Inhibition of ITGB8 in neurodegenerative diseases

Abstract

Provided herein are methods and compositions that inhibit integrin subunit beta 8 (ITGB8, also known as integrin αvβ8) to treat neurodegenerative diseases associated with microglial dysfunction, including Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS).

Description

[Technical Field]

[0001] Priority claim This application claims the benefit of U.S. Provisional Application No. 63 / 411,585, filed September 29, 2022, the entire contents of which are incorporated herein by reference.

[0002] Federally sponsored research or development This invention was made with government support under Grant Nos. AG051812, AG054672, AG075509, AG076982, AG080992, EY027921, NS088137, NS104609, and NS101673 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Provided herein are methods and compositions that inhibit integrin subunit beta 8 (ITGB8, also known as integrin αvβ8) to treat neurodegenerative diseases associated with microglial dysfunction, including Alzheimer's disease (AD) and amyotrophic lateral sclerosis (ALS). [Background technology]

[0004] Microglia play a vital role in supporting normal brain function. 1 , which can lead to neurodegeneration in disease cases 2 Recently, genome-wide association meta-analysis studies (GWAS) 3、4 and interactome surveys 5 revealed that microglial gene expression patterns are strongly correlated with late-onset Alzheimer's disease (AD). 6 Disease-associated microglia (DAM) 7 Also known as AD 6We have identified that APOE is regulated by the reciprocal inhibition of transforming growth factor b (TGFβ) and induction of apolipoprotein E (APOE) signaling in various neurodegenerative models, including human cerebrospinal fluid (CFD). There are three major APOE variants in humans: e2, e3, and e4. APOE e4 is a major genetic risk factor for late-onset AD and has previously been shown to accelerate the progression of AD in humans and mouse models. 8、9、10、11、12、13 In the central nervous system (CNS), APOE is expressed in astrocytes, reactive microglia, oligodendrocytes, endothelial cells, and epithelial cells of the choroid plexus. 14、15 However, the role of APOE4 in regulating microglial phenotype and function in vivo remains unclear. APOE is a multifunctional protein present in the CNS and peripheral nervous system, expressed primarily in the liver and to a lesser extent in immune cells. 16、17 Although APOE4 deletion in hepatocytes did not affect amyloid deposition in APP / PS1 mice, 18 Liver-specific expression of APOE4 in an Apoe knockout (KO) background enhanced AD pathology and cognitive impairment in amyloid precursor protein (APP) transgenic mice. 19 Furthermore, deletion of APOE4 in astrocytes significantly reduced neurodegeneration in a mouse model of tauopathy. 20 Several studies have investigated the molecular signature of microglia in mice globally expressing APOE4. 12、13 However, the cell-autonomous role of APOE4 expressed by microglia in controlling AD pathology has not been investigated. Summary of the Invention

[0005] APOE e4 is the strongest genetic risk factor for late-onset Alzheimer's disease (AD). Although APOE exhibits the most abundant gene expression in neurodegenerative microglia (MGnD), the contribution of microglial APOE4 to AD pathogenesis remains unclear. Here, we demonstrate a negative role for microglial APOE4 in inducing the MGnD response to neurodegeneration in mice and humans. In APP / PS1 mice, microglial APOE4 deletion rescues the MGnD phenotype and is associated with neuroprotection and reduced pathology in P301S tau transgenic mice. Mechanistically, APOE4-mediated induction of ITGB8-TGFb signaling inhibits the MGnD response through upregulation of microglial homeostatic checkpoints, including INPP5D, in mice. In APP / PS1 mice, microglial deletion of Inpp5d restores MGnD-astrocyte crosstalk and promotes plaque clearance. We identify the microglial APOE4-ITGB8-TGFb pathway as a negative regulator of the microglial response to AD pathology. As shown here, reversing the MGnD phenotype by inhibiting ITGB8-TGFb signaling could be used as a therapeutic intervention for neurodegenerative diseases such as AD and ALS.

[0006] Thus, provided herein is a method for treating a subject with a neurodegenerative disease associated with microglial dysfunction, the method comprising administering a therapeutically effective amount of an inhibitor of integrin subunit beta 8 (ITGB8). Also provided herein is an ITGB8 inhibitor for use in the method for treating a subject with a neurodegenerative disease associated with microglial dysfunction.

[0007] In some embodiments, the ITGB8 inhibitor is an antibody that binds to ITGB8. In some embodiments, the antibody that binds to ITGB8 is ADWA11, ADWA16, C6D4, 37E11, HuC6D4F12, CL7290, or a humanized version thereof. In some embodiments, the humanized version is ADWA11-2.1, ADWA11-2.2, ADWA11-2.3, ADWA11-2.4, ADWA16-1, ADWA16-2, ADWA16-3, ADWA16-3.2, ADWA16-4, ADWA16hugraft, Ab1, Ab2, or Ab3.

[0008] In some embodiments, the ITGB8 inhibitor is an inhibitory oligonucleotide that targets human ITGB8 and reduces ITGB8 expression. In some embodiments, the oligonucleotide is 15 to 21 nucleotides in length. In some embodiments, at least one nucleotide of the oligonucleotide is a nucleotide analog. In some embodiments, the oligonucleotide is a gapmer or a mixmer.

[0009] In some embodiments, the neurodegenerative disease is Alzheimer's disease (AD) or amyotrophic lateral sclerosis (ALS).

[0010] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention. Other suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database values, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0011] Other features and advantages of the invention will become apparent from the following detailed description and drawings, and from the claims. [Brief explanation of the drawings]

[0012] [Figure 1A] APOE4 inhibits microglial responses to acute neurodegeneration. DEG heatmap of 4-month-old APOE4-KI vs. APOE3-KI microglia, where DEGs were identified by DESeq2 analysis using LRT (n = 11–14 mice / group, P < 0.05). [Figure 1B] APOE4 inhibits microglial responses to acute neurodegeneration. Spi1-normalized counts. [Figure 1C] APOE4 inhibits the microglial response to acute neurodegeneration. Schematic representation of apoptotic neurons injected into the cortex and hippocampus of 8-month-old APOE3-KI and APOE4-KI mice. Sorting strategy for labeled apoptotic neurons 16 hours after injection of phagocytic and non-phagocytic microglia. Created with Biorender.com. [Figure 1D] APOE4 inhibits microglial responses to acute neurodegeneration. Gating strategy for CD11b+ / Fcrls+ microglia from the injection site of apoptotic neurons (AN) in APOE3-KI and APOE4-KI mice. [Figure 1E] APOE4 inhibits microglial responses to acute neurodegeneration. Bar graph showing the percentage of CD11b+ / Fcrls+ cells (n = 7–9 mice / group). [Figure 1F] APOE4 inhibits microglial responses to acute neurodegeneration. Principal component analysis (PCA) of each group. [Figure 1G] APOE4 inhibits microglial responses to acute neurodegeneration. Heatmap of phagocytic and non-phagocytic microglia in APOE3-KI and APOE4-KI mice. DEGs were identified using DESeq2 analysis with LRT (n=4-6 mice / group, P<0.05). [Figure 1H]APOE4 inhibits microglial responses to acute neurodegeneration. Gene ontology analysis of DEGs related to phagocytosis, autophagosome maturation, IFNg signaling, and antigen presentation (P<0.05). [Figure 1I] APOE4 inhibits the microglial response to acute neurodegeneration. Confocal microscopy images of Iba1, Lamp1, and AN at the injection site. [Figure 1J] APOE4 inhibits microglial responses to acute neurodegeneration. Quantification of Lamp1 immunoreactivity per Iba1+ cell (n = 6–7 mice / group). [Figure 1K] APOE4 inhibits microglial responses to acute neurodegeneration. Schematic diagram of tamoxifen administration at 1.5 months of age and AN infusion into the cortex and hippocampus of 8-month-old APOE3-KI, APOE4-KI, APOE3-cKO, and APOE4-cKO mice. [Figure 1L] APOE4 inhibits the microglial response to acute neurodegeneration. Percentage of CD11b+ / Fcrls+ microglia at the injection site in APOE4-KI and APOE4-cKO mice (n=4 mice / group). [Figure 1M] APOE4 inhibits microglial responses to acute neurodegeneration. Heatmap of non-phagocytic and phagocytic microglia isolated from AN-injected APOE3-KI, APOE3-cKO, APOE4-KI, and APOE4-cKO mice. DEGs were identified using DESeq2 analysis with LRT (n = 3–6 mice / group, P < 0.05). Two-tailed Student's t-test. Data are presented as mean ± standard error. [Figure 2A] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Schematic diagram of Tat-Cre or PBS injection into Spi1fl / fl brains followed by AN injection. Created with Biorender.com. [Figure 2B]APOE4 inhibits microglial responses to neurodegeneration via PU.1. Volcano plot showing DEGs in phagocytic microglia isolated from Spi1fl / fl mice treated with Tat-Cre or PBS. DEGs were identified using DESeq2 analysis with LRT (n=5 mice / group, P<0.05). [Figure 2C] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Scatter plot comparing DEGs in microglia from Spi1-cKO and APOE4-cKO mice. DEGs were identified using DESeq2 analysis with LRT (P<0.05, Log2FC>0.25 or <-0.25). [Figure 2D] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Representative images of brain sections from Tmem119WT / WT:Spi1fl / WT:APP / PS1 and Tmem119CreERT2 / WT:Spi1fl / WT:APP / PS1 mice stained with HJ3.4B. [Figure 2E] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Quantification of HJ3.4B+ area / ROI (n = 3–6 mice / group). [Figure 2F] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Confocal images of Clec7a, HJ3.4B, and Iba1 in Tmem119WT / WT:Spi1fl / WT:APP / PS1 and Tmem119CreERT2 / WT:Spi1fl / WT:APP / PS1 mice. [Figure 2G] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Quantification of Clec7a+ and Iba1+ areas per plaque (n = 3–6 mice / group). [Figure 2H] APOE4 inhibits the microglial response to neurodegeneration via PU.1. Heatmap of microglia isolated from APP / PS1:APOE4-KI mice injected with PU.1 inhibitor and control. DEGs were identified using DESeq2 analysis with LRT (n = 4-5 mice / group, P < 0.05). [Figure 2I] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Confocal images of Iba1 and Clec7a in APP / PS1:APOE4-KI mice injected with PU.1 inhibitor and control. [Figure 2J] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Quantification of Clec7a immunoreactivity and Iba1+ areas per ROI (n = 4–5 mice / group). [Figure 2K] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Normalized Serpina3 counts in astrocytes isolated from APP / PS1:APOE4-KI mice injected with PU.1 inhibitors and controls (n = 4–5 mice / group). [Figure 2L] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Confocal images of Gfap and Serpina3n in APP / PS1:APOE4-KI mice injected with a PU.1 inhibitor and control. [Figure 2M] APOE4 inhibits microglial responses to neurodegeneration via PU.1. Quantification of Serpina3n+ / Gfap+ areas per ROI (n = 4–5 mice / group). Two-tailed Student's t-test. Data are presented as mean ± standard error. [Figure 3A] Microglial APOE4 deletion restores MGnD responses and promotes neuroprotection against chronic neurodegeneration. Schematic diagram of tamoxifen administration at 1.5 months of age and analysis of P301S mice at 9 months of age. Created with Biorender.com. [Figure 3B] Microglial APOE4 deletion restores the MGnD response and promotes neuroprotection against chronic neurodegeneration. qPCR validation of human APOE expression in sorted microglia (n = 6–9 mice / group). [Figure 3C]Microglial APOE4 deletion restores the MGnD response and promotes neuroprotection against chronic neurodegeneration. DEGs in aggregated samples of WT, Tau(P301S), and APOE mutants. DEGs were identified using DESeq2 analysis with LRT (n = 3–11 mice / group, P < 0.01). [Figure 3D] Microglial APOE4 deletion restores the MGnD response and promotes neuroprotection against chronic neurodegeneration. Confocal images of Clec7a, phosphorylated tau (AT-100), and Iba1. Arrows indicate Clec7a+ microglia associated with phosphorylated tau in the cortex of P301S:APOE3-KI, P301S:APOE3-cKO, P301S:APOE4-KI, and P301S:APOE4-cKO mice. [Figure 3E] Microglial APOE4 deletion restores MGnD responses and promotes neuroprotection against chronic neurodegeneration. Quantification of Clec7a and AT-100 positive areas in the cortex (n=7-16 ROIs / group). [Figure 3F] Microglial APOE4 deletion restores MGnD responses and promotes neuroprotection against chronic neurodegeneration. Volcano plot of DEGs in P301S:APOE4-cKO versus P301S:APOE4-KI mice. DEGs were identified using DESeq2 analysis with LRT (n = 3–8 mice / group, P < 0.05). [Figure 3G] Microglial APOE4 deletion restores MGnD responses and promotes neuroprotection against chronic neurodegeneration. Representative images of cresyl violet staining of P301S mice harboring different APOE variants. Dashed boxes indicate regions of interest. [Figure 3H] Microglial APOE4 deletion restores the MGnD response and promotes neuroprotection against chronic neurodegeneration. Quantification of cortical neurons in WT and P301S mice with different APOE variants (n = 7–10 mice / group). One-way ANOVA. Data are presented as mean ± standard error. [Figure 4A]Targeting APOE4 in microglia limits Ab pathology in APP / PS1 mice. Schematic of tamoxifen administration at 1.5 months of age and analysis of APP / PS1 mice at 4 months of age. Created with Biorender.com. [Figure 4B] Targeting APOE4 in microglia limits Ab pathology in APP / PS1 mice. qPCR validation of human APOE expression in sorted microglia (n = 3–12 mice / group). [Figure 4C] Targeting APOE4 in microglia limits Ab pathology in APP / PS1 mice. Heatmap showing the top 100 DEGs in microglia isolated from APP / PS1:APOE4-KI vs. APP / PS1:APOE4-cKO mice. DEGs were identified using DESeq2 analysis with LRT (n = 5–9 mice / group, P < 0.01). [Figure 4D] Targeting APOE4 in microglia limits Ab pathology in APP / PS1 mice. Quantification of cortical HJ3.4B+ plaque numbers / ROI (n = 7–14 mice / group). [Figure 4E] Targeting APOE4 in microglia limits Ab pathology in APP / PS1 mice. Quantification of Lamp1 area in the cortex (n = 7–14 mice / group). One-way ANOVA. Data are presented as mean ± standard error. [Figure 5A] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. UMAP plot of astrocyte scRNAseq analysis showing clusters 3 and 5. Violin plot of key activated genes representing clusters 3 and 5: Gfap, Vim, Fabp7, and Cd9. [Figure 5B] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Volcano plot of cluster 3 comparing APP / PS1:APOE4-cKO vs. APP / PS1:APOE4-KI mice. DEGs were identified using the FindMarkers Seurat function (P<0.05). [Figure 5C] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Donut chart showing the percentage of Gfap+Apoelow and Gfap+Apoehigh astrocyte clusters in APP / PS1:APOE4-KI vs. APP / PS1:APOE4-cKO mice. [Figure 5D] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Top up-regulated canonical pathways in astrocytes in Cluster 3 identified using IPA. DEGs for pathway enrichment analysis were determined with P<0.05 using the FindMarkers Seurat function, and pathways were selected with P<0.05. [Figure 5E] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Confocal images of Gfap, Iba1, and human APOE in the cortex of 4-month-old APP / PS1:APOE3-KI, APP / PS1:APOE3-cKO, APP / PS1:APOE4-KI, and APP / PS1:APOE4-cKO mice. Yellow arrows indicate the presence or loss of human APOE immunoreactivity in Gfap+ and Iba1+ cells. [Figure 5F] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Quantification of Gfap+ areas (n = 39–61 plaques / group). [Figure 5G] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Quantification of Apoe+ immunoreactivity in plaque-associated Gfap+ cells (n = 39–61 plaques / group). [Figure 5H]Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Confocal images of Serpina3n, Gfap, and HJ3.4B. [Figure 5I] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Quantification of Sepina3n+ immunoreactivity in Gfap+ cells (n = 30–44 plaques / group). [Figure 5J] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Schematic diagram of the experimental design for adoptive transfer of phagocytic microglia. MGnD was isolated from APOE3-KI, APOE4-KI, and APOE4-cKO mice and injected into 2-month-old WT recipient mice, followed by isolation of astrocytes from the recipient mice 16 hours later. Created with Biorender.com. [Figure 5K] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Volcano plot of DEGs in astrocytes isolated from WT recipient mice injected with MGnD microglia sorted from APOE4-KI compared to APOE3-KI mice. DEGs were identified using DESeq2 analysis with LRT (n=3 mice / group, P<0.05). [Figure 5L] Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. Volcano plot of DEGs in astrocytes isolated from WT recipient mice injected with MGnD cells sorted from APOE4-cKO mice compared with APOE4-KI mice. DEGs were identified using DESeq2 analysis with LRT (n=3 mice / group, P<0.05). [Figure 5M]Targeting microglial APOE4 promotes astrocyte activation and recruitment to plaques in APP / PS1 mice. IPA analysis of the most affected upstream regulators in WT astrocytes isolated from recipient mice after injection of APOE4-cKO MGnD cells versus APOE4-KI MGnD cells. DEGs used for upstream analysis were identified using DESeq2 analysis with LRT (n=3 mice / group, P<0.05). Upstream regulators with P<0.05 were selected. One-way ANOVA. Data are presented as mean ± SEM. [Figure 6A] Impaired induction of the MGnD signature and astrocytic activation in APOE e4 AD carriers. Volcano plots of bulk RNA-seq analysis of whole brain tissue isolated from males (a) and females (b). Selected DEGs are shown to be induced (red dots) and repressed (blue dots) in AD APOE e3 / 4 vs. AD APOE e3 / 3 carriers. DEGs were identified using DESeq2 analysis with LRT (male n = 5-7 donors, female n = 6-7 donors, P < 0.05). [Figure 6B] Impaired induction of the MGnD signature and astrocytic activation in APOE e4 AD carriers. Volcano plots of bulk RNA-seq analysis of whole brain tissue isolated from males (a) and females (b). Selected DEGs are shown to be induced (red dots) and repressed (blue dots) in AD APOE e3 / 4 vs. AD APOE e3 / 3 carriers. DEGs were identified using DESeq2 analysis with LRT (male n = 5-7 donors, female n = 6-7 donors, P < 0.05). [Figure 6C] Impaired induction of MGnD signature and astrocytic activation in APOE e4 AD carriers. Comparison of the top 100 DEGs between female AD:APOE e3 / 4 carriers and AD:APOE e3 / 3 carriers. DEGs were identified using DESeq2 analysis with LRT (P<0.05, n=6-7 donors / group). [Figure 6D]Impaired induction of the MGnD signature and astrocytic activation in APOE e4 AD carriers. Normalized number of key affected genes. [Figure 6E] Impaired induction of MGnD signature and astrocytic activation in APOE e4 AD carriers. Most affected KEGG pathways comparing AD:APOE e3 / 3 female carriers with AD:APOE e3 / 4 female carriers. DEGs used for pathway analysis were identified by DESeq2 analysis and LRT. [Figure 6F] Impaired induction of MGnD signature and astrocytic activation in APOE e4 AD carriers. Volcano plot of microglial DEGs comparing AD:APOE e3 / 4 carriers with APOE e3 / 3 carriers analyzed from the dataset of Zhou et al. DEGs were identified using the FindMarkers Seurat function (n=6 AD:APOE e3 / 3 carriers, n=4 AD:APOE e3 / 4 carriers, P<0.05). [Figure 6G] Impaired induction of the MGnD signature and astrocytic activation in APOE e4 AD carriers. Confocal images of brain sections from APOE e3 / 3 and e3 / 4 AD women stained for pSmad3, IBA1, and HJ3.4B. [Figure 6H] Impaired induction of the MGnD signature and astrocytic activation in APOE e4 AD carriers. Quantification of pSMAD3 immunoreactivity in IBA1+ cells (n=27–33 cells / group). [Figure 6I] Impaired induction of the MGnD signature and astrocytic activation in APOE e4 AD carriers. Confocal microscopy images of GFAP in AD brains carrying APOE e3 / 3 and e3 / 4. [Figure 6J] Impaired induction of the MGnD signature and astrocytic activation in APOE e4 AD carriers. Quantification of GFAP immunoreactivity per plaque (n = 43–52 plaques / group). [Figure 6K]Impaired induction of MGnD signature and astrocytic activation in APOE e4 AD carriers. Donut plot representing the analysis of the dataset by Zhou et al.49 showing the percentage of GFAPHiSERPINA3+ and GFAPHiSERPINA3- astrocyte clusters in AD:APOE e3 / 4 and APOE e3 / 3 carriers (mean expression cutoffs were GFAP>4, SERPINA3>0). [Figure 6L] Impaired induction of the MGnD signature and astrocytic activation in APOE e4 AD carriers. Volcano plot comparing astrocytic DEGs in AD:APOE e3 / 4 carriers and APOE e3 / 3 carriers analyzed from the dataset by Zhou et al. 49. DEGs were identified using the FindMarkers Seurat function (n = 6 AD:APOE e3 / 3 carriers, n = 4 AD:APOE e3 / 4 carriers, P < 0.05). White arrows indicate the enlarged ROIs in ig. Two-tailed Student's t-test. Data are shown as mean ± standard error. [Figure 7A] Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Representative images of Tmem119 immunoreactivity in sagittal brain sections from Itgb8-cKO mice and control littermates. The affected area (cortex) is highlighted in blue. The white arrow indicates the enlarged ROI. [Figure 7B] Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Confocal microscopy images of Clec7a, Gfap, and Apoe in Itgb8-cKO and control mice. [Figure 7C] Inhibition of ITGB8-TGFb signaling enhances MGnD responses and attenuates AD pathology in APP / PS1 mice. Quantification of Clec7a+ immunoreactivity in the cortex (n=12 ROIs / group). [Figure 7D]Inhibition of ITGB8-TGFb signaling enhances MGnD responses and attenuates AD pathology in APP / PS1 mice. Quantification of Gfap+ immunoreactivity in the cortex (n=12 ROIs / group). [Figure 7E] Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Heatmap of microglia isolated from Itgb8-KO and control mice. DEGs were identified using DESeq2 analysis with LRT (n=4-5 mice / group, P<0.05). [Figure 7F] Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Top KEGG pathways in Itgb8-KO microglia compared to control microglia. DEGs for pathway analysis were identified using LRT and DESeq2 analysis with P<0.05, and pathways were selected with P<0.05. [Figure 7G] Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Confocal images of pSmad3, Apoe, and Iba1 in Itgb8-cKO and control mice. White arrows indicate the enlarged ROIs. [Figure 7H] Inhibition of ITGB8-TGFb signaling enhances MGnD responses and attenuates AD pathology in APP / PS1 mice. Quantification of pSmad3 immunoreactivity in Iba1+ cells (n=45–47 cells / group). [Figure 7I] Inhibition of ITGB8-TGFb signaling enhances MGnD responses and attenuates AD pathology in APP / PS1 mice. Quantification of Apoe immunoreactivity in Iba1+ cells (n=45–47 cells / group). [Figure 7J]Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Scatter plot comparing DEGs in microglia from Itgb8-cKO and Tgfbr2-cKO mice described by Lund et al. DEGs were identified using DESeq2 analysis with LRT (n=3 mice / group for Lund et al., n=4 / 5 mice / group for Itgb8-cKO, P<0.05, Log2FC>0.25 or <-0.25). [Figure 7K] Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Schematic diagram of the brains of APP / PS1 mice injected with anti-ITGB8 neutralizing antibody or IgG isotype control and analyzed 3 days later. [Figure 7L] Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Heatmap of isolated microglia from APP / PS1 mice treated with anti-ITGB8 neutralizing antibody and IgG isotype control, and the top affected GO pathways. DEGs were identified using DESeq2 analysis with LRT (n=5 mice / group, P<0.05). [Figure 7M] Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Confocal images of HJ3.4B+ plaques at the injection site 14 days after treatment of APP / PS1 mice with anti-ITGB8 neutralizing antibody and IgG isotype control. [Figure 7N] Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Quantification of HJ3.4B+ plaques at the injection site (n = 8–9 mice / group). [Figure 7O]Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Confocal images of Gfap, Clec7a, and HJ3.4B+ plaques at the injection site 14 days after treatment of APP / PS1:APOE4 KI mice with anti-ITGB8 neutralizing antibody and IgG isotype control. [Figure 7P] Inhibition of ITGB8-TGFb signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. Quantification of HJ3.4B+ plaque area, Gfap+ area, and Clec7a+ area per ROI at the injection site (n = 11 ROIs from 6-7 mice / group). Two-tailed Student's t-test. Data are shown as mean ± standard error. [Figure 8A] Impaired induction of the MGnD signature and astrocyte activation in APOE e4 AD brains. Confocal images of GFAP and HJ3.4B immunoreactivity and detection of ITGB8 gene expression using RNAscope in AD:APOE e3 / 4 men compared to AD:APOE e3 / 3 men. [Figure 8B] Impaired induction of MGnD signature and astrocyte activation in APOE e4 AD brains. Quantification of ITGB8 fluorescence in ROIs comparing AD:APOEe3 / 4 vs. AD:APOEe3 / 3 men (n=7-8 donors / group). [Figure 8C] Impaired induction of MGnD signature and astrocyte activation in APOE e4 AD brains. Quantification of ITGB8 fluorescence in GFAP+ astrocytes comparing AD:APOE e3 / 4 vs. AD:APOE e3 / 3 men (n=7-8 donors / group). [Figure 8D] Impaired induction of the MGnD signature and astrocyte activation in APOE e4 AD brain. Confocal images of GFAP and HJ3.4B immunoreactivity and detection of Itgb8 mRNA expression in APP / PS1:APOE4-cKO and APP / PS1:APOE4-KI mice using RNAscope. [Figure 8E]Impaired induction of the MGnD signature and astrocyte activation in APOE e4 AD brains. Quantification of ITGB8 fluorescence in GFAP+ astrocytes (n=10-18 ROIs from 3-5 mice / group). Two-tailed unpaired Student's t-test. Data are shown as mean ± standard error. [Figure 9] Inhibition of Itgb8 signaling enhances the MGnD response and attenuates AD pathology in APP / PS1 mice. A, Quantification of the percentage of Ab-42 phagocytic microglia in WT and Itgb8-cKO mice (n = 5–10 mice / group). B, APP / PS1 mice were injected with anti-ITGB8 neutralizing antibodies and IgG isotype control at the MHC II, Iba1, and HJ3.4B sites. The graph shows quantification of MHC II+ immunoreactivity at the injection site (n = 4 mice / group). Two-tailed Student's t-test. Data are presented as mean ± standard error. [Figure 10A] Microglial Smad2 / 3 deletion induces the MGnD phenotype. Expression of key homeostatic and MGnD genes in microglia from Itgb8-cKO (n = 4–5 mice / group) compared with non-transgenic control mice. [Figure 10B] Microglial Smad2 / 3 deletion induces the MGnD phenotype. Expression levels of key AD risk factor genes (Inpp5d, Havcr2, Bin1) in microglia from Itgb8-cKO mice (n = 4–5 mice per group) compared with non-transgenic control mice. Two-tailed Student's t-test. Data are shown as mean ± standard error. [Figure 11] Targeting ITGB8-TGFb signaling with ADWA-11 attenuates cognitive decline in 5xFAD mice. A, Schematic of anti-ITGB8 treatment and behavioral testing (n=15). B, Assessment of the T-maze test. C, Assessment of latency in WT and 5xFAD mice during 5 days of testing in the water maze. One-way analysis from area under the curve. D, Quantification of time (%) in the target quadrant on the study day in the water maze. One-way analysis. Data are presented as mean ± standard error; *P<0.05, **P<0.01. DETAILED DESCRIPTION OF THE INVENTION

[0013] Several mechanisms by which APOE4 increases the risk of developing AD have been proposed, most of which involve models involving global expression or astrocyte-specific deletion of APOE4. 12、13、20、58 Here, we demonstrate cell-autonomous negative regulation of microglial APOE4 in the acquisition of the MGnD phenotype in response to neurodegeneration. Mice bearing tau and amyloid pathology lacking microglial APOE4 exhibited restored induction of the MGnD response, improved neuronal survival, reduced plaque pathology, and increased association of microglia and astrocytes with Aβ plaques. Microglial APOE3 deletion reduced Clec7a expression in P301S mice to levels comparable to those seen in APOE4-KI. We recently reported that Apoe - / - We demonstrated that the MGnD response is impaired in APOE4-KI glaucoma mice, similar to that in mice. 22 Thus, microglial expression of APOE3 is important for inducing the MGnD response to neurodegeneration, and its deletion accelerates neuronal loss, whereas microglial deletion of APOE4 promotes neuroprotection in tau mice. In addition to the classical role of APOE in cholesterol transport, APOE4 has been shown to acquire novel functions in the nucleus, where it translocates and directly binds to DNA, affecting the transcription of genes associated with AD. 59、60 Furthermore, microglial APOE4 showed increased nuclear localization in AD brains. 59These results suggest that nuclear localization of APOE4 may directly repress MGnD gene transcription, a function absent in APOE3 microglia and attenuated by APOE4 deletion. Thus, APOE may play a dual role in regulating MGnD responses based on its subcellular localization, which may be altered in APOE4-expressing microglia and explain the distinct neurodegenerative effects detected in tau mice after microglial APOE3 deletion compared with APOE4. Consistent with these findings, the transcription factor PU.1 was upregulated in APOE4-KI microglia, and its deletion strongly induced MGnD gene expression. Furthermore, Liu et al. used microglia-specific expression of human APOE mutants to demonstrate that microglial APOE3 induces a transcriptomic signature of an activated immune response, whereas APOE4 inhibits the activation of inflammatory responses to amyloid pathology. This APOE4 microglial phenotype was associated with reduced expression of genes involved in antigen presentation and interferon response, and increased Aβ plaque deposition. AD brains with the APOE e4 allele showed a gender-dependent impairment of the MGnD signature, with females exhibiting significantly reduced astrocytic activation. These genes include CD33, BIN1, ABCA7, CR1, INPP5D, and HAVCR2. 4、61 Several AD risk genes, including , were enriched in the brains of APOE e4 AD women and were associated with downregulation of key MGnD genes. 6、21、22 These results support previous reports showing that higher PU.1 expression in humans is associated with earlier onset of AD. 29、62 In female AD brains with the APOE e4 allele, PU.1 expression is associated with increased SMAD3 expression levels, which may reinforce the microglial homeostatic signature as a downstream molecule of TGFβ signaling. 21、28、50Furthermore, immunoreactive phosphorylated SMAD3 (pSMAD3), a marker of TGFb signaling, was increased in microglia from female AD brains with the APOE e4 allele, indicating a promotion of a microglial homeostatic signature. The TGFb-rich environment in the AD brains of APOE e4 carriers suppresses astrocyte activation, which is due to the TGFb ligand 63 Astrocytes are suppressed in response to Tgfbr2 44 This is consistent with previous reports that loss of Smad2 / 3 or Smad3 results in astrocyte activation. We also found that microglial deletion of APOE4 in APP / PS1 mice promoted astrocyte activation and Ab plaque encapsulation. Furthermore, reactive astrocytes have been shown to play a beneficial role in limiting AD pathology, and a reduction in reactive astrocytes in AD mice resulted in increased plaque burden, synaptic dysfunction, and memory loss. 64 These findings in mice and humans suggest that APOE4 is a TGFβ-dependent microglial homeostatic regulator that inhibits microglia-astrocyte crosstalk in response to neurodegeneration. 21 These findings suggest that APOE4 causes AD pathology in part through the induction of ATP. In line with these findings, Liu et al. demonstrated that APOE4 reduces the activated microglial signature response to AD pathology in human brain and in APOE e4 allele-bearing human induced pluripotent stem cell-derived microglia.

[0014] Although TGFb signaling has been suggested to play both beneficial and detrimental roles in AD, 72 , overproduction in astrocytes promotes cerebrovascular fibrosis and amyloidosis 73 Furthermore, TGFb1 has been implicated in vascular dementia and has been suggested to promote abnormal vascular remodeling, and has been proposed as a therapeutic target for AD. 74 In APOE e4 carriers, latent TGFb1 51We detected upregulation of ITGB8, which plays a key role in the activation of microglia. In the AD brains of women with the APOE e4 allele, we confirmed induction of SMAD3 and INPP5D signaling, associated with downregulation of the MGnD gene. Mechanistically, genetic deletion of Itgb8 or Inpp5d was sufficient to restore the MGnD response and astrocytic activation, coupled with reduced plaque burden in AD mice. Furthermore, pharmacological inhibition of ITGB8-TGFb signaling enhanced the MGnD response, associated with increased plaque clearance in AD mice. These data support the beneficial role of MGnD-microglia in limiting AD pathology and reveal that the ITGB8-TGFb axis may function as a therapeutic intervention for AD.

[0015] Treatment method Provided herein are methods for reducing the impaired microglial response to neurodegeneration in a subject and treating a neurodegenerative disease associated with a microglial disorder. The methods of the present invention can be used in any mammalian subject, including humans. Accordingly, provided herein are methods for treating a subject in need of treatment, such as a subject with a microglial disorder and / or a neurodegenerative disease associated with a microglial disorder, comprising administering to the subject an effective amount of an ITGB8 inhibitor.

[0016] In some embodiments, the neurodegenerative disease associated with microglial impairment is Alzheimer's disease (AD) or amyotrophic lateral sclerosis (ALS). In some embodiments, the subject has Alzheimer's disease, or other tauopathy, such as frontotemporal dementia, frontotemporal dementia with parkinsonism, frontotemporal lobe dementia, multisystem tauopathy, multisystem tauopathy with presenile dementia, Wilhelmsen-Lynch disease, dementia disinhibited, dementia parkinsonism, and amyotrophic lateral sclerosis complex, Pick's disease or Pick-like dementia, corticobasal degeneration, frontotemporal dementia, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), or multiple sclerosis (MS), e.g., progressive MS. In some embodiments, the disease may or may not be an eye-related neurodegenerative disease, such as glaucoma and age-related macular degeneration.

[0017] As used herein, a "therapeutically effective amount" is an amount sufficient to alleviate signs or symptoms of a disease, reduce (delay) progression of a disease, or reduce the severity of a disease in a subject diagnosed with the disease. A "prophylactically effective amount" is an amount that reduces the incidence or risk of a disease sign or symptom in a subject at risk for a disease, or delays the onset of a disease sign or symptom in a subject at risk, such as a subject with a genetic mutation associated with a disease described herein. Signs and symptoms include dementia, forgetfulness / memory loss, etc. A subject described herein can be a human diagnosed with a neurodegenerative disease described herein or a human with a mutation associated with a neurodegenerative disease described herein.

[0018] An effective amount can be administered in one or more administrations, applications, or doses. The therapeutically effective amount (i.e., effective dosage) of a therapeutic compound will vary depending on the therapeutic compound selected. The composition can be administered from one or more times daily to one or more times weekly (including once every other day). A skilled artisan will understand that certain factors, including, but not limited to, the severity of the disease or disorder, previous treatments, the subject's general health and / or age, and other diseases present, can affect the dosage and timing required to effectively treat a subject. Furthermore, treatment of a subject with a therapeutically effective amount of a therapeutic compound described herein can include a single treatment or a series of treatments.

[0019] The dosage, toxicity, and therapeutic efficacy of therapeutic compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, by determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. Compounds that exhibit high therapeutic indices are preferred. Compounds that exhibit toxic side effects may also be used, but care must be taken to design a delivery system that targets such compounds to the site of affected tissues in order to minimize potential damage to uninfected cells and reduce side effects.

[0020] Data obtained from cell culture assays and animal studies can be used to formulate a range of dosages for use in humans. The dosage of the compounds preferably lies within a range of circulating concentrations that include the ED50 with little or no toxicity. Dosages may vary within this range depending on the dosage form employed and the route of administration used. For any compound used in the methods described herein, the therapeutically effective amount can be initially determined from cell culture assays. In animal models, doses can be formulated to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful dosages for humans. Plasma concentrations can be measured, for example, by high-performance liquid chromatography.

[0021] ITGB8 inhibitors A number of ITGB8 inhibitors are known in the art, including antibodies and inhibitory oligonucleotides.

[0022] Anti-ITGB8 antibody Antibodies and antigen-binding fragments thereof that bind to human ITGB8 include CL7290 (described in WO2022268644), the 37E1 antibody described in US9290572, ADWA-2, ADWA-8, ADWA-10, ADWA-11, ADWA-13, ADWA-15, ADWA-16, ADWA-25, and ADWA-20 (described in US20160046717), C6D4, and other antibodies, such as B13C4 15-8, B13C4 15-10, B13H3.2, B13C1231015, B15B11VH, B2B2 15-9, R11D12715.3, RSDLVH-1, RSDLVH-3, RSDLVH-16, 29 and 44, A1=B4=F9, A5=C6, and D4=E6 (described in WO2018064478), HuC6D4F12 (described in US20210277125), and variants thereof (including humanized and chimeric versions thereof). In some embodiments, the antibody is a humanized ADWA11 antibody (including ADWA11 VH01 / VK01, ADWA11 VH02 / VK01, ADWA11 VH03 / VK01, ADWA11 VH03 / VK02, ADWA11 VH05 / VK01, ADWA11 VH05-2 / VK01, ADWA11-2.1, ADWA11-2.2, ADWA11-2.3, and ADWA11-2.4) described in WO2020051333, and a humanized ADWA16 antibody (including ADWA16-1, ADWA16-2, ADWA16-3, ADWA16-3.2, ADWA16-4, ADWA16hugraft, Ab1, Ab2, or Ab3 described in WO2022164816). Additional antibodies are known in the art or may be obtained using methods known in the art, including those described in the above references.

[0023] In some embodiments, the antibody or antigen-binding fragment thereof specifically binds to human and inhibits binding of TGFp peptide to ανβ8.

[0024] Inhibitory oligonucleotides targeting ITGB8 As discussed above, the present methods can include administering inhibitory oligonucleotides ("oligos") targeting ITGB8 (i.e., ITGB8 mRNA or DNA) to reduce ITGB8 expression. Oligos useful in the methods and compositions of the present invention include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, molecules containing modified bases, locked nucleic acid molecules (LNA molecules), antagomirs, peptide nucleic acid molecules (PNA molecules), mixmers, gapmers, and other oligomeric compounds or oligonucleotide mimetics that hybridize to at least a portion of ITGB8 and modulate its function. In some embodiments, oligos include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides containing modified linkages, interfering RNA (RNAi), short interfering RNA (siRNA), or short hairpin RNA (shRNA), or combinations thereof. See also WO2015 / 051239.

[0025] The sequence of human ITGB8 is known in the art and includes: [Table 1] An exemplary genomic sequence for human ITGB8 is found in NC_000007.14, range 20329766-20415754.

[0026] In some embodiments, the oligos hybridize to at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more consecutive nucleotides of the target sequence.

[0027] In some embodiments, the method involves introducing into cells an oligo that specifically binds to or is complementary to ITGB8. A "specifically" binding nucleic acid primarily binds to its target, i.e., ITGB8 RNA, but not to other non-target RNAs. Thus, the specificity of a nucleic acid interaction refers to its function (e.g., inhibition of ITGB8), not its hybridization ability. The oligo may non-specifically bind to other sites in the genome or other mRNAs without interfering with the binding of other regulatory proteins or causing degradation of the non-specifically bound RNA. Therefore, this non-specific binding does not significantly affect the function of other non-target RNAs and does not result in significant adverse effects. These methods can be used to treat subjects, for example, those at risk of neurodegeneration after acute injury or those with evidence of a chronic neurodegenerative disease, by administering to the subject a composition (e.g., one described herein) containing an oligo that binds to ITGB8. Examples of ITGB8 target sequences are provided above. Exemplary sequences include commercially available shRNAs, such as those from Santa Cruz Biotechnology, as well as the following siRNAs: AATTCTCGAACGTGTCACGT, AACGTCTATGTCAATCGCACA, and CAGCCTGTTTGCAGTGGTCGA (5'-3'), or the following shRNAs shB8-1, or shB8-4: GGAATCTCATTCGATGCATAC, CCAAGCTACTTGAGAATATTT, and TCTCGCTCTTGATAGCAAATT (5'-3') (Malric et al., Mol Cancer Res. 2019 Feb;17(2):384-397).

[0028] In some embodiments, the methods described herein include administering a composition, such as a sterile composition, containing an oligo complementary to the ITGB8 sequence described herein.The oligo used in carrying out the methods described herein is an antisense RNA or small interfering RNA, including but not limited to shRNA or siRNA.In some embodiments, the oligo is a modified nucleic acid polymer (e.g., a locked nucleic acid (LNA) molecule), a gapmer, or a mixmer.

[0029] Oligos have been utilized as therapeutic moieties in the treatment of disease states in animals, including humans. Oligos can be useful therapeutic tools that can be configured to serve as therapeutic regimens for the treatment of cells, tissues, animals, and particularly humans.

[0030] With respect to treatment, an animal, preferably a human, suspected of or at risk for neurodegeneration is treated by administering an oligo in accordance with the present disclosure. For example, in one non-limiting embodiment, the method comprises administering to an animal in need of treatment a therapeutically effective amount of an oligo described herein.

[0031] In some embodiments, the oligos are 10-50, 13-50, or 13-30 nucleotides in length. Those skilled in the art will understand that this embodies oligonucleotides having antisense (complementary) portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any length within that range. It is understood that such oligos may contain non-complementary bases. For example, a 30-nucleotide oligo may contain a 15-base portion complementary to the target ITGB8 RNA. In some embodiments, the oligonucleotide is 15 nucleotides in length. In some embodiments, the antisense or oligonucleotide compounds described herein are 12 or 13-30 nucleotides in length. One of skill in the art will understand that this embodies oligos having antisense (complementary) portions that are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, or any range therein.

[0032] Preferably, the oligos contain one or more modifications including modified sugar moieties, and / or modified internucleoside linkages, and / or modified nucleotides, and / or combinations thereof. Not all positions in a given oligonucleotide need be uniformly modified, and in fact more than one of the modifications described herein can be incorporated within a single oligonucleotide, or even within a single nucleoside within an oligonucleotide.

[0033] In some embodiments, the oligos are chimeric oligonucleotides, containing two or more chemically distinct regions, each composed of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confer one or more beneficial properties (e.g., improved nuclease resistance, increased cellular uptake, improved target binding affinity, etc.), and a region that serves as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. The chimeric oligos described herein can be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides, and / or oligonucleotide mimetics, as described above. Such compounds are also known in the art as hybrids or gapmers. Representative United States patents that teach methods for fabricating such hybrid structures include, but are not limited to, U.S. Patent Nos. 5,013,830, 5,149,797, 5,220,007, 5,256,775, 5,366,878, 5,403,711, 5,491,133, 5,565,350, 5,623,065, 5,652,355, 5,652,356, and 5,700,922, each of which is incorporated herein by reference.

[0034] In some embodiments, the oligos contain at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-O-alkyl, 2'-O-alkyl-O-alkyl, or 2'-fluoro modified nucleotide. In another preferred embodiment, the RNA modification can include a 2'-fluoro, 2'-amino, or 2'-O-methyl modification of the pyrimidine, abasic residue, or ribose of the inverted base at the 3' end of the RNA. Such modifications can be routinely incorporated into oligonucleotides, which have been shown to have higher Tm (i.e., higher target binding affinity) for a given target than 2'-deoxyoligonucleotides.

[0035] Several nucleotide and nucleoside modifications have been shown to render incorporated oligonucleotides more resistant to nuclease digestion than native oligonucleotides, and the modified oligos remain intact for longer periods than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those containing modified backbones, such as phosphorothioates, phosphotriesters, methylphosphonates, short alkyl or cycloalkyl intersugar linkages, or short heteroatom or heterocyclic intersugar linkages. The most preferred oligonucleotides are those having phosphorothioate backbones and oligonucleotides having heteroatom backbones, particularly CH2-NH-O-CH2, CH,~N(CH3)~O~CH2 (known as the methylene(methylimino) or MMI backbone), CH2--O--N(CH3)-CH2, CH2-N(CH3)-N(CH3)-CH2, and ON(CH3)-CH2-CH2 backbones (the native phosphodiester backbone is represented as O-P--O-CH,); amide backbones (see De Mesmaeker et al. Ace. Chem. Res., 1995, 28:366-374); morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbones (in which the phosphodiester backbone of the oligonucleotide is replaced by a polyamide backbone and the nucleotides are attached directly or indirectly to the aza-nitrogen atoms of the polyamide backbone (Nielsen et al., Science 1991,254,1497).Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates, including 3' alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-amino phosphoramidates and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs, and those with reverse polarity, where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,4 See Nos. 05,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.

[0036] Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510; Genesis, Vol. 30, No. 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Patent No. 5,034,506, issued July 23, 1991. In some embodiments, the morpholino-based oligomeric compound is a phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in Iverson, Curr. Opin. Mol. Ther., 3:235-238, 2001; and Wang et al., J. Gene Med., 12:354-364, 2010; the disclosures of which are incorporated herein by reference in their entireties).

[0037] Pharmaceutical Compositions and Methods of Administration The methods described herein can include the administration of pharmaceutical compositions and formulations that include ITGB8 inhibitors and / or oligonucleotides designed to target ITGB8.

[0038] In some embodiments, the composition is formulated with a pharmaceutically acceptable carrier. Pharmaceutical compositions and formulations can be administered parenterally, topically, orally, or by local administration, such as aerosol or transdermal. Pharmaceutical compositions can be formulated in any manner and can be administered in a variety of unit dosage forms depending on the individual patient's condition or the extent of the disease or illness, the general medical condition, and the resulting preferred method of administration. Details of the techniques for formulating and administering pharmaceuticals are well documented in the scientific and patent literature. See, for example, Remington: The Science and Practice of Pharmacy, 21st ed., 2005.

[0039] The oligos can be administered alone or as a component of a pharmaceutical preparation (composition). The compounds can be formulated for administration in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifying agents, and lubricating agents, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening agents, flavoring agents, and perfuming agents, preservatives, and antioxidants can also be present in the composition.

[0040] Formulations of the compositions described herein include those suitable for intradermal, inhalation, oral / nasal, topical, parenteral, rectal, and / or vaginal administration. The formulations can be conveniently provided in unit dosage form and can be prepared by any method well known in the art of pharmacy. The amount of active ingredient (e.g., nucleic acid sequences of the present invention) that can be combined with carrier materials to produce a single dosage form will vary depending on the host treated and the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient that can be combined with carrier materials to produce a single dosage form will generally be the amount of compound that produces a therapeutic effect, e.g., an antigen-specific T cell or humoral response.

[0041] The pharmaceutical formulations of the present invention can be manufactured according to any method known in the art for the manufacture of pharmaceuticals. Such formulations may contain sweeteners, flavorings, coloring agents, preservatives, etc. The formulations may be mixed with non-toxic pharmaceutically acceptable excipients suitable for manufacturing. The formulations may contain one or more diluents, emulsifiers, preservatives, buffers, excipients, etc., and may be provided in the form of liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled-release formulations, tablets, pills, gels, patches, implants, etc.

[0042] Pharmaceutical preparations for oral administration can be formulated using pharmaceutically acceptable carriers known in the art in appropriate dosage amounts. The carriers can be used to formulate the pharmaceutical into unit dosage forms suitable for ingestion by the patient, such as tablets, pills, powders, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc. Pharmaceutical compositions for oral use can be formulated as solid excipients, optionally with the addition of suitable excipients, followed by grinding the resulting mixture and processing the granular mixture to obtain tablets or dragee cores. Suitable solid excipients include carbohydrate or protein fillers, such as sugars such as lactose, sucrose, mannitol, or sorbitol; starches derived from corn, wheat, rice, potato, or other plants; celluloses such as methylcellulose, hydroxypropylmethylcellulose, or sodium carboxymethylcellulose; gums such as gum arabic and gum tragacanth; and proteins such as gelatin and collagen. Disintegrants or solubilizers may be added, such as cross-linked polyvinylpyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Push-fit capsules may contain the active ingredients in admixture with fillers or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol, with or without stabilizers.

[0043] Aqueous suspensions can contain an active agent (e.g., an inhibitory nucleic acid sequence described herein) mixed with excipients suitable for the manufacture of aqueous suspensions (e.g., for aqueous intradermal injections). Such excipients include suspending agents such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth, and gum acacia; dispersing or wetting agents such as naturally occurring phosphatides (e.g., lecithin); condensation products of alkylene oxides with fatty acids (e.g., polyoxyethylene stearate); condensation products of ethylene oxide with long-chain aliphatic alcohols (e.g., heptadecaethyleneoxycetanol); condensation products of ethylene oxide with partial esters derived from fatty acids and hexitols (e.g., polyoxyethylene sorbitol monooleate); or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides (e.g., polyoxyethylene sorbitan monooleate). Aqueous suspensions may also contain one or more preservatives, for example, ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, aspartame, or saccharin. Formulations can be adjusted for osmotic pressure.

[0044] In some embodiments, oil-based pharmaceuticals are used to administer the inhibitory nucleic acid sequences described herein. Oil suspensions may be formulated by suspending the active ingredient in a vegetable oil (such as peanut oil, olive oil, sesame oil, or coconut oil) or a mineral oil (such as liquid paraffin), or a mixture thereof. See, for example, U.S. Pat. No. 5,716,928, which describes the use of essential oils or essential oil components to increase the bioavailability of orally administered hydrophobic pharmaceutical compounds and reduce inter- and intra-individual variability (see also U.S. Pat. No. 5,858,401). Oil suspensions may also contain thickening agents such as beeswax, hard paraffin, or cetyl alcohol. The addition of sweeteners such as glycerol, sorbitol, or sucrose provides a palatable oral formulation. These compositions may be preserved by the addition of antioxidants such as ascorbic acid. For examples of injectable oil vehicles, see Minto (1997) J. Pharmacol. Exp. Ther. 281:93-102.

[0045] Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oil phase can be a vegetable oil or a mineral oil, as described above, or a mixture thereof. Suitable emulsifying agents include, for example, naturally occurring gums such as acacia gum and tragacanth gum, naturally occurring phosphatides such as esters or partial esters derived from soybeans, lecithin, fatty acids, and hexitol anhydrides (e.g., sorbitan monooleate), and condensation products of such partial esters with ethylene oxide, such as polyoxyethylene sorbitan monooleate. Emulsions can also contain sweeteners and flavoring agents, as in the formulation of syrups and elixirs. Such formulations can also contain demulcents, preservatives, and coloring agents. In some embodiments, these injectable oil-in-water emulsions contain paraffin oil, sorbitan monooleate, ethoxylated sorbitan monooleate, and / or ethoxylated sorbitan trioleate.

[0046] Pharmaceutical compounds can also be administered via routes including intranasal, inhalation, powder and aerosol formulations (for examples of steroid inhalants, see, e.g., Rohatagi (1995) J. Clin. Pharmacol. 35:1187-1193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75:107-111).

[0047] In some embodiments, pharmaceutical compounds can also be delivered as microspheres that slowly release in the body. For example, microspheres can be administered via intradermal injection of drugs that slowly release subcutaneously (see, e.g., Rao (1995) J. Biomater Sci. Polym. Ed. 7:623-645), as biodegradable injectable gel formulations (see, e.g., Gao (1995) Pharm. Res. 12:857-863 (1995)), or as oral microspheres (see, e.g., Eyles (1997) J. Pharm. Pharmacol. 49:669-674).

[0048] In some embodiments, pharmaceutical compounds can be administered parenterally, such as intravenously (IV) or intrathecally. These formulations can comprise a solution of the active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be employed include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils can be used as a solvent or suspending medium. For this purpose, any bland fixed oil can be used, including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can similarly be used in the preparation of injectable solutions. These solutions are sterile and generally free of undesirable matter. These compositions can be sterilized by conventional, well-known sterilization techniques. The compositions can contain pharmaceutically acceptable auxiliary substances required to approximate physiological conditions (pH adjusting agents and buffers, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, and the like). The concentration of the active agent in these formulations can vary widely and is selected primarily based on the volume of liquid, viscosity, weight, and the like, depending on the particular method of administration selected and the patient's needs. For IV administration, the preparation can be a sterile injectable preparation, such as a sterile injectable aqueous or oily suspension. This suspension can be formulated using a suitable dispersing or wetting agent and suspending agent. The sterile injectable preparation can also be a suspension in a non-toxic parenterally acceptable diluent or solvent, such as 1,3-butanediol. Administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into the blood vessel for a specified period of time).

[0049] In some embodiments, pharmaceutical compositions and formulations are lyophilized. Stable lyophilized formulations containing oligonucleotides can be produced by lyophilizing a solution containing a pharmaceutical agent described herein and a bulking agent, such as mannitol, trehalose, raffinose, and sucrose, or a mixture thereof. The process for preparing a stable lyophilized formulation includes lyophilizing a solution containing about 2.5 mg / mL of protein, about 15 mg / mL of sucrose, about 19 mg / mL of NaCl, and a sodium citrate buffer with a pH greater than 5.5 and less than 6.5. See, e.g., US20040028670.

[0050] Compositions and formulations can be delivered using liposomes. Liposomes can be used to focus the delivery of active agents to target cells in vivo, particularly if the liposome surface carries target cell-specific receptor ligands or is otherwise directed preferentially to a particular organ. See, for example, U.S. Patent Nos. 6,063,400 and 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13:293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; and Ostro (1989) Am. J. Hosp. Pharm. 46:1576-1587. In the present invention, the term "liposome" refers to a vesicle composed of a bilayer or bilayer-arranged amphiphilic lipids. Liposomes are unilamellar or multilamellar vesicles with a membrane formed from a lipophilic substance and an aqueous interior containing the composition to be delivered. Cationic liposomes are positively charged liposomes that are thought to interact with negatively charged DNA molecules to form stable complexes. pH-sensitive or negatively charged liposomes are thought to entrap DNA rather than complex with it. Both cationic and non-cationic liposomes have been used to deliver DNA into cells.

[0051] Liposomes also include "sterically stabilized" liposomes, i.e., liposomes containing one or more specialized lipids. Incorporation of these specialized lipids into liposomes results in liposomes with increased circulation lifetimes compared to liposomes that do not contain such specialized lipids. Examples of sterically stabilized liposomes include liposomes in which a portion of the vesicle-forming lipid portion of the liposome is composed of one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860.

[0052] The formulations described herein may be administered for prophylactic and / or therapeutic treatments. In some embodiments, for therapeutic applications, a subject at risk for or suffering from a disorder described herein is administered an amount of the composition sufficient to cure, alleviate, or partially inhibit the clinical symptoms of the disorder or its complications. This may be referred to as a therapeutically effective amount.

[0053] An amount of pharmaceutical composition sufficient to accomplish this is a therapeutically effective amount. Effective dosing schedules and amounts, i.e., regimens, for this use will vary depending on a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the patient's general health, physical condition, and age. The method of administration is also taken into consideration when calculating a dosage regimen for a patient.

[0054] The dosing regimen also takes into account pharmacokinetic parameters well known in the art, such as the rate of absorption, bioavailability, metabolism, and clearance of the active agent (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol. 58:611-617; Groning (1996) Pharmazie 51:337-341; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84:1144-1146; Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24:103-108; Remington: The Science and Practice of Pharmacy, 21st ed., 2005). State-of-the-art technology allows the clinician to determine the dosing regimen for each individual patient, active ingredient, and disease or condition being treated. Guidelines provided for similar compositions used as pharmaceuticals can be used as guidance in determining whether the dosing regimen, i.e., dosing schedule and dosage levels, administered in practicing the methods described herein are accurate and appropriate.

[0055] Single or multiple administrations of the formulation can be carried out depending, for example, on the dosage and frequency required and tolerated by the patient, the extent and amount of therapeutic effect (e.g., effect on tumor size or growth) occurring after each administration, etc. The formulation should provide a quantity of active agent sufficient to effectively treat, prevent, or ameliorate the condition, disease, or symptom.

[0056] In some embodiments, the methods described herein may include co-administration with other drugs or pharmaceuticals. For example, an ITGB8 inhibitor can be co-administered with an agent for treating or reducing the risk of a disorder described herein. [Example]

[0057] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0058] Materials and Methods In the examples below, the following materials and methods were used.

[0059] Human brain tissue and neuropathology Frozen brain tissue blocks from the superior parietal gyrus for RNA-seq and chromatin immunoprecipitation DNA sequencing (ChIP-seq) were obtained from the Netherlands Brain Bank (NBB). Donors agreed to donate their brains to NBB. To ensure tissue quality, postmortem dissection time was limited to 10 hours. Paraffin brain tissue sections were obtained from NBB and the Massachusetts Alzheimer's Disease Resource Center (ADRC). This study was approved by the ethics committee of Brigham and Women's Hospital, University of California, San Francisco, and complies with the World Medical Association Declaration of Helsinki on ethical principles for medical research involving human subjects. Neuropathological staging of the brain was performed by NBB and ADRC for tissue selection.

[0060] mouse B6.129P2(Cg)-Cx3cr1 tm2.1(cre / ERT2)Litt / WganJ mice (Cx3cr1-CRE ERT2 , Stock number 021160) 26 , C57BL / 6-Tmem119 em1(cre / ERT2)Gfng / J(Tmem119-CRE ERT2 , Stock number 031820) 76 , B6.129S6-Inpp5d tm1Wgk / J mouse (Inpp5d flox , Stock number 028255) 77 , Smad2 tm1.1Epb / J mice (Smad2 flox , Stock number 022074) 78 and Smad3 tm1Zuk Mouse (Smad3 flox , MGI:3822465) 79 was purchased from The Jackson Laboratory.ERT2 The mice were human APOE knock-in mice and APOE3 mice, respectively. fl / fl Mice and APOE4 fl / fl crossed with mice 18 These transgenic mice were then transgenic for APP / PS1 34 Mouse or P301S 32 The mice were triple crossed with B6.Cg-Tg(Thy1-APPSw, Thy1-PSEN1*L166P)21Jckr(APP / PS1) mice. 34 Mice were kindly provided by Dr. Mathias Jucker (University of Tübingen). B6;C3-Tg(Prnp-MAPT*P301S)PS19Vle / J (P301S, JAX stock number 008169). 32 Mice were crossed with C57BL / 6 mice for over 10 generations. B6.129P2-Apoe tm2(APOE*3)Mae N8 (MGI number 4838571) 80 and B6.129P2-Apoe tm3(APOE*4)Mae N8 (MGI number 4838572) 81 was obtained from Taconic. fl / fl mouse 82 was provided by Daniel Tenen and Junyan Zhang of Beth Israel Deaconess Medical Center. fl / fl mouse 83 was kindly provided by Dr. Thomas Arnold at the University of California, San Francisco. Itgb8-tdT mice were kindly provided by Helen Paidassi at the Université Claude Bernard Lyon 1. 84 Provided by Dr. Cx3cr1-CRE ERT2 Mice were transfected with Inpp5d on both WT and APP / PS1 backgrounds. fl / fl Cx3cr1-CRE mice were crossed with Cx3cr1-cre (stock Tg(Cx3cr1-cre)MW126Gsat / Mmucd, MMRRC_036395-UCD) mice. 85、86 were obtained from the Mouse Resource and Research Center (MMRRC) at the University of California, Davis, and Smad2 floxマウス and Smad3flox All experimental procedures using animals were approved by the Animal Care and Use Committee of Brigham and Women's Hospital, Harvard Medical School.

[0061] Tamoxifen treatment At 6 weeks of age, mice were injected intraperitoneally (ip) with 75 mg / kg tamoxifen (Sigma Aldrich, T5648-5G) dissolved in corn oil daily for 5 consecutive days.

[0062] Microglia isolation Mice were euthanized in a CO2 chamber and transcardially perfused with ice-cold Hank's balanced salt solution (HBSS, Thermo Fisher, 14175103). The entire brain was removed from the skull and sectioned in a sagittal brain matrix for further processing. The left hemisphere was used for classification, and the right hemisphere for immunohistochemistry. The left hemisphere was homogenized to generate a single-cell suspension, which was then resuspended and centrifuged at 800g, 23°C, with an acceleration of 3 and a deceleration of 1 for 25 minutes in a 37% / 70% Percoll Plus (GE Healthcare, 17-5445-02) gradient of HBSS. Mononuclear cells were harvested from the interface layer. Cells were immunoblotted with rat APC-conjugated anti-mouse Fcrls (1:1000, clone 4G11, Butovsky Lab). 21 The cells were stained with PE-Cy7-conjugated anti-mouse CD11b (1:300, eBioscience, 50-154-54) and PerCP / Cy5.5-conjugated anti-mouse Ly-6C (1:300, Biolegend, 128012). - CD11b + Fcrls + Cells were washed and sorted using a BD FACSAria™ II (BD Bioscience). Analysis was performed using FlowJo™ 10. For mice stereotactically injected with apoptotic neurons (AN), a 3x6 mm area was placed around the injection site. 2Coronal slices were harvested. Microglia were enriched using the same method as above. Apoptotic neurons were labeled with Alexa Fluor™ 405 dye. During sorting, phagocytic (AN-Alexa Fluor 405) + Ly-6C - CD11b + Fcrls + ) and non-phagocytic (AN-Alexa Fluor 405 - Ly-6C - CD11b + Fcrls + ) Microglia were collected as previously described. 6 .

[0063] Primary neuron culture Primary neurons were collected from embryonic day 18 (E18) mouse embryos. Cerebral hemispheres were isolated. Meninges were then removed from the hemispheres under a dissecting microscope. The hemispheres were digested with 10 U / mL papain solution at 37°C for 15 minutes and then triturated with a trituration solution consisting of 19 mL Neurobasal medium (Gibco, 21103-049), 133 μL BSA (Sigma, A-9576), 0.5 mL Pen / Strep / Glucose / Pyruvate, and 200 μL DNase (Sigma, D-5025) using a fire-polished glass pipette until a single-cell suspension was created. The suspension was filtered through a 40 μm cell strainer, centrifuged at 400 g for 5 minutes, and resuspended in 1 mL of HBSS. Cell numbers were counted using trypan blue staining (Gibco™, 15-250-061) and a cell counter (Nexcelom). Cells were seeded at approximately 1 million cells per well in a 6-well poly-D-lysine-coated plate in a minimum volume of 2 mL of growth medium made with Neurobasal, 1:50 B-27 supplement (Gibco 17504-044), 1:200 Pen / Strep (Gibco, 15140-122), 1:400 Glutamax (Gibco, 35050-061), and 1:50 fetal bovine serum (FBS, Gibco, 10-438-026). After 24 h of incubation at 37°C, cell viability and contamination were checked under a microscope. Half of the growth medium was replaced with fresh growth medium containing 5 μM Ara-C (Sigma-Aldrich, C1768-100MG) without FBS. After 5 days, half of the medium was removed and replaced with new growth medium without FBS.

[0064] Induction of apoptotic neurons Primary neurons (d7-d10) were typically cultured one week after initiation. Neurons were removed from the plate surface by multiple washes with PBS. They were then incubated under UV light (302 nm) at 6315 W for 20 minutes to induce apoptosis. After this step, the neurons were stored on ice. Cells were collected, pelleted by centrifugation, and resuspended in 1 mL of PBS. Next, protected from light, they were stained with a labeling dye (Alexa Fluor™ 405 NHS Ester, Invitrogen, A3000) for 15 minutes at 37°C. The neurons were then washed, centrifuged, and resuspended. The number of apoptotic cells was determined using trypan blue staining and a cell counter. Neurons were resuspended at a density of 25,000 dead cells per μL of PBS.

[0065] RT-qPCR Total RNA was extracted using the RNeasy Plus Micro Kit (Qiagen, 74034) according to the manufacturer's protocol. Total RNA from human tissues was extracted using the mirVana miRNA Isolation Kit (Invitrogen, AM1560) according to the manufacturer's protocol. For quantitative reverse transcription-polymerase chain reaction (RT-qPCR), RNA was used after reverse transcription (High-Capacity cDNA Reverse Transcription Kit, Applied Biosystems, 436884). Total mRNA amplification was performed using commercially available FAM-labeled Taqman probes for human APOE (Thermo Fisher Scientific, Hs00171168_m1) and mouse Gapdh (Thermo Fisher Scientific, Mm9999915_g1). Real-time PCR reactions were performed using QuantStudio™ 7 (Applied Biosystems). All RT-qPCR runs were performed in duplicate, and mRNA levels were expressed as relative expression normalized to Gapdh as mean ± SEM.

[0066] Stereotactic injection Mice were anesthetized with an intraperitoneal injection of ketamine (100 mg / kg) and xylazine (10 mg / kg). To induce the MGnD paradigm, 2 μl of the apoptotic neuron mixture was injected bilaterally into the hippocampus (ML: ±1.5 mm, AP: -2 mm, DV: -2 mm) and cortex (ML: ±1.5 mm, AP: -2 mm, DV: -1 mm) using a stereotaxic injection device. Animals were processed 16 hours after injection. To knock out PU.1 from microglia, 6- to 8-week-old PU.1 mice were cultured. flox / floxMice were stereotactically injected with TAT-Cre (MilliporeSigma, SCR508) into the cerebral ventricles (ML: ±1 mm, AP: -1 mm, DV: -2.5 mm, 2 μl per injection site, 10 μg / μl, 40 μg per brain). To induce the MGnD paradigm, 5 days after the intravenous injection of TAT-Cre, apoptotic neurons labeled with Alexa Flour™ 405 dye premixed with TAT-Cre were injected into the cortex and hippocampus as described above. Phagocytic and non-phagocytic microglia were sorted from brain regions narrowed to the injection site and subjected to SmartSeq2 analysis. To study the role of PU.1, PU.1 was inhibited using a PU.1 inhibitor (DB1876, MCE, HY-135797A). The PU.1 inhibitor was dissolved in 10% DMSO (Invitrogen, D12345) according to the manufacturer's instructions to a concentration of 2.08 mg / ml (4 mM). 10% DMSO was used as a control. The PU.1 inhibitor or control was injected into the cortex and hippocampus as described above. Seven days later, microglia and astrocytes were isolated from brain regions restricted to the injection site and subjected to IHC and Smart-seq2 analysis. To study the role of MGnD with different APOE alleles in regulating astrocytic responses, apoptotic neurons were injected into the cortex and hippocampus of APOE3-KI, APOE4-KI, and APOE4-cKO mice, and the MGnD paradigm was induced as described above. After 16 hours, phagocytic microglia were sorted from the brain and injected into the hippocampus and subsquamous nucleus of WT mice (ML: ±1.5 mm, AP: -2 mm, DV: -1 and -2 mm, 2 μl per injection site) at 3,000 microglia per injection site. After 16 hours, astrocytes were isolated from the brain region restricted to the injection site and subjected to Smart-seq2 analysis. To study the role of Itgb8, mouse Itgb8 was blocked using an anti-ITgb8 antibody (ADWA11). Mouse IgG1 was used as an isotype control (BioXCell, catalog no. BP0083). Both ADWA11 and IgG1 were diluted to 0.5 μg / μl in sterile PBS.Anti-ITGB8 antibody or isotype control was injected into the cortex and hippocampus (ML: ±1.5 mm, AP: -2 mm, DV: -1 and -2 mm, 2 μL per injection site). 14 days later, microglia were isolated from the brain region restricted to the injection site and subjected to IHC and Smart-seq2 analysis. Fluorescently labeled amyloid b peptide (1-42) (Anaspec, AS-60480-01) was reconstituted with NH4OH and diluted to 1 μg / μL in sterile PBS. The antibody was injected into the cortex and hippocampus (ML: ±1.5 mm, AP: -2 mm, DV: -1 and -2 mm, 2 μL per injection site). Six hours later, phagocytic and non-phagocytic microglia were isolated from the brain region restricted to the injection site and subjected to FACS analysis.

[0067] scRNA-seq Brain tissue isolated from mice after perfusion was performed as previously described. 87Briefly, tissue was minced, and 75 μL of papain suspension (Worthington, LS003126) was diluted with enzyme stock solution (ESS) and incubated in 10 mL of enzyme digestion solution equilibrated to 37°C. 200 mL of ESS medium was prepared by mixing 20 mL of 10x EBSS (Sigma-Aldrich, E7510), 2.4 mL of 30% D(+)-glucose (Sigma-Aldrich, G8769), 5.2 mL of 1 M NaHCO3 (VWR, AAJ62495-AP), 200 μL of 500 mM EDTA (Thermo Fisher Scientific, 15575020), and 168.2 mL of ddH2O, which was filter-sterilized with a 0.22 μm filter. Samples were shaken at 80 rpm for 40 minutes at 37°C. Enzymatic digestion was stopped with 1 mL of 10x ovomucoid inhibitor solution and 20 μL of 0.4% DNase (Worthington, LS002007) diluted in 10 mL of inhibitor stock solution (ISS). 10 mL of 10x ovomucoid inhibitor stock solution contains 300 mg of BSA (Sigma-Aldrich, A8806) and 300 mg of ovomucoid trypsin inhibitor (Worthington, LS003086) diluted in 10 mL of 1x PBS and sterilized by filtration through a 0.22 μm filter. ISS medium contains 50 mL of 10x EBSS (Sigma-Aldrich, E7510), 6 mL of 30% D(+)-glucose (Sigma-Aldrich, G8769), and 13 mL of 1 M NaHCO3 (VWR, AAJ62495-AP), diluted with 170.4 mL of ddH2O, and filter-sterilized using a 0.22 μm filter. Tissue was mechanically dissociated using a 5 mL serological pipette, filtered through a 70 μm cell strainer (Thermo Fisher Scientific, 22363548), and transferred to a new 50 mL conical tube. The tissue was centrifuged at 500 g for 5 minutes and resuspended in 10 mL of 30% Percoll solution (2.7 mL Percoll Plus (GE Healthcare Biosciences, 17-5445-01), 1 mL of 10x PBS, and 6.3 mL of ddH2O). Samples were centrifuged at 800 g with acceleration of 4 and deceleration of 3 for 25 min at 23°C.Samples were loaded onto the 10X Genomics Chromium platform for GEM and cDNA generation, equipped with cell- and transcript-specific barcodes and sequencing libraries constructed using the Chromium Single Cell 3′ Library & Gel Bead Kit v3. Libraries were sequenced using Illumina sequencing. NovaSeq S1 was used, targeting a depth of 100,000 reads per cell. Gene counts were obtained by aligning reads to the mm10 genome (refdata-gex-GCRm38-2020-A) using CellRanger software (v.4.0.0) (10x Genomics). Single-cell clustering and differential expression analysis were performed using Seurat (v.4.0.6) (satijalab.org / Seurat / index.html). 88The analysis was performed using Seurat v4. Cells with more than 200 sequence reads and less than 20% mitochondrial transcripts were selected, and genes with more than two reads across all samples were entered into downstream analyses. Expression counts were normalized using the "LogNormalize" method and scaled to the mitochondrial read count using linear regression implemented in Seurat's "Regress Out" function. Variable genes were identified using the "vst" selection method. Next, the data were centered and scaled, analyzed by principal component analysis (PCA), and dimensionality reduced to the top 30 principal components. Cells were clustered in PCA space using gene expression data implemented in Seurat v4's FindNeighbors and FindClusters commands. This method returned 27 cell clusters, which were visualized on a UMAP created by the top 30 principal components. Differentially expressed genes within each cluster were output by FindAllMarkers. Clusters were identified based on cell-type-specific key signature genes. 26 clusters were reliably assigned, while one cluster did not exhibit a conclusive cell-type signature. For identified astrocytic cells (clusters 3 and 5), the FindMarkers function was used to identify differentially expressed genes comparing clusters 3 and 5. Astrocyte donut plots were created using cutoffs of >2 for Gfap, >3 for Apoe, >1 for Vim, >0.9 for Serpina3n, and >0.9 for Cd9. For identified microglial cells (clusters 1, 4, 9, and 26), cell reclustering was performed to extract variants missing from the original clustering of all cells. The data were then centered and scaled, analyzed by principal component analysis (PCA), and dimensionality reduced to the top 26 principal components. This method returned 11 cell clusters, which were visualized on a UMAP created by the top 26 principal components. Differentially expressed genes in the comparison of homeostatic and MGnD samples were identified by cell type-specific key signature genes using the FindMarkers function.Gene expression was visualized using the FeaturePlot, DittoHeatmap, and VlnPlot functions in Seurat-v4. Zhou et al. 49 and Olah et al. 48 The processed data from Zhou et al. were downloaded from the AD Knowledge Portal and processed using the workflow described above with some adjustments. 49 In this case, cells with a mitochondrial content of 5% or more were removed. 89 For Olah et al., only cells with less than 10% mitochondrial transcripts were selected. (See "Code availability" for detailed instructions.)

[0068] Bulk RNA-seq Smart-Seq2 libraries were prepared by Broad Technology Labs and sequenced by the Broad Genomics Platform. cDNA libraries were sequenced using the Smart-seq2 protocol. 90 RNA sequencing was performed on an Illumina NextSeq500 using the High Output v2 kit, generating 2 × 25 bp reads. Count files (fastq) were downloaded and aligned to the mm10 genome using Salmon (v1.7), and sequencing quality was checked using Multiqc (v1.11). Potential technical outliers were excluded for further analysis. All analyses were performed using DESeq2 (v1.34.00). 91Biological outliers were determined using PCA plots and heatmap visualization and removed for final analysis. Low-abundance genes with an average number of reads per sample below 5 were excluded. Comparisons were performed using LRT, with a cutoff for significant genes of P<0.01 or P<0.05. Heatmaps were visualized using the pheatmap package (v.1.0.12), volcano plots were generated using the EnhancedVolcano package (v1.12.0), and violin plots were generated using the geom_violin function in the ggplot2 package (v3.3.5) (see "Code Availability" for detailed instructions).

[0069] Astrocyte sorting Astrocytes were isolated after perfusion using enzymatic digestion as described in Isolating Mouse Brain Cells for scRNA-seq. Cells were stained on ice in the dark for 30 minutes. The following antibodies were used for negative selection: PE anti-CD45R / B220 (BD, 553089, 1:100), PE anti-Ter119 (Biolegend, 116207, 1:100), PE anti-Olig4 (R&D Systems, FAB1326P, 1:100), PE anti-CD105 (eBioscience, 12-1051-82, 1:100), PE anti-CD140a (eBioscience, 12-1401-81, 1:100), PE anti-Ly6G (Biolegend, 127608, 1:100), PE-Cy7 anti-CD11b (eBioscience, 50-154-54, 1:300), BV421™ anti-CD45 (Biolegend, 103133, 1:100), and Alexa Fluor® 700 anti-O1 (R&D Systems, FAB1327N, 1:100). For positive selection of sorted astrocytes, APC anti-ACSA2 (Miltenyi Biotec, 130-117-535, 1:100) was used.

[0070] Comparison between datasets Lund et al. 75The bulk RNA-seq data from

[2017] was cross-compared with the Itgb8-KO data from WT mice. DEGs (P<0.05, Log2 fold change (FC)>0.25) from both studies were selected and plotted on a scatter plot. MGnD-related genes were compared with those from Kraseman et al. (2017). 6 Linear regressions were calculated using geom_smooth() for the MGnD and M0 genes (see "Code availability" for detailed instructions).

[0071] Ingenuity Pathway Analysis Pathway analysis was performed using Gene Ontology (GO) enrichment analysis (geneontology.org). Differentially expressed genes were used to detect pathways related to biological processes. Differentially expressed genes with corresponding fold changes and adjusted p-values ​​were analyzed using Gene Set Enrichment Analysis (GSEA, gsea-msigdb.org / gsea / index.jsp). 92、93 and Ingenuity Pathway Analysis (IPA, digitalinsights.qiagen.com / products-overview / discovery-insights-portfolio / analysis-and-visualization / qiagen-ipa / ). In IPA, as previously described 21 ,Canonical pathways and biological functions were tested to generate biological networks.

[0072] Nuclei isolation Brain nuclei are identified using previously developed methods 96 The method was followed with slight modifications to isolate brain tissue from frozen human brain. Briefly, approximately 100 mg of brain tissue was dissected on dry ice and immediately homogenized in 10 ml of 1% formaldehyde. The homogenate was fixed for exactly 10 min with shaking, and then quenched by adding glycine to a final concentration of 0.125 M. The fixed brain homogenate was then resuspended in NF1 buffer. 96The nuclei were washed twice with PBS and lysed on ice for 60 minutes. After further separation using a Dounce homogenizer and filtration through a 70 μm cell strainer, the nuclei were placed on a sucrose cushion and centrifuged to remove myelin. The nuclear pellet was then washed twice with FACS buffer (HBSS containing 0.2% BSA) and finally flash-frozen for future use.

[0073] Anti-H3K9ac ChIP-seq Anti-H3K9ac ChIP was performed using the iDeal ChIP-seq kit for Histones (Diagenode, C01010059) according to the manufacturer's instructions with minor modifications. The sonication program was 20 cycles (30 seconds "on", 30 seconds "off") at a high A power setting. Two milliliters of anti-H3K9ac antibody (Millipore, 07-352) was added per IP reaction. DNA libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB, E7103S) according to the manufacturer's instructions. DNA libraries were analyzed using a Qubit 4 Fluorometer (Invitrogen, Q33238) and a 2100 Bioanalyzer DNA system (Agilent). Pooled libraries were sent to Genewiz, Inc., where 2x150bp sequences were sequenced on an Illumina HiSeq platform.

[0074] ChIP-seq data analysis First, the quality of the raw fastq files was checked using Multiqc sequence analysis. Cutadapt (v.4.0) was used to cut the adapters (-a AGATCGGAAGAGCACACGTCTGAACTCCAGTC -AAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT) and the resulting fragments were analyzed using bowtie2 (v.2.3.4.3). 97 Reads were aligned to the mouse genome (mm10) using Sambamba (v.0.8.2). SAM files were then analyzed using98 The BAM files were sorted and filtered using samtools (v.1.15.1). Unmapped and duplicated fragments were discarded. The sorted BAM files were then run on the samtools (v.1.15.1) 99 The BAM files were then indexed using deeptools (v.3.5.0) 100 The data were converted to BigWig files for visualization using . Normalization of all BigWig files was performed against the effective genome size (2652783500 for mouse H3K9ac ChIP-seq). Peak analysis was performed using Macs2 (v.2.2.7) with stringent parameters (-f BAMPE --mfold 5 50 -p 0.001). 101 The analysis was performed using IGV (v. 2.11.4). A master peak file was created to extract counts from the BAM files. For mouse H3K9ac, microglia isolated from three mice were pooled for ChIP. The peak pile threshold for both samples was set to >10, and to determine significantly different peaks, the fold change cutoff was set to >2 or <0.5 (see "Code Availability" for details). Peaks were visualized using IGV (v. 2.11.4), exported as .png, and edited in Adobe Illustrator.

[0075] Lipidomics Polar and nonpolar lipid analysis was performed using a liquid chromatography / mass spectrometry (LC-MS) system coupled to a Shimadzu Nexera X2 U-HPLC (Shimadzu Corp.) and an Exactive™ Plus orbitrap mass spectrometer (Thermo Fisher Scientific). 30K sorted microglia were prepared in 50 μL of isopropanol. After centrifugation, 10 μL of the supernatant was directly injected onto a 100 x 2.1 mm, 1.7 μm ACQUITY BEH C8 column (Waters). The column was isocratically eluted with 80% mobile phase A (95:5:0.1 vol / vol / vol 10 mM ammonium acetate / methanol / formic acid) for 1 minute, followed by a linear gradient to 80% mobile phase B (99.9:0.1 vol / vol methanol / formic acid) over 2 minutes, a linear gradient to 100% mobile phase B over 7 minutes, and then 100% mobile phase B for 3 minutes. Mass spectrometry (MS) was performed using electrospray ionization in positive ion mode with a full scan analysis from 200 to 1100 m / z at a resolution of 70,000 and a data acquisition rate of 3 Hz. Other MS settings were sheath gas 50, source CID 5 eV, sweep gas 5, spray voltage 3 kV, capillary temperature 300 °C, S-lens RF 60, heater temperature 300 °C, microscan 1, automatic gain control target 1 e6, and maximum ion time 100 ms. Raw data were processed using TraceFinder software (Thermo Fisher Scientific) for targeted peak integration and manual review of identified lipid subsets, and Progenesis QI (Nonlinear Dynamics) for peak detection and integration of both known and unknown lipids. Lipid identity was determined based on comparison with reference extracts and indicated by the total number of carbons in the lipid acyl chain and the total number of double bonds in the lipid acyl chain. All analyses were performed using R (v. 4.1.1). By excluding metabolites with missing data in one or more samples, a total of 199 metabolites was reduced to 170. Data were normalized using the Z-score method.Heatmaps of the 170 metabolites were plotted using the pheatmap package (v.1.0.12).

[0076] immunohistochemistry Before tissue excision and fixation, mice were transcardially perfused with cold HBSS. Tissues that were not sufficiently perfused were not further analyzed to eliminate autofluorescence associated with blood contamination. Two different tissue preparation protocols (paraffin embedding for human brain tissue, or microtome free-floating sections) were applied, as previously described. 33 Briefly, sections were blocked for 1 hour at room temperature with PBS containing 20% ​​horse serum (Thermo Fisher Scientific, NC9909742) and 0.3% Triton X-100 (Sigma). Primary antibodies were incubated overnight at 4°C in PBS containing 2% horse serum and 0.3% Triton X-100. The following primary antibodies were used: mouse anti-Aβ (1:300, BioLegend, 803001), chicken anti-GFAP (1:400, Abcam, 4674), mouse anti-phosphorylated tau (1:50, Thermo Fisher Scientific, AT-100, MN1060), goat anti-Iba1 (1:100, Abcam 5076), rabbit anti-Iba1 (1:200, Wako, 019-19741), and mouse anti-HJ3.4B. 102(1:600, Holtzman Lab), rat anti-LAMP1 (1:100, DSHB, 1D4B), rat anti-Dectin1 (1:100, Invivogen, clone: ​​R1-8g7), rabbit anti-APOE (1:400, Cell Signaling Technology, 13366S), rabbit anti-pSmad3 (1:100, Abcam, ab52903), guinea pig anti-Plin2 (1:200, Fitzgerald Industries International, 20R-AP002), goat anti-Serpina3n (1:200, R&D Systems, AF4709), and anti-MHC II (1:200, BioLegend, IA / IE, 107601). Secondary antibodies included Cy2 / Cy3 / Cy5-conjugated donkey anti-mouse / goat / rabbit / rat / chicken / guinea pig antibodies (1:200, all from Jackson Immunoresearch). Sections were imaged with a Zeiss LSM710 confocal microscope using a 20x or 40x objective. Two negative controls were routinely used in the immunostaining procedure: staining with an isotype control antibody followed by a secondary antibody, or staining with the secondary antibody alone. Tissues were applied to slides and mounted using ProLong™ Gold Antifade Mountant with DAPI (Thermo Scientific, P36931) or VECTASHIELD® Antifade Mounting Medium (Vector Laboratories, H-1000), then sealed with a coverslip. Mouse brains from Itgb8-tdT and Smad2 / 3-cKO strains were harvested after transcardial perfusion with 20 mL of cold PBS and 20 mL of cold 4% formaldehyde. Tissues were fixed overnight in 4% formaldehyde at 4°C, followed by overnight incubation in 30% sucrose. Samples were embedded (Tissue-Plus™ OCT Compound, Fisher Scientific, 23-730-571) and cryosectioned at 20 μm. Sections were mounted on glass plates and blocked with 1-2% BSA, 5% donkey serum, and 0.5% Triton X-100 in PBS.Primary and secondary antibodies were diluted in PBS containing 1% BSA and 0.25%–0.5% Triton X-100. The primary antibodies were goat anti-Sox9 (1:300, R&D Systems, AF3075), rabbit anti-Olig2 (1:300, Millipore, AF2418), mouse anti-NeuN (1:300, Millipore, MAB377), rabbit anti-GFAP (1:300, DAKO, Z0334), rat anti-GFAP (1:300, Invitrogen 13-0300), goat anti-Pdgfra (1:300, R&D Systems, AF1062), goat anti-Iba1 (1:300, Novus, NB100-1028), rat anti-Cd68 (1:300, Bio-Rad, MCA1957), and rabbit anti-Apoe (1:300, Abcam, ab183596). Secondary antibodies included Cy2 / Cy3 / Cy5-conjugated donkey anti-mouse / goat / rabbit antibodies (1:200, Jackson Immunoresearch).

[0077] Thioflavin S staining and quantification Free-floating brain sections, 30 μm thick, were incubated in filtered 1% aqueous Thioflavin S (Sigma T1892) for 8 minutes at room temperature. Sections were then washed sequentially with 80%, 95% ethanol, and distilled water. Images of the whole cortex were taken with a Leica Microsystems DMi8 microscope using tile scan. Thioflavin S-positive areas were quantified using an automatic thresholding method with "Otsu" in Fiji. Seven animals per group were analyzed.

[0078] Cresyl violet staining and neuron counting Free-floating brain sections with a section thickness of 30 μm were stained with cresyl violet (Sigma) to estimate neuronal viability. Staining was performed to visualize neurons. Sample slices were incubated in 100% ethanol for 6 minutes, degreased in xylene for 15 minutes, and then degreased again in 100% ethanol for 10 minutes. After rinsing with distilled water, slides were stained with 0.5% cresyl violet acetate for 15 minutes and rinsed again with distilled water. Next, sections were placed in differentiation buffer (0.2% acetic acid in 95% ethanol) for 2 minutes, dehydrated with ethanol and xylene, and fixed in Depex medium. Pyramidal neurons were counted from serial sections at 30 μm intervals in each brain and analyzed using one-way ANOVA with Fisher's LSD post-hoc test. Neuronal viability (%) was quantified relative to the number of pyramidal neurons in age-matched APOE3-KI mice.

[0079] RNAscope The RNAscope® ISH technique was applied to human formalin-fixed, paraffin-embedded (FFPE) sections and mouse 4% PFA-fixed (frozen) sections using the RNAscope® Multiplex Fluorescent Reagent Kit (v2, ACD, 323100), human ITGB8 probe (Hs-ITGB8-XMfa, ACD, 515881), mouse Itgb8 probe (Mm-Itgb8, ACD, 407931), INPP5D probe (Hs-INPP5D, ACD, 465051), negative control probe DapB (ACD, 321831), and positive control probe (Hs-PPIB, ACD, 313901) according to the manufacturer's instructions. The sections were further blocked with PBS containing 5% BSA, 5% normal donkey serum, and 0.3% Triton for 1 h, followed by primary antibodies (anti-GFAP, 1:400, Abcam, 4674; anti-IBA1, 1:200, Wako, 019-19741; anti-HJ3.4B 102Sections were blocked with AlexaFluor 488 donkey anti-mouse (1:300, AlexaFluor 546 donkey anti-goat (1:300, AlexaFluor 546 donkey anti-rabbit (1:300, AlexaFluor 647 donkey anti-mouse (1:300)) overnight at 4°C. Secondary antibodies (AlexaFluor 488 donkey anti-mouse (1:300, AlexaFluor 546 donkey anti-rabbit (1:300, AlexaFluor 647 donkey anti-mouse (1:300)) were applied for 2 hours. After PBS washes, sections were mounted with Fluoromount-G™ mounting medium containing DAPI (Thermo Fisher, 00-4958-02) and sealed with a coverslip.

[0080] Image visualization Images were cropped, merged, and optimized using Fiji, Photoshop CS6 13.0 (Adobe), and placed using Adobe Illustrator CS5 15.1.

[0081] Image analysis To assess the amount of MGnD and neuritic dystrophy, randomly selected 40x magnification images were taken near the injection site of APOE3-KI, APOE4-KI, and APOE4-cKO mice. The Lamp1-positive areas in APOE3-KI and APOE4-KI mice were quantified using an automatic thresholding method using "Otsu" in Fiji. The Lamp1-positive areas were calculated by dividing the area by the Iba1. + Further normalization was performed to the positive area of ​​the cells. Five to seven animals were analyzed per experimental group. CreERT2 / WT :Spi1 fl / wt :APP / PS1 mice and Tmem119 WT / WT :Spi1 fl / wt :APP / PS1 mouse HJ3.4B +To quantify plaque burden, 10x magnification images were taken from the cortex. HJ3.4B-positive areas were quantified using the automatic thresholding method "RenyiEntropy" in Fiji. Clec7a and Iba1-positive areas were quantified using the automatic thresholding method "Moments" in Fiji. Three to six mice were analyzed per experimental group. To assess the abundance of Clec7a, Iba1, and Serpina3N, 10x and 40x magnification images were taken from the cortex of APP / PS1:APOE4-KI mice injected with PU.1 inhibitor or control. The integrated density of Clec7a was measured using Fiji. The automatic thresholding method in Fiji was used to quantify the positive areas ("Moments" for Iba1 and "Triangle / Triangle" for Serpina3N / Gfap). To assess the abundance of Clec7a and phosphorylated tau (AT-100), 40x magnification images were taken from the cortex of P301S:APOE3-KI, P301S:APOE3-cKO, P301S:APOE4-KI, and P301S:APOE4-cKO mice. Clec7a and AT-100-positive areas were quantified using the automatic thresholding method in Fiji's "Triangle" software. Seven to 16 ROIs were analyzed from four animals per experimental group. To assess the abundance of APOE, 40x magnification images were taken from the cortex of P301S:APOE4-KI and P301S:APOE4-cKO mice. APOE-positive areas were quantified using the automatic thresholding method in Fiji's "Triangle" software. Five mice per experimental group were analyzed. To measure the area of ​​Clec7a, Gfap, Apoe, Serpina3n, and Plin2 in the plaque region, images were taken at 20x or 40x magnification from the cortex of APP / PS1:APOE3-KI, APP / PS1:APOE3-cKO, APP / PS1:APOE4-KI, and APP / PS1:APOE4-cKO mice. Images were exported to Fiji, and individual plaques were selected and cropped for analysis. The Clec7a and Gfap-positive areas per plaque were quantified using Fiji's automatic thresholding methods ("RenyiEntropy" for Clec7a and "Otsu" for Gfap).The positive areas for Clec7a and Gfap were further normalized to plaque size in each image. For each experimental group, 55–73 plaques were analyzed for Clec7a and 39–61 plaques for Gfap. + Apoe in cells + or Serpina3n + To quantify the area percentage, 39–61 plaque areas for Apoe and 30–44 plaque areas for Serpina3n were analyzed per experimental group. Positive areas were quantified using the automatic thresholding method in Fiji ("Otsu / Otsu" for Apoe / Gfap and "RenyiEntropy / Triangle" for Serpina3n / Gfap). Overlay areas were calculated using a customized macro in Fiji. To calculate the percentage of Plin2 in Iba1+ cells, Iba1+ and Plin2+ areas were selected by freehand selection and measured in Fiji. Eight to 24 cells were analyzed per group. HJ3.4B + To quantify plaque burden and Lamp1 area, 10x magnification images were taken from the cortex of APP / PS1:APOE3-KI, APP / PS1:APOE3-cKO, APP / PS1:APOE4-KI, and APP / PS1:APOE4-cKO mice. HJ3.4B and Lamp1-positive areas were quantified in Fiji using an automated thresholding method with "Otsu" and "Triangle" separately. The average positive area for each animal was calculated. The number of plaques was quantified using a customized macro in Fiji. Three to six images were taken per animal, and 7 to 14 mice were quantified per group. To quantify GFAP and pSMAD3 in the human brain, 40x magnification images were taken from cortical sections of human AD patients with APOE e3 / 3 and APOE e3 / 4 alleles. For GFAP quantification, individual plaques were selected in Fiji and excised for analysis. GFAP-positive areas per plaque were quantified using the automated thresholding method "Otsu" in Fiji. 43–52 plaques were analyzed per group. For pSMAD3 quantification, individual IBA1 +Cells were selected and excised for analysis in Fiji. + The pSMAD3-positive area per cell was quantified using the automatic thresholding method "Otsu" in Fiji. The pSMAD3-positive area was further analyzed using Iba1. + Normalized to cell area, 27–33 cells were analyzed per group. + Cellular INPP5D and GFAP + To quantify cellular ITGB8 fluorescence, two to three images were collected per sample in the gray matter. Positive areas were quantified using the automatic thresholding method in Fiji ("RenyiEntropy / Triangle" for INPP5D / IBA1 and "Otsu / Triangle" for ITGB8 / GFAP). Overlay areas were calculated using a customized macro in Fiji. Seven to eight samples per sex per group were analyzed for INPP5D, and seven to eight male samples per group for ITGB8. GFAP + To quantify Itgb8 fluorescence in cells, 3–4 images were collected per sample in the cortex of APP / PS1:APOE4-KI and APP / PS1:APOE4-cKO mice. + Itgb8 in astrocytes +Positive areas were quantified using the Fiji autothresholding method with "RenyiEntropy / Triangle" for Itgb8 / Gfap. Overlay areas were calculated using a customized Fiji macro. Three to five mice were analyzed per group. To measure Clec7a and Gfap immunoreactivity, 20x magnified images were taken from the cortex of control and Itgb8-cKO mice. Integrated density was measured in Fiji. Twelve ROIs were analyzed per group. Images were exported to Fiji for analysis. Positive areas for HJ3.4B were quantified using the Fiji autothresholding method "Intermodes." Eight to nine ROIs from five mice were analyzed per experimental group. Positive areas were quantified using the Fiji autothresholding method with "Moments" for Gfap and "RenyiEntropy" for HJ3.4B and Clec7a. Eight ROIs from five mice were analyzed per experimental group. To quantify plaque burden and MHC II area in APP / PS1 brains injected with anti-ITGB8 antibody, 20x and 40x magnification images were taken from cortical sections proximal to the injection site. Images were exported to Fiji, and HJ3.4B or MHC II-positive areas were quantified using the automatic thresholding method "Otsu" in Fiji. Four to seven mice per group were analyzed for MHC II. Eight to nine mice per group were analyzed for HJ3.4B (two independent experiments were combined and normalized to the control group). To quantify plaque, Clec7a, and Gfap area in APP / PS1:APOE4-KI brains injected with anti-ITGB8 antibody, 20x and 40x magnification images were taken from cortical sections proximal to the injection site. The positive areas were quantified using automatic thresholding methods: "Otsu" for Clec7a, "Triangle" for HJ3.4B, and "RenyiEntropy" for Gfap in Fiji. Eleven ROIs were analyzed from 6–7 mice per group. To measure the load of Clec7a, Iba1, Lamp1, Tmem119, and Gfap in the plaque area, 10x or 20x magnification images were taken from the cortex of APP / PS1 and APP / PS1:Inpp5d-cKO mice.Integrated densities were measured using Fiji. Per experimental group, 115–218 plaque areas were analyzed for Clec7a and Iba1, 126–138 plaques for Lamp1 and Tmem119, and 127–154 plaques for Gfap. HJ3.4B in the cortex. + To quantify plaque burden, 10x magnification images were taken from the cortex of APP / PS1 and APP / PS1:Inpp5d-cKO mice. HJ3.4B-positive areas were quantified using the "Otsu" automated thresholding method in Fiji. Seven mice per experimental group (three ROIs per mouse) were analyzed.

[0082] statistical analysis The experimental sample size was selected based on previous publications using analyses of APP / PS1 and P301S mice and humans, and effect sizes and expected variances were defined. Statistical analyses were performed using GraphPad Prism statistical software. All comparisons were assessed for normal distribution. Student's t-tests were used for comparisons of only two groups, and one-way analysis of variance with Fisher's LSD post hoc test was used for comparisons of multiple groups.

[0083] Example 1. APOE4 inhibits microglial responses to acute neurodegeneration We recently demonstrated that APOE expression by microglia is regulated by TGFb signaling. 21 We demonstrated that it is required for the switch in microglial phenotype from homeostatic microglia to MGnD in neurodegeneration. 6To study the role of APOE variants in regulating microglial signatures, we sorted microglia from 4-month-old APOE3-KI and APOE4-KI-untreated mice. Bulk RNA sequencing (RNA-seq) analysis of isolated microglia confirmed significant upregulation of homeostatic genes, such as Tgfbr2, Inpp5d, Spi1, and Smad3, in APOE4 microglia compared with 4-month-old APOE3 microglia (Figure 1a, b). Epigenetic analysis of genomic DNA bound to lysine 9-acetylated histone 3 (H3K9ac) by anti-H3K9ac chromatin immunoprecipitation (ChIP) sequencing of isolated microglia revealed that APOE4 microglia exhibited reduced chromatin acetylation compared with APOE3 microglia. Furthermore, genomic regions associated with homeostatic microglial properties, such as Inpp5d, Havcr2, and Smad3, were shown to be enriched in H3K9ac in APOE4 microglia compared with APOE3 microglia. To investigate the effects of APOE variants on microglial responses to acute neurodegeneration, we injected apoptotic neurons into the brains of APOE3 and APOE4 KI mice and sorted phagocytic and non-phagocytic microglia from the injection site (Figure 1c). FACS analysis of the injection site using the microglia-specific marker Fcrls was performed. 6、21、22 Compared with APOE3 microglia, Fcrls + / CD11b +We demonstrated that engulfment of dead neurons by APOE4 microglia was impaired (Figure 1d, e). Using bulk RNA-seq analysis of isolated microglia, APOE3 engulfing microglia showed an induction of the MGnD profile compared with non-engulfing microglia isolated from the same mice (Figure 1f, g). However, APOE4 engulfing microglia failed to induce the MGnD response of key genes, such as Clec7a, Itgax, Lilr4b, Lpl, and Spp1 (Figure 1g). Furthermore, APOE4 microglia failed to upregulate the expression of genes related to phagocytosis, antigen presentation, interferon-γ (IFNg) signaling, and autophagosome maturation in response to the engulfment of apoptotic neurons (Figure 1h). Ingenuity pathway analysis (IPA) comparing phagocytic APOE3 and APOE4 microglia with non-phagocytic APOE3 and APOE4 microglia revealed a dysfunctional response of APOE4 microglia to engulfment of dead neurons and antigen presentation. 23 and microglia 24 It has been shown to promote the accumulation of enlarged late endosomes in AD and inhibit the clearance of amyloid plaques in AD transgenic mice. 25 Therefore, we performed immunohistochemistry of microglia at the injection site and found that Iba1 microglia were more prevalent than APOE3 microglia. + APOE4 and Lamp1 in microglia + We detected lysosomal accumulation (Fig. 1i, j). Furthermore, APOE4 microglia exhibited impaired responses to acute neurodegeneration, and exhibited reduced phagocytic Iba1 activity at the injection site compared to APOE3 microglia. + The number of cells was shown to be reduced (Fig. 1i). To clarify the cell-autonomous role that APOE4 expressed in microglia plays in regulating microglial phenotype and function, we investigated the Cx3cr1 CreERT2 mouse 26 APOE3-KI fl / fl (APOE3-cKO) mice and APOE4-KI fl / flThese mice were crossed with APOE4-cKO (APOE4-cKO) mice, which were recently described and used to study the role that astrocyte-expressed APOE variants play in regulating multiple cellular phenotypes in neurodegeneration and tauopathy. 20 . Cx3cr1 CreERT2 / WT and Cx3cr1 WT / WT APOE3-KI expressing gene fl / fl Mice and APOE4-KI fl / fl Mice were treated with tamoxifen (TAM) at 1.5 months of age to conditionally delete mutant APOE in microglia. Eight-month-old mice were injected with apoptotic neurons into the cortex and hippocampus (Figure 1m). FACS analysis of cells isolated from the injection site revealed significantly higher Fcrls expression in APOE4-cKO mice compared with APOE4-KI mice. + / Cd11b + Increased microglial recruitment was demonstrated (Fig. 1n). Conditional deletion of APOE4 in microglia restored expression of key MGnD genes and down-regulated homeostatic genes in response to engulfment of apoptotic neurons (Fig. 1o).

[0084] Example 2. APOE4 inhibits microglial responses to neurodegeneration via PU.1 The SMAD3 promoter has previously been reported to be less acetylated in the prefrontal cortex of humans with AD compared with controls. 27 Spi1, also known as PU.1, binds to SMAD3 and establishes a homeostatic gene regulatory landscape in microglia. 28 Importantly, recent GWAS studies have suggested that low expression of PU.1 is protective against AD. 29 To investigate whether high expression of Spi1 in APOE4 microglia (Fig. 1a) maintains a homeostatic signature, we conditionally deleted microglial Spi1 in 2-month-old mice intracranially injected with fluorescently labeled apoptotic neurons as a model of acute neurodegeneration. 6(Fig. 2a). Spi1 deletion in microglia enhanced the expression of MGnD genes, including Clec7a, while homeostatic genes, including Tgfb1, Cd33, and Inpp5d, were downregulated (Fig. 2b). Furthermore, by comparing Spi1 deletion with APOE4 deletion in phagocytic microglia (Fig. 1o), we identified common MGnD and homeostatic genes that were induced and downregulated, respectively, in both conditions (Fig. 2c). To verify the enhanced MGnD response to amyloid pathology, we used APP / PS1:Tmem119. CreERT2 Mice and Spi1 fl / WT Mice were mated and treated with tamoxifen at 1.5 months of age, and plaque lesions were assessed at 4 months of age (Fig. 2d, e). Microglial Spi1 deletion in APP / PS1 mice reduced plaque burden and increased Clec7a expression around amyloid plaques. + This resulted in enhanced MGnD (Figure 2d-g). This was further validated by RNA-seq analysis of microglia isolated from APP / PS1:APOE4-KI mice treated with a PU.1 pharmacological inhibitor, demonstrating induction of the MGnD signature and suppression of homeostatic genes (Figure 2h). Immunohistochemical analysis of mouse brains demonstrated enhanced expression of Clec7a, Serpina3n, and Serpina4a around amyloid plaques. + Enhanced MGnD responses and increased astrocyte activation were observed (Fig. 2i-m). Taken together, these results suggest that APOE4 predisposes microglia toward a homeostatic signature that counteracts the microglial response to acute neurodegeneration, and that targeting microglial APOE4 or PU.1 can restore MGnD induction.

[0085] Example 3. Microglial APOE4 deletion restores MGnD responses and promotes neuroprotection against chronic neurodegeneration Neurodegeneration is a pathological hallmark of AD pathology 30 , and is exacerbated in APOE4-expressing mouse models of tauopathy 20,31 To analyze the effects of microglial APOE variants on tau-induced neurodegeneration, we investigated the Cx3cr1 CreERT2 / WT:APOE3-KI fl / fl Mice and Cx3cr1-CRE ERT2 / WT :APOE4-KI fl / fl The mice were crossed with P301S mice, which develop tau pathology and neurodegeneration between 6 and 9.5 months of age. 32 These mice were treated with tamoxifen at 1.5 months of age and evaluated at 9 months of age (Fig. 3a). qPCR analysis revealed that Cx3cr1 CreERT2 Deletion of the human APOE gene in microglia was confirmed (Figure 3b). There was no significant difference in APOE immunoreactivity when comparing P301S:APOE3-KI and P301S:APOE4-KI mice. Microglia sorted from the brains of 9-month-old P301S:APOE3-KI mice upregulated key MGnD genes, such as Clec7a and Itgax, and downregulated TGFβ signaling molecules, such as Smad3 and Tgfb1, compared with microglia isolated from WT:APOE3-KI mice (Figure 3c). In contrast, microglia from P301S:APOE4-KI mice displayed reduced MGnD and increased TGFβ signaling signatures compared with microglia from age-matched P301S:APOE3-KI mice (Figure 3c). Immunohistochemical analysis confirmed decreased Clec7a immunoreactivity in cortical microglia in P301S:APOE4-KI mice and increased tau hyperphosphorylation compared with age-matched P301S:APOE3-KI mice (Fig. 3d, e). Previous studies have shown that brain regions of P301S:APOE4-KI mice show significant neurodegeneration compared with 9.5-month-old P301S:APOE3-KI mice, although the MGnD phenotype was similar between the two groups. 20,31 We found that conditional deletion of APOE4 in microglia was sufficient to restore Clec7a immunoreactivity and the MGnD expression signature in P301S mice, which was associated with reduced tau hyperphosphorylation (Figure 3d-f). To examine the effects of microglial deletion in APOE mutants on neurodegeneration, we performed a multivariate analysis of the tau-like phenotype in P301S mice, as previously described. 33We quantified cresyl violet-stained neurons in cortical layer 5. P301S:APOE4-KI mice showed increased neuronal loss in cortical layer 5 compared with P301S:APOE3-KI mice, whereas P301S mice lacking microglial APOE4 showed significantly reduced neuronal loss compared with age-matched P301S:APOE4-KI mice (Figure 3g, h). These results suggest that APOE4 expression in microglia is important for the MGnD response to tau-mediated neurodegeneration in the cortex and that APOE4 deletion in microglia delays neuronal loss.

[0086] Example 4. Microglial deletion of APOE4 restores MGnD microglia and promotes Ab plaque clearance in APP / PS1 mice APOE4 has been shown to promote Ab plaque pathology in both mouse models and AD brains 8、9、10、11、12、13 To investigate the cell-intrinsic regulation of APOE4 in microglia, we used the APP / PS1 mouse model, which develops plaque pathology at 2 months of age. 34 , Cx3cr1 CreERT2 / WT :APOE3-KI fl / fl Mouse and Cx3cr1 CreERT2 / WT :APOE4-KI fl / flWe crossed these mice with APP / PS1:APOE3-cKO and APP / PS1:APOE4-cKO mice, respectively, and designated them APP / PS1:APOE3-cKO and APP / PS1:APOE4-cKO mice. These mice were treated with tamoxifen at 1.5 months of age and evaluated at 4 months of age to verify the deletion of human APOE in microglia (Figure 4a, b). RNA-seq analysis of sorted microglia demonstrated restoration of the MGnD signature in APP / PS1:APOE4-cKO mice compared with APP / PS1:APOE4-KI mice (Figure 4c). To characterize the microglial response in APP / PS1 mice in more detail, we utilized single-cell RNA-seq of brain cells isolated from APP / PS1:APOE4-KI and APP / PS1:APOE4-cKO mice. We applied unsupervised clustering and identified six clusters exhibiting microglia-like expression profiles. To distinguish peripherally recruited myeloid cells and border-associated macrophages (BAMs) from microglia, we reclustered all microglia-like cells and identified Ms4a7 + and Mrc1 + macrophages 35,36 and Lyve1 + BAM cells 37,38 Among all microglia, we identified three major subtypes, which we named 1) M0 (homeostatic microglia) expressing Tmem119, P2ry12, and Gpr34, 2) MGnD expressing Clec7a and Spp1, and 3) interferon microglia enriched in Stat1, Irf7, and Ilfit1. Restoration of the MGnD phenotype in APP / PS1:APOE4-cKO was confirmed by HJ3.4B. + Aβ plaque pathology (Figure 4D) and Lamp1 + This was accompanied by a significant reduction in dystrophic neurites (Figure 4E). + Immunoreactivity of dystrophic neurites was enhanced in APOE3-deficient microglia (Figure 4E). Induced pluripotent stem cell-derived APOE4 microglia were shown to accumulate lipid droplets that disrupt the coordinated microglia-neuron crosstalk required to maintain neural population homeostasis. 39To investigate whether APOE4-KI microglia exhibit an altered metabolic profile, we performed lipidomic analysis of microglia sorted from mice carrying APOE mutants on the APP / PS1 and WT backgrounds. Compared with APOE3-KI microglia, increased levels of specific lipid species were detected in APOE4-KI microglia, which were more pronounced on the APP / PS1 background. Furthermore, recent studies have identified APOE4-driven dysregulation of lipid metabolism in human astrocytes and microglia. 24 This may be exacerbated by AD pathology. Immunohistochemistry confirmed increased accumulation of Plin2 lipid droplets in microglia from APP / PS1:APOE4-KI mice. Conditional deletion of APOE4 in microglia reduced this accumulation. Collectively, these results suggest that MGnD microglia play a beneficial role in limiting AD pathology, a role that is inhibited by APOE4, and that deletion of APOE4 in microglia is sufficient to restore the MGnD response to phagocytic stress and neurodegeneration.

[0087] Example 5. Microglial APOE4 deficiency promotes astrocyte activation and Ab plaque inclusion via Lgals3 signaling APOE4 expression in astrocytes has been shown to be associated with metabolic dysfunction and contribute to tau pathology 20 However, the impact of microglial APOE4 on astrocyte phenotype and function remains unclear. Using scRNA-seq analysis of brain cells isolated from APP / PS1:APOE4-KI vs. APP / PS1:APOE4-cKO mice, we detected two astrocyte clusters (3 and 5). Cluster 3 was enriched for key reactive astrocyte genes, including Gfap, Vim, Fabp7, Cd9, and Serpina3n, compared with cluster 5. 40(Fig. 5a). Microglial APOE4 deletion further induced the expression of Apoe, Ttr, Cd9, Vim, Gfap, and Serpina3n in cluster 3 (Fig. 5b). The most induced gene in cluster 3 was Ttr (Fig. 5b), an APOE transporter involved in the inhibition of Ab fibrillation. 41 Notably, in APP / PS1:APOE4-cKO, cluster 3 astrocytes significantly downregulated Vegfa (Fig. 5b), indicating that this disrupts the integrity of the blood-brain barrier. 42 Furthermore, microglial deletion of APOE4 leads to the expression of Gfap Hi / Apoe Hi , Gfap Hi / Serpina3n Hi , Gfap Hi / Vim Hi , and Gfap Hi / Cd9 Hi The proportion of astrocytes was increased (Fig. 5c). IPA analysis of astrocytes from APP / PS1:APOE4-cKO mice showed upregulation of metabolic pathways for cholesterol biosynthesis, response to oxidative stress, and HIF1a and IGF-1 signaling (Fig. 5d). IHC analysis showed that Gfap immunoreactivity around plaques was reduced in APP / PS1:APOE4-KI mice compared with APP / PS1:APOE3-KI mice, whereas Gfap immunoreactivity was restored in APP / PS1:APOE4-cKO mice (Fig. 5e-f). Immunostaining for human APOE protein and Gfap revealed that Iba1 in APP / PS1:APOE3-cKO and APP / PS1:APOE4-cKO mice was significantly reduced, despite APOE immunoreactivity being detected in plaques and astrocytes. + APOE deletion in microglia was confirmed (Fig. 5e). +Astrocyte APOE immunoreactivity was also restored in APP / PS1:APOE4-cKO mice (Fig. 5e, g), confirming the results of scRNA-seq analysis (Fig. 5b). Furthermore, APP / PS1:APOE3-cKO and APP / PS1:APOE4-KI mice showed significantly higher levels of Gfap than APP / PS1:APOE3-KI mice. + Serpina3n protein expression in astrocytes was reduced (Fig. 5h, i). On the other hand, APOE4 deletion in microglia reduced the expression of Gfap, which encapsulates Ab plaques. + increased Serpina3a in astrocytes (Fig. 5h).

[0088] To address the impact of direct microglia-astrocyte crosstalk via APOE3 and APOE4 alleles expressed in microglia, we transplanted MGnD-engulfing microglia collected from APOE3-KI, APOE4-KI, and APOE4-cKO donor mice injected with apoptotic neurons into WT naive mice (Figure 5j). Sixteen hours later, astrocytes were isolated from the injection site and analyzed by bulk RNA-seq. We found that APOE4-MGnD-injected mice exhibited reduced expression of astrocyte activation markers, such as Serpina3n and Gfap, compared with APOE3-MGnD-injected mice (Figure 5k). Importantly, deletion of APOE4 in microglia restored crosstalk with astrocytes and induced classical astrocyte activation molecules, such as Serpina3n, Cd9, and Gfap (Figure 5l). IPA analysis confirmed that IGF-1 was the most activated upstream regulator, while TGFb1 was the most suppressed upstream regulator in astrocytes in response to APOE4-cKO MGnD (Figure 5m). Together, these findings support the important role that Lgals3-expressing MGnD microglia play in promoting astrocyte activation and recruitment to plaques.

[0089] Example 6. Impaired induction of MGnD signature and astrocyte activation in APOE e4 AD carriers Women with the APOE4 allele have been shown to be at higher risk of developing AD and have more rapid disease progression compared to male carriers of APOE e4. 8 To study APOE4-related sex differences in AD subjects, we used RNA-seq analysis of whole human brains. In AD brains of men with the APOE e3 / 4 allele, expression levels of MGnD genes, such as CLEC7A, AXL, LYZ, CD300LG, and HLA-DQB2, were significantly decreased, whereas ITGB8, an upstream regulator of TGFβ signaling, was more induced compared to APOE e3 / 3 brains (Figure 6a). We also found significantly increased GRN expression in APOE e3 / 4 men, which has previously been reported to correlate with reduced microglial activation in humans. 45 Furthermore, consistent with the reduced astrocyte activation in APP / PS1:APOE4-KI mice, we found decreased expression of S100A, GFAP, and VIM in female APOE e3 / 4 AD brains (Fig. 6b, c). Importantly, several AD risk factors, such as ABCA7, IFNAR1, APP, BIN1, CD33, and HAVCR2, were among the top up-regulated genes in female APOE e3 / 4 AD brains (Fig. 6b, d). HAVCR2 is a cancer-related gene. 46 It encodes the checkpoint molecule T cell immunoglobulin mucin-3, one of the most promising new therapies for AD, and was recently identified as an AD risk gene in a GWAS study. 4 Furthermore, downstream adaptors of TGFβ signaling 47 SMAD3, a phosphodiesterase inhibitor, was upregulated in APOE e3 / 4AD female brains (Fig. 6b, d). KEGG pathway analysis of female microglial RNAseq data showed enrichment of pathways related to neurodegenerative diseases, reactive oxygen species, phagosome formation, and protein degradation in APOE e3 / 3AD carriers (Fig. 6e). Publicly available human brain scRNAseq data 48showed that expression of TGFβ signaling genes and downstream AD risk factors, including INPP5D, was increased in female APOE e3 / 4 carriers. Meanwhile, MGnD genes, such as APOE, SPP1, and HLA-DQB1, were decreased in female APOE e3 / 4 carriers (). Importantly, Zhou et al. 49 Similar observations were found in an independent cohort reported by

[14] , which showed increased expression of SPI1, TGFB1, and GRN in microglia from APOE e3 / 4-expressing AD brains (Figure 6f). Furthermore, RNAscope analysis revealed increased expression of IBA1 in APOE e3 / 4 AD carriers compared with APOE e3 / 3 AD carriers. + We confirmed that microglia express the homeostatic checkpoint INPP5D in an increased manner. These human findings are consistent with our previous results showing enhanced Spi1 expression in APOE4-KI mice (Figure 1a) and restoration of the MGnD signature after genetic deletion of Spi1 (PU.1) in mice receiving apoptotic neurons. PU.1 has been shown to bind to SMAD3 and promote maintenance of the microglial homeostatic signature. 50 Importantly, we detected increased SMAD3 expression in female APOE e3 / 4 brains (Fig. 6b), suggesting that PU.1 promotes TGFβ regulation in APOE e3 / 4 AD carriers, supporting previous observations that higher SPI1 expression is associated with earlier AD onset. 29 Immunohistochemical analysis revealed that IBA1 in women with APOE e3 / 4AD + SMAD3 activation and pSMAD3 immunoreactivity in microglia were confirmed (Fig. 6g, h). We also confirmed that GFAP immunoreactivity associated with Ab plaques was reduced in female APOE e3 / 4 brains compared to APOE e3 / 3 brains (Fig. 6i, j). Public snRNA-seq data for astrocytes in AD brains expressing the APOE e3 / 3 and e3 / 4 alleles. 49 Analysis of the GFAP gene revealed that APOE e3 / 3 donors had a significantly higher GFAP gene expression level than APOE e3 / 4 donors. Hi and SERPINA3+ An increased proportion of astrocytes was confirmed (Figure 6k). Furthermore, astrocyte activation genes such as CST3, HSP90AB1, and ALDOC were decreased, and TGFb1 signaling-related genes TGFBR3, TGFB2, and ITGB8 were significantly increased in APOE e3 / 4 subjects (Figure 6l). To confirm the increased ITGB8 expression level in astrocytes, we performed RNAscope analysis and found that GFAP expression was significantly higher in APOE e3 / 4 compared to APOE e3 / 3 AD men. + We detected induction of ITGB8 in astrocytes (Figure 8A-Ci). Furthermore, RNAscope showed that Itgb8 expression was reduced in astrocytes from APP / PS1:APOE4-cKO mice compared with APP / PS1:APOE4-KI mice (Figure 8D-E). Taken together, these findings indicate increased TGFβ signaling in APOE4 carriers, which may promote the development of AD through inhibiting the response of MGnD microglia and astrocytes to neurodegeneration.

[0090] Example 7. Deletion of ITGB8-TGFb signaling promotes MGnD response and Aβ phagocytosis To gain molecular insight into the role of APOE4-mediated induction of TGFb signaling in the AD brain, we investigated the latent TGFb1 signaling pathway in WT and APP / PS1 mice. 51 We genetically and pharmacologically inhibited ITGB8, which is important for the activation of . 52 In agreement with Itgb8 - TdTomato reporter mice showed strong expression of Itgb8 in cortical astrocytes, mature oligodendrocytes, and oligodendrocyte precursor cells, but not in microglia, neurons, or endothelial cells. Cre :Itgb8 fl / fl In mouse cortex-specific deletion of the Itgb8 gene (Itgb8-cKO), homeostatic Tmem119 +While microglia were completely abolished, Clec7a was highly expressed in cortical microglia (Figure 7a). This mouse model allowed us to investigate the effects of Itgb8 deletion in the cortex and hippocampus, while leaving the rest of the brain unaffected. This is particularly important for distinguishing microglial responses between affected and unaffected regions within the same brain. Our data validate that MGnD was induced only in the affected regions, i.e., the cortex and hippocampus. Furthermore, Clec7a was downregulated in the cortex of Itgb8-cKO mice. + Increased Gfap immunoreactivity was also observed, colocalizing with MGnD microglia (Fig. 7b-d). RNA-seq of cortical microglia revealed induction of MGnD-related genes (Apoe, Cd300ld, Cd74, Axl), whereas homeostatic genes (Tmem119, Siglech, Mertk, Havcr2) were suppressed (Fig. 7e). Notably, cortical microglia from Itgb8-cKO mice did not express the peripheral monocyte lineage gene Ms4a3. 53 This is in line with the previously published Nestin-CRE:Itgb8 fl / fl Mouse model 44 This confirms that microglia were not replaced by peripheral monocytes, as shown in

[10] . Functional characterization revealed that phagosome formation, antigen presentation, chemokine signaling, and IFNg signaling were induced in cortical microglia from Itgb8-cKO mice. Further characterization of microglia was performed using the acute response to neurodegeneration induced by intracranial injection of apoptotic neurons. 6 We found that antigen presentation and IFNg signaling-related genes were upregulated in Itgb8-cKO mice compared with control mice. Furthermore, Itgb8 deletion promoted microglial Ab phagocytosis in response to acute intracranial Ab injection (Fig. 9A). We focused on Smad3 as a regulator of the microglial homeostatic signature downstream of TGFb. 21、28、50 We found that Smad3 phosphorylation was reduced and Apoe immunoreactivity was increased in Itgb8-KO mice (Fig. 7g-i). fl / flUsing mice, we confirmed that deletion of Smad2 / 3 in microglia suppressed the expression of the microglial homeostatic molecule Tmem119 and enhanced the expression of MGnD molecules such as Cd68 and Apoe, which are associated with astrocyte activation. Cre :Itgb8 fl / fl The gene expression profile of mouse cortical microglia was similar to that of Tgfbr2-cKO microglia (Fig. 6j) and previously published Nrros-KO 54 The microglial transcriptomes of the Itgb8 and Smad2 / 3-cKO mice (Figure 10A) were highly similar (R = 0.89, P < 2.2e-16). Importantly, AD risk factors, including Bin1, Inpp5d, and Havcr2, were reduced in all datasets (Figure 7j, Figure 10B). The reproducibility of the microglial gene expression profiles indicates that focal deletion of Itgb8 suppresses TGFβ signaling, leading to the induction of the MGnD phenotype.

[0091] Example 8. Microglial homeostatic checkpoint Inpp5d deletion promotes plaque clearance via induction of the MGnD response Induction of MGnD gene expression in microglia lacking Itgb8, Tgfbr2, Nrros, or Smad2 / 3 was associated with suppression of AD risk factors, including Bin1, Havcr2, and Inpp5d. 3、4 Furthermore, APOE4 microglia showed increased Inpp5d expression levels (Fig. 1a) and increased histone acetylation at the Inpp5d locus. To investigate the impact of microglia-specific Inpp5d on AD pathology and MGnD responses, we investigated the effects of Cx3cr1 CreERT2 / WT :Inpp5d fl / fl We crossed APP / PS1 mice with APP / PS1 mice. Microglial deletion of Inpp5d-induced MGnD responses in APP / PS1 mice was associated with reduced Ab plaque burden as measured by thioflavin S and HJ3.4b staining. Furthermore, Inpp5d-deficient microglia showed increased Clec7a immunoreactivity in association with Ab plaques. Importantly, microglial deletion of Inpp5d reduced Lamp1 expression in APP / PS1 mice.+ Furthermore, the increased MGnD response associated with Ab plaques was sufficient to reduce dystrophic neurites. + Similarly, a recent study showed that microglial deletion of Inpp5d prevents plaque-induced neurodystrophy in transgenic AD mice. 55,56 These results support the role of Inpp5d as a microglial homeostatic checkpoint and that its deletion is beneficial in alleviating AD pathology through the induction of the MGnD response.

[0092] Example 9. Inhibition of ITGB8-TGFb signaling enhances MGnD responses and attenuates AD pathology in APP / PS1 mice To test whether microglial activation and enhanced phagocytosis could alleviate AD pathological features in adult APP / PS1 mice, we administered an anti-ITGB8 neutralizing mAb (ADWA-11). 57 Three days after injection into 4-month-old APP / PS1 mice, microglia increased antigen presentation and IFNg signaling (Fig. 7k, l). Immunohistochemical analysis revealed that MHC-II activity around the injection site was significantly increased. + Increased immunoreactivity was confirmed (Figure 9B). Furthermore, 14 days after injection, we found that plaque size was significantly reduced in the anti-ITGB8 mAb-injected group compared with the control group (Figure 7m, n). In APOE4-KI:APP / PS1 mice, treatment with anti-ITGB8 mAb restored the induction of Clec7a and GFAP, which are associated with reduced plaque lesions (Figure 7o, p). Overall, these results strongly support the critical role of ITGB8-TGFb signaling in regulating the MGnD response in AD pathology. Therefore, pharmacological targeting of ITGB8-TGFb signaling in AD may promote MGnD responses and astrocyte activation, providing a novel approach for therapeutic modulation of innate immunity in AD and dementia.

[0093] Example 10. Targeting ITGB8-TGFb signaling prevents cognitive decline in 5xFAD mice Microglia and astrocytes play important roles in brain physiology, but they can also promote central nervous system (CNS) pathology in neurological diseases. APOE4 is the strongest genetic risk factor for late-onset AD. We demonstrate that APOE and TGFβ regulate neurodegenerative microglia (MGnD) in preclinical models of AD. 6,22,31 Disease-associated microglia (DAM) 7 Astrocytes also respond to neurodegeneration, expressing disease-associated astrocytes (DAAs) associated with amyloid-β (Aβ) plaques. 40 Furthermore, reactive astrocytes have been shown to play a beneficial role in limiting AD pathology, and a reduction in reactive astrocytes in AD mice resulted in increased plaque burden, synaptic dysfunction, and memory loss. 64 The present inventors discovered that integrin subunit β8 (ITGB8), induced in astrocytes in the APOE4 brain environment, activates microglial TGFb signaling, locking them into a homeostatic state and thereby inhibiting responses to neurodegeneration. As described in Examples 1-9, the microglial APOE4-ITGB8-TGFb pathway is identified as a negative regulator of the microglial response to AD pathology, and reversing the MGnD phenotype by inhibiting ITGB8-TGFb signaling represents a promising therapeutic intervention for AD.

[0094] To test whether microglial activation and enhanced phagocytosis could alleviate AD pathological features in adult APP / PS1 mice, we used an anti-ITGB8 neutralizing mAb (ADWA-11). 57 Three days after injection into 4-month-old APP / PS1 mice, microglia increased antigen presentation and IFNg signaling, which have recently been shown to play a key role in inducing a pre-MGnD subset that limits neurodegenerative pathology and preserves cognitive function in an AD mouse model. 105Furthermore, we found that 14 days after injection of anti-ITGB8 mAb, the size of Ab plaques was significantly reduced (see above).

[0095] Furthermore, the 5xFAD mouse is a widely used model to study amyloid pathology associated with synaptic dysfunction, neurodegeneration, and cognitive impairment. 104 We treated ADWA-11 and wild-type mice (n = 15 / group) to determine whether ADWA-11 could ameliorate cognitive decline present in AD pathology. Treatment began at 4 months of age with either ADWA-11 mAb or an isotype control (3 mg / ml) administered intraperitoneally (i.p.) once weekly. At 8 months of age, mice were assessed for spatial learning and memory using the water maze test, and for spatial short-term memory and alternation behavior using the T-maze test (Figure 11A). Systemic administration of ADWA-11 restored short-term memory, as evidenced by the T-maze test, similar to that in WT mice (Figure 11B).

[0096] Furthermore, spatial learning (Figure ​(Figure11C)) and memory (Figure11D)) were improved after chronic treatment with ADWA-11mAb. Importantly, 16 weeks of chronic treatment with ADWA-11mAb was safe and did not result in any visible changes in clinical behavior. Therefore, pharmacological inhibition of ITGB8 signaling by peripheral treatment represents a novel approach for treating AD and dementia.

[0097] References 1.Colonna, M. & Butovsky, O.Microglia Function in the Central Nervous System During Health and Neurodegeneration.Annu Rev Immunol 35,441-468(2017). 2. Heneka, MT et al. Neuroinflammation in Alzheimer's disease. Lancet Neurol 14, 388-405 (2015). 3.Jansen,I.E.et al.Genome-wide meta-analysis identifies new loci and functional pathways influencing Alzheimer’s disease risk.Nat Genet 51,404-413(2019). 4.Wightman,D.P.et al.A genome-wide association study with 1,126,563 individuals identifies new risk loci for Alzheimer’s disease.Nat Genet 53,1276-1282(2021). 5.Nott,A.et al.Brain cell type-specific enhancer-promoter interactome maps and disease-risk association.Science 366,1134-1139(2019). 6.Krasemann,S.et al.The TREM2-APOE Pathway Drives the Transcriptional Phenotype of Dysfunctional Microglia in Neurodegenerative Diseases.Immunity 47,566-581 e569(2017). 7.Keren-Shaul,H.et al.A Unique Microglia Type Associated with Restricting Development of Alzheimer’s Disease.Cell 169,1276-1290 e1217(2017). 8.Farrer,L.A.et al.Effects of age,sex,and ethnicity on the association between apolipoprotein E genotype and Alzheimer disease.A meta-analysis.APOE and Alzheimer Disease Meta Analysis Consortium.JAMA 278,1349-1356(1997). 9.Corder,E.H.et al.Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer’s disease in late onset families.Science 261,921-923(1993). 10.Strittmatter,W.J.et al.Apolipoprotein E: high-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease.Proc Natl Acad Sci USA 90,1977-1981(1993). 11.Raber,J.et al.Isoform-specific effects of human apolipoprotein E on brain function revealed in ApoE knockout mice:increased susceptibility of females.Proc Natl Acad Sci USA 95,10914-10919(1998). 12.Youmans,K.L.et al.APOE4-specific changes in Abeta accumulation in a new transgenic mouse model of Alzheimer disease.J Biol Chem 287,41774-41786(2012). 13.Liu,D.S.et al.APOE4 enhances age-dependent decline in cognitive function by down-regulating an NMDA receptor pathway in EFAD-Tg mice.Mol Neurodegener 10,7(2015). 14.Xu,Q.et al.Profile and regulation of apolipoprotein E(ApoE)expression in the CNS in mice with targeting of green fluorescent protein gene to the ApoE locus.J Neurosci 26,4985-4994(2006). 15.Nelissen,K.et al.Liver X receptors regulate cholesterol homeostasis in oligodendrocytes.J Neurosci Res 90,60-71(2012). 16.Williams,T.,Borchelt,D.R.& Chakrabarty,P.Therapeutic approaches targeting Apolipoprotein E function in Alzheimer’s disease.Mol Neurodegener 15,8(2020). 17.Basu,S.K.,Brown,M.S.,Ho,Y.K.,Havel,R.J.& Goldstein,J.L.Mouse macrophages synthesize and secrete a protein resembling apolipoprotein E.Proc Natl Acad Sci USA 78,7545-7549(1981). 18.Huynh,T.V.et al.Lack of hepatic apoE does not influence early Abeta deposition:observations from a new APOE knock-in model.Mol Neurodegener 14,37(2019). 19.Liu,C.C.et al.Peripheral apoE4 enhances Alzheimer’s pathology and impairs cognition by compromising cerebrovascular function.Nat Neurosci 25,1020-1033(2022). 20.Wang,C.et al.Selective removal of astrocytic APOE4 strongly protects against tau-mediated neurodegeneration and decreases synaptic phagocytosis by microglia.Neuron 109,1657-1674 e1657(2021). 21.Butovsky,O.et al.Identification of a unique TGF-beta-dependent molecular and functional signature in microglia.Nat Neurosci 17,131-143(2014). 22.Margeta,M.A.et al.Apolipoprotein E4 impairs the response of neurodegenerative retinal microglia and prevents neuronal loss in glaucoma.Immunity 55(9):1627-1644.e7(2022). 23.Fote,G.M.et al.Isoform-dependent lysosomal degradation and internalization of apolipoprotein E requires autophagy proteins.J Cell Sci 135(2022). 24.Tcw,J.et al.Cholesterol and matrisome pathways dysregulated in astrocytes and microglia.Cell 185,2213-2233 e2225(2022). 25.Pohlkamp,T.et al.NHE6 depletion corrects ApoE4-mediated synaptic impairments and reduces amyloid plaque load.Elife 10(2021). 26.Parkhurst,C.N.et al.Microglia promote learning-dependent synapse formation through brain-derived neurotrophic factor.Cell 155,1596-1609(2013). 27.Klein,H.U.et al.Epigenome-wide study uncovers large-scale changes in histone acetylation driven by tau pathology in aging and Alzheimer’s human brains.Nat Neurosci 22,37-46(2019). 28.Gosselin,D.et al.Environment drives selection and function of enhancers controlling tissue-specific macrophage identities.Cell 159,1327-1340(2014). 29.Huang,K.L.et al.A common haplotype lowers PU.1 expression in myeloid cells and delays onset of Alzheimer’s disease.Nat Neurosci 20,1052-1061(2017). 30.Serrano-Pozo,A.,Frosch,M.P.,Masliah,E.& Hyman,B.T.Neuropathological alterations in Alzheimer disease.Cold Spring Harb Perspect Med 1,a006189(2011). 31.Shi,Y.et al.ApoE4 markedly exacerbates tau-mediated neurodegeneration in a mouse model of tauopathy.Nature 549,523-527(2017). 32.Yoshiyama,Y.et al.Synapse loss and microglial activation precede tangles in a P301S tauopathy mouse model.Neuron 53,337-351(2007). 33.Rosenzweig,N.et al.PD-1 / PD-L1 checkpoint blockade harnesses monocyte-derived macrophages to combat cognitive impairment in a tauopathy mouse model.Nat Commun 10,465(2019). 34.Radde,R.et al.Abeta42-driven cerebral amyloidosis in transgenic mice reveals early and robust pathology.EMBO Rep 7,940-946(2006). 35.Bennett,F.C.et al.A Combination of Ontogeny and CNS Environment Establishes Microglial Identity.Neuron 98,1170-1183 e1178(2018). 36.Van Hove,H.et al.A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment.Nat Neurosci 22,1021-1035(2019). 37.Mrdjen,D.et al.High-Dimensional Single-Cell Mapping of Central Nervous System Immune Cells Reveals Distinct Myeloid Subsets in Health,Aging,and Disease.Immunity 48,380-395 e386(2018). 38.Jordao,M.J.C.et al.Single-cell profiling identifies myeloid cell subsets with distinct fates during neuroinflammation.Science 363(2019). 39.Victor,M.B.et al.Lipid accumulation induced by APOE4 impairs microglial surveillance of neuronal-network activity.Cell Stem Cell 29,1197-1212 e1198(2022). 40.Habib,N.et al.Disease-associated astrocytes in Alzheimer’s disease and aging.Nat Neurosci 23,701-706(2020). 41.Nilsson,L.et al.Transthyretin Interferes with Abeta Amyloid Formation by Redirecting Oligomeric Nuclei into Non-Amyloid Aggregates.J Mol Biol 430,2722-2733(2018). 42.Argaw,A.T.et al.Astrocyte-derived VEGF-A drives blood-brain barrier disruption in CNS inflammatory disease.J Clin Invest 122,2454-2468(2012). 43.Munger,J.S.& Sheppard,D.Cross talk among TGF-beta signaling pathways,integrins,and the extracellular matrix.Cold Spring Harb Perspect Biol 3,a005017(2011). 44.Arnold,T.D.et al.Impaired alphaVbeta8 and TGFbeta signaling lead to microglial dysmaturation and neuromotor dysfunction.J Exp Med 216,900-915(2019). 45.Gotzl,J.K.et al.Opposite microglial activation stages upon loss of PGRN or TREM2 result in reduced cerebral glucose metabolism.EMBO Mol Med 11(2019). 46.Wolf,Y.,Anderson,A.C.& Kuchroo,V.K.TIM3 comes of age as an inhibitory receptor.Nat Rev Immunol 20,173-185(2020). 47.Nakao,A.et al.TGF-beta receptor-mediated signalling through Smad2,Smad3 and Smad4.EMBO J 16,5353-5362(1997). 48.Olah,M.et al.Single cell RNA sequencing of human microglia uncovers a subset associated with Alzheimer’s disease.Nat Commun 11,6129(2020). 49.Zhou,Y.et al.Human and mouse single-nucleus transcriptomics reveal TREM2-dependent and TREM2-independent cellular responses in Alzheimer’s disease.Nat Med 26,131-142(2020). 50.Gosselin,D.et al.An environment-dependent transcriptional network specifies human microglia identity.Science 356(2017). 51.Travis,M.A.et al.Loss of integrin alpha(v)beta8 on dendritic cells causes autoimmunity and colitis in mice.Nature 449,361-365(2007). 52.Zhang,Y.et al.An RNA-sequencing transcriptome and splicing database of glia,neurons,and vascular cells of the cerebral cortex.J Neurosci 34,11929-11947(2014). 53.Liu,Z.et al.Fate Mapping via Ms4a3-Expression History Traces Monocyte-Derived Cells.Cell 178,1509-1525 e1519(2019). 54.Wong,K.et al.Mice deficient in NRROS show abnormal microglial development and neurological disorders.Nat Immunol 18,633-641(2017). 55.Samuels,J.D.et al.The Alzheimer’s disease risk factor INPP5D restricts neuroprotective microglial responses in amyloid beta-mediated pathology.Alzheimers Dement(2023). 56.Iguchi,A.et al.INPP5D modulates TREM2 loss-of-function phenotypes in a beta-amyloidosis mouse model.iScience 26,106375(2023). 57.Dodagatta-Marri,E.et al.Integrin alphavbeta8 on T cells suppresses anti-tumor immunity in multiple models and is a promising target for tumor immunotherapy.Cell Rep 36,109309(2021). 58.Mahan,T.E.et al.Selective reduction of astrocyte apoE3 and apoE4 strongly reduces Abeta accumulation and plaque-related pathology in a mouse model of amyloidosis.Mol Neurodegener 17,13(2022). 59.Rohn,T.T.& Moore,Z.D.Nuclear Localization of Apolipoprotein E4:A New Trick for an Old Protein.Int J Neurol Neurother 4(2017). 60.Theendakara,V.et al.Direct Transcriptional Effects of Apolipoprotein E.J Neurosci 36,685-700(2016). 61.Hollingworth,P.et al.Common variants at ABCA7,MS4A6A / MS4A4E,EPHA1,CD33 and CD2AP are associated with Alzheimer’s disease.Nat Genet 43,429-435(2011). 62.Pimenova,A.A.et al.Alzheimer’s-associated PU.1 expression levels regulate microglial inflammatory response.Neurobiol Dis 148,105217(2021). 63.Liddelow,S.A.et al.Neurotoxic reactive astrocytes are induced by activated microglia.Nature 541,481-487(2017). 64.Katsouri,L.et al.Ablation of reactive astrocytes exacerbates disease pathology in a model of Alzheimer’s disease.Glia 68,1017-1030(2020). 65.Tan,Y.et al.Galectin-3:a key player in microglia-mediated neuroinflammation and Alzheimer’s disease.Cell Biosci 11,78(2021). 66.Sirko,S.et al.Astrocyte reactivity after brain injury-:The role of galectins 1 and 3.Glia 63,2340-2361(2015). 67.Boza-Serrano,A.et al.Galectin-3,a novel endogenous TREM2 ligand,detrimentally regulates inflammatory response in Alzheimer’s disease.Acta Neuropathol 138,251-273(2019). 68.Tao,C.C.et al.Galectin-3 promotes Abeta oligomerization and Abeta toxicity in a mouse model of Alzheimer’s disease.Cell Death Differ 27,192-209(2020). 69.Mabuchi,F.et al.The apolipoprotein E gene polymorphism is associated with open angle glaucoma in the Japanese population.Mol Vis 11,609-612(2005). 70.Lam,C.Y.et al.Association of apolipoprotein E polymorphisms with normal tension glaucoma in a Chinese population.J Glaucoma 15,218-222(2006). 71.Margeta,M.A.et al.Association of APOE With Primary Open-Angle Glaucoma Suggests a Protective Effect for APOE epsilon4.Invest Ophthalmol Vis Sci 61,3(2020). 72.Tesseur,I.et al.Deficiency in neuronal TGF-beta signaling promotes neurodegeneration and Alzheimer’s pathology.J Clin Invest 116,3060-3069(2006). 73.Wyss-Coray,T.et al.Amyloidogenic role of cytokine TGF-beta1 in transgenic mice and in Alzheimer’s disease.Nature 389,603-606(1997). 74.Kandasamy,M.et al.TGF-beta Signaling:A Therapeutic Target to Reinstate Regenerative Plasticity in Vascular Dementia? Aging Dis 11,828-850(2020). 75.Lund,H.et al.Fatal demyelinating disease is induced by monocyte-derived macrophages in the absence of TGF-β signaling.Nat Immunol 19,1-7(2018). 76.Kaiser,T.& Feng,G.Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia.eNeuro 6(2019). 77.Wang,J.W.et al.Influence of SHIP on the NK repertoire and allogeneic bone marrow transplantation.Science 295,2094-2097(2002). 78.Ju,W.et al.Deletion of Smad2 in mouse liver reveals novel functions in hepatocyte growth and differentiation.Mol Cell Biol 26,654-667(2006). 79.Li,Q.et al.Redundant roles of SMAD2 and SMAD3 in ovarian granulosa cells in vivo.Mol Cell Biol 28,7001-7011(2008). 80.Sullivan,P.M.et al.Targeted replacement of the mouse apolipoprotein E gene with the common human APOE3 allele enhances diet-induced hypercholesterolemia and atherosclerosis.J Biol Chem 272,17972-17980(1997). 81.Knouff,C.et al.Apo E structure determines VLDL clearance and atherosclerosis risk in mice.J Clin Invest 103,1579-1586(1999). 82.Iwasaki,H.et al.Distinctive and indispensable roles of PU.1 in maintenance of hematopoietic stem cells and their differentiation.Blood 106,1590-1600(2005). 83.Proctor,J.M.,Zang,K.,Wang,D.,Wang,R.& Reichardt,L.F.Vascular development of the brain requires beta8 integrin expression in the neuroepithelium.J Neurosci 25,9940-9948(2005). 84.Nakawesi,J.et al.alphavbeta8 integrin-expression by BATF3-dependent dendritic cells facilitates early IgA responses to Rotavirus.Mucosal Immunol 14,53-67(2021). 85.Gong,S.et al.A gene expression atlas of the central nervous system based on bacterial artificial chromosomes.Nature 425,917-925(2003). 86.Gong,S.et al.Targeting Cre recombinase to specific neuron populations with bacterial artificial chromosome constructs.J Neurosci 27,9817-9823(2007). 87.Sanmarco,L.M.et al.Gut-licensed IFNgamma(+) NK cells drive LAMP1(+)TRAIL(+)anti-inflammatory astrocytes.Nature 590,473-479(2021). 88.Hao,Y.et al.Integrated analysis of multimodal single-cell data.Cell 184,3573-3587 e3529(2021). 89.Ianevski,A.,Giri,A.K.& Aittokallio,T.Fully-automated and ultra-fast cell-type identification using specific marker combinations from single-cell transcriptomic data. Nat Commun 13,1246(2022). 90.Picelli,S.et al.Smart-seq2 for sensitive full-length transcriptome profiling in single cells.Nat Methods 10,1096-1098(2013). 91.Love,M.I.,Huber,W.& Anders,S.Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.Genome Biol 15,550(2014). 92.Mootha,V.K.et al.PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes.Nat Genet 34,267-273(2003). 93.Subramanian,A.et al.Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles.Proc Natl Acad Sci USA 102,15545-15550(2005). 94.Browaeys,R.,Saelens,W.& Saeys,Y.NicheNet:modeling intercellular communication by linking ligands to target genes.Nat Methods 17,159-162(2020). 95.Gu,Z.,Gu,L.,Eils,R.,Schlesner,M.& Brors,B.circlize Implements and enhances circular visualization in R. Bioinformatics 30,2811-2812(2014). 96.Nott,A.,Schlachetzki,J.C.M.,Fixsen,B.R.& Glass,C.K.Nuclei isolation of multiple brain cell types for omics interrogation.Nat Protoc 16,1629-1646(2021). 97.Langmead,B.& Salzberg,S.L.Fast gapped-read alignment with Bowtie 2.Nat Methods 9,357-359(2012). 98.Tarasov,A.,Vilella,A.J.,Cuppen,E.,Nijman,I.J.& Prins,P.Sambamba:fast processing of NGS alignment formats.Bioinformatics 31,2032-2034(2015). 99.Li,H.et al.The Sequence Alignment / Map format and SAMtools.Bioinformatics 25,2078-2079(2009). 100.Ramirez,F.,Dundar,F.,Diehl,S.,Gruning,B.A.& Manke,T.deepTools:a flexible platform for exploring deep-sequencing data.Nucleic Acids Res 42,W187-191(2014). 101.Zhang,Y.et al.Model-based analysis of ChIP-Seq(MACS).Genome Biol 9,R137(2008). 102.Bero,A.W.et al.Bidirectional relationship between functional connectivity and amyloid-beta deposition in mouse brain.J Neurosci 32,4334-4340(2012). 103.Li,Q.et al.Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing.Neuron 101,207-223 e210(2019). 104.Oakley, H. et al.Intraneuronal beta-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer's disease mutations: potential factors in amyloid plaque formation.J Neurosci 26,10129-10140,doi:10.1523 / JNEUROSCI.1202-06.2006(2006). 105.Yin, Z. et al., Identification of a protective microglial state mediated by miR-155 and interferon-γ signaling in a mouse model of Alzheimer's disease.Nat Neurosci.2023 Jul;26(7):1196-1207.

[0098] Other embodiments While the present invention has been described in conjunction with its detailed description, it should be understood that the foregoing description is intended to be illustrative, but not limiting, of the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. 1. A method of treating a subject having a neurodegenerative disease associated with microglial dysfunction, comprising administering a therapeutically effective amount of an inhibitor of integrin subunit beta 8 (ITGB8).

2. The method of claim 1 , wherein the inhibitor of ITGB8 is an antibody that binds to ITGB8.

3. 3. The method of claim 2, wherein the antibody that binds to ITGB8 is ADWA11, ADWA16, C6D4, 37E11, HuC6D4F12, CL7290, or a humanized version thereof.

4. 4. The method of claim 3, wherein the humanized version is ADWA11-2.1, ADWA11-2.2, ADWA11-2.3, ADWA11-2.4, ADWA16-1, ADWA16-2, ADWA16-3, ADWA16-3.2, ADWA16-4, ADWA16hugraft, Ab1, Ab2, or Ab3.

5. The method of claim 1, wherein the inhibitor of ITGB8 is an inhibitory oligonucleotide targeting human ITGB8 that reduces the expression of ITGB8.

6. The method of claim 5, wherein the oligonucleotide is 15 to 21 nucleotides in length.

7. The method of claim 5 , wherein at least one nucleotide of the oligonucleotide is a nucleotide analog.

8. The method of claim 5, wherein the oligonucleotide is a gapmer or a mixmer.

9. The method according to claims 1 to 8, wherein the neurodegenerative disease is Alzheimer's disease (AD) or amyotrophic lateral sclerosis (ALS).

10. 10. An ITGB8 inhibitor for use in a method of treating a subject having a neurodegenerative disease associated with microglial dysfunction.

11. The inhibitor for use according to claim 10, wherein the ITGB8 inhibitor is an antibody that binds to ITGB8.

12. The inhibitor for use according to claim 11, wherein the antibody that binds to ITGB8 is ADWA11, ADWA16, C6D4, 37E11, HuC6D4F12, CL7290, or a humanized version thereof.

13. 13. The inhibitor for use according to claim 12, wherein the humanized version is ADWA11-2.1, ADWA11-2.2, ADWA11-2.3, ADWA11-2.4, ADWA16-1, ADWA16-2, ADWA16-3, ADWA16-3.2, ADWA16-4, ADWA16hugraft, Ab1, Ab2, or Ab3.

14. The inhibitor for use according to claim 15, wherein the inhibitor of ITGB8 is an inhibitory oligonucleotide targeting ITGB8 that reduces the expression of ITGB8.

15. The inhibitor for use according to claim 14, wherein the length of said oligonucleotide is 15 to 21 nucleotides.

16. The inhibitor for use according to claim 14, wherein at least one nucleotide of the oligonucleotide is a nucleotide analogue.

17. The inhibitor for use according to claim 14, wherein the oligonucleotide is a gapmer or a mixmer.

18. The inhibitor for use according to claims 10 to 17, wherein the neurodegenerative disease is Alzheimer's disease (AD) or amyotrophic lateral sclerosis (ALS).

Images