antisense strand comprising the nucleotide sequence of usUfsauagUfuuauGfcCfcUfucaugsusc (SEQ ID NO: 207), and a sense strand comprising the nucleotide sequence of csasugaaGfgGfcAfuaaacuauaa (SEQ ID NO: 163); (j) an antisense strand comprising the nucleotide sequence of asUfsagguAfaaaaAfcUfgGfcagcgsgsa (SEQ ID NO: 209), and a sense strand comprising the nucleotide sequence of csgscugcCfaGfuUfuuuuaccuau (SEQ ID NO: 185); (k) an antisense strand comprising the nucleotide sequence of isUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 217), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); (l) an antisense strand comprising the nucleotide sequence of usUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 218), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuaa (SEQ ID NO: 222); or (m) an antisense strand comprising the nucleotide sequence of a4sUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 219), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuau (SEQ ID NO: 161); wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, and "U " refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, and "Tf" refers to refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

[0285] Embodiment 51. A polynucleic acid molecule conjugate for regulating the expression of coagulation factor XI (FXI) gene, comprising the polynucleic acid molecule of any one of embodiments 1 to 50 and an asialoglycoprotein receptor targeting moiety.

[0286] Embodiment 52 The polynucleic acid molecule conjugate of embodiment 51, wherein the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are joined via a linker.

[0287] Embodiment 53. The linker has the following formula (IV):

[0288] [ka] wherein at least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule.

[0289] Embodiment 54. The polynucleic acid molecule conjugate of embodiment 51, wherein Y1 is the last nucleotide on the 3'-end of the sense strand of the polynucleic acid molecule, or Y2 is the first nucleotide on the 5'-end of the sense strand of the polynucleic acid molecule.

[0290] Embodiment 55. The polynucleic acid molecule conjugate of embodiment 54, wherein Y1 and Y2 are two consecutive nucleotides in the polynucleic acid molecule.

[0291] Embodiment 56 The polynucleic acid molecule conjugate of any one of embodiments 51 to 55, wherein the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose.

[0292] Embodiment 57. A polynucleic acid molecule comprising a linker and an asialoglycoprotein receptor targeting moiety, together with the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule,

[0293] [ka]

[0294] [ka] wherein Z in formula (V'), (V''"), (V'''''), or (V'''''') is -H, -OH, -O-methyl, -F, or -O-methoxyethyl; and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or the like.

[0295] Embodiment 58. A pharmaceutical composition comprising a polynucleic acid molecule according to any one of embodiments 1 to 57 or a polynucleic acid molecule conjugate according to any one of embodiments 40 to 46, and a pharmaceutically acceptable excipient.

[0296] Embodiment 59. The pharmaceutical composition of embodiment 58, formulated as a nanoparticle formulation.

[0297] Embodiment 60. A pharmaceutical composition according to embodiment 58 or 59, formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.

[0298] Embodiment 61. A method for regulating mRNA expression of the coagulation factor XI (FXI) gene in a subject, comprising the step of regulating mRNA expression of the FXI gene in a subject by administering to the subject a polynucleic acid molecule described in any one of embodiments 1 to 57, a polynucleic acid molecule conjugate described in any one of embodiments 40 to 46, or a pharmaceutical composition described in any one of embodiments 58 to 60.

[0299] Embodiment 62. A method for regulating FXI or FXIa protein levels or FXI or FXIa activity in a subject in need of such regulation, comprising the step of regulating FXI or FXIa protein levels or FXI or FXIa activity in the subject by administering to the subject a polynucleic acid molecule described in any one of embodiments 1 to 57, a polynucleic acid molecule conjugate described in any one of embodiments 40 to 46, or a pharmaceutical composition described in any one of embodiments 58 to 60.

[0300] Embodiment 63 The method of embodiment 62, wherein the subject in need thereof is suffering from thrombosis or a symptom thereof. [Example]

[0301] These examples are provided for illustrative purposes only and do not limit the scope of the claims provided herein. In all of the sequences presented herein, the representation of the oligonucleotide structure is read from left to right (5' to 3'). The monomer codes present in the oligonucleotide code are linked by a 5'-3' phosphodiester bond (followed by a 3' internucleotide bond, read from left to right) unless otherwise specified. The abbreviations for the nucleotide monomers used in the representation of the oligonucleotide structure are as follows: "A" represents adenosine-3'-phosphate, "a" represents 2'-O-methyladenosine-3'-phosphate, "Af" represents 2'-fluoroadenosine-3'-phosphate, "dA" represents 2'-deoxyadenosine-3'-phosphate, "C" represents cytidine-3'-phosphate, "c" represents 2'-O-methylcytidine-3'-phosphate, "Cf" represents 2'-fluorocytidine-3'-phosphate, "dC" represents 2'-deoxycytidine-3'-phosphate, "G" represents guanosine-3'-phosphate, "g" represents 2'-O-methylguanosine-3'-phosphate, and "Gf" represents 2'-fluoroguanosine-3'-phosphate. "dG" represents 2'-deoxyguanosine-3'-phosphate, "U" represents uridine-3'-phosphate, "u" represents 2'-O-methyluridine-3'-phosphate, "Uf" represents 2'-fluorouridine-3'-phosphate, "dU" represents 2'-deoxyuridine-3'-phosphate, "T" represents 5-methyluridine-3'-phosphate, "t" represents 2'-O-methyl-5-methyluridine-3'-phosphate, "Tf" represents 2'-fluoro-5-methyluridine-3'-phosphate, "dT" represents thymidine-3'-phosphate, and "s" represents 3'-phosphorothioate.

[0302] Example 1 - In vitro efficacy of siRNA targeting FXI A panel of siRNAs was generated (shown in Table 1), and the passenger / sense strands were each conjugated with a triantennary GalNAc moiety (GalNAcL96). The siRNA-GalNAc conjugates were evaluated in vitro on primary human hepatocytes.

[0303] Thaw cryopreserved primary human hepatocytes and plate 5.4 x 10 cells per well on a collagen-coated 96-well plate. 4 Hepatocytes were seeded at a density of 100 μg / ml cells. Hepatocytes were treated with siRNAs shown in Table 1, in which the passenger / sense strands were each conjugated to a triantennary GalNAc moiety, by incubation for 48 hours in the absence of transfection reagent (free uptake). Cells were treated with siRNAs at concentrations of 100 nM, 30 nM, or 10 nM. At the end of the incubation period, cells were lysed, mRNA was isolated, and target gene expression was measured by qPCR and normalized to the housekeeping gene, human GapDH, using standard protocols. Three replicates were performed for each siRNA dose level. The in vitro potencies of the siRNAs are listed in Table 3. The results in Table 3 are plotted in Figures 1 and 2. Table 4 shows the results for the positive control.

[0304] Example 2 - Drug response curves for selected FXI siRNAs A select group of siRNAs targeting FXI, shown in Table 2, was used, with the passenger / sense strands each conjugated to a tripartentary GalNAc moiety via an X2 linker (see formula (V')). For dose-response curve determination, primary human hepatocytes were plated at the appropriate density in 96-well plates. siRNA conjugated to the 3'-sense strand X2-GalNAc (via formula V') was added in triplicate at six concentrations for free uptake simultaneously with cell plating. Concentrations of 1000, 100, 10, 1, 0.1, and 0.01 nM were evaluated. After 48 hours of incubation, cells were harvested, and residual FXI mRNA was measured by RT-PCR and normalized to the housekeeping gene (GAPDH). IC50 values ​​and maximum FXI mRNA silencing were determined, and the results are listed in Table 5.

[0305] Example 3 - In Vivo Efficacy of siRNA Targeting FXI in Cynomolgus Monkeys Using the siRNA targeting FXI, i.e., SRS-000007 shown in Table 2, the passenger / sense strand (SEQ ID NO: 161) was conjugated to a triantennary GalNAc moiety at its 3' end via an X2 linker (see formula (V')). Female cynomolgus monkeys (n = 4 per treatment group / siRNA) received a single subcutaneous dose of saline or SRS-000007 at a dose level of 1 mg / kg or 5 mg / kg. Plasma samples were collected pre-dose (D7, D1) and on days 4, 8, 11, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, and 85 post-treatment. Circulating FXI protein levels in all plasma samples were analyzed using an FXI ELISA assay (Affinity Biologicals, product code FXI-AG). The results are shown in Figure 3. Results are plotted as percent change in circulating FXI protein levels compared to the pre-dose D1 time point.

[0306] Example 4 - In Vitro Dose Response in Primary Human Hepatocytes Using SRS-000007, which targets FXI, the passenger / sense strand was conjugated to a tripartentary GalNAc moiety via an X2 linker (see formula (V')), as shown in Table 2. For dose-response curve determination, three different donor lots of primary human hepatocytes were plated at appropriate densities in 96-well plates. SRS-000007 conjugated to the 3'-sense strand X2-GalNAc (via formula V') was added in triplicate at six concentrations for free uptake simultaneously with cell plating. Concentrations of 1000, 100, 10, 1, 0.1, and 0.01 nM were evaluated. After 72 hours of incubation, cells were harvested, and residual FXI mRNA was measured by RT-PCR and normalized to the housekeeping gene (GAPDH). IC50 values ​​and maximum FXI mRNA silencing were determined, and the results are listed in Table 6. Dose-response curves for each donor were plotted and are presented in FIG.

[0307] Example 5 - In Vivo Efficacy of siRNA Targeting FXI in Cynomolgus Monkeys The siRNAs targeting FXI shown in Table 7 were used. In the siRNAs SRS-000007, SRS-000236, SRS-000255, and SRS-000257, the passenger / sense strand was conjugated to a triantennary GalNAc moiety at the 3' end via an X2 linker (see formula (V')), respectively. In siRNA SRS-000258, the passenger / sense strand was conjugated to a triantennary GalNAc moiety at the 5' end via an X2 linker (see formula (V'')). Female cynomolgus monkeys (n=3 per treatment group / siRNA) received a single subcutaneous dose of 0.75 mg / kg. Plasma samples were collected pre-dose (D-7, D1) and on days 4, 8, 11, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, and 85 after treatment. Circulating FXI protein levels in all plasma samples were analyzed using an FXI ELISA assay (Affinity Biologicals, product code FXI-AG). Results are shown in Figure 5. Results are plotted as the percent change in circulating FXI protein levels relative to the mean pre-dose time point.

[0308] Example 6 - In Vivo Efficacy of siRNA Targeting FXI in Cynomolgus Monkeys The siRNAs targeting FXI shown in Table 8 were used. The passenger / sense strand was conjugated at the 3' end with a triantennary GalNAc moiety via an X2 linker (see formula (V')). Male cynomolgus monkeys (n=3 per treatment group / siRNA) received a single subcutaneous dose of 1.0 mg / kg. Plasma samples were collected pre-dose (D-15, D-8, and D1) and on days 8, 11, 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, 85, and 113 post-treatment. Circulating FXI protein levels in all plasma samples were analyzed using an FXI ELISA assay (Affinity Biologicals, product code FXI-AG). Results are shown in Figure 6. Results are plotted as the percent change in circulating FXI protein levels compared to the mean pre-dose time point.

[0309] Example 7 - In vitro efficacy of siRNA targeting FXI Using SRS-000007 and SRS-002331 in Table 9, the passenger / sense strand was conjugated to a tripartentary GalNAc moiety via an X2 linker (see formula (V')). To determine dose-response curves, two different donor lots of primary human hepatocytes were plated in 96-well plates at appropriate densities. siRNA was added in triplicate at eight concentrations for free uptake simultaneously with cell plating. Concentrations of 10,000, 1,000, 100, 10, 1, 0.1, 0.01, and 0.001 nM were evaluated. After 72 hours of incubation, cells were harvested, and residual FXI mRNA was measured by RT-PCR and normalized to the housekeeping gene (GAPDH). IC50 values ​​and maximum FXI mRNA silencing were determined, and the results are listed in Table 10. The dose-response curves for each donor were plotted and are presented in Figure 7.

[0310] Example 8 - In Vivo Efficacy of siRNA Targeting FXI in Cynomolgus Monkeys The siRNAs targeting FXI shown in Table 9 were used. The passenger / sense strand was conjugated at the 3' end to a triantennary GalNAc moiety via an X2 linker (see formula (V')). Cynomolgus monkeys were subcutaneously administered. Plasma samples were collected before and at various time points after administration. Circulating FXI protein levels in all plasma samples were analyzed using an FXI ELISA assay (Affinity Biologicals, product code FXI-AG) and compared to pre-administration levels.

[0311] While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the present disclosure. It is understood that various alternatives to the embodiments of the present disclosure described herein may be employed in practicing the present disclosure. The following claims define the scope of the disclosure, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.

[0312] [Table 2-1]

[0313] [Table 2-2]

[0314] [Table 2-3]

[0315] [Table 3-1]

[0316] [Table 3-2]

[0317] [Table 4-1]

[0318] [Table 4-2]

[0319] [Table 5]

[0320]

Table 6

[0321]

Table 7

[0322]

Table 8

[0323]

Table 9

[0324]

Table 10

[0325]

Table 11

Claims

1. A polynucleic acid molecule for regulating the expression of the coagulation factor XI (FXI) gene, comprising a nucleic acid sequence that is at least 80%, at least 85%, or at least 90% identical to a nucleic acid sequence in Tables 1-2 and 7-9.

2. The polynucleic acid molecule of claim 1, wherein the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand (passenger strand) and an antisense strand (guide strand).

3. 3. The polynucleic acid molecule of claim 2, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220.

4. The polynucleic acid molecule according to any one of claims 2 to 3, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 1 to 50 and 215 to 216.

5. 5. The polynucleic acid molecule of any one of claims 2 to 4, wherein the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 contiguous sequences of a nucleic acid sequence selected from SEQ ID NOs: 101-150 and 220, with no more than 1, 2, 3, or 4 mismatches.

6. 6. The polynucleic acid molecule of any one of claims 2 to 5, wherein the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive sequences of a nucleic acid sequence selected from SEQ ID NOs: 1 to 50 and 215 to 216, with 1, 2, 3, or 4 or less mismatches.

7. The polynucleic acid molecule according to any one of claims 2 to 6, wherein the sense strand comprises the nucleic acid sequences of SEQ ID NOs: 101 to 150 and 220, and the antisense strand comprises the nucleic acid sequences of SEQ ID NOs: 1 to 50 and 215 to 216.

8. The polynucleic acid molecule of any one of claims 2 to 7, wherein the sense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220.

9. The polynucleic acid molecule according to any one of claims 2 to 8, wherein the antisense strand comprises a nucleic acid sequence that is at least 90%, at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216.

10. 10. The polynucleic acid molecule according to any one of claims 2 to 9, wherein the sense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220, and the antisense strand comprises a nucleic acid sequence selected from SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216.

11. 11. The polynucleic acid molecule of any one of claims 2 to 10, wherein the antisense strand comprises 5'-nNfnnnnNfnNfnnnnnnNfnNfnnnnnnnn-3', 5'-nNfnnnnNfnnnnnnnnNfnNfnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnnnnnnnn-3', 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnnn-3', or 5'-nNfnnnnnnnnnnNfnNfnNfnnnnnnnn-3', wherein "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

12. 12. The polynucleic acid molecule of any one of claims 2 to 11, wherein the sense strand comprises 5'-nnnnnnNfnNfnNfnnnnnnnnnnnn-3', 5'-nnnnnnNfnNfNfNfnnnnnnnnnnnn-3', 5'-nnnnnnnnNfNfNfNfnnnnnnnnnnnn-3', or 5'-nnnnnnNfnNfnNfnNfnnnnnnnnnn-invdN-invdN-3', wherein "Nf" represents a 2'-fluoro modified nucleotide, "n" represents a 2'-O-methyl modified nucleotide, and "invdN" represents an inverted deoxynucleotide.

13. 13. The polynucleic acid molecule of any one of claims 2 to 12, wherein the sense strand comprises 5'-nnnnnnnNfnNfnNfnnnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnnnnnnnNfnNfnNfnnnnnnnn-3', wherein "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

14. 13. The polynucleic acid molecule of any one of claims 2 to 12, wherein the sense strand comprises 5'-nnnnnnnNfnNfnNfnnnnnnnnnnnn-3' and the antisense strand comprises 5'-nNfnnnnNfnnnnNfnNfnNfnnnnnnnn-3', wherein "Nf" represents a 2'-fluoro modified nucleotide and "n" represents a 2'-O-methyl modified nucleotide.

15. 15. The polynucleic acid molecule of any one of claims 1 to 14, comprising modified internucleotide linkages, which are optionally phosphorothioate internucleotide linkages.

16. 16. The polynucleic acid molecule of claim 15, wherein the modified internucleotide linkage is a sterically enriched phosphorothioate internucleotide linkage.

17. 17. The polynucleic acid molecule according to any one of claims 15 to 16, wherein the modified internucleotide linkage is a SP chiral internucleotide phosphorothioate linkage.

18. 18. The polynucleic acid molecule of any one of claims 15 to 17, wherein the polynucleic acid comprises a plurality of modified internucleotide linkages, and at least 1, 2, 3, or 4 of the plurality of modified internucleotide linkages are sterically enriched phosphorothioate internucleotide linkages.

19. 20. The polynucleic acid molecule of claim 18, wherein the stereochemically enriched phosphorothioate internucleotide linkages include both R and S isomers.

20. 20. The polynucleic acid molecule of any one of claims 18 to 19, wherein a stereochemically rich phosphorothioate is positioned between two consecutive nucleosides that are two of the six 5' or 3' terminal nucleosides of the sense strand or the antisense strand.

21. 21. The polynucleic acid molecule of any one of claims 1 to 20, wherein the polynucleic acid molecule comprises hypoxanthine nucleobase-containing nucleoside substitutions.

22. 22. The polynucleic acid molecule of claim 21, wherein said hypoxanthine nucleobase-containing nucleoside substitution is an inosine substitution optionally comprising 2'-O-methylinosine-3'-phosphate.

23. 23. The polynucleic acid molecule of claim 22, wherein the inosine substitution is in the seed region of the antisense strand.

24. 23. The polynucleic acid molecule of claim 22, wherein the inosine substitution is within 7 nucleotides from the 5' end of the antisense strand, and optionally the inosine substitution is within the first nucleotide from the 5' end of the antisense strand.

25. 25. The polynucleic acid molecule of any one of claims 1 to 24, wherein the first nucleotide from the 5' end of the antisense strand is substituted by a uridine or adenosine, optionally wherein the uridine comprises 2'-O-methyluridine-3'-phosphate, or optionally wherein the adenosine comprises 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

26. 26. The polynucleic acid molecule of any one of claims 1 to 25, wherein the sense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 151 to 200, 214, and 221.

27. 27. The polynucleic acid molecule of any one of claims 1 to 26, wherein the antisense strand comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a nucleic acid sequence selected from SEQ ID NOs: 51 to 100, 201 to 213, and 217 to 219.

28. 28. The polynucleic acid molecule according to any one of claims 1 to 27, wherein the sense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 151 to 200, 214, and 221, and the antisense strand comprises a nucleic acid sequence selected from the nucleic acid sequences of SEQ ID NOs: 51 to 100, 201 to 213, and 217 to 219.

29. A polynucleic acid molecule for regulating the expression of the coagulation factor XI (FXI) gene, comprising: (a) an antisense strand comprising the nucleotide sequences of SEQ ID NOs: 4, 6-7, 9-11, 13-14, 35, 50, and 215-216, and a sense strand comprising the nucleotide sequences of SEQ ID NOs: 104, 106-107, 109-111, 113-114, 135, 150, and 220; or (b) an antisense strand comprising the nucleotide sequences of SEQ ID NOs: 54, 56-57, 59-61, 63-64, 85, 100, 201-213, and 217-219, and a sense strand comprising the nucleotide sequences of SEQ ID NOs: 154, 156-157, 159-161, 163-164, 185, 200, 214, and 221. A polynucleic acid molecule comprising:

30. (a) an antisense strand comprising the nucleotide sequence AUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 11), and a sense strand comprising the nucleotide sequence GCUUGCAACAAAGACAUUUAU (SEQ ID NO: 111); (b) an antisense strand comprising the nucleotide sequence AUGUCUUUGUUGCAAGCGCUUAU (SEQ ID NO: 9), and a sense strand comprising the nucleotide sequence AAGCGCUUGCAACAAAGACAU (SEQ ID NO: 109); (c) an antisense strand comprising the nucleotide sequence AAUGUCUUUGUUGCAAGCGCUUA (SEQ ID NO: 10), and a sense strand comprising the nucleotide sequence AGCGCUUGCAACAAAGACAUU (SEQ ID NO: 110); (d) an antisense strand comprising the nucleotide sequence of UUAUAGUUUAUGCCCUUCAUGUC (SEQ ID NO: 13), and a sense strand comprising the nucleotide sequence of CAUGAAGGGCAUAAACUAUAA (SEQ ID NO: 113); (e) an antisense strand comprising the nucleotide sequence AUAGGUAAAAAAACUGGCAGCGGA (SEQ ID NO: 35), and a sense strand comprising the nucleotide sequence CGCUGCCAGUUUUUUACCUAU (SEQ ID NO: 135); (f) an antisense strand comprising the nucleotide sequence IUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 215), and a sense strand comprising the nucleotide sequence GCUUGCAACAAAGACAUUUAU (SEQ ID NO: 111); or (g) an antisense strand comprising the nucleotide sequence of UUAAAUGUCUUUGUUGCAAGCGC (SEQ ID NO: 216), and a sense strand comprising the nucleotide sequence of GCUUGCAACAAAGACAUUUAA (SEQ ID NO: 220); 30. The polynucleic acid molecule of claim 29, comprising:

31. A polynucleic acid molecule for regulating the expression of the coagulation factor XI (FXI) gene, comprising: (a) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 61), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuuau (SEQ ID NO: 161); (b) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcsaagcsgsc (SEQ ID NO: 211), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuuau (SEQ ID NO: 161); (c) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfsuGfcaagcsgsc (SEQ ID NO: 212), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuuau (SEQ ID NO: 161); (d) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaasgcsgsc (SEQ ID NO: 213), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuuau (SEQ ID NO: 161); (e) an antisense strand comprising the nucleotide sequence of asUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 61), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuuau(invdT)(invdT) (SEQ ID NO: 214); (f) an antisense strand comprising the nucleotide sequence of asUfsgucuUfuguuGfcAfaGfcgcuusasasu (SEQ ID NO: 204), and a sense strand comprising the nucleotide sequence of asasgcgcUfuGfcAfacaaagacau (SEQ ID NO: 159); (g) an antisense strand comprising the nucleotide sequence of asAfsugucUfuuguUfgCfaAfgcgcususa (SEQ ID NO: 205), and a sense strand comprising the nucleotide sequence of asgscgcuUfgCfaAfcaaagacauu (SEQ ID NO: 160); (h) an antisense strand comprising the nucleotide sequence of asUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 206), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuuau (SEQ ID NO: 161); (i) an antisense strand comprising the nucleotide sequence of usUfsauagUfuuauGfcCfcUfucaugsusc (SEQ ID NO: 207), and a sense strand comprising the nucleotide sequence of csasugaaGfgGfcAfuaaacuauaa (SEQ ID NO: 163); (j) an antisense strand comprising the nucleotide sequence of asUfsagguAfaaaaAfcUfgGfcagcgsgsa (SEQ ID NO: 209), and a sense strand comprising the nucleotide sequence of csgscugcCfaGfuUfuuuuaccuau (SEQ ID NO: 185); (k) an antisense strand comprising the nucleotide sequence of isUfsaaaugucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 217), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuuau (SEQ ID NO: 161); (l) an antisense strand comprising the nucleotide sequence of usUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 218), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuuaa (SEQ ID NO: 222); or (m) an antisense strand comprising the nucleotide sequence of a4sUfsaaauGfucuuUfgUfuGfcaagcsgsc (SEQ ID NO: 219), and a sense strand comprising the nucleotide sequence of gscsuugcAfaCfaAfagacauuuuau (SEQ ID NO: 161). wherein "A" refers to adenosine-3'-phosphate, "a" refers to 2'-O-methyladenosine-3'-phosphate, "Af" refers to 2'-fluoroadenosine-3'-phosphate, "dA" refers to 2'-deoxyadenosine-3'-phosphate, "C" refers to cytidine-3'-phosphate, "c" refers to 2'-O-methylcytidine-3'-phosphate, "Cf" refers to 2'-fluorocytidine-3'-phosphate, "dC" refers to 2'-deoxycytidine-3'-phosphate, "G" refers to guanosine-3'-phosphate, "g" refers to 2'-O-methylguanosine-3'-phosphate, "Gf" refers to 2'-fluoroguanosine-3'-phosphate, "dG" refers to 2'-deoxyguanosine-3'-phosphate, and "U " refers to uridine-3'-phosphate, "u" refers to 2'-O-methyluridine-3'-phosphate, "Uf" refers to 2'-fluorouridine-3'-phosphate, "dU" refers to 2'-deoxyuridine-3'-phosphate, "T" refers to 5-methyluridine-3'-phosphate, "t" refers to 2'-O-methyl-5-methyluridine-3'-phosphate, and "Tf" refers to 2'-O-methyl-5-methyluridine-3'-phosphate. refers to 2'-fluoro-5-methyluridine-3'-phosphate, "dT" refers to 2'-deoxythymidine-3'-phosphate, "s" refers to 3'-phosphorothioate, "invdT" refers to 3'-inverted thymidine, "i" refers to 2'-O-methylinosine-3'-phosphate, and "a4" refers to 2'-O-methyl-8-bromo-adenosine-3'-phosphate.

32. A polynucleic acid molecule conjugate for regulating the expression of the coagulation factor XI (FXI) gene, comprising the polynucleic acid molecule of any one of claims 1 to 31 and an asialoglycoprotein receptor targeting moiety.

33. 33. The polynucleic acid molecule conjugate of claim 32, wherein the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are joined via a linker.

34. The linker has the following formula (IV): 【Chemical 1】 wherein at least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule.

35. 35. The polynucleic acid molecule conjugate of claim 34, wherein Y1 is the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule or Y2 is the first nucleotide on the 5' end of the sense strand of the polynucleic acid molecule.

36. 35. The polynucleic acid molecule conjugate of claim 34, wherein Y1 and Y2 are two consecutive nucleotides in the polynucleic acid molecule.

37. 37. The polynucleic acid molecule conjugate of any one of claims 32 to 36, wherein said asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc) or galactose.

38. the linker and the asialoglycoprotein receptor targeting moiety, together with the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule, 【Chemistry 2】 【Chemistry 3】 As shown in wherein Z in formula (V'), (V''"), (V'''"), or (V''''") is -H, -OH, -O-methyl, -F, or -O-methoxyethyl; and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, an abasic moiety, or the like.

39. A pharmaceutical composition comprising the polynucleic acid molecule of any one of claims 1 to 31 or the polynucleic acid molecule conjugate of any one of claims 32 to 38, and a pharmaceutically acceptable excipient.

40. A method for regulating mRNA expression of the coagulation factor XI (FXI) gene in a subject, comprising the step of regulating mRNA expression of the FXI gene in the subject by administering to the subject a polynucleic acid molecule described in any one of claims 1 to 31, a polynucleic acid molecule conjugate described in any one of claims 32 to 38, or a pharmaceutical composition described in claim 39.

41. 40. A method of regulating FXI or FXIa protein levels or FXI or FXIa activity in a subject in need thereof, comprising the step of regulating the FXI or FXIa protein levels or FXI or FXIa activity in the subject by administering to the subject a polynucleic acid molecule of any one of claims 1 to 31, a polynucleic acid molecule conjugate of any one of claims 32 to 38, or a pharmaceutical composition of claim 39.

42. 42. The method of claim 41, wherein the subject in need thereof is suffering from thrombosis or a symptom thereof.