RNA complexes and nanostructures for the treatment of cancer metastasis

Abstract

Disclosed herein are compositions and methods for one-step CMC preparation of RNA therapeutic complexes (nanostructures) containing nucleoside analogs. In some embodiments, the nucleoside analogs are incorporated into RNA oligonucleotides that self-assemble to form the RNA complex during RNA synthesis in one-step preparation. Therefore, no additional conjugation or synthesis steps are required.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 377,390, filed September 28, 2022, and U.S. Provisional Application No. 63 / 511,969, filed July 5, 2023, which are incorporated by reference herein in their entireties.

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support under Grant Nos. CA207946 and EB019036 awarded by the National Institutes of Health. The government has certain rights in this invention. [Background technology]

[0003] Metastasis is the major outcome leading to patient death. siRNA has been a long-standing dream for cancer treatment. However, currently, no siRNA drug has been approved by the FDA for cancer treatment. The main reasons for the ineffectiveness of treatment are the lack of an effective procedure for delivering siRNA to cancer cells in vivo and the trapping of siRNA in endosomes. Summary of the Invention

[0004] Disclosed herein are specific designs for effectively delivering inhibitory RNA molecules (e.g., siRNA) to cells in vivo, as well as a novel method for releasing siRNA in an RNA nanocomplex via a specific design for cleaving the accompanying RNA sequence. In particular, disclosed herein are therapeutic RNA complexes comprising a plurality of synthetic double-stranded RNA oligonucleotides, each of which comprises a sense strand having a 5'-end and a 3'-end, an antisense strand having a 5'-end and a 3'-end, and a cholesterol molecule attached to the 3'-end of the sense strand, the plurality of synthetic double-stranded RNA oligonucleotides forming an aggregate with the cholesterol molecule centrally located. The sense strand comprises more than 25 nucleotides, and all pyrimidines in the sense strand lack oxygen at the 2'-position. The antisense strand comprises an siRNA sequence having 18-25 regular nucleotides, and is longer than the antisense strand. At least 95% of the nucleotides in the antisense strand hybridize to complementary nucleotides in the sense strand.

[0005] In some embodiments, the nucleoside analog comprises a 2'-difluoro-deoxypyrimidine, a floxuridine (5-fluorodeoxyuridine, UB5F) nucleotide, a gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotide, or a combination thereof. In some embodiments, the 5'-end of the sense strand is modified with GalNAc (N-acetylgalactosamine), UAMC-1110 (SP-13786; (S)-N-(2-(2-cyano-4,4-difluoropyrrolidin-1-yl)-2-oxoethyl)quinoline-4-carboxamide), FA (folic acid), or DCL (N-[N-[(S)-1,3-dicarboxypropyl]carbamoyl]-(S)-lysine).

[0006] Also described herein are RNA nanostructures that can be composed of one or more synthetic RNA oligonucleotides designed (or configured) to self-assemble to form an RNA nanostructure. The RNA nanostructure can be composed of double-stranded arms (DA) that can align around a core domain when assembled. Furthermore, at least one of the RNA oligonucleotides in the RNA nanostructure contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 floxuridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides, or a combination thereof. In some embodiments, at least one, two, three, or four of the synthetic RNA oligonucleotides have an amino acid sequence that is about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 1-448. In some embodiments, synthetic RNA oligonucleotides comprising nucleoside analogs are combined with unmodified RNA oligonucleotides to form RNA nanostructures. For example, at least one, two, three, or four synthetic RNA oligonucleotides having an amino acid sequence that is about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 1-448 can be combined with at least one, two, three, four, five, or six synthetic RNA oligonucleotides having an amino acid sequence that is about 80-100% identical to any one of SEQ ID NOs: 298-394. Suitable combinations of these oligonucleotides for forming RNA nanoparticles are described herein.

[0007] Also disclosed herein are compositions and methods for one-step CMC production of RNA therapeutic complexes (nanostructures) containing nucleoside analogs. In some embodiments, the nucleoside analogs are incorporated into RNA oligonucleotides that self-assemble to form the RNA complex during RNA synthesis in one-step production. Therefore, additional conjugation or synthesis steps are not required. The disclosed compositions and methods enable large-scale industrial production of high-purity RNA therapeutics without the complexities associated with drug conjugation. In some embodiments, the RNA complex contains at least two types of nucleoside analogs. In some embodiments, the RNA complex contains at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleoside analogs distributed throughout the RNA complex. In some embodiments, the RNA complex does not contain uridine or cytidine nucleotides.

[0008] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. [Brief explanation of the drawings]

[0009] [Figure 1] 1 shows modified nucleotides used in the disclosed RNA nanoparticles. [Figure 2] 1 shows the results of a cytotoxicity test of RNA-UB5F nanoparticles in breast cancer cell lines. [Figure 3] 1 shows the results of a cytotoxicity test of RNA-CR2FF nanoparticles in breast cancer cell lines. [Figure 4] 1 shows the results of a cytotoxicity test of RNA-CR2FF-UB5F nanoparticles in breast cancer cell lines. [Figure 5] Survivin-double stranded structure is shown, with the sense strand having 3' cholesterol and gemcitabine (as Y). [Figure 6]Survivin-double stranded structure is shown, where the sense strand has 3' cholesterol and gemcitabine (as Y) and the antisense strand has an extension attached. [Figure 7] Survivin-double stranded structure is shown, where the sense strand has 3' cholesterol and gemcitabine (as Y), and the antisense strand has an adjacent extended RNA structure. [Figure 8] RRM2-Duplex structure is shown, with the sense strand having 3' cholesterol and gemcitabine (as Y). [Figure 9] RRM2-Duplex structure is shown, where the sense strand has 3' cholesterol and gemcitabine (as Y) and the antisense strand has an extension attached. [Figure 10] RRM2-Duplex structure is shown, where the sense strand has 3' cholesterol and gemcitabine (as Y), and the antisense strand has an adjacent extended RNA structure. [Figure 11] 10 is a curve showing the results of a weight change test of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colon adenocarcinoma cells. [Figure 12] 1 is a histogram showing the results of a weight change test of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colon adenocarcinoma cells. [Figure 13] 1 shows the results of an in vivo metastasis suppression test of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colon adenocarcinoma cells. [Figure 14] 1 shows the results of an ex vivo metastasis inhibition test of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colon adenocarcinoma cells. [Figure 15] 1 shows the design of an RNA / drug / siRNA complex to form an RNA micelle, which carries an siRNA (survivin or RRM2 siRNA) and multiple molecules of gemcitabine. [Figure 16A]We demonstrate that lung-tropic training of HT29 cells resulted in two major changes: the rate of metastatic tumor progression (from 5 months to 1 month after injection), as imaged by bioluminescence scanning. [Figure 16B] We show that lung-tropic training of HT29 cells resulted in two major changes: an increase in metastatic burden, as imaged by bioluminescence scanning. [Figure 17A] We demonstrate the in vivo administration of RNA micelles in the treatment of lung metastasis of CRC, where bioluminescence imaging in whole-body mice after RNA micelle delivery demonstrates a decrease in GFP signal in the tumor. [Figure 17B] We demonstrate the in vivo administration of RNA micelles in the treatment of lung metastasis of CRC, where bioluminescence imaging of tumors after RNA micelle delivery demonstrates a decrease in GFP at the tumor site. [Figure 17C] 1 shows in vivo delivery of RNA micelles in the treatment of lung metastasis of CRC, with Ki-67 staining demonstrating growth of resected tumors after treatment. [Figure 17D] 1 shows in vivo delivery of RNA micelles in the treatment of lung metastasis of CRC, with caspase 3 staining demonstrating apoptotic signals in resected tumors after treatment. DETAILED DESCRIPTION OF THE INVENTION

[0010] Before describing the present disclosure in more detail, it is to be understood that this disclosure is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is used only for the purpose of describing particular embodiments and is not intended to be limiting, as the scope of the present disclosure will be limited only by the appended claims.

[0011] Where a range of numerical values ​​is given, unless the context clearly dictates otherwise, it is understood that each intervening value (to the tenth of the unit of the lower limit) between the upper and lower limits of that range, as well as any other value or intervening value stated in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, unless there is a specifically excluded limit in the stated range. When the stated range includes one or both limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0012] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this disclosure, the preferred methods and materials are described below.

[0013] All publications and patents cited herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited, as if each individual publication or patent was specifically and individually indicated to be incorporated by reference. The citation of any publication is for the sole purpose of indicating its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by prior disclosure. Further, the dates of publication provided may be different from the actual publication dates, which may require independent confirmation.

[0014] As will be apparent to one skilled in the art upon reading this disclosure, the individual embodiments described and illustrated herein have individual components and features which may be readily separated or combined with the features of any of the other embodiments without departing from the scope or spirit of the disclosure. Any described methods can be performed in the order described or in any other order which is logically possible.

[0015] Embodiments of the present disclosure employ, unless otherwise indicated, techniques of chemistry, biology, and the like, within the skill of the art.

[0016] The following examples are presented to fully disclose and explain to those skilled in the art how to practice the methods and use the probes disclosed and claimed herein. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperatures, etc.), but some errors and variations should be expected. Unless otherwise indicated, parts are parts by weight, temperatures are in °C, and pressures are at or near atmospheric. Standard temperature and pressure are defined as 20°C and 1 atmosphere.

[0017] Before describing embodiments of the present disclosure in detail, it is to be understood that, unless otherwise indicated, the present disclosure is not limited to particular materials, reagents, reactants, or manufacturing steps, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. It is also possible in the present disclosure for steps to be executed in differing order where this is logically possible.

[0018] definition It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0019] As used herein, "self-assembly" refers to the ability of nucleic acids (and, in some cases, preformed nucleic acid nanostructures (e.g., crystals)) to anneal to one another in a sequence-specific manner, in a predictable fashion, and without external control. In some aspects, nucleic acid nanostructure self-assembly methods involve combining nucleic acids (e.g., single-stranded nucleic acids or oligonucleotides) in a single container and allowing the nucleic acids to anneal to one another based on sequence complementarity. In some aspects, this annealing process involves subjecting the nucleic acids to an elevated temperature and then gradually lowering the temperature to promote sequence-specific binding. A variety of nucleic acid nanostructure or self-assembly methods are known and are described herein.

[0020] The term "subject" refers to any individual who is the target of administration or treatment. A subject can be a vertebrate, e.g., a mammal. Thus, a subject can be a human or animal patient. The term "patient" refers to a subject under the care of a clinician, e.g., a physician.

[0021] The term "therapeutically effective" refers to the amount of composition used being sufficient to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration does not necessarily mean elimination, but may suffice to reduce or alter.

[0022] The term "pharmaceutically acceptable" refers to compounds, substances, compositions, and / or dosage forms that are suitable, within the scope of sound medical judgment, for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, with a reasonable benefit / risk ratio.

[0023] The term "treatment" refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, condition, or disorder. The term includes active treatment, i.e., treatment specifically directed at ameliorating a disease, condition, or disorder, and also includes causal treatment, i.e., treatment directed at eliminating the cause of the associated disease, condition, or disorder. In addition, the term includes palliative treatment, i.e., treatment designed to relieve symptoms rather than cure the disease, condition, or disorder; preventative treatment, i.e., treatment directed at minimizing or partially or completely suppressing the onset of the associated disease, condition, or disorder; and supportive treatment, i.e., treatment used to complement another specific treatment directed at ameliorating the associated disease, condition, or disorder.

[0024] The term "prevent" refers to a treatment that forestalls or delays the onset of a disease or condition, or reduces the severity of a disease or condition. Thus, if a treatment can treat a disease in a subject who has symptoms of the disease, it can also prevent the disease in a subject who has not yet developed all or some of the symptoms.

[0025] As used herein, the percent sequence identity of a given nucleotide or amino acid sequence C to, with, or relative to a given nucleic acid sequence D (which may also be expressed as a given sequence C having or comprising a certain percent sequence identity to, with, or relative to a given sequence D) is defined hereinafter as: It is calculated as 100 x fraction W / Z, where W is the number of nucleotides or amino acids determined to be identical by a sequence alignment program in aligning sequences C and D, and Z is the total number of nucleotides or amino acids in sequence D. It should be understood that if the length of sequence C is not equal to the length of sequence D, then the percent sequence identity of C to D will not be equal to the percent sequence identity of D to sequence C.

[0026] As used herein, the term "siRNA" refers to a short inhibitory polynucleotide that can silence gene expression after transcription in a cell. Although siRNA is usually double-stranded, only one strand of the siRNA is involved in gene silencing.

[0027] inhibitory RNA Disclosed herein are compositions and methods for stabilizing and delivering inhibitory nucleic acids. As used herein, inhibitory nucleic acid or "siNA" is defined as short interfering nucleic acid. Examples of siNA include, but are not limited to, RNAi, double-stranded RNA, and siRNA. siNA can inhibit the transcription or translation of genes in cells. siNAs can be 16-1000 or more nucleotides in length, and in certain embodiments, 18-100 nucleotides in length. In certain embodiments, siNAs can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. siNAs can comprise nucleic acids and / or nucleic acid analogs. Typically, siNAs inhibit the translation of a single gene in a cell, although in certain embodiments, siNAs may inhibit the translation of multiple genes in a cell.

[0028] Within a siNA, the nucleic acid components do not need to be of the same type or be entirely uniform (e.g., a siNA may contain both nucleotides and nucleic acids or nucleotide analogs). Typically, a siNA forms a double-stranded structure. This double-stranded structure can result from two separate nucleic acids that are partially or completely complementary. In certain embodiments of the present invention, a siNA may contain only a single nucleic acid (polynucleotide) or nucleic acid analog, which can form a double-stranded structure by complementing itself (e.g., forming a hairpin loop). The double-stranded structure of a siNA may contain 16, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90-100, 150, 200, 250, 300, 350, 400, 450, 500, or more consecutive nucleic acid bases, and all ranges between these values. The siNA may contain 17 to 35 consecutive nucleic acid bases, more preferably 18 to 30 consecutive nucleic acid bases, more preferably 19 to 25 consecutive nucleic acid bases, more preferably 20 to 23 consecutive nucleic acid bases, or 20 to 22 consecutive nucleic acid bases, or 21 consecutive nucleic acid bases, which hybridize with a complementary nucleic acid (which may be another portion of the same nucleic acid or a separate complementary nucleic acid) to form a double-stranded structure.

[0029] SiNA (e.g., siRNA) is well known in the art.For example, siRNA and double-stranded RNA are described in U.S. Patent No. 6,506,559 and U.S. Patent No. 6,573,099, and U.S. Patent Application No. 2003 / 6051263, U.S. Patent No. 2003 / 0055020, U.S. Patent No. 2004 / 0265839, U.S. Patent No. 2002 / 0168707, U.S. Patent No. 2003 / 0159161, and U.S. Patent No. 2004 / 0064842, all of which are incorporated herein by reference in their entirety.

[0030] In some cases, siRNAs can (i) bind to the respective mRNA, (ii) disrupt signal transduction, and (iii) suppress the proliferation of cancer or tumor cells.

[0031] Typically, the introduction of double-stranded RNA (dsRNA), sometimes alternatively referred to herein as "small interfering RNA (siRNA)," induces potent and specific gene silencing, a phenomenon known as RNA interference or RNAi. This phenomenon has been widely reported in the nematode C. elegans (Fire et al., 1998) but is also widely observed in other organisms, ranging from trypanosomes to mice. Depending on the organism considered, RNA interference has also been referred to as "cosuppression," "posttranscriptional gene silencing," "sense suppression," and "quelling." RNAi is an attractive biotechnology tool because it provides a means to knock out the activity of specific genes.

[0032] When designing RNAi, several factors must be considered, including the nature of the siRNA, the durability of the gene silencing effect, and the choice of delivery system. To produce an RNAi effect, the siRNA introduced into an organism typically contains exon sequences. Furthermore, because the RNAi process relies on homology, the sequence must be carefully selected to maximize gene specificity while minimizing the possibility of mutual interference between homologous but non-gene-specific sequences. Preferably, the siRNA exhibits greater than 80, 85, 90, 95, 98, or even 100% identity between the siRNA sequence and the gene to be inhibited. Sequences with less than about 80% identity to the target gene have substantially less effect. Therefore, the higher the homology between the FAK, EphA2, and / or β2AR siRNA and the FAK, EphA2, and / or β2AR gene whose expression is to be inhibited, the less likely the expression of unrelated genes will be affected.

[0033] siRNAs may also contain modifications of one or more nucleotides. Such modifications can include the addition of non-nucleotide material to the end(s) or internal (at one or more nucleotide positions in the RNA) of the 19-25 nucleotide RNA. In certain embodiments, the RNA molecule contains a 3'-hydroxy group. Nucleotides in the RNA molecules of the present invention can also include non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. Double-stranded oligonucleotides may contain modified backbones, such as phosphorothioates, phosphorodithioates, or other modified backbones known in the art, or may contain non-natural internucleoside linkages. Additional modifications of siRNA (e.g., 2'-O-methylribonucleotides, 2'-deoxy-2'-fluororibonucleotides, "universal base" nucleotides, 5-C-methyl nucleotides, one or more phosphorothioate internucleotide linkages, and incorporation of reverse deoxybasic residues) are described in US Patent Publication No. 20040019001 and US Patent No. 6,673,611 (each of which is incorporated herein by reference in its entirety).All such modified nucleic acids or RNAs described above are collectively referred to as modified siRNAs.

[0034] Introduction of siRNA into cells can be achieved by methods known in the art, such as microinjection, electroporation, or transfection of a vector containing a nucleic acid from which siRNA can be transcribed. Alternatively, siRNA can be directly introduced into cells in a form capable of binding to target mRNA transcripts. To enhance durability and membrane permeability, siRNA may be combined with or modified with liposomes, poly-L-lysine, lipids, cholesterol, lipofectin, or derivatives thereof. In certain embodiments, cholesterol-conjugated siRNA can be used (see Song et al., 2003).

[0035] Therapeutic RNA complex Disclosed herein is a therapeutic RNA complex for delivering siRNA to a subject's cells. The therapeutic RNA complex comprises a plurality of synthetic double-stranded RNA oligonucleotides, each of which comprises a sense strand having a 5'-end and a 3'-end, an antisense siRNA strand having a 5'-end and a 3'-end, and a cholesterol molecule attached to the 3'-end of the sense strand. In some embodiments, the sense strand comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleoside analogs, such as floxuridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides, or combinations thereof. These nucleoside analogs protect the sense strand from RNase degradation but also target it for digestion once inside the cell.

[0036] In some embodiments, the antisense strand is an anti-cancer siRNA that affects survival or apoptosis. For example, the antisense strand can be a survivin siRNA or an RRM2 siRNA. In some embodiments, the survivin siRNA has the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the RRM2 siRNA has the nucleic acid sequence of SEQ ID NO: 2.

[0037] In some embodiments, sense strand is the same length as antisense strand or longer.Importantly, in order to protect siRNA from RNase degradation, at least 85%, 90%, 95% or 100% of the nucleotides in antisense strand must be hybridized with the complementary nucleotides of sense strand.When entering cells, sense strand is degraded, thereby releasing siRNA into cells.

[0038] In some embodiments, the plurality of synthetic double-stranded RNA oligonucleotides are aggregates with a central cholesterol molecule, referred to herein as "RNA micelles."

[0039] In some embodiments, the RNA complex further comprises GalNAc (N-acetylgalactosamine), UAMC-1110 (SP-13786; (S)—N-(2-(2-cyano-4,4-difluoropyrrolidin-1-yl)-2-oxoethyl)quinoline-4-carboxamide), FA (folic acid), or DCL (N-[N-[(S)-1,3-dicarboxypropyl]carbamoyl]-(S)-lysine) at the 5′ end of the sense strand.

[0040] Thus, disclosed herein is a synthetic double-stranded RNA oligonucleotide comprising a sense strand having a 5' end and a 3' end, and an antisense siRNA strand having a 5' end and a 3' end, wherein the sense strand comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more floxuridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides, or combinations thereof.

[0041] Also disclosed herein is a method for stabilizing siRNA for therapeutic administration, the method comprising: preparing a plurality of synthetic single-stranded RNA oligonucleotides complementary to the siRNA sequence, each of the RNA oligonucleotides comprising 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleoside analogs configured to prevent degradation by RNases, and each of the RNA oligonucleotides comprising a cholesterol moiety attached to its 3' end. The method then comprises contacting the siRNA and the RNA oligonucleotides under conditions suitable for allowing hybridization of the siRNA with the RNA oligonucleotide to produce a double-stranded RNA molecule that aggregates with a cholesterol molecule at its center.

[0042] RNA nanostructures Also described herein are RNA nanostructures that can be composed of one or more synthetic RNA oligonucleotides designed (or configured) to self-assemble to form RNA nanostructures, which, when assembled, can be composed of double-stranded arms (DA) that can align around a core domain.

[0043] In some embodiments, at least one of the RNA oligonucleotides in the RNA nanoparticles comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 floxuridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides, or a combination thereof.

[0044] In some embodiments, the RNA oligonucleotide is modified at the 5' end with GalNAc (N-acetylgalactosamine), UAMC-1110 (SP-13786; (S)—N-(2-(2-cyano-4,4-difluoropyrrolidin-1-yl)-2-oxoethyl)quinoline-4-carboxamide), FA (folic acid), or DCL (N-[N-[(S)-1,3-dicarboxypropyl]carbamoyl]-(S)-lysine).

[0045] In some embodiments, the disclosed RNA oligonucleotides have one of the following sequences: 3WJ-A with floxuridine and gemcitabine and their derivatives: 5'-XXGYYAXGXGXAXGXGGG-3', 5'-XXGYYAXGXGXAXGXGGGGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 6) (the target aptamer sequence is written in lowercase), 5'-XXGYYAXGXGXAXGXGGGGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 7), 5'-XXGYYXGXGXAXGXGGGgcgacugguuacccggucg-3' (SEQ ID NO: 8) (target aptamer sequence written in lowercase), 5'-XXGYYAXGXGXGXGGGcagaacguauacuauucug-3' (SEQ ID NO: 9) (target aptamer sequence written in lowercase), 5'-GalNAc-XXGYYAXGXGXGXGGG-3', 5'-FA-XXGYYAXGXGXAXGXGGG-3', 5'-DCL-XXGYYAXGXGXAXGXGGG-3', 5'-UAMC1110-XXGYYAXGXGXAXGXGGG-3', 3WJ-B with floxuridine and gemcitabine and their derivatives: 5'-YYYAYAXAYXXXGXXGAXYY-3', 5'-YYYAYAXAYXXXGXXGAXYYgccuuaguaacgugcuuaugucgauucgacaggc-3' (SEQ ID NO: 10) (the target aptamer sequence is written in lowercase), 5'-YYYAYAXAYXXXGXXGAXYYGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 11), 5'-YYYAYAXAYXXXGXXGAXYYgcgacugguuacccggucg-3' (SEQ ID NO: 12) (target aptamer sequence written in lowercase), 5'-YYYAYAXAYXXXGXXGAXYYcagaacguauacuauucug-3' (SEQ ID NO: 13) (target aptamer sequence written in lowercase), 5'-GalNAc-YYYAYAXAYXXXGXXGAXYY-3', 5'-FA-YYYAYAXAYXXXGXXGAXYY-3', 5'-DCL-YYYAYAXAYXXXGXXGAXYY-3', 5'-UAMC1110-YYYAYAXAYXXXGXXGAXYY-3', 3WJ-C with floxuridine and gemcitabine and their derivatives: 5'-GGAXYAAXYAXGGYAA-3', 5'-GGAXYAAXYAXGGYAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 14) (target aptamer sequence written in lowercase), 5'-GGAXYAAXYAXGGYAAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 15), 5'-GAXYAAXYAXGGYAAgcgacugguuacccggucg-3' (SEQ ID NO: 16) (target aptamer sequence written in lowercase), 5'-GAXYAAXYAXGGYAAcagaacguauacuauucug-3' (SEQ ID NO: 17) (target aptamer sequence written in lowercase), 5'-GalNAc-GGAXYAAXYAXGGYAA-3' (SEQ ID NO: 18), 5'-FA-GGAXYAAXYAXGGYAA-3' (SEQ ID NO: 18, 3WJ-c-FA), 5'-DCL-GGAXYAAXYAXGGYAA-3' (SEQ ID NO: 19), 5'-UAMC1110-GGAXYAAXYAXGGYAA-3' (SEQ ID NO: 20), 4WJ-A with floxuridine and gemcitabine and their derivatives: 5'-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-3' (SEQ ID NO: 21), 5'-XXAGGXAAAGYYYYXGYAGGXGYXAYYGAXGXAAXXYAAgccuuaguaacgugcuuaugucgauucgacaggaggc-3' (SEQ ID NO: 22) (the target aptamer sequence is written in lowercase), 5'-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAAgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 23) (the target aptamer sequence is written in lowercase), 5'-XXAGGXAAAGYYYYXGYAGGXGYXAYYGAXGXAAXXYAAgcgacugguuacccggucg-3' (SEQ ID NO: 24) (target aptamer sequence written in lowercase), 5'-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAAcagaacguauacuauucug-3' (SEQ ID NO: 25) (target aptamer sequence written in lowercase), 5'-GalNAc-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-3' (SEQ ID NO: 21), 5'-FA-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-3' (SEQ ID NO: 21), 5'-DCL-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-3' (SEQ ID NO: 21), 5'-UAMC1110-XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-3' (SEQ ID NO: 21), 4WJ-B with floxuridine and gemcitabine and their derivatives: 5'-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-3' (SEQ ID NO: 26), 5'-XXGAAXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAGgccuuaguaacgugcuuaugucgauucgacaggaggc-3' (SEQ ID NO: 27) (target aptamer sequence written in lowercase), 5'-XXGAAXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAGgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 28) (target aptamer sequence written in lowercase), 5'-XXGAAXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAGgcgacugguuacccggucg-3' (SEQ ID NO: 29) (target aptamer sequence written in lowercase), 5'-XXGAAXAYXAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAGcagaacguauacuauucug-3' (SEQ ID NO: 30) (target aptamer sequence written in lowercase), 5'-GalNAc-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-3' (SEQ ID NO: 26), 5'-FA-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-3' (SEQ ID NO: 26), 5'-DCL-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-3' (SEQ ID NO: 26), 5'-UAMC1110-XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-3' (SEQ ID NO: 26), 4WJ-C with floxuridine and gemcitabine and their derivatives: 5'-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-3' (SEQ ID NO: 31), 5'-YXGXXYAGYYXYGYAGYAGYAGYYYXGAAXAGGgccuuaguaacgugcuuaugucgauucgacaggaggc-3' (SEQ ID NO: 32) (target aptamer sequence written in lowercase), 5'-YXGXXYAGYYXYGYAGYAGYAYGYYXGAAXAGGgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 33) (the target aptamer sequence is written in lowercase), 5'-YXGXXYAGYYXYGYAGYAGYAGYAGYAGYYXGAAXAGGgcgacguuacccggucg-3' (SEQ ID NO: 34) (target aptamer sequence written in lowercase), 5'-YXGXXYAGYYXYGYAGYAGYAGYAGYYXGAAXAGGcagaacguauacuauucug-3' (SEQ ID NO: 35) (target aptamer sequence written in lowercase), 5'-GalNAc-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-3' (SEQ ID NO: 31), 5'-FA-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-3' (SEQ ID NO: 31), 5'-DCL-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-3' (SEQ ID NO: 31), 5'-UAMC1110-YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-3' (SEQ ID NO: 31), 4WJ-D with floxuridine and gemcitabine and their derivatives: 5'-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-3' (sequence 36), 5'-YYXAXXYAGGXGYGXGYXAYYXAAgccuuaguaacgugcuuaugucgauucgacaggc-3' (SEQ ID NO: 37) (target aptamer sequence written in lowercase), 5'-YYXAXXYAGGXGYGXGYXAYYXAAgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 38) (target aptamer sequence written in lowercase), 5'-YYXAXXYAGGXGYGXGYXAYYXAAgcgacugguuacccggucg-3' (SEQ ID NO: 39) (target aptamer sequence written in lowercase), 5'-YYXAXXYAGGXGYGXGYXAYYXAAcagaacguauacuauucug-3' (SEQ ID NO: 40) (target aptamer sequence written in lowercase), 5'-GalNAc-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-3' (SEQ ID NO: 36), 5'-FA-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-3' (SEQ ID NO: 36), 5'-DCL-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-3' (SEQ ID NO: 36), 5'-UAMC1110-YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-3' (SEQ ID NO: 36), 6WJ-A with floxuridine and gemcitabine and their derivatives: 5'-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-3' (SEQ ID NO: 41), 5'-GAGXAXGXXAGGYYXGGGXGAGXYXXGYXYYXAYYGgccuuaguaacgugcuuaugucgauucgacaggc-3' (SEQ ID NO: 42) (target aptamer sequence written in lowercase), 5'-GAGXAXGXXAGGYYXGGGXGAGXYXXGYXYYXAYYGgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 43) (target aptamer sequence written in lowercase), 5'-GAGXAXGXXAGGYYXGGGXGAGXYXXGYYXYYXAYYGgcgacugguuacccggucg-3' (SEQ ID NO: 44) (target aptamer sequence written in lowercase), 5'-GAGXAXGXXAGGYYXGGGXGAGXYXXGYGXYYXAYYGcagaacguauacuauucug-3' (SEQ ID NO: 45) (target aptamer sequence written in lowercase), 5'-GalNAc-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-3' (SEQ ID NO: 41), 5'-FA-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-3' (SEQ ID NO: 41), 5'-DCL-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-3' (sequence number), 5'-UAMC1110-GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-3' (SEQ ID NO: 41), 6WJ-B with floxuridine and gemcitabine and their derivatives: 5'-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-3' (SEQ ID NO: 46), 5'-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYgccuuaguaacgugcuuaugucgauucgacaggaggc-3' (SEQ ID NO: 47) (target aptamer sequence written in lowercase), 5'-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 48) (target aptamer sequence written in lowercase), 5'-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYgcgacugguuacccggucg-3' (SEQ ID NO: 49) (target aptamer sequence written in lowercase), 5'-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYcagaacguauacuauucug-3' (SEQ ID NO: 50) (target aptamer sequence written in lowercase), 5'-GalNAc-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-3' (SEQ ID NO: 46), 5'-FA-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-3' (SEQ ID NO: 46), 5'-DCL-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-3' (SEQ ID NO: 46), 5'-UAMC1110-YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-3' (SEQ ID NO: 46), 6WJ-C with floxuridine and gemcitabine and their derivatives: 5'-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-3' (SEQ ID NO: 51), 5'-GGGAAYAGXAYAYAAYXAGXGXYYGGGAXAGGGAYAXAYAgccuuaguaacgugcuuaugucgauucgacaggaggc-3' (SEQ ID NO: 52) (target aptamer sequence written in lowercase), 5'-GGGAAYAGXAYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYAgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 53) (target aptamer sequence written in lowercase), 5'-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYAgcgacguuacccggucg-3' (SEQ ID NO: 54) (target aptamer sequence written in lowercase), 5'-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYAcagaacguauacuauucug-3' (SEQ ID NO: 55) (target aptamer sequence written in lowercase), 5'-GalNAc-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-3' (SEQ ID NO: 51), 5'-FA-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-3' (SEQ ID NO: 51), 5'-DCL-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-3' (SEQ ID NO: 51), 5'-UAMC1110-GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-3' (SEQ ID NO: 51), 6WJ-D with floxuridine and gemcitabine and their derivatives: 5'-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXY-3' (SEQ ID NO: 56), 5'-XGXAXGXYYYYYYYYYYYYYGGAXGYYYYAGGYYXAAYAXAYXYgccuuaguaacgugcuuaugucgauucgacaggc-3' (SEQ ID NO: 57) (target aptamer sequence written in lowercase), 5'-XGXAXGXYYYYYYYYYYYYYYYGGAXGYYYYAGGYYYXAAYAXAYXYgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 58) (target aptamer sequence written in lowercase), 5'-XGXAXGXYYYYYYYYYYYYYYYYGGAXGYYYYYAGGYYYXAAYAXAXAYXYgcgacugguuacccggucg-3' (SEQ ID NO: 59) (target aptamer sequence written in lowercase), 5'-XGXAXGXYYYYYYYYYYYYYYYGGAXGYYYYAGGYYYXAAYAXAYXYcagaacguauacuauucug-3' (SEQ ID NO: 60) (target aptamer sequence written in lowercase), 5'-GalNAc-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXY-3' (SEQ ID NO: 56), 5'-FA-XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXY-3' (SEQ ID NO: 56), 5'-DCL-XGXAXGXYYYYYYYYYYGGAXGYYYYYAGGYYXAAYAXAYXY-3' (SEQ ID NO: 56), or 5'-UAMC1110-XGXAXGXYYYYYYGGAXGYYYYYYAGGYYXAAYAXAYXY-3' (SEQ ID NO: 56), where X is floxuridine (5-fluorodeoxyuridine, UB5F) and Y is gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF).

[0046] In some embodiments, the disclosed RNA oligonucleotides have one of the following sequences: 3WJ-A with only gemcitabine and its derivatives: 5'-UUGYYAUGUGUAUGUGGG-3' (SEQ ID NO: 61), 5'-UUGYYAUGUGUAUGUGGGGgccuuaguaacgugcuuugaugucgauucgacaggc-3' (SEQ ID NO: 280) (target aptamer sequence written in lowercase), 5'-uugyyauguauggggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 281), 5'-UUGYYAUGUGUAUGUGGGgcgacugguacccggucg-3' (SEQ ID NO: 282) (target aptamer sequence in lowercase), 5'-UUGYYAUGUGUAUGUGUGGcagaacguauacuauucug-3' (SEQ ID NO: 283) (target aptamer sequence written in lowercase), 5'-GalNAc-UUGYYAUGUGUAUGUGGG-3' (SEQ ID NO: 61), 5'-FA-UUGYYAUGUGUAUGUGGG-3' (SEQ ID NO: 61, 3WJ a FA), 5'-DCL-UUGYYAUGUGUAUGUGGG-3' (SEQ ID NO: 61), 5'-UAMC1110-UUGYYAUGUGUAUGUGGG-3' (SEQ ID NO: 61), 3WJ-B with only gemcitabine and its derivatives: 5'-YYYAYAUAYUUUGUUGAUYY-3' (SEQ ID NO: 62), 5'-YYYAYAUAYUUUGUGAUYYgccuuaguaacgugcuuaugucgauucgacaggc-3' (SEQ ID NO: 63) (target aptamer sequence written in lowercase), 5'-YYYAYAUAYUUUGUUGAUYYGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 64), 5'-YYYAYAUAYUUUGUGAUYYgcgacuguacccggucg-3' (SEQ ID NO: 65, 3WJ-b-EpCAMapt) (target aptamer sequence written in lowercase), 5'-YYYAYAUAYUUUGUGAUYYcagaacguauacuauucug-3' (SEQ ID NO: 66) (target aptamer sequence written in lowercase), 5'-GalNAc-YYYAYAUAYUUUGUUGAUYY-3' (SEQ ID NO: 62), 5'-FA-YYYAYAUAYUUUGUUGAUYY-3' (SEQ ID NO: 62), 5'-DCL-YYYAYAUAYUUUGUUGAUYY-3' (SEQ ID NO: 62), 5'-UAMC1110-YYYAYAUAYUUUGUUGAUYY-3' (SEQ ID NO: 62), 3WJ-C with only gemcitabine and its derivatives: 5'-GGAUYAAUYAUGGYAA-3' (SEQ ID NO: 67), 5'-GGAUYAAUYAUGGYAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 68 (target aptamer sequence written in lowercase)), 5'-GGAUYAAUYAUGGYAAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 69), 5'-GGAUYAAUYAUGGYAAgcgacugguuacccggucg-3' (SEQ ID NO: 70) (target aptamer sequence written in lowercase), 5'-GGAUYAAUYAUGGYAAcagaacguauacuauucug-3' (SEQ ID NO: 71) (target aptamer sequence written in lowercase), 5'-GalNAc-GGAUYAAUYAUGGYAA-3' (SEQ ID NO: 67), 5'-FA-GGAUYAAUYAUGGYAA-3' SEQ ID NO: 67), 5'-DCL-GGAUYAAUYAUGGYAA-3' (SEQ ID NO: 67), 5'-UAMC1110-GGAUYAAUYAUGGYAA-3' (SEQ ID NO: 67), 4WJ-A with only gemcitabine and its derivatives: 5'-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA-3' (SEQ ID NO: 72), 5'-UUAGGUAAAGYYAYYUGYAGGUGYUAYGAUGUAUYAAgccuuaguaacgugcuuaugucgauucgacaggaggc-3' (SEQ ID NO: 73) (target aptamer sequence written in lowercase), 5'-UUAGGUAAAGYYAYYUGYAGGUGYUAYGAUGUAUYAAgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 74) (target aptamer sequence written in lowercase), 5'-UUAGGUAAAGYYAYYUGYAGGUGYUAYGAUGUAUYAAgcgacguuacccggucg-3' (SEQ ID NO: 75) (target aptamer sequence written in lowercase), 5'-UUAGGUAAAGYYAYYUGYAGGUGYUAYGAUGUAUYAAcagaacguauacuauucug-3' (SEQ ID NO: 76) (target aptamer sequence written in lowercase), 5'-GalNAc-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA-3' (SEQ ID NO: 72), 5'-FA-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA-3' (SEQ ID NO: 72), 5'-DCL-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA-3' (SEQ ID NO: 72), 5'-UAMC1110-UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA-3' (SEQ ID NO: 72), 4WJ-B with only gemcitabine and its derivatives: 5'-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG-3' (SEQ ID NO: 77), 5'-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAGgccuuaguaacgugcuuaugucgauucgacaggaggc-3' (SEQ ID NO: 78) (target aptamer sequence written in lowercase), 5'-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAGgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 79) (target aptamer sequence written in lowercase), 5'-UUGAAUUAYAUYGGUAGGYAYGGGYUGUGYGAGGYUGAAYAGgcgacuguacccggucg-3' (SEQ ID NO: 80) (target aptamer sequence written in lowercase), 5'-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAGcagaacguauacuauucug-3' (SEQ ID NO: 81) (target aptamer sequence written in lowercase), 5'-GalNAc-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG-3' (SEQ ID NO: 77), 5'-FA-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG-3' (SEQ ID NO: 77), 5'-DCL-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG-3' (SEQ ID NO: 77), 5'-UAMC1110-UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG-3' (SEQ ID NO: 77), 4WJ-C with only gemcitabine and its derivatives: 5'-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG-3' (SEQ ID NO: 82), 5'-YUGUUYAGYYUYGYAYAGYAGYAYGYYUGAAUAGGgccuuaguaacgcuuugaugucgauucgacaggc-3' (SEQ ID NO: 83) (target aptamer sequence written in lowercase), 5'-YUGUUYAGYYUYGYAYAGYAGYAYGYYUGAAUAGGgggaccgaaaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 84) (target aptamer sequence written in lowercase), 5'-YUGUUYAGYYUYGYAYAGYAGYAYGYYUGAAUAGGgcgacguuacccggucg-3' (SEQ ID NO: 85) (target aptamer sequence written in lowercase), 5'-YUGUUYAGYYUYGYAYAGYAGYAYGYYUGAAUAGGcagaacguauacuauucug-3' (SEQ ID NO: 86) (target aptamer sequence written in lowercase), 5'-GalNAc-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG-3' (SEQ ID NO: 82), 5'-FA-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG-3' (SEQ ID NO: 82), 5'-DCL-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG-3' (SEQ ID NO: 82), 5'-UAMC1110-YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG-3' (SEQ ID NO: 82), 4WJ-D with gemcitabine and its derivatives only: 5'-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA-3' (SEQ ID NO: 87), 5'-YYUAUYAGGUGYGUGYUGGYUGGYUUAYUAAgccuuaguaacgugcuuaugucgauucgacaggaggc-3' (SEQ ID NO: 88) (target aptamer sequence written in lowercase), 5'-YYUAUUYAGGUGYGUGYUGGYAGGUGGYUUUAYUAAgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 89) (target aptamer sequence written in lowercase), 5'-YYUAUYAGGUGYUGGYUGGYUGGYUUAYUAAgcgacguuacccggucg-3' (SEQ ID NO: 90) (target aptamer sequence written in lowercase), 5'-YYUAUUYAGGUGYGUGYUGGYUGGUGGYUUUAYUAAcagaacguauacuauucug-3' (SEQ ID NO: 91) (target aptamer sequence written in lowercase), 5'-GalNAc-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA-3' (SEQ ID NO: 87), 5'-FA-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA-3' (SEQ ID NO: 87), 5'-DCL-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA-3' (SEQ ID NO: 87), 5'-UAMC1110-YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA-3' (SEQ ID NO: 87), 6WJ-A with only gemcitabine and its derivatives: 5'-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG-3' (SEQ ID NO: 92), 5'-GAGUAUAUGUUAGGYUGGYUGGUGUGUYUYUAYGgccuuaguaacgugcuuaugucgauucgacaggaggc-3' (SEQ ID NO: 93) (target aptamer sequence written in lowercase), 5'-GAGUAUAUGUUAGGYUGGYUGGUGUGUYUYUAYGgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 94) (target aptamer sequence written in lowercase), 5'-GAGUAUAUGUUAGGYUGGYUGGUGUYUYUAYGgcgacuguacccggucg-3' (SEQ ID NO: 95) (target aptamer sequence written in lowercase), 5'-GAGUAUAUGUUAGGYUGGYUGGUGUGUYUGYUYUAYGcagaacguauacuauucug-3' (SEQ ID NO: 96) (target aptamer sequence written in lowercase), 5'-GalNAc-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG-3' (SEQ ID NO: 92), 5'-FA-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG-3' (SEQ ID NO: 92), 5'-DCL-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG-3' (SEQ ID NO: 92), 5'-UAMC1110-GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG-3' (SEQ ID NO: 92), 6WJ-B with only gemcitabine and its derivatives: 5'-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY-3' (SEQ ID NO: 97), 5'-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGGUAYUGUYYYgccuuaguaacgugcuuaugucgauucgacaggaggc-3' (SEQ ID NO: 98) (target aptamer sequence written in lowercase), 5'-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGGUAYUGUYYYgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 99) (target aptamer sequence written in lowercase), 5'-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGGUAYUGUYYYgcgacguuacccggucg-3' (SEQ ID NO: 100) (target aptamer sequence written in lowercase), 5'-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGGUAYUGUYYYcagaacguauacuauucug-3' (SEQ ID NO: 101) (target aptamer sequence written in lowercase), 5'-GalNAc-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY-3 (SEQ ID NO: 97), 5'-FA■YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY-3' (SEQ ID NO: 97), 5'-DCL-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY-3' (SEQ ID NO: 97), 5'-UAMC1110-YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY-3' (SEQ ID NO: 97), 6WJ-C with only gemcitabine and its derivatives: 5'-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA-3' (SEQ ID NO: 102), 5'-GGGAAYAGUAYAYAAYUAGUGUYYYGGGAUAGGAYAUAGCCUAGUAACGUGCUUGAGUCGUUCGAGGC-3' (SEQ ID NO: 103) (target aptamer sequence written in lowercase), 5'-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYAgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 104) (target aptamer sequence written in lowercase), 5'-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYAgcgacugguuacccggucg-3' (SEQ ID NO: 105) (target aptamer sequence written in lowercase), 5'-GGGAAYAGUAYYYGGGAUAGGAYAUAGUGUYYYGGGAUAGGAYAUAYAcagaacguauacuauucug-3' (SEQ ID NO: 106) (target aptamer sequence written in lowercase), 5'-GalNAc-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA-3' (SEQ ID NO: 102), 5'-FA-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA-3' (SEQ ID NO: 102), 5'-DCL-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA-3' (SEQ ID NO: 102), 5'-UAMC1110-GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA-3' (SEQ ID NO: 102), 6WJ-D with only gemcitabine and its derivatives: 5'-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY-3' (SEQ ID NO: 107), 5'-UGUAUGUYYUAYYYYGGGAUGYYAGGYUAAYAUAYUYgccuuaguaacgugcuuaugucgauucgacaggc-3' (SEQ ID NO: 108) (target aptamer sequence written in lowercase), 5'-UGUAUGUYYUAYYYYGGGAUGYYAGGYUAAYAUAYUYgggaccgaaaaagaccugacuucuauacuaagucuacguccc-3' (SEQ ID NO: 109) (target aptamer sequence written in lowercase), 5'-UGUAUGUYYUAYYYYGGGAUGYYAGGYUAAYAUAYUYgcgacuguacccggucg-3' (SEQ ID NO: 110) (target aptamer sequence written in lowercase), 5'-UGUAUGUYYUAUYYYGGGAUGYYAGGYUAAYAUAYUYcagaacguauacuauucug-3' (SEQ ID NO: 111) (target aptamer sequence in lowercase), 5'-GalNAc-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY-3' (SEQ ID NO: 107), 5'-FA-UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY-3' (SEQ ID NO: 107), 5'-DCL-UGUAUGUYYUAUYYYGGGAUGYYAGGYYUAAYAUAYUY-3' (SEQ ID NO: 107), or 5' UAMC1110 UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY 3' (SEQ ID NO: 107), where Y is gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF).

[0047] In some embodiments, the disclosed RNA oligonucleotides have one of the following sequences: 3WJ-A containing only floxuridine and its derivatives: 5'-XXGCCAXGXGXAXGXGGG-3' (SEQ ID NO: 112), 5'-XXGCCAXGXGXAXGXGGGGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 113) (target aptamer sequence written in lowercase), 5'-XXGCCAXGXGXAXGXGGGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 114) (target aptamer sequence written in lowercase), 5'-XXGCCAXGXGXAXGXGGGgcgacugguuacccggucg-3' (SEQ ID NO: 115) (target aptamer sequence in lowercase), 5'-XXGCCAXGXGXAXGXGGGcagaacguauacuauucug-3' (SEQ ID NO: 116, 3WJ-a-CD133apt) (target aptamer sequence written in lowercase), 5'-GalNAc-XXGCCAXGXGXAXGXGGG-3' (SEQ ID NO: 112), 5'-FA-XXGCCAXGXGXAXGXGGG-3' (SEQ ID NO: 112), 5'-DCL-XXGCCAXGXGXAXGXGGG-3' (SEQ ID NO: 112), 5'-UAMC1110-XXGCCAXGXGXAXGXGGG-3' (SEQ ID NO: 112), 3WJ-B containing only floxuridine and its derivatives: 5'-CCCACAXACXXXGXXGAXCC-3' (SEQ ID NO: 117, 3WJ-b), 5'-CCCACAXACXXXGXXGAXCCgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 118) (target aptamer sequence written in lowercase), 5'-CCCACAXACXXXGXXGAXCCgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 119) (target aptamer sequence written in lowercase) 5'-CCCACAXACXXXGXXGAXCCgcgacugguuacccggucg-3' (SEQ ID NO: 120) (target aptamer sequence written in lowercase), 5'-CCCACAXACXXXGXXGAXCCcagaacguauacuauucug-3' (SEQ ID NO: 121) (target aptamer sequence written in lowercase), 5'-GalNAc-CCCACAXACXXXGXXGAXCC-3' (SEQ ID NO: 117), 5'-FA-CCCACAXACXXXGXXGAXCC-3' (SEQ ID NO: 117), 5'-DCL-CCCACAXACXXXGXXGAXCC-3' (SEQ ID NO: 117), 5'-UAMC1110-CCCACAXACXXXGXXGAXCC-3' (SEQ ID NO: 117), 3WJ-C containing only floxuridine and its derivatives: 5'-GGAXCAAXCAXGGCAA-3' (SEQ ID NO: 122), 5'-GGAXCAAXCAXGGCAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 123) (target aptamer sequence written in lowercase), 5'-GGAXCAAXCAXGGCAAgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 124) (target aptamer sequence written in lowercase), 5'-GGAXCAAXCAXGGCAAgcgacugguuacccggucg-3' (SEQ ID NO: 125) (target aptamer sequence in lowercase), 5'-GGAXCAAXCAXGGCAAcagaacguauacuauucug-3' (SEQ ID NO: 126) (target aptamer sequence written in lowercase), 5'-GalNAc-GGAXCAAXCAXGGCAA-3' (SEQ ID NO: 122), 5'-FA-GGAXCAAXCAXGGCAA-3' (SEQ ID NO: 122), 5'-DCL-GGAXCAAXCAXGGCAA-3' (SEQ ID NO: 122), 5'-UAMC1110-GGAXCAAXCAXGGCAA-3' (SEQ ID NO: 122), 4WJ-A containing only floxuridine and its derivatives: 5'-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-3' (SEQ ID NO: 127), 5'-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 128) (target aptamer sequence written in lowercase), 5'-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAAgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 129) (target aptamer sequence written in lowercase), 5'-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAAgcgacugguuacccggucg-3' (SEQ ID NO: 130) (target aptamer sequence written in lowercase), 5'-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAAcagaacguauacuauucug-3' (SEQ ID NO: 131) (target aptamer sequence written in lowercase), 5'-GalNAc-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-3' (SEQ ID NO: 127), 5'-FA-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-3' (SEQ ID NO: 127), 5'-DCL-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-3' (SEQ ID NO: 127), 5'-UAMC1110-XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-3' (SEQ ID NO: 127), 4WJ-B containing only floxuridine and its derivatives: 5'-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-3' (SEQ ID NO: 132), 5'-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 133) (target aptamer sequence written in lowercase), 5'-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 134) (target aptamer sequence written in lowercase), 5'-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAGgcgacugguuacccggucg-3' (SEQ ID NO: 135) (target aptamer sequence written in lowercase), 5'-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAGcagaacguauacuauucug-3' (SEQ ID NO: 136) (target aptamer sequence written in lowercase), 5'-GalNAc-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-3' (SEQ ID NO: 132), 5'-FA-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-3' (SEQ ID NO: 132), 5'-DCL-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-3' (SEQ ID NO: 132), 5'-UAMC1110-XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-3' (SEQ ID NO: 132), 4WJ-C containing only floxuridine and its derivatives: 5'-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-3' (SEQ ID NO: 137), 5'-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 138) (target aptamer sequence written in lowercase), 5'-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 139) (target aptamer sequence written in lowercase), 5'-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGGgcgacugguuacccggucg-3' (SEQ ID NO: 140) (target aptamer sequence written in lowercase), 5'-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGGcagaacguauacuauucug-3' (SEQ ID NO: 141) (target aptamer sequence written in lowercase), 5'-GalNAc-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-3' (SEQ ID NO: 137), 5'-FA-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-3' (SEQ ID NO: 137), 5'-DCL-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-3' (SEQ ID NO: 137), 5'-UAMC1110-CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-3' (SEQ ID NO: 137), 4WJ-D containing only floxuridine and its derivatives: 5'-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-3' (SEQ ID NO: 142), 5'-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 143) (target aptamer sequence written in lowercase), 5'-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAAgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 144) (target aptamer sequence written in lowercase), 5'-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAAgcgacugguuacccggucg-3' (SEQ ID NO: 145) (target aptamer sequence written in lowercase), 5'-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAAcagaacguauacuauucug-3' (SEQ ID NO: 146) (target aptamer sequence written in lowercase), 5'-GalNAc-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-3' (SEQ ID NO: 142), 5'-FA-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-3' (SEQ ID NO: 142), 5'-DCL-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-3' (SEQ ID NO: 142), 5'-UAMC1110-CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-3' (SEQ ID NO: 142), 6WJ-A containing only floxuridine and its derivatives: 5'-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-3' (SEQ ID NO: 147), 5'-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCGgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 148) (target aptamer sequence written in lowercase), 5'-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCGgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 149) (target aptamer sequence written in lowercase), 5'-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCGgcgacugguuacccggucg-3' (SEQ ID NO: 150) (target aptamer sequence in lowercase), 5'-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCGcagaacguauacuauucug-3' (SEQ ID NO: 151) (target aptamer sequence in lowercase), 5'-GalNAc-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-3' (SEQ ID NO: 147), 5'-FA-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-3' (SEQ ID NO: 147), 5'-DCL-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-3' (SEQ ID NO: 147), 5'-UAMC1110-GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-3' (SEQ ID NO: 147), 6WJ-B containing only floxuridine and its derivatives: 5'-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-3' (SEQ ID NO: 152), 5'-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCCgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 153) (target aptamer sequence written in lowercase), 5'-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCCgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 154) (target aptamer sequence written in lowercase), 5'-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCCgcgacugguuacccggucg-3' (SEQ ID NO: 155) (target aptamer sequence written in lowercase), 5'-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCCcagaacguauacuauucug-3' (SEQ ID NO: 156) (target aptamer sequence written in lowercase), 5'-GalNAc-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-3' (SEQ ID NO: 152), 5'-FA-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-3' (SEQ ID NO: 152), 5'-DCL-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-3' (SEQ ID NO: 152), 5'-UAMC1110-CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-3' (SEQ ID NO: 152), 6WJ-C containing only floxuridine and its derivatives: 5'-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-3' (SEQ ID NO: 157), 5'-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACAgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 158) (target aptamer sequence written in lowercase), 5'-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACAgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 159) (target aptamer sequence written in lowercase), 5'-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACAgcgacugguuacccggucg-3' (SEQ ID NO: 160) (target aptamer sequence in lowercase), 5'-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACAcagaacguauacuauucug-3' (SEQ ID NO: 161) (target aptamer sequence written in lowercase), 5'-GalNAc-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-3' (SEQ ID NO: 157), 5'-FA-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-3' (SEQ ID NO: 157), 5'-DCL-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-3' (SEQ ID NO: 157), 5'-UAMC1110-GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-3' (SEQ ID NO: 157), 6WJ-D containing only floxuridine and its derivatives: 5'-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-3' (SEQ ID NO: 162), 5'-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXCgccuuaguaacgugcuuugaugucgauucgacaggaggc-3' (SEQ ID NO: 163) (target aptamer sequence written in lowercase), 5'-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXCgggaccgaaaaagaccugacuucuauacuaagucuacguuuccc-3' (SEQ ID NO: 164) (target aptamer sequence written in lowercase), 5'-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXCgcgacugguuacccggucg-3' (SEQ ID NO: 165) (target aptamer sequence in lowercase), 5'-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXCcagaacguauacuauucug-3' (SEQ ID NO: 166) (target aptamer sequence written in lowercase), 5'-GalNAc-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-3' (SEQ ID NO: 162), 5'-FA-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-3' (SEQ ID NO: 162), 5'-DCL-XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-3' (SEQ ID NO: 162), or 5' UAMC1110 XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-3' (SEQ ID NO: 162), where X is floxuridine (5-fluorodeoxyuridine, UB5F).

[0048] In some embodiments, the disclosed RNA oligonucleotides have one of the following unmodified sequences: 3WJ-A: 5'-UUGCCAUGUGUAUGUGGG-3' (SEQ ID NO: 167), 5'-UUGCCAUGUGUAUGUGGGGGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 168), 5'-UUGCCAUGUGUAUGUGGGGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 169), 5'-UUGCCUGUGUAUGUGGGGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 170), 5'-UUGCCAUGUGUAUGUGGGCAGAACGUAUACUAUUCUG-3' (SEQ ID NO: 171), 5'-GalNAc-UUGCCAUGUGUAUGUGGG-3' (SEQ ID NO: 167), 5'-FA-UUGCCAUGUGUAUGUGGG-3' (SEQ ID NO: 167), 5'-DCL-UUGCCAUGUGUAUGUGGG-3' (SEQ ID NO: 167), 5'-UAMC1110-UUGCCAUGUGUAUGUGGG-3' (SEQ ID NO: 167), 3WJ-B: 5'-CCCACAUACUUUGUUGAUCC-3' (SEQ ID NO: 172), 5'-CCCACAUACUUUGUUGAUCCGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 173), 5'-CCCACAUACUUUGUUGAUCCGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 174), 5'-CCCACAUACUUUGUUGAUCCGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 175), 5'-CCCACAUACUUUGUUGAUCCCAGAACGUAUACUAUUCUG-3' (SEQ ID NO: 176), 5'-GalNAc-CCCACAUACUUUGUUGAUCC-3' (SEQ ID NO: 173), 5'-FA-CCCACAUACUUUGUUGAUCC-3' (SEQ ID NO: 173), 5'-DCL-CCCACAUACUUUGUUGAUCC-3' (SEQ ID NO: 173), 5'-UAMC1110-CCCACAUACUUUGUUGAUCC-3' (SEQ ID NO: 173), 3WJ-C: 5'-GGAUCAAUCAUGGCAA-3' (SEQ ID NO: 177), 5'-GGAUCAAUCAUGGCAAGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 178), 5'-GGAUCAAUCAUGGCAAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 179), 5'-GGAUCAAUCAUGGCAAGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 180), 5'-GGAUCAAUCAUGGCAACAGAACGUAUACUAUUCUG-3' (SEQ ID NO: 181), 5'-GalNAc-GGAUCAAUCAUGGCAA-3' (SEQ ID NO: 177), 5'-FA-GGAUCAAUCAUGGCAA-3' (SEQ ID NO: 177), 5'-DCL-GGAUCAAUCAUGGCAA-3' (SEQ ID NO: 177), 5'-UAMC1110-GGAUCAAUCAUGGCAA-3' (SEQ ID NO: 177), 4WJ-A: 5'-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-3' (SEQ ID NO: 182), 5'-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAAGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 183), 5'-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 184), 5'-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAAGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 185), 5'-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAACAGAACGUAUACUAUUCUG-3' (SEQ ID NO: 186), 5'-GalNAc-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-3' (SEQ ID NO: 182), 5'-FA-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-3' (SEQ ID NO: 182), 5'-DCL-UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-3' (SEQ ID NO: 182), 5'-UAMC1110 UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-3' (SEQ ID NO: 182), 4WJ-B: 5'-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-3' (SEQ ID NO: 187), 5'-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAGGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 188), 5'-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAGGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 189), 5'-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAGGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 190), 5'-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAGCAGAACGUAUACUAUUCUG-3' (SEQ ID NO: 191), 5'-GalNAc-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-3' (SEQ ID NO: 187), 5'-FA-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-3' (SEQ ID NO: 187), 5'-DCL-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-3' (SEQ ID NO: 187), 5'-UAMC1110-UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-3' (SEQ ID NO: 187), 4WJ-C: 5'-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-3' (SEQ ID NO: 192), 5'-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGGGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 193), 5'-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGGGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 194), 5'-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGGGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 195), 5'-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGGCAGAACGUAUACUAUUCUG-3' (SEQ ID NO: 196), 5'-GalNAc-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-3' (SEQ ID NO: 192), 5'-FA-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-3' (SEQ ID NO: 192), 5'-DCL-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-3' (SEQ ID NO: 192), 5'-UAMC1110-CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-3' (SEQ ID NO: 192), 4WJ-D: 5'-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-3' (SEQ ID NO: 197), 5'-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAAGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 198), 5'-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 199), 5'-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAAGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 200), 5'-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAACAGAACGUAUACUAUUCUG-3' (SEQ ID NO: 201), 5'-GalNAc-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-3' (SEQ ID NO: 197), 5'-FA-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-3' (SEQ ID NO: 197), 5'-DCL-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-3' (SEQ ID NO: 197), 5'-UAMC1110-CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-3' (SEQ ID NO: 197), 6WJ-A: 5'-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-3' (SEQ ID NO: 202); 5'-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCGGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 203), 5'-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCGGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 204), 5'-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCGGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 205), 5'-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCGCAGAACGUAUACUAUUCUG-3' (SEQ ID NO: 206), 5'-GalNAc-GAGUAUAUGUUAGGCCUGGUGUCCUUGCGUCUUCUACCG-3' (SEQ ID NO: 202), 5'-FA-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-3' (SEQ ID NO: 202), 5'-DCL-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-3' (SEQ ID NO: 202), 5'-UAMC1110-GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-3' (SEQ ID NO: 202), 6WJ-B: 5'-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-3' (SEQ ID NO: 207), 5'-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCCGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 208), 5'-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCCGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 209), 5'-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCCGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 210), 5'-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCCCAGAACGUAUACUAUUCUG-3' (SEQ ID NO: 211), 5'-GalNAc-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-3' (SEQ ID NO: 207), 5'-FA CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-3' (SEQ ID NO: 207), 5'-DCL CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-3' (SEQ ID NO: 207), 5'-UAMC1110-CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-3' (SEQ ID NO: 207), 6WJ-C: 5'-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-3' (SEQ ID NO: 212), 5'-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACAGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 213), 5'-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACAGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 214), 5'-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACAGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 215), 5'-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACACAGAACGUAUACUAUUCUG 3' (SEQ ID NO: 216), 5'-GalNAc-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-3' (SEQ ID NO: 212), 5'-FA GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-3' (SEQ ID NO: 212), 5'-DCL-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-3' (SEQ ID NO: 212), 5'-UAMC1110-GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-3' (SEQ ID NO: 212), 6WJ-D: 5'-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-3' (SEQ ID NO: 217), 5'-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUCGCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3' (SEQ ID NO: 218), 5'-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUCGGGACCGAAAAAGACCUGACUUCUAUACUAAGUCUACGUUUCCC-3' (SEQ ID NO: 219), 5'-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUCGCGACUGGUUACCCGGUCG-3' (SEQ ID NO: 220), 5'-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUCCAGAACGUAUACUAUUCUG-3' (SEQ ID NO: 221), 5'-GalNAc-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-3' (SEQ ID NO: 217), 5'-FA-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-3' (SEQ ID NO: 217), 5'-DCL-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUACUC-3' (SEQ ID NO: 217), or 5'-UAMC1110-UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-3' (SEQ ID NO: 217).

[0049] 5'XXGYYAXGXGXAXGXGGG cholesterol-3' (SEQ ID NO: 222), 5'YYYAYAXAYXXXGXXGAXYY cholesterol-3' (SEQ ID NO: 223), 5'GGAXYAAXYAXGGYAA-cholesterol-3' (SEQ ID NO: 224), 5'XXAGGXAAAGYYAYYXGYAGGXGYXAYYGAXGXAAXXYAA-cholesterol-3' (SEQ ID NO: 225), 5'XXGAAXXAYAXYGGXAGYAYGGGYXGXGYGAGGYXGAAYAG-cholesterol-3' (SEQ ID NO: 226), 5'YXGXXYAGYYXYGYAYAGYYAGYAYGYAYYXGAAXAGG-cholesterol-3' (SEQ ID NO: 227), 5'YYXAXXYAGGXGYGXGYXGGGYXGYAGGXGGYXXXAYYXAA-cholesterol-3' (SEQ ID NO: 228), 5'GAGXAXAXGXXAGGYYXGGGXGAGXYYXXGYGXYXXYXAYYG-cholesterol-3' (SEQ ID NO: 229), 5'YGGXAGAAGAYGYAAGGAYXXGYXAGXXGXGGXAYXGXXYYY-cholesterol-3' (SEQ ID NO: 230), 5'GGGAAYAGXAYYAYAAYXAGXGXYYYGGGAXAGGGAYAXAYA-cholesterol-3' (SEQ ID NO: 231), 5'XGXAXGXYYYXAXYYYGGGAXGYYYAGGYYXAAYAXAXAYXY-cholesterol-3' (SEQ ID NO: 232), where X is floxuridine (5-fluorodeoxyuridine, UB5F) and Y is gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF).

[0050] In some embodiments, the disclosed RNA oligonucleotides have one of the following sequences: 5'UUGYYAUGUGUAUGUGGG cholesterol-3' (SEQ ID NO: 233), 5'YYYAYAUAYUUUGUUGAUYY cholesterol-3' (SEQ ID NO: 234), 5'GGAUYAAUYAUGGYAA cholesterol-3' (SEQ ID NO: 235), 5'UUAGGUAAAGYYAYYUGYAGGUGYUAYYGAUGUAAUUYAA cholesterol-3' (SEQ ID NO: 236), 5'UUGAAUUAYAUYGGUAGYAYGGGYUGUGYGAGGYUGAAYAG cholesterol-3' (SEQ ID NO: 237), 5'YUGUUYAGYYUYGYAYAGYYAGYAYGYAYYUGAAUAGG cholesterol-3' (SEQ ID NO: 238), 5'YYUAUUYAGGUGYGUGYUGGGYUGYAGGUGGYUUUAYYUAA cholesterol-3' (SEQ ID NO: 239), 5'GAGUAUAUGUUAGGYYUGGGUGAGUYYUUGYGUYUUYUAYYG cholesterol-3' (SEQ ID NO: 240), 5'YGGUAGAAGAYGYAAGGAYUUGYUAGUUGUGGUAYUGUUYYY cholesterol-3' (SEQ ID NO: 241), 5'GGGAAYAGUAYYAYAAYUAGUGUYYYGGGAUAGGGAYAUAYA cholesterol-3' (SEQ ID NO: 242), 5'UGUAUGUYYYUAUYYYGGGAUGYYYAGGYYUAAYAUAUAYUY cholesterol-3' (SEQ ID NO: 243), where Y is gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF).

[0051] 5'XXGCCAXGXGXAXGXGGG-cholesterol-3' (SEQ ID NO: 244), 5'CCCACAXACXXXGXXGAXCC-cholesterol-3' (SEQ ID NO: 245), 5'GGAXCAAXCAXGGCAA-cholesterol-3' (SEQ ID NO: 246), 5'XXAGGXAAAGCCACCXGCAGGXGCXACCGAXGXAAXXCAA-cholesterol-3' (SEQ ID NO: 247), 5'XXGAAXXACAXCGGXAGCACGGGCXGXGCGAGGCXGAACAG-cholesterol-3' (SEQ ID NO: 248), 5'CXGXXCAGCCXCGCACAGCCAGCACGCACCXGAAXAGG-cholesterol-3' (SEQ ID NO: 249), 5'CCXAXXCAGGXGCGXGCXGGGCXGCAGGXGGCXXXACCXAA-cholesterol-3' (SEQ ID NO: 250), 5'GAGXAXAXGXXAGGCCXGGGXGAGXCCXXGCGXCXXCXACCG-cholesterol-3' (SEQ ID NO: 251), 5'CGGXAGAAGACGCAAGGACXXGCXAGXXGXGGXACXGXXCCC-Cholesterol-3' (SEQ ID NO: 252), 5'GGGAACAGXACCACAACXAGXGXCCCGGGAXAGGGACAXACA-cholesterol-3' (SEQ ID NO: 253), 5'XGXAXGXCCCXAXCCCGGGAXGCCCAGGCCXAACAXAXACXC-cholesterol-3' (SEQ ID NO: 254), where X is floxuridine (5-fluorodeoxyuridine, UB5F).

[0052] 5'UUGCCAUGUGUAUGUGGG-cholesterol-3' (SEQ ID NO: 255), 5'CCCACAUACUUUGUUGAUCC-cholesterol-3' (SEQ ID NO: 256), 5'GGAUCAAUCAUGGCAA-cholesterol-3' (SEQ ID NO: 257), 5'UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA-cholesterol-3' (SEQ ID NO: 258), 5'UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG-cholesterol-3' (SEQ ID NO: 259), 5'CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGG-cholesterol-3' (SEQ ID NO: 260), 5'CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA-cholesterol-3' (SEQ ID NO: 261), 5'GAGUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG-cholesterol-3' (SEQ ID NO: 262), 5'CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC-cholesterol-3' (SEQ ID NO: 263), 5'GGGAACAGUACCACAACUAGUGUCCCGGGAUAGGGACAUACA-cholesterol-3' (SEQ ID NO: 264), 5'UGUAUGUCCCUAUCCCGGGAUGCCCAGGCCUAACAUAUACUC-cholesterol-3' (SEQ ID NO: 265), Survivin-Sense with extension 5'XXGYAGGXXYYXXAXYXGXYAXXAYAXAYAYYYX-cholesterol-3' (SEQ ID NO: 266), 5'UUGYAGGUUYYUUAUYUGUYAUUAYAUAYAYYYU-cholesterol-3' (SEQ ID NO: 267), 5'XXGCAGGXXCCXXAXCXGXCAXXACAXACCCX-cholesterol-3' (SEQ ID NO: 268), 5'UUGCAGGUUCCUUAUCUGUCAUUACAUACACCCU-cholesterol-3' (SEQ ID NO: 269).

[0053] RRM2-Sense with extension 5'XXGYGAXXXAGYYAAGAAGXXYAXXAYAXAYAYYYX-cholesterol-3' (SEQ ID NO: 270), 5'UUGYGAUUUAGYYAAGAAGUUYAUUAYAUAYYYYU-cholesterol-3' (SEQ ID NO: 271), 5'XXGCGAXXXAGCCAAGAAGXXCAXXACAXACACCCX-cholesterol-3' (SEQ ID NO: 272), 5'UUGCGAUUUAGCCAAGAAGUUCAUUACAUACACCCU-cholesterol-3' (SEQ ID NO: 273), where X is floxuridine (5-fluorodeoxyuridine, UB5F), Y is gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF), C,U is 2F'-modified C,U, and A,G are unmodified.

[0054] Survivin-antisense 5'UGACAGAUAAGGAACCUGC 3' (SEQ ID NO: 1).

[0055] RRM2-antisense 5'UGAACUUCUUGGCUAAAUCGC 3' (SEQ ID NO: 3).

[0056] Survivin-antisense-extension 5'GGGUGUAUGUAAUGACAGAUAAGGAACCUGC 3' (SEQ ID NO: 4).

[0057] RRM2-antisense 5'GGGUGUAUGUAAUGAACUUCUUGGCUAAAUCGC 3' (SEQ ID NO: 2),

[0058] extension 5'GGGUGUAUGUAA 3' (SEQ ID NO: 5), where A, C, G, and U are unmodified.

[0059] Modular RNA nanostructures can be composed of 3, 4, 5, 6, 7, 8, 9, or more synthetic single-stranded RNA oligonucleotides that can self-assemble through hybridization to form an RNA nanostructure. Each synthetic single-stranded RNA oligonucleotide can be approximately 16 to approximately 120 bases in length. The precise sequence of each synthetic single-stranded RNA oligonucleotide in each modular RNA nanostructure can be designed to achieve specific physical properties when combined with two or more other synthetic single-stranded RNA oligonucleotides. RNA nanostructures can be composed of 3, 4, 5, 6, 7, 8, 9, or more synthetic RNA oligonucleotides. The synthetic RNA oligonucleotides can be designed to form highly ordered two- and / or three-dimensional structures upon self-assembly. RNA nanostructures can have 3, 4, 5, 6, 7, 8, 9, or more double-stranded arms (DAs) branching from a core domain. The DAs can be arranged symmetrically or asymmetrically around the core domain.

[0060] The core domain can have 0 to 4 symmetric or asymmetric bulge nucleotides separating individual DAs, which can allow for optimization of the thermodynamic stability, steric constraints, and / or structural configuration of individual loops. Variations in the duplex sequence (DA) and the number of unpaired core nucleotides both affect the thermodynamic stability of the RNA nanostructure. Therefore, varying the sequence of the synthetic RNA oligonucleotides that form the RNA nanostructure can optimize its physical and functional properties.

[0061] The melting temperature (Tm) of an RNA nanostructure can be greater than or equal to about 65° C. In some embodiments, the melting temperature of an RNA nanostructure can be greater than 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some embodiments, the Tm of an RNA nanostructure can be 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C.

[0062] The synthetic RNA oligonucleotides can be single-stranded. Each individual synthetic RNA oligonucleotide can be composed of 16 to 120 nucleotides. These nucleotides can be natural ribonucleotides or can be modified. In some embodiments, the synthetic RNA oligonucleotide(s) can be modified at the 2' position. The 2' position or other modifications can be 2'fluoro-, 2'O-methyl-, LNA-, or any other backbone-, sugar-, or base-modified ribonucleotides, or any combination of natural ribonucleotides and backbone-, sugar-, and base-modified ribonucleotides. Modifications are described in more detail elsewhere herein. Each synthetic RNA oligonucleotide was 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133 Each synthetic RNA oligonucleotide can be designed and configured to self-assemble with 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 120 nucleotides, or any range therein. Each synthetic RNA oligonucleotide can be designed and configured to self-assemble with 2, 3, 4, 5, 6, 7, 8, or more other synthetic RNA oligonucleotides to form an RNA nanostructure as described herein.

[0063] In addition to the nucleoside analogs described herein, the remaining nucleotides can be unmodified or modified. The modifications can be 5'-terminal and / or 3'-terminal and / or 2'-internal sugar and / or base internal modifications. Typical 5'-terminal modifications include amino, carboxy, phosphate, thiol, maleimide, alkyne, cholesterol, aldehyde, carbon spacer, PEG spacer, doubler, trebler, photocleavable amino, photocleavable spacer, fluorophore (e.g., cyanine 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, desthiobiotin, digoxigenin, quencher (e.g., dabsyl, dabsyl, black hole, BBQ650, etc.), or other 5'-modifications known to those skilled in the art. Typical 3'-end modifications include amino, carboxy, phosphate, thiol, alkyne, cholesterol, carbon spacer, PEG spacer, fluorophore (e.g., cyanine 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, desthiobiotin, digoxigenin, quencher (dabsyl, dabsyl, blackhole, BBQ650, etc.), or other 3' modifications known to those of skill in the art. Exemplary internal modifications include amino-dA, amino-dC, amino-dT, carboxy-dT, 2'O-propargyl, 2'amino, 2'fluoro, 2'methoxy, 5-ethynyl-dU, C8-alkyne-dC, C8-alkyne-dT, carbon spacers, PEG spacers, fluorophores (e.g., cyanine 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, desthiobiotin, digoxigenin, quenchers (dabcyl, dabcyl, blackhole, BBQ650, etc.), or other 5' modifications known to those skilled in the art. The modification may be an alkyne group added to the nucleotide. The modification may also be a functional group added to the nucleotide. In synthetic RNA oligonucleotides, one or more of the terminal (e.g., 5'- and / or 3'-terminal) nucleotides may be modified.

[0064] The RNA nanostructure can have a size of up to 1 micrometer when measured along its longest or largest dimension. The size of the RNA nanostructure can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 56, 900nm。 It can be 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, or about 900nm. In some embodiments, the size of the RNA nanostructure, as measured along its longest or largest dimension, is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 8, 49, 50, 51, 52, 53, 54, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nm, or any range of values ​​therein. In some embodiments, the size of the RNA nanostructure, as measured along its longest or largest dimension, can be about 1 to 30, about 1 to 40, about 1 to 50, about 10 to 50, about 10 to 40, about 10 to 30, about 30 to 50, about 30 to 40, or about 40 to 50. In some embodiments, the RNA nanostructure can be approximately spherical.In other embodiments, the RNA nanostructure can be triangular planar, triangular pyramidal, T-shaped, tetrahedral, square planar, seesaw, trigonal bipyramid, square pyramidal, pentagonal planar, octahedral, triangular prism, pentagonal pyramidal, pentagonal bipyramid, square antipyramid, triple-coated triangular prism, coated square antipyramid, arrowhead, arrowtail, X-shaped, or a distorted version of any of these shapes.

[0065] The principle for designing self-assembling nucleic acid nanostructures is that the sequence complementarity of nucleic acid strands is encoded, so that the nucleic acid strands self-assemble into predetermined nanostructures under appropriate physical conditions by pairing complementary segments. Based on this basic principle (see, for example, Seeman NCJ Theor. Biol. 99:237, 1982, which is incorporated herein by reference), researchers have created a variety of synthetic nucleic acid nanostructures (see, for example, Seeman NC Nature 421:427, 2003 and Shih WM et al. Curr. Opin. Struct. Biol. 20:276, 2010, each of which is incorporated herein by reference).Examples of nucleic acid (e.g., DNA) nanostructures that can be used in accordance with the present disclosure and methods for making such structures are known and include lattice-like structures (see, e.g., Winfree E. et al. Nature 394:539, 1998; Yan H. et al. Science 301:1882, 2003; Yan H. et al. Proc. Natl. Acad. of Sci. USA 100:8103, 2003; Liu D. et al. J. Am. Chem. Soc. 126:2324, 2004; and Rothemund PWK et al. PLoS Biology 2:2041, 2004, each of which is incorporated herein by reference), ribbon-like structures (see, e.g., Park SH et al. Nano Let. 5:729, 2005; Yin P. et al. Science 301:1882, 2003; Yan H. et al. Proc. Natl. Acad. of Sci. USA 100:8103, 2003; Liu D. et al. J. Am. Chem. Soc. 126:2324, 2004; and Rothemund PWK et al. PLoS Biology 2:2041, 2004, each of which is incorporated herein by reference), and other nanostructures. 321:824, 2008), tubular (see, e.g., Yan H. Science, 2003; P. Yin, 2008, which are incorporated herein by reference), finite two-dimensional and three-dimensional objects with defined shapes (see, e.g., Chen J. et al. Nature 350:631, 1991; Rothemund PWK Nature, 2006; He Y. et al. Nature 452:198, 2008; Ke Y. et al. Nano. Lett. 9:2445, 2009; Douglas SM et al. Nature 459:414, 2009; Dietz H. et al. Science 325:725, 2009; Andersen E. Set al. Nature 459:73, 2009; Liedl T. et al. Nature, 2009, each of which is incorporated herein by reference). Nanotech. 5:520, 2010, and Han D. et al. Science 332:342, 2011), and macroscopic crystalline forms (see, for example, Meng JP et al. Nature 461:74, 2009, which is incorporated herein by reference).The synthetic RNA oligonucleotides can be single-stranded nucleic acids, double-stranded nucleic acids, or a combination of single-stranded and double-stranded nucleic acids.

[0066] The components of RNA nanostructures (synthetic RNA oligonucleotides and modular RNA motifs) can be designed using the computer-aided design methods described herein. While the computer design is demonstrated using specific RNA nanostructures, it will be understood that one of skill in the art can extrapolate the principles taught therein to any desired RNA nanostructure.

[0067] Each synthetic RNA oligonucleotide can be designed to generate highly ordered two- and three-dimensional structures in which base pairing occurs when combined with two or more additional synthetic RNA oligonucleotides, with three or more DAs surrounding a core domain that may or may not include interstrand base pairing, or can contain 0 to 4 nucleotides that form symmetric or asymmetric bulges between the DAs. Each synthetic RNA oligonucleotide can be designed to contain 16 to 120 nucleotides. Each synthetic RNA oligonucleotide can be designed to contain one or more modified nucleotides.

[0068] The rational design of synthetic RNA oligonucleotides and / or RNA nanostructures described herein can be implemented in a computing environment. The computing environment can include one or more computing devices that can include at least one processor circuit, and the computing device can have, for example, a processor and memory. In accordance with various aspects of the present disclosure, various applications and / or other functions can also be executed in the computing environment. Various data can also be stored in one or more data stores accessible to the computing environment.

[0069] Components executing on the computing environment can include, for example, a rational RNA design system and other applications, services, processes, systems, engines, or functions not described in detail herein. The rational RNA design system can be executed to facilitate the design of synthetic RNA oligonucleotides and / or RNA nanostructures described herein. The rational RNA design system can also perform various back-end functions that can be associated with the design of RNA oligonucleotides, such as the synthetic RNA oligonucleotides and / or RNA nanostructures described herein.

[0070] This synthetic RNA oligonucleotide can be synthesized using standard molecular biology and biochemistry techniques.In other words, various nucleic acids that can form RNA nanoparticles can be synthesized de novo as desired.Such synthesis techniques will be known to those skilled in the art.

[0071] Pharmaceutical preparations Also provided herein are pharmaceutical formulations that can include an amount of the RNA complexes or nanostructures described herein and a pharmaceutical carrier suitable for administration to an individual in need thereof. The individual in need thereof can have or be suspected of having cancer or other disease or disorder that requires treatment or prevention. In some embodiments, the subject in need thereof is in need of a diagnostic procedure, such as an imaging procedure. The pharmaceutical formulation can include an amount of the RNA complexes or nanostructures described herein that can be effective in treating or preventing cancer.

[0072] The formulations can be administered via any suitable route of administration. For example, the formulations (and / or compositions) can be administered to a subject in need thereof orally, intravenously, intraocularly, intraocularly, intramuscularly, intravaginally, intraperitoneally, rectally, parenterally, topically, intranasally, or subcutaneously. Other suitable routes are described herein. In some embodiments, the RNA complex or nanostructure comprises an effective amount of a cargo molecule.

[0073] The RNA complexes or nanostructures can be formulated in the form of a solution or suspension for parenteral administration, such as by injection or infusion. The formulations can be administered via any route, including administration into the bloodstream or directly into the organ or tissue to be treated.

[0074] Parenteral formulations can be prepared as aqueous compositions using techniques known in the art.Typically, such compositions can be prepared as injectable preparations, for example, as solutions or suspensions, as solid forms suitable for use in preparing solutions or suspensions when adding a reconstitution medium before injection, as emulsions such as water-in-oil (w / o) emulsions, oil-in-water (o / w) emulsions, and microemulsions thereof, liposomes, or emulsomes.

[0075] The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, one or more polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), oils such as vegetable oils (e.g., peanut oil, corn oil, sesame oil, etc.), and combinations thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and / or by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars or sodium chloride.

[0076] Solutions and dispersions of the RNA nanostructures described herein can be prepared in water or another solvent or dispersion medium, suitably mixed with one or more pharmaceutically acceptable excipients, including, but not limited to, surfactants, dispersing agents, emulsifying agents, pH adjusters, and combinations thereof.

[0077] Suitable surfactants can be anionic, cationic, amphoteric, or nonionic surfactants. Suitable anionic surfactants include, but are not limited to, those containing carboxylate, sulfonate, or sulfate ions. Suitable anionic surfactants include sodium, potassium, and ammonium long-chain alkyl and alkylaryl sulfonates, such as sodium dodecylbenzenesulfonate; dialkyl sodium sulfosuccinates, such as sodium bis-(2-ethylthio)-sulfosuccinate; and alkyl sulfates, such as sodium lauryl sulfate. Suitable cationic surfactants include, but are not limited to, quaternary ammonium compounds, such as benzalkonium chloride, benzethonium chloride, cetrimonium bromide, stearyldimethylbenzylammonium chloride, polyoxyethylene, and coconut amine. Suitable nonionic surfactants include ethylene glycol monostearate, propylene glycol myristate, glyceryl monostearate, glyceryl stearate, polyglyceryl-4-oleate, sorbitan acylate, sucrose acylate, PEG-150 laurate, PEG-400 monolaurate, polyoxyethylene monolaurate, polysorbate, polyoxyethylene octylphenyl ether, PEG-1000 cetyl ether, polyoxyethylene tridecyl ether, polypropylene glycol butyl ether, Poloxamer® 401, stearoyl monoisopropanolamide, and polyoxyethylene hydrogenated tallow amide. Examples of amphoteric surfactants include sodium N-dodecyl-β-alanine, sodium N-lauryl-β-iminodipropionate, myristoamphoacetate, lauryl betaine, and lauryl sulfobetaine.

[0078] The preparation can contain a preservative to prevent the growth of microorganisms.Suitable preservatives include, but are not limited to, parabens, chlorobutanol, phenol, sorbic acid, and thimerosal.The preparation can also contain an antioxidant to prevent the degradation of the RNA complex or nanostructure.

[0079] Upon reconstitution, the formulation may be buffered for parenteral administration to a pH of 3 to 8. Suitable buffers include, but are not limited to, phosphate buffers, acetate buffers, and citrate buffers.

[0080] Water-soluble polymers can be used in formulations for parenteral administration. Suitable water-soluble polymers include, but are not limited to, polyvinylpyrrolidone, dextran, carboxymethylcellulose, and polyethylene glycol. Sterile injectable solutions can be prepared by incorporating the RNA complexes or nanostructures in the required amount in an appropriate solvent or dispersion medium, optionally with one or more of the excipients listed above, followed by filter sterilization. Dispersions can be prepared by incorporating various sterilized RNA complexes or nanostructures into a sterile vehicle containing a basic dispersion medium and other required ingredients from those listed above. Sterile powders for preparing sterile injectable solutions can be prepared by vacuum drying and freeze-drying techniques, which yield a powder of the RNA complexes or nanostructures and any additional desired ingredients from a previously sterile-filtered solution. These powders can actually be prepared in a way that the particles have porous properties, thereby increasing their solubility. Methods for producing porous particles are well known to those skilled in the art.

[0081] Pharmaceutical formulations for parenteral administration can be in the form of a sterile aqueous solution or suspension of particles formed from one or more RNA complexes or nanostructures. Acceptable solvents include, for example, water, Ringer's solution, phosphate-buffered saline (PBS), and isotonic sodium chloride solution. The formulation can also be a sterile solution, suspension, or emulsion in a non-toxic, parenterally acceptable diluent or solvent, such as 1,3-butanediol.

[0082] In some cases, the formulation may be distributed or packaged in liquid form. In other embodiments, formulations for parenteral administration may be packaged as solid formulations, obtained, for example, by lyophilization of a suitable liquid formulation, which can be reconstituted with a suitable carrier or diluent prior to administration.

[0083] Solutions, suspensions, or emulsions for parenteral administration can be buffered with an effective amount of buffering agent necessary to maintain a pH suitable for intraocular administration. Suitable buffers include, but are not limited to, acetate, borate, carbonate, citrate, and phosphate buffers.

[0084] Solutions, suspensions, or emulsions for parenteral administration may also contain one or more tonics to adjust the isotonic range of the formulation. Suitable tonics include, but are not limited to, glycerin, mannitol, sorbitol, sodium chloride, and other electrolytes.

[0085] Solutions, suspensions, or emulsions for parenteral administration may also contain one or more preservatives to prevent bacterial contamination of the ophthalmic preparation. Suitable preservatives include, but are not limited to, polyhexamethylene biguanidine (PHMB), benzalkonium chloride (BAK), stabilized oxychloro complexes (also known as Purite®), phenylmercuric acetate, chlorobutanol, sorbic acid, chlorhexidine, benzyl alcohol, parabens, thimerosal, and mixtures thereof.

[0086] Solutions, suspensions, or emulsions for using nanotechnology, including nanoformulations for parenteral administration, can also contain one or more excipients such as dispersing agents, wetting agents, and suspending agents.

[0087] The RNA complexes or nanostructures described herein can be formulated for topical administration. Suitable dosage forms for topical administration include creams, ointments, salves, sprays, gels, lotions, emulsions, solutions, and transdermal patches. The formulations can be formulated for transmucosal, transepithelial, transendothelial, or transdermal administration. These topical formulations can include one or more chemical penetration enhancers, membrane permeabilizers, membrane transport agents, emollients, surfactants, stabilizers, and combinations thereof.

[0088] In some embodiments, the RNA complexes or nanostructures can be administered as a liquid formulation, such as a solution or suspension, a semi-solid formulation, such as a lotion or ointment, or a solid formulation. In some embodiments, the RNA nanostructures can be formulated as liquid formulations, including solutions or suspensions, such as eye drops, or as semi-solid formulations, such as ointments or lotions for topical administration to the skin, mucous membranes such as the eye, vaginally, or rectally.

[0089] The formulation may include one or more excipients such as emollients, surfactants, emulsifiers, and penetration enhancers.

[0090] Suitable emollients include, but are not limited to, almond oil, castor oil, carob extract, cetostearyl alcohol, cetyl alcohol, cetyl esters wax, cholesterol, cottonseed oil, cyclomethicone, ethylene glycol palmitostearate, glycerin, glycerin monostearate, glyceryl monooleate, isopropyl myristate, isopropyl palmitate, lanolin, lecithin, light mineral oil, medium-chain triglycerides, mineral oil and lanolin alcohol, petrolatum, petrolatum and lanolin alcohol, soybean oil, starch, stearyl alcohol, sunflower oil, xylitol, and combinations thereof. In some embodiments, these emollients can be ethylhexyl stearate and ethylhexyl palmitate.

[0091] Suitable surfactants include, but are not limited to, emulsifying wax, glyceryl monooleate, polyoxyethylene alkyl ethers, polyoxyethylene castor oil derivatives, polysorbates, sorbitan esters, benzyl alcohol, benzyl benzoate, cyclodextrins, glyceryl monostearate, poloxamer, povidone, and combinations thereof. In some embodiments, the surfactant can be stearyl alcohol.

[0092] Suitable emulsifiers include acacia, metallic soaps, certain animal and vegetable oils, various polar compounds, anionic emulsifying wax, calcium stearate, carbomer, cetostearyl alcohol, cetyl alcohol, cholesterol, diethanolamine, ethylene glycol palmitostearate, glycerin monostearate, glyceryl monooleate, hydroxypropyl cellulose, hypromellose, hydrous lanolin, lanolin alcohol, lecithin, medium chain triglycerides, methylcellulose, mineral oil and lanolin alcohol, monobasic sodium hydrogen phosphate, monosodium phosphate, methylcellulose ... These emulsifiers include, but are not limited to, ethanolamine, nonionic emulsifying wax, oleic acid, poloxamer, poloxamers, polyoxyethylene alkyl ether, polyoxyethylene castor oil derivatives, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, propylene glycol alginate, self-emulsifying glycerin monostearate, sodium citrate dihydrate, sodium lauryl sulfate, sorbitan esters, stearic acid, sunflower oil, tragacanth, triethanolamine, xanthan gum, and combinations thereof. In some embodiments, the emulsifier can be glycerol stearate.

[0093] Suitable classes of penetration enhancers include, but are not limited to, fatty alcohols, fatty acid esters, fatty acids, fatty alcohol ethers, amino acids, phospholipids, lecithin, cholate salts, enzymes, amines and amides, complexing agents (liposomes, cyclodextrins, modified cellulose, and diimides), macrocyclic compounds such as macrocyclic lactones, ketones, and anhydrides, and cyclic ureas, surfactants, N-methylpyrrolidone and its derivatives, DMSO and related compounds, ionic compounds, azone and related compounds, and solvents such as alcohols, ketones, amides, polyols (e.g., glycols).

[0094] Suitable emulsions include, but are not limited to, water-in-oil emulsions and oil-in-water emulsions. Either or both phases of these emulsions can contain a surfactant, an emulsifier, and / or a non-volatile non-aqueous liquid substance. In some embodiments, the surfactant can be a non-ionic surfactant. In other embodiments, the emulsifier is an emulsifying wax. In further embodiments, the non-volatile non-aqueous liquid substance is a glycol. In some embodiments, the glycol is propylene glycol. The oil phase can contain other suitable oily pharmaceutically acceptable excipients. Suitable oily pharmaceutically acceptable excipients include, but are not limited to, hydroxylated castor oil or sesame oil, which can be used in the oil phase as a surfactant or emulsifier.

[0095] Also provided is a lotion containing the RNA nanostructure described herein. In some embodiments, the lotion can be in the form of an emulsion having a viscosity of 100 to 1000 centistokes. The lotion's fluidity allows for quick and even application over a wide area. The lotion can be formulated to dry on the skin, leaving a thin film of the active ingredient on the surface of the skin.

[0096] Also provided are creams containing the RNA complexes or nanostructures described herein. The creams may contain emulsifiers and / or other stabilizers. In some embodiments, the creams are in the form of a cream having a viscosity greater than 1,000 centistokes, typically in the range of 20,000 to 50,000 centistokes. Creams are easier to spread and remove than ointments.

[0097] One difference between creams and lotions is viscosity, which depends on the amount / amount of various oils used and the percentage of water used in preparing the formulation. Creams can be thicker than lotions, have a wider range of uses, and can contain a wider variety of oils / butters depending on the desired skin effect. In some embodiments of cream formulations, the water base may be about 60% to about 75% of the total, the oil base may be about 20% to about 30% of the total, and the remaining percentages may be emulsifiers, preservatives, and additives, totaling 100%.

[0098] Also provided is an ointment comprising the RNA complex or nanostructure described herein and a suitable ointment base.Suitable ointment bases include hydrocarbon bases (e.g., petrolatum, white petrolatum, yellow ointment, and mineral oil), absorbent bases (e.g., hydrophilic petrolatum, anhydrous lanolin, lanolin, and cold cream), water-removing bases (e.g., hydrophilic ointments), and water-soluble bases (e.g., polyethylene glycol ointments).Pastes typically differ from ointments in that they contain a higher proportion of solid components.Pastes generally have higher absorption and are less sticky than ointments prepared with the same ingredients.

[0099] Also described herein are gels comprising the RNA complexes or nanostructures described herein, a gelling agent, and a liquid vehicle. Suitable gelling agents include, but are not limited to, modified celluloses such as hydroxypropyl cellulose and hydroxyethyl cellulose, carbopol homopolymers and copolymers, thermoreversible gels, and combinations thereof. Suitable solvents in the liquid vehicle include, but are not limited to, alkylene glycols such as diglycol monoethyl ether and propylene glycol, and alcohols such as dimethyl isosorbide, isopropyl alcohol, and ethanol. These solvents can be selected based on their ability to dissolve the drug. Other additives that can improve the feel and / or emollient properties of the formulation on the skin can also be incorporated. Such additives include, but are not limited to, isopropyl myristate, ethyl acetate, C12-C15 alkyl benzoates, mineral oil, squalane, cyclomethicone, capric / caprylic triglyceride, and combinations thereof.

[0100] Also described herein are foams that can contain the RNA complexes or nanostructures described herein. The foams can be emulsions combined with a gaseous propellant. The gaseous propellant can include a hydrofluoroalkane (HFA). Suitable propellants include HFAs such as 1,1,1,2-tetrafluoroethane (HFA 134a) and 1,1,1,2,3,3,3-heptafluoropropane (HFA 227), although mixtures and blends thereof, as well as other HFAs currently approved or that may be approved for medical use, are suitable. The propellant can be free of hydrocarbon propellant gases that may generate flammable or explosive vapors during spraying. Additionally, the foams can be free of volatile alcohols that may generate flammable or explosive vapors during use.

[0101] A buffering agent can be used to control the pH of the composition. The buffering agent can buffer the composition to a pH of about 4 to about 7.5, about 4 to about 7, or about 5 to about 7. In some embodiments, the buffering agent can be triethanolamine.

[0102] Preservatives can be included to prevent the growth of fungi and microorganisms. Suitable preservatives include, but are not limited to, benzoic acid, butylparaben, ethylparaben, methylparaben, propylparaben, sodium benzoate, sodium propionate, benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, and thimerosal.

[0103] In certain embodiments, the formulations can be provided via continuous administration of one or more formulations to a patient in need thereof. Topical applications can be applied repeatedly, or patches can be used to administer the noscapine analog continuously over an extended period of time.

[0104] The RNA complexes or nanostructures described herein can be prepared as enteral formulations, such as for oral administration. Suitable oral dosage forms include tablets, capsules, solutions, suspensions, syrups, and lozenges. Tablets can be manufactured using compression or molding techniques well known in the art. Gelatin or non-gelatin capsules can be prepared using techniques well known in the art as hard or soft capsule shells that can contain liquid, solid, and semi-solid fill materials.

[0105] Formulations containing the RNA complexes or nanostructures described herein can be prepared using pharmaceutically acceptable carriers. As used generally herein, the term "carrier" includes, but is not limited to, diluents, preservatives, binders, lubricants, disintegrants, swelling agents, fillers, stabilizers, and combinations thereof. Polymers used in dosage forms include, but are not limited to, suitable hydrophobic or hydrophilic polymers, and suitable pH-dependent or pH-independent polymers. Suitable hydrophobic and hydrophilic polymers include, but are not limited to, hydroxypropylmethylcellulose, hydroxypropylcellulose, hydroxyethylcellulose, carboxymethylcellulose, polyethylene glycol, ethylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, polyvinyl alcohol, polyvinyl acetate, and ion exchange resins. The term "carrier" also includes all components of coating compositions, which may include plasticizers, pigments, colorants, stabilizers, and lubricants.

[0106] Formulations comprising the RNA complexes or nanostructures described herein can be prepared using one or more pharmaceutically acceptable excipients, including diluents, preservatives, binders, lubricants, disintegrants, swelling agents, fillers, stabilizers, and combinations thereof.

[0107] Delayed-release formulations containing the RNA complexes or nanostructures described herein can be prepared as described in standard references such as "Pharmaceutical Dosage Form Tablets" (eds. Liberman et al., (New York, Marcel Dekker, Inc., 1989)), "Remington - The Science and Practice of Pharmacy" (20th ed., Lippincott Williams & Wilkins, Baltimore, MD, 2000), and "Pharmaceutical Dosage Forms and Drug Delivery Systems" (6th Edition, Ansel et al., (Media, PA: Williams and Wilkins, 1995)). These references provide information on excipients, materials, equipment, and processes for preparing tablets and capsules, as well as carriers, materials, equipment, and processes for preparing tablets, capsules, and granules.

[0108] Formulations containing the RNA complexes or nanostructures described herein can be coated with a suitable coating material, for example, to delay release after the particles have passed through the acidic environment of the stomach. Suitable coating materials include, but are not limited to, cellulosic polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and hydroxypropyl methylcellulose acetate succinate, polyvinyl acetate phthalate, acrylic acid polymers and copolymers, and methacrylic resins commercially available under the trade name EUDRAGIT® (Roth Pharma, Westerstadt, Germany), zein, shellac, and polysaccharides.

[0109] Coatings can be formed with different ratios of water-soluble polymers, water-insoluble polymers, and / or pH-dependent polymers, with or without water-insoluble / water-soluble non-polymeric excipients, to create the desired release profile. Coatings can be applied to dosage forms (matrix or simple), including, but not limited to, tablets (compressed with or without coated beads), capsules (with or without coated beads), beads, particle compositions, and "neat drug substance" formulated as, but not limited to, a suspension or sprinkle dosage form.

[0110] Additionally, the coating material may include conventional carriers such as plasticizers, pigments, colorants, lubricants, stabilizers, pore-forming agents, and surfactants. Optional pharmaceutically acceptable excipients include, but are not limited to, diluents, binders, lubricants, disintegrants, colorants, stabilizers, and surfactants.

[0111] Diluents, also known as "fillers," can be used to increase the bulk of solid dosage forms to provide a practical size for tablet compression or bead or granule formation. Suitable diluents include, but are not limited to, dicalcium phosphate dihydrate, calcium sulfate, lactose, sucrose, mannitol, sorbitol, cellulose, microcrystalline cellulose, kaolin, sodium chloride, dry starch, hydrolyzed starch, pregelatinized starch, silicon dioxide, titanium oxide, magnesium aluminum silicate, and powdered sugar. Typical diluents include inert powdered substances such as starch, powdered cellulose, especially crystalline and microcrystalline cellulose, sugars such as fructose, mannitol, and sucrose, grain flours, and similar edible powders. Typical diluents include, for example, various starches, lactose, mannitol, kaolin, calcium phosphate or sulfate, inorganic salts such as sodium chloride, and powdered sugar. Powdered cellulose derivatives are also useful.

[0112] Binders can impart cohesive properties to solid dosage formulations, thereby ensuring that tablets, beads, or granules remain intact after formation into a dosage form. Suitable binder materials include, but are not limited to, starch, pregelatinized starch, gelatin, sugars (including sucrose, glucose, dextrose, lactose, and sorbitol), polyethylene glycol, waxes, natural or synthetic gums (such as acacia, tragacanth, and sodium alginate), cellulose (including hydroxypropylmethylcellulose, hydroxypropylcellulose, ethylcellulose, and Veegum), and synthetic polymers (such as acrylic and methacrylic acid copolymers, methacrylic acid copolymers, methyl methacrylate copolymers, aminoalkyl methacrylate copolymers, polyacrylic acid / polymethacrylic acid, polyvinylpyrrolidone, and the like). Representative tablet binders include substances such as starch, gelatin, and sugars such as lactose, fructose, and glucose. Natural and synthetic gums can also be used, such as acacia, alginate, methylcellulose, and polyvinylpyrrolidone.Polyethylene glycol, hydrophilic polymers, ethylcellulose, and waxes can also function as binders.

[0113] Lubricants can be included to facilitate tablet production. Suitable lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, glycerol behenate, polyethylene glycol, talc, and mineral oil. Lubricants can be included in tablet formulations to prevent the tablet and die from sticking in the die press. Lubricants can be selected from slippery solids such as talc, magnesium stearate, calcium stearate, stearic acid, and hydrogenated vegetable oils.

[0114] Disintegrants can be used to facilitate the breakup or "disintegration" of the dosage form after administration and generally include, but are not limited to, starch, sodium starch glycolate, sodium carboxymethyl starch, sodium carboxymethyl cellulose, hydroxypropyl cellulose, pregelatinized starch, clay, cellulose, arginine, gums, or cross-linked polymers such as cross-linked PVP (Polyplasdone® XL from GAF Chemical Corp).

[0115] Stabilizers can be used to inhibit or retard drug decomposition reactions, including, for example, oxidative reactions. Suitable stabilizers include, but are not limited to, antioxidants, butylated hydroxytoluene (BHT), ascorbic acid, its salts and esters, vitamin E, tocopherol and its salts, sulfites such as sodium metabisulfite, cysteine ​​and its derivatives, citric acid, propyl gallate, and butylhydroxyanisole (BHA).

[0116] In some embodiments, a pharmaceutical formulation containing an RNA complex or nanostructure includes an amount of one or more additional active agents. Suitable additional active agents include, but are not limited to, DNA, RNA, modified ribonucleotides, amino acids, peptides, polypeptides, antibodies, aptamers, ribozymes, ribozyme guide sequences that inhibit the translation or transcription of essential tumor proteins and genes, hormones, immunomodulators, antipyretics, anxiolytics, antipsychotics, analgesics, anticonvulsants, anti-inflammatory agents, antihistamines, anti-infective agents, and chemotherapeutic agents (anti-cancer agents). Other suitable additional active agents include sensitizers (e.g., radiosensitizers). RNA nanostructures can be used as monotherapy or in combination with other active agents for the treatment or prevention of diseases or disorders.

[0117] Suitable hormones include, but are not limited to, amino acid-derived hormones (e.g., melatonin and thyroxine), small peptide and protein hormones (e.g., thyrotropin-releasing hormone, vasopressin, insulin, growth hormone, luteinizing hormone, follicle-stimulating hormone, thyroid-stimulating hormone), eicosanoids (e.g., arachidonic acid, lipoxins, and prostaglandins), and steroid hormones (e.g., estradiol, testosterone, tetrahydrotestosterone, cortisol).

[0118] Suitable immunomodulatory agents include, but are not limited to, prednisone, azathioprine, 6-MP, cyclosporine, tacrolimus, methotrexate, interleukins (e.g., IL-2, IL-7, and IL-12), cytokines (e.g., interferons (IFN-α, IFN-β, IFN-ε, IFN-κ, IFN-ω, and IFN-γ), granulocyte colony-stimulating factor, and imiquimod), chemokines (e.g., CCL3, CCL26, and CXCL7), cytosine phosphate-guanosine, oligodeoxynucleotides, glucans, antibodies, and aptamers.

[0119] Suitable analgesics include, but are not limited to, paracetamol / acetaminophen, nonsteroidal anti-inflammatory drugs (e.g., ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 inhibitors (e.g., rofecoxib, celecoxib, and etoricoxib), opioids (e.g., morphine, codeine, oxycodone, hydrocodone, dihydromorphine, pethidine, buprenorphine), tramadol, norepinephrine, flupiretin, nefopam, orphenadrine, pregabalin, gabapentin, cyclobenzaprine, scopolamine, methadone, ketobemidone, piritramide, and aspirin and related salicylates (e.g., choline salicylate, magnesium salicylate, and sodium salicylate).

[0120] Suitable antispasmodic agents include, but are not limited to, mebeverine, papverine, cyclobenzaprine, carisoprodol, orphenadrine, tizanidine, metaxalone, mesocarbamol, chlorzoxazone, baclofen, dantrolene, baclofen, tizanidine, and dantrolene.

[0121] Suitable anti-inflammatory agents include, but are not limited to, prednisone, nonsteroidal anti-inflammatory agents (e.g., ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 inhibitors (e.g., rofecoxib, celecoxib, and etoricoxib), and immunoselective anti-inflammatory derivatives (e.g., submandibular peptide-T and its derivatives).

[0122] Suitable antihistamines include H1 receptor antagonists (e.g., acrivastine, azelastine, bilastine, brompheniramine, buclizine, bromodiphenhydramine, carbinoxamine, cetirizine, chlorpromazine, cyclizine, chlorpheniramine, clemastine, cyproheptadine, desloratadine, dexbrompheniramine, dexchlorpheniramine, dimenhydrinate, dimethindene, diphenhydramine, doxylamine, ebastine, embramine, fexofenadine, hydroxybenzoates, Antihypertensive drugs include, but are not limited to, benzodiazepine, levocetirizine, loratadine, meclozine, mirtazapine, olopatadine, orphenadrine, phenindamine, pheniramine, phenyltoloxamine, promethazine, pyrilamine, quetiapine, rupatadine, tripelennamine, and triprolidine), H2 receptor antagonists (e.g., cimetidine, famotidine, lafutidine, nizatidine, lafitidine, and roxatidine), tritoqualine, catechin, cromoglycate, nedocromil, and β-adrenergic agonists.

[0123] Suitable anti-infective agents include amebicides (e.g., nitazoxanide, paromomycin, metronidazole, tinidazole, chloroquine, and iodoquinol), aminoglycosides (e.g., paromomycin, tobramycin, gentamicin, amikacin, kanamycin, and neomycin), anthelmintics (e.g., pyrantel, mebendazole, ivermectin, praziquantel, albendazole, miltefosine, thiabendazole, oxamniquine), antifungals (e.g., azole antifungals (e.g., itraconazole, fluconazole, ponazole), and the like). saconazole, ketoconazole, clotrimazole, miconazole, and voriconazole), echinocandins (e.g., caspofungin, anidulafungin, and micafungin), griseofulvin, terbinafine, flucytosine, and polyenes (e.g., nystatin and amphotericin b), antimalarials (e.g., pyrimethamine / sulfadoxine, artemether / lumefantrine, atovaquone / proguanil, quinine, hydroxychloroquine, mefloquine, chloroquine, doxycycline, pyrimethamine, and halofan antituberculosis drugs (e.g., aminosalicylates, isoniazid / rifampin, isoniazid / pyrazinamide / rifampin, bedaquiline, isoniazid, ethambutol, rifampin, rifabutin, rifapentine, capreomycin, and cycloserine), antiviral drugs (amantadine, rimantadine, abacavir / lamivudine, emtricitabine / tenofovir, cobicistat / elvitegravir / emtricitabine / tenofovir, efavirenz / emtricitabine / tenofovir, abacavir / lamivudine / zidobacter dlgine, lamivudine / zidovudine, emtricitabine / tenofovir, emtricitabine / opinavir / ritonavir / tenofovir, interferon alfa-2v / ribavirin, peginterferon alfa-2b, maraviroc, raltegravir, dolutegravir, enfuvirtide, foscarnet, fomivirsen, oseltamivir, zanamivir, nevirapine, efavirenz, etravirine, rilpivirine, delaviridine, nevirapine, entecavir, lamivudine, adefovir, sofosbuvir, didanosine, tenofovir, abacavir, zidovudine,stavudine, emtricitabine, zalcitabine, telbivudine, simeprevir, boceprevir, telaprevir, lopinavir / ritonavir, fosamprenavir, dolanunavir, ritonavir, tipranavir, atazanavir, nelfinavir, amprenavir, indinavir, saquinavir, ribavirin, valciclovir, acyclovir, famciclovir, ganciclovir, and valganciclovir), carbapenems (e.g., doripenem, meropenem, ertapenem, and cilastatin / imipenem), cephalosporins (e.g., cefadroxil, cephradine), , cefazolin, cephalexin, cefepime, ceftaroline, loracarbef, cefotetan, cefuroxime, cefprozil, loracarbef, cefoxitin, cefaclor, ceftibuten, ceftriaxone, cefotaxime, cefpodoxime, cefdinir, cefixime, cefditoren, cefizoxime, and ceftazidime), glycopeptide antibiotics (e.g., vancomycin, dalbavancin, oritavancin, and telvancin), glycylcyclines (e.g., tigecycline), leprosy drugs (e.g., clofazimine, salicylic acid), dromide), lincomycin and its derivatives (e.g., clindamycin and lincomycin), macrolides and their derivatives (e.g., telithromycin, fidaxomicin, erythromycin, azithromycin, clarithromycin, dirithromycin, and troliandomycin), linezolid, sulfamethoxazole / trimethoprim, rifaximin, chloramphenicol, fosfomycin, metronidazole, aztreonam, bacitracin, beta-lactam antibiotics (benzathine penicillin (benzathine and benzylpenicillin) phenoxymethylpenicillin, cloxacillin, flucloxacillin, methicillin, temocillin, mecillinam, azlocillin, mezlocillin, piperacillin, amoxicillin, ampicillin, bacampicillin, carbenicillin, piperacillin, ticarcillin, amoxicillin / clavulanic acid, ampicillin / sulbactam, piperacillin / tazobactam, clavulanic acid / ticarcillin, penicillin, procaine penicillin, oxacillin, dicloxacillin, nafcillin, cefazolin, cephalexin, cephem C, cephalothin, cefaclor,Cefamandole, cefuroxime, cefotetan, cefoxitin, cefixime, cefotaxime, cefpodoxime, ceftazidime, ceftriaxone, cefepime, cefpirome, ceftaroline, biapenem, doripenem, ertapenem, faropenem, imipenem, meropenem, panipenem, razupenem, tebipenem, thienamycin, aztreonam, tigemonam, nocardicin A, taboxinin, and beta-lactams), quinolones (e.g., lomefloxacin, norfloxacin, ofloxacin, gatifloxacin, moxifloxacin, ciprofloxacin, levofloxacin, gemifloxacin, moxifloxacin, cinoxacin, These include, but are not limited to, drugs for treating urinary tract infections (e.g., nitrofurantoin, methenamine, fosfomycin, cinoxacin, nalidixic acid, enoxacin, grepafloxacin, gatifloxacin, trovafloxacin, and sparfloxacin), sulfonamides (e.g., sulfamethoxazole / trimethoprim, sulfasalazine, and sulfasoxazole), tetracyclines (e.g., doxycycline, demeclocycline, minocycline, and doxycycline / salicylic acid, doxycycline / omega-3 polyunsaturated fatty acids, and tetracycline), and drugs for treating urinary tract infections (e.g., nitrofurantoin, methenamine, fosfomycin, cinoxacin, nalidixic acid, trimethoprim, and methylene blue).

[0124] Suitable chemotherapeutic agents include paclitaxel, brentuximab vedotin, doxorubicin, 5-FU (fluorouracil), everolimus, pemetrexed, melphalan, pamidronate, anastrozole, exemestane, nelarabine, ofatumumab, bevacizumab, belinostat, tositumomab, carmustine, bleomycin, bosutinib, busulfan, alemtuzumab, irinotecan, vandetanib, bicalutamide, lomustine, daunorubicin, clofarabine, cabozantinib, dactinomycin, ramucirumab, cytarabine, sarcolemma ... Itoxan, cyclophosphamide, decitabine, dexamethasone, docetaxel, hydroxyurea, dacarbazine, leuprolide, epirubicin, oxaliplatin, asparaginase, estramustine, cetuximab, vismodegib, asparaginase irwiniacrisansemi, amifostine, etoposide, flutamide, toremifene, fulvestrant, letrozole, degarelix, pralatrexate, methotrexate, floxuridine, obinutuzumab, gemcitabine, afatinib, imatinib mesylate, carmustine, etoposide Rivulin, trastuzumab, altretamine, topotecan, ponatinib, idarubicin, ifosfamide, ibrutinib, axitinib, interferon alfa-2a, gefitinib, romidepsin, ixabepilone, ruxolitinib, cabazitaxel, ado-trastuzumab emtansine, carfilzomib, chlorambucil, sargramostim, cladribine, mitotane, vincristine, procarbazine, megestrol, trametinib, mesna, strontium-89 chloride, mechlorethamine, mitomycin, busulfan, gemtuzumab ozoites Gamycin, vinorelbine, filgrastim, pegfilgrastim, sorafenib, nilutamide, pentostatin, tamoxifen, mitoxantrone, pegaspargase, denileukin diftitox, alitretinoin, carboplatin, pertuzumab, cisplatin, pomalidomide, prednisone, aldeslequin, mercaptopurine, zoledronic acid, lenalidomide, rituximab, octreotide, dasatinib, regorafenib, histrelin, sunitinib, siltoximab, omacetaxine, thioguanine, dabrafenib, erlotinib,Anticancer agents include, but are not limited to, bexarotene, temozolomide, thiotepa, thalidomide, BCG, temsirolimus, bendamustine hydrochloride, triptorelin, arsenic trioxide, lapatinib, valrubicin, panitumumab, vinblastine, bortezomib, tretinoin, azacitidine, pazopanib, teniposide, leucovorin, crizotinib, capecitabine, enzalutamide, ipilimumab, goserelin, vorinostat, idelalisib, ceritinib, abiraterone, epothilones, tafluposide, azathioprine, doxifluridine, vindesine, all-trans retinoic acid, and other anticancer agents listed elsewhere herein.

[0125] Methods of using RNA complexes and nanostructures and their formulations The RNA complexes or nanostructures provided herein can be administered to a subject, cell, or population thereof in need thereof. The subject in need thereof can have cancer or another disease or disorder that may benefit from a nucleoside analog. The amount administered can be an effective amount of the RNA complexes or nanostructures provided herein. The subject in need thereof can be symptomatic or asymptomatic. In some embodiments, the RNA complexes or nanostructures provided herein can be co-administered with another active agent. It is understood that co-administration can refer to an additional compound included in the formulation or provided in a dosage form separate from the RNA complex or nanostructure or formulation thereof. An effective amount of an RNA complex or nanostructure, such as those described herein, or a formulation thereof, can range from about 0.1 mg / kg to about 500 mg / kg. In some embodiments, the effective amount is in the range of about 0.1 mg / kg to 10 mg / kg. In further embodiments, the effective amount is in the range of about 0.1 mg / kg to 100 mg / kg. In some further embodiments, the effective amount is in the range of about 0.1 mg to about 1000 mg. In some embodiments, the effective amount can be from about 500 mg to about 1000 mg.

[0126] Administration of these RNA complexes or nanostructures and formulations thereof can be systemic or local. The compounds and formulations described herein can be administered to a subject in need thereof one or more times per day. In one embodiment, the compound(s) and / or formulation(s) thereof can be administered once per day. In some embodiments, the compound(s) and / or formulation(s) thereof can be administered once per day. In another embodiment, the compound(s) and / or composition(s) thereof can be administered twice per day. In some embodiments, when administered, an effective amount of the compound and / or formulation is administered to a subject in need thereof. The compound(s) and / or formulation(s) thereof can be administered one or more times per week. In some embodiments, the compound(s) and / or formulation(s) thereof can be administered one day per week. In other embodiments, the compound(s) and / or formulation(s) thereof can be administered 2-7 days per week.

[0127] In some embodiments, the RNA complex or nanostructure and / or formulation(s) thereof can be administered in a dosage form. The amount or effective amount of the compound(s) and / or formulation(s) thereof can be divided into multiple dosage forms. For example, the effective amount can be divided into two dosage forms, with the first dosage form being administered, for example, in the morning and the second dosage form being administered in the evening. Although the effective amount is administered twice, the subject will receive the effective amount for one day. In some embodiments, the effective amount is about 0.1 to about 1000 mg per day. The effective amount in the dosage form can range from about 0.1 mg / kg to about 1000 mg / kg. The dosage form can be formulated for oral, intravaginal, intravenous, transdermal, subcutaneous, intraperitoneal, or intramuscular administration. Preparation of dosage forms for various administration routes is described elsewhere herein.

[0128] The modular RNA motifs described herein, and the RNA complexes or nanostructures described herein, can be used in the preparation of therapeutic agents for the treatment of disease or cancer.

[0129] Although the present invention has been described with reference to certain embodiments, it should be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims. [Example]

[0130] Example 1: Figure 2 shows the results of cytotoxicity testing of RNA-UB5F nanoparticles in breast cancer cell lines.

[0131] FIG. 3 shows the results of cytotoxicity testing of RNA-CR2FF nanoparticles in breast cancer cell lines.

[0132] FIG. 4 shows the results of cytotoxicity testing of RNA-CR2FF-UB5F nanoparticles in breast cancer cell lines.

[0133] FIG. 5 shows the survivin duplex structure, where the sense strand has 3′ cholesterol and gemcitabine (as Y).

[0134] FIG. 6 shows the survivin duplex structure, where the sense strand has 3′ cholesterol and gemcitabine (as Y) and the antisense strand has an extension attached.

[0135] FIG. 7 shows the survivin duplex structure, where the sense strand has 3′ cholesterol and gemcitabine (as Y) and the antisense strand has the adjacent extended RNA structure.

[0136] FIG. 8 shows the RRM2-duplex structure, where the sense strand has 3′ cholesterol and gemcitabine (as Y).

[0137] FIG. 9 shows the RRM2-duplex structure, where the sense strand has 3′ cholesterol and gemcitabine (as Y) to which the extended antisense strand is attached.

[0138] FIG. 10 shows the RRM2-duplex structure, where the sense strand has 3′ cholesterol and gemcitabine (as Y) and the antisense strand has an RNA structure with adjacent extensions.

[0139] FIG. 11 is a curve showing the results of a weight change test of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colon adenocarcinoma cells.

[0140] FIG. 12 is a histogram showing the results of a weight change test of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colon adenocarcinoma cells.

[0141] FIG. 13 shows the results of an in vivo metastasis suppression test of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colon adenocarcinoma cells.

[0142] FIG. 14 shows the results of an ex vivo metastasis suppression test of RNA-CR2FF-cholesterol nanoparticles in an animal model of lung metastasis of human colon adenocarcinoma cells.

[0143] Example 2: Efficient suppression of pulmonary CRC metastasis by non-toxic RNA micelles carrying both siRNA and gemcitabine Materials and Methods Synthesis of RNA micelles RNA micelles carrying gemcitabine and either survivin or RRM2 siRNA were constructed using a one-pot, single-step assembly method. Each micelle consisted of two component strands: 1) cholesterol-gemcitabine-sense siRNA and 2) antisense siRNA. The RNA strands were synthesized using solid-phase synthesis with commercially available phosphoramidite monomers: 2'-TBDMS adenosine (n-bz) CED, 2'-TBDMS guanosine (n-ibu) CED, N4-benzoyl-2'-deoxy-5'-O-DMT-2',2'-difluorocytidine 3'-CE phosphoramidite (gemcitabine amidite), and 2'-fluorouridine CED. Subsequently, the RNA strands were deprotected according to the protocol provided by the manufacturer (Azco Biotech). Cholesterol was added to the 3' end of the sense siRNA strand using a 3'-cholesteryl-TEG CPG support (Glen Research Corp.) according to the manufacturer's instructions. Alexa-fluor 647 labeling was incorporated into the micelles on the cholesterol-gemcitabine-sense siRNA strand. Conjugation reactions were performed by mixing primary amine-labeled RNA with an NHS ester fluorophore at a 1:10 molar ratio in 0.1 M sodium bicarbonate buffer at pH 8.5. The conjugation reaction was incubated at room temperature for 16 hours in the dark, as previously described (Ghimire, C., et al., ACS Nano 2020, 14:13180-13191). The synthesized RNA from the terminated strand is typically purified using an ion-pair reversed-phase column, which allows complete labeling with cholesterol during solid-phase synthesis.

[0144] array Cholesterol-Gemcitabine-Survivincense 5'-XXGYAGGXXYYXXAXYXGXYAXXAYAXAYAYYYX-3'-cholesterol (SEQ ID NO: 274), where Y is gemcitabine and X is 2'-F uridine (floxuridine).

[0145] Survivin antisense 5'-UGACAGAUAAGGAACCUGC-3' (SEQ ID NO: 1) Survivin antisense-extension 5'-GGGXGXAXGXAAUGACAGAUAAGGAACCUGC-3' (SEQ ID NO: 275) where X is 2'-F uridine (floxuridine).

[0146] Cholesterol-Gemcitabine-RRM2 Sense 5'-XXGCGAXXXAGCCAAGAAGXXCAXXACAXACACCCX-3' (SEQ ID NO: 276), where Y is gemcitabine and X is 2'-F uridine (floxuridine).

[0147] RRM2 antisense 5'-UGAACUUCUUGGCUAAAUCGC-3' (SEQ ID NO: 2) Cholesterol-Gemcitabine-Survivincense-Alexa647 5'Alexa647-XXGYAGGXXYYXXAXYXGXYAXXAYAXAYAYYYX-3'cholesterol (SEQ ID NO: 277), where Y is gemcitabine and X is 2'-F uridine (floxuridine).

[0148] Gemcitabine-survivincense 5'-XXGYAGGXXYYXXAXYXGXYAXXACAXAYAYYYX-3' (SEQ ID NO: 278), where Y is gemcitabine and X is 2'-F uridine (floxuridine).

[0149] Survivincence 5'-GCAGGXXCCXXAXCXGXCAXX-3' (SEQ ID NO: 279), where Y is gemcitabine and X is 2'-F uridine (floxuridine).

[0150] The two constituent micelle chains were prepared as described in previous literature (Shu, Y., et al. J. Control. Release 2018, 276:17-29; Yin, H., et al. ACS Nano 2019, 13:706-717; Guo, S., et al. Nat. Commun. 2020, 11:972-982; Li, H., et al. Adv. Mater. 2016, 28:7501-7507; and Khisamutdinov, E. F., et al. Nucleic Acids Res. 2014, 42:9996-10004), micelles were assembled by mixing equimolar concentrations in TMS buffer (50 mM Tris pH 8.0, 100 mM NaCl, 10 mM MgCl) or PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM NaHPO, 2 mM KHPO pH 7.4), followed by heating to 95°C for 5 min and gradually cooling to 4°C over 45 min.

[0151] Characterization of RNA micelles The formation of RNA micelles was analyzed via agarose gel electrophoresis using a 1% agarose gel run at 4°C and 100V for 30 minutes on TAE running buffer.

[0152] The apparent hydrodynamic size and zeta potential of preassembled RNA micelles were measured. All RNA samples were measured at 25 °C in diethylpyrocarbonate HO and PBS buffer (137 mmol / L NaCl, 2.7 mmol / L KCl, 100 mmol / L NaHPO, 2 mmol / L KHPO pH 7.4).

[0153] cell culture Human CRC cell lines HT29 and HT29 GL LungM3 were grown and cultured in medium containing 10% fetal bovine serum and penicillin / streptomycin in a humidified atmosphere of 5% CO in an incubator at 37°C.

[0154] In vitro proliferation assay of RNA micelles Cell cytotoxicity was tested using the CellTiter 96 Non-Radioactive Cell Proliferation Assay (Promega) according to the manufacturer's instructions. Briefly, 5 × 10 cells were cultured in a 5 × 10 well-culture medium. 3 HT29 cells were seeded overnight in a 96-well plate. RNA micelles, free gemcitabine, and siRNA were added to each well in triplicate at gemcitabine concentrations of 5, 25, 100, and 250 nM. After 48 hours of incubation at 37°C in a humidified 5% CO2 environment, 15 μL of MTT dye solution was added to each well, and the plate was incubated at 37°C in the dark for 4 hours. Next, 50 μL of lysis / quenching mixture was added to each well, and the crystals were dissolved in the dark. The plate was then incubated at room temperature for 2 hours. Finally, the crystals in each well were completely dissolved to form a homogeneous, colored solution, and the absorbance was measured at 570 nm using a Synergy 4 microplate reader (Bio-Tek). Data were collected using Gen5, and normalized data were plotted using Origin.

[0155] In vivo tumor formation Male and female NOD.Cg-Prkdc scid Il2rgtm1Wjl / SzJNCr nude mice (8 weeks old) were obtained from Jackson Labs and housed in a clean, pathogen-free room under controlled temperature (27°C), humidity, and a 12-hour light-dark cycle. Mice were fed standard chow and tap water ad libitum and allowed a one-week acclimatization period. All animal experiments were approved by the University of Kentucky Institutional Animal Care and Use Committee and conducted in accordance with the National Institutes of Health guidelines for the care of laboratory animals. HT29 cells were induced to tropize the lungs by an initial intravenous injection. Lung metastases were excised and reinjected into mice. This in vivo selection process was repeated three times to establish the HT29 GL LungM3 cell line. HT29 GL LungM3 tumor cells were intravenously injected into mice to induce lung metastases. Mice were anesthetized using isoflurane (2% in oxygen, flow rate 0.6 L / min) and injected with 1 × 10 6 cells were injected.

[0156] In vivo tumor regression of CRC metastases NOD.Cg-Prkdc scid Il2rgtm1Wjl / SzJNCr nude mice bearing confirmed HT29 GL LungM3 tumors were treated twice weekly via tail vein injection with 1 mg / kg of each sample (containing PBS, micelle-extension / siSurv, micelle / siSurv, or micelle / siRRM2) in 300 μL. Mice received a total of six treatments. On day 26, mice were euthanized, and bioluminescence and GFP signals were imaged using a Lago SII microscope (Spectral Instruments Imaging, Tucson, AZ). Tumors were excised, fixed in 10% formaldehyde, and embedded in paraffin blocks. Tumor sections were stained with Ki-67 (Cell Signaling, Part Number 9027) or IHC-grade cleaved caspase 3 (Cell Signaling, Part Number 9579) primary antibodies, followed by fluorochrome-conjugated secondary antibodies, and then imaged using a microscope.

[0157] Chemokine induction of RNA micelles by ELISA RAW 264.7 cells were plated in a 24-well plate at 2.5 × 10 cells per well. 5 Cells were seeded at a density of 1000 cells / ml and cultured overnight. RNA micelles were then diluted in Opti-MEM medium (Life Technologies Corporation, Carlsbad, CA, USA) and added to the cells. The cells were cultured for 8 hours at 37°C under humidified air with 5% CO2. The cell culture supernatant was collected and stored at -80°C until use. The concentrations of TNF-α and IL-6 in the supernatant were measured by enzyme-linked immunosorbent assay (ELISA) using a Mouse ELISA MAX™ Deluxe set (BioLegend, San Diego, CA) according to the manufacturer's protocol.

[0158] result RNA micelles hold multiple chemical drug molecules and siRNA molecules by forming homogeneous microcellular structures.

[0159] RNA micelles were previously developed using a three-branched structure (pRNA-3WJ) derived from the pRNA of the Phi29 DNA packaging motor by adding a cholesterol tag to the 3' end of one of the component strands (Shu, Y., et al. J. Control. Release 2018, 276:17-29; Yin, H., et al. ACS Nano 2019, 13:706-717). These micelles were conjugated with paclitaxel or anti-miRNA sequences and administered in vivo to mouse tumor models. Here, the RNA micelles were redesigned into a simpler structure that self-assembles from cholesterol-siRNA chimeras, as shown in Figure 15. Furthermore, gemcitabine was incorporated into the micelle design by nucleotide substitution of cytosine ribonucleotides. Each RNA chimera was designed to contain 12 gemcitabine molecules on the sense strand of survivin and RRM2 siRNA. Thus, while gemcitabine is released, the antisense siRNA is also released into RISC without undergoing Dicer processing. The RNA micelle components were synthesized via solid-phase synthesis using phosphoramidite technology. Cholesterol via 3'-cholesteryl-TEG CPG and gemcitabine via gemcitabine amidite were placed on the sense strand of the siRNA. After purifying the two RNA strands, the siRNA folded and underwent an annealing step, during which the cholesterol tag self-assembled to form a hydrophobic core, forming the micelle.

[0160] The formation and physical properties of the RNA micelles were then characterized. First, micelle formation was confirmed through a 1% agarose gel compared to the single-stranded components. The assembly gel showed that the cholesterol sense strand self-assembled to form a micellar structure, as indicated by its relatively slow migration rate. This micellar structure was maintained even when the antisense siRNA strand was annealed with the sense strand micelles. As shown in the agarose gel, the RNA micelles formed a single band, indicating the formation of a homogeneous product. Furthermore, dynamic light scattering (DLS) was completed on the resulting RNA micelles. These RNA micelles are larger than many RNA nanoparticles that have been fabricated (Ghimire, C., et al. ACS Nano 2020, 14:13180-13191; Guo, S., et al. Nat. Commun. 2020, 11:972-982; Li, H., et al. Adv. Mater. 2016, 28:7501-7507; and Khisamutdinov, EF, et al. Nucleic Acids Res. 2014, 42:9996-10004), but are still in the nanometer range and retain the original properties of RNA nanoparticles.

[0161] The RNA micelles are treated with DNase II to specifically release gemcitabine, and consequently the antisense strand of the siRNA.

[0162] Gemcitabine has previously been incorporated into nucleic acid sequences to improve therapeutic delivery to tumor cells (Zhu, L., et al. J Am Chem Soc 2022, 144:1493-1497; Ma, Y., et al. Chem Commun (Camb) 2019, 55:6603-6606; and Pan, G., et al. ACS Appl Mater Interfaces 2019, 11:41082-41090). These nucleic acid constructs, including drug tamers and nanogels, demonstrated the ability to cleave gemcitabine through incubation with DNase II. Specifically, DNase II can release gemcitabine, which is highly concentrated in lysosomes (Zhu, L., et al. J Am Chem Soc 2022, 144:1493-1497). To demonstrate the stability and controlled release of gemcitabine and survivin or RRM2 siRNA from RNA micelles, nanoparticles were incubated with fetal bovine serum (FBS) containing an array of nucleases or DNase II. After incubation over time, the RNA micelle structures were analyzed by native PAGE. Interestingly, while the RNA micelles demonstrated stability against FBS degradation, they also showed degradation and subsequent release of gemcitabine and antisense siRNA strands. As shown in the gel, the RNA micelles were degraded by DNase II, resulting in short RNA fragments at the bottom of the gel. A single band of approximately 20 nt was observed, indicating that the antisense survivin and RRM2 strands were released, while the micelles maintained stability. This result indicates that the RNA micelles can maintain stability during circulation in the body without premature release of either gemcitabine or siRNA, and that the therapeutic agents are processed intracellularly for controlled intracellular release.

[0163] RNA micelles spontaneously target and internalize CRC cells Although gemcitabine efficiently crosses the cell membrane using nucleoside transporters, tumor cells rapidly develop resistance by downregulating nucleoside transporters such as SLC29A1, SLC28A1, and SLC28A3. Cells lacking these transporters lack gemcitabine entry and are less susceptible to gemcitabine cytotoxicity. Furthermore, nanoparticles rely on endocytosis as an internalization mechanism and are often trapped in endosomes, resulting in limited therapeutic efficacy. To verify the internalization of RNA micelles for intracellular delivery of gemcitabine and siRNA, we incorporated an Alexa-fluor 647 fluorescent tag into the RNA micelle design. RNA micelles / Alexa 647 were then incubated with HT29 and HCT116 CRC cell lines and imaged by live-cell confocal microscopy. Time-lapse imaging demonstrated an increase in fluorescent signal within CRC cells, indicating that the RNA micelles were able to bind and be internalized within the cells. Because RNA micelles do not contain CRC-targeting ligands, this binding occurs spontaneously and is independent of receptor-mediated endocytosis. We hypothesize that the high cholesterol content of RNA micelles allows them to interact with cholesterol-rich lipid rafts on the cell membrane, thereby inducing raft-dependent endocytosis (El-Sayed, A., et al. Mol Ther 2013, 21:1118-1130). This endocytic pathway is cholesterol-dependent and may or may not involve caveolae (Lajoie, P., et al. Int Rev Cell Mol Biol 2010, 282:135-163 and Lajoie, P., et al. J Cell Mol Med 2007, 11:644-653). To verify whether the RNA micelles were endocytosed, we repeatedly observed the cells using a confocal microscope while staining them (Zheng, Z., et al. J. Control. Release 2019, 311-312:43-49). The results were confirmed.Although endosomal entrapment can inhibit drug delivery, DNase II is present at high levels in lysosomes, allowing gemcitabine and siRNA to be released without processing by Dicer, maintaining the efficacy of the therapeutic agent (Zhu, L., et al. J Am Chem Soc 2022,144:1493-1497).

[0164] RNA micelles do not trigger an immune response Cancer therapeutics, including chemotherapy and nanoparticle platforms, are generally known to not only exhibit toxicity through interactions with healthy tissue but also trigger immune responses through cytokine induction (Lee, C.S., et al. World J Gastroenterol 2014, 20:3751-3761; Driscoll, J., et al. Curr Protoc 2021, 1:e249; and Hong, E., et al. Nano Lett. 2018, 18:4309-4321). RNA nanoparticles have previously been shown to control immune responses through their size, shape, and sequence (Khisamutdinov, E.F., et al. Nucleic Acids Res. 2014, 42:9996-10004; Guo, S., et al. Mol. Ther. Nucleic Acids 2017, 9:399-408). Therefore, RNA nanoparticles can be designed to induce or evade immune responses. Furthermore, conjugation of paclitaxel to RNA nanoparticles significantly reduced cytokine induction (Guo, S., et al. Nat. Commun. 2020, 11:972-982). RNA micelles were incubated with RAW 264.7 macrophage cells, and cytokine responses were analyzed by ELISA. Results demonstrated that control RNA micelles and RNA micelles containing gemcitabine and survivin or RRM2 siRNA did not significantly increase cytokine induction compared with cells alone. These results demonstrate that RNA micelles are safe for activating large-scale immune responses and are compatible with in vivo applications.

[0165] RNA micelles specifically suppress lung metastasis of CRC without adverse effects on the body

[0166] The RNA micelles demonstrated the ability to effectively suppress CRC and deliver high levels of either gemcitabine and survivin or RRM2 siRNA. The developed RNA micelles were tested for their ability to inhibit the growth of CRC lung metastases in a mouse model. HT29 GL LungM3 cells, derived from HT29 CRC cells "trained" to have lung tropism (Reichel, D., et al. Pharm Res 2017, 34:2385-2402 and Rychahou, P., et al. J Control Release 2018, 275:85-91), were intravenously injected into nude mice, allowing tumors to form in the lungs of these mice. HT29 GL LungM3 cells express GFP, allowing for monitoring of tumor growth and regression (Figures 16A and 16B). Once tumors developed, the RNA micelles were administered to the mice twice weekly for six treatments. At the end of the nanoparticle regimen, mice were imaged via IVIS, and the lungs were excised and imaged. Results demonstrated a significant decrease in GFP signal in both sets of images, demonstrating lung tumor regression (Figures 17A and 17B). Interestingly, RNA micelles containing gemcitabine and survivin siRNA resulted in almost complete elimination of GFP signal, suggesting complete tumor treatment. To further examine the therapeutic effect in mice, lungs were cryosectioned and stained for Ki-67 and caspase 3 signals (Figures 17C and 17D). In the treatment group, Ki-67 signals were observed throughout the lungs, indicating the continued presence of microtumors. Furthermore, low levels of caspase signals were observed in the lungs, indicating that tumor death was not due to caspase pathway activation. Overall, further optimization of RNA micelle administration or a longer regimen may be possible to treat tumors and achieve complete tumor regression. However, the presented data demonstrate that RNA micelles are highly effective in treating CRC lung metastases. The body weight of the mice was monitored throughout the in vivo study.The results showed that the RNA micelle samples containing survivin or RRM2 siRNA did not show significant weight loss compared to the PBS group, nor did they show any obvious signs of toxicity in the mice. This data, combined with the lack of cytokine induction, indicates that RNA micelles are generally safe and compatible with in vivo testing. However, further safety testing is required before RNA micelles can be used in clinical settings.

[0167] Consideration Nanoparticles often have complex structures, requiring several synthetic and chemical steps to form the final drug-conjugated particle. This can result in reduced product yields, increased manufacturing costs and labor, and compromised nanoparticle quality due to lack of uniformity. The RNA micelles presented herein overcome these challenges by using a single-step, one-pot manufacturing method that produces uniform and stable micelles. Gemcitabine was directly incorporated into the RNA micelles during solid-phase synthesis using phosphoramidites, achieving a 98.5% incorporation yield, eliminating the need for an additional chemical conjugation step. Furthermore, RRM2 and survivin siRNAs were easily incorporated through sequence extension from the RNA micelles and simple hybridization with the antisense strand. The presented RNA micelles are extremely simple in design, easy to synthesize, and self-assemble through nucleic acid folding and cholesterol interactions. The RNA micelles were proven to maintain stability against nucleases and form uniform products with a narrow particle size distribution.

[0168] As previously shown, RNA is a known elastomer and can change size and shape under external forces (Bao, L., et al. Biophys. J. 2017, 112:1094-1104; Kriegel, F., et al. J. Struct. Biol. 2017, 197:26-36; Lipfert, J., et al. Proc. Natl. Acad. Sci. USA 2014, 111:15408-15413; and Chou, F. C., et al. PLoS Comput. Biol. 2014, 10:e1003756). Furthermore, the inventors have shown that the 10 nm RNA nanoparticles they developed elongate into ellipsoidal structures when force is applied, and return to their original shape and size when the force is released (Ghimire, C., et al. ACS Nano 2020, 14: 13180-13191). These results, combined with the fact that RNA is inherently dynamic and constantly remodeling (Binzel, DW, et al. Chem Rev 2021, 121:7398-7467; Li, X., et al. Adv Drug Deliv Rev 2022, 186:114316; Yu, AM, et al. Mol Cell 2021, 81:870-883 e810; Hurst, T., et al. RNA Biol 2021, 1-11; Jing, Z., et al. J. Chem. Theory Comput. 2019, 15:6422-6432; and Larsen, KP, et al. Cold Spring Harb Perspect Biol 2019, 11), suggest that RNA nanoparticles possess deformable and dynamic properties that enable them to penetrate leaky tumor vasculature and spontaneously accumulate in tumors. Our results demonstrate that spontaneous therapeutic drug delivery to lung metastatic tumors can be achieved with high yields without the need for tumor-targeting ligands. RNA micelles are believed to be able to change size under blood pressure to penetrate leaky blood vessels and act like a ratchet, preventing them from returning to the bloodstream once inside the tumor microenvironment. Thus, a highly effective therapeutic drug delivery platform is formed.Furthermore, the mobility and deformability of RNA micelles allow them to be rapidly excreted in urine through renal glomerular filtration, resulting in low accumulation in major organs and rapid clearance from the body. We have demonstrated that 10 nm RNA nanoparticles developed by the inventors can pass through the renal glomerulus, which has a 5.5 nm cutoff size for renal excretion, within 30 minutes to 1 hour after intravenous administration, without detectable toxicity (Ghimire, C., et al. ACS Nano 2020, 14:13180-13191 and Guo, S., et al. Nat. Commun. 2020, 11:972-982). Therefore, a low-toxicity delivery platform was generated, as evidenced by the lack of weight change observed in mice.

[0169] RNA micelles have demonstrated the ability to internalize into CRC cells after accumulating in CRC lung metastases through spontaneous targeting. This internalization allows for the delivery of gemcitabine and siRNA at high efficacy levels. The exact mechanism of RNA micelle internalization remains unclear because the micelles lack targeting ligands for receptor-mediated endocytosis. However, it has been hypothesized that cholesterol, abundant in cellular lipid rafts, may interact with the high cholesterol concentration present in the core of the RNA micelles (El-Sayed, A., et al. Mol Ther 2013, 21:1118-1130; Cho YY, et al. Molecules 2020, 25; Tian, ​​N., et al. J Biol Chem 2012, 287:44447-44463; and Nabi, IR, et al. J Cell Biol 2003, 161:673-677). Thus, the interaction between cholesterol in micelles and cholesterol in lipid rafts can enable endocytosis of RNA micelles. Upon internalization of RNA micelles or individual RNA nanoparticles within micelles, 12 gemcitabine molecules are released through automated processing by DNase II (Zhu, L., et al. J Am Chem Soc 2022, 144:1493-1497 and Ma, Y., et al. Chem Commun (Camb) 2019, 55:6603-6606). By carefully designing RNA micelles incorporating gemcitabine into the RNA sequence, the antisense siRNA strand can be released without Dicer processing. Gemcitabine is placed in the sense strand of the siRNA, which degrades it upon release, resulting in the release of the antisense siRNA, which is then incorporated into RISC. This simple micelle design results in efficient intracellular internalization, drug release, and high efficacy.

[0170] Taken together, the presented data suggest that RNA micelles carrying multiple gemcitabine and siRNA molecules show strong potential for the treatment of CRC metastases and may also be applicable to other tumors and metastasis types. We demonstrated that RNA micelles induced no apparent toxicity or immune responses during circulation. This is most likely due to rapid renal excretion of RNA micelles that do not accumulate in tumors. Furthermore, internalization of RNA micelles results in the automatic disposal of siRNA and gemcitabine. Therefore, the mechanism of action of gemcitabine does not depend on nucleoside transporters that can be used to induce chemotherapy resistance, as is often the case with gemcitabine administration. Furthermore, the combination of survivin or RRM2 siRNA with gemcitabine not only creates a potent combination therapy but also further diversifies the therapeutic options for combating acquired chemotherapy resistance. RNA micelles demonstrated outstanding capabilities in the treatment of CRC lung metastases, a disease that currently presents challenges in clinical practice. Further investigation through in-depth preclinical studies is required to advance these RNA-based nanoparticles toward clinical application.

[0171] conclusion Since its conception, RNA nanotechnology has continued to demonstrate its capabilities in the delivery of therapeutic agents, including siRNA, miRNA, and small chemical drugs, and is developing into a versatile field. Herein, we developed novel RNA micelles by incorporating hydrophobic cholesterol onto a double-stranded RNA sequence containing multiple gemcitabine molecules and one survivin or RRM2 siRNA molecule. These novel RNA micelles enabled automated intracellular processing to release both gemcitabine and the antisense siRNA strand in a single step. As a result, the RNA micelles were able to deliver high concentrations of therapeutic agents upon spontaneous targeting to CRC lung metastases, resulting in almost complete tumor regression. This study realizes a powerful therapeutic tool through a simple one-step synthesis that is easy to construct and use.

[0172] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed invention belongs. References cited herein and the material for which they are cited are specifically incorporated herein by reference.

[0173] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein which equivalents are intended to be encompassed by the following claims.

Claims

1. A therapeutic RNA complex comprising a plurality of synthetic double-stranded RNA oligonucleotides, each synthetic double-stranded RNA oligonucleotide comprising a sense strand and an antisense strand; the sense strand has 5' and 3' ends comprising more than 25 nucleotides and a cholesterol molecule attached to the 3' end of the sense strand, and no pyrimidines in the sense strand contain oxygen at the 2' position; the antisense strand has 5' and 3' ends containing 18 to 25 normal nucleotides; the sense strand is greater than 18 nucleotides, and the 2' positions of all pyrimidines in the sense strand contain two fluorines and no oxygen; the antisense strand comprises an siRNA sequence having unmodified nucleotides; the sense strand is the same length as or longer than the antisense strand; at least 95% of the nucleotides in the antisense strand hybridize to complementary nucleotides in the sense strand; the plurality of synthetic double-stranded RNA oligonucleotides are in aggregates with the cholesterol molecule at the center; Therapeutic RNA complex.

2. 2. The therapeutic RNA complex of claim 1, wherein the sense strand comprises 2'-difluoro-deoxypyrimidine, floxuridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides, or a combination thereof.

3. 3. The therapeutic RNA complex of claim 1 or 2, further comprising GalNAc (N-acetylgalactosamine), UAMC-1110 (SP-13786; (S)—N-(2-(2-cyano-4,4-difluoropyrrolidin-1-yl)-2-oxoethyl)quinoline-4-carboxamide), FA (folic acid), or DCL (N-[N-[(S)-1,3-dicarboxypropyl]carbamoyl]-(S)-lysine) at the 5'-end of the sense strand.

4. The therapeutic RNA complex of claim 1, wherein the antisense strand is an anti-cancer siRNA that affects survival or apoptosis.

5. The therapeutic RNA complex of claim 4 , wherein the antisense strand is a survivin siRNA or an RRM2 siRNA.

6. The therapeutic RNA complex of claim 5 , wherein the survivin siRNA comprises the nucleic acid sequence of SEQ ID NO:

1.

7. The therapeutic RNA complex of claim 6 , wherein the RRM2 siRNA comprises the nucleic acid sequence of SEQ ID NO:

2.

8. 1. A synthetic double-stranded RNA oligonucleotide comprising a sense strand having a 5'-end and a 3'-end, and an antisense siRNA strand having a 5'-end and a 3'-end, wherein the sense strand comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more floxuridine (5-fluorodeoxyuridine, UB5F) nucleotides, gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotides, or a combination thereof.

9. 1. An RNA nanoparticle comprising at least three synthetic RNA nucleotides linked to each other, wherein the at least three synthetic RNA oligonucleotides form a central core domain and at least three double-stranded arms are arranged around and extend outward from the core domain, and at least one of the synthetic RNA oligonucleotides comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-273, or a variant thereof having at least 90% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-273.

10. 10. The RNA nanoparticle of claim 9, wherein at least one of the synthetic RNA oligonucleotides comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 167-221, or a variant thereof having at least 90% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 167-221.

11. The RNA nanoparticle of claim 9, comprising: a first synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 6-9, 61, 280-283, 112-116, or 167-171; a second synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 10-13, 62-66, 117-121, or 172-176; and a third synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 14-18, 67-71, 122-126, or 177-181.

12. a first synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 21-25, 41-45, 72-76, 92-96, 127-131, 147-151, 182-186, or 202-206; a second synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 26-30, 46-50, 77-81, 97-101, 132-136, 152-156, 187-191, or 207-211; The RNA nanoparticle of claim 9, comprising a third synthetic RNA oligonucleotide having a nucleic acid sequence of SEQ ID NO: 36-40, 56-60, 87-91, 107-111, 142-146, 162-166, 197-201, or 217-221.

13. 1. A method of stabilizing siRNA for therapeutic administration, comprising: (a) generating a plurality of synthetic single-stranded RNA oligonucleotides complementary to the siRNA sequence, each of the RNA oligonucleotides comprising 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleoside analogs configured to prevent degradation by RNases, and each of the RNA oligonucleotides comprising a cholesterol moiety conjugated to its 3' end; and (b) contacting the siRNA with the RNA oligonucleotide under conditions suitable for allowing the siRNA to hybridize to the RNA oligonucleotide, thereby producing an aggregated double-stranded RNA molecule with the cholesterol molecule in the center.

14. 14. The method of claim 13, wherein the nucleoside analog comprises a floxuridine (5-fluorodeoxyuridine, UB5F) nucleotide, a gemcitabine (2',2'-difluoro-2'-deoxycytidine, dFdC, CR2FF) nucleotide, or a combination thereof.

Images