Immune cells with combinatorial gene perturbations
Combinatorial gene perturbations using recombinant nucleic acids enhance T cell proliferation and effector function in CAR-T cell therapy, addressing limitations by reducing gene expression in immune cells, thereby improving cancer treatment efficacy.
Patent Information
- Application Number
- JP2025515706
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-09-16
- Filing Date
- 2023-09-15
- Publication Date
- 2025-10-01
AI Technical Summary
CAR-T cell-based immunotherapy for cancer is limited by peripheral blood survival, reduced proliferation, effector function, susceptibility to suppression, and lack of memory T cell persistence, necessitating additional therapies targeting intrinsic T cell pathways.
Combinatorial gene perturbations using recombinant nucleic acids, such as guide RNAs and CRISPR-associated endonucleases, to reduce expression of genes like CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A in immune cells, enhancing T cell proliferation and target cell killing.
The combinatorial gene perturbations significantly enhance T cell proliferation and effector function, improving the efficacy of CAR-T cell therapy by reducing gene expression by up to 99% compared to control cells, thereby boosting the immune response against cancer cells.
Smart Images

Figure 2025532585000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 376,041, filed September 16, 2022, the disclosure of which is incorporated herein by reference in its entirety for all purposes.
[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically and is incorporated herein by reference in its entirety. The XML copy was created on XX / 20XX, is named XXXXXUS_sequencelisting.xml, and is X,XXX,XXX bytes in size. [Background technology]
[0003] background Cancer is a disease characterized by the uncontrolled proliferation of cells. Many approaches to treating cancer have been attempted, including drug and radiation therapy. Recent cancer treatments attempt to use the body's own immune cells to attack cancer cells. One promising approach uses T cells taken from the patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give T cells the new ability to target specific proteins. These receptors are chimeric because they combine antigen-binding and T-cell activation functions into a single receptor.
[0004] Immunotherapy using CAR-T cells is promising because the modified T cells have the potential to recognize cancer cells in order to more effectively target and destroy them. After engineering T cells with a CAR, the resulting CAR-T cells are introduced into patients to attack tumor cells. When CAR-T cells are infused into patients, they come into contact with target antigens on cells. The CAR-T cells bind to the antigen and become activated. Upon antigen engagement, the CAR T cells can exponentially proliferate, initiate antitumor cytokine production, and target tumor cell killing.
[0005] However, CAR-T cell-based immunotherapy remains limited. In particular, CAR-T cells may lack peripheral blood survival, have reduced proliferation and effector function, be susceptible to suppression and exhaustion, and may not provide memory T cell persistence. Therefore, additional therapies targeting intrinsic pathways of T cells are needed to address these limitations of CAR-T therapy.
[0006] Individual perturbations of the genes DNMT3A, TET2, CD5, DGKA, DGKZ, MAP4K1, CBLB, FAS, PTPN2, NR4A1, ZC3H12A, and CISH have been reported to enhance T cell proliferation or T cell-mediated target cell killing, features that have been reported to predict T cell efficacy in CAR T and other T cell therapeutic applications. While the effects of individual gene perturbations have been established, it is unclear whether co-perturbation of any two of these genes has a more pronounced effect on T cell proliferation or T cell-mediated target cell killing than the individual component genes. Summary of the Invention
[0007] overview In one aspect, provided herein is one or more recombinant nucleic acids comprising at least one sequence set forth in SEQ ID NOs: 12-207.
[0008] In some embodiments, the nucleic acid is a guide RNA.
[0009] In some embodiments, the nucleic acid further comprises a protein comprising a nuclease domain, wherein the nucleic acid and the protein form a ribonucleoprotein (RNP) complex.
[0010] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.
[0011] In some embodiments, the ribonucleoprotein (RNP) complex reduces expression of one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the RNP complex.
[0012] In some embodiments, the nucleic acid comprises a first nucleic acid and a second nucleic acid, wherein the first and second nucleic acids are different.
[0013] In some embodiments, the sequence includes the sequence set forth in SEQ ID NO:12 and the sequence set forth in SEQ ID NO:13.
[0014] In some embodiments, the sequence includes the sequence set forth in SEQ ID NO:21 and the sequence set forth in SEQ ID NO:13.
[0015] In some embodiments, the sequence includes the sequence set forth in SEQ ID NO:21 and the sequence set forth in SEQ ID NO:12.
[0016] In some embodiments, the sequence includes the sequence set forth in SEQ ID NO:12 and the sequence set forth in SEQ ID NO:14.
[0017] In some embodiments, the sequence includes the sequence set forth in SEQ ID NO:13 and the sequence set forth in SEQ ID NO:20.
[0018] In some embodiments, the sequence includes the sequence set forth in SEQ ID NO:21 and the sequence set forth in SEQ ID NO:20.
[0019] In some embodiments, the sequence includes the sequence set forth in SEQ ID NO:20 and the sequence set forth in SEQ ID NO:22.
[0020] In some embodiments, the sequence includes the sequence set forth in SEQ ID NO:17 and the sequence set forth in SEQ ID NO:13.
[0021] In some embodiments, the sequence includes the sequence set forth in SEQ ID NO:20 and the sequence set forth in SEQ ID NO:14.
[0022] In some embodiments, the sequence includes the sequence set forth in SEQ ID NO:21 and the sequence set forth in SEQ ID NO:22.
[0023] In some embodiments, the nucleic acid is a short hairpin RNA (shRNA). In some embodiments, the shRNA reduces expression of one or more of CD5, CBLB, CISH, DGKA, DNMT3A, PTPN2, TET2, and / or ZC3H12A in cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the shRNA. In some embodiments, the first and second nucleic acids are different.
[0024] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO:1.
[0025] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding a human CBLB comprising the sequence set forth in SEQ ID NO:2.
[0026] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human CISH comprising the sequence set forth in SEQ ID NO:3.
[0027] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding DGKA comprising the sequence set forth in SEQ ID NO:4.
[0028] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding DGKZ comprising the sequence set forth in SEQ ID NO:5.
[0029] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding DNMT3A comprising the sequence set forth in SEQ ID NO:6.
[0030] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding MAP4K1 comprising the sequence set forth in SEQ ID NO:7.
[0031] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding NR4A1 comprising the sequence set forth in SEQ ID NO:8.
[0032] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding TET2 comprising the sequence set forth in SEQ ID NO:10.
[0033] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding PTPN2 comprising the sequence set forth in SEQ ID NO:9.
[0034] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding ZC3H12A comprising the sequence set forth in SEQ ID NO:11.
[0035] In one embodiment, (1) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human CD5, comprising the sequence set forth in SEQ ID NO: 1; (2) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human CBLB, comprising the sequence set forth in SEQ ID NO: 2; (3) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human CISH, comprising the sequence set forth in SEQ ID NO: 3; (4) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding DGKA, comprising the sequence set forth in SEQ ID NO: 4; (5) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding DGKZ, comprising the sequence set forth in SEQ ID NO: 5; (6) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding DNMT3A, comprising the sequence set forth in SEQ ID NO: 6; (7) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding DNMT3A, comprising the sequence set forth in SEQ ID NO: 7. (9) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding MAP4K1 comprising the sequence set forth in SEQ ID NO: 10; (10) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 9; (11) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding NR4A1 comprising the sequence set forth in SEQ ID NO: 8; or (12) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding ZC3H12A comprising the sequence set forth in SEQ ID NO: 11.
[0036] In some embodiments, the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.
[0037] In some embodiments, the nucleic acid is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.
[0038] In some embodiments, the nucleic acid is an shRNA.
[0039] In some embodiments, the nucleic acid reduces expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.
[0040] In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding CD5 and comprises the sequence set forth in any one of SEQ ID NOs: 47-72. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding CBLB and comprises the sequence set forth in any one of SEQ ID NOs: 23-46. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding CISH and comprises the sequence set forth in any one of SEQ ID NOs: 73-95. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding DGKA and comprises the sequence set forth in any one of SEQ ID NOs: 181-204. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding DNMT3A and comprises the sequence set forth in any one of SEQ ID NOs: 96-122. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding TET2 and comprises the sequence set forth in any one of SEQ ID NOs: 147-175. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding PTPN2 and comprises the sequence set forth in any one of SEQ ID NOs: 123-146. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding ZC3H12A, and comprises the sequence set forth in any one of SEQ ID NOs: 176-180 and 205-207.
[0041] In some embodiments, the nucleic acid sequence comprises at least a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO:1, and a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human CBLB comprising the sequence set forth in SEQ ID NO:2.
[0042] In some embodiments, the nucleic acid sequence comprises at least a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding TET2 comprising the sequence set forth in SEQ ID NO:9, and a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human CBLB comprising the sequence set forth in SEQ ID NO:2.
[0043] In some embodiments, the nucleic acid sequence comprises at least a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding TET2 comprising the sequence set forth in SEQ ID NO:9, and a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO:1.
[0044] In some embodiments, the nucleic acid sequence comprises at least a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO: 1, and a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human CISH comprising the sequence set forth in SEQ ID NO: 3.
[0045] In some embodiments, the recombinant nucleic acid further comprises one or more of a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds a first antigen, a nucleotide sequence encoding a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds a second antigen, or a nucleotide sequence encoding a T cell receptor (TCR).
[0046] In some embodiments, the first antigen and the second antigen are different.
[0047] In some embodiments, the recombinant nucleic acid comprises, in a 5' to 3' direction, a TCR, a nucleic acid disclosed herein.
[0048] In some embodiments, the recombinant nucleic acid comprises, in a 5' to 3' direction, a nucleic acid disclosed herein, a TCR.
[0049] In some embodiments, the recombinant nucleic acid comprises, in a 5' to 3' direction, a CAR, a nucleic acid disclosed herein, and a priming receptor.
[0050] In some embodiments, the nucleic acid comprises, in a 5' to 3' direction, a priming receptor, a recombinant nucleic acid disclosed herein, and a CAR.
[0051] In some embodiments, the recombinant nucleic acid further comprises 5' homology directed repair arms and / or 3' homology directed repair arms that are complementary to the insertion site in the host cell chromosome.
[0052] In some embodiments, the recombinant nucleic acid comprises a 5' homology-directed repair arm and a 3' homology-directed repair arm.
[0053] In some embodiments, the recombinant nucleic acid is incorporated into an expression cassette or expression vector.
[0054] In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the recombinant nucleic acid.
[0055] In some embodiments, the nucleic acid comprises a first nucleic acid and a second nucleic acid, wherein the first nucleic acid and the second nucleic acid are encoded on a single nucleic acid.
[0056] In some embodiments, the first nucleic acid comprises a 5' homology-directed repair arm and the second nucleic acid comprises a 3' homology-directed repair arm.
[0057] In some embodiments, the first nucleic acid and the second nucleic acid are encoded on different nucleic acids.
[0058] In some embodiments, the first nucleic acid and the second nucleic acid are combined into a single expression cassette or a single expression vector.
[0059] In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the first nucleic acid and / or upstream of the second nucleic acid.
[0060] In some embodiments, the expression vector is a non-viral vector.
[0061] In one aspect, provided herein is an expression vector comprising one or more recombinant nucleic acids disclosed herein.
[0062] In some embodiments, the expression vector is a non-viral vector.
[0063] In some embodiments, the 5' and 3' ends of the recombinant nucleic acid(s) comprise one or more nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell.
[0064] In some embodiments, the insertion site is located at the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.
[0065] In some embodiments, the GSH locus is the GS94 locus.
[0066] In one embodiment, (1) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human CD5, comprising the sequence set forth in SEQ ID NO: 1; (2) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human CBLB, comprising the sequence set forth in SEQ ID NO: 2; (3) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human CISH, comprising the sequence set forth in SEQ ID NO: 3; (4) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding DGKA, comprising the sequence set forth in SEQ ID NO: 4; (5) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding DGKZ, comprising the sequence set forth in SEQ ID NO: 5; (6) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding DNMT3A, comprising the sequence set forth in SEQ ID NO: 6; (7) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding SEQ ID NO: Provided herein are immune cells comprising at least one or more nucleic acids selected from the group consisting of: (1) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding MAP4K1 comprising the sequence set forth in SEQ ID NO: 7; (2) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding TET2 comprising the sequence set forth in SEQ ID NO: 10; (3) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 9; (4) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding NR4A1 comprising the sequence set forth in SEQ ID NO: 8; or (5) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding ZC3H12A comprising the sequence set forth in SEQ ID NO: 11.
[0067] In some embodiments, the one or more nucleic acids are shRNA, siRNA, dsRNA, or antisense oligonucleotides.
[0068] In some embodiments, the one or more nucleic acids is an shRNA.
[0069] In some embodiments, the shRNA is complementary to an mRNA encoding CD5 and comprises the sequence set forth in any one of SEQ ID NOs: 47-72. In some embodiments, the shRNA is complementary to an mRNA encoding CBLB and comprises the sequence set forth in any one of SEQ ID NOs: 23-46. In some embodiments, the shRNA is complementary to an mRNA encoding CISH and comprises the sequence set forth in any one of SEQ ID NOs: 73-95. In some embodiments, the shRNA is complementary to an mRNA encoding DGKA and comprises the sequence set forth in any one of SEQ ID NOs: 181-204. In some embodiments, the shRNA is complementary to an mRNA encoding DNMT3A and comprises the sequence set forth in any one of SEQ ID NOs: 96-122. In some embodiments, the shRNA is complementary to an mRNA encoding TET2 and comprises the sequence set forth in any one of SEQ ID NOs: 147-175. In some embodiments, the shRNA is complementary to an mRNA encoding PTPN2 and comprises the sequence set forth in any one of SEQ ID NOs: 123-146. In some embodiments, the shRNA is complementary to an mRNA encoding ZC3H12A and comprises a sequence set forth in any one of SEQ ID NOs: 176-180 and 205-207.
[0070] In some embodiments, the cells further comprise a deletion of at least a first target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A.
[0071] In some embodiments, the method further comprises a deletion of at least a second target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A, wherein the first target gene and the second target gene are different.
[0072] In some embodiments, at least the first or second target gene(s) are deleted via CRISPR-Cas9 gene editing.
[0073] In some embodiments, expression of at least one or more target genes selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain a nucleic acid or that contain a target gene.
[0074] In one aspect, provided herein is an immune cell comprising a deletion of at least a first target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A.
[0075] In some embodiments, the method further comprises a deletion of at least a second target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A, wherein the first target gene and the second target gene are different.
[0076] In some embodiments, at least the first or second target gene(s) are deleted via CRISPR-Cas9 gene editing.
[0077] In some embodiments, expression of the at least first or at least second target gene in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain a deletion of the at least first or at least second target gene.
[0078] In one aspect, provided herein is an immune cell comprising a first guide RNA, wherein the first guide RNA comprises a sequence set forth in SEQ ID NOs: 12-22.
[0079] In some embodiments, the nucleic acid further comprises a second guide RNA comprising a sequence set forth in SEQ ID NOs: 12-22.
[0080] In some embodiments, the nucleic acid further comprises a protein comprising a nuclease domain, wherein the nucleic acid and the protein form a ribonucleoprotein (RNP) complex.
[0081] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.
[0082] In one aspect, provided herein is an immune cell comprising one or more nucleic acids comprising a first shRNA and a second shRNA, wherein the first shRNA and the second shRNA each comprise a sequence set forth in any one of SEQ ID NOs: 23 to 207.
[0083] In some embodiments, the first or second nucleic acid reduces expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, or ZC3H12A in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid.
[0084] In some embodiments, expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first or second nucleic acid.
[0085] In some embodiments, expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A is determined by a nucleic acid assay or a protein assay.
[0086] In some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.
[0087] In some embodiments, the protein assay comprises at least one of immunoblotting, fluorescence-activated cell sorting, flow cytometry, magnetic-activated cell sorting, or affinity-based cell separation.
[0088] In some embodiments, the cells further comprise one or more of a priming receptor comprising a first extracellular antigen-binding domain that specifically binds a first antigen, a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds a second antigen, or a T cell receptor (TCR).
[0089] In some embodiments, the immune cells are primary human immune cells.
[0090] In some embodiments, the primary immune cells are natural killer (NK) cells, natural killer T (NKT) cells, T cells, γδ T cells, CD8+ T cells, CD4+ T cells, primary T cells, T cell progenitors, or induced pluripotent stem cells (iPSCs).
[0091] In some embodiments, the primary immune cells are primary T cells.
[0092] In some embodiments, the primary immune cells are primary human T cells.
[0093] In some embodiments, the immune cells are virus-free.
[0094] In some embodiments, the immune cells are viable, virus-free primary cells.
[0095] In some embodiments, the immune cells are autoimmune cells.
[0096] In some embodiments, the immune cells are allogeneic immune cells.
[0097] In one aspect, provided herein are primary immune cells comprising at least one recombinant nucleic acid comprising a first nucleic acid comprising a sequence set forth in SEQ ID NOs: 12-207, wherein the primary immune cells do not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cells.
[0098] In one aspect, provided herein are viable virus-free primary cells comprising one or more ribonucleoprotein complexes (RNPs), wherein the RNPs comprise a nuclease domain and a guide RNA, and the guide RNA comprises a first nucleic acid comprising a sequence set forth in SEQ ID NOs: 12-22.
[0099] In some embodiments, the antibody further comprises a second, different nucleic acid comprising a sequence set forth in SEQ ID NOs: 12-207.
[0100] In one aspect, a primary immune cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid(s) complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid(s) comprises: (1) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO: 1; (2) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human CBLB comprising the sequence set forth in SEQ ID NO: 2; (3) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human CISH comprising the sequence set forth in SEQ ID NO: 3; (4) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding DGKA comprising the sequence set forth in SEQ ID NO: 4; (5) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding DGKZ comprising the sequence set forth in SEQ ID NO: 5; (6) a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding DNMT3A comprising the sequence set forth in SEQ ID NO: 6. (7) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding MAP4K1 comprising the sequence set forth in SEQ ID NO:7, (9) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding TET2 comprising the sequence set forth in SEQ ID NO:10, (10) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:9, (11) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding NR4A1 comprising the sequence set forth in SEQ ID NO:8, or (12) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding ZC3H12A comprising the sequence set forth in SEQ ID NO:11, wherein the 5' and 3' ends of the recombinant nucleic acid(s) comprise nucleotide sequences homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell.
[0101] In one aspect, a viable virus-free primary cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid(s) complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid(s) comprises: (1) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO: 1; (2) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human CBLB comprising the sequence set forth in SEQ ID NO: 2; (3) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human CISH comprising the sequence set forth in SEQ ID NO: 3; (4) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding DGKA comprising the sequence set forth in SEQ ID NO: 4; (5) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding DGKZ comprising the sequence set forth in SEQ ID NO: 5; (6) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding DNMT3A comprising the sequence set forth in SEQ ID NO: 6. (7) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding MAP4K1 comprising the sequence set forth in SEQ ID NO:7, (9) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding TET2 comprising the sequence set forth in SEQ ID NO:10, (10) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:9, (11) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding NR4A1 comprising the sequence set forth in SEQ ID NO:8, or (12) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding ZC3H12A comprising the sequence set forth in SEQ ID NO:11, wherein the 5' and 3' ends of the recombinant nucleic acid(s) comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell.
[0102] In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding CD5 and comprises the sequence set forth in any one of SEQ ID NOs: 47-72. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding CBLB and comprises the sequence set forth in any one of SEQ ID NOs: 23-46. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding CISH and comprises the sequence set forth in any one of SEQ ID NOs: 73-95. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding DGKA and comprises the sequence set forth in any one of SEQ ID NOs: 181-204. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding DNMT3A and comprises the sequence set forth in any one of SEQ ID NOs: 96-122. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding TET2 and comprises the sequence set forth in any one of SEQ ID NOs: 147-175. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding PTPN2 and comprises the sequence set forth in any one of SEQ ID NOs: 123-146. In some embodiments, the nucleic acid sequence is an shRNA complementary to an mRNA encoding ZC3H12A, and comprises the sequence set forth in any one of SEQ ID NOs: 176-180 and 205-207.
[0103] In some embodiments, the cell further comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds a first antigen, and a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds a second antigen, wherein the first antigen and the second antigen are different.
[0104] In one aspect, provided herein is a population of cells comprising a plurality of immune cells disclosed herein.
[0105] In one aspect, provided herein is a pharmaceutical composition comprising an immune cell disclosed herein or a population of cells disclosed herein and a pharmaceutically acceptable excipient.
[0106] In one aspect, provided herein is a pharmaceutical composition comprising a recombinant nucleic acid disclosed herein, or a vector disclosed herein, and a pharmaceutically acceptable excipient.
[0107] In one embodiment, there is provided a method for editing immune cells, comprising: providing a ribonucleoprotein (RNP) comprising a nuclease domain and a guide RNA, wherein the guide RNA comprises a sequence set forth in SEQ ID NOs: 12 to 22; Non-viral introduction of RNP into immune cells, wherein the guide RNA specifically hybridizes to a target region in the genome of the primary immune cell, and the nuclease domain cleaves the target region to create a double-strand break in the genome of the immune cell. Provided herein is a method comprising:
[0108] In one embodiment, there is provided a method for editing immune cells, comprising: providing a ribonucleoprotein (RNP)-recombinant nucleic acid(s) complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid(s) comprise a recombinant nucleic acid(s) disclosed herein, wherein the 5' and 3' ends of the recombinant nucleic acid(s) comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of an immune cell; non-virally introducing an RNP-recombinant nucleic acid(s) complex into an immune cell, wherein the guide RNA specifically hybridizes to a target region in the genome of the primary immune cell and the nuclease domain cleaves the target region to create an insertion site in the genome of the immune cell; editing an immune cell via insertion of a recombinant nucleic acid(s) disclosed herein into an insertion site in the genome of the immune cell; A method is provided herein, comprising:
[0109] In some embodiments, the non-viral introducing comprises electroporation.
[0110] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.
[0111] In some embodiments, the target region of the cell's genome is the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.
[0112] In some embodiments, the recombinant nucleic acid(s) are double-stranded recombinant nucleic acid(s) or single-stranded recombinant nucleic acid(s).
[0113] In some embodiments, the recombinant nucleic acid(s) are linear recombinant nucleic acid(s) or circular recombinant nucleic acid(s), and optionally, the circular recombinant nucleic acid(s) are plasmids.
[0114] In some embodiments, the immune cells are primary human immune cells.
[0115] In some embodiments, the immune cells are autoimmune cells.
[0116] In some embodiments, the immune cells are allogeneic immune cells.
[0117] In some embodiments, the immune cells are natural killer (NK) cells, natural killer T (NKT) cells, T cells, γδ T cells, CD8+ T cells, CD4+ T cells, primary T cells, T cell progenitor cells, or induced pluripotent stem cells (iPSCs).
[0118] In some embodiments, the immune cells are primary T cells.
[0119] In some embodiments, the immune cells are primary human T cells.
[0120] In some embodiments, the immune cells are virus-free.
[0121] In some embodiments, the method further comprises obtaining immune cells from the patient and introducing the recombinant nucleic acid in vitro.
[0122] In one aspect, provided herein is a method of treating a disease in a subject, the method comprising administering to the subject an immune cell(s) disclosed herein or a pharmaceutical composition disclosed herein.
[0123] In some embodiments, the disease is cancer.
[0124] In some embodiments, the cancer is a solid cancer or a liquid cancer.
[0125] In some embodiments, the cancer is breast cancer, HER2-positive breast cancer, estrogen receptor-positive breast cancer, progesterone receptor-positive breast cancer, HER2- / estrogen receptor- / progesterone receptor-negative breast cancer, triple-negative breast cancer, non-small cell lung cancer (NSCLC), lung adenocarcinoma, lung squamous cell carcinoma, lung adenosquamous cell carcinoma, prostate cancer, castration-resistant prostate cancer, colon cancer, rectal cancer, microsatellite instability (MSI) colon cancer, non-MSI colon cancer, or non-MSI or rectal cancer.
[0126] In some embodiments, administration of the cell(s) enhances the immune response.
[0127] In some embodiments, the enhanced immune response is an adaptive immune response.
[0128] In some embodiments, the enhanced immune response is an increase in T cell cytotoxicity.
[0129] In some embodiments, the enhanced immune response is an increase in T cell expansion and / or proliferation.
[0130] In some embodiments, the enhanced immune response is an innate immune response.
[0131] In one aspect, provided herein is a method of enhancing an immune response in a subject, the method comprising administering to the subject an immune cell(s) disclosed herein or a pharmaceutical composition disclosed herein.
[0132] In some embodiments, the enhanced immune response is an adaptive immune response.
[0133] In some embodiments, the enhanced immune response is an increase in T cell cytotoxicity.
[0134] In some embodiments, the enhanced immune response is an increase in T cell expansion and / or proliferation.
[0135] In some embodiments, the enhanced immune response is an innate immune response.
[0136] In some embodiments, expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid or the RNP complex.
[0137] In some embodiments, expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid or the RNP complex.
[0138] In some embodiments, expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in immune cells is determined by a nucleic acid assay or a protein assay.
[0139] In some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.
[0140] In some embodiments, the protein assay comprises at least one of immunoblotting, fluorescence-activated cell sorting, flow cytometry, magnetic-activated cell sorting, or affinity-based cell separation.
[0141] In some embodiments, the method further comprises administering to the subject an immunotherapy, either simultaneously with or after the immune cells. [Brief explanation of the drawings]
[0142] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description and accompanying drawings.
[0143] [Figure 1] Figure 1 shows target cell killing in repeated stimulation assays by IC1T cells harboring individual or combined gene perturbations of the indicated genes compared to non-targeting control cells. Bars represent median values from 3-4 replicates, and error bars represent standard deviation. [Figure 2A] Target cell growth after incubation with T cells harboring a gene perturbation in the CD5 gene (single KO) or a gene perturbation in CD5 and a second gene as indicated (+CD5 KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR less than 0.05 and both indicated genes less than 0.01 are indicated with * and **, respectively. [Figure 2B] Growth of target cells after incubation with T cells harboring a gene perturbation in the CBLB gene (single KO) or a gene perturbation in CBLB and a second gene indicated (+CBLB KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR less than 0.05 and both indicated genes less than 0.01 are indicated with * and **, respectively. [Figure 2C] Growth of target cells after incubation with T cells harboring a gene perturbation in the CISH gene (single KO) or a gene perturbation in CISH and a second gene indicated (+CISH KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR less than 0.05 and both indicated genes less than 0.01 are indicated with * and **, respectively. [Figure 2D]Growth of target cells after incubation with T cells harboring a gene perturbation in the DNMT3A gene (single KO) or a gene perturbation in DNMT3A and a second gene indicated (+DNMT3A KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR less than 0.05 and both indicated genes less than 0.01 are indicated with * and **, respectively. [Figure 2E] Target cell growth after incubation with T cells harboring a gene perturbation in the DGKA gene (single KO) or a gene perturbation in DGKA and a second gene indicated (+DGKA KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR less than 0.05 and both indicated genes less than 0.01 are indicated with * and **, respectively. [Figure 2F] Target cell growth after incubation with T cells harboring a gene perturbation in the DGKZ gene (single KO) or a gene perturbation in DGKZ and a second gene indicated (+DGKZ KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR of less than 0.05 and less than 0.01 compared to the addition of both indicated genes are indicated with * and **, respectively. [Figure 2G]Growth of target cells after incubation with T cells harboring a gene perturbation in the MAP4K1 gene (single KO) or a gene perturbation in MAP4K1 and a second gene as indicated (+MAP4K1 KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR of less than 0.05 and less than 0.01 compared to the addition of both indicated genes are indicated with * and **, respectively. [Figure 2H] Figure 1 presents target cell growth after incubation with T cells harboring a gene perturbation in the NR4A1 gene (single KO) or a gene perturbation in NR4A1 and a second gene as indicated (+NR4A1 KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR of less than 0.05 and less than 0.01 compared to the addition of both indicated genes are indicated with * and **, respectively. [Figure 2I] Growth of target cells after incubation with T cells harboring a genetic perturbation in the PTPN2 gene (single KO) or a genetic perturbation in PTPN2 and a second gene as indicated (+PTPN2 KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional genetic perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR of less than 0.05 and both indicated genes with an FDR of less than 0.01 are indicated with * and **, respectively. [Figure 2J]Growth of target cells after incubation with T cells harboring a genetic perturbation in the TET2 gene (single KO) or a genetic perturbation in TET2 and a second gene indicated (+TET2 KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional genetic perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR less than 0.05 and both indicated genes less than 0.01 are indicated with * and **, respectively. [Figure 2K] Growth of target cells after incubation with T cells harboring a gene perturbation in the ZC3H12A gene (single KO) or a gene perturbation in ZC3H12A and a second gene indicated (+ZC3H12A KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior killing compared to the addition of the indicated gene with an FDR of less than 0.05 and less than 0.01 compared to the addition of both indicated genes are indicated with * and **, respectively. [Figure 3] Figure 1 shows T cell proliferation in repeated stimulation assays using integrated circuit T cells with individual or combined gene perturbations of the indicated genes compared to non-targeting control cells. Bars represent median values from 3-4 replicates, and error bars represent standard deviation. [Figure 4A] Figure 1 presents T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in CD5 (single KO) or a gene perturbation in CD5 and a second gene as indicated (+CD5 KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR less than 0.05 and both indicated genes with an FDR less than 0.01 are indicated with * and **, respectively. [Figure 4B]Figure 1 presents T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in CBLB (single KO) or a gene perturbation in CBLB and a second gene indicated (+CBLB KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR less than 0.05 and both indicated genes with an FDR less than 0.01 are indicated with * and **, respectively. [Figure 4C] T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in CISH (single KO) or a gene perturbation in CISH and a second gene indicated (+CISH KO) is presented. Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR less than .05 and both indicated genes with an FDR less than .01 are indicated with * and **, respectively. [Figure 4D] Figure 1 presents T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in DNMT3A (single KO) or a gene perturbation in DNMT3A and a second gene as indicated (+DNMT3A KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR less than .05 and both indicated genes with an FDR less than .01 are indicated with * and **, respectively. [Figure 4E]Figure 1 presents T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in DGKA (single KO) or a gene perturbation in DGKA and a second gene indicated (+DGKA KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR less than .05 and both indicated genes less than .01 are indicated with * and **, respectively. [Figure 4F] Figure 1 presents T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in DGKZ (single KO) or a gene perturbation in DGKZ and a second gene indicated (+DGKZ KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR less than 0.05 and both indicated genes with an FDR less than 0.01 are indicated with * and **, respectively. [Figure 4G] Figure 1 presents T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in MAP4K1 (single KO) or a gene perturbation in MAP4K1 and a second gene as indicated (+MAP4K1 KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR of less than 0.05 and both indicated genes with an FDR of less than 0.01 are indicated with * and **, respectively. [Figure 4H]
[0039] Figure 1 shows T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in NR4A1 (single KO) or a gene perturbation in NR4A1 and a second gene indicated (+NR4A1 KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR < 0.05 and < 0.01 compared to the addition of both indicated genes are indicated with an * and **, respectively. [Figure 4I] Figure 1 presents T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in PTPN2 (single KO) or a gene perturbation in PTPN2 and a second gene indicated (+PTPN2 KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR < 0.05 and < 0.01 compared to the addition of both indicated genes are indicated with * and **, respectively. [Figure 4J] Figure 1 presents T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in TET2 (single KO) or a gene perturbation in TET2 and a second gene indicated (+TET2 KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR < 0.05 and < 0.01 compared to the addition of both indicated genes are indicated with * and **, respectively. [Figure 4K]Figure 1 presents T cell proliferation after incubation of target cells with T cells harboring a gene perturbation in ZC3H12A (single KO) or a gene perturbation in ZC3H12A and a second gene indicated (+ZC3H12A KO). Open bars are perturbations of the indicated gene alone, filled bars are in combination with the indicated additional gene perturbation, and error bars represent standard deviation. Combinations showing superior T cell proliferation compared to the addition of the indicated gene with an FDR less than 0.05 and both indicated genes with an FDR less than 0.01 are indicated with * and **, respectively. [Figure 5] Graphs of the combined performance (log10 relative growth - log2 relative tumor growth) of ICT cells with the indicated gene perturbations are shown. [Figure 6A] Figure 1 shows a graph of tumor volume in mice implanted with ALPG / MSLN-expressing tumor cells and treated with logic gate-expressing tumor cells with the indicated genetic perturbations. Figure 2 shows tumor volume in mice with a DNMT3A / CBLB double knockout. [Figure 6B] Figure 1 shows graphs of tumor volume in mice implanted with ALPG / MSLN-expressing tumor cells and treated with logic gate-expressing tumor cells with the indicated genetic perturbations. Figure 2 shows tumor volume in mice with a TET2 / PTPN2 double knockout. [Figure 6C] Figure 1 shows a graph of tumor volume in mice implanted with ALPG / MSLN-expressing tumor cells and treated with logic gate-expressing tumor cells with the indicated genetic perturbations. Figure 2 shows tumor volume in mice with a CBLB / PTPN2 double knockout. [Figure 6D] Graphs of tumor volume in mice implanted with ALPG / MSLN-expressing tumor cells and treated with logic gate-expressing tumor cells with the indicated genetic perturbations are shown. Tumor volume in mice with a PTPN2 / CISH double knockout is shown. [Figure 6E]Graphs of tumor volume in mice implanted with ALPG / MSLN-expressing tumor cells and treated with logic gate-expressing tumor cells with the indicated genetic perturbations are shown. Tumor volume in mice with a PTPN2 / ZC3H12A double knockout is shown. [Figure 7A] Graphs of mRNA expression of target genes as measured by qPCR following expression of the indicated shRNAs are shown. Expression of CBLB following expression of the indicated shRNAs is shown. [Figure 7B] Graphs of mRNA expression of target genes as measured by qPCR following expression of the indicated shRNAs are shown. Figure 1 shows the expression of CD5 following expression of the indicated shRNAs. [Figure 7C] Graphs of mRNA expression of target genes as measured by qPCR following expression of the indicated shRNAs are shown. Graphs of CISH expression following expression of the indicated shRNAs are shown. [Figure 7D] Graphs of mRNA expression of target genes as measured by qPCR following expression of the indicated shRNAs are shown. Expression of DNMT3A following expression of the indicated shRNAs are shown. [Figure 7E] Graphs of mRNA expression of target genes as measured by qPCR following expression of the indicated shRNAs are shown. Figure 1 shows the expression of PTPN2 following expression of the indicated shRNAs. [Figure 7F] Figure 1 shows a graph of mRNA expression of target genes as measured by qPCR after expression of the indicated shRNAs. Figure 2 shows the expression of TET2 after expression of the indicated shRNAs. [Figure 7G] Graphs of mRNA expression of target genes as measured by qPCR following expression of the indicated shRNAs are shown. Expression of ZC3H12A following expression of the indicated shRNAs are shown. [Figure 7H] Graphs of mRNA expression of target genes measured by qPCR after expression of the indicated shRNAs are shown. Figure 1 shows the expression of DGKA after expression of the indicated shRNAs. [Figure 8A]Figure 1 shows gene expression analysis by RNAseq of cells expressing shRNA or validated sgRNA for ZC3H12A compared to the control. Dots represent individual genes that were differentially expressed in at least one of the cells expressing shRNA or sgRNA compared to the control. The horizontal axis represents the log fold change (logFC) of the gene in sgRNA-expressing cells compared to the control. The vertical axis represents the logFC of the gene in shRNA-expressing cells compared to the control. Figure 1 shows gene expression analysis of shRNA19-expressing and sgRNA-expressing cells for ZC3H12A compared to the control. [Figure 8B] Figure 1 shows gene expression analysis by RNAseq of cells expressing shRNA or validated sgRNA for ZC3H12A compared to the control. Dots represent individual genes that were differentially expressed in at least one of the cells expressing shRNA or sgRNA compared to the control. The horizontal axis represents the log fold change (logFC) of the gene in sgRNA-expressing cells compared to the control. The vertical axis represents the logFC of the gene in shRNA-expressing cells compared to the control. Figure 1 shows gene expression analysis of shRNA29-expressing and sgRNA-expressing cells for ZC3H12A compared to the control. [Figure 8C] Gene expression analysis by RNAseq of cells expressing shRNA or validated sgRNA for ZC3H12A compared to the control is shown. Dots represent individual genes that were differentially expressed in at least one of the cells expressing shRNA or sgRNA compared to the control. The horizontal axis represents the log fold change (logFC) of the gene in sgRNA-expressing cells compared to the control. The vertical axis represents the logFC of the gene in shRNA-expressing cells compared to the control. Gene expression analysis of shRNA10-expressing and sgRNA-expressing cells for ZC3H12A compared to the control is shown. [Figure 8D]Figure 1 shows gene expression analysis by RNAseq of cells expressing shRNA or validated sgRNA for ZC3H12A compared to the control. Dots represent individual genes that were differentially expressed in at least one of the cells expressing shRNA or sgRNA compared to the control. The horizontal axis represents the log fold change (logFC) of the gene in sgRNA-expressing cells compared to the control. The vertical axis represents the logFC of the gene in shRNA-expressing cells compared to the control. Figure 1 shows gene expression analysis of shRNA86-expressing and sgRNA-expressing cells for ZC3H12A compared to the control. [Figure 8E] Figure 1 shows gene expression analysis by RNAseq of cells expressing shRNA or validated sgRNA for ZC3H12A compared to the control. Dots represent individual genes that were differentially expressed in at least one of the cells expressing shRNA or sgRNA compared to the control. The horizontal axis represents the log fold change (logFC) of the gene in sgRNA-expressing cells compared to the control. The vertical axis represents the logFC of the gene in shRNA-expressing cells compared to the control. Figure 1 shows gene expression analysis of shRNA40-expressing and sgRNA-expressing cells for ZC3H12A compared to the control. [Figure 8F] Figure 1 shows gene expression analysis by RNAseq of cells expressing shRNA or validated sgRNA for ZC3H12A compared to the control. Dots represent individual genes that were differentially expressed in at least one of the cells expressing shRNA or sgRNA compared to the control. The horizontal axis represents the log fold change (logFC) of the gene in sgRNA-expressing cells compared to the control. The vertical axis represents the logFC of the gene in shRNA-expressing cells compared to the control. Figure 1 shows gene expression analysis of shRNA97-expressing and sgRNA-expressing cells for ZC3H12A compared to the control. [Figure 8G]Figure 1 shows gene expression analysis by RNAseq of cells expressing shRNA or validated sgRNA for ZC3H12A compared to the control. Dots represent individual genes that were differentially expressed in at least one of the cells expressing shRNA or sgRNA compared to the control. The horizontal axis represents the log fold change (logFC) of the gene in sgRNA-expressing cells compared to the control. The vertical axis represents the logFC of the gene in shRNA-expressing cells compared to the control. Figure 1 shows gene expression analysis of shRNA99- and sgRNA-expressing cells for ZC3H12A compared to the control. [Figure 8H] Figure 1 shows gene expression analysis by RNAseq of cells expressing shRNA or validated sgRNA for ZC3H12A compared to the control. Dots represent individual genes that were differentially expressed in at least one of the cells expressing shRNA or sgRNA compared to the control. The horizontal axis represents the log fold change (logFC) of the gene in sgRNA-expressing cells compared to the control. The vertical axis represents the logFC of the gene in shRNA-expressing cells compared to the control. Figure 1 shows gene expression analysis of shRNA106-expressing and sgRNA-expressing cells for ZC3H12A compared to the control. [Figure 9] Graphs of the combined performance (log10 relative growth - log2 relative tumor growth) of ICT cells expressing the indicated shRNA combinations are shown. DETAILED DESCRIPTION OF THE INVENTION
[0144] Detailed Description definition Terms used in the claims and specification, unless otherwise specified, are defined as set forth below.
[0145] As used herein, the term "locus" refers to a specific, fixed physical location on a chromosome where a gene or genetic marker is located.
[0146] The term "safe harbor locus" refers to a locus at which a gene or genetic element may be integrated without disrupting the expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS) or genomic safe harbor (GSH) sites. As used herein, safe harbor locus refers to an "integration site" or "knock-in site" at which a sequence encoding a transgene, as defined herein, may be inserted. In some embodiments, the insertion occurs with replacement of sequences located at the integration site. In some embodiments, the insertion occurs without replacement of sequences at the integration site. Examples of contemplated integration sites are provided in Table D.
[0147] As used herein, the term "insertion" refers to a nucleotide sequence that is integrated (inserted) into a target locus or safe harbor site. An insertion can be used to refer to a gene or genetic element that is integrated into a target locus or safe harbor site, for example, using homology-directed repair (HDR), CRISPR / Cas9 genome editing, or other methods for inserting nucleotide sequences into genomic regions known to those skilled in the art.
[0148] The term "insertion" refers to the manipulation of a nucleotide sequence to introduce a non-native sequence. This can be done, for example, by using restriction enzymes and ligases, whereby a DNA sequence of interest, usually encoding a gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with the appropriate restriction enzyme to create compatible overlaps, and then joining the molecules together using ligase. Those skilled in the art will be very familiar with such manipulations, and examples can be found in Sambrook et al. (Sambrook, Fritsch, & Maniatis, "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, 1989), which is incorporated herein by reference in its entirety, including any figures, drawings, and tables.
[0149] The "CRISPR / Cas" system refers to a broad class of bacterial systems for defense against foreign nucleic acids. CRISPR / Cas systems are found in a wide range of fungal and archaeal organisms. CRISPR / Cas systems include type I, type II, and type III subtypes. Wild-type type II CRISPR / Cas systems utilize an RNA-mediated nuclease, Cas9, in a complex with guide and activator RNAs to recognize and cleave foreign nucleic acids. Guide RNAs with both guide and activator RNA activity are also known in the art. In some cases, such dual-activity guide RNAs are referred to as small guide RNAs (sgRNAs).
[0150] Cas9 homologs are found in a wide variety of fungi, including, but not limited to, bacteria from the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologs are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1;10(5):726-737; Nat. Rev. Microbiol. 2011 June;9(6):467-477; Hou, et al., Proc Natl Acad Sci US A. 2013 Sep 24;110(39):15644-9; Sampson et al., Nature. 2013 May 9;497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21. The Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in host cells.
[0151] As used herein, the term "Cas9" refers to an RNA-mediated nuclease (e.g., of bacterial or archaeal origin or derived therefrom). Exemplary RNA-mediated nucleases include the aforementioned Cas9 protein and homologs thereof, including, but not limited to, CPF1 (see, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015). Similarly, as used herein, the term "Cas9 ribonucleoprotein" complex, etc., refers to a complex between a Cas9 protein and a crRNA (e.g., a guide RNA or a small guide RNA), a Cas9 protein and a trans-activating crRNA (tracrRNA), a Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex containing a Cas9 protein, a tracrRNA, and a crRNA guide RNA).
[0152] As used herein, the phrase "immune cell" includes all cell types that can give rise to immune cells, including hematopoietic cells, such as hematopoietic stem cells, pluripotent stem cells, and induced pluripotent stem cells (iPSCs). In some embodiments, the immune cell is a B cell, a macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell precursor, or a dendritic cell. In some embodiments, the cell is an innate immune cell.
[0153] As used herein, the term "primary" in the context of primary cells or primary stem cells refers to cells that have not been transformed or immortalized. Such primary cells can be cultured, subcultured, or passaged a limited number of times (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times). In some cases, primary cells are adapted to in vitro culture conditions. In some cases, primary cells are isolated from organisms, systems, organs, or tissues, optionally sorted, and used directly, for example, without culturing or subculturing. In some cases, primary cells are stimulated, activated, or differentiated. For example, primary T cells can be activated by contact with (e.g., culturing in the presence of) CD3, CD28 agonist, IL-2, IFN-γ, or a combination thereof.
[0154] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to cells that have completed maturation in the thymus and identified a specific foreign antigen in the body. These terms also refer to the major type of white blood cell that has various roles in the immune system, including activating and inactivating other immune cells. T cells can be any T cell, such as cultured T cells, e.g., primary T cells, or T cells from cultured T cell lines, e.g., Jurkat, SupT1, etc., or mammalian-derived T cells. T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., not cultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or subpopulations thereof. T cells can be CD3+ cells. T cells can be CD4+ cells. + , CD8 + , or CD4 + and CD8 +The T cell can be any type of T cell, CD4+ / CD8+ double-positive T cell, CD4+ helper T cell (e.g., Th1 and Th2 cells), CD8+ T cell (e.g., cytotoxic T cell), peripheral, including, but not limited to, blood mononuclear cells (PBMC), peripheral blood leukocytes (PBL), tumor-infiltrating lymphocytes (TIL), memory T cell, naive T cell, regulatory T cell, gamma delta T cell, etc. It can be any T cell at any stage of development. Additional types of helper T cell include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Additional types of memory T cell include cells such as central memory T cells (Tcm cells), effector memory T cells (Tem cells and TEMRA cells), etc. T cells can also refer to genetically modified T cells, such as T cells modified to express a T cell receptor (TCR), a chimeric antigen receptor (CAR), or a priming receptor (primeR). T cells can also be differentiated from stem or progenitor cells.
[0155] "CD4+ T cells" refer to a subset of T cells that express CD4 on their surface and are involved in cellular immune responses. CD4+ T cells are characterized by a post-stimulation secretory profile that can include secretion of cytokines such as IFN-γ, TNF-α, IL-2, IL-4, and IL-10. "CD4" is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but has also been found on other cells, including monocytes / macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and has been suggested as an associative recognition element in MHC (major histocompatibility complex) class II-restricted immune responses. On T lymphocytes, the CD4 antigen defines helper / inducer subsets.
[0156] "CD8+ T cells" refer to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells. The "CD8" molecule is a differentiation antigen present on thymocytes and on cytotoxic and suppressor T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is the associative recognition element in major histocompatibility complex class I restricted interactions.
[0157] As used herein, the phrase "hematopoietic stem cells" refers to a type of stem cell that can give rise to blood cells. Hematopoietic stem cells can give rise to myeloid or lymphoid cells, or a combination thereof. Hematopoietic stem cells are primarily found in the bone marrow, but they can also be isolated from peripheral blood, or fractions thereof. Various cell surface markers can be used to identify, select, or purify hematopoietic stem cells. In some cases, hematopoietic stem cells express c-kit + and lin - In some cases, human hematopoietic stem cells are identified as CD34 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells are identified as CD34 - , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells express CD133 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, mouse hematopoietic stem cells express CD34 lo / - , SCA-1 + , Thy1 + / lo , CD38+ , C-kit + , lin - In some cases, hematopoietic stem cells express CD150 + CD48 - CD244 - is.
[0158] As used herein, the phrase "hematopoietic cells" refers to cells derived from hematopoietic stem cells. Hematopoietic cells can be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood, or a fraction thereof). Alternatively, hematopoietic cells can be obtained or provided by isolating hematopoietic stem cells and differentiating the stem cells. Hematopoietic cells include cells with limited potential to differentiate into additional cell types. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells. Hematopoietic cells include lymphoid and myeloid cells, such as lymphocytes, erythrocytes, granulocytes, monocytes, and platelets.
[0159] As used herein, the term "construct" refers to a macromolecule or complex of molecules that includes a polynucleotide.
[0160] As used herein, the term "integration" refers to the process of stably inserting one or more nucleotides of a construct into a cell genome, i.e., covalently linking them to a nucleic acid sequence in the chromosomal DNA of the cell. It can also refer to a nucleotide deletion at the site of integration. If there is a deletion at the insertion site, "integration" can further include the replacement of the deleted endogenous sequence or nucleotides with one or more inserted nucleotides.
[0161] The terms "delete," "perturb," or "perturbation" with respect to a gene refer to a complete, partial, or functional deletion of the target gene.
[0162] The term "exogenous" refers to a molecule or activity that is introduced into a host cell and is not native to that cell. The molecule can be introduced, for example, by introduction of an encoding nucleic acid into the host genetic material, e.g., by integration into a host chromosome, or as non-chromosomal genetic material such as a plasmid. Thus, when used in reference to expression of an encoding nucleic acid, the term refers to introducing the encoding nucleic acid into a cell in an expressible form. The term "endogenous" refers to a molecule or activity that is present in a host cell under natural, unedited conditions. Similarly, when used in reference to expression of an encoding nucleic acid, the term refers to expression of an encoding nucleic acid that is contained within the cell and not exogenously introduced.
[0163] The term "heterologous" refers to a nucleic acid or polypeptide sequence or domain that is not native to the flanking sequences, e.g., a heterologous sequence is not found in nature coupled to a nucleic acid or polypeptide sequence that occurs at one or both termini.
[0164] The term "homologous" refers to a nucleic acid or polypeptide sequence or domain that is natural to the adjacent sequence, e.g., a homologous sequence is found in nature coupled to a nucleic acid or polypeptide sequence occurring at one or both termini.
[0165] As used herein, a "polynucleotide donor construct" refers to a nucleotide sequence (e.g., a DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide. The polynucleotide donor construct is transcribed into RNA and, optionally, translated into a polypeptide. The polynucleotide donor construct can include prokaryotic sequences, cDNA derived from eukaryotic mRNA, genomic DNA sequences derived from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, the polynucleotide donor construct can be an miRNA, an shRNA, a native polypeptide (i.e., a naturally occurring polypeptide) or a fragment thereof, or a variant polypeptide (e.g., a naturally occurring polypeptide having less than 100% sequence identity to the native polypeptide) or a fragment thereof.
[0166] As used herein, the terms "complementary" or "complementarity" refer to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are generally A and T (or A and U), and G and C. The guide RNAs described herein can include a DNA target sequence that is fully complementary or substantially complementary (e.g., has 1-4 mismatches) to a sequence, e.g., a genomic sequence in a cell.
[0167] As used herein, the term "transgene" refers to a polynucleotide that has been transferred from one organism to another, either naturally or by any of several genetic engineering techniques. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein. A "recombinant protein" is a protein that is encoded by a gene - recombinant DNA - that has been cloned in a system that supports expression of the gene and translation of messenger RNA (see expression system). The recombinant protein can be a therapeutic agent, e.g., a protein that treats a disease or disorder disclosed herein. As used, transgene can refer to a polynucleotide that encodes a polypeptide.
[0168] "Protein," "polypeptide," and "peptide" are used interchangeably herein.
[0169] As used herein, the terms "operably linked" or "operably linked" refer to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the function of the other. For example, a promoter is operably linked to a coding sequence or functional RNA if it is capable of affecting the expression of the coding sequence or functional RNA (i.e., the coding sequence or functional RNA is under the transcriptional control of the promoter). A coding sequence can be operably linked to a regulatory sequence in both sense and antisense orientation.
[0170] As used herein, the term "developmental cell state" refers, for example, to when a cell is inactive, actively developing, differentiating, senescent, etc. A developmental cell state can also refer to a cell in a precursor state (e.g., a T cell precursor).
[0171] As used, the term "encoding" refers to a nucleic acid sequence that encodes a protein or polypeptide of interest. The nucleic acid sequence can be either a DNA or an RNA molecule. In a preferred embodiment, the molecule is a DNA molecule. In another preferred embodiment, the molecule is an RNA molecule. When present as an RNA molecule, it contains a sequence that instructs the host cell's ribosomes to begin translation (e.g., a start codon, ATG) and a sequence that instructs the ribosomes to terminate translation (e.g., a stop codon). Between the start codon and the stop codon is an open reading frame (ORF). Such terms are known to those of skill in the art.
[0172] As used herein, the term "subject" refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs, and sheep. In certain embodiments, the subject is a human. In some embodiments, the subject has a disease or condition that can be treated with the engineered cells or populations thereof provided herein. In some aspects, the disease or condition is cancer.
[0173] As used herein, the term "promoter" refers to a nucleotide sequence (e.g., a DNA sequence) capable of controlling the expression of a coding sequence or functional RNA. A promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. A promoter can be derived entirely from a native gene, can be composed of different elements from different promoters found in nature, and / or can include synthetic DNA segments. A promoter, as contemplated herein, can be endogenous to the cell of interest or exogenous to the cell of interest. It will be understood by those skilled in the art that different promoters can induce gene expression in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions. As is known in the art, promoters can be selected according to the strength of the promoter and / or the conditions under which the promoter is active, e.g., constitutive promoters, strong promoters, weak promoters, inducible / repressible promoters, tissue-specific or developmentally regulated promoters, cell cycle-dependent promoters, etc.
[0174] The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., a CMV promoter, a UBC promoter). In some embodiments, the promoter may be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell-type specific promoter, etc.). See, e.g., U.S. Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.
[0175] As contemplated herein, gene editing can involve knocking in or knocking out a gene (or nucleotide sequence). As used herein, the term "knock-in" refers to the addition of a DNA sequence or a fragment thereof to a genome. Such a knocked-in DNA sequence may include an entire gene or multiple genes, and may include regulatory sequences associated with a gene or any portion or fragment thereof. For example, a polynucleotide donor construct encoding a recombinant protein can be inserted into the genome of a cell harboring a mutant gene. In some embodiments, the knock-in strategy involves replacing an existing sequence with a provided sequence, e.g., replacing a mutant allele with a wild-type copy. On the other hand, the term "knock-out" refers to the removal of a gene or the expression of a gene. For example, a gene can be knocked out by either deleting or adding a nucleotide sequence, which leads to a disruption of the reading frame. As another example, a gene can be knocked out by replacing a portion of the gene with an unrelated (e.g., non-coding) sequence.
[0176] As used herein, the term "non-homologous end joining" or NHEJ refers to a cellular process in which broken or nicked ends of a DNA strand are directly ligated without the need for a homologous template nucleic acid. NHEJ can result in the addition, deletion, substitution, or combination of one or more nucleotides at the repair site.
[0177] As used herein, "homologous recombination repair" or HDR refers to the cellular process in which the broken or nick end of a DNA strand is repaired by polymerization from a homologous template nucleic acid. Thus, the original sequence is replaced with the sequence of the template. The homologous template nucleic acid can be provided by a homologous sequence (sister chromatid, homologous chromosome, or repeat region on the same or different chromosome) located elsewhere in the genome. Alternatively, exogenous template nucleic acid can be introduced to obtain specific HDR-induced changes in the sequence at the target site. In this way, specific mutations can be introduced at the break site.
[0178] As used herein, single-stranded DNA template or double-stranded DNA template refers to the DNA oligonucleotide that can be used by cell as template for HDR.Generally, single-stranded DNA template or double-stranded DNA template has at least one region of homology with target site.In some cases, single-stranded DNA template or double-stranded DNA template has two homologous regions adjacent to the region that contains the heterologous sequence that is inserted into target cleavage site.
[0179] The terms "vector" and "plasmid" are used interchangeably and, as used herein, refer to a polynucleotide vehicle useful for introducing genetic material into a cell. A vector can be linear or circular. A vector can integrate into a target genome of a host cell or replicate independently within the host cell. A vector can include, for example, an origin of replication, a multicloning site, and / or a selectable marker. An expression vector typically includes an expression cassette. Vectors and plasmids include, but are not limited to, integrative vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.
[0180] As used herein, the term "introducing" in the context of introducing a nucleic acid or a complex containing a nucleic acid, such as an RNP-DNA template complex, refers to the translocation of the nucleic acid sequence or RNP-DNA template complex from outside the cell to inside the cell. In some cases, introducing refers to the translocation of the nucleic acid or complex from outside the cell to the nucleus of the cell. Various methods of such translocation are contemplated, including, but not limited to, electroporation, contact with nanowires or nanotubes, receptor-mediated internalization, translocation via cell-penetrating peptides, liposome-mediated translocation, etc.
[0181] As used herein, the term "expression cassette" refers to a recombinantly or synthetically produced polynucleotide construct that includes regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. For example, the regulatory sequences can facilitate transcription of the selected polynucleotide within the host cell, or transcription and translation of the selected polynucleotide within the host cell. The expression cassette can, for example, be integrated into the genome of the host cell or can be present in an expression vector.
[0182] As used herein, the phrase "subject in need thereof" refers to a subject who exhibits and / or is diagnosed with one or more symptoms or signs of a disease or disorder described herein.
[0183] "Chemotherapeutic agents" refer to chemical compounds useful in the treatment of cancer. Chemotherapeutic agents include "antihormonal agents" or "endocrine therapy agents" that act to regulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.
[0184] The term "composition" refers to a mixture containing, for example, engineered cells or nucleic acids as contemplated herein. In some embodiments, a composition may contain additional components, such as adjuvants, stabilizers, excipients, etc. The term "composition" or "pharmaceutical composition" refers to a preparation that is in a form that allows the biological activity of the active ingredients contained therein to be effective in treating a subject, and that does not contain additional ingredients that are unacceptably toxic to a subject in the amounts provided in the pharmaceutical composition.
[0185] The term "in situ" refers to processes that occur within living cells grown isolated from an organism, for example, grown in tissue culture.
[0186] The term "in vivo" refers to a process that occurs within a living organism.
[0187] As used herein, the term "ex vivo" generally includes experiments or measurements performed in or on living tissue, preferably in an artificial environment outside the organism, preferably with minimal variation from natural conditions.
[0188] As used herein, the term "mammal" includes both humans and non-humans, including, but not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.
[0189] The term percent "identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotide or amino acid residues that are identical when compared and aligned for maximum correspondence, as determined using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those of skill in the art), or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the entire length of the two sequences being compared.
[0190] For sequence comparison, typically, one sequence serves as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated as necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence(s) relative to the reference sequence based on the designated program parameters.
[0191] Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, 575 Science Dr., Madison, Wis.)), or by visual inspection (see generally Ausubel et al., infra).
[0192] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).
[0193] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example, an amount sufficient to modulate protein aggregation in a cell.
[0194] The term "therapeutically effective amount" is an amount effective to ameliorate symptoms of the disease.
[0195] The term "ameliorate" refers to any therapeutically beneficial outcome in the treatment of a disease state, for example, a cancer disease state, a reduction in its severity or progression, a remission thereof, or a cure thereof.
[0196] As used herein, the term "effective amount" refers to a sufficient amount of a compound (e.g., a composition described herein, a cell described herein) to produce a beneficial or desired result. An effective amount can be administered in one or more administrations, applications, or dosages, and is not intended to be limited to a particular formulation or route of administration.
[0197] As used herein, the term "treating" includes any effect that results in an improvement of the condition, disease, disorder, etc. or improves the symptoms thereof, e.g., alleviating, reducing, modulating, ameliorating, or eliminating.
[0198] The terms "modulate" and "modulation" refer to decreasing or inhibiting, or alternatively activating or increasing, the recited variable.
[0199] The terms "increase" and "activate" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater increase in the recited variable.
[0200] The terms "reduce" and "inhibit" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater decrease in the recited variable.
[0201] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.
[0202] Recombinant Nucleic Acid Compositions The CD5 antigen (CD5, HGNC:1685, NCBI Entrez Gene:921) is a member of the scavenger receptor cysteine-rich (SRCR) superfamily.
[0203] Cbl proto-oncogene B (CBLB, HGNC:1542, NCBI Entrez Gene:868) is an E3 ubiquitin protein ligase.
[0204] Cytokine-inducible SH2-containing protein (CISH, HGNC:1984, NCBI Entrez Gene:1154) is a member of the cytokine-inducible STAT inhibitor (CIS) protein family.
[0205] Diacylglycerol kinase alpha (DGKA, HGNC:2849, NCBI Entrez Gene:1606) acts as a regulator in intracellular signaling pathways, competing with protein kinase C for the second messenger diacylglycerol.
[0206] Diacylglycerol kinase zeta (DGKZ, HGNC:2857, NCBI Entrez Gene:8525), like DGKA, is another member of the diacylglycerol kinase family.
[0207] DNA methyltransferase 3 alpha (DNMT3A, HGNC:2978, NCBI Entrez Gene:1788) is a DNA methyltransferase.
[0208] Mitogen-activated protein kinase kinase kinase kinase 1 (MAP4K1, HGNC:6863, NCBI Entrez Gene:11184) is involved in ATP binding activity and MAP kinase kinase kinase kinase activity.
[0209] Nuclear receptor subfamily 4 group A member 1 (NR4A1, HGNC:7980, NCBI Entrez Gene:3164) is a member of the steroid-thyroid hormone-retinoid receptor superfamily.
[0210] Protein tyrosine phosphatase non-receptor type 2 (PTPN2, HGNC:9650, NCBI Entrez Gene:5771) is a member of the protein tyrosine phosphatase (PTP) family.
[0211] Tet methylcytosine dioxygenase 2 (TET2, HGNC:25941; NCBI Entrez Gene:54790) is involved in myelopoiesis, and defects in this gene are associated with several myeloproliferative disorders.
[0212] Zinc finger CCCH type-containing 12A (ZC3H12A, HGNC:26259, NCBI Entrez Gene:80149) is a transcriptional activator that induces cell death in cardiomyocytes.
[0213] As used herein, a "target gene" refers to a nucleic acid sequence in a cell whose expression can be specifically and effectively regulated using the recombinant nucleic acid molecules and methods described herein. In certain embodiments, the target gene can be involved in the growth (proliferation), maintenance (survival) and / or immune behavior of an individual's immune cells.
[0214] In some embodiments, the target gene is PTPN2. In some embodiments, the target gene is CD5. In some embodiments, the target gene is CBLB. In some embodiments, the target gene is CISH. In some embodiments, the target gene is DGKA. In some embodiments, the target gene is DGKZ. In some embodiments, the target gene is DNMT3A. In some embodiments, the target gene is MAP4K1. In some embodiments, the target gene is NR4A1. In some embodiments, the target gene is ZC3H12A.
[0215] In some embodiments, two or more target genes are deleted or regulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, at least two target genes are deleted or regulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, the recombinant nucleic acid molecule(s) is / are an shRNA. In some embodiments, the recombinant nucleic acid molecule(s) is / are a guide RNA.
[0216] In some embodiments, the one or more recombinant nucleic acids comprise at least one sequence. In some embodiments, the one or more recombinant nucleic acids comprise at least two sequences. In some embodiments, the one or more recombinant nucleic acids comprise at least three sequences. In some embodiments, the one or more recombinant nucleic acids comprise at least four sequences. In some embodiments, the one or more recombinant nucleic acids comprise at least five sequences. In some embodiments, the one or more recombinant nucleic acids are encoded on one polynucleotide. In some embodiments, the one or more recombinant nucleic acids are encoded on two or more polynucleotides. In some embodiments, the one or more recombinant nucleic acids are encoded on three or more polynucleotides. In some embodiments, the one or more recombinant nucleic acids are encoded on four or more polynucleotides. In some embodiments, the one or more recombinant nucleic acids are encoded on five or more polynucleotides.
[0217] In some embodiments, the nucleic acid comprises a first nucleic acid and a second nucleic acid, and the first and second nucleic acids are different. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 12, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 13. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 21, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 13. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 21, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 12. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 12, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 14. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 13, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 20. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 21, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 20. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 20, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 22. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 17 and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 13. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 20 and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 14. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 21 and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 22.
[0218] In some embodiments, the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.
[0219] In some embodiments, the nucleic acid is an RNA interference (RNAi) molecule.Exemplary RNAi molecules include short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotide.In some embodiments, the nucleic acid is short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotide.In some embodiments, the nucleic acid is shRNA.
[0220] Single-stranded hairpin ribonucleic acid (shRNA) is a short double-stranded nucleic acid in which the sense and antisense strands are connected by a hairpin loop. They consist of a stem-loop structure, which can be transcribed in cells from an RNA polymerase II or RNA polymerase III promoter on a plasmid construct. When expressed, shRNA is processed into an RNAi species. Expression of shRNA from a plasmid is known to be relatively stable, thereby offering a strong advantage over the use of, for example, synthetic siRNA. shRNA expression units can be incorporated into various plasmids, liposomes, viral vectors, and other vehicles for delivery and integration into target cells. Expression of shRNA from a plasmid can be stably incorporated for constitutive expression. shRNA is synthesized in the cell nucleus, further processed, transported to the cytoplasm, and then incorporated into the RNA-induced silencing complex (RISC) for activity. The shRNA is converted into an active siRNA molecule (capable of binding to and sequestering the mRNA transcript encoded by the target gene and / or preventing its translation).
[0221] The Argonaute family of proteins is a major component of RISC. Within the Argonaute family of proteins, only Ago2 contains endonuclease activity that can cleave and release the passenger strand from the stem portion of the shRNA molecule. The remaining three members of the Argonaute family, Ago1, Ago3, and Ago4, which do not have discernible endonuclease activity, also assemble to form RISC and are thought to function in a cleavage-independent manner. Therefore, RISC can be characterized as having cleavage-dependent and cleavage-independent pathways.
[0222] RNAi (e.g., antisense RNA, siRNA, microRNA, shRNA, etc.) is described in International Publication Nos. 2018232356A1, 2019084552A1, 2019226998A1, 2020014235A1, 2020123871A1, and 2020186219A1, each of which is incorporated by reference herein for all purposes.
[0223] Antisense oligonucleotide structures and chemical modifications are described in International Publication No. WO 20 / 132521, which is incorporated herein by reference.
[0224] dsRNA and shRNA molecules, as well as methods of use and production, are described in US Pat. No. 8,829,264, US Pat. No. 9,556,431, and US Pat. No. 8,252,526, each of which is incorporated herein by reference.
[0225] In some embodiments, the one or more recombinant nucleic acids comprise an shRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 23-207. In some embodiments, the one or more recombinant nucleic acids comprise an shRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 23-46 that is complementary to an mRNA encoding CBLB. In some embodiments, the one or more recombinant nucleic acids comprise an shRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 47-72 that is complementary to an mRNA encoding CD5. In some embodiments, the one or more recombinant nucleic acids comprise an shRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 73-95 that is complementary to an mRNA encoding CISH. In some embodiments, the one or more recombinant nucleic acids comprise an shRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 96-122 that is complementary to an mRNA encoding DNMT3A. In some embodiments, the one or more recombinant nucleic acids comprise an shRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 123-146 that is complementary to an mRNA encoding PTPN2. In some embodiments, the one or more recombinant nucleic acids comprise an shRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 147-175 that is complementary to an mRNA encoding TET2. In some embodiments, the one or more recombinant nucleic acids comprise an shRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 176-180 and 205-207 that is complementary to an mRNA encoding ZC3H12A. In some embodiments, the one or more recombinant nucleic acids comprise an shRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs: 181-204 that is complementary to an mRNA encoding DGKA.
[0226] In some embodiments, the one or more recombinant nucleic acids comprise a first nucleic acid and a second nucleic acid, wherein the first and second nucleic acids are different. In some embodiments, each of the first and second nucleic acids is an shRNA.
[0227] In some embodiments, the first nucleic acid is an shRNA complementary to an mRNA encoding DNMT3A, and the second nucleic acid is an shRNA complementary to an mRNA encoding CBLB. In some embodiments, the first nucleic acid is an shRNA complementary to an mRNA encoding PTPN2, and the second nucleic acid is an shRNA complementary to an mRNA encoding CBLB. In some embodiments, the first nucleic acid is an shRNA complementary to an mRNA encoding TET2, and the second nucleic acid is an shRNA complementary to an mRNA encoding CBLB. In some embodiments, the first nucleic acid is an shRNA complementary to an mRNA encoding CD5, and the second nucleic acid is an shRNA complementary to an mRNA encoding CISH. In some embodiments, the first nucleic acid is an shRNA complementary to an mRNA encoding PTPN2, and the second nucleic acid is an shRNA complementary to an mRNA encoding CISH. In some embodiments, the first nucleic acid is an shRNA complementary to the mRNA encoding PTPN2, and the second nucleic acid is an shRNA complementary to the mRNA encoding TET2. In some embodiments, the first nucleic acid is an shRNA complementary to the mRNA encoding PTPN2, and the second nucleic acid is an shRNA complementary to the mRNA encoding ZC3H12A. In some embodiments, the first nucleic acid is an shRNA complementary to the mRNA encoding TET2, and the second nucleic acid is an shRNA complementary to the mRNA encoding ZC3H12A.
[0228] In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:37, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:120. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:45, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:120. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:120, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:29. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:45, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:122. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:29, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:122. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:37, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:111. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:122, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:37. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:46, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:122. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:46, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:120. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:37, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:141. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:141, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:44. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:143, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:29. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:46, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:141. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:29, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:141. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:37, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:143. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:45, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:146.In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:45, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:141. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:29, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:146. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:37, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:174. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:46, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:170. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:170, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:29. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:46, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:174. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:44, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:170. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:29, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:174. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:72, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:93. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:93, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:69. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:72, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:94. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:71, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:95. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:95, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:69. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:141, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:94. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:94, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:146. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:94, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:143.In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:93, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:146. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:95, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:146. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:141, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:95. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:174, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:141. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:143, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:174. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:146, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:170. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:146, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:178. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:146, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:177. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 143, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 176. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 146, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 176. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 141, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 178. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 143, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 178. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 141, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 177. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 176, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 141. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 174, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 176. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:174 and the second nucleic acid comprises the sequence set forth in SEQ ID NO:177.In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 170 and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 176. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO: 170 and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 177.
[0229] siRNA molecules, as well as methods of use and production, are described in US Pat. No. 7,361,752 and US Patent Publication No. US2005 / 0048647, both of which are incorporated herein by reference.
[0230] Additional methods and compositions for RNA interference, e.g., shRNA, siRNA, dsRNA, and antisense oligonucleotides, are generally known in the art and are further described in U.S. Pat. No. 7,361,752, U.S. Pat. No. 8,829,264, U.S. Pat. No. 9,556,431, U.S. Pat. No. 8,252,526, WO 00 / 44895, WO 01 / 36646, WO 99 / 32619, WO 00 / 01846, WO 01 / 29058, WO 00 / 44914, and WO 04 / 030634, each of which is incorporated herein by reference.
[0231] Nucleic acid sequences (or constructs) that can be used to encode the RNAi molecules, e.g., shRNAs, described herein can include a promoter operably linked (or connected) directly or indirectly to the sequence encoding the RNAi molecule. Such promoters can be selected based on the host cell and the desired effect. Non-limiting examples of suitable promoters include constitutive and inducible promoters, such as inducible RNA polymerase II (pol II)-based promoters. Non-limiting examples of suitable promoters further include tetracycline-inducible or repressible promoters, EF1a, RNA polymerase I or III-based promoters, pol II-dependent viral promoters, e.g., the CMV-IE promoter, and pol III U6 and H1 promoters. The bacteriophage T7 promoter can also be used (it will be understood that in this case, T7 polymerase must also be present). In particular, nucleic acid sequences need not be limited to the use of any single promoter, as they can include two or more shRNAs (i.e., effector combinations), including, but not limited to, integrated shRNA molecules. Each integrated promoter can control one or any combination of the shRNA molecule components.
[0232] In certain embodiments, the promoter may be preferentially active in target cells; for example, it may be desirable to preferentially express at least one recombinant nucleic acid in immune cells using an immune cell-specific promoter. Introduction of such constructs into host cells may be performed under conditions in which two or more recombinant nucleic acids contained within recombinant nucleic acid precursor transcripts initially exist within a single primary transcript, whereby separate RNA molecules (e.g., shRNAs, each containing its own stem-loop structure) are subsequently excised from such precursor transcript by endogenous ribonucleases. The resulting mature recombinant nucleic acids (e.g., shRNAs) can then induce degradation and / or translational repression of target gene mRNA transcripts produced in the cell. Alternatively, each of the precursor stem-loop structures may be produced as part of a separate transcript, in which case each recombinant nucleic acid sequence preferably includes its own promoter and transcription termination sequence. Additionally, multiple recombinant nucleic acid precursor transcripts may exist within a single primary transcript.
[0233] The stem-loop structure of the shRNA recombinant nucleic acids described herein may be about 40-100 nucleotides in length, or preferably about 50-75 nucleotides in length. The stem region may be about 15-45 nucleotides (or more), or about 20-30 nucleotides in length. In some embodiments, the stem region is 22 nucleotides in length. In some embodiments, the stem region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides in length.
[0234] The stem may contain a fully complementary duplex (but for either 3' tail), but a bulge or internal loop may be present on either arm of the stem. The number of such bulges and asymmetric internal loops is preferably small (e.g., 1, 2, or 3) and about 3 or less nucleotides in size. The terminal loop portion may contain about 4 or more nucleotides, but preferably about 25 or less. The loop portion is preferably 6 to 15 nucleotides in size.
[0235] As described herein, the stem region of shRNA comprises a passenger strand and a guide strand, whereby the guide strand contains a sequence complementary to the target mRNA transcript encoded by the target gene(s).Preferably, the GC content and matching of the guide strand and the passenger strand are carefully designed for thermodynamically favorable strand unwinding activity with or without endonuclease cleavage.Furthermore, the specificity of the guide strand is preferably confirmed through BLAST search (www.ncbi.nim.nih.qov / BLAST).
[0236] The present invention provides that the expression levels of multiple target genes can be regulated using the methods and recombinant nucleic acids described herein. For example, the present invention provides that a first set of recombinant nucleic acids can be designed to contain a sequence (guide strand) designed to reduce the expression level of a first target gene, and a second set of recombinant nucleic acids can be designed to contain a sequence (guide strand) designed to reduce the expression level of a second target gene. The different sets of recombinant nucleic acids can be expressed and reside within the same or separate pre-transcripts. In certain embodiments, such a multiplex approach, i.e., the use of the recombinant nucleic acids described herein to regulate the expression levels of two or more target genes, can have an enhanced therapeutic effect on patients. For example, when a patient is provided with cells expressing the recombinant nucleic acid molecules described herein to treat, prevent, or ameliorate the effects of cancer, it may be desirable to provide the patient with two or more types of recombinant nucleic acid molecules designed to reduce the expression levels of multiple genes involved in immune cell activation or suppression.
[0237] The recombinant nucleic acid molecule(s) described herein may be capable of reducing target gene expression in a cell by at least about 50% compared to control cells that do not contain the recombinant nucleic acid molecule(s). For example, the recombinant nucleic acid molecule(s) (e.g., shRNA) may be capable of reducing the expression of a target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in a cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more compared to control cells that do not contain the recombinant nucleic acid molecule(s). The recombinant nucleic acid molecule(s) can be capable of reducing expression of a target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in a cell by at least about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, or the like, as compared to a control cell that does not contain the recombinant nucleic acid molecule(s).
[0238] Recombinant nucleic acid molecule(s) can be chemically synthesized or in vitro transcribed and can further include one or more modifications to the sugar phosphate backbone or nucleoside residues.
[0239] Other methods known in the art for introducing nucleic acids into cells can be used, such as lipid-mediated carrier transport and chemical-mediated transport, e.g., calcium phosphate, etc. Thus, the recombinant nucleic acid molecule(s) construct can be introduced with components that perform one or more of the following activities: enhancing RNA uptake by cells, promoting annealing of duplexes for shRNA, stabilizing the annealed shRNA strands, or otherwise increasing inhibition of the target gene.
[0240] In some embodiments, the one or more recombinant nucleic acids further comprise a 5' homologous recombination repair arm and / or a 3' homologous recombination repair arm, wherein the 5' homologous recombination repair arm and / or the 3' homologous recombination repair arm are complementary to the insertion site in the host cell chromosome. In some embodiments, the one or more recombinant nucleic acids comprise a 5' homologous recombination repair arm and a 3' homologous recombination repair arm. In some embodiments, the one or more recombinant nucleic acids are incorporated into an expression cassette or expression vector. In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the one or more recombinant nucleic acids.
[0241] In some embodiments, the one or more recombinant nucleic acids comprise at least a first nucleic acid and at least a second nucleic acid. The first and second nucleic acids may be RNAi molecules, e.g., shRNA. In some embodiments, the first and second nucleic acids are incorporated into a single expression cassette or a single expression vector. In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the first nucleic acid and / or upstream of the second nucleic acid. In some embodiments, the expression vector is a non-viral vector.
[0242] Recombinant cells Also provided herein are recombinant cells comprising a deletion or perturbation of at least a first target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A. In some embodiments, the cells further comprise a deletion or perturbation of at least a second target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A, wherein the first target gene and the second target gene are different.
[0243] In some embodiments, at least the first or second target gene(s) are deleted or perturbed via CRISPR-Cas9 gene editing. In some embodiments, expression of the first or second target gene in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain a deletion of the first or second target gene.
[0244] Also provided herein are cells comprising a first guide RNA, wherein the first guide RNA comprises a sequence set forth in SEQ ID NOs: 12 to 22. In some embodiments, the cell further comprises a second guide RNA comprising a sequence set forth in SEQ ID NOs: 12 to 22.
[0245] In some embodiments, the cell further comprises a protein comprising a nuclease domain, wherein the nucleic acid and the protein form a ribonucleoprotein (RNP) complex. In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.
[0246] In some embodiments, the first or second nucleic acid reduces expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in immune cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid. In some embodiments, expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first or second nucleic acid.
[0247] In some embodiments, expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A is determined by a nucleic acid assay or a protein assay.
[0248] Also provided herein are recombinant cells comprising at least one recombinant nucleic acid non-virally inserted into a target region of the cell's genome. In some embodiments, the immune cell comprises a first nucleic acid sequence at least 15 nucleotides in length, the first nucleic acid sequence being: (1) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO:1; (2) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human CBLB comprising the sequence set forth in SEQ ID NO:2; (3) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human CISH comprising the sequence set forth in SEQ ID NO:3; (4) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding DGKA comprising the sequence set forth in SEQ ID NO:4; (5) a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding DGKZ comprising the sequence set forth in SEQ ID NO:5; or (6) a DNMT comprising the sequence set forth in SEQ ID NO:6. (7) a nucleic acid sequence at least 15 nucleotides in length that is complementary to the mRNA encoding MAP4K1, comprising the sequence set forth in SEQ ID NO: 7; (9) a nucleic acid sequence at least 15 nucleotides in length that is complementary to the mRNA encoding TET2, comprising the sequence set forth in SEQ ID NO: 10; (10) a nucleic acid sequence at least 15 nucleotides in length that is complementary to the mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO: 9; (11) a nucleic acid sequence at least 15 nucleotides in length that is complementary to the mRNA encoding NR4A1, comprising the sequence set forth in SEQ ID NO: 8; or (12) a nucleic acid sequence at least 15 nucleotides in length that is complementary to the mRNA encoding ZC3H12A, comprising the sequence set forth in SEQ ID NO: 11.
[0249] In some embodiments, the cells are immune cells. In some embodiments, the immune cells are primary human immune cells. The primary immune cells are natural killer (NK) cells, natural killer T (NKT) cells, T cells, γδ T cells, CD8+ T cells, CD4+ T cells, primary T cells, T cell progenitor cells, or induced pluripotent stem cells (iPSCs). In some embodiments, the primary immune cells are primary T cells. In some embodiments, the primary immune cells are primary human T cells. In some embodiments, the immune cells are virus-free. In some embodiments, the immune cells are viable virus-free primary cells. In some embodiments, the immune cells are autologous immune cells. In some embodiments, the immune cells are allogeneic immune cells.
[0250] In some embodiments, expression of a gene (e.g., CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A) targeted by the recombinant nucleic acid molecule(s) is reduced or decreased in the target cells. Target gene expression may be reduced by at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more. Target gene expression may be reduced by about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, or more compared to control cells that do not contain the recombinant nucleic acid molecule(s).
[0251] Cells containing recombinant nucleic acid molecule(s) insertions at the target locus or safe harbor site described in this disclosure may be referred to as engineered cells. In some embodiments, the immune cells are any cells that can give rise to pluripotent immune cells. In some embodiments, the immune cells can be induced pluripotent stem cells (iPSCs) or human pluripotent stem cells (HSPCs). In some embodiments, the immune cells include primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, natural killer (NK) cells, T cells, CD8+ cells, CD4+ cells, or T cell precursors. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD8+ cells. + In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD4 + CD8 + T cells.
[0252] In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, T cells, or T cell precursor cells. Non-limiting examples of immune cells contemplated by the present disclosure include T cells, B cells, natural killer (NK) cells, NKT / iNKT cells, macrophages, myeloid cells, and dendritic cells. Non-limiting examples of stem cells contemplated by the present disclosure include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo-derived embryonic stem cells (ntES; nuclear transfer ES), male germ cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem / progenitor stem cells (HSPCs), somatic cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells, and other stem cells, including bone cells, chondrocytes, myocytes, cardiomyocytes, neurons, tenocytes, adipocytes, pancreatic cells, hepatocytes, kidney cells, and follicular cells. In some embodiments, the engineered cells are T cells, NK cells, iPSCs, and HSPCs. In some embodiments, the engineered cells used in the present disclosure are human cell lines (e.g., intentionally immortalized cell lines, cancer cell lines, etc.) grown in vitro.
[0253] In some embodiments, the immune cells are autologous immune cells. In some embodiments, the immune cells are allogeneic immune cells.
[0254] Also provided herein are populations of cells comprising a plurality of primary immune cells. In some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genomes of the cells comprise at least one recombinant nucleic acid molecule. In some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genomes of the cells comprise at least two shRNA molecules. In some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genomes of the cells comprise at least 3, 4, 5, 6, 7, 8, 9, 10 or more recombinant nucleic acid molecules.
[0255] Also provided herein are populations of cells comprising the recombinant nucleic acid(s).
[0256] The cells may further comprise a chimeric protein such as a T cell receptor (TCR), a chimeric antigen receptor (CAR), or a priming receptor. In some embodiments, the cells comprise at least one T cell receptor (TCR). In some embodiments, the cells comprise at least one chimeric antigen receptor. In some embodiments, the cells comprise at least one priming receptor. In some embodiments, the cells comprise at least one chimeric antigen receptor and at least one priming receptor. The at least one recombinant nucleic acid molecule encoding the at least one RNAi molecule can be encoded on the same DNA template or nucleic acid fragment as the at least one RNAi molecule, or on a different DNA template or nucleic acid fragment from the RNAi molecule.
[0257] When the TCR and the RNAi recombinant nucleic acid molecule(s) are encoded on the same DNA template or nucleic acid fragment, the various components can be arranged on the DNA template in any order. For example, the DNA template can comprise, from 5' to 3', the TCR and at least one RNAi recombinant nucleic acid. Alternatively, the DNA template can comprise, from 5' to 3', at least one RNAi recombinant nucleic acid and the TCR.
[0258] When the CAR, priming receptor, and RNAi recombinant nucleic acid molecule(s) are encoded on the same DNA template or nucleic acid fragment, the various components can be arranged on the DNA template in any order. For example, the DNA template can include, from 5' to 3', a CAR, at least one RNAi recombinant nucleic acid, and a priming receptor. Alternatively, the DNA template can include, from 5' to 3', i) a priming receptor, at least one RNAi recombinant nucleic acid, and a CAR; ii) at least one RNAi recombinant nucleic acid, a priming receptor, and a CAR; iii) at least one RNAi recombinant nucleic acid, a CAR, and a priming receptor; iv) a priming receptor, a CAR, and at least one RNAi recombinant nucleic acid; v) a CAR, a priming receptor, and at least one RNAi recombinant nucleic acid; vi) at least one RNAi recombinant nucleic acid, a priming receptor, and a CAR; vii) at least one RNAi recombinant nucleic acid, a CAR, and a priming receptor. In some embodiments, at least one RNAi recombinant nucleic acid comprises two recombinant nucleic acids. In some embodiments, the recombinant nucleic acid comprises a nucleic acid complementary to one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A.
[0259] In some embodiments, the priming receptor comprises a first extracellular antigen-binding domain that specifically binds a first antigen, and the chimeric antigen receptor (CAR) comprises a second extracellular antigen-binding domain that specifically binds a second antigen.
[0260] Methods for reducing gene expression Another aspect of the present invention provides a method for attenuating expression of a target gene in a mammalian cell, comprising introducing into the mammalian cell at least a first recombinant nucleic acid, e.g., a guide RNA, complementary to the target gene mRNA, and a ribonucleoprotein (RNP) comprising a nuclease domain. In some embodiments, the guide RNA specifically hybridizes to at least a first target gene in a primary immune cell, and the nuclease domain cleaves the target region to generate a double-stranded break in the genome of the immune cell. In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease. In some embodiments, the at least a first target gene is one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A. In some embodiments, the target gene is CD5. In some embodiments, the at least a first target gene is CBLB. In some embodiments, the at least first target gene is CISH. In some embodiments, the at least first target gene is DGKA. In some embodiments, the at least first target gene is DGKZ. In some embodiments, the at least first target gene is DNMT3A. In some embodiments, the at least first target gene is FAS. In some embodiments, the at least first target gene is MAP4K1. In some embodiments, the at least first target gene is NR4A1. In some embodiments, the at least first target gene is PTPN2. In some embodiments, the at least first target gene is TET2. In some embodiments, the at least first target gene is TOX. In some embodiments, the at least first target gene is ZC3H12A.
[0261] In some embodiments, the method includes introducing into the mammalian cell at least a second recombinant nucleic acid complementary to at least a second target gene mRNA, e.g., a guide RNA, and a ribonucleoprotein (RNP) comprising a nuclease domain. In some embodiments, the at least second target gene is one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A. In some embodiments, the at least second target gene is CD5. In some embodiments, the target gene is CBLB. In some embodiments, the at least second target gene is CISH. In some embodiments, the at least second target gene is DGKA. In some embodiments, the at least second target gene is DGKZ. In some embodiments, the at least second target gene is DNMT3A. In some embodiments, the at least second target gene is FAS. In some embodiments, the at least second target gene is MAP4K1. In some embodiments, the at least second target gene is NR4A1. In some embodiments, the at least second target gene is PTPN2. In some embodiments, the at least second target gene is TET2. In some embodiments, the at least second target gene is TOX. In some embodiments, the at least second target gene is ZC3H12A.
[0262] Another aspect of the present invention provides a method for attenuating expression of a target gene in a mammalian cell, comprising introducing into the mammalian cell a recombinant nucleic acid complementary to the target gene mRNA, such as a single-stranded hairpin ribonucleic acid (shRNA), siRNA, dsRNA, or antisense oligonucleotide. In some embodiments, the recombinant nucleic acid complementary to the target gene mRNA is an shRNA. In some embodiments, the shRNA comprises a self-complementary sequence of 19 to 100 nucleotides that forms a duplex region, which hybridizes to the target gene mRNA transcript under intracellular conditions. In some embodiments, the shRNA comprises a 22-nt self-complementary sequence. In some embodiments, the shRNA (i) is a substrate for cleavage by RNase III enzyme to produce a double-stranded RNA product, (ii) does not result in general sequence-independent killing of mammalian cells, and (iii) reduces expression of the target gene in a manner dependent on the sequence of the complementary region. In some embodiments, the target gene is one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A.
[0263] Immune cells comprising the recombinant nucleic acid can have reduced or diminished expression of a target gene selected from the group consisting of one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A. In some embodiments, the immune cells have about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, or 50-55% reduced expression of one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A compared to control cells that do not comprise the recombinant nucleic acid molecule(s).
[0264] In some embodiments, expression of one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid(s), the first nucleic acid, or the second nucleic acid.
[0265] Another aspect of the present invention provides a method for attenuating expression of a target gene in a mammalian cell, the method comprising introducing into the mammalian cell a recombinant nucleic acid complementary to the target gene mRNA. In some embodiments, the recombinant nucleic acid is a guide RNA. In some embodiments, the recombinant nucleic acid further comprises a protein comprising a nuclease domain, wherein the nucleic acid and the protein form a ribonucleoprotein (RNP) complex. In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease. In some embodiments, the ribonucleoprotein (RNP) complex reduces expression of one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in the cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the RNP complex.
[0266] In some embodiments, the one or more recombinant nucleic acids comprise the sequence set forth in SEQ ID NO: 12 and the sequence set forth in SEQ ID NO: 13. In some embodiments, the one or more recombinant nucleic acids comprise the sequence set forth in SEQ ID NO: 21 and the sequence set forth in SEQ ID NO: 13. In some embodiments, the one or more recombinant nucleic acids comprise the sequence set forth in SEQ ID NO: 21 and the sequence set forth in SEQ ID NO: 12. In some embodiments, the one or more recombinant nucleic acids comprise the sequence set forth in SEQ ID NO: 12 and the sequence set forth in SEQ ID NO: 14.
[0267] In some embodiments, the expression of one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A is determined by a nucleic acid or protein assay. In some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.
[0268] How to Treat Cancer In another aspect, the invention provides a method of treating an immune-related condition (e.g., cancer) in an individual, comprising administering to the individual an effective amount of a composition comprising cells comprising a deletion or perturbation in at least one gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A.
[0269] In another aspect, the present invention provides a method of treating an immune-related condition (e.g., cancer) in an individual, comprising administering to the individual an effective amount of a composition comprising cells comprising at least one sequence set forth in SEQ ID NOs: 12-22.
[0270] In another aspect, the present invention provides methods of treating an immune-related condition (e.g., cancer) in an individual, comprising administering to the individual an effective amount of a composition comprising cells containing at least one recombinant nucleic acid comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to a target selected from the group consisting of one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A. In some embodiments, the recombinant nucleic acid is an shRNA molecule. In some embodiments, the shRNA is selected from the group consisting of shRNA molecules of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A. In some embodiments, the cells contain shRNA molecules for at least CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A.
[0271] In another aspect, the present invention provides methods for enhancing an immune response in an individual, the method comprising administering to the individual an effective amount of a composition comprising cells comprising at least one shRNA molecule, wherein the shRNA molecule is complementary to an mRNA encoding a protein selected from the group consisting of one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A shRNA molecules. In some embodiments, the cells comprise at least one shRNA molecule comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 23-207. In some embodiments, the cells comprise an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 47-72 that is complementary to an mRNA encoding CD5. In some embodiments, the cells comprise an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 23-46 that is complementary to an mRNA encoding CBLB. In some embodiments, the cells comprise an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 73-95 that is complementary to an mRNA encoding CISH. In some embodiments, the cell contains an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 181-204 that is complementary to an mRNA encoding DGKA. In some embodiments, the cell contains an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 96-122 that is complementary to an mRNA encoding DNMT3A. In some embodiments, the cell contains an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 147-175 that is complementary to an mRNA encoding TET2. In some embodiments, the cell contains an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 123-146 that is complementary to an mRNA encoding PTPN2. In some embodiments, the cell contains an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 176-180 and 205-207 that is complementary to an mRNA encoding ZC3H12A.
[0272] In some embodiments, the methods provided herein are useful for treating an immune-related condition in an individual. In certain embodiments, the individual is a human.
[0273] In some embodiments, the methods provided herein (e.g., methods of enhancing an immune response) are useful for treating cancer, and thus, an individual receiving a system described herein has cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a liquid cancer. In some embodiments, the cancer is immune-evasive. In some embodiments, the cancer is immune-responsive. In certain embodiments, the cancer is breast cancer, HER2-positive breast cancer, estrogen receptor-positive breast cancer, progesterone receptor-positive breast cancer, HER2- / estrogen receptor- / progesterone receptor-negative breast cancer, triple-negative breast cancer, non-small cell lung cancer (NSCLC), lung adenocarcinoma, lung squamous cell carcinoma, lung adenosquamous cell carcinoma, prostate cancer, castration-resistant prostate cancer, colon cancer, rectal cancer, microsatellite instability (MSI) colon cancer, non-MSI colon cancer, or non-MSI or rectal cancer.
[0274] In some embodiments, the treatment results in a decrease in cancer volume or size. In some embodiments, the treatment is effective in reducing cancer volume compared to the cancer volume before administration of the recombinant nucleic acid or recombinant cells. In some embodiments, the treatment results in a decrease in cancer growth rate. In some embodiments, the treatment is effective in reducing cancer growth rate compared to the cancer growth rate before administration of the recombinant cells. In some embodiments, the treatment is effective in eliminating the cancer.
[0275] Immunomodulatory methods The method of administration of cells containing a deletion or perturbation in at least one gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A can result in modulation of the immune response. The modulation can be an increase or a decrease in the immune response. In some embodiments, the modulation is an increase in the immune response.
[0276] The method of administering cells comprising at least one sequence set forth in SEQ ID NOs: 12-22 can result in modulation of the immune response. The modulation can be an increase or a decrease in the immune response. In some embodiments, the modulation is an increase in the immune response.
[0277] Methods of administering cells containing recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A can result in modulation of immune responses. In some embodiments, the cells contain at least one shRNA molecule comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 23-207. In some embodiments, the cells contain an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 47-72 that is complementary to an mRNA encoding CD5. In some embodiments, the cells contain an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 23-46 that is complementary to an mRNA encoding CBLB. In some embodiments, the cells contain an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 73-95 that is complementary to an mRNA encoding CISH. In some embodiments, the cells contain an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 181-204 that is complementary to an mRNA encoding DGKA. In some embodiments, the cells comprise an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 96-122 that is complementary to an mRNA encoding DNMT3A. In some embodiments, the cells comprise an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 147-175 that is complementary to an mRNA encoding TET2. In some embodiments, the cells comprise an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 123-146 that is complementary to an mRNA encoding PTPN2. In some embodiments, the cells comprise an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 176-180 and 205-207 that is complementary to an mRNA encoding ZC3H12A. The modulation can be an increase or decrease in the immune response. In some embodiments, the modulation is an increase in the immune response.
[0278] In one aspect, administration of the cells described herein can result in the induction of pro-inflammatory molecules, such as cytokines or chemokines. In some embodiments, the cytokine is IFNg. Generally, the induced pro-inflammatory molecules are present at levels greater than those achieved with isotype controls. Such pro-inflammatory molecules then lead to the activation of anti-tumor immunity, including, but not limited to, T cell activation, T cell proliferation, T cell differentiation, M1-like macrophage activation, and NK cell activation. Thus, administration of a system comprising the recombinant nucleic acids disclosed herein or the target gene deletions or perturbations described herein can induce multiple anti-tumor immune mechanisms that result in tumor destruction.
[0279] In another aspect, provided herein is a method of increasing an immune response in an individual, the method comprising administering to the individual an effective amount of cells comprising at least one sequence set forth in SEQ ID NOs: 12-22.
[0280]
[0010] In another aspect, provided herein are methods of increasing an immune response in an individual, the method comprising administering to the individual an effective amount of cells comprising a deletion of at least a first target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A. In some embodiments, the cells further comprise a deletion of at least a second target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A, wherein the first target gene and the second target gene are different.
[0281] In another aspect, provided herein are methods of increasing an immune response in an individual, the methods comprising administering to the individual an effective amount of cells comprising a recombinant nucleic acid comprising a first nucleic acid sequence at least 15 nucleotides in length that is complementary to CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A. In some embodiments, the methods of increasing an immune response in a subject comprise administering to the subject cells comprising a recombinant nucleic acid comprising a second nucleic acid sequence at least 15 nucleotides in length that is complementary to CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A.
[0282] In some embodiments, the cells are present in a pharmaceutical composition that further comprises a pharmaceutically acceptable excipient.
[0283] In any aspect of increasing an immune response described herein, the increase, decrease, or alteration of any aspect of characteristic(s) or function(s) is as compared to a cell that does not contain a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A, or a cell that does not contain a deletion in the target gene (e.g., contains a functional target gene).
[0284] Increasing an immune response can be both an enhanced immune response or an induced immune response. For example, increasing an immune response encompasses both initiating or initiating an immune response or increasing or amplifying an ongoing or existing immune response. In some embodiments, the treatment induces an immune response. In some embodiments, the induced immune response is an adaptive immune response. In some embodiments, the induced immune response is an innate immune response. In some embodiments, the treatment enhances an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the treatment increases an immune response. In some embodiments, the increased immune response is an adaptive immune response. In some embodiments, the increased immune response is an innate immune response. In some embodiments, the immune response is started or initiated by administration of cells comprising a recombinant nucleic acid comprising at least one nucleic acid sequence at least 15 nucleotides in length complementary to CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A. In some embodiments, the immune response is enhanced by administration of cells comprising at least one recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A. In some embodiments, the immune response is started or initiated by administration of cells comprising a deletion of at least a second target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A. In some embodiments, the immune response is started or initiated by administration of cells comprising at least one sequence set forth in SEQ ID NOs: 12-22 and a protein comprising a nuclease domain, wherein the nucleic acid and protein form a ribonucleoprotein (RNP) complex.
[0285] In another aspect, the present application provides a method of gene editing a cell with a recombinant nucleic acid comprising at least one nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding a protein selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A, wherein the gene editing results in modulation of immune function of the cell. The modulation can be an increase in immune response. In some embodiments, the modulation is an increase in immune function. In some embodiments, the modulation of function results in activation of the cell comprising the recombinant nucleic acid comprising at least one nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding a protein selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A. In some embodiments, the cell comprises at least one shRNA molecule comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 23-207. In some embodiments, the cell comprises an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 47-72 that is complementary to an mRNA encoding CD5. In some embodiments, the cell comprises an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 23-46 that is complementary to an mRNA encoding CBLB. In some embodiments, the cell comprises an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 73-95 that is complementary to an mRNA encoding CISH. In some embodiments, the cell comprises an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 181-204 that is complementary to an mRNA encoding DGKA. In some embodiments, the cell comprises an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 96-122 that is complementary to an mRNA encoding DNMT3A. In some embodiments, the cell comprises an shRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 147-175 that is complementary to an mRNA encoding TET2.In some embodiments, the cells contain an shRNA that is complementary to an mRNA encoding PTPN2 and that includes a nucleotide sequence set forth in any one of SEQ ID NOs: 123-146. In some embodiments, the cells contain an shRNA that is complementary to an mRNA encoding ZC3H12A and that includes a nucleotide sequence set forth in any one of SEQ ID NOs: 176-180 and 205-207.
[0286] In another aspect, the application provides a method of gene editing a cell with a ribonucleoprotein (RNP) comprising a nuclease domain and a guide RNA, wherein the guide RNA comprises a sequence set forth in SEQ ID NOs: 12-22, resulting in modulation of immune function of the cell. The modulation can be an increase in immune response. In some embodiments, the modulation is an increase in immune function. In some embodiments, the modulation of function results in activation of cells comprising a deletion or perturbation in at least one of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A.
[0287] In some embodiments, the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.
[0288] In some embodiments, modulating the function of a cell comprising a recombinant nucleic acid(s) described herein results in an increase in the ability of the cell to stimulate both naive and activated T cells, for example, by increasing cytokine or chemokine secretion by the cell expressing the recombinant nucleic acid(s). In some embodiments, modulating the function enhances or increases the ability of the cell to produce a cytokine, chemokine, CAR, or costimulatory or activating receptor. In some embodiments, modulating increases a T cell stimulatory function of the cell expressing the recombinant nucleic acid(s), where T cell stimulatory function includes, for example, the ability of the cell to induce T cell receptor (TCR) signaling, T cell proliferation, or T cell cytokine production.
[0289] In some embodiments, the increased immune response is secretion of cytokines and chemokines, hi some embodiments, the recombinant nucleic acid(s) induce increased expression of at least one cytokine or chemokine in the cells compared to isotype control cells.
[0290] In some embodiments, the enhanced immune response is anti-tumor immune cell recruitment and activation.
[0291] In some embodiments, cells expressing the recombinant nucleic acid(s) induce a memory immune response compared to isotype control cells. Generally, a memory immune response is a protective immune response upon subsequent exposure to a pathogen or antigen previously encountered by the immune system. Exemplary memory immune responses include immune responses following infection or vaccination with an antigen. Generally, memory immune responses are mediated by lymphocytes, e.g., T cells or B cells. In some embodiments, a memory immune response is a protective immune response to cancer, including cancer cell growth, proliferation, or metastasis. In some embodiments, a memory immune response inhibits, prevents, or reduces cancer cell growth, proliferation, or metastasis.
[0292] How to edit cells The term "gene editing" or "genome editing," as used herein, refers to a type of genetic manipulation in which DNA is inserted into, replaced, or removed from a genome using engineered nucleases or "molecular scissors." This is a useful tool for elucidating the function and effects of sequence-specific genes or proteins or for modifying cellular behavior (e.g., for therapeutic purposes).
[0293] Currently available genome editing tools include zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) for integrating genes into safe harbor loci (e.g., the adeno-associated virus integration site 1 (AAVS1) safe harbor locus). The DICE (dual integrase cassette exchange) system, which utilizes phiC31 integrase and Bxb1 integrase, is a tool for targeted integration. Additionally, clustered regularly interspaced short palindromic repeats / Cas9 (CRISPR / Cas9) technology can be used for targeted gene insertion.
[0294] Site-specific gene editing approaches can include homology-dependent or homology-independent mechanisms.
[0295] All methods known in the art for targeted insertion of gene sequences are contemplated in the methods described herein for inserting constructs into gene target or safe harbor loci.
[0296] Provided herein is a method for inserting one or more recombinant RNAi nucleic acids without the presence of a viral vector.In some embodiments, one or more recombinant nucleic acids can be inserted into the genome of primary immune cells without the presence of a viral vector.
[0297] Described herein are methods and compositions for achieving integration of nucleotide sequences encoding one or more recombinant nucleic acids into the genome of a cell, some of which improve integration efficiency, reduce off-target effects, and / or reduce loss of cell viability.
[0298] A plasmid encoding one or more recombinant nucleic acids is introduced into immune cells using a nuclease, such as a CRISPR-associated system (Cas). The nuclease can be introduced in a ribonucleoprotein format by a guide RNA (gRNA) that targets a specific site on the genome of the immune cell. The nuclease cuts the genomic DNA at this specific site. The specific site can be a portion of the genome that encodes an endogenous immune cell receptor. Therefore, by cutting the genome at this site, the immune cell no longer expresses the endogenous immune cell receptor.
[0299] The plasmid may contain 5' and 3' homologous recombination repair arms that are complementary to sequences at specific sites in the genome of immune cells. The complementary sequences are on either side of the site cleaved by the nuclease, allowing the plasmid to be integrated into the designated insertion site in the genome of immune cells. Once the plasmid is integrated, the cells express the shRNA.
[0300] First, immune cells such as T cells are activated. The immune cells can be obtained from a patient. Thus, the present disclosure provides a method in which immune cells such as T cells are harvested from a patient. Then, a plasmid encoding one or more recombinant nucleic acids is introduced into the T cells. Advantageously, the plasmids of the present disclosure can be introduced using electroporation. When introducing the plasmid via electroporation, a nuclease can also be introduced. By using electroporation, the method of the present disclosure avoids the use of viral vectors to introduce transgenes, which is a known bottleneck in immune cell engineering. The immune cells are then expanded and co-cultured to generate a sufficient amount of engineered immune cells for use as a therapeutic treatment.
[0301] A method for editing the genome of a cell can include: a) providing a Cas9 ribonucleoprotein complex (RNP)-DNA template complex comprising: (i) an RNP, wherein the RNP comprises a Cas9 nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell, and the Cas9 nuclease domain cleaves the target region to create an insertion site in the genome of the cell; and (ii) a double-stranded or single-stranded DNA template, wherein the 5' and 3' ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site, and wherein the molar ratio of RNP to DNA template in the complex is from about 3:1 to about 100:1; and b) introducing the RNP-DNA template complex into the cell.
[0302] In some embodiments, the methods described herein provide an efficiency of delivery of RNP-DNA template complexes of at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the efficiency is determined in terms of cells that are viable after introducing the RNP-DNA template into cells. In some cases, the efficiency is determined in terms of the total number of cells (viable or nonviable) into which the RNP-DNA template is introduced.
[0303] As another example, the efficiency of delivery can be determined by quantifying the number of genome-edited cells in a cell population (compared to the total cells or total viable cells obtained after the introduction step). Various methods for quantifying genome editing are available. These methods include, but are not limited to, the use of mismatch-specific nucleases such as T7 endonuclease I, sequencing of one or more target loci (e.g., by Sanger sequencing of cloned target locus amplified fragments), and high-throughput large-scale sequencing.
[0304] In some embodiments, the loss of cell viability is reduced compared to the loss of cell viability after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these. In some embodiments, the off-target effects of integration are reduced compared to off-target integration after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these.
[0305] In some cases, the methods described herein provide high cell viability of cells into which the RNP-DNA template has been introduced, in some cases, the viability of cells into which the RNP-DNA template has been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the viability of cells into which the RNP-DNA template has been introduced is about 20% to about 99%, about 30% to about 90%, about 35% to about 85% or 90% or more, about 40% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 60% to about 85% or 90% or more, or about 70% to about 85% or 90% or more.
[0306] In the methods provided herein, the molar ratio of RNP to DNA template can be from about 3:1 to about 100:1. For example, the molar ratio can be from about 5:1 to about 10:1, from about 5:1 to about 15:1, from 5:1 to about 20:1, from 5:1 to about 25:1, from about 8:1 to about 12:1, from about 8:1 to about 15:1, from about 8:1 to about 20:1, or from about 8:1 to about 25:1.
[0307] In some embodiments, the DNA template has a concentration of about 2.5 pM to about 25 pM. For example, the DNA template concentration can be about 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM, or any concentration therebetween.
[0308] In some embodiments, the amount of DNA template can be about 1 μg to about 10 μg. For example, the amount of DNA template can be about 1 μg to about 2 μg, about 1 μg to about 3 μg, about 1 μg to about 4 μg, about 1 μg to about 5 μg, about 1 μg to about 6 μg, about 1 μg to about 7 μg, about 1 μg to about 8 μg, about 1 μg to about 9 μg, or about 1 μg to about 10 μg. In some embodiments, the amount of DNA template is about 2 μg to about 3 μg, about 2 μg to about 4 μg, about 2 μg to about 5 μg, about 2 μg to about 6 μg, about 2 μg to about 7 μg, about 2 μg to about 8 μg, about 2 μg to about 9 μg, or 2 μg to about 10 μg. In some embodiments, the amount of DNA template is about 3 μg to about 4 μg, about 3 μg to about 5 μg, about 3 μg to about 6 μg, about 3 μg to about 7 μg, about 3 μg to about 8 μg, about 3 μg to about 9 μg, or about 3 μg to about 10 μg. In some embodiments, the amount of DNA template is about 4 μg to about 5 μg, about 4 μg to about 6 μg, about 4 μg to about 7 μg, about 4 μg to about 8 μg, about 4 μg to about 9 μg, or about 4 μg to about 10 μg. In some embodiments, the amount of DNA template is about 5 μg to about 6 μg, about 5 μg to about 7 μg, about 5 μg to about 8 μg, about 5 μg to about 9 μg, or about 5 μg to about 10 μg. In some embodiments, the amount of DNA template is about 6 μg to about 7 μg, about 6 μg to about 8 μg, about 6 μg to about 9 μg, or about 6 μg to about 10 μg. In some embodiments, the amount of DNA template is about 7 μg to about 8 μg, about 7 μg to about 9 μg, or about 7 μg to about 10 μg. In some embodiments, the amount of DNA template is about 8 μg to about 9 μg, or about 8 μg to about 10 μg. In some embodiments, the amount of DNA template is about 9 μg to about 10 μg.
[0309] In some embodiments, the DNA template encodes an shRNA molecule or a fragment thereof. In some embodiments, the DNA template encodes at least one shRNA molecule. In some embodiments, the DNA template encodes at least two shRNA molecules. In some embodiments, the DNA template encodes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more shRNA molecules.
[0310] In some embodiments, the DNA template comprises regulatory sequences, such as promoter and / or enhancer sequences, for regulating expression of the heterologous protein or fragment thereof after insertion into the genome of the cell.
[0311] In some cases, the DNA template is a linear DNA template. In some cases, the DNA template is a single-stranded DNA template. In some cases, the single-stranded DNA template is a pure single-stranded DNA template. As used herein, "pure single-stranded DNA" refers to single-stranded DNA that is substantially devoid of other strands or opposite strands of DNA. "Substantially devoid" means that the pure single-stranded DNA is devoid of one DNA strand at least 100 times more than another DNA strand.
[0312] In some cases, the RNP-DNA template complex is formed by incubating the RNP with the DNA template for less than about 1 minute to about 30 minutes at a temperature of about 20° C. to about 25° C. For example, the RNP can be incubated with the DNA template at a temperature of about 20° C., 21° C., 22° C., 23° C., 24° C., or 25° C. for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, or any amount of time therebetween. In another example, the RNP can be incubated with the DNA template at a temperature of about 20° C. to about 25° C. for about less than 1 minute to about 1 minute, about less than 1 minute to about 5 minutes, about less than 1 minute to about 10 minutes, about 5 to 10 minutes, about 5 to 15 minutes, about 10 to about 15 minutes, about 10 to about 20 minutes, or about 10 to about 30 minutes. In some embodiments, the RNP-DNA template complex and cells are mixed before introducing the RNP-DNA template complex into the cells.
[0313] In some embodiments, introducing the RNP-DNA template complex comprises electroporation. Methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in the Examples herein. Additional or alternative methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in WO / 2006 / 001614 or Kim, JA et al. Biosens. Bioelectron. 23, 1353-1360 (2008). Additional or alternative methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in U.S. Patent Application Publication Nos. 2006 / 0094095, 2005 / 0064596, or 2006 / 0087522. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Li, L. Het al. Cancer Res. Treat. 1, 341-350 (2002), U.S. Patent Nos. 6,773,669, 7,186,559, 7,771,984, 7,991,559, 6485961, 7029916, and U.S. Patent Application Publication Nos. 2014 / 0017213 and 2012 / 0088842, all of which are incorporated herein by reference. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Geng, T. et al., J. Control Release 144, 91-100 (2010), and Wang, J., et al. Lab. Chip 10, 2057-2061 (2010), all of which are incorporated herein by reference.
[0314] In some embodiments, the Cas9 protein can be in an active endonuclease form so that when it binds to a target nucleic acid as part of a complex with a guide RNA or a DNA template, a double-strand break is introduced into the target nucleic acid. The double-strand break can be repaired by NHEJ to introduce random mutations, or by HDR to introduce specific mutations. Various Cas9 nucleases can be used in the methods described herein. For example, a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3' of the region targeted by the guide RNA can be used. Such a Cas9 nuclease can target any region of the genome that contains an NGG sequence. As another example, a Cas9 protein with an orthogonal PAM motif requirement can be used to target a sequence that does not have an adjacent NGG PAM sequence. Exemplary Cas9 proteins with orthogonal PAM sequence specificity include, but are not limited to, CFP1, those described in Nature Methods 10, 1116-1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015 (both of which are incorporated herein by reference).
[0315] In some cases, Cas9 protein is a nickase, so that when it binds to target nucleic acid as part of a complex with guide RNA, it introduces single-strand breaks or nicks into target nucleic acid.A pair of Cas9 nickases, each of which is bound to structurally different guide RNAs, can target two adjacent sites in the target genome region, and thus introduce a pair of adjacent single-strand breaks into the target genome region.Nickase pairs can increase specificity because off-target effects are more likely to result in a single nick, which is generally repaired without lesions by base excision repair mechanisms.Exemplary Cas9 nickases include Cas9 nucleases with D10A or H840A mutations.
[0316] In some embodiments, the RNP comprises a Cas9 nuclease. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP-DNA template complex comprises at least two structurally distinct RNP complexes. In some embodiments, the at least two structurally distinct RNP complexes contain structurally distinct Cas9 nuclease domains. In some embodiments, the at least two structurally distinct RNP complexes contain structurally distinct guide RNAs. In some embodiments, where the at least two structurally distinct RNP complexes contain structurally distinct guide RNAs, each of the structurally distinct RNP complexes comprises a Cas9 nickase, and the structurally distinct guide RNAs hybridize to opposite strands of the target region.
[0317] In some cases, multiple RNP-DNA templates containing structurally distinct ribonucleoprotein complexes are introduced into cells. For example, a Cas9 protein can be complexed with multiple (e.g., 2, 3, 4, 5, or more, e.g., 2-10, 5-100, 20-100) structurally distinct guide RNAs to target insertion of the DNA templates at multiple structurally distinct target genomic regions.
[0318] In the methods and compositions provided herein, cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, etc. Optionally, the cells are mammalian cells, e.g., human cells. The cells can be in vitro, ex vivo, or in vivo. The cells can also be primary cells, germ cells, stem cells, or progenitor cells. Progenitor cells can be, for example, pluripotent stem cells or hematopoietic stem cells. In some embodiments, the cells are primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the primary hematopoietic cells are immune cells. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD4+ In some embodiments, the T cells are CD8 + In some embodiments, the T cells are CD4 + CD8 + In some embodiments, the T cells are CD4 - CD8 - The modified cells are T cells. Also provided are any populations of cells modified by any of the methods described herein. In some embodiments, the method further comprises expanding the population of modified cells.
[0319] In some cases, cells are removed from a subject, modified using any of the methods described herein, and administered to the patient. In other cases, any of the constructs described herein are delivered to the patient in vivo. See, e.g., U.S. Patent No. 9,737,604 and Zhang et al., "Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy," NPG Asia Materials Volume 9, page e441 (2017) (both incorporated herein by reference).
[0320] In some embodiments, the RNP-DNA template complex is about 1×10 5 ~about 2×10 6 For example, the RNP-DNA template complex is introduced into cells at approximately 1 × 10 5 ~Approx. 5×10 5 cells, approximately 1 x 10 5 ~Approx. 1×10 6 , 1×10 5 ~Approx. 1.5×10 6 , 1×10 5 ~about 2×10 6 , about 1×10 6 ~Approx. 1.5×10 6 cells or approximately 1 x 10 6 ~about 2×10 6 can be introduced into
[0321] In some cases, the methods and compositions described herein can be used to generate, modify, use, or control recombinant immune cells, such as chimeric antigen receptor T cells (CAR T cells), or T cells expressing a priming receptor (primeR) or a recombinant T cell receptor (TCR). Such CAR T cells can be used to treat or prevent cancer, infectious disease, or autoimmune disease in a subject. For example, in some embodiments, one or more gene products are inserted or knocked into T cells to express a heterologous protein (e.g., a chimeric antigen receptor (CAR), a priming receptor, or a T cell receptor (TCR)).
[0322] Insertion site Methods for editing the genome of an immune cell include methods for editing the genome of a human T cell, comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of the TCR-α subunit (TRAC) in a human immune cell. In some embodiments, the target region is in exon 1 of the constant domain of the TRAC gene. In other embodiments, the target region is in exon 1, exon 2, or exon 3, prior to the start of the sequence encoding the TCR-α transmembrane domain.
[0323] The method for editing the genome of an immune cell also includes a method for editing the genome of a human immune cell, comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of a TCR-β subunit (TRBC) in a human T cell. In some embodiments, the target region is in exon 1 of the TRBC1 or TRBC2 gene.
[0324] Methods for editing the genome of immune cells specifically include methods for editing the genome of human immune cells, comprising inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).
[0325] Methods for editing the genome of a T cell also include methods of editing the genome of a human T cell comprising inserting a nucleic acid sequence or construct into the GS94 target region (locus chr11:128340000-128350000).
[0326] In some embodiments, the target region is the GS94 locus.
[0327] Gene editing therapies include, for example, vector integration and site-specific integration. Site-specific integration is a promising alternative to random integration of viral vectors because it reduces the risk of insertional mutagenesis or insertional oncogenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406; Porteus et al. Nat Biotechnol. 2005 23:967-973; Paques et al. Curr Gen Ther. 2007 7:49-66). However, site-specific integration continues to face challenges, such as low knock-in efficiency, risk of insertional oncogenesis, unstable and / or abnormal expression of adjacent genes or transgenes, and low accessibility (e.g., within 20 kB of adjacent genes). These challenges can be addressed, in part, by identifying and using safe harbor loci or safe harbor sites (SHSs), which are sites where genes or genetic elements can be integrated without disrupting the expression or regulation of adjacent genes.
[0328] The most widely used of the putative human safe harbor sites is the AAVS1 site on chromosome 19q, which was originally identified as a site for recurrent adeno-associated virus insertion. Other potential SHSs have been identified based on homology to sites originally identified in other species (e.g., the human homolog of the permissive mouse Rosa26 locus) or in an increasing number of human genes that appear non-essential under some circumstances. One putative SHS of this type is the CCR5 chemokine receptor gene, whose disruption confers resistance to human immunodeficiency virus infection. Additional potential genomic SHSs have been identified in humans and other cell types based on viral integration site mapping or gene trap analysis, similar to the original mouse Rosa26 locus. The top three SHSs, AAVS1, CCR5, and Rosa26, are located near many protein-coding genes and regulatory elements. (See Sadelain, M., et al. (2012). Safe harbors for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosure of which is incorporated herein by reference in its entirety.)
[0329] AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (e.g., DNA transgenes) with expected functions. It is located at position 19q13.42. It has an open chromatin structure and is transcriptionally competent. The canonical SHS locus for AAVS1 is chr19:55, 625, 241 to 55, 629, 351. See Pellenz et al., "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion," Human Gene Therapy, vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference). Exemplary AAVS1-targeting gRNAs and target sequences are provided below. ●AAVS1-gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT ●AAVS1 target sequence: ggggccactagggacaggat
[0330] CCR5, located on chromosome 3 at position 3p21.31, encodes the primary co-receptor for HIV-1. Disruption of this site in the CCR5 gene is beneficial in HIV / AIDS treatment and has prompted the development of zinc finger nucleases targeting its third exon. The canonical SHS locus for CCR5 is chr3:46, 414, 443 to 46, 414, 942. See Pellenz et al., "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion," Human Gene Therapy, Vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference).
[0331] The mouse Rosa26 locus is particularly useful for genetic modification because it can be targeted with high efficiency and is expressed in most cell types tested. Irion et al. 2007 (“Identification and targeting of the ROSA26 locus in human embryonic stem cells.” Nature biotechnology 25.12(2007):1477-1482, the relevant disclosure of which is incorporated herein by reference, identified the human homolog, human ROSA26, on chromosome 3 (position 3p25.3). The canonical SHS locus for human Rosa26 (hRosa26) is chr3:9,415,082-9,414,043. See Pellenz et al. “New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7(2019):814-828, the relevant disclosure of which is incorporated herein by reference.
[0332] Additional examples of safe harbor sites are provided in Pellenz et al. "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference). Additional examples of integration sites are provided in Table D.
[0333] In some embodiments, safe harbor sites allow for high transgene expression (sufficient to enable transgene functionality or treatment of the disease of interest) and stable expression of the transgene over days, weeks, or months. In some embodiments, knockout of the gene at the safe harbor locus confers a benefit to cellular function, or the gene at the safe harbor locus has no known function in the cell. In some embodiments, the safe harbor locus results in stable transgene expression in vitro with or without CD3 / CD28 stimulation, negligible off-target cleavage detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage compared to other loci detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and is located outside of cancer-associated genes.
[0334] When used, "neighboring genes" can refer to genes that are within about 100 kB, about 125 kB, about 150 kB, about 175 kB, about 200 kB, about 225 kB, about 250 kB, about 275 kB, about 300 kB, about 325 kB, about 350 kB, about 375 kB, about 400 kB, about 425 kB, about 450 kB, about 475 kB, about 500 kB, about 525 kB, or about 550 kB of the safe harbor locus (integration site).
[0335] In some embodiments, the present disclosure contemplates nucleic acid inserts containing one or more recombinant RNAi nucleic acids, such as at least one shRNA molecule. The incorporation of one or more recombinant RNAi nucleic acids can result in, for example, improved therapeutic properties. These enhanced therapeutic properties, as used herein, refer to enhanced therapeutic properties of cells compared to typical immune cells of the same normal cell type. For example, NK cells with "enhanced therapeutic properties" have enhanced, improved, and / or increased therapeutic outcomes compared to typical, unmodified, and / or naturally occurring NK cells. Therapeutic properties of immune cells may include, but are not limited to, cell engraftment, trafficking, homing, viability, self-renewal, persistence, immune response control and modulation, survival, and cytotoxicity. Therapeutic properties of immune cells may also be manifested by the expression of antigen-targeting receptors, HLA presentation or lack thereof, tolerance to the tumor microenvironment, induction and immunomodulation of bystander immune cells, improved target specificity due to reduction, and resistance to treatments such as chemotherapy.
[0336] As used herein, "insert size" refers to the length of the nucleotide sequence to be integrated (inserted) into the target locus or safe harbor site.
[0337] An insert, as used herein, refers to a nucleic acid molecule or polynucleotide inserted into a target locus or safe harbor site. In some embodiments, the nucleotide sequence is a DNA molecule, e.g., genomic DNA, or comprises deoxyribonucleotides. In some embodiments, the insert comprises smaller fragments of DNA, such as plastid DNA, mitochondrial DNA, or DNA isolated in the form of a plasmid, fosmid, cosmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), and / or any other subgenomic segment of DNA. Nucleotides in the insert are contemplated as naturally occurring nucleotides, non-naturally occurring nucleotides, and modified nucleotides. Nucleotides may be chemically or biochemically modified or contain non-natural or derivatized nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with an analog, and internucleotide modifications. Polynucleotides can be in any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular conformations, and other three-dimensional conformations contemplated in the art.
[0338] The insert can have coding and / or non-coding regions. The insert can include non-coding sequences (e.g., regulatory elements, e.g., promoter sequences). In some embodiments, the insert encodes one or more recombinant RNAi nucleic acids.
[0339] In some embodiments, nucleic acid sequences are inserted into the genome of immune cells via non-viral delivery.In non-viral delivery methods, nucleic acids can be naked DNA or can be in non-viral plasmids or vectors.Non-viral delivery techniques can be site-specific integration techniques described herein or known to those skilled in the art.Examples of site-specific techniques for integration into safe harbor loci include, but are not limited to, homology-dependent manipulation using nucleases and homology-independent targeted insertion using Cas9 or other CRISPR endonucleases.
[0340] In some embodiments, an insert is integrated into a safe harbor site by introducing into the engineered cell (a) a targeting nuclease that cleaves a target region of the safe harbor site to create an insertion site, and (b) a nucleic acid sequence (the insert), where the insert is integrated into the insertion site, for example, by HDR. Examples of non-viral delivery techniques that can be used in the methods of the present disclosure are provided in U.S. Application Nos. 16 / 568,116 and 16 / 622,843, the relevant disclosures of which are incorporated herein by reference in their entireties.
[0341] Examples of contemplated safe harbor integration sites are provided in Table D.
[0342] [Table D] TIFF2025532585000003.tif239165TIFF2025532585000004.tif239165TIFF2025532585000005.tif239165TIFF2025532585000006.tif23916 5TIFF2025532585000007.tif241165TIFF2025532585000008.tif235165TIFF2025532585000009.tif229165TIFF2025532585000010.tif90165
[0343] CRISPR-Cas editing One effective example of gene editing is the CRISPR-Cas approach (e.g., CRISPR-Cas9), which incorporates the use of a guide polynucleotide (e.g., a guide ribonucleic acid or gRNA) and a cas endonuclease (e.g., Cas9 endonuclease).
[0344] As used herein, a polypeptide referred to as a "Cas endonuclease" or having "Cas endonuclease activity" refers to a CRISPR-associated (Cas) polypeptide encoded by a Cas gene, which is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., U.S. Patent No. 8,697,359). This definition also includes variants of Cas endonucleases that retain guide polynucleotide-dependent endonuclease activity. The Cas endonucleases used in the donor DNA insertion methods detailed herein are endonucleases that introduce double-strand breaks in DNA at target sites (e.g., within a target locus or at a safe harbor site).
[0345] As used herein, the term "guide polynucleotide" refers to a polynucleotide sequence that can complex with a Cas endonuclease and enable the Cas endonuclease to recognize and cleave a DNA target site. A guide polynucleotide can be a single molecule or a double molecule. A guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence). A guide polynucleotide that contains only ribonucleic acid is also referred to as a "guide RNA." In some embodiments, a polynucleotide donor construct is inserted into a safe harbor locus using a guide RNA (gRNA) in combination with a cas endonuclease (e.g., Cas9 endonuclease).
[0346] The guide polynucleotide comprises a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) that is complementary to a nucleotide sequence in the target DNA, and a second nucleotide sequence that interacts with a Cas endonuclease polypeptide. The guide polynucleotide may be a duplex molecule (also referred to as a double-stranded guide polynucleotide) that comprises a sequence domain (also referred to as a Cas endonuclease recognition domain or CER domain). The CER domain of this duplex guide polynucleotide comprises two separate molecules that hybridize along complementary regions. The two separate molecules may be RNA sequences, DNA sequences, and / or RNA-DNA combination sequences.
[0347] Genome editing using the CRISPR-Cas approach relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by RNA-guided Cas endonucleases (e.g., Cas9 endonuclease). Homologous recombination repair (HDR) of these DSBs allows for precise editing of the genome by introducing defined genomic changes, including base substitutions, sequence insertions, and deletions. Conventional HDR-based CRISPR / Cas9 genome editing involves transfecting cells with Cas9, gRNA, and donor DNA containing homologous arms matching the locus of interest.
[0348] HITI (homology-independent targeted insertion) uses a homology-independent strategy based on non-homologous end joining (NHEJ), which can be more efficient than HDR. A guide RNA (gRNA) targets the insertion site. For HITI, the donor plasmid lacks homology arms, and DSB repair does not occur via the HDR pathway. The donor polynucleotide construct can be engineered to contain Cas9 cleavage site(s) adjacent to the gene or sequence to be inserted. This results in Cas9 cleavage in both the donor plasmid and the genomic target sequence. Both the target and donor have blunt ends, and the linearized donor DNA plasmid is used by the NHEJ pathway, which leads to integration into the genomic DSB site. (See, e.g., Suzuki, K., et al. (2016). In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration. Nature, 540(7631), 144-149, the relevant disclosure of which is incorporated herein in its entirety.)
[0349] Methods for gene editing using CRISPR-Cas approaches are known to those skilled in the art. (See, e.g., U.S. Application Nos. US16 / 312,676, US15 / 303,722, and US15 / 628,533, the disclosures of which are incorporated herein by reference in their entireties.) Additionally, the use of endonucleases to insert transgenes into safe harbor loci is described, for example, in U.S. Application No. 13 / 036,343, the disclosure of which is incorporated herein by reference in its entirety.
[0350] The guide RNA and / or mRNA (or DNA) encoding the endonuclease can be chemically conjugated to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Non-limiting examples of such moieties include cholesterol moieties, cholic acid, thioethers, thiocholesterol, aliphatic chains (e.g., dodecanediol or undecyl residues), phospholipids such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-3-H-phosphonate, polyamine or polyethylene glycol chains, adamantane acetic acid, palmityl moieties, and lipid moieties such as octadecylamine or hexylamino-carbonyl-t-oxycholesterol moieties. See, e.g., U.S. Patent Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.
[0351] therapeutic use For therapeutic applications, the engineered cells, populations thereof, or compositions thereof are administered to a subject, generally a mammal, generally a human, in an effective amount.
[0352] The engineered cells can be administered to a subject by infusion (eg, continuous infusion over a period of time) or other modes of administration known to those of skill in the art.
[0353] The engineered cells provided herein find use in gene therapy as well as non-pharmaceutical uses, such as, for example, the production of animal models and the production of recombinant cell lines expressing a recombinant nucleic acid of interest.
[0354] The engineered cells of the present disclosure can be any cell, generally a mammalian cell, generally a human cell, that has been modified by incorporating a transgene into a safe harbor locus as described herein. Exemplary cells are provided in the recombinant cell section.
[0355] The engineered cells, compositions, and methods of the present disclosure are useful for therapeutic applications such as immunotherapy or T cell therapy. In some embodiments, insertion of a sequence encoding an shRNA molecule within a safe harbor locus maintains TCR expression relative to the absence of the insertion, allowing transgene expression while maintaining TCR function.
[0356] In some embodiments, the present disclosure provides methods of treating a subject in need of treatment by administering to the subject a composition comprising any of the engineered cells described herein. In some embodiments, administration of the engineered cell composition results in a desired pharmacological and / or physiological effect. This effect can be a partial or complete cure of the disease and / or adverse effects resulting from the disease. In some embodiments, treatment includes any treatment of a disease in a subject (e.g., a mammal, e.g., a human). Additionally, treatment can stabilize or reduce undesirable clinical symptoms in a subject (e.g., a patient). The cells, populations thereof, or compositions thereof provided herein can be administered during or after the onset of a disease.
[0357] In certain embodiments, a subject has a disease, condition, and / or injury that can be treated and / or ameliorated by cell therapy. In some embodiments, a subject in need of cell therapy is a subject with an injury, disease, or condition that triggers cell therapy (e.g., therapy in which cellular material is administered to the subject). However, it is contemplated that the severity of at least one symptom associated with the injury, disease, or condition can be treated, ameliorated, and / or reduced.
[0358] Method of administration An effective amount of the immune cells comprising the system can be administered for the treatment of cancer. The appropriate dosage of the immune cells comprising the system can be determined based on the type of cancer being treated, the type of immune cells comprising the system, the severity and course of the cancer, the individual's clinical condition, the individual's clinical history and response to treatment, and the judgment of the attending physician.
[0359] Pharmaceutical Compositions The engineered recombinant cells or recombinant nucleic acids provided herein can be administered as part of a pharmaceutical composition. These compositions can contain, in addition to one or more of the recombinant cells, pharmaceutically acceptable excipients, carriers, buffers, stabilizers, or other materials known to those of skill in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, or intraperitoneal. Pharmaceutical compositions can contain one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used, and one of skill in the art can select a suitable pharmaceutical excipient. Therefore, the pharmaceutical excipients provided below are intended to be exemplary and not limiting. Additional pharmaceutical excipients include those described, for example, in Handbook of Pharmaceutical Excipients, Rowe et al. (Eds.) 6 th Ed. (2009), which is incorporated by reference in its entirety.
[0360] Various modes of administering the additional therapeutic agent are contemplated herein. In some embodiments, the additional therapeutic agent is administered by any suitable mode of administration.
[0361] The compositions can be administered alone or in combination with other treatments, either simultaneously or sequentially, depending on the condition to be treated.
[0362] Kits and Products The present application provides kits comprising any one or more of the systems or cell compositions described herein and instructions for use. The instructions may be present in the kit as a package insert, on a label on the container of the kit or its components, or in digital form (e.g., on a CD-ROM or via an internet link). The kit may include one or more of a genome-targeting nucleic acid, a polynucleotide encoding the genome-targeting nucleic acid, a site-directed polypeptide, and / or a polynucleotide encoding the site-directed polypeptide. Additional components in the kit, such as buffers (reconstitution buffer, stabilization buffer, dilution buffer, etc.), and / or one or more control vectors, are also contemplated.
[0363] In some embodiments, the kit further contains a component selected from any of a secondary antibody, a reagent for immunohistochemistry, a pharmaceutically acceptable excipient, and instructions, and any combination thereof. In a specific embodiment, the kit comprises a pharmaceutical composition comprising any one or more of the antibody compositions described herein and one or more pharmaceutically acceptable excipients.
[0364] The present application also provides an article of manufacture comprising any one of the antibody compositions or kits described herein. An example of an article of manufacture is a vial (including a sealed vial). [Example]
[0365] Below are examples of specific embodiments for carrying out the present invention. The examples are provided for illustrative purposes only and are not intended to limit the scope of the present disclosure in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.
[0366] The practice of the present invention will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA technology, and pharmacology, which are within the skill of the art. Such techniques are fully explained in the literature, see, for example, TECreighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2002); nd Edition, 1989), Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.), Remington's Pharmaceutical Sciences, 18 th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990), Carey and Sundberg Advanced Organic Chemistry 3 rd Ed. (Plenum Press) Vols A and B (1992).
[0367] Example 1: Identification and characterization of combinatorial gene perturbations that affect T cell killing or proliferation in vitro material T cell editing and repeated stimulation evaluation using cells in vitro Engineered T cells were generated using CITE non-viral gene delivery. Briefly, pan-T cells were isolated from healthy human donors using the Miltenyi StraightFrom® Leukopak® CD4 / CD8 MicroBead Kit. Isolated T cells were stimulated with anti-CD3 / anti-CD28 beads. Two days after stimulation, cells were resuspended in a solution containing S. pyogenes Cas9 complexed with the GS94 guide RNA and a donor DNA template encoding the transgene of interest. To evaluate the effects of various gene knockouts, cells were treated with Cas9 RNPs plus sgRNAs targeting DNMT3A, TET2, CD5, DGKA, DGKZ, MAP4K1, CBLB, FAS, PTPN2, NR4A1, ZC3H12A, or CISH, either alone or in the indicated combinations. The effective sequences of the sgRNAs are summarized in Table 1. Cells were then electroporated using a Lonza 4-D Nucleofector and harvested in fresh medium supplemented with IL-7 and IL-15. Cells were counted, and fresh medium was added every 2-3 days after electroporation. All constructs tested encoded logic gates expressing the PrimeR receptor (SEQ ID NO: 213) for ALPG and a CAR (SEQ ID NO: 212) targeting MSLN. Such cells are referred to as integrated circuit T cells (ICT).
[0368] Four days after electroporation, edited cells were enriched for Myc+ cells via positive selection using beads (the Myc tag was expressed on the priming receptor). T cells were co-cultured with K562 tumor cells engineered to express ALPG and MSLN at a 2:1 effector:target (E:T) ratio. T cells and tumors were quantified by flow cytometry every 2–3 days. At each time point, T cells were normalized to a defined concentration and restimulated at a 2:1 E:T ratio. A total of six stimulations were performed over 14 days.
[0369] Computational integration of RSA data Proliferation of T cells and target tumor cells over the course of RSA was determined by a computational workflow substituting the total number of cells per well with the following formula: Volume = (number of beads + 1) ÷ (bead concentration x beads (uL)) Number of cells per μL = Number of tags ÷ Volume Number of cells per mL = (1000 ÷ cell volume) × number of cells per μL Total cell number = (well volume ÷ 1000) × number of cells per mL
[0370] The primary tags used in the workflow were CD3 (T cells) and GFP (target tumor cells). The total number of T cells per well on day 0 was assigned as the total number of T cells seeded, which was typically 85,000. The total number of target tumor cells on day 0 was calculated based on the E:T ratio. For example, if 85,000 T cells were seeded and the E:T ratio was 2:1, the number of target tumor cells on day 0 would be 42,500.
[0371] Quality control was performed on each well and wells with any of the following criteria were excluded: any wells where the T cell count decreased to 0 and then increased; any wells with less than 100 beads; any wells with less than 20 viable cells.
[0372] At each restimulation time point, cells were re-normalized, typically equaling 85,000 "T cells per stimulation," maintaining an E:T ratio of 2:1 if possible to ensure T cells were constantly challenged. In each well, if there were more T cells than "T cells per stimulation," T cells were diluted. Otherwise, no dilution was performed and no additional T cells were added. This was reflected in the calculation workflow by normalizing the observed total T cell number at each time point by the dilution factor, defined as follows (where "total T cell number" is the "total cell number" calculated as above for the CD3 tag): Dilution = number of T cells per stimulation / total number of T cells (if "total number of cells" ≥ "number of T cells per stimulation") 1 (if "total cell number" < "number of T cells per stimulation") Renormalized total T cell count = total T cell count x dilution
[0373] In the experimental protocol, if the target cell number was lower than the desired number based on the "number of T cells per stimulation" and E:T ratio, additional target cells were added at each stimulation. For example, if the "number of T cells per stimulation" was 85,000 and the E:T ratio was 2:1, the target cells were renormalized to 42,500 cells. On the other hand, if the target cell number exceeded this amount, no target cell removal was performed unless dilutions were performed based on T cell number as described above. This is reflected in the calculation workflow as follows, where "total target cell number" and "total T cell number" are the "total cell number" calculated as described above for GFP and CD3 tags, respectively): Number of diluted targets = total number of target cells x dilution Target by ET ratio = total T cell count × dilution ÷ ET ratio Renormalized total target cell number = Max(target number by dilution, target by ET ratio)
[0374] T cell and target cell proliferation values were calculated at each time point as the ratio of the total cell number observed to the amount at the previous renormalization and summarized cumulatively as follows (where n = total number of measurements): T cell proliferation = (total T cell number + 1) ÷ (renormalized total T cell number + 1) TIFF2025532585000011.tif23165
[0375] "T cell proliferation" values were capped at 0.05 and 999 to prevent extreme values from dominating the cumulative summary measure. Target tumor cell proliferation values were calculated similarly. T cell and target cell proliferation metrics were then normalized to the control sample for downstream analysis.
[0376] statistical analysis A false discovery rate (FDR) statistical approach was used to identify gene perturbations that, when paired, significantly improved either T cell-mediated target killing or T cell proliferation compared to their individual constituent genes. Briefly, log values were normalized to the non-targeting control (NTC) per plate per donor, with median NTC across replicates = 1; log for T cell proliferation (CD3) and log for target proliferation (GFP). 10 Two tests were performed on both the ICT proliferation and target cell killing function data: 1) one-tailed t-tests of paired perturbation combinations against each single perturbation, excluding the NTC control, and 2) one-tailed t-tests of combined perturbations compared to the composite sum of the single perturbation values to test for superadditivity. For single gene perturbations, the statistics used in the t-tests were defined as follows: mean was defined as the mean across replicates of gene perturbation A + the mean across replicates of gene perturbation B. Standard deviation was defined as sqrt(variance of gene perturbation A + variance of gene perturbation B). n was defined as the number of samples for gene perturbation A + the number of samples for gene perturbation B. Benjamini-Hochberg FDR correction was performed as follows: one-tailed t-tests of combined gene perturbations against each individual gene perturbation, corrected across all combinations. One-tailed t-tests of combined gene perturbations compared to the composite sum of the individual constituent gene perturbations, corrected across all tests. Fold changes (i.e., log-scale differences) were calculated as the combined gene perturbations compared to their composite sum: (mean logarithmic value of the combined gene perturbations normalized to the non-targeting control) minus the sum (mean logarithmic value of the individual gene perturbations normalized to the NTC). The combined gene perturbations compared to each single perturbation: (mean logarithmic value of the combined gene perturbations normalized to the NTC) minus (mean logarithmic value of the single gene perturbations normalized to the NTC). A relaxed FDR cutoff of 0.05 was used to compile the table.
[0377] result To identify genes that confer additive benefits when perturbed in pairs relative to either of the individual component genes, we performed pairwise CRISPR screens in which DNMT3A, TET2, CD5, DGKA, DGKZ, MAP4K1, CBLB, FAS, PTPN2, NR4A1, ZC3H12A, or CISH were ablated individually or in combination with each other via CRISPR / Cas9 in T cells and subjected to repetitive cell-based killing assays to induce a high-stress, exhaustion-prone situation.
[0378] As shown in Figure 1, the observed T cell killing activity between single and dual gene perturbations ranged from a slight decrease in killing in T cells with perturbations to DGKZ to a 7 log decrease observed with combined perturbations of TET2 and CBLB. 10 The combined perturbations with CBLB showed significant improvements in T cell killing, with 8 of the top 10 combined perturbations including CBLB as one of the component genes. Several gene perturbation combinations were identified that showed statistically significant superior T cell killing compared to either of the individual component genes (summarized in Table 1), indicating that combined perturbations provide benefits compared to the individual perturbations. Furthermore, many of the gene combinations showed statistically significant superior T cell killing compared to the composite sum of the individual combinations (summarized in Table 2), indicating that these combinations induce supra-additive killing activity.
[0379] Table 1 provides gene knockout combinations that conferred superior T cell cytotoxicity to either of the individual component genes.
[0380] [Table 1] TIFF2025532585000013.tif30165
[0381] Table 2 provides gene knockout combinations that conferred superadditive T cell killing compared to either of the individual component genes.
[0382] [Table 2] TIFF2025532585000015.tif239165TIFF2025532585000016.tif37165
[0383] While CRISPR-mediated CD5 perturbation as a single gene perturbation did not confer a significant improvement in T cell killing compared to non-targeting controls, pairwise CD5 perturbation with other genes, such as ZC3H12A, DGKZ, PTPN2, DNMT3A, MAP4K1, DGKA, and CISH, did not similarly confer improved killing when evaluated as single perturbations (Figure 2A). CD5 perturbation in combination with genes such as TET2 and CBLB, which conferred improved killing as single perturbations, also demonstrated superior killing than expected due to additive activity. Combined CD5 perturbation with NR4A1 was not significantly different from either individual perturbation, providing an example that not all combined CD5 perturbations produce supra-additive effects.
[0384] CRISPR-mediated perturbation of CBLB significantly improved T cell killing, by 3 logs compared to non-targeting controls. 10 The CBLB gene expression levels were significantly higher than those observed with CBLB alone (Figure 2B). Perturbation of CBLB in pairs with other genes, such as ZC3H12A, PTPN2, DGKZ, DNMT3A, CISH, and DGKA, which did not confer improved killing when assessed as single perturbations, resulted in significant improvements in killing over that observed with CBLB perturbation alone. Perturbation of CBLB in combination with genes, such as TET2, which conferred improved killing as single perturbations, also demonstrated superior killing than expected due to additive activity. Combined perturbation of CBLB with NR4A1 or MAP4K1 was not significantly different from single perturbations of CBLB or the other paired genes alone, providing examples of combined perturbations with CBLB that do not produce supra-additive effects.
[0385] CRISPR-mediated perturbation of CISH did not significantly alter T cell killing compared to non-targeting controls (Figure 2C). Paired CISH perturbations with other genes that did not confer improved killing when assessed as single perturbations, including pairing with PTPN2, MAPK41, DGKZ, DGKA, and DNMT3A, resulted in significant improvements in killing beyond that observed with CISH perturbations alone. Perturbations of CISH in combination with genes that conferred improved killing as single perturbations, such as TET2 and CBLB, also demonstrated superior killing than expected due to additive activity. Combined perturbations of CISH with ZC3H12A or NR4A1 were not significantly different from single perturbations of CISH or the other paired genes alone, demonstrating examples of combined perturbations with CISH that do not produce superadditive effects.
[0386] CRISPR-mediated perturbation of DNMT3A did not significantly affect T cell killing compared to non-targeting controls (Figure 2D). Perturbation of DNMT3A in pairs with other genes that did not confer improved killing when assessed as single perturbations, including pairing with DGKZ, PTPN2, CD5, and CISH, resulted in significant improvements in killing beyond that observed with DNMT3A perturbation alone. Perturbation of DNMT3A in combination with genes such as CBLB, which conferred improved killing as single perturbations, also demonstrated superior killing than expected due to additive activity. Combined perturbation of DNMT3A with ZC3H12A, DGKA, NR4A1, MAP4K1, or TET2 was not significantly different from single perturbations of DNMT3A or the other paired genes alone, demonstrating examples of combinatorial perturbations with DNMT3A that do not produce supra-additive effects.
[0387] CRISPR-mediated perturbation of DGKA did not significantly alter T cell killing compared to non-targeting controls (Figure 2E). Perturbation of DGKA in pairs with other genes that did not confer improved killing when assessed as single perturbations, including pairing with ZC3H12A, MAP4K1, DGKZ, PTPN2, CISH, and CD5, resulted in significant improvements in killing beyond that observed with DGKA perturbation alone. Perturbation of DGKA in combination with genes such as TET2 and CBLB, which conferred improved killing as single perturbations, also demonstrated superior killing than expected due to additive activity. Combined perturbation of DGKA with DNMT3A or NR4A1 was not significantly different from single perturbations of DGKA or the other paired genes alone, providing examples of combined perturbations with DGKA that did not produce a supra-additive effect.
[0388] CRISPR-mediated perturbation of DGKZ resulted in a modest decrease in T cell killing compared to non-targeting controls (Figure 2F). Perturbation of DGKZ in pairs with other genes that did not confer improved killing when assessed as single perturbations, including pairing with PTPN2, CISH, and DGKA, resulted in significant improvements in killing beyond that observed with DGKZ perturbation alone. Perturbation of DGKZ in combination with genes that conferred improved killing as single perturbations, such as CBLB, also demonstrated superior killing than expected due to additive activity. Combined perturbation of DGKZ with MAP4K1, DNMT3A, TET2, CD5, or NR4A1 was not significantly different from single perturbations of DGKZ or the other paired genes alone, demonstrating examples of combined perturbations with DGKZ that do not produce supra-additive effects.
[0389] CRISPR-mediated perturbation of MAP4K1 did not significantly affect T cell killing compared to non-targeting controls (Figure 2G). Perturbation of MAP4K1 in pairs with other genes that did not confer improved killing when assessed as single perturbations, including pairing with ZC3H12A, PTPN2, DGKA, and CISH, resulted in significant improvements in killing beyond that observed with MAP4K1 perturbation alone. Perturbation of MAP4K1 in combination with genes such as TET2 and CBLB, which conferred improved killing as single perturbations, did not further improve killing activity. Combined perturbation of MAP4K1 with NR4A1, TET2, or CBLB was not significantly different from single perturbations of MAP4K1 or the other paired genes alone, demonstrating examples of combined perturbations with MAP4K1 that do not produce supra-additive effects.
[0390] CRISPR-mediated perturbation of NR4A1 resulted in a modest improvement in T cell killing compared to non-targeting controls (Figure 2H). Perturbation of NR4A1 in pairs with other genes did not result in an improvement in killing beyond that expected from NR4A1 alone or the paired genes. These findings highlight the impossibility of predicting which genes, when perturbed in pairs, will have the ability to complement each other as additive or supra-additive contributors to T cell killing.
[0391] CRISPR-mediated perturbation of PTPN2 did not significantly affect T cell killing compared to non-targeting controls (Figure 2I). Perturbation of PTPN2 in pairs with other genes that did not confer improved killing when assessed as single perturbations, including pairing with MAP4K1, CISH, DGKZ, DGKA, CD5, and DNMT3A, resulted in significant improvements in killing beyond that observed with PTPN2 perturbation alone. Perturbation of PTPN2 in combination with genes such as TET2 or CBLB, which conferred improved killing as single perturbations, also demonstrated superior killing than expected due to additive activity. Combined perturbation of PTPN2 with ZC3H12A or NR4A1 was not significantly different from single perturbations of PTPN2 or the other paired genes alone, demonstrating examples of combinatorial perturbations with PTPN2 that do not produce supra-additive effects.
[0392] CRISPR-mediated perturbation of TET2 resulted in a modest improvement in T cell killing compared to non-targeting controls (Figure 2J). Perturbation of TET2 in pairs with other genes that did not confer improved killing when assessed as single perturbations, including pairing with ZC3H12A, PTPN2, DGKA, CD5, and CISH, resulted in significant improvements in killing beyond that observed with TET2 perturbation alone. Perturbation of TET2 in combination with genes such as NR4A1 or CBLB, which conferred improved killing as single perturbations, also demonstrated superior killing than expected due to additive activity. Combined perturbation of TET2 with DGKZ, DNMT3A, or MAP4K1 was not significantly different from single perturbations of TET2 or the other paired genes alone, demonstrating examples of combinatorial perturbations with TET2 that do not produce supra-additive effects.
[0393] CRISPR-mediated perturbation of ZC3H12A resulted in a modest decrease in T cell killing compared to non-targeting controls (Figure 2K). Perturbation of ZC3H12A in pairs with other genes that did not confer improved killing when assessed as single perturbations, including pairing with MAP4K1 and DGKA, resulted in significant improvements in killing beyond that observed with ZC3H12A perturbation alone. Perturbation of ZC3H12A in combination with genes that conferred improved killing as single perturbations resulted in improvements in killing beyond that expected for either paired gene alone. Combined perturbation of ZC3H12A with CISH, NR4A1, DGKZ, DNMT3A, PTPN2, TET2, CD5, or CBLB was not significantly different from single perturbations of ZC3H12A or the other paired genes alone, demonstrating examples of combined perturbations with ZC3H12A that do not produce superadditive effects.
[0394] In addition to different effects on T cell-mediated target cell killing, a wide range of T cell proliferation was observed between single and dual gene perturbations (summarized in Figure 3 ), ranging from a moderate decrease in proliferation of T cells with perturbations to DGKA+NR4A1 compared to non-targeting controls to a 4-log decrease observed with combined perturbations of TET2 and PTPN2. 10 Combination perturbations with TET2 showed significant improvements in T cell killing, with five of the top 10 combination perturbations including TET2 as one of the component genes. Several combinations of gene perturbations were identified that showed statistically significant superior T cell proliferation compared to either of the individual component genes (summarized in Table 3), indicating that the combined perturbation of these genes provides a benefit compared to the individual gene perturbations. Furthermore, many of the combinations of gene perturbations showed statistically significant superior T cell proliferation compared to the combined sum of the individual combinations (summarized in Table 4), indicating that these combinations induce supra-additive killing activity.
[0395] Table 3 provides gene knockout combinations that conferred superior T cell proliferation to either of the individual component genes.
[0396] [Table 3]
[0397] Table 4 provides gene knockout combinations that conferred superadditive T cell proliferation compared to either of the individual component genes.
[0398] [Table 4]
[0399] CRISPR-mediated CD5 perturbation did not significantly affect T cell proliferation compared to non-targeting controls (Figure 4A). Pairwise perturbation of CD5 with MAP4K1, TET2, and CBLB improved proliferation compared to either of the constituent genes or the combined sum of these genes, indicating that co-perturbation of these genes produces a supra-additive effect. Co-perturbation of CD5 with NR4A1, DNMT3A, DGKZ, CISH, PTPN2, DGKA, or ZC3H12A did not produce a supra-additive effect, but significant effects were observed in combination with CD5 and DGKA or MAP4K1 compared to perturbation of these genes alone.
[0400] CRISPR-mediated perturbation of CBLB improved T cell proliferation compared to non-targeting controls (Figure 4B). Pairwise perturbation of CBLB with CD5 and TET2 improved proliferation compared to either of the constituent genes or the combined sum of these genes, indicating that co-perturbation of these genes produces a supra-additive effect. Co-perturbation of CBLB with NR4A1, DGKA, DGKZ, MPA4K1, ZC3H12A, CISH, DNMT3A, or PTPN2 did not produce a supra-additive effect, but significant effects were observed in combination with CBLB and DGKA or MAP4K1 compared to perturbation of these genes alone.
[0401] CRISPR-mediated CISH perturbation increased T cell proliferation by approximately 3 logs compared to non-targeting controls (Figure 4C). Pairwise CISH perturbation with other genes did not significantly improve proliferation beyond the effects of perturbing either of the individual component genes in any pair.
[0402] CRISPR-mediated perturbation of DNMT3A did not significantly affect T cell proliferation compared to non-targeting controls (Figure 4D). Perturbation of DNMT3A in pairs with other genes did not significantly improve proliferation beyond the effects of perturbing either of the individual component genes in any pair.
[0403] CRISPR-mediated perturbation of DGKA increased T cell proliferation compared to non-targeting controls (Figure 4E). Perturbation of DGKA in pairs with other genes did not significantly improve proliferation beyond the effects of perturbing either of the individual component genes in any pair.
[0404] CRISPR-mediated perturbation of DGKZ did not significantly affect T cell proliferation compared to non-targeting controls ( Figure 4F ). Perturbation of DGKZ in pairs with other genes did not significantly improve proliferation beyond the effects of perturbing either of the individual component genes in any pair.
[0405] CRISPR-mediated perturbation of MAP4K1 improved T cell proliferation compared to non-targeting controls (Figure 4G). Paired perturbation of MAP4K1 with CD5 improved proliferation compared to either of the constituent genes or the combined sum of these genes, indicating that co-perturbation of these genes produces a supra-additive effect. Co-perturbation of MAP4K1 with NR4A1, DGKZ, CISH, DNMT3A, ZC3H12A, DGKA, CBLB, TET2, or PTPN2 did not produce a supra-additive effect, but a significant impact was observed with the combination of MAP4K1 and TET2 compared to either gene perturbation alone.
[0406] CRISPR-mediated perturbation of NR4A1 did not significantly affect T cell proliferation compared to non-targeting controls (Figure 4H). Perturbation of NR4A1 in pairs with other genes did not significantly improve proliferation beyond the effects of perturbing either of the individual component genes in any pair.
[0407] CRISPR-mediated perturbation of PTPN2 increased T cell proliferation by approximately 2 logs compared to non-targeting controls (Figure 4I). Pairwise perturbation of PTPN2 with TET2 improved proliferation compared to either of the constituent genes or the combined sum of these genes, indicating that co-perturbation of these genes produces a supra-additive effect. Co-perturbation of MAP4K1 with NR4A1, DGKZ, ZC3H12A, CISH, CBLB, DGKA, CD5, MAP4K1, or DNMT3A did not produce a supra-additive effect.
[0408] CRISPR-mediated TET2 perturbation slightly improved T cell proliferation compared to non-targeting controls (Figure 4J). Pairwise perturbation of TET2 with CD5, CBLB, ZC3H12A, or PTPN2 improved proliferation compared to either of the constituent genes or the combined sum of these genes, indicating that co-perturbation of these genes produces a supra-additive effect. Co-perturbation of TET2 with DNMT3A, DGKZ, MAP4K1, DGKA, NR4A1, or CISH did not produce a supra-additive effect.
[0409] CRISPR-mediated perturbation of ZC3H12A improved T cell proliferation compared to non-targeting controls (Figure 4K). Pairwise perturbation of ZC3H12A with TET2 improved proliferation compared to either of the constituent genes or the combined sum of these genes, indicating that co-perturbation of these genes produces a supra-additive effect. Co-perturbation of TET2 with MAP4K1, DGKZ, NR4A1, CBLB, DGKA, PTPN2, CISH, DNMT3A, or CD5 did not produce a supra-additive effect.
[0410] Example 2: Characterization of combinatorial gene perturbations in vitro and in vivo material Generation of logic gated CAR T T cells from donors were isolated from Leukopacks® and activated (day 0). Forty-eight hours after activation, T cells were engineered (day 2). To engineer T cells, sgRNAs targeting the indicated sites or sgRNAs against CD5 (SEQ ID NO: 12), CBLB (SEQ ID NO: 13), CISH (SEQ ID NO: 14), DGKA (SEQ ID NO: 15), DNMT3A (SEQ ID NO: 17), PTPN2, TET2, FAS (SEQ ID NO: 207), and / or ZC3H12A, or dual shRNA constructs targeting FAS (SEQ ID NO: 208) and PTPN2 (SEQ ID NO: 141) or dual shRNA controls targeting luciferase (SEQ ID NOs: 208 and 209), were complexed with sNLS-SpCas9-sNLS nuclease for 10 minutes at room temperature to form a ribonucleoprotein mix. Specific sgRNA combinations are provided in Table 5. Then, a plasmid containing logic gate CAR (SEQ ID NO: 212) and PrimeR (SEQ ID NO: 213) and ThermoFisher™ Gene Editing Buffer were added to the ribonucleoprotein and mixed. The mix was added to activated T cells and electroporated using a Xenon Electroporator and Singleshot system. After electroporation, the engineered T cells were harvested using fresh medium supplemented with 12.5 ng / mL of IL-7 and IL-15. The engineered T cells were replenished with fresh medium supplemented with 12.5 ng / mL of IL-7 and IL-15 on days 3 and 5. Six days after manipulation (day 8), the cells were evaluated for logic gate insertion and cryopreserved.
[0411] In vitro repeated stimulation assay evaluation of logic-gated CAR T The ALPG / MSLN logic gate plus gene knockout or shRNA knockdown was compared in a repeated stimulation assay using H1975 target cells. The engineered ALPG / MSLN CAR was enriched for CAR+ cells via the Myc surface protein tag. H1975 target cells were seeded at 10,000 cells / well in a 96-well plate, and 10,000 Myc+CAR T cells were added to achieve a target-to-CAR ratio of 1:1. Target cell killing was monitored using fluorescent tags within the target cells and an Incucyte® system for real-time imaging. Every three days, half of the T cells were removed and seeded on 10,000 fresh target cells for a total of four rounds of target cell stimulation. Between reseedings, one-quarter of the T cells were harvested and subjected to flow analysis of CAR proliferation. Performance was quantified as the fold improvement over CAR alone in both proliferation and target cell killing.
[0412] In vivo tumor model evaluation of logic-gated CAR T To evaluate the efficacy of T cells engineered with the ALPG / MSLN logic gate, a subcutaneous lung cancer model, H1975, was used. Logic gates containing gene knockouts for combinations of CBLB, CISH, DGKA, DNMT3A, PTPN2, TET2, and / or ZC3H12A genes were compared to unedited control T cells. NSG MHC I / II KO mice were injected with Hi975 cells overexpressing hALPG and hMSLN. H1975 cells were injected into the right flank of mice in a 1:1 suspension in 100 μL of phosphate-buffered saline (PBS). Animals were randomized into treatment groups according to tumor volume, and T cells were administered at a dose of 0.1 × 10 6 The tumor volumes were measured before and twice a week after the start of treatment and calculated as V = (length × width 2) / 2.
[0413] result To evaluate the effect of gene perturbations on the performance of logic gate-expressing CAR-T cells, we performed repeated stimulation assays using H1975 cells expressing exemplary ALPG / MSLN logic gates with CRISPR-mediated perturbation or shRNA-mediated knockdown of selected gene combinations. As shown in Figure 5, several tested combinations of gene perturbation(s) or knockdown(s) enhanced the combined performance of logic gate-expressing T cells, while two combinations reduced the combined performance. A summary of combinations that enhanced the performance of logic gate T cells is provided in Table 5.
[0414] TIFF2025532585000019.tif131165
[0415] To evaluate the effect of combined gene knockdown on the antitumor activity of logic gate T cells in vivo, H1975 cells expressing exemplary ALPG / MSLN logic gates with CRISPR-mediated perturbation of selected gene combinations were tested in a subcutaneous NSG lung cancer model.
[0416] Combined knockout of DNMT3A and CBLB resulted in a reduction in initial tumor volume, with subsequent growth beginning 70 days after tumor engraftment (Figure 6A). Combined knockout of TET2 and PTPN2 resulted in a reduction in initial tumor volume, with subsequent growth beginning around 70 days after tumor engraftment (Figure 6B). Combined knockout of CBLB and PTPN2 resulted in a sustained reduction in tumor volume over the experimental period (Figure 6C). Combined knockout of PTPN2 and CISH resulted in a reduction in initial tumor volume, with subsequent growth beginning around 70 days after tumor engraftment (Figure 6D). Combined knockout of PTPN2 and ZC3H12A resulted in a reduction in initial tumor volume, with subsequent growth beginning around 80 days after tumor engraftment (Figure 6E).
[0417] Example 3: Validation of shRNA against target genes in vitro method shRNA-mediated gene knockdown T cells from at least three donors were engineered to express shRNA modules containing sequences for the luciferase control (SEQ ID NOs: 205 and 206) or for CBLB (SEQ ID NOs: 23-46), CISH (SEQ ID NOs: 73-95), DGKA (SEQ ID NOs: 181-204), DNMT3A (SEQ ID NOs: 96-122), PTPN2 (SEQ ID NOs: 123-146), TET2 (SEQ ID NOs: 147-175), or ZC3H12A (SEQ ID NOs: 176-180). Six days after engineering, magnetic enrichment was performed using Dynabeads MyOne Streptavidin T1 and biotinylated anti-Myc antibody. Highly pure populations of edited T cells (i.e., >80%), as determined by flow cytometry using anti-Myc PE, were then lysed, and mRNA was extracted using the Dynabeads mRNA Direct Purification Kit. After extraction, mRNA was quantified using the Quant-it RiboGreen RNA Assay Kit and used to synthesize cDNA using the SuperScript IV First-Strand Synthesis Kit. The cDNA was then used to perform real-time quantitative reverse transcription PCR (qPCR) using TaqMan Fast Advanced Master Mix and TaqMan assays for RPL13A, CBLB, CISH, DGKA, DNMT3A, PTPN2, TET2, or ZC3H12A. Raw data were opened and exported using ThermoFisher Scientific Design and Analysis software.
[0418] For evaluation of CD5 knockdown, T cells from at least three donors were engineered to express shRNA modules containing sequences against luciferase (control) or shRNA modules containing sequences against CD5 (SEQ ID NOs: 47-72). Six days after editing, T cells were stained for Myc and CD5 expression using anti-Myc AF647 and anti-CD5 PE, respectively, and analyzed by flow cytometry on an Attune NxT flow cytometer. Relative CD5 expression was quantified using the ratio of CD5 gMFI of Myc+ cells divided by that of Myc- cells. This value was then normalized to the relative CD5 expression of the control group to calculate knockdown.
[0419] To simultaneously assess the on-target and off-target effects of ZC3H12A shRNAs (SEQ ID NOs: 176-180 and 205-207), T cells were engineered with ICT and a single shRNA against ZC3H12A. As a positive control for indirect on-target effects, cells were separately engineered with an exemplary MSLN / APLG logic gate and a validated single sgRNA against ZC3H12A. Six days after engineering, logic gate-expressing cells were enriched by positive selection using an anti-Myc antibody. The enriched cell pellet was lysed, and RNA was extracted.
[0420] The enriched cell pellets were resuspended in lysis buffer and transferred to a 384-well plate. UMI-barcoded oligoDT primers were dispensed into individual cell lysates, and the samples were incubated to allow primer annealing. A reverse transcription master mix containing diluted ERCC synthesis controls was dispensed into each sample, and the plate was incubated to allow reverse transcription. The reverse-transcribed samples were pooled into one reaction and purified with Agencourt RNAClean XP beads. The purified samples were digested with Exonuclease I and then amplified. After cDNA amplification, the cDNA was purified with Agencourt SPRISelect XP beads. The purified cDNA was tagged with Illumina transposase and indexed. Libraries were quantified using a Tapestation and then sequenced on a NovaSeq (Illumina). A minimum of 2 million reads per cell pellet was sequenced.
[0421] RNA-seq reads were aligned to the GRCh38 genome using STAR (v2.7.7a) in STARsolo mode, duplicate UMIs were removed, and reads were assigned to samples via HT-RNA sample barcodes. Expression was quantified by STAR using the quantmode GeneCounts option and Ensembl GRCh38 genome annotations. Differential expression analysis was performed using EdgeR (v3.34).
[0422] Differentially expressed genes were selected based on comparisons between control and shRNA samples or between control and sgRNA samples (defined as FDR less than 0.05). From this filtered list of genes, Pearson correlation tests were performed between the log2 fold changes between control versus shRNA samples and between control versus sgRNA samples to determine correlation coefficients and associated p-values.
[0423] Generation of logic gated CAR T T cells from donors were isolated from Leukopacks® and frozen for later use. On the day of use, T cells from donors were thawed and activated (Day 0). Forty-eight hours after activation, T cells were engineered (Day 2). To engineer T cells, sgRNAs targeting the designated sites were complexed with sNLS-SpCas9-sNLS nuclease for 10 minutes at room temperature to form a ribonucleoprotein mix. Then, a plasmid containing the logic gates CAR (SEQ ID NO: 212) and primeR (SEQ ID NO: 213) along with shRNA modules containing sequences against luciferase (control) or combinations of CBLB, CISH, DGKA, DNMT3A, PTPN2, TET2, and / or ZC3H12A as outlined in Table 6, and supplemented Primary P3 solution, were added to the ribonucleoprotein mix and mixed. The mix was added to activated T cells and electroporated using a Lonza 96-well Shuttle system. After electroporation, engineered T cells were harvested using fresh medium supplemented with 12.5 ng / mL of IL-7 and IL-15. Engineered T cells were replenished with fresh medium supplemented with 12.5 ng / mL of IL-7 and IL-15 on days 3 and 5. Six days after manipulation (day 8), cells were processed for downstream experiments.
[0424] TIFF2025532585000020.tif141165
[0425] In vitro repeated stimulation assay evaluation of logic-gated CAR T ALPG / MSLN CARs with gene knockdown via dual shRNA modules were compared in repeated stimulation assays with H1975 target cells. Engineered ALPG / MSLN logic gate-expressing T cells were enriched for CAR+ cells via the Myc surface protein tag.
[0426] H1975 target cells were seeded at 10,000 cells / well in a 96-well plate, and 10,000 Myc+CAR T cells were added to achieve a target-to-CAR ratio of 1:1. Target cell killing was monitored using fluorescent tags within the target cells and an Incucyte® system for real-time imaging. Every three days, half of the T cells were removed and seeded on 10,000 fresh target cells for a total of four rounds of target cell stimulation. Between reseedings, one-quarter of the T cells were harvested and subjected to flow analysis of CAR proliferation. Performance was quantified as the fold improvement over CAR alone in both proliferation and target cell killing.
[0427] result To evaluate the efficiency of shRNAs in suppressing the expression of target genes, we performed qPCR screening at the mRNA level (CBLB, CISH, DNMT3, PTPN2, TET2, ZC3H12A, and DGKA) and flow cytometry screening at the protein level (CD5). The results of the shRNA screening are shown in Figure 7A-7H, and quantification of gene expression for the best-performing shRNA for each gene is listed in Table 7.
[0428] TIFF2025532585000021.tif198165
[0429] To further evaluate the on- and off-target effects of ZC3H12A shRNA, we performed RNA sequencing. Significant positive correlations were observed between differentially expressed genes between shRNA or sgRNA and control (Figures 8A-8H). Because low resolution was observed in detecting direct knockdown of ZC3H12A using RNA sequencing or qRT-PCR, shRNAs targeting ZC3H12A were selected for further analysis based on correlation analysis.
[0430] Repeat stimulation assays were performed to evaluate the effect of combined gene targeting on the performance of T cells expressing exemplary ALPG / MSLN logic gates. Selected shRNAs were tested against the gene combinations outlined in Table 6.
[0431] Dual shRNAs that significantly enhanced the expression of logic gates in T cells were identified for each gene combination (Figure 9). The best-performing dual shRNAs for each gene pairing are summarized in Table 8.
[0432] TIFF2025532585000022.tif239165TIFF2025532585000023.tif127165
[0433] While the present invention has been particularly shown and described with reference to preferred and various alternative embodiments, it will be understood by those skilled in the relevant art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention.
[0434] All references, issued patents, and patent applications cited within the body of this specification are hereby incorporated by reference in their entirety for all purposes.
[0435] TIFF2025532585000024.tif238165TIFF2025532585000025.tif231165TIFF2025532585000026.tif231165TIFF2025532585000027.tif231165TIFF2025532585000028.tif231165TIFF2025532585000029.tif231165TIFF2025532585000030.tif226165TIFF2025532585000031.tif237165TIFF2025532585000032.tif231165TIFF2025532585000033.tif237165TIFF2025532585000034.tif237165TIFF2025532585000035.tif237165TIFF2025532585000036.tif237165TIFF2025532585000037.tif237165TIFF2025532585000038.tif237165TIFF2025532585000039.tif237165TIFF2025532585000040.tif237165TIFF2025532585000041.tif231165TIFF2025532585000042.tif237165TIFF2025532585000043.tif231165TIFF2025532585000044.tif237165TIFF2025532585000045.tif231165TIFF2025532585000046.tif237165TIFF2025532585000047.tif231165TIFF2025532585000048.tif235165TIFF2025532585000049.tif239165TIFF2025532585000050.tif239165TIFF2025532585000051.tif239165TIFF2025532585000052.tif221165TIFF2025532585000053.tif239165TIFF2025532585000054.tif222165TIFF2025532585000055.tif239165TIFF2025532585000056.tif240165TIFF2025532585000057.tif239165TIFF2025532585000058.tif240165TIFF2025532585000059.tif172165TIFF2025532585000060.tif161165.
Claims
1. One or more recombinant nucleic acids comprising at least one sequence set forth in any one of SEQ ID NOs: 12-207.
2. 10. The one or more recombinant nucleic acids of claim 1, wherein the nucleic acid is a guide RNA.
3. 3. The one or more recombinant nucleic acids of any one of claims 1 to 2, further comprising a protein comprising a nuclease domain, wherein the nucleic acid and the protein form a ribonucleoprotein (RNP) complex.
4. 4. The one or more recombinant nucleic acids of claim 3, wherein the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.
5. 5. The recombinant nucleic acid of claim 3 or 4, wherein the ribonucleoprotein (RNP) complex reduces expression of one or more of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in a cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the RNP complex.
6. 6. The one or more recombinant nucleic acids of any one of claims 1 to 5, comprising a first nucleic acid and a second nucleic acid, wherein the first nucleic acid and the second nucleic acid are different.
7. One or more recombinant nucleic acids according to any one of claims 1 to 6, comprising the sequence set forth in SEQ ID NO: 12 and the sequence set forth in SEQ ID NO:
13.
8. One or more recombinant nucleic acids according to any one of claims 1 to 6, comprising the sequence set forth in SEQ ID NO:21 and the sequence set forth in SEQ ID NO:
13.
9. One or more recombinant nucleic acids according to any one of claims 1 to 6, comprising the sequence set forth in SEQ ID NO:21 and the sequence set forth in SEQ ID NO:
12.
10. One or more recombinant nucleic acids according to any one of claims 1 to 6, comprising the sequence set forth in SEQ ID NO: 12 and the sequence set forth in SEQ ID NO:
14.
11. 7. One or more recombinant nucleic acids according to any one of claims 1 to 6, comprising the sequence set forth in SEQ ID NO: 13 and the sequence set forth in SEQ ID NO:
20.
12. One or more recombinant nucleic acids according to any one of claims 1 to 6, comprising the sequence set forth in SEQ ID NO: 21 and the sequence set forth in SEQ ID NO:
20.
13. 7. One or more recombinant nucleic acids according to any one of claims 1 to 6, comprising the sequence set forth in SEQ ID NO: 20 and the sequence set forth in SEQ ID NO:
22.
14. One or more recombinant nucleic acids according to any one of claims 1 to 6, comprising the sequence set forth in SEQ ID NO: 17 and the sequence set forth in SEQ ID NO:
13.
15. One or more recombinant nucleic acids according to any one of claims 1 to 6, comprising the sequence set forth in SEQ ID NO: 20 and the sequence set forth in SEQ ID NO:
14.
16. 7. One or more recombinant nucleic acids according to any one of claims 1 to 6, comprising the sequence set forth in SEQ ID NO: 21 and the sequence set forth in SEQ ID NO:
22.
17. 10. The one or more recombinant nucleic acids of claim 1, wherein the nucleic acid is a short hairpin RNA (shRNA).
18. 18. The one or more recombinant nucleic acids of claim 17, wherein the shRNA reduces expression of one or more of CD5, CBLB, CISH, DGKA, DNMT3A, PTPN2, TET2, and / or ZC3H12A in cells by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the shRNA.
19. 20. One or more recombinant nucleic acids according to claim 1, 17, or 18, comprising a first nucleic acid and a second nucleic acid, wherein the first nucleic acid and the second nucleic acid are different.
20. One or more recombinant nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to an mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO:
1.
21. One or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human CBLB comprising the sequence set forth in SEQ ID NO:
2.
22. One or more recombinant nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to an mRNA encoding human CISH comprising the sequence set forth in SEQ ID NO:
3.
23. One or more recombinant nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to an mRNA encoding DGKA comprising the sequence set forth in SEQ ID NO:
4.
24. One or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding DGKZ comprising the sequence set forth in SEQ ID NO:
5.
25. One or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding DNMT3A comprising the sequence set forth in SEQ ID NO:
6.
26. One or more recombinant nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding MAP4K1 comprising the sequence set forth in SEQ ID NO:
7.
27. One or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding NR4A1 comprising the sequence set forth in SEQ ID NO:
8.
28. One or more recombinant nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding TET2 comprising the sequence set forth in SEQ ID NO:
10.
29. One or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding PTPN2 comprising the sequence set forth in SEQ ID NO:
9.
30. One or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding ZC3H12A comprising the sequence set forth in SEQ ID NO:
11.
31. (1) A nucleic acid sequence of at least 15 nucleotides in length that is complementary to mRNA encoding human CD5, comprising the sequence set forth in SEQ ID NO: 1; (2) A nucleic acid sequence of at least 15 nucleotides in length that is complementary to the mRNA encoding human CBLB, comprising the sequence set forth in SEQ ID NO: 2; (3) A nucleic acid sequence of at least 15 nucleotides in length complementary to an mRNA encoding human CISH, comprising the sequence set forth in SEQ ID NO: 3; (4) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding DGKA, comprising the sequence set forth in SEQ ID NO: 4; (5) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding DGKZ, comprising the sequence set forth in SEQ ID NO: 5; (6) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding DNMT3A, comprising the sequence set forth in SEQ ID NO: 6; (7) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding MAP4K1, comprising the sequence set forth in SEQ ID NO: 7; (9) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding TET2, comprising the sequence set forth in SEQ ID NO: 10; (10) A nucleic acid sequence of at least 15 nucleotides in length complementary to mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO: 9; (11) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding NR4A1, comprising the sequence set forth in SEQ ID NO: 8; or (12) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding ZC3H12A, including the sequence set forth in SEQ ID NO:
11. One or more recombinant nucleic acids comprising at least two or more nucleic acids selected from the group consisting of:
32. 32. The one or more recombinant nucleic acids of any one of claims 20 to 31, wherein the nucleic acid sequences are at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.
33. 33. The one or more recombinant nucleic acids of any one of claims 20 to 32, wherein the nucleic acid is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.
34. 34. The one or more recombinant nucleic acids of claim 33, wherein the nucleic acid is an shRNA.
35. 35. The one or more recombinant nucleic acids of any one of claims 20-34, wherein the nucleic acids reduce expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in a cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.
36. 36. The one or more recombinant nucleic acids of any one of claims 20 and 31-35, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding CD5 and comprises a sequence set forth in any one of SEQ ID NOs: 47-72.
37. 36. The one or more recombinant nucleic acids of any one of claims 21 and 31 to 35, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding CBLB and comprises a sequence set forth in any one of SEQ ID NOs: 23 to 46.
38. 36. The one or more recombinant nucleic acids of any one of claims 22 and 31 to 35, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding CISH and comprises a sequence set forth in any one of SEQ ID NOs: 73 to 95.
39. One or more recombinant nucleic acids according to any one of claims 23 and 31 to 35, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding DGKA and comprises a sequence set forth in any one of SEQ ID NOs: 181 to 204.
40. 36. The one or more recombinant nucleic acids of any one of claims 25 and 31 to 35, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding DNMT3A and comprises a sequence set forth in any one of SEQ ID NOs: 96 to 122.
41. 36. One or more recombinant nucleic acids according to any one of claims 28 and 31 to 35, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding TET2 and comprises a sequence set forth in any one of SEQ ID NOs: 147 to 175.
42. 36. The one or more recombinant nucleic acids of any one of claims 29 and 31-35, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding PTPN2 and comprises a sequence set forth in any one of SEQ ID NOs: 123-146.
43. The one or more recombinant nucleic acids of any one of claims 30 to 35, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding ZC3H12A and comprises a sequence set forth in any one of SEQ ID NOs: 176-180 and 205-207.
44. 44. The one or more recombinant nucleic acids according to any one of claims 31 to 43, comprising at least a nucleic acid sequence of at least 15 nucleotides in length complementary to an mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO:1, and a nucleic acid sequence of at least 15 nucleotides in length complementary to an mRNA encoding human CBLB comprising the sequence set forth in SEQ ID NO:
2.
45. 44. One or more recombinant nucleic acids according to any one of claims 31 to 43, comprising at least a nucleic acid sequence at least 15 nucleotides long that is complementary to the mRNA encoding TET2 comprising the sequence set forth in SEQ ID NO:9, and a nucleic acid sequence at least 15 nucleotides long that is complementary to the mRNA encoding human CBLB comprising the sequence set forth in SEQ ID NO:
2.
46. 44. One or more recombinant nucleic acids according to any one of claims 31 to 43, comprising at least a nucleic acid sequence at least 15 nucleotides long complementary to the mRNA encoding TET2 comprising the sequence set forth in SEQ ID NO:9, and a nucleic acid sequence at least 15 nucleotides long complementary to the mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO:
1.
47. 44. The one or more recombinant nucleic acids of any one of claims 31 to 43, comprising at least a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human CD5 comprising the sequence set forth in SEQ ID NO:1, and a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human CISH comprising the sequence set forth in SEQ ID NO:
3.
48. the recombinant nucleic acid is a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to a first antigen, a nucleotide sequence encoding a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to a second antigen, or a nucleotide sequence encoding a T cell receptor (TCR).
48. The one or more recombinant nucleic acids of any one of claims 20 to 47, further comprising one or more of:
49. 49. The one or more recombinant nucleic acids of claim 48, wherein the first antigen and the second antigen are different.
50. The recombinant nucleic acid is, in the 5' to 3' direction: (a) the TCR; (b) a nucleic acid according to any one of claims 20 to 47; 50. One or more recombinant nucleic acids according to claim 48 or 49, comprising:
51. The recombinant nucleic acid is, in the 5' to 3' direction: (a) a nucleic acid according to any one of claims 20 to 47; (b) the TCR 50. One or more recombinant nucleic acids according to claim 48 or 49, comprising:
52. The recombinant nucleic acid is, in the 5' to 3' direction: (a) the CAR; (b) a nucleic acid according to any one of claims 20 to 47, and (c) the priming receptor 50. One or more recombinant nucleic acids according to claim 48 or 49, comprising:
53. The nucleic acid is, in the 5' to 3' direction: (a) the priming receptor; (b) a nucleic acid according to any one of claims 20 to 47, and (c) Said CAR 50. One or more recombinant nucleic acids according to claim 48 or 49, comprising:
54. 54. The one or more recombinant nucleic acids of any one of claims 20 to 53, wherein the recombinant nucleic acid further comprises 5' homology directed repair arms and / or 3' homology directed repair arms complementary to the insertion site in the host cell chromosome.
55. 55. The one or more recombinant nucleic acids of claim 54, wherein the recombinant nucleic acid comprises the 5' homology-directed repair arm and the 3' homology-directed repair arm.
56. 56. The one or more recombinant nucleic acids of any one of claims 20 to 55, wherein the recombinant nucleic acid is incorporated into an expression cassette or expression vector.
57. 57. The one or more recombinant nucleic acids of claim 56, wherein the expression cassette or the expression vector further comprises a constitutive promoter upstream of the recombinant nucleic acid.
58. 58. The one or more recombinant nucleic acids of any one of claims 20 to 57, comprising a first nucleic acid and a second nucleic acid, wherein said first nucleic acid and said second nucleic acid are encoded on a single nucleic acid.
59. 59. The one or more recombinant nucleic acids of Claim 58, wherein the first nucleic acid comprises the 5' homology-directed repair arms and the second nucleic acid comprises the 3' homology-directed repair arms.
60. 60. The one or more recombinant nucleic acids of any one of claims 58 or 59, wherein the first nucleic acid and the second nucleic acid are encoded on different nucleic acids.
61. 61. The one or more recombinant nucleic acids of any one of claims 58 to 60, wherein the first nucleic acid and the second nucleic acid are incorporated into a single expression cassette or a single expression vector.
62. 62. The one or more recombinant nucleic acids of claim 61, wherein the expression cassette or the expression vector further comprises a constitutive promoter upstream of the first nucleic acid and / or upstream of the second nucleic acid.
63. 63. The one or more recombinant nucleic acids of any one of claims 56 to 62, wherein the expression vector is a non-viral vector.
64. 64. An expression vector comprising one or more recombinant nucleic acids according to any one of claims 1 to 63.
65. 65. The expression vector of claim 64, which is a non-viral vector.
66. 66. The vector of claim 64 or 65, wherein the 5' and 3' ends of the recombinant nucleic acid comprise one or more nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of the primary cell.
67. 67. The vector of claim 66, wherein the insertion site is located in the T-cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.
68. 68. The vector of claim 67, wherein the GSH locus is the GS94 locus.
69. (1) A nucleic acid sequence of at least 15 nucleotides in length that is complementary to mRNA encoding human CD5, comprising the sequence set forth in SEQ ID NO: 1; (2) A nucleic acid sequence of at least 15 nucleotides in length that is complementary to the mRNA encoding human CBLB, comprising the sequence set forth in SEQ ID NO: 2; (3) A nucleic acid sequence of at least 15 nucleotides in length complementary to an mRNA encoding human CISH, comprising the sequence set forth in SEQ ID NO: 3; (4) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding DGKA, comprising the sequence set forth in SEQ ID NO: 4; (5) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding DGKZ, comprising the sequence set forth in SEQ ID NO: 5; (6) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding DNMT3A, comprising the sequence set forth in SEQ ID NO: 6; (7) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding MAP4K1, comprising the sequence set forth in SEQ ID NO: 7; (9) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding TET2, comprising the sequence set forth in SEQ ID NO: 10; (10) A nucleic acid sequence of at least 15 nucleotides in length complementary to mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO: 9; (11) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding NR4A1, comprising the sequence set forth in SEQ ID NO: 8; or (12) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding ZC3H12A, including the sequence set forth in SEQ ID NO:
11. An immune cell comprising at least one nucleic acid selected from the group consisting of:
70. 70. The immune cell of claim 69, wherein the one or more nucleic acids are shRNA, siRNA, dsRNA, or antisense oligonucleotides.
71. The immune cell of claim 70, wherein the one or more nucleic acids are shRNAs.
72. The immune cell of claim 71, wherein the shRNA is complementary to the mRNA encoding CD5 and comprises a sequence set forth in any one of SEQ ID NOs: 47 to 72.
73. The immune cell of claim 71, wherein the shRNA is complementary to the mRNA encoding CBLB and comprises a sequence set forth in any one of SEQ ID NOs: 23 to 46.
74. The immune cell of claim 71, wherein the shRNA is complementary to the mRNA encoding CISH and comprises a sequence set forth in any one of SEQ ID NOs: 73 to 95.
75. The immune cell of claim 71, wherein the shRNA is complementary to the mRNA encoding DGKA and comprises a sequence set forth in any one of SEQ ID NOs: 181 to 204.
76. The immune cell of claim 71, wherein the shRNA is complementary to the mRNA encoding DNMT3A and comprises a sequence set forth in any one of SEQ ID NOs: 96-122.
77. 72. The immune cell of claim 71, wherein the shRNA is complementary to the mRNA encoding TET2 and comprises a sequence set forth in any one of SEQ ID NOs: 147-175.
78. The immune cell of claim 71, wherein the shRNA is complementary to the mRNA encoding PTPN2 and comprises a sequence set forth in any one of SEQ ID NOs: 123-146.
79. The immune cell of claim 71, wherein the shRNA is complementary to the mRNA encoding ZC3H12A and comprises a sequence set forth in any one of SEQ ID NOs: 176-180 and 205-207.
80. 80. The immune cell of any one of claims 69-79, wherein the cell further comprises a deletion of at least a first target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A.
81. 81. The immune cell of claim 80, further comprising a deletion of at least a second target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A, wherein the first target gene and the second target gene are different.
82. 82. The immune cell of claim 80 or 81, wherein the at least first or second target gene is deleted via CRISPR-Cas9 gene editing.
83. The immune cell of any one of claims 69 to 82, wherein the expression of at least one or more target genes selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A in the immune cell is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not comprising the nucleic acid or comprising the target gene.
84. 1. An immune cell comprising a deletion of at least a first target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A.
85. 85. The immune cell of claim 84, further comprising a deletion of at least a second target gene selected from the group consisting of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and ZC3H12A, wherein the first target gene and the second target gene are different.
86. The immune cell of claim 84 or 85, wherein the at least first or second target gene is deleted via CRISPR-Cas9 gene editing.
87. 87. The immune cell of any one of claims 84 to 86, wherein expression of the at least first or at least second target gene in the immune cell is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not comprise a deletion of the at least first or at least second target gene.
88. An immune cell comprising a first guide RNA, wherein the first guide RNA comprises a sequence set forth in SEQ ID NOs: 12-22.
89. The immune cell of claim 67, further comprising a second guide RNA comprising a sequence set forth in SEQ ID NOs: 12-22.
90. The immune cell of claim 67 or 68, further comprising a protein comprising a nuclease domain, wherein the nucleic acid and the protein form a ribonucleoprotein (RNP) complex.
91. 70. The immune cell of any one of claims 67 to 69, wherein the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.
92. An immune cell comprising one or more nucleic acids comprising a first shRNA and a second shRNA, wherein the first shRNA and the second shRNA each comprise a sequence set forth in any one of SEQ ID NOs: 23-207.
93. 93. The immune cell of any one of claims 69-92, wherein the one or more nucleic acids reduce expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, or ZC3H12A in the immune cell by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not containing the one or more nucleic acids.
94. 94. The immune cell of claim 93, wherein expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in the immune cell is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid or the second nucleic acid.
95. 95. The immune cell of any one of claims 83, 87, 93 or 94, wherein expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A is determined by a nucleic acid assay or a protein assay.
96. 96. The immune cell of claim 95, wherein the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.
97. 96. The immune cell of claim 95, wherein the protein assay comprises at least one of immunoblotting, fluorescence-activated cell sorting, flow cytometry, magnetic-activated cell sorting, or affinity-based cell separation.
98. The cells a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to a first antigen, a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to a second antigen, or a T cell receptor (TCR). The immune cell of any one of claims 69 to 97, further comprising one or more of:
99. The immune cell of any one of claims 69 to 98, which is a primary human immune cell.
100. The immune cell of any one of claims 69 to 99, wherein the primary immune cell is a natural killer (NK) cell, a natural killer T (NKT) cell, a T cell, a γδ T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, a T cell progenitor cell, or an induced pluripotent stem cell (iPSC).
101. The immune cell of any one of claims 69 to 100, wherein the primary immune cell is a primary T cell.
102. The immune cell of any one of claims 69 to 101, wherein the primary immune cell is a primary human T cell.
103. The immune cell according to any one of claims 69 to 102, which is virus-free.
104. The immune cell of any one of claims 69 to 103, which is a viable, virus-free primary cell.
105. The immune cell according to any one of claims 69 to 104, which is an autoimmune cell.
106. The immune cell according to any one of claims 69 to 104, which is an allogeneic immune cell.
107. 1. A primary immune cell comprising at least one recombinant nucleic acid comprising a first nucleic acid comprising a sequence set forth in SEQ ID NOs: 12-207, wherein the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell.
108. 1. A viable, virus-free primary cell comprising one or more ribonucleoprotein complexes (RNPs), wherein the RNPs comprise a nuclease domain and a guide RNA, and the guide RNA comprises a first nucleic acid comprising a sequence set forth in SEQ ID NOs: 12-22.
109. 109. The immune cell of claim 107 or 108, further comprising a second, different nucleic acid comprising a sequence set forth in SEQ ID NOs: 12-207.
110. A primary immune cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid comprises: (1) A nucleic acid sequence of at least 15 nucleotides in length that is complementary to mRNA encoding human CD5, comprising the sequence set forth in SEQ ID NO: 1; (2) A nucleic acid sequence of at least 15 nucleotides in length that is complementary to the mRNA encoding human CBLB, comprising the sequence set forth in SEQ ID NO: 2; (3) A nucleic acid sequence of at least 15 nucleotides in length complementary to an mRNA encoding human CISH, comprising the sequence set forth in SEQ ID NO: 3; (4) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding DGKA, comprising the sequence set forth in SEQ ID NO: 4; (5) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding DGKZ, comprising the sequence set forth in SEQ ID NO: 5; (6) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding DNMT3A, comprising the sequence set forth in SEQ ID NO: 6; (7) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding MAP4K1, comprising the sequence set forth in SEQ ID NO: 7; (9) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding TET2, comprising the sequence set forth in SEQ ID NO: 10; (10) A nucleic acid sequence of at least 15 nucleotides in length complementary to mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO: 9; (11) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding NR4A1, comprising the sequence set forth in SEQ ID NO: 8; or (12) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding ZC3H12A, including the sequence set forth in SEQ ID NO:
11. wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell.
111. A viable virus-free primary cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid comprises: (1) A nucleic acid sequence of at least 15 nucleotides in length that is complementary to mRNA encoding human CD5, comprising the sequence set forth in SEQ ID NO: 1; (2) A nucleic acid sequence of at least 15 nucleotides in length that is complementary to the mRNA encoding human CBLB, comprising the sequence set forth in SEQ ID NO: 2; (3) A nucleic acid sequence of at least 15 nucleotides in length complementary to an mRNA encoding human CISH, comprising the sequence set forth in SEQ ID NO: 3; (4) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding DGKA, comprising the sequence set forth in SEQ ID NO: 4; (5) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding DGKZ, comprising the sequence set forth in SEQ ID NO: 5; (6) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding DNMT3A, comprising the sequence set forth in SEQ ID NO: 6; (7) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding MAP4K1, comprising the sequence set forth in SEQ ID NO: 7; (9) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding TET2, comprising the sequence set forth in SEQ ID NO: 10; (10) A nucleic acid sequence of at least 15 nucleotides in length complementary to mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO: 9; (11) A nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding NR4A1, comprising the sequence set forth in SEQ ID NO: 8; or (12) A nucleic acid sequence of at least 15 nucleotides that is complementary to the mRNA encoding ZC3H12A, including the sequence set forth in SEQ ID NO:
11. wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell.
112. 112. The cell of claim 110 or 111, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding CD5 and comprises a sequence set forth in any one of SEQ ID NOs: 47 to 72.
113. The cell of claim 110 or 111, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding CBLB and comprises a sequence set forth in any one of SEQ ID NOs: 23 to 46.
114. The cell of claim 110 or 111, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding CISH and comprises a sequence set forth in any one of SEQ ID NOs: 73 to 95.
115. The cell of claim 110 or 111, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding DGKA and comprises a sequence set forth in any one of SEQ ID NOs: 181 to 204.
116. The cell of claim 110 or 111, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding DNMT3A and comprises a sequence set forth in any one of SEQ ID NOs: 96 to 122.
117. The cell of claim 110 or 111, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding TET2 and comprises a sequence set forth in any one of SEQ ID NOs: 147-175.
118. The cell of claim 110 or 111, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding PTPN2 and comprises a sequence set forth in any one of SEQ ID NOs: 123-146.
119. The cell of claim 110 or 111, wherein the nucleic acid sequence is an shRNA complementary to the mRNA encoding ZC3H12A and comprises a sequence set forth in any one of SEQ ID NOs: 176-180 and 205-207.
120. The cell of any one of claims 107 to 119, further comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to a first antigen, and a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to a second antigen, wherein the first antigen and the second antigen are different.
121. A population of cells comprising a plurality of immune cells according to any one of claims 69 to 120.
122. A pharmaceutical composition comprising an immune cell according to any one of claims 69 to 120 or a cell population according to claim 121, and a pharmaceutically acceptable excipient.
123. A pharmaceutical composition comprising a recombinant nucleic acid according to any one of claims 1 to 63, or a vector according to any one of claims 64 to 67, and a pharmaceutically acceptable excipient.
124. 1. A method for editing immune cells, comprising: (a) providing a ribonucleoprotein (RNP) comprising a nuclease domain and a guide RNA, wherein the guide RNA comprises a sequence set forth in SEQ ID NOs: 12-22; (b) non-virally introducing the RNP into the immune cell, wherein the guide RNA specifically hybridizes to a target region in the genome of the primary immune cell, and the nuclease domain cleaves the target region to create a double-stranded break in the genome of the immune cell. The method comprising:
125. 1. A method for editing immune cells, comprising: (a) providing a ribonucleoprotein (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid comprises a recombinant nucleic acid according to any one of claims 20 to 63, and wherein the 5' and 3' ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the immune cell; (b) non-virally introducing the RNP-recombinant nucleic acid complex into the immune cell, wherein the guide RNA specifically hybridizes to a target region in the genome of the primary immune cell, and the nuclease domain cleaves the target region to create an insertion site in the genome of the immune cell; (c) editing the immune cell via insertion of the recombinant nucleic acid of any one of claims 20 to 63 into the insertion site in the genome of the immune cell. The method comprising:
126. 126. The method of claim 124 or 125, wherein the non-viral introducing comprises electroporation.
127. 127. The method of any one of claims 124 to 126, wherein the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.
128. 128. The method of any one of claims 125 to 127, wherein the target region of the genome of the cell is the T-cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.
129. 129. The method of any one of claims 125 to 128, wherein the recombinant nucleic acid is a double-stranded recombinant nucleic acid or a single-stranded recombinant nucleic acid.
130. 130. The method of any one of claims 125 to 129, wherein the recombinant nucleic acid is a linear recombinant nucleic acid or a circular recombinant nucleic acid, optionally wherein the circular recombinant nucleic acid is a plasmid.
131. 131. The method of any one of claims 124 to 130, wherein the immune cells are primary human immune cells.
132. The method of any one of claims 124 to 131, wherein the immune cells are autoimmune cells.
133. 132. The method of any one of claims 124 to 131, wherein the immune cells are allogeneic immune cells.
134. 134. The method of any one of claims 124-133, wherein the immune cell is a natural killer (NK) cell, a natural killer T (NKT) cell, a T cell, a gamma delta T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, a T cell progenitor cell, or an induced pluripotent stem cell (iPSC).
135. The method of any one of claims 124 to 134, wherein the immune cells are primary T cells.
136. The method of any one of claims 124 to 135, wherein the immune cells are primary human T cells.
137. The method of any one of claims 124 to 136, wherein the immune cells are virus-free.
138. 138. The method of any one of claims 124 to 137, further comprising obtaining immune cells from a patient and introducing said recombinant nucleic acid in vitro.
139. 124. A method of treating a disease in a subject, comprising administering to the subject an immune cell according to any one of claims 69 to 121 or a pharmaceutical composition according to claim 122 or 123.
140. 140. The method of claim 139, wherein the disease is cancer.
141. 141. The method of claim 140, wherein the cancer is a solid cancer or a liquid cancer.
142. 142. The method of claim 140 or 141, wherein the cancer is breast cancer, HER2-positive breast cancer, estrogen receptor-positive breast cancer, progesterone receptor-positive breast cancer, HER2- / estrogen receptor- / progesterone receptor-negative breast cancer, triple-negative breast cancer, non-small cell lung cancer (NSCLC), lung adenocarcinoma, lung squamous cell carcinoma, lung adenosquamous cell carcinoma, prostate cancer, castration-resistant prostate cancer, colon cancer, rectal cancer, microsatellite instability (MSI) colon cancer, non-MSI colon cancer, or non-MSI or rectal cancer.
143. 143. The method of any one of claims 139-142, wherein said administration of said cells enhances an immune response.
144. 144. The method of claim 143, wherein the enhanced immune response is an adaptive immune response.
145. 145. The method of claim 144, wherein the enhanced immune response is an increase in T cell cytotoxicity.
146. 145. The method of claim 144, wherein the enhanced immune response is increased T cell expansion and / or proliferation.
147. 144. The method of claim 143, wherein the enhanced immune response is an innate immune response.
148. 124. A method for enhancing an immune response in a subject, comprising administering to the subject an immune cell according to any one of claims 69 to 121 or a pharmaceutical composition according to claim 122 or 123.
149. 149. The method of claim 148, wherein the enhanced immune response is an adaptive immune response.
150. 150. The method of claim 149, wherein the enhanced immune response is an increase in T cell cytotoxicity.
151. 150. The method of claim 149, wherein the enhanced immune response is increased T cell expansion and / or proliferation.
152. 150. The method of claim 149, wherein the enhanced immune response is an innate immune response.
153. 153. The method of any one of claims 139-152, wherein expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in the immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid or RNP complex.
154. 154. The method of any one of claims 139-153, wherein expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in the immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid or RNP complex.
155. 155. The method of any one of claims 153 to 154, wherein expression of CD5, CBLB, CISH, DGKA, DGKZ, DNMT3A, MAP4K1, NR4A1, PTPN2, TET2, and / or ZC3H12A in the immune cells is determined by a nucleic acid assay or a protein assay.
156. 156. The method of claim 155, wherein the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.
157. 156. The method of claim 155, wherein the protein assay comprises at least one of immunoblotting, fluorescence-activated cell sorting, flow cytometry, magnetic-activated cell sorting, or affinity-based cell separation.
158. 158. The method of any one of claims 139-157, further comprising administering to the subject an immunotherapy either simultaneously with or subsequent to the immune cells.