Therapy via trans-splicing of OPA1 pre-messenger RNA to treat diseases associated with OPA1 gene mutations

Abstract

The present invention provides pre-mRNA trans-splicing molecules (RTMs) useful for correcting mutations in the OPA1 gene, and methods of using the RTMs as gene therapy (e.g., ex vivo and in vivo gene therapy) for treating or preventing diseases or disorders associated with OPA1 mutations.

Description

[Technical Field]

[0001] Related Applications This application claims priority to European Patent Application No. 22 199 015, filed September 30, 2023, which is incorporated herein by reference in its entirety. [Background technology]

[0002] Hereditary optic neuropathies (HON) are a genetically diverse group of disorders characterized primarily by vision loss and optic nerve atrophy. Several genetic defects that alter key mitochondrial functions have been proposed to contribute to the development of syndromic and nonsyndromic optic neuropathies. Subsets of HON, including autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+ or ADOAplus), and Behr syndrome, are caused by mutations in the OPA1 gene. HON affects approximately 400,000 people worldwide, 37,000 in Europe, and 3,000 in France (Lenaers et al., Progress in Retinal and Eye Research, 2021, Vol. 83:100935; Kjer et al., Acta Ophthalmol Scand., 1996, Vol. 74(1):3-7).

[0003] ADOA is considered the most common form of HON, with a prevalence ranging from 1:10,000 to 1:50,000 (Kjer et al., Acta Ophthalmol. Scand., 1996, Vol. 4(1):3-7). ADOA is characterized by bilateral central visual field loss and color vision impairment due to progressive degeneration of retinal ganglion cells (RGCs) and their axons that form the optic nerve. This degeneration prevents visual information from being transmitted to the brain's higher visual cortex. ADOA onset typically occurs during the first decade of life and is usually diagnosed before adulthood, although symptoms have been reported as early as 1 year of age. It is primarily a pediatric disorder, and affected individuals typically gradually develop signs of neurological deterioration by age 15. ADOA+ is symptomatic ADOA and accounts for approximately 20% of all ADOA cases. ADOA+ symptoms typically begin within the first decade of life and are characterized by bilateral, symmetric, progressive vision loss. Sensorineural hearing loss may present with other extraocular findings, such as chronic progressive external ophthalmoplegia, proximal myopathy, ataxia, and axonal sensory-motor polyneuropathy, beginning in the second and third decades of life. Behr syndrome is associated with biallelic OPA1 variants and is characterized by early-onset optic atrophy associated with spinocerebellar degeneration, resulting in ataxia, pyramidal signs, peripheral neuropathy, and developmental delay.

[0004] Currently, there is no established medical treatment for OPA1-associated hereditary optic neuropathy. Dietary supplements such as coenzyme Q-10 (CoQ), idebenone, and vitamin B12, vitamin C, and lutein have been suggested to reduce reactive oxygen species-induced stress in the optic nerve (Carelli et al., Curr. Opin. Neurol., 2013, 26(1):52-58). Topical agents considered neuroprotective or anti-apoptotic, such as brimonidine, have also been recommended, but evidence of their effectiveness remains anecdotal (Carelli et al., Curr. Opin. Neurol., 2013, 26(1):52-58). While eyeglasses or contact lenses can correct associated hyperopia, myopia, and astigmatism, they cannot repair or correct the vision loss caused by ADOA. People with ADOA may find that using low vision aids (e.g., magnifying glasses, large print displays, talking clocks, tinted lenses, electronic magnifiers, or other aids) improves visual function.

[0005] AODA, AODA+, and Behr syndrome are commonly associated with mutations in the nuclear OPA1 gene, which encodes a mitochondrial dynamin-related GTPase involved in mitochondrial membrane dynamics and structural organization (Newman et al., Am. J. Ophthal., 2005, 140(3):517-523; Kline et al., Arch. Ophthalmol., 1979, 97(9):245-251; Delettre et al., Mol. Genet. Metab., 2002, 75(2):97-107). Abnormalities in mitochondrial metabolism and impaired oxidative phosphorylation are linked to increased levels of reactive oxygen species and retinal ganglion cell (RGC) apoptosis (Chun et al., Semin. Pediatr. Neurol., 2017, 24(2):129-134; Chun et al., Curr. Opin. Ophthalmol., 2016, 27(6):475-480). RGC degeneration, primarily in the papillomacular bundle, has been suggested to underlie visual impairment (Delettre et al., Mol. Genet. Metab., 2002, 75(2):97-107).

[0006] The discovery of OPA1 mutations as a cause of ADOA was crucial for improving our understanding of its pathogenesis and possibly establishing effective treatments, especially strategies based on gene therapy approaches. Thus, adeno-associated virus (AAV) delivery of OPA1 isoform 1 was shown to be effective in treating pathogenic OPA1 mutations (Opa1 delTTAG / + In a heterozygous mouse model of OPA1, the overexpression of OPA1 showed significant protection of RGCs but did not result in a significant increase in visual acuity (Sarzi et al., Sci Rep., 2018, 8:2468). Overexpression of OPA1 isoforms 1 or 7 was found to correct mitochondrial dysfunction and partially restore visual perception and integration (Maloney et al., Front. Neurosci., 2020, 14:571-479). However, this study also confirmed that overexpression of OPA1 isoforms is more detrimental than pathological conditions because it induces alterations in the mitochondrial network.

[0007] It has been reported that OPA1 mutations can also be associated with other neurological disorders, such as sensorineural hearing loss or sensorimotor neuropathy, or ataxia, progressive external ophthalmoplegia, and mitochondrial myopathy (Amati-Bonneau et al., Brain, 2008, 131:338-351; Hudson et al., Brain, 2008, 131:329-337).

[0008] Although new therapeutic approaches are being developed and tested, disease-modifying treatments for genetic diseases, particularly neuropathies, and in particular optic neuropathies associated with mutations in the OPA1 gene, are not yet available. Thus, there remains a need in the art for novel strategies, particularly strategies that allow for fine-tuning of the expression of all eight OPA1 protein isoforms, which is essential for obtaining therapeutic benefit. [Prior art documents] [Patent documents]

[0009] [Patent Document 1] US Patent Application Publication No. 2006 / 0246422 [Patent Document 2] US Patent Application Publication No. 2013 / 0059901 [Patent Document 3] U.S. Patent No. 6,083,702 [Patent Document 4] U.S. Patent No. 6,013,487 [Patent Document 5] U.S. Patent No. 6,280,978 [Patent Document 6] U.S. Patent No. 7,399,753 [Patent Document 7] U.S. Patent No. 7,968,334 [Patent Document 8] U.S. Patent No. 8,053,232 [Patent Document 9] U.S. Patent No. 8,735,366 [Patent Document 10] U.S. Patent No. 9,303,078 [Patent Document 11] U.S. Patent No. 9,655,979 [Patent Document 12] U.S. Patent No. 7,561,972 [Patent Document 13] U.S. Patent No. 7,561,973 [Patent Document 14] U.S. Patent No. 7,888,112 [Patent Document 15] U.S. Patent Application Publication No. 2018 / 0355354

Non-licensed literature

[0010]

Non-patent document 1

Non-patent document 2

Non-patent document 3

Non-patent document 4

Non-patented document 5

Non-patent document 6

Non-patent document 7

Non-patent document 8

[0011] The present invention relates to the creation of a versatile gene therapy approach using spliceosome-mediated RNA trans-splicing (SMaRT™) for treating diseases associated with mutations in the OPA1 gene. In particular, the inventors have identified specific target intronic and exonic sequences in mutant endogenous OPA1 pre-messenger RNA (pre-mRNA) located downstream of alternatively spliced ​​exons and upstream of the mutated major exon. Therapeutic molecules, such as pre-mRNA trans-splicing molecules (RTMs or PTMs), are designed based on these specific target intronic sequences that function to complement defective OPA1 genes by trans-splicing OPA1 pre-mRNA to eliminate the mutation in the mature OPA1 RNA. The present invention allows for the maintenance of endogenous regulation of gene expression and the abundance of each of the eight isoforms of OPA1. This allows for the correction of transcripts resulting from dominant-negative and haploinsufficient alleles. The pre-mRNA trans-splicing molecule of the present invention can correct approximately 90% of all known pathogenic mutations in the human OPA1 gene. In addition, the pre-mRNA trans-splicing molecule can be used to treat not only asymptomatic patients suffering from blindness, but also symptomatic patients who also experience sensorineural hearing loss and polyneuropathy. Indeed, all that needs to be constructed to transduce target cells (retinal ganglion cells, or cells of the auditory nerve, or cells of the central nervous system (CNS) or peripheral nervous system (PNS)) is the vectorization of the pre-mRNA trans-splicing molecule, which remains unmodified. [Means for solving the problem]

[0012] Thus, the present invention provides a method for the production of a nucleic acid sequence operably linked in a 5' to 3' or 3' to 5' direction, (a) a binding domain configured to bind to an OPA1 target sequence, including an intron, an intron / exon junction, or an exon; (b) a splicing domain configured to mediate trans-splicing, and (c) a coding domain containing at least one functional OPA1 exon; 1. A nucleic acid OPA1 pre-mRNA trans-splicing molecule comprising: The present invention provides a nucleic acid OPA1 pre-mRNA trans-splicing molecule that is configured to trans-splice an endogenous mutant OPA1 pre-mRNA adjacent to an OPA1 target sequence, thereby replacing the endogenous mutant OPA1 exon with a functional OPA1 exon and correcting the mutation in the OPA1 transcript.

[0013] In certain embodiments, the OPA1 target sequence comprising an intron, an intron / exon junction, or an exon is Homo sapiens OPA1 introns 8-9 / exon 9.

[0014] In certain embodiments, the OPA1 target sequence, including an intron, intron / exon junction, or exon, is Homo sapiens OPA1 introns 8-9 / exon 9 consisting of SEQ ID NO:1.

[0015] In certain embodiments, the binding domain is at a binding site within or encompassing nucleotides 1-52 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 1-50 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 261-315 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 361-603 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 361-460 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 375-460 of SEQ ID NO:1 or nucleotides 461-603 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 510-784 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 510-756 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 510-726 of SEQ ID NO:1. or at a binding site within or encompassing nucleotides 518-784 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 518-756 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 518-726 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 561-784 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 561-756 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 561-726 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 627-784 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 627-756 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 627-726 of SEQ ID NO:1, or a combination of said binding sites.

[0016] In certain embodiments, the binding domain is selected from nucleotides 1 to 52 of SEQ ID NO: 1, or nucleotides 1 to 50 of SEQ ID NO: 1, or nucleotides 261 to 315 of SEQ ID NO: 1, or nucleotides 361 to 603 of SEQ ID NO: 1, or nucleotides 361 to 460 of SEQ ID NO: 1, or nucleotides 375 to 460 of SEQ ID NO: 1, or nucleotides 461 to 603 of SEQ ID NO: 1, or nucleotides 510 to 784 of SEQ ID NO: 1, or nucleotides 510 to 756 of SEQ ID NO: 1, or nucleotides 510 to 726 ... nucleotides 518 to 784, or nucleotides 518 to 756 of SEQ ID NO: 1, or nucleotides 518 to 726 of SEQ ID NO: 1, or nucleotides 561 to 784 of SEQ ID NO: 1, or nucleotides 561 to 756 of SEQ ID NO: 1, or nucleotides 561 to 726 of SEQ ID NO: 1, or nucleotides 627 to 784 of SEQ ID NO: 1, or nucleotides 627 to 756 of SEQ ID NO: 1, or nucleotides 627 to 726 of SEQ ID NO: 1, or a combination of said binding sites.

[0017] In certain embodiments, the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:2 (BD#114), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:3 (BD#128), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:4 (BD#162), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:5 (BD#135), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:6 (BD#106), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:7 (BD #100), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:8 (BD #130), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:9 (BD #158), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:10 (BD #166), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:11 (BD #196), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 12 (BD #224), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 13 (BD ​​#209), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 14 (BD #239), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 15 (BD #267), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 16 (BD #217), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 17 (BD #247), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 18 (BD #275), or the binding domain is a combination of said binding domains.

[0018] In certain embodiments, the mutation is present in any one of OPA1 exons 9-31.

[0019] In certain embodiments, the mutation is associated with hereditary optic neuropathies, particularly autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+), and Behr's syndrome, or extraocular diseases, particularly sensorineural hearing loss, peripheral neuropathy, Parkinsonism, mitochondrial myopathy, and heart disease.

[0020] In certain embodiments, the mutation is associated with a hereditary optic neuropathy selected from autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+), and Beer's syndrome.

[0021] In certain embodiments, the mutation is associated with a susceptibility to optic neuropathy: normal tension glaucoma.

[0022] In certain embodiments, the mutation is associated with an extraocular disease selected from sensorineural hearing loss, peripheral neuropathy, Parkinsonism, and mitochondrial myopathy.

[0023] In certain embodiments, the mitochondrial myopathy is mitochondrial depletion syndrome 14.

[0024] In certain embodiments, the coding domain comprises functional OPA1 exons 9-31.

[0025] In certain embodiments, the nucleic acid OPA1 pre-mRNA trans-splicing molecule is SEQ ID NO: 27 (OPA1 RTM th #114), or SEQ ID NO: 28 (OPA1 RTM th #128), or SEQ ID NO: 30 (OPA1 RTM th #162), or SEQ ID NO: 29 (OPA1 RTM th #135) or SEQ ID NO: 26 (OPA1 RTM th #106), or SEQ ID NO: 31 (OPA1 RTM th #100), or SEQ ID NO: 32 (OPA1 RTM th #130), or SEQ ID NO: 33 (OPA1 RTM th#158), or SEQ ID NO: 34 (OPA1 RTM th #166), or SEQ ID NO: 35 (OPA1 RTM th #196), or SEQ ID NO: 36 (OPA1 RTM th #224), or SEQ ID NO: 37 (OPA1 RTM th #209), or SEQ ID NO: 38 (OPA1 RTM th #239), or SEQ ID NO: 39 (OPA1 RTM th #267), or SEQ ID NO: 40 (OPA1 RTM th #217), or SEQ ID NO: 41 (OPA1 RTM th #247), or SEQ ID NO: 42 (OPA1 RTM th #275).

[0026] The present invention further provides a cloning vector recombinant adeno-associated virus comprising the nucleic acid OPA1 trans-splicing molecule described above.

[0027] In certain embodiments, the cloning vector is selected from a plasmid, a minicircle, a cosmid, a YAC vector, a BAC vector, and a viral vector, which may be an adeno-associated virus (AAV), in particular a recombinant adeno-associated virus (rAAV), a single-stranded adeno-associated virus (ssAAV), or a self-complementary adeno-associated virus (scAAV).

[0028] In certain embodiments, the recombinant adeno-associated virus targets retinal ganglion cells, photoreceptor cells, amacrine cells, horizontal cells, bipolar cells, or cells of the auditory nerve.

[0029] The present invention further provides a cell comprising the nucleic acid OPA1 trans-splicing molecule described above or the cloning vector described above.

[0030] The present invention also provides a pharmaceutical composition comprising the nucleic acid OPA1 trans-splicing molecule described above, or the cloning vector described above, or the cell described above, and at least one pharmaceutically acceptable carrier or excipient.

[0031] The present invention further provides a nucleic acid OPA1 trans-splicing molecule as described above, or a cloning vector as described above, or a cell as described above, or a pharmaceutical composition as described above, for use in treating or preventing a disease or disorder associated with a mutation in the OPA1 gene in a subject.

[0032] In certain embodiments, the disease or disorder associated with OPA1 gene mutations is a hereditary optic neuropathic disorder, particularly autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+), and Behr's syndrome, or an extraocular disease, particularly sensorineural hearing loss, peripheral neuropathy, Parkinsonism, mitochondrial myopathy, and heart disease.

[0033] In certain embodiments, the disease or disorder associated with an OPA1 gene mutation is a hereditary optic neuropathy selected from autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+), and Behr's syndrome.

[0034] In certain embodiments, the disease or disorder associated with OPA1 gene mutations is optic neuropathy: susceptibility to normal tension glaucoma.

[0035] In certain embodiments, the disease or disorder associated with an OPA1 gene mutation is an extraocular disease selected from sensorineural hearing loss, peripheral neuropathy, Parkinsonism, and mitochondrial myopathy.

[0036] In certain embodiments, the mitochondrial myopathy is mitochondrial depletion syndrome 14.

[0037] These and other objects, advantages and features of the present invention will become apparent to those of ordinary skill in the art upon reading the following detailed description of the preferred embodiments. [Brief explanation of the drawings]

[0038]

Figure 1

Figure 2

Figure 3A

Figure 3B

Figure 4

Figure 5

Figure 6-1

Figure 6-2

Figure 6-3

Figure 6-4

Figure 6-5

Figure 7

Figure 8A

Figure 8B

Figure 8C

[0039] definition Throughout this specification, several terms are used which are defined in the following paragraphs.

[0040] As used herein, the term "subject" refers to a human or another mammal, including an experimental animal (e.g., a primate, mouse, rat, rabbit, dog, cat, horse, pig, livestock, etc.), who may or may not have a disease associated with a mutation in the OPA1 gene. A non-human subject may be a transgenic or otherwise modified animal. In many embodiments of the present invention, the subject is a human. In such embodiments, the subject is often referred to as an "individual" or "patient." The terms "individual" and "patient" do not denote a particular age. The term "patient" or "affected subject" more specifically refers to an individual who is suffering from a disease or condition associated with a mutation in the OPA1 gene (i.e., an individual who exhibits clinical signs of a disease or disorder) or who is at risk for developing such a disease or disorder. A subject can be characterized as "at risk" for developing a disease by identifying a mutation in the OPA1 gene that is associated with the disease. In some embodiments, a subject at risk for developing a disease has one or more OPA1 mutations associated with the disease. Additionally or alternatively, a subject can be characterized as "at risk" for developing a disease if they have a family history of the disease.

[0041] The term "mutation," as used herein, refers to any abnormal nucleic acid sequence that results in a defective protein product (e.g., a non-functional protein product, a protein product with reduced function, a protein product with abnormal function, and / or a protein product that is produced in lower or higher amounts than normal). Mutations include base pair variations (e.g., single nucleotide polymorphisms), missense mutations, frameshift mutations, deletions, insertions, splice mutations, and cryptic mutations. In some embodiments, a mutation refers to a nucleic acid sequence that differs from the corresponding wild-type nucleic acid sequence or a functional variant thereof in one or more portions of its sequence. In some embodiments, a mutation refers to a nucleic acid sequence that encodes a protein having an amino acid sequence that differs from the sequence of the wild-type protein or a functional variant thereof. A "mutated exon" refers to an exon containing a mutation, or an exon sequence that reflects a mutation in a different region, such as a cryptic exon resulting from a mutation in an intron. A "mutated intron" refers to an intron containing a mutation, or a deletion, or an insertion, or an inversion that affects the sequence or expression level of a gene of interest.

[0042] As used herein, the term "disease or disorder associated with a mutation" or "mutation associated with a disease or disorder" refers to a correlation between a disease or disorder and a mutation. In some embodiments, the disease or disorder associated with the mutation is known or suspected to be caused, in whole or in part, directly or indirectly, by the mutation. For example, a subject carrying a mutation may be at risk of developing the disease or disorder, and the risk may further depend on other factors, such as other (e.g., independent) mutations (e.g., in the same gene or different genes) or environmental factors.

[0043] The term "OPA1" refers to a human nuclear gene encoding a mitochondrial protein with similarity to dynamin-related GTPases. The encoded protein is localized to the inner mitochondrial membrane and helps regulate mitochondrial membrane dynamics and structure. More specifically, the term "OPA1" refers to the human OPA1 gene, located on chromosome 3q28-q29, more precisely on the forward strand of chromosome 3, from base pair 193,593,144 to base pair 193,697,811. Mutations in this gene have been associated with neuropathologies, more specifically, ocular and / or auditory pathologies. As used herein, the term "disease or disorder associated with mutations in the OPA1 gene" refers to any disease or disorder known or suspected to be caused, in whole or in part, directly or indirectly, by mutations in the human OPA1 gene. Examples of such diseases include autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+), and Behr's syndrome.

[0044] As used herein, the term "treatment" is used to characterize a method or process that aims to (1) delay or prevent the onset of a disease or condition (herein, a disease or disorder associated with a mutation in the OPA1 gene), (2) slow or halt the progression, worsening, or deterioration of at least one symptom of a disease or condition, (3) result in the improvement of at least one symptom of a disease or condition, or (4) cure a disease or condition. For prophylactic or preventative action, treatment may be administered before the onset of a disease or condition. Alternatively, or in addition, for therapeutic action, treatment may be administered after the onset of a disease or condition. As used herein, the term "prevention" of a disorder is defined as reducing the risk of developing the disease, e.g., prophylactic therapy for a subject at risk of developing a disorder associated with a mutation in the OPA1 gene.

[0045] As used herein, a "pharmaceutical composition" is defined as comprising an effective amount of at least one nucleic acid OPA1 trans-splicing molecule according to the present invention and at least one pharmaceutically acceptable carrier or excipient.

[0046] As used herein, the term "effective amount" refers to any amount of a compound (e.g., a nucleic acid OPA1 trans-splicing molecule) or composition sufficient to achieve its intended purpose, e.g., a desired biological or medical response in a cell, tissue, system, or subject. An effective amount of a nucleic acid OPA1 trans-splicing molecule is an amount capable of eliciting a measurable desired outcome; e.g., in a therapeutic method, an effective amount is an amount capable of measurably reducing or ameliorating the symptoms of the disease or condition being treated.

[0047] As used herein, the term "pharmaceutically acceptable carrier or excipient" refers to a carrier medium that does not interfere with the effectiveness of the biological activity of the active ingredient and that is not excessively toxic to the host at the concentration at which it is administered. This term includes solvents, dispersion media, antibacterial and antifungal agents, isotonic agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art (see, e.g., "Remington's Pharmaceutical Sciences," E.W. Martin, 18th ed., 1990, Mack Publishing Co.: Easton, PA, which is incorporated herein by reference in its entirety). In certain embodiments, the term "pharmaceutically acceptable" means approved by a regulatory agency or listed in the United States / European Pharmacopoeia or other generally recognized pharmacopoeias for use in mammals, more particularly humans.

[0048] The terms "approximately" and "about," when used herein in reference to numerical values, generally include values ​​within a range of 10% in either direction (greater or less than) the numerical value, unless otherwise stated or apparent from the context (e.g., where such a numerical value would exceed 100% of the possible values).

[0049] Detailed Description of Certain Preferred Embodiments As mentioned above, the present invention provides nucleic acid trans-splicing molecules (e.g., pre-mRNA trans-splicing molecules (RTMs, also called PTMs)) useful for correcting mutations in the OPA1 gene. Also provided are methods of using the nucleic acid trans-splicing molecules as gene therapy (e.g., ex vivo and in vivo gene therapy) for treating or preventing diseases or disorders associated with OPA1 mutations, particularly ADOA, ADOA+, and Behr's syndrome.

[0050] I - nucleic acid OPA1 trans-splicing molecule The present invention is based on the use of spliceosome-mediated RNA trans-splicing (SMaRT™), a technology that has the ability to reprogram mRNAs and the proteins they encode. SMaRT™ is used here to correct mutations in the human OPA1 gene.

[0051] 1. OPA1 gene mutation The human OPA1 gene consists of 30 coding exons (exons 1-28, 4b, and 5b) distributed across more than 100 kb of genomic DNA on chromosome 3q28-q29. Alternative splicing of exons 4, 4b, and 5b results in eight mRNA variants encoding eight isoforms of 924 to 1015 amino acids (Delettre et al., Hum. Genet., 2001, 109(6):584-591), the precise balance of which is essential for proper OPA1 function. The OPA1 protein is classified as a large GTPase of the dynamin-like family. It is imported into mitochondria via its amino-terminal import sequence, the mitochondrial targeting sequence (MTS), and is required for fusion of the inner and outer mitochondrial membranes.

[0052] As of April 2021, the Human Gene Mutation Database (HGMD) (Stenson et al., Hum. Genet., 2017; 136:665-677; Weisschuch et al., PLoS One, 2021; 16(7):e0253987) lists more than 400 OPA1 disease-causing variants, and the Leiden Open Variation Database for OPA1 (website: www.lovd.nl / OPA1) (Le Roux et al., Orphanet J. Rare Dis., 2019; 14:214), whose entries overlap significantly but not completely with HGMD, lists 593 unique published variants. Dominant-negative and haploinsufficient effects have been proposed as the primary pathogenic mechanisms of OPA1 variants (Pesch et al., Hum. Mol. Genet., 2001, 10:1359-1368; Le Roux et al., Orphanet J. Rare Dis., 2019, 14:214). Thus, the majority of disease-causing variants are predicted to result in OPA1 missense amino acid changes or truncated polypeptides, either as nonsense variants, frameshift variants, or splice variants (the latter including deep intronic variants that result in the inclusion of spurious exons in transcripts, or partial gene deletions or duplications) (Bonifert et al., Brain, 2014, 137:2164-2177; Bonifert et al., Mol. Ther. Nucleic Acids, 2016, 5:e390). In addition, copy number variants (CNVs) and structural variants such as inversions are part of the mutational spectrum of OPA1 (Furhmann et al., J Med Genet., 2009; 46:136-44; Almind et al., BMC Med Genet., 2011; 12:49; Weisschuh et al., BMC Med Genet., 2020; 21:236).More than 95% of disease-causing variants are located downstream of alternative exons in the OPA1 gene.

[0053] 2. Spliceosome-Mediated RNA Trans-Splicing (SMaRT™) Splicing is a naturally occurring process that occurs during the production of fully active messenger RNA (mRNA) and is mediated by the cell's own spliceosome. Within cells, a pre-mRNA intermediate exists, containing non-coding nucleic acid sequences (introns) and coding nucleic acid sequences (exons) that encode the amino acids that form the gene product. In the pre-mRNA, introns are interspersed between exons, and are eventually excised from the pre-mRNA, fusing the exons together to form mature RNA (mRNA). The primary form of splicing in eukaryotic cells is cis-splicing, in which exons from a single pre-mRNA transcript are joined together. In contrast, RNA trans-splicing involves the joining of exons from more than one pre-mRNA transcript. Trans-spliced ​​RNAs can encode new proteins or non-coding regulatory transcripts, not only increasing proteome complexity but also contributing to the regulation of gene expression.

[0054] Spliceosome-mediated RNA trans-splicing (SMaRT™) has emerged as a novel technology for repairing inherited gene defects or errors at the pre-mRNA level and correcting single-gene disorders by replacing one or more mutant exons with their wild-type counterparts using the endogenous cellular splicing machinery. This technology uses engineered pre-mRNA trans-splicing molecules (RTMs) that specifically bind to target pre-mRNAs in the nucleus and trigger trans-splicing in a process mediated by the spliceosome. SMaRT™ can be used to replace 5', 3', or internal sequences on an exon-by-exon basis. This methodology is described, for example, in Puttaraju et al., Nature Biotechnol, 1999, 17:246-252; Gruber et al., Mol. Oncol., 2013, 7(6):1056; Avale, Hum. Mol. Genet., 2013, 22(13):2603-2611; Rindt et al., Cell Mol. Life Sci., 2012, 69(24):4191; Liemberger et al., Int. J. Mol. Sci., 2018, 19:762; U.S. Patent Application Publication Nos. 2006 / 0246422, 2013 / 0059901, and U.S. Patent Nos. 6,083,702, 6,013,487, 6,280,978, 7,399,753, 7,968,334, 8,053,232, 8,735,366, 9,303,078, and 9,655,979, which are incorporated herein by reference.See also Berger et al., Mol. Ther., 2015, 23(5):918-930; Koller et al., Nucleic Acids Res., 2011, 39(16):e108; Koller et al., Int. J. Mol. Sci., 2015, 16(1):1179-1191; Murauer et al., Hum. Gene Ther. Methods, 2013, 24(1):19-27; Rindt et al., Front. Neurosci., 2017, 11:544; Tockner et al., Gene Ther., 2016, 23(11):775-784.

[0055] Exon replacement offers several advantages over other gene therapy approaches, such as complementary DNA (cDNA) therapy. First, for very large genes, the sequence to be replaced can be reduced to a size that facilitates viral packaging and transduction. Second, the increase in wild-type alleles and the concomitant decrease in mutant alleles result in an enhanced change in their quantitative ratio, making this technique suitable for correcting dominant mutations. Third, because trans-splicing occurs at the pre-messenger RNA (pre-mRNA) level, target gene expression remains under the control of the respective endogenous promoter, eliminating problems arising from transgene overexpression.

[0056] Spliceosome-mediated RNA trans-splicing requires the coexistence of three distinct components: the spliceosome, the target pre-mRNA transcript, and the pre-mRNA trans-splicing molecule (RTM). While the spliceosome and target pre-mRNA transcript are naturally provided by the cell, the RTM is an artificial, genetically engineered molecule that can specifically bind to the target pre-mRNA in the nucleus. The spliceosome-mediated process then results in a trans-splicing event between the endogenous pre-mRNA and the exogenous RTM.

[0057] Each pre-mRNA trans-splicing molecule (RTM) is engineered to contain (a) a binding domain (BD) that hybridizes to the selected target region, bringing the RTM and the target transcript into close proximity; (b) a splicing domain containing splicing elements essential for mediating trans-splicing; and (c) the coding domain of the wild-type gene that is missing from the endogenous pre-mRNA. Similar to the RNA cis-splicing process, the binding and splicing domain sequences of the RTM are excised after trans-splicing and are not retained in the final reprogrammed mRNA product. Three types of SMaRT™ approaches are available, depending on the location of the mutation to be corrected or the region to be replaced. The two main types are replacement of the upstream (5') coding cassette (5'-trans-splicing) and replacement of the downstream (3') coding cassette (3'-trans-splicing). The third type is internal exon replacement.

[0058] 3. Nucleic Acid OPA1 Trans-splicing Molecule In a first aspect, the present invention provides an OPA1 pre-mRNA trans-splicing molecule. More specifically, the present invention provides a nucleic acid OPA1 trans-splicing molecule comprising, operably linked in a 5' to 3' or 3' to 5' direction, (a) a binding domain configured to bind to an OPA1 target sequence, including an intron, an intron / exon junction, or an exon, (b) a splicing domain configured to mediate trans-splicing, and (c) a coding domain comprising a functional OPA1 exon, wherein the nucleic acid OPA1 trans-splicing molecule is configured to trans-splice the coding domain into an endogenous OPA1 exon adjacent to the OPA1 target sequence, thereby replacing the endogenous OPA1 exon with the functional OPA1 exon and correcting an OPA1 mutation.

[0059] Human OPA1 target sequence. The OPA1 target sequence may be any fragment of the Homo sapiens OPA1 gene (chromosome 3: 193,593,144-193,697,811), including introns, intron / exon junctions, or exons.

[0060] However, the present invention is based, at least in part, on Applicants' discovery that a specific region of the human OPA1 genomic sequence provides a highly efficient binding site for the binding domain of a trans-splicing molecule, effectively mediating trans-splicing. This target region ensures both conservation and trans-splicing of eight OPA1 pre-mRNA transcripts to modify eight different OPA1 mRNAs and corresponding OPA1 protein isoforms.

[0061] The human OPA1 trans-splicing target sequence is the Homo sapiens OPA1 introns 8-9 (193,637,282-193,637,951) / exon 9 (ENSE00003604184:193,637,952-193,638,065) genomic sequence. In certain embodiments, the Homo sapiens OPA1 introns 8-9 / exon 9 genomic sequence is the sequence set forth in SEQ ID NO: 1. SEQ ID NO: 1 gtatgtgaaa aattgatagt gaacttgcca attagcaaaa aaagaagcag cttagcttcc taaaaattat gtgtatatat gtacacatac acatatatac atactagatg taggcattta tattttttat gtaatcttac atgttccaag taatgtctta agcaatatta tttgactatt ttagttcatt ataaatatta ataaatataa gtacattata tttatgagtt actgtatgtg ttataaagga agatatttgg ctttatatgt cttaatatta gtaatattta aatactgaac agtggattaa attagccata tgcgtgaaat ttaagctaat agaattgaaa atgtgtttgt aaacagtaaa ctagctatgg aaaagattta tggaaagtta ataacctggt tttagaaata ctggtttaaa ttagcacaag tttttaaaat aaaaattagg ctataaacag tggatccagt tatagttttg ctgttcctat tttcaatgtg cacacatgca tcaatcacca tttttttacg gattttaaaa tattttttca cctgtagaaa ttttaaaaga ctaaaaaact cagagcagca ttacaaatag gttttaattt taatttggta tcagaaaaat atgaataagt gttctttgtt ttgtgggaag GTTGTTGTGG TTGGAGATCA GAGTGCTGGA AAGACTAGTG TGTTGGAAAT GATTGCCCAA GCTCGAATAT TCCCAAGAGG ATCTGGGGAG ATGATGACAC GTTCTCCAGT TAAG In this 784-nucleotide (nt) sequence, Homo sapiens OPA1 introns 8-9 (670 bp) and Homo sapiens OPA1 exon 9 (114 bp) are indicated in lowercase and uppercase letters, respectively. The human OPA1 trans-splicing target sequence is located downstream of OPA1 alternative splice exons (4, 4b, and 5b) and upstream of pathogenic variants observed in hereditary optic neuropathies associated with mutations in the OPA1 gene.

[0062] Thus, in a preferred embodiment of the present invention, the OPA1 target sequence, including an intron, an intron / exon junction, or an exon, is the human OPA1 trans-splicing target sequence of SEQ ID NO:1.

[0063] b. Binding Domain. The binding domain present in the nucleic acid OPA1 trans-splicing molecule of the present invention can specifically bind to the human OPA1 intron 8-9 / exon 9 target sequence of SEQ ID NO: 1, or its complementary sequence. As used herein, the term "specific binding" between a binding domain and an OPA1 target sequence refers to hydrogen bonding between the binding domain and the OPA1 target sequence sufficient to mediate trans-splicing by resulting in association of the trans-splicing molecule with the target pre-mRNA. Preferably, the hydrogen bonds between the binding domain and the OPA1 target sequence are between complementary nucleotide bases and are in the antisense orientation relative to each other (in this case, the term "specific binding" refers to "specific hybridization" relative to each other). As will be understood by those skilled in the art, the term "specific binding" encompasses binding between a binding domain and a portion of the OPA1 target sequence. Such portions are referred to herein as "binding sites."

[0064] The binding domain may be 100% complementary to the OPA1 target sequence of SEQ ID NO: 1 or its complementary sequence, or may have sufficient complementarity to be able to stably hybridize with the target pre-mRNA. For example, in some embodiments, the binding domain is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to the OPA1 target sequence of SEQ ID NO: 1 or its complementary sequence. The degree of complementarity will be selected by one of skill in the art based on the need to maintain the nucleic acid construct, including the trans-splicing molecule and sequences necessary for expression and integration into a recombinant adeno-associated virus, within the 3,000 or maximum 4,000 nucleotide base limit. The choice of sequence and the strength of hybridization depend on the complementarity and length of the nucleic acids (see, e.g., Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

[0065] In the practice of the invention, a binding domain may be 6 to 500 nucleotides in length. In some embodiments, a binding domain is 20 to 400 nucleotides in length. In some embodiments, a binding domain is 50 to 300 nucleotides in length. In some embodiments, a binding domain is 100 to 200 nucleotides in length. In some embodiments, a binding domain is 10 to 20 nucleotides in length (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length), 20 to 30 nucleotides in length (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length), 30 to 40 nucleotides in length (e.g., 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length), or 40 to 50 nucleotides in length. 0 nucleotides in length (e.g., 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides in length), 50 to 60 nucleotides in length (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides in length), 60 to 70 nucleotides in length (e.g., 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 nucleotides in length), or 70 to 80 nucleotides in length (e.g., 70, 71, 72, 73 , 74, 75, 76, 77, 78, 79, or 80 nucleotides in length), 80 to 90 nucleotides in length (e.g., 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 nucleotides in length), 90 to 100 nucleotides in length (e.g., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides in length), or 100 to 110 nucleotides in length (e.g., 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2101, 2102, 2103, 2104, 2105, 2106, 2107, 2108, 2109, 2201, 2201, 2201, 2201, 2202, 2203, 2204, 2205, 2206, 2207, 2208, 2209, 2301, 2302, 2303, 2304, 2305, 2306, 2307, 2308, 2309, 2401, 2401, 2402, 2403, 2 120-130 nucleotides in length (e.g., 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, or 130 nucleotides in length), or 130-140 nucleotides in length (e.g., 130, 131, 132,133, 134, 135, 136, 137, 138, 139, or 140 nucleotides in length), 140 to 150 nucleotides in length (e.g., 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, or 150 nucleotides in length), 150 to 160 nucleotides in length (e.g., 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, or 160 nucleotides in length), or 160 to 170 nucleotides in length (e.g., 160, 161, 162, 163, 164, 165, 166, 167 , 168, 169, or 170 nucleotides in length), 170 to 180 nucleotides in length (e.g., 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, or 180 nucleotides in length), 180 to 190 nucleotides in length (e.g., 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, or 190 nucleotides in length), or 190 to 200 nucleotides in length (e.g., 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200 nucleotides in length). nucleotide length), 200 to 210 nucleotides long (e.g., 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, or 210 nucleotides long), 210 to 220 nucleotides long (e.g., 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, or 220 nucleotides long), 220 to 230 nucleotides long (e.g., 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, or 230 nucleotides long), or 230 to 240 nucleotides long. nucleotide length (e.g., 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, or 240 nucleotides), 240 to 250 nucleotides long (e.g., 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, or 250 nucleotides), 250 to 260 nucleotides long (e.g., 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, or 260 nucleotides), or 260 to 270 nucleotides long (e.g., 260, 261, 262,263, 264, 265, 266, 267, 268, 269, or 270 nucleotides in length), 270 to 280 nucleotides in length (e.g., 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, or 280 nucleotides in length), or 280 to 290 nucleotides in length (e.g., 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 36 The length of the nucleic acid sequence may be 290 to 300 nucleotides (e.g., 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, or 300 nucleotides), 300 to 350 nucleotides, 350 to 400 nucleotides, 400 to 450 nucleotides, or 450 to 500 nucleotides.

[0066] In certain embodiments, a binding domain is a single binding domain, i.e., its sequence specifically hybridizes to a single portion (or binding site) of the OPA1 target sequence of SEQ ID NO: 1. In other embodiments, a binding domain comprises a sequence that specifically hybridizes to more than one portion (or binding site) of the OPA1 target sequence of SEQ ID NO: 1. For example, a binding domain can be a dual binding domain that specifically hybridizes to two distinct binding sites of the OPA1 target sequence of SEQ ID NO: 1, where the distinct binding sites are separated by tens or hundreds of nucleotides. More generally, a binding domain can be a multiple binding domain that specifically hybridizes to two or more distinct binding sites of the OPA1 target sequence of SEQ ID NO: 1, where the distinct binding sites are separated by tens or hundreds of nucleotides.

[0067] The binding site within the OPA1 target sequence of SEQ ID NO: 1 may be 6 to 300 nucleotides in length. For example, the binding site within the OPA1 target sequence of SEQ ID NO: 1 may contain 6 to 12, 12 to 18, 18 to 24, 24 to 50, 50 to 100, 100 to 150, or 150 to 200 nucleotides, or 200 to 250 nucleotides, or even 250 to 300 nucleotides.

[0068] In some embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule of the invention is configured to bind (i.e., specifically bind) to an OPA1 target sequence at a binding site within or including nucleotides 1-52 of SEQ ID NO:1. Thus, in certain embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule of the invention is complementary (e.g., antisense) to six or more consecutive nucleotides of the binding site within or including nucleotides 1-52 of SEQ ID NO:1. In particular, the binding domain may be complementary (e.g., antisense) to six or more consecutive nucleotides of the binding site within or including nucleotides 1-50 of SEQ ID NO:1. In certain embodiments, the binding site consists of nucleotides 1-52 of SEQ ID NO:1. In certain embodiments, the binding site consists of nucleotides 1-50 of SEQ ID NO:1.

[0069] In some embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule of the invention specifically binds to an OPA1 target sequence at a binding site within or encompassing nucleotides 261-315 of SEQ ID NO: 1. Thus, in certain embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule of the invention is complementary (e.g., antisense) to six or more contiguous nucleotides of the binding site within or encompassing nucleotides 261-315 of SEQ ID NO: 1. In certain embodiments, the binding site consists of nucleotides 261-315 of SEQ ID NO: 1.

[0070] In some embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule of the invention specifically binds to an OPA1 target sequence at a binding site within or encompassing nucleotides 361-603 of SEQ ID NO: 1, or at a binding site within or encompassing nucleotides 361-460 of SEQ ID NO: 1, or at a binding site within or encompassing nucleotides 375-460 of SEQ ID NO: 1, or at a binding site within or encompassing nucleotides 461-603 of SEQ ID NO: 1. Thus, in certain embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule of the invention is complementary (e.g., antisense) to six or more consecutive nucleotides of a binding site within or encompassing nucleotides 361-603 of SEQ ID NO: 1. In particular, the binding domain may be complementary (e.g., antisense) to six or more consecutive nucleotides of a binding site within or including nucleotides 361-460 of SEQ ID NO:1, or a binding site within or including nucleotides 375-460 of SEQ ID NO:1, or a binding site within or including nucleotides 461-603 of SEQ ID NO:1. In certain embodiments, the binding site consists of nucleotides 361-603 of SEQ ID NO:1. In other embodiments, the binding site consists of nucleotides 361-460 of SEQ ID NO:1. In yet other embodiments, the binding site consists of nucleotides 375-460 of SEQ ID NO:1. In yet other embodiments, the binding site consists of nucleotides 461-603 of SEQ ID NO:1.

[0071] In some embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention is at a binding site within or encompassing nucleotides 510-784 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 510-756 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 510-726 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 518-784 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 518-756 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 518-726 of SEQ ID NO:1. or at a binding site within or encompassing nucleotides 561-784 of SEQ ID NO: 1, or at a binding site within or encompassing nucleotides 561-756 of SEQ ID NO: 1, or at a binding site within or encompassing nucleotides 561-726 of SEQ ID NO: 1, or at a binding site within or encompassing nucleotides 627-784 of SEQ ID NO: 1, or at a binding site within or encompassing nucleotides 627-756 of SEQ ID NO: 1, or at a binding site within or encompassing nucleotides 627-726 of SEQ ID NO: 1. Thus, in certain embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule of the invention is complementary (e.g., antisense) to six or more consecutive nucleotides of the binding site within or encompassing nucleotides 510-784 of SEQ ID NO: 1. In particular, the binding domain may be complementary (e.g., antisense) to six or more consecutive nucleotides of a binding site within or encompassing nucleotides 510 to 756 of SEQ ID NO:1, or nucleotides 510 to 726 of SEQ ID NO:1, or nucleotides 518 to 784 of SEQ ID NO:1, or nucleotides 518 to 756 of SEQ ID NO:1, or nucleotides 518 to 726 of SEQ ID NO:1, or nucleotides 561 to 784 of SEQ ID NO:1, or nucleotides 561 to 756 of SEQ ID NO:1, or nucleotides 561 to 726 of SEQ ID NO:1, or nucleotides 627 to 784 of SEQ ID NO:1, or nucleotides 627 to 756 of SEQ ID NO:1, or nucleotides 627 to 726 of SEQ ID NO:1. In certain embodiments, the binding site consists of nucleotides 510 to 784 of SEQ ID NO: 1. In other embodiments, the binding site consists of nucleotides 510 to 756 of SEQ ID NO: 1, or nucleotides 510 to 726 of SEQ ID NO: 1, or nucleotides 518 to 784 of SEQ ID NO: 1, or nucleotides 518 to 756 of SEQ ID NO: 1, or nucleotides 518 to 726 of SEQ ID NO: 1, or nucleotides 561 to 784 of SEQ ID NO: 1, or nucleotides 561 to 756 of SEQ ID NO: 1, or nucleotides 561 to 726 of SEQ ID NO: 1, or nucleotides 627 to 784 of SEQ ID NO: 1, or nucleotides 627 to 756 of SEQ ID NO: 1, or nucleotides 627 to 726 of SEQ ID NO: 1.

[0072] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 55-nt sequence (3' to 5'): The binding domain comprises or consists of a single binding domain having the sequence ctaatttaatccactgttcagtatttaaatattactaatattaagacatataaag (SEQ ID NO: 2 - BD#114), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 261-315 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 2.

[0073] The term "fragment," as used herein in reference to a binding domain, refers to a portion of said binding domain that consists of consecutive nucleotides of the binding domain and that hybridizes to the binding site of the OPA1 target sequence of SEQ ID NO: 1. In other words, a fragment of a binding domain is a binding domain as defined herein.

[0074] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 86-nt sequence (3' to 5'): The OPA1 target sequence comprises or consists of a single binding domain having the sequence cctaatttttattttaaaaacttgtgctaatttaaaccagtatttctaaaaccaggttattaactttccataaatcttttccatag (SEQ ID NO: 3 - BD#128), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 375-460 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 3 - BD#128.

[0075] In another preferred embodiment, the binding domain of the nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 143-nt sequence (3' to 5'): The OPA1 target sequence comprises or consists of a single binding domain having the sequence taatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgcatgtgtgcacattgaaaataggaacagcaaaactataactggatccactgtttatag (SEQ ID NO: 4 - BD#162), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 461-603 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 4 - BD#162.

[0076] In yet another preferred embodiment, the binding domain of the nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 105-nt sequence (1× antisense+1× sense): The binding domain comprises or consists of a binding domain having the sequence ctgcttctttttttgctaattggcaagttcactatcaatttttcacatacctttatatgtcttaatattagtaatatttaaatactgaacagtggattaaattag (SEQ ID NO: 5 - BD#135), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 1-50 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 5 - BD#135.

[0077] In yet another preferred embodiment, the binding domain of the nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 250-nt sequence (4× antisense+1× sense): cctaatttttattttaaaaacttgtgctaatttaaaccagtatttctaaaaccaggttattaactttccataaatcttttccatagctgcttcttttttgctaattggcaagttcactatcaatttt tcacatacctttattgtcttaatattagtaatatttaaatactgaacagtggattaaattagcttaaatttcacgcatatggctagtttactgtttacaaacacattttcaattctattag(SEQ ID NO: 6 - BD#106), which hybridizes to the OPA1 target sequence at a first binding site consisting of nucleotides 375-460 of SEQ ID NO:1 (similar to BD#128), a second binding site consisting of nucleotides 1-50 of SEQ ID NO:1 (similar to BD#135), a third binding site consisting of nucleotides 316-335 of SEQ ID NO:1, and a fourth binding site consisting of nucleotides 336-374 of SEQ ID NO:1.

[0078] In certain embodiments, the binding domain of the nucleic acid OPA1 trans-splicing molecule of the present invention comprises or consists of a combination of at least two of the above-described binding domains, i.e., BD#114 (SEQ ID NO: 2), BD#128 (SEQ ID NO: 3), BD#162 (SEQ ID NO: 4), BD#135 (SEQ ID NO: 5), and BD#106 (SEQ ID NO: 6). For example, the binding domain may be a combination of BD#114 (SEQ ID NO: 2) and BD#128 (SEQ ID NO: 3), or BD#114 (SEQ ID NO: 2) and BD#162 (SEQ ID NO: 4), or BD#128 (SEQ ID NO: 3) and BD#162 (SEQ ID NO: 4), etc.

[0079] Other antisense binding domains have also been generated by rational PCR.

[0080] Thus, in certain preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 100-nt sequence (3' to 5'): GCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgatacc (SEQ ID NO:7 - BD#100), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 627-726 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO:7.

[0081] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 130-nt sequence (3' to 5'): CCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgatacc (SEQ ID NO: 8 - BD#130), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 627-756 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 8.

[0082] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 158-nt sequence (3' to 5'): The OPA1 target sequence comprises or consists of a binding domain having the sequence CTTAACTGGAGAACGTGTCATCATCTCCCCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgatacc (SEQ ID NO: 9 - BD#158), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 627-784 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 9.

[0083] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 166-nt sequence (3' to 5'): The binding domain comprises or consists of a binding domain having the sequence GCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacagg (SEQ ID NO: 10 - BD#166), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 561-726 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 10.

[0084] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the present invention comprises the following 196-nt sequence (3' to 5'): CCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacagg (SEQ ID NO: 11 - BD#196), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 561-756 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 11.

[0085] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 224-nt sequence (3' to 5'): The OPA1 target sequence comprises or consists of a binding domain having the sequence CTTAACTGGAGAACGTGTCATCATCTCCCCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacagg (SEQ ID NO: 12 - BD#224), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 561-784 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 12.

[0086] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 209-nt sequence (3' to 5'): GCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgc (SEQ ID NO: 13 - BD#209), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 518 to 726 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 13.

[0087] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the present invention comprises the following 239-nt sequence (3' to 5'): CCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgc (SEQ ID NO: 14 - BD#239), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 518 to 756 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 14.

[0088] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 267-nt sequence (3' to 5'): The OPA1 target sequence comprises or consists of a binding domain having the sequence CTTAACTGGAGAACGTGTCATCATCTCCCCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgc (SEQ ID NO: 15 - BD#267), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 518 to 784 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 15.

[0089] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the present invention comprises the following 217-nt sequence (3' to 5'): The binding domain may comprise or consist of a binding domain having the sequence: gcaatcatttccaacacactagtctttccagcactctgatctccaaccacaaccttcccacaaaacaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgcatgtgtgc (SEQ ID NO: 16 - BD#217), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 510 to 726 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 16.

[0090] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 247-nt sequence (3' to 5'): The binding domain may comprise or consist of a binding domain having CCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgcatgtgtgc (SEQ ID NO: 17 - BD#247), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 510 to 756 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 17.

[0091] In some preferred embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule according to the invention comprises the following 275-nt sequence (3' to 5'): The OPA1 target sequence comprises or consists of a binding domain having the sequence CTTAACTGGAGAACGTGTCATCATCTCCCCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgcatgtgtgc (SEQ ID NO: 18 - BD#275), which hybridizes to the OPA1 target sequence at a binding site consisting of nucleotides 510 to 784 of SEQ ID NO: 1. In certain embodiments, the binding domain is a fragment of SEQ ID NO: 18.

[0092] c. Splicing Domain. The nucleic acid OPA1 trans-splicing molecule also contains a splicing domain. As used herein, the terms "splice domain" and "splice region" are used interchangeably. They refer to nucleic acid sequences containing motifs that are recognized by the spliceosome and mediate trans-splicing.

[0093] In a 3'-trans-splicing molecule, such as a nucleic acid OPA1 trans-splicing molecule according to the present invention, the splicing domain comprises a branch point (BP), a polypyrimidine tract (PPT), and an acceptor splice site that mediates trans-splicing. The splice site is a 3' acceptor splice site (AG or YAG).

[0094] Those skilled in the art can select a splicing domain according to known methods and principles. Consensus sequences of splicing domains used in RNA splicing are well known in the art (see Moore et al., 1993, The RNA World, Cold Spring Harbor Laboratory Press, pp. 303-358). However, modified consensus sequences that maintain the ability to function as a splicing domain can be used in the practice of the present invention.

[0095] In certain embodiments, the splicing domain of a nucleic acid OPA1 trans-splicing molecule according to the present invention comprises a branch point (BP), a polypyrimidine tract (PPT), and a 3' acceptor splice site, wherein the PPT is located between the branch point and the splice site.

[0096] In certain embodiments, the branch point consists of the 8 nucleotide (nt) nucleic acid sequence: 5'-tactaact-3' (SEQ ID NO: 19).

[0097] In certain embodiments, the polypyrimidine tract consists of the 16-nt nucleic acid sequence: 5'-tcttcttttttttctg-3' (SEQ ID NO: 20).

[0098] In certain embodiments, the 3' acceptor splice site consists of the 3-nt nucleic acid sequence: 5'-cag-3' (SEQ ID NO: 21).

[0099] The splicing domain may be included as part of an intronic splicing enhancer (ISE), which may contain one or more additional components. For example, a spacer region may be present within the intronic splicing enhancer (ISE) to separate the splicing domain from the binding domain within the pre-mRNA trans-splicing molecule. The spacer region can be designed to include features such as (1) a stop codon that functions to block translation of any unspliced ​​trans-spliced ​​molecule and / or (2) a sequence that enhances trans-splicing into the target pre-mRNA. The spacer may be 3 to 30 nucleotides or longer, depending on the length of the other components of the trans-splicing molecule.

[0100] In certain embodiments, the spacer consists of the following 27-nt nucleic acid sequence: 5'-gagaacattattatagcgttgctcgag-3' (SEQ ID NO: 22).

[0101] In certain embodiments, the binding domain of a nucleic acid OPA1 trans-splicing molecule of the present invention is linked to an intronic splicing enhancer cassette, as defined above, comprising a 27-nt spacer, an 8-nt branch point, a 16-nt polypyrimidine tract, and a 3-nt 3' acceptor splice site. For example, such an intronic splicing enhancer cassette is shown in Figure 5 and has the following nucleic acid sequence: It consists of 5'-gagaacattattatagcgttgctcgagtactaactggtacctcttcttttttttctgcag-3' (SEQ ID NO: 23).

[0102] d. Coding Domain. The third component present in a nucleic acid OPA1 pre-mRNA trans-splicing molecule of the present invention is the coding domain. The term "coding domain," as used herein, refers to a sequence (e.g., a wild-type or corrected coding sequence of interest) configured to be trans-spliced ​​into a target OPA1 endogenous pre-mRNA and replace one or more endogenously mutant exons of the target pre-mRNA. Preferably, the coding domain comprises a wild-type or corrected coding sequence (typically corresponding to one or more functional OPA1 exons) necessary to correct a targeted mutation or defect causing a disease or disorder associated with an OPA1 mutation, particularly a hereditary optic neuropathy of interest, such as ADOA, ADOA+, and Beer syndrome. Thus, in one embodiment, the coding domain comprises a single exon of the target OPA1 gene comprising a normal wild-type sequence lacking a disease-causing mutation. In another embodiment, the coding domain comprises multiple exons of the target OPA1 gene, each exon comprising a normal wild-type sequence lacking a disease-causing mutation.

[0103] In some embodiments of the invention, a coding domain comprises complementary DNA (cDNA). For example, one or more functional OPA1 exons within a coding domain can be cDNA sequences. In some embodiments, the entire coding domain is a cDNA sequence. Additionally or alternatively, all or a portion of the coding domain or one or more functional OPA1 exons thereof can be naturally occurring (i.e., wild-type) sequences (e.g., sequences having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an endogenous normal OPA1 exon).

[0104] The entire or a portion of the coding domain or one or more functional OPA1 exons thereof is a codon-optimized sequence. Codon optimization refers to modifying a nucleic acid sequence to alter individual nucleic acids without resulting in any changes to the encoded amino acids. Such modified sequences are referred to herein as "codon-optimized," meaning that the nucleic acid sequence has been modified to enhance, for example, expression or stability without resulting in any changes to the encoded amino acids. Codon optimization is known in the art (see, e.g., U.S. Pat. Nos. 7,561,972, 7,561,973, and 7,888,112). The sequence surrounding the translation start site can be converted to a consensus Kozak sequence according to known methods (see, e.g., Kozak et al., Nucleic Acids Res., 1987, 15(20):8125-8148).

[0105] For delivery by a recombinant adeno-associated virus (AAV) vector, the coding domain can be a nucleic acid sequence of up to 4,000 nucleotide bases in length (e.g., 1,000 to 4,000 nucleotide bases in length, 1,500 to 3,000 nucleotide bases in length, or 2,000 to 2,500 nucleotide bases in length).

[0106] In a preferred embodiment, the coding domain of a nucleic acid OPA1 3'-pre-mRNA trans-splicing molecule of the invention comprises functional OPA1 exons 9-31, i.e., all exons 3' to the binding region of the OPA1 target binding domain (i.e., introns 8-9). In one specific embodiment, the coding domain comprises the following 2013-nt nucleic acid sequence (optimized and modified OPA1 cDNA, corresponding to the wild-type Homo sapiens OPA1 amino acid sequence and encoded by exon 9 through the stop codon) (5' to 3'): or a codon-optimized version thereof.

[0107] This coding domain can be made compatible with the intronic splicing enhancer cassette described above (see SEQ ID NO: 25 provided in the Examples below).

[0108] e. Optional Components and Modifications of Nucleic Acid OPA1 Pre-mRNA Trans-Splicing Molecules. In certain embodiments, nucleic acid OPA1 trans-splicing molecules according to the invention comprise a 3' UTR sequence or a ribozyme sequence added to the 3' or 5' end.

[0109] In some embodiments, splicing enhancers, such as sequences referred to as exon splicing enhancers, may also be included in the structure of the synthetic nucleic acid OPA1 pre-mRNA trans-splicing molecules of the present invention. Additional features, such as polyadenylation signals to modify RNA expression / stability, additional binding regions, "safe" self-complementary regions, additional splice sites, or blocking groups to modulate the stability and prevent degradation of the molecule, may be added to the pre-mRNA trans-splicing molecules. Additionally, a stop codon may be included in the pre-mRNA trans-splicing molecule structure to prevent translation of the unspliced ​​pre-mRNA trans-splicing molecule. Additional elements, such as 3' hairpin structures, circular RNAs, nucleotide base modifications, or synthetic analogs, may be incorporated into the nucleic acid OPA1 pre-mRNA trans-splicing molecules of the present invention to promote or facilitate nuclear localization and spliceosome integration, as well as intracellular stability.

[0110] When nucleic acid OPA1 pre-mRNA trans-splicing molecules are synthesized in vitro, such trans-splicing molecules may be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, the molecule's stability, hybridization with the target pre-mRNA, import into the cell and / or nucleus, intracellular stability against enzymatic cleavage, etc. For example, pre-mRNA trans-splicing molecules can be modified to reduce their overall charge, thereby enhancing cellular uptake of the molecule. Additionally, modifications can be made to reduce susceptibility to nucleases or chemical degradation. Nucleic acid OPA1 pre-mRNA trans-splicing molecules can be synthesized to be conjugated to another molecule, such as a peptide, hybridization-triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent.

[0111] Various other well-known modifications to nucleic acid molecules can be introduced as a means of increasing intracellular stability and half-life. Possible modifications are known in the art. Modifications that can be made to the structure of synthetic pre-mRNA trans-splicing molecules include backbone modifications.

[0112] f. Specific Nucleic Acid OPA1 Pre-mRNA Trans-Splicing Molecules. The present invention provides several specific nucleic acid OPA1 pre-mRNA trans-splicing molecules, each of which contains one of the binding domains defined above. In particular, the present invention provides several specific nucleic acid OPA1 pre-mRNA trans-splicing molecules, the sequence of which consists, from 5' to 3', of one of the specific binding domains defined above, a 27-nt spacer, an 8-nt branchpoint, a KpnI (restriction cloning site), a 16-nt polypyrimidine tract, a 3-nt 3' acceptor splice site, and a coding domain corresponding to the 2013-nt wild-type or codon-optimized Homo sapiens OPA1 cDNA from exon 9 through the stop codon defined above.

[0113] The specific nucleic acid OPA1 trans-splicing molecule is - 2326-nt sequence SEQ ID NO: 26 (OPA1 RTM in the Examples section) th #106): - 2131-nt sequence SEQ ID NO: 27 (OPA1 RTM in the Examples section) th #114): - 2162-nt sequence SEQ ID NO: 28 (OPA1 RTM in the Examples section) th #128): - 2181-nt sequence SEQ ID NO: 29 (OPA1 RTM in the Examples section) th #135): - 2219-nt sequence SEQ ID NO: 30 (OPA1 RTM in the Examples section) th #162): - 2185-nt sequence SEQ ID NO: 31 (OPA1 RTM in the Examples section) th Designed as #100): - 2215-nt sequence SEQ ID NO: 32 (OPA1 RTM in the Examples section) th Designed as #130): - 2243-nt sequence SEQ ID NO: 33 (OPA1 RTM in the Examples section) th #158): - 2251-nt sequence SEQ ID NO: 34 (OPA1 RTM in the Examples section) th Designed as #166): - 2281-nt sequence SEQ ID NO: 35 (OPA1 RTM in the Examples section) th #196): - 2309-nt sequence SEQ ID NO: 36 (OPA1 RTM in the Examples section) th #224): - 2294-nt sequence SEQ ID NO: 37 (OPA1 RTM in the Examples section) th #209): - 2324-nt sequence SEQ ID NO: 38 (OPA1 RTM in the Examples section) th #239): - 2352-nt sequence SEQ ID NO: 39 (OPA1 RTM in the Examples section) th #267): - 2302-nt sequence SEQ ID NO: 40 (OPA1 RTM in the Examples section) th #217): - 2332-nt sequence SEQ ID NO: 41 (OPA1 RTM in the Examples section) th #247): - 2360-nt sequence SEQ ID NO: 42 (OPA1 RTM in the Examples section) th #275): is.

[0114] II - Recombinant vectors and cells containing nucleic acid OPA1 trans-splicing molecules The present invention also provides recombinant vectors containing the nucleic acid OPA1 pre-mRNA trans-splicing molecules described herein. More specifically, the nucleic acid OPA1 pre-mRNA trans-splicing molecules of the present invention can be recombinantly engineered into various host vector systems that also provide large-scale DNA replication and contain the necessary elements to direct the transcription of the pre-mRNA trans-splicing molecules. Using such constructs to transduce target cells in a patient results in the transcription of sufficient amounts of the pre-mRNA trans-splicing molecules, which will form complementary base pairs with endogenously expressed OPA1 pre-mRNA targets, thereby promoting the pre-mRNA trans-splicing reaction. Such vectors remain episomal as long as they can be transcribed to produce the desired RNA. Methods for assembling recombinant vectors generally involve culturing host cells and are known in the art. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, MA et al., Nat. Medic., 2001, 7(I):33-40; and Walther W. and Stein U., Drugs, 2000, 60(2):249-71.

[0115] The vector containing the nucleic acid OPA1 pre-mRNA trans-splicing molecule of interest can be a plasmid, virus, or other vector known in the art for replication and expression in mammalian target cells. Expression of the pre-mRNA trans-splicing molecule can be regulated by any promoter / enhancer sequence known in the art to act in mammalian, preferably human, cells. Such promoters / enhancers can be inducible or constitutive. Such promoters include, but are not limited to, the SV40 early promoter region, the promoter contained in the 3' long terminal repeat of Rous sarcoma virus, the herpes thymidine kinase promoter, the metallothionein gene regulatory sequence, the viral cytomegalovirus CMV promoter, the human chorionic gonadotropin-P promoter, the CAG promoter (also known as the CBA promoter or CAGGS promoter - CMV enhancer, chicken beta-actin promoter, and rabbit beta-globin splice acceptor site), the human elongation factor-1 alpha (EF-1a) promoter, the ubiquitin UBC promoter, the phosphoglycerate kinase PGK promoter, and the OPA1 promoter. In certain embodiments, the promoter is capable of driving gene expression in retinal cells, such as RPE cells (e.g., RPE65, VMD2, or OA1 promoters), photoreceptors (e.g., rhodopsin kinase (RHO), rhodopsin (RHO), or opsin (OP) human promoters), or preferably, retinal ganglion cells (RGCs) (e.g., human connexin 36 (cx36) or SNCG promoters). According to certain preferred embodiments, the promoter is the SNCG promoter (see U.S. Patent Application Publication No. 2018 / 0355354).

[0116] Any type of cloning vector, including plasmids, minicircles, cosmids, YAC vectors, BAC vectors, and viral vectors, can be used to prepare recombinant DNA constructs that can be directly introduced into tissue sites. Alternatively, viral vectors can be used that selectively infect desired target cells depending on the selected serotype and pseudotyping. Vectors for use in the practice of the present invention include any eukaryotic expression vector, including, but not limited to, viral expression vectors such as those derived from the retrovirus, modified vaccinia virus Ankara, adenovirus, or adeno-associated virus classes.

[0117] In certain preferred embodiments, the recombinant vector is an adeno-associated virus (AAV), or a recombinant adeno-associated virus (rAAV), or a single-stranded adeno-associated virus (ssAAV), or a self-complementary adeno-associated virus (scAAV). The use of AAV or rAAV is a common mode of exogenous DNA delivery because it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. In certain embodiments, the vector is an rAAV carrying a pre-mRNA trans-splicing molecule and driven by a promoter that expresses the pre-mRNA trans-splicing molecule in selected cells of a subject, such as ocular cells such as retinal ganglion cells (RGCs) or auditory neurons such as spiral ganglion neurons (SGNs). More than 30 naturally occurring serotypes of AAV are available. Numerous natural variants of AAV capsids exist, making it possible to identify and use AAVs with properties particularly suitable for target cells. AAV viruses can be genetically engineered by conventional molecular biology techniques, allowing such particles to be optimized for cell-specific delivery of pre-mRNA trans-splicing molecule nucleic acid sequences, for minimizing immunogenicity, for tailoring stability and particle longevity, for efficient degradation, for precise delivery to the nucleus, etc.

[0118] In certain embodiments, the pre-mRNA trans-splicing molecules of the present invention are delivered to target cells in vitro (or ex vivo). Various delivery systems, such as encapsulation in liposomes, microparticles, microcapsules, receptor-mediated endocytosis, construction of nucleic acids as part of retroviruses, adenoviruses, adeno-associated viruses, or other vectors, DNA injection, electroporation, calcium phosphate-mediated transfection, pure lipid-rich transfection reagents versus mixed lipid and non-lipid-based transfection reagents (for a review, see Chong et al., Peer J 2021, 21(9):e11165), etc., are known and can be used to introduce the pre-mRNA trans-splicing molecules of the present invention into cells. In this case, the nucleic acid OPA1 pre-mRNA trans-splicing molecule, which can be in any form used by those of skill in the art, binds to the pre-mRNA and mediates a trans-splicing reaction, resulting in the formation of a chimeric mRNA containing a portion of the exogenous and therapeutic nucleic acid pre-mRNA OPA1 trans-splicing molecule spliced ​​to a portion of the endogenous OPA1 pre-mRNA. Accordingly, the present invention also relates to cells containing the nucleic acid OPA1 pre-mRNA trans-splicing molecules described herein, or recombinant vectors containing the nucleic acid OPA1 pre-mRNA trans-splicing molecules described herein.

[0119] In certain embodiments, the cell is a target cell. As used herein, the term "target cell" refers to an ocular cell, which is any cell associated with ocular function and expressing the OPA1 gene. Such target cells include retinal ganglion cells (RGCs), photoreceptor cells, amacrine cells, horizontal cells, and bipolar cells. Preferentially, the target cell is an RGC. The target cell may also be a cell of the auditory nerve, such as an SGN. The OPA1 gene is expressed in the eye and in other organs, including the brain, heart, skeletal muscle, liver, and testis. The term "target cell" can also include such extraocular neurons or auditory neurons.

[0120] In certain embodiments, the cell is a host cell. As used herein, the term "host cell" refers to a packaging cell line in which a recombinant AAV is produced from a plasmid.

[0121] III - THERAPEUTIC USES OF NUCLEIC ACID OPA1 PRE-mRNA TRANS-SPLICING MOLECULES AND METHODS OF TREATMENT The present invention relates to a nucleic acid OPA1 pre-mRNA trans-splicing molecule according to the present invention, or a recombinant vector comprising the pre-mRNA trans-splicing molecule, or a cell comprising the pre-mRNA trans-splicing molecule or recombinant vector (optionally after formulation with one or more suitable pharmaceutically acceptable carriers or excipients (see below)) for use in correcting a pathogenic mutation in the OPA1 gene in a subject. Accordingly, the compounds and compositions of the present invention are useful in methods for treating diseases or disorders caused by mutations in the OPA1 gene. Such diseases and disorders include, inter alia, autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+), and Behr's syndrome. Other diseases and disorders include susceptibility to normal-tension glaucoma (OMIM #606657), a progressive optic neuropathy accompanied by glaucomatous optic nerve damage and visual field loss, with intraocular pressure (IOP) consistently measured below 21 mmHg. Extraocular diseases and disorders associated with mutations in the OPA1 gene include sensorineural hearing loss, peripheral neuropathy, Parkinsonism, mitochondrial myopathy, and heart disease. In certain embodiments, the mitochondrial myopathy is mitochondrial depletion syndrome 14 (OMIN #616895), which is characterized by severe, fatal infantile mitochondrial encephalomyopathy and hypertrophic cardiomyopathy accompanied by hypotonia and peripheral hypertonia with bowed, tonic posture, feeding difficulties, and severe neurodevelopmental delay.

[0122] Therapeutic methods according to the invention include contacting a target OPA1 gene product (e.g., an OPA1 pre-mRNA) with an OPA1 pre-mRNA trans-splicing molecule according to the invention under conditions such that the coding domain of the pre-mRNA trans-splicing molecule is spliced ​​into the target OPA1 gene product and a portion of the target gene product having one or more mutations is replaced with functional (i.e., healthy) mRNA, or normal mRNA, or wild-type mRNA, or modified mRNA, or optimized mRNA of the target gene, to correct the expression and function of an OPA1 protein isoform in the target cell.

[0123] In certain embodiments, the contacting comprises direct administration to the affected subject, while in other embodiments, the contacting occurs ex vivo on cultured cells, and after repair, the ex vivo treated cells are reimplanted into the subject from which the cells were extracted.

[0124] In certain embodiments, administering a therapeutically effective amount of a compound or composition according to the present invention to an individual suffering from a disease or disorder associated with one or more OPA1 gene mutations and / or biallelic mutations in the OPA1 gene alleviates one or more symptoms selected from the group consisting of decreased visual acuity, decreased central visual acuity, impaired color vision, blind spot / central scotoma, temporal pallor of the optic disc, peripapillary telangiectatic microangiopathy, peripapillary retinal nerve fiber layer swelling (pseudoedema), or optic nerve atrophy. In certain embodiments, administering a therapeutically effective amount of a compound or composition according to the present invention can halt the progression of one or more of such symptoms. In certain embodiments, treatment halts the progression of visual acuity loss. In other embodiments, treatment halts the progression of color vision impairment and / or loss. In certain embodiments, treatment improves visual acuity from less than 20 / 400 or less than about 20 / 400 to 20 / 100, to about 20 / 100, or to better than 20 / 100. In another embodiment, the treatment improves color vision.

[0125] In certain embodiments, administration of a therapeutically effective amount of a compound or composition according to the invention to an individual suffering from a symptomatic disease or disorder associated with an OPA1 gene mutation (e.g., a subject suffering from ADOA+ or Behr's syndrome) results in the alleviation of one or more extraocular findings, such as chronic progressive external ophthalmoplegia, proximal muscle myopathy, ataxia and axonal sensory motor polyneuropathy, spinocerebellar degeneration resulting in ataxia, pyramidal signs, peripheral neuropathy, and developmental delay.

[0126] 1. Indications In many embodiments, the subject is a human, and more particularly, a patient diagnosed with one of the above-listed hereditary optic neuropathies associated with mutations in the OPA1 gene. In certain embodiments, the subject is known to be at risk of developing such a hereditary optic neuropathy.

[0127] The subject may be of any age that may benefit from a therapeutic or prophylactic therapy. For example, in some embodiments, the subject is 0-5 years old, 5-10 years old, 10-20 years old, 20-30 years old, 30-50 years old, 50-70 years old, or older than 70 years old. In certain embodiments, the subject is 12 months or older, 18 months or older, 2 years or older, 3 years or older, 4 years or older, 5 years or older, 6 years or older, 7 years or older, 8 years or older, 9 years or older, or 10 years or older.

[0128] 2. Administration The nucleic acid OPA1 pre-mRNA trans-splicing molecule of the present invention, or a recombinant vector containing the nucleic acid OPA1 pre-mRNA trans-splicing molecule, or ex vivo treated cells can be optionally formulated into a pharmaceutical composition and then administered to a subject in need thereof by any suitable route. Suitable administration methods include, but are not limited to, subretinal injection, intravitreal injection, intravenous injection, or intrathecal injection. Injection into ocular cells via the palpebral vein or any ocular vein can also be used. Still other modes of administration can be selected by those skilled in the art.

[0129] 3. Dosage Administration of the nucleic acid OPA1 pre-mRNA trans-splicing molecules of the present invention, or recombinant vectors comprising the nucleic acid OPA1 pre-mRNA trans-splicing molecules, or cells comprising the nucleic acid OPA1 pre-mRNA trans-splicing molecules or recombinant vectors (optionally after formulation with one or more suitable pharmaceutically acceptable carriers or excipients) will be carried out at a dosage such that the amount delivered is effective for the intended purpose. The dose administered will depend on the desired therapeutic effect, the stage of progression of the disorder, the age, sex, weight, and general health of the patient, as well as the target cells, the use (or non-use) of concomitant therapy, and other clinical factors. Such factors can be readily determined by the attending physician during the course of therapy. Alternatively, or in addition, the dosage to be administered can be determined from studies using animal models. Adjusting dosages to achieve maximum efficacy based on these or other methods is well known in the art and within the capabilities of a trained physician. As studies using the compounds of the present invention are conducted, more information regarding appropriate dosage levels will become apparent.

[0130] Treatment according to the invention may consist of a single dose or multiple doses (e.g., multiple administrations over a period of time, e.g., several years over the course of a patient's life). Exemplary courses of treatment may include weekly, biweekly, monthly, quarterly, semi-annual, or yearly treatment. Alternatively, treatment may be stepped, with multiple doses administered initially, followed by fewer and less frequent doses.

[0131] For example, in embodiments where the therapeutic agent is a recombinant adeno-associated virus carrying a nucleic acid OPA1 trans-splicing molecule according to the present invention, it is desirable to use the lowest effective dosage (total genome copies delivered) of virus to reduce undesirable effects such as toxicity and other problems associated with ocular administration, e.g., the risk of retinal dysplasia and retinal detachment. In certain embodiments, the effective dosage is about 10 per dose. 8 ~10 13 The effective dose is in the range of 10 9 ~10 13 For example, an effective dose may comprise about 1.5×10 11 vg, or approximately 1.5 × 10 10 vg, or approximately 2.8 × 10 11 vg, or approximately 5 × 10 11 vg, or approximately 1.5 × 10 12 vg, or even about 1.5×10 13 vg. Still other dosage amounts within these ranges or other units may be selected by the attending physician, taking into consideration the factors mentioned above.

[0132] The dose can be delivered in a volume of about 50 mL to about 1 mL, including all values ​​within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In particular, the volume can be about 50 μL, about 75 μL, about 100 μL, about 125 μL, about 150 μL, about 175 μL, about 200 μL, about 250 μL, about 300 μL, about 350 μL, about 400 μL, about 450 μL, about 500 μL, about 600 μL, about 700 μL, about 800 μL, about 900 μL, or about 1,000 μL.

[0133] Alternatively or additionally, the volume and / or concentration of a recombinant AAV composition according to the invention is selected so that only certain anatomical regions containing target cells are affected, hi other embodiments, the volume and / or concentration of a recombinant AAV composition according to the invention is selected so that it reaches a larger portion of the eye.

[0134] 4. Combination Therapy The therapeutic methods of the present invention may be administered in combination with another or secondary therapy. The therapy may be any currently known or yet unknown therapy that helps prevent, stop, or ameliorate any of the effects associated with a pathogenic OPA1 mutation. The secondary therapy is selected so as not to interfere with the OPA1 pre-mRNA binding domain or its target site, unless it can, as a scaffolding agent, promote the interaction and trans-splicing reaction between the endogenous mutant target pre-mRNA and the exogenous corrective pre-mRNA trans-splicing molecule. The secondary therapy can be administered before, simultaneously with, or after the therapeutic methods described herein. In one embodiment, the secondary therapy includes a non-specific approach to maintaining the health of ocular cells, particularly retinal ganglion cells (RGCs), such as the administration of neurotrophic factors, antioxidants, or anti-apoptotic agents.

[0135] 5. Monitoring the therapeutic effect of treatment The effectiveness of the treatment according to the present invention can be evaluated using any suitable method known in the art, for example, by conducting functional and / or imaging studies. Such studies include, but are not limited to, electroretinography (ERG), perimetry, confocal scanning laser ophthalmoscopy (cSLO) to measure the topographical mapping of retinal layers and their thickness, and full-field optical coherence tomography (OCT), optical coherence tomography angiography (OCTA), and tomographic mapping of cone density using adaptive optics (OA). In addition, visual field testing, perimetry, and microperimetry, mobility testing, visual acuity testing, and color vision testing may be performed. The results of imaging and / or functional studies can be used to modify, adapt, or optimize treatment.

[0136] IV - Pharmaceutical Compositions and Kits 1. Pharmaceutical Compositions The present invention provides pharmaceutical compositions comprising a nucleic acid OPA1 pre-mRNA trans-splicing molecule described herein, or a recombinant vector comprising such a trans-splicing molecule, or a cell comprising the trans-splicing molecule or recombinant vector, and a pharmaceutically acceptable carrier or excipient. Preferably, the pharmaceutical composition comprises an effective amount of the nucleic acid OPA1 pre-mRNA trans-splicing molecule, recombinant vector, or cell. In some embodiments, the pharmaceutical composition further comprises one or more additional biologically active agents.

[0137] The pharmaceutical compositions of the present invention can be formulated into dosage unit forms for ease of administration and uniformity of dosage. The term "unit dosage form" as used herein refers to a physically discrete unit of nucleic acid OPA1 trans-splicing molecule, or recombinant vector, or cell for a patient to be treated. However, it is understood that the total dosage of the composition will be determined by the attending physician, pharmacist, or biologist within the scope of sound medical judgment.

[0138] a. Formulation. The pharmaceutical compositions described herein can be administered using any route of administration effective to achieve the desired therapeutic effect. The optimal pharmaceutical formulation can vary depending on the route of administration and desired dosage.

[0139] The pharmaceutical composition according to the present invention may be in the form of an injectable solution. Injectable preparations, for example, sterile injectable aqueous or oily suspensions, can be formulated according to known techniques using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparations may also be sterile injectable solutions, suspensions, or emulsions in non-toxic diluents or solvents such as mannitol, 1,3-butanediol, water (e.g., sterile pyrogen-free water), Ringer's solution, isotonic sodium chloride solution, sterile pyrogen-free phosphate-buffered saline, or other buffers for maintaining pH at an appropriate physiological level, such as HEPES. Additionally, sterile fixed oils are conventionally used as a solution or suspension medium. For this purpose, any non-irritating fixed oil, including synthetic monoglycerides or diglycerides, can be used. Fatty acids such as oleic acid can also be used to prepare injectable preparations.

[0140] In certain embodiments, the pharmaceutical composition according to the present invention comprises a surfactant. Suitable surfactants, such as PBS-Pluronic F-68 (also known as Poloxamer 188, LUTROL® F68), may be included because they are known to prevent AAV from adhering to inert surfaces and ensure delivery of the desired dose. Other suitable surfactants include TWEEN®. For example, for long-term storage, the pharmaceutical composition can be frozen in the presence of TWEEN® 20 or glycerol.

[0141] Injectable preparations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium before use.

[0142] For injectable formulations, the pharmaceutical composition may be a lyophilized powder mixed with suitable excipients in a suitable vial or tube. Prior to clinical use, the drug can be reconstituted by dissolving the lyophilized powder in a suitable solvent system to form a composition suitable for injection (e.g., subretinal, intravitreal, or subconjunctival injection).

[0143] It is also contemplated that the pharmaceutical compositions of the present invention may be formulated / administered as eye drops.

[0144] Materials and methods for producing various formulations are known in the art and can be adapted to the practice of the subject invention. Suitable formulations for delivery of DNA molecules, recombinant vectors, or cells can be found, for example, in "Remington's Pharmaceutical Sciences," E. W. Martin, 19th ed., 1995, Mack Publishing Co.: Easton, PA; Liberman and Lachman, eds., "Pharmaceutical Dosage Forms," ​​Marcel Decker, New York City, NY, 1980; and "Pharmaceutical Dosage Forms and Drug Delivery Systems," 17th ed., Lippincott Williams & Wilkins, 1999.

[0145] The ex vivo treated cells can be formulated with a pharmaceutical carrier for administration in any convenient manner for medical use, for example, in a pharmaceutically acceptable ophthalmic preparation for intraocular injection. Pharmaceutical compositions containing ex vivo treated cells used in the methods of the present invention can be implanted as a suspension, gel, colloid, slurry, or mixture. The preparation is preferably encapsulated or injected into the vitreous humor in a viscous form for delivery to the site of retinal damage. Alternatively, cryopreserved ex vivo treated cells can be resuspended in a commercially available balanced salt solution at the time of injection to achieve the osmolality and concentration required for administration by subretinal injection. For example, when administering the composition via intravitreal injection, the solution can be concentrated so that it can be delivered in a minimal volume. The concentration of the injection can be any amount that is effective and non-toxic. Pharmaceutical compositions of ex vivo treated cells for treating patients contain at least about 10 4 A dose of at least about 10 cells / mL, e.g. 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or 10 10 Can be formulated at a dose of cells / mL.

[0146] b. Additional Biologically Active Agents. In certain embodiments, the nucleic acid OPA1 pre-mRNA trans-splicing molecule, or a recombinant vector containing such a trans-splicing molecule, or cells containing the trans-splicing molecule or recombinant vector, is the only active ingredient in the pharmaceutical composition of the present invention. In other embodiments, the pharmaceutical composition further comprises one or more biologically active agents. Examples of suitable biologically active agents include, but are not limited to, anti-inflammatory agents, immunomodulators, analgesics, antimicrobial agents, antibacterial agents, antibiotics, antioxidants, antiseptics, and combinations thereof. If necessary or desired, the pharmaceutical composition may further comprise a local anesthetic to ease pain at the injection site.

[0147] In such pharmaceutical compositions, the nucleic acid OPA1 pre-mRNA trans-splicing molecule, recombinant vector, or cell, and at least one additional biologically active agent can be combined in one or more preparations for simultaneous, separate, or sequential administration. More specifically, the compositions of the present invention can be formulated so that the nucleic acid OPA1 pre-mRNA trans-splicing molecule, recombinant vector, or cell, and additional biologically active agent can be administered together or independently of each other. For example, the nucleic acid OPA1 pre-mRNA trans-splicing molecule, recombinant vector, or cell, and additional biologically active agent can be formulated together in a single pharmaceutical composition. Alternatively, they may be maintained and administered separately (e.g., in different compositions and / or containers), thereby constituting a pharmaceutical kit or pack.

[0148] 2. Medicine Kit In another aspect, the present invention provides pharmaceutical kits comprising one or more containers (e.g., vials, ampoules, test tubes, flasks, or bottles) containing one or more components of the pharmaceutical compositions of the present invention, allowing for the therapeutic administration of the nucleic acid OPA1 pre-mRNA trans-splicing molecules described herein, or recombinant vectors containing such trans-splicing molecules, or cells containing the trans-splicing molecules or recombinant vectors, to a subject in need thereof. Alternatively, the kits may incorporate components for producing or assembling pharmaceutical compositions containing nucleic acid OPA1 pre-mRNA trans-splicing molecules, carriers, rAAV particles, surfactants, and the like, as well as suitable laboratory hardware for preparing the compositions.

[0149] The various components of the pharmaceutical kit may be supplied in solid (e.g., lyophilized) or liquid form. It is generally preferred that each component be provided in its respective container in a portioned or concentrated form. The kit according to the invention may also include a medium for reconstituting the lyophilized components. The individual containers of the kit will preferably remain sealed for commercial sale.

[0150] In certain embodiments, the pharmaceutical kit may include a device for administering the composition, such as a needle, a pen device, a jet injector, or another needle-free injector.

[0151] In certain embodiments, the pharmaceutical kit includes one or more additional biologically active agents. Optionally, the container may be accompanied by a notice or package insert in a format prescribed by a government agency regulating the manufacture, use, or sale of pharmaceutical or biological products, the notice reflecting approval by the agency for manufacture, use, or sale for human administration. The package insert notice may include instructions for using the pharmaceutical composition in accordance with the methods of treatment disclosed herein.

[0152] An identifier, such as a bar code, radio frequency, or ID tag, may be present in or on the kit and can be used to uniquely identify the kit, for example, for purposes of quality control, inventory control, and tracking movement between work sites.

[0153] The present invention will be further illustrated by the following figures and examples, which, however, should not be construed in any way as limiting the scope of the present invention. [Example]

[0154] The following examples describe some preferred modes for making and practicing the present invention. However, it should be understood that the examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Furthermore, unless a description in the examples is presented in the past tense, that statement, like the rest of the specification, is not intended to imply that the experiments were actually performed or the data actually obtained.

[0155] Selection of OPA1 trans-splicing target region The Homo sapiens (Hs) OPA1 introns 8-9 (193,637,282-193,637,951) / exon 9 (ENSE00003604184:193,637,952-193,638,065) genomic sequence, defined as the human OPA1 trans-splicing target sequence, was selected as the region to hybridize via the antisense binding domain. Hs OPA1 introns 8-9 (670 bp) and Hs OPA1 exon 9 (114 bp) are indicated in lowercase and uppercase letters, respectively, in the 784-nucleotide sequence below. The underlined nucleotides represent the forward primer (5'-gtatgtgaaaaattgatagtgaacttgcc-3' = SEQ ID NO: 43) and reverse primer (5'-CTTAACTGGAGAACGTGTCATCATC-3' = SEQ ID NO: 44) used for PCR amplification. The amplified 784 nucleotide fragment was used as a template for the creation of the antisense binding domain. SEQ ID NO: 1 gtatgtgaaaaattgatagtgaacttgccaattagcaaaaaagaagcagcttagcttcctaaaaaattatgtgtatatatgtacacatacacatatatacatactagatgtaggcatttatattttttatgtaatcttacatgttccaagtaatgtcttaagcaatattatttgactatttagttcattataaatattaataaatataag tacattattatttatgagttactgtatgtgttataaaaggaagatatttggctttatatgtcttaatattagttaatatttaaatactgaacagtggattaaattagccatatgcgtgaaatttaagctaatagaattgaaaatgtgtttgtaaacagtaaactagctatggaaaagatttatgga aagttaataacctggttttagaaatactggtttaaattatagcacaagttttaaaaaataaaaattaggctataaacagtggatccagttatagttttgctgttcctattttcaatgtgcacacatgcatcaatcaccatttttttacggattttaaaatatttttcacctgtagaaattttaa aagactaaaaaactcagagcagcattacaaataggttttaatttaatttggtatcagaaaaatatgaataagtgttctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGGGGGA GATGATGACACGTTCTCCAGTTAAG

[0156] HsOPA1イントロン8~9 / エクソン9(193,637,282~193,638,065) をますますますます。それますますますたりますます。 - downstream of OPA1 alternative splice exons (4, 4b, 5b) and upstream of pathogenic variants registered in patients with OPA1-related dominant optic atrophy (DOA), OPA1-related dominant optic atrophy plus (DOA+), and Behr syndrome (see Figure 1). This target region ensures both conservative and trans-splicing of eight OPA1 pre-mRNA transcripts, resulting in eight distinct OPA1 mRNAs and corresponding OPA1 protein isoforms. - Its size allows for the generation of a wide variety of antisense binding domains.

[0157] Also, for HsOPA1 intron 8-9 / exon 9 OPA1-minigene editing used in the minigene GFP assay (see Figure 2), flanking primers: Forward primer: 5'-GCCGAGGTAAGAGATATCGTATGTGAAAAATTGATAGTGAACTTG-3' (SEQ ID NO: 45); and Reverse primer: 5'-TAGACTCGAGCGGCCGCCTTAACTGGAGAACGTGTCATC-3' (SEQ ID NO: 46) The HsOPA1 intron 8-9 / exon 9 sequence (193,637,282-193,638,065) was PCR amplified using the following primers: The resulting amplicon (819 bp) was cloned between the EcoRV and NotI restriction sites downstream of the 5' half of the AcGFP1 coding sequence (336 bp) by the Gibson cloning and assembly method and confirmed by Sanger sequencing using the following sequencing primers: Seq_HsOPA1-MG_Fw1 5'-ATCTTCTTCGAGGATGACGGCAA-3' (SEQ ID NO: 47) Seq_HsOPA1-MG_Fw2: 5'-GCTATGGAAAAGATTTATGGAAAGTTAATAACCTGG-3' (SEQ ID NO: 48) Seq_HsOPA1-MG_Rv1: 5'-GTTTAAACTCAATGGTGATGGTGATGATGA-3' (SEQ ID NO: 49) Seq_HsOPA1-MG_Rv2: 5'-AAACTATAACTGGATCCACTGTTTATAGCCTAA-3' (SEQ ID NO: 50)

[0158] Creation of OPA1 antisense binding domain Starting with the HsOPA1 intron 8-9 / exon 9 (193,637,282-193,638,065) PCR-amplified sequence (784 bp), a bank of antisense binding domains was created by CviJI* (5'-PuG↑↓CPy-3') endonuclease digestion or sonication (1 min per 100 bp) using the methods described by Bauer et al. (Methods Mol. Biol., 2013, 961:441-455) and Murauer et al. (Hum. Gene Ther. Methods, 2013, 24(1):19-27). CviJI*-digested fragments were ranked from 5 to 500 bp, and sonicated fragments were ranked from 25 to 700 bp (see Figure 3).

[0159] Using the intro 8-9 / exon 9 (193,637,282-193,638,065) Homo sapiens OPA1 sequence as a template, an additional bank of antisense binding domains was generated by rational PCR using the flanking PCR primer combinations shown in Table 1 for downstream Gibson cloning assembly into the RTM0 plasmid (see plasmid map in Figure 4).

[0160] [Table 1]

[0161] Cloning of the OPA1 antisense binding domain into the RTM0 plasmid for minigene assays Four hundred putative antisense-binding domains for Homo sapiens OPA1 introns 8-9 / exon 9 (193,637,282–193,638,065), generated by CviJI* digestion or sonication, were subcloned into the HpaI blunt-end cloning site of the RTM0 plasmid (i.e., a plasmid lacking the antisense-binding domains) according to Murauer et al. (Hum. Gene Ther. Methods, 2013, 24(1):19–27). Domains generated by rational PCR were subcloned between the EcoRI and ClaI cohesive-end cloning sites for OPA1-specific RTM editing (see Figure 4). The RTM0 plasmid was published by Bauer et al. (Methods In Molecular Biology, 2013, Vol. 961, DOI 10.1007 / 978-1-62703-227-8_30) and Murauer et al. (Hum. Gene Ther. Methods, 2013, Vol. 24(1):19-27) and was a gift from the group of Ulrich Koller (Austria).

[0162] These Homo sapiens OPA1 antisense binding domains were linked to an intronic splicing enhancer (ISE) cassette contained in the RTM0 plasmid, which contains a 27-bp spacer, an 8-bp branch point (BP), a 16-bp polypyrimidine tract (PPT), and a 3' acceptor splice site (3'ASS), as shown in Figure 5.

[0163] Cloning of the OPA1 antisense binding domain was confirmed by Sanger sequencing using the forward primer (5'-GGCTAACTAGAGAACCCACTGC-3'-SEQ ID NO: 58) and reverse primer (5'-CCATCCTCCTTGAAATCGGTGC-3'-SEQ ID NO: 59).

[0164] Mechanistic proof of principle for Homo sapiens OPA1 trans-splicing and selection of an OPA1-targeting RTM containing an antisense binding domain that induces the highest trans-splicing rate Following the recommendations of Murauer et al. (Hum. Gene Ther. Methods, 2013, 24(1):19-27) and Koller et al. (Mol. Ther. Nucleic Acids, 2014, 3(4):e157) for the design of highly functional RNA trans-splicing molecules, individual OPA1-specific RTMs were tested in a minigene GFP reconstitution assay for their ability to trans-splice a co-transfected target Homo sapiens intron 8-9 / exon 9 OPA1 minigene. An efficient antisense binding domain against Homo sapiens OPA1 intron 8-9 / exon 9 (193,637,282-193,638,065) was selected as the one inducing the highest OPA1 trans-splicing rate, as revealed by the highest percentage of GFP-expressing cells (see Figure 6).

[0165] Identification of an efficient binding domain for Homo sapiens OPA1 trans-splicing Mechanistic proof of principle using an OPA1 minigene assay revealed an efficient binding domain for OPA1 trans-splicing. BD#106 (250 nt) is a multiple binding domain with the following sequence: In the following sequences, the different binding domains are separated by the symbol " / ". cctaatttttattttaaaaacttgtgctaatttaaaccagtatttctaaaaccaggttattaactttccataaatcttttccatag / ctgcttctttttttgctaattggcaagttcactatcaattttt cacatac / ctttatatgtcttaatattagtaatatttaaatactgaacagtggattaaattag / cttaaatttcacgcatatgg / ctagtttactgtttacaaacacattttcaattctattag (SEQ ID NO: 6) It hybridizes to positions 3:193,637,656 to 3:193,637,741, 3:193,637,282 to 3:193,637,331, 3:193,637,597 to 3:193,637,616, and 3:193,637,617 to 3:193,637,655 of the human genome. The corresponding 5'-3' sequence is ctatggaaaagatttatggaaagttaataacctggttttagaaatactggtttaaattagcacaagtttttaaaataaaaattagg / gtatgtgaaaaattgatagtgaacttgccaattagcaaaaaaagaagcag / ccatatgcgtgaaatttaag / ctaatagaattgaaaatgtgtttgtaaacagtaaactag (SEQ ID NO: 60). - BD#114 (55 nt) is a single binding domain and has the following sequence: ctaatttaatccactgttcagtatttaaatattactaatattaagacatataaag (SEQ ID NO: 2) It hybridizes to positions 3:193,637,542 to 3:193,637,596 of the human genome. The corresponding 5'-3' sequence is ctttatatgtcttaatattagtaatatttaaatactgaacagtggattaaattag (SEQ ID NO: 61). BD#128 (86 nt) is a single binding domain and has the following sequence: cctaatttttattttaaaaacttgtgctaatttaaaccagtatttctaaaaccaggttattaactttccataaatcttttccatag (SEQ ID NO: 3) It hybridizes to positions 3:193,637,656 to 3:193,637,741 of the human genome. The corresponding 5'-3' sequence is ctatggaaaagatttatggaaagttaataacctggttttagaaatactggtttaaattagcacaagtttttaaaataaaaattagg (sequence number 62). - BD#135 (105 nt) is a double binding domain (1x antisense + 1x sense). In this sequence, the symbol " / " separates the two different binding domains. ctgcttctttttttgctaattggcaagttcactatcaatttttcacatac / ctttatatgtcttaatattagtaatatttaaatactgaacagtggattaaattag (SEQ ID NO: 5) It hybridizes only to positions 3:193,637,282 to 3:193,637,331 of the human genome. The corresponding 5'-3' sequence is gtatgtgaaaaattgatagtgaacttgccaattagcaaaaaaagaagcag (sequence number 63). - BD#162 (143 nt) is a single binding domain and has the following sequence: taatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgcatgtgtgcacattgaaaataggaacagcaaaactataactggatccactgtttatag (SEQ ID NO: 4) It hybridizes to positions 3:193,637,742 to 3:193,637,884 of the human genome. The corresponding 5'-3' sequence is ctataaacagtggatccagttatagttttgctgttcctattttcaatgtgcacacatgcatcaatcaccatttttttacggattttaaaatattttttcacctgtagaaattttaaaagactaaaaaactcagagcagcatta (sequence number 64).

[0166] Other antisense binding domains have also been generated by rational PCR. The primers used are listed in Table 1. The antisense binding domain for OPA1 trans-splicing is as follows: BD#100 (100 nt) is a single binding domain and has the following sequence: gcaatcatttccaacacactagtctttccagcactctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttctgatacc (SEQ ID NO: 7) It hybridizes to positions 3:193,637,908 to 3:193,638,007 of the human genome. The corresponding 5'-3' sequence is ggtatcagaaaaatatgaataagtgttctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGC (SEQ ID NO: 77). BD#130 (130 nt) is a single binding domain and has the following sequence: ccagatcctcttgggaatattcgagcttgggcaatcatttccaacacactagtctttccagcactctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttctgatacc (SEQ ID NO: 8) It hybridizes to positions 3:193,637,908 to 3:193,638,037 of the human genome. The corresponding 5'-3' sequence is ggtatcagaaaaatatgaataagtgttctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGG (SEQ ID NO: 78). - BD#158 (158 nt) is a single binding domain and has the following sequence: cttaactggagaacgtgtcatcatctccccagatcctcttgggaatattcgagcttgggcaatc atttccaacacactagtctttccagcactctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttctgatacc (SEQ ID NO: 9) It hybridizes to positions 3:193,637,908 to 3:193,638,065 of the human genome. The corresponding 5'-3' sequence is ggtatcagaaaaatatgaataagtgttctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGGGGAGATGATGACACGTTCTCCAGTTAAG (SEQ ID NO: 79). - BD#166 (166 nt) is a single binding domain and has the following sequence: GCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACcttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacagg (SEQ ID NO: 10) It hybridizes to positions 3:193,637,842 to 3:193,638,007 of the human genome. The corresponding 5'-3' sequence is cctgtagaaattttaaaagactaaaaaactcagagcagcattacaaataggttttaattttaatttggtatcagaaaaatatgaataagtgttctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGC (SEQ ID NO: 80). - BD#196 (196 nt) is a single binding domain and has the following sequence: ccagatcctcttgggaatattcgagcttgggcaatcatttccaacacactagtctttccagcac tctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagtttttagtcttttaaaatttctacagg (SEQ ID NO: 11) It hybridizes to 3:193,637,842 to 193,638,037 of the human genome. The corresponding 5'-3' sequence is cctgtagaaattttaaaagactaaaaaactcagagcagcattacaaataggttttaattttaatttggtatcagaaaaatatgaataagtgttctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGG (SEQ ID NO: 81). - BD#224 (224 nt) is a single binding domain and has the following sequence: cttaactggagaacgtgtcatcatctccccagatcctcttgggaatattcgagcttgggcaatg atttccaacacactagtctttccagcactctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacagg (SEQ ID NO: 12) It hybridizes to positions 3:193,637,842 to 3:193,638,065 of the human genome. The corresponding 5'-3' sequence is cctgtagaaattttaaaagactaaaaaactcagagcagcattacaaataggttttaattttaatttggtatcagaaaaatatgaataagtgttctttgtttgtgggaagGTTGTTGT GGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGGGGAGATGATGACACGTTCTCCAGTTAAG (SEQ ID NO: 82). - BD#209 (209nt) is a single binding domain and has the following sequence: gcaatcatttccaacacactagtctttccagcactctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaa attaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgc (SEQ ID NO: 13) It hybridizes to positions 3:193,637,799 to 3:193,638,007 of the human genome. The corresponding 5'-3' sequence is gcatcaatcaccatttttttacggattttaaaatattttttcacctgtagaaattttaaaagactaaaaaactcagagcagcattacaaataggttttaattttaatttg gtatcagaaaaatatgaataagtgttctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGC (SEQ ID NO: 83). BD#239 (239 nt) is a single binding domain and has the following sequence: Ccagatcctcttgggaatattcgagcttgggcaatcatttccaacacactagtctttccagcactctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttc tgataccaaattaaaattaaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgc (SEQ ID NO: 14) It hybridizes to positions 3:193,637,799 to 3:193,638,037 of the human genome. The corresponding 5'-3' sequence is gcatcaatcaccatttttttacggattttaaaatattttttcacctgtagaaattttaaaagactaaaaaactcagagcagcattacaaataggttttaattttaatttggtatcagaaaaatat gaataagtgttctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGG (SEQ ID NO: 84). - BD#267 (267nt) is a single binding domain and has the following sequence: cttaactggagaacgtgtcatcatctccccagatcctcttgggaatattcgagcttgggcaatc atttccaacacactagtctttccagcactctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaatt aaaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgc (SEQ ID NO: 15) It hybridizes to positions 3:193,637,799 to 3:193,638,065 of the human genome. The corresponding 5'-3' sequence is gcatcaatcaccatttttttacggattttaaaatattttttcacctgtagaaattttaaaagactaaaaaactcagagcagcattacaaataggttttaattttaatttggtatcagaaaaatatgaataagtgttctt tgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGGGGAGATGATGACACGTTCTCCAGTTAAG (SEQ ID NO: 85). BD#217 (217 nt) is a single binding domain and has the following sequence: gcaatcatttccaacacactagtctttccagcactctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaatta aaacctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgcatgtgtgc (SEQ ID NO: 16 It hybridizes to positions 3:193,637,791 to 3:193,638,007 of the human genome. The corresponding 5'-3' sequence is gcacacatgcatcaatcaccatttttttacggattttaaaatattttttcacctgtagaaattttaaaagactaaaaaactcagagcagcattacaaataggttttaattttaa tttggtatcagaaaaatatgaataagtgttctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGC (SEQ ID NO: 86). BD#247 (247 nt) is a single binding domain and has the following sequence: ccagatcctcttgggaatattcgagcttgggcaatcatttccaacacactagtctttccagcac tctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaacctatttgtaatgc tgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgcatgtgtgc (SEQ ID NO: 17) It hybridizes to positions 3:193,637,791 to 3:193,638,037 of the human genome. The corresponding 5'-3' sequence is gcacacatgcatcaatcaccatttttttacggattttaaaatattttttcacctgtagaaattttaaaagactaaaaaactcagagcagcattacaaataggttttaattttaatttggtatcagaaaa atatgaataagtgttctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGG (SEQ ID NO: 87). - BD#275 (275nt) is a single binding domain and has the following sequence: ttacctggagaacgtgtcatcatctccccagatcctcttgggaatattcgagcttgggcaatc atttccaacacactagtctttccagcactctgatctccaaccacaacaaccttcccacaaaacaaagaacacttattcatatttttctgataccaaattaaaattaaaa cctatttgtaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgcatgtgtgc (SEQ ID NO: 18) It hybridizes to positions 3:193,637,791 to 3:193,638,060 of the human genome. The corresponding 5'-3' sequence is gcacacatgcatcaatcaccatttttttacggattttaaaatattttttcacctgtagaaattttaaaagactaaaaaactcagagcagcattacaaataggttttaattttaatttggtatcagaaaaatatgaataagtgt tctttgttttgtgggaagGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGGGGAGATGATGACACGTTCTCCAGTTAAG (SEQ ID NO: 88).

[0167] Cloning into therapeutic vectors Preselected OPA1-RTM was PCR amplified for Gibson assembly with the optimized wild-type OPA1 cDNA sequence using the primers shown in Table 2 below.

[0168] [Table 2]

[0169] This generated the OPA1 antisense binding domain fused to an ISE with the sequence shown below, where the binding domain (BD) is in bold, the spacer is underlined, the branch point (BP) is in bold and underlined, the polypyrimidine track (PPT) is in italics, and the 3' acceptor splice site (3'ASS) is in italics and underlined. BD#106+ISE (SEQ ID NO: 72): cgagctcaagcttcgaattccctaatttttattttaaaaacttgtgctaatttaaaccagtatttctaaaaccaggttattaactttccataaatcttttccatag / ctgcttctttttttgctaattggcaagttca ctatcaatttttcacatac / ctttatatgtcttaatattagtaatatttaaatactgaacagtggattaaattag / cttaaatttcacgcatatgg / ctagtttactgtttacaaacacattttcaattctattagaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag GTAGTAGTCGTAGGTGATCAG BD#114+ISE (SEQ ID NO: 73): cgagctcaagcttcgaattcctaatttaatccactgttcagtatttaaatattactaatattaagacatataaagaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag GTAGTAGTCGTAGGTGATCAG - BD#128+ISE (SEQ ID NO: 74): cgagctcaagcttcgaattccctaatttttattttaaaaacttgtgctaatttaaaccagtatttctaaaaccaggttattaactttccataaatcttttccatagaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag GTAGTAGTCGTAGGTGATCAG - BD#135+ISE (SEQ ID NO: 75): cgagctcaagcttcgaattcctgcttcttttttgctaattggcaagttcactatcaatttttcacatacctttatatgtcttaatattagtaatatttaaatactgaacagtggattaaattagaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag GTAGTAGTCGTAGGTGATCAG - BD#162+ISE (SEQ ID NO: 76): cgagctcaagcttcgaattctaatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgcatgtgtgcacattgaaaataggaacagcaaaactataactggatccactgtttatagaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag GTAGTAGTCGTAGGTGATCAG

[0170] This also generated a 2013 nucleotide modified OPA1 cDNA (modified wild-type Homo sapiens OPA1 cDNA from exon 9 to the stop codon) that is 5′-compatible with the 3′ end of the ISE fragment for upstream binding domain + Gibson cloning assembly.

[0171] The most potent Homo sapiens OPA1 trans-splicing binding domain was subcloned upstream of a modified wild-type OPA1 cDNA (2,013 bp) between the EcoRI and SalI restriction sites of the bicistronic mammalian expression vector pEF1α-IRES-AcGFP1 (631971, TakaraBio; see Figure 7 ) using the Gibson cloning assembly method. This construct was transiently transfected into fibroblasts from an OPA1-associated dominant optic atrophy (ADOA) patient for OPA1 haploinsufficiency rescue and mitochondrial fusion induction assays.

[0172] This resulted in the generation of a therapeutic OPA1 pre-mRNA trans-spliced ​​molecule, the sequence of which is as follows: 5'-binding domain (BD)-spacer-branch point (BP)-KpnI-polypyrimidine tract (PPT)-3' acceptor splicing site (3'ASS)-OPA1 cDNA-3': - OPA1 RTM th #106: cctaatttttattttaaaaacttgtgctaatttaaaccagtatttctaaaaccaggttattaactttccataaatcttttccatag / ctgcttcttttttgctaattggcaagttcactatcaattt ttcacatac / ctttatatgtcttaatattagtaatatttaaatactgaacagtggattaaattag / cttaaatttcacgcatatgg / ctagtttactgtttacaaacacattttcaattctattagaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #114: ctaatttaatccactgttcagtatttaaatattactaatattaagacatataaagaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #128: cctaatttttattttaaaaacttgtgctaatttaaaccagtatttctaaaaccaggttattaactttccataaatcttttccatagaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #135: ctgcttctttttttgctaattggcaagttcactatcaatttttcacatacctttatatgtcttaatattagtaatatttaaatactgaacagtggattaaattagaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #162: taatgctgctctgagttttttagtcttttaaaatttctacaggtgaaaaaatattttaaaatccgtaaaaaaatggtgattgatgcatgtgtgcacattgaaaataggaacagcaaaactataactggatccactgtttatagaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #100: GCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #:130 CCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #158: CTTAACTGGAGAACGTGTCATCATCTCCCCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #166: GCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCAAATTAAAATTAAAACCTATTTGTAATGCTGCTCTGAGTTTTTTAGTCTTTTAAAATTTCTACAGGatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #196: CCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCAAATTAAAATTAAAACCTATTTGTAATGCTGCTCTGAGTTTTTTAGTCTTTTAAAATTTCTACAGGatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #224: CTTAACTGGAGAACGTGTCATCATCTCCCCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCAAATTAAAATTAAAACCTATTTGTAATGCTGCTCTGAGTTTTTTAGTCTTTTAAAATTTCTACAGGatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #209: GCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCAAATTAAAATTAAAACCTATTTGTAATGCTGCTCTGAGTTTTTTAGTCTTTTAAAATTTCTACAGGTGAAAAAATATTTTAAAATCCGTAAAAAAATGGTGATTGATGCatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #239: CCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCAAATTAAAATTAAAACCTATTTGTAATGCTGCTCTGAGTTTTTTAGTCTTTTAAAATTTCTACAGGTGAAAAAATATTTTAAAATCCGTAAAAAAATGGTGATTGATGCatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #267: CTTAACTGGAGAACGTGTCATCATCTCCCCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCAAATTAAAATTAAAACCTATTTGTAATGCTGCTCTGAGTTTTTTAGTCTTTTAAAATTTCTACAGGTGAAAAAATATTTTAAAATCCGTAAAAAAATGGTGATTGATGCatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #217: GCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCAAATTAAAATTAAAACCTATTTGTAATGCTGCTCTGAGTTTTTTAGTCTTTTAAAATTTCTACAGGTGAAAAAATATTTTAAAATCCGTAAAAAAATGGTGATTGATGCATGTGTGCatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #247: CCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCAAATTAAAATTAAAACCTATTTGTAATGCTGCTCTGAGTTTTTTAGTCTTTTAAAATTTCTACAGGTGAAAAAATATTTTAAAATCCGTAAAAAAATGGTGATTGATGCATGTGTGCatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag - OPA1 RTM th #275: CTTAACTGGAGAACGTGTCATCATCTCCCCAGATCCTCTTGGGAATATTCGAGCTTGGGCAATCATTTCCAACACACTAGTCTTTCCAGCACTCTGATCTCCAACCACAACAACCTTCCCACAAAACAAAGAACACTTATTCATATTTTTCTGATACCAAATTAAAATTAAAACCTATTTGTAATGCTGCTCTGAGTTTTTTAGTCTTTTAAAATTTCTACAGGTGAAAAAATATTTTAAAATCCGTAAAAAAATGGTGATTGATGCATGTGTGCatcgatgttaac gagaacattattatagcgttgctcgagtactaact ggtacctcttcttttttttctg cag

[0173] Results of fibroblasts derived from biopsies of OPA1 patients The results obtained are shown in FIG. Expression of OPA1 trans-splicing therapeutic pre-messenger RNA in fibroblasts derived from OPA1 patient biopsies established proof-of-concept for cell therapy by 1) correcting OPA1 haploinsufficiency and the absence of protein overexpression (Figure 8A), 2) inducing fusion of pathologically fragmented mitochondrial networks (Figure 8B-C), and 3) the absence of adverse effects on healthy mitochondrial networks (controls) (Figure 8B-C).

Claims

1. operably linked in a 5' to 3' or 3' to 5' direction, (a) a binding domain configured to bind to an OPA1 target sequence, including an intron, an intron / exon junction, or an exon; (b) a splicing domain configured to mediate trans-splicing, and (c) Coding domain containing functional OPA1 exons 1. A nucleic acid OPA1 pre-mRNA trans-splicing molecule comprising: The nucleic acid OPA1 pre-mRNA trans-splicing molecule is configured to trans-splice the coding domain to an endogenous mutant OPA1 exon adjacent to the OPA1 target sequence, thereby replacing the endogenous mutant OPA1 exon with the functional OPA1 exon and correcting the mutation in the OPA1 transcript.

2. 2. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of claim 1, wherein the OPA1 target sequence comprising an intron, an intron / exon junction, or an exon is Homo sapiens OPA1 introns 8-9 / exon 9.

3. 3. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of claim 1 or claim 2, wherein the OPA1 target sequence, including an intron, an intron / exon junction, or an exon, is Homo sapiens OPA1 introns 8-9 / exon 9 consisting of SEQ ID NO:

1.

4. The binding domain may be located at a binding site within or including nucleotides 1 to 52 of SEQ ID NO:1, or at a binding site within or including nucleotides 1 to 50 of SEQ ID NO:1, or at a binding site within or including nucleotides 261 to 315 of SEQ ID NO:1, or at a binding site within or including nucleotides 361 to 603 of SEQ ID NO:1, or at a binding site within or including nucleotides 361 to 460 of SEQ ID NO:1, or at a binding site within or including nucleotides 375 to 460 of SEQ ID NO:1 or nucleotides 461 to 603 of SEQ ID NO:1, or at a binding site within or including nucleotides 510 to 784 of SEQ ID NO:1, or at a binding site within or including nucleotides 510 to 756 of SEQ ID NO:1, or at a binding site within or including nucleotides 510 to 726 of SEQ ID NO:1, or at a binding site within or including nucleotides 518 to 784 of SEQ ID NO:

1.

10. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of claim 3, wherein the nucleic acid OPA1 pre-mRNA trans-splicing molecule is configured to bind to the OPA1 target sequence at or encompassing a binding site within or encompassing nucleotides 518-756 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 518-726 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 561-784 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 561-756 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 561-726 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 627-784 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 627-756 of SEQ ID NO:1, or at a binding site within or encompassing nucleotides 627-726 of SEQ ID NO:1, or at a combination of said binding sites.

5. The binding domain is selected from nucleotides 1 to 52 of SEQ ID NO:1, or nucleotides 1 to 50 of SEQ ID NO:1, or nucleotides 261 to 315 of SEQ ID NO:1, or nucleotides 361 to 603 of SEQ ID NO:1, or nucleotides 361 to 460 of SEQ ID NO:1, or nucleotides 375 to 460 of SEQ ID NO:1, or nucleotides 461 to 603 of SEQ ID NO:1, or nucleotides 510 to 784 of SEQ ID NO:1, or nucleotides 510 to 756 of SEQ ID NO:1, or nucleotides 510 to 726 of SEQ ID NO:1, or nucleotides 518 to 784 ....

5. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of claim 3, wherein the nucleic acid OPA1 pre-mRNA trans-splicing molecule is complementary to six or more contiguous nucleotides of a binding site within or encompassing nucleotides 8 to 756, or nucleotides 518 to 726 of SEQ ID NO:1, or nucleotides 561 to 784 of SEQ ID NO:1, or nucleotides 561 to 756 of SEQ ID NO:1, or nucleotides 561 to 726 of SEQ ID NO:1, or nucleotides 627 to 784 of SEQ ID NO:1, or nucleotides 627 to 756 of SEQ ID NO:1, or nucleotides 627 to 726 of SEQ ID NO:1, or a combination of said binding sites.

6. The binding domain comprises or consists of, or is a fragment of, SEQ ID NO:2 (BD#114), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:3 (BD#128), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:4 (BD#162), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:5 (BD#135), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:6 (BD#106), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:7 (BD #100), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:8 (BD #130), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:9 (BD #158), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:10 (BD #166), or the binding domain comprises or consists of, or is a fragment of, SEQ ID NO:11 (BD or the binding domain comprises or consists of or a fragment of SEQ ID NO: 12 (BD #224), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 13 (BD ​​#209), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 14 (BD #239), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 15 (BD #267), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 16 (BD #217), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 17 (BD #247), or the binding domain comprises or consists of or a fragment of SEQ ID NO: 18 (BD #275), or the binding domain is a combination of the binding domains.

7. 7. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of claim 1, wherein the mutation is present in any one of OPA1 exons 10 to 31.

8. 8. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of claim 7, wherein the mutation is associated with hereditary optic neuropathies, in particular autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+), and Beer's syndrome, or extraocular diseases, in particular sensorineural hearing loss, peripheral neuropathy, Parkinsonism, mitochondrial myopathy, and heart disease.

9. 8. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of claim 7, wherein the mutation is associated with a hereditary optic neuropathy selected from autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+), and Beer's syndrome.

10. 8. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of claim 7, wherein the mutation is associated with susceptibility to optic neuropathy: normal tension glaucoma.

11. 8. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of claim 7, wherein the mutation is associated with an extraocular disease selected from sensorineural hearing loss, peripheral neuropathy, Parkinsonism, and mitochondrial myopathy.

12. 12. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of claim 11, wherein the mitochondrial myopathy is mitochondrial depletion syndrome 14.

13. 13. The nucleic acid OPA1 pre-mRNA trans-splicing molecule of any one of claims 1 to 12, wherein the coding domain comprises functional OPA1 exons 9 to 31.

14. The nucleic acid OPA1 pre-mRNA trans-splicing molecule is SEQ ID NO: 27 (OPA1 RTM th #114), or SEQ ID NO: 28 (OPA1 RTM th #128), or SEQ ID NO: 30 (OPA1 RTM th #162), or SEQ ID NO: 29 (OPA1 RTM th #135) or SEQ ID NO: 26 (OPA1 RTM th #106), or SEQ ID NO: 31 (OPA1 RTM th #100), or SEQ ID NO: 32 (OPA1 RTM th #130), or SEQ ID NO: 33 (OPA1 RTM th #158), or SEQ ID NO: 34 (OPA1 RTM th #166), or SEQ ID NO: 35 (OPA1 RTM th #196), or SEQ ID NO: 36 (OPA1 RTM th #224), or SEQ ID NO: 37 (OPA1 RTM th #209), or SEQ ID NO: 38 (OPA1 RTM th #239), or SEQ ID NO: 39 (OPA1 RTM th #267), or SEQ ID NO: 40 (OPA1 RTM th #217), or SEQ ID NO: 41 (OPA1 RTM th #247), or SEQ ID NO: 42 (OPA1 RTM th #275).

15. A cloning vector comprising the nucleic acid OPA1 pre-mRNA trans-splicing molecule of any one of claims 1 to 14.

16. 16. The cloning vector of claim 15, wherein the cloning vector is selected from a plasmid, a minicircle, a cosmid, a YAC vector, a BAC vector, and a viral vector.

17. 17. The cloning vector of claim 16, wherein the viral vector is an adeno-associated virus (AAV), in particular a recombinant adeno-associated virus (rAAV), a single-stranded adeno-associated virus (ssAAV), or a self-complementary adeno-associated virus (scAAV).

18. 18. The cloning vector of any one of claims 15 to 17, wherein the recombinant adeno-associated virus targets retinal ganglion cells, photoreceptor cells, amacrine cells, horizontal cells, bipolar cells, or cells of the auditory nerve.

19. A cell comprising a nucleic acid OPA1 pre-mRNA trans-splicing molecule according to any one of claims 1 to 14 or a cloning vector according to any one of claims 15 to 18.

20. A pharmaceutical composition comprising a nucleic acid OPA1 pre-mRNA trans-splicing molecule according to any one of claims 1 to 14, or a cloning vector according to any one of claims 15 to 18, or a cell according to claim 19, and at least one pharmaceutically acceptable carrier or excipient.

21. 21. A nucleic acid OPA1 pre-mRNA trans-splicing molecule according to any one of claims 1 to 14, or a cloning vector according to any one of claims 15 to 18, or a cell according to claim 19, or a pharmaceutical composition according to claim 20, for use in treating or preventing a disease or disorder associated with a mutation in the OPA1 gene in a subject.

22. 22. The nucleic acid OPA1 pre-mRNA trans-splicing molecule, or cloning vector, or cell, or pharmaceutical composition for use according to claim 21, wherein the disease or disorder associated with the OPA1 gene mutation is a hereditary optic neuropathic disorder, in particular autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+), and Beer's syndrome, or an extraocular disease, in particular sensorineural hearing loss, peripheral neuropathy, Parkinsonism, mitochondrial myopathy, and heart disease.

23. 22. The nucleic acid OPA1 pre-mRNA trans-splicing molecule, or cloning vector, or cell, or pharmaceutical composition for use according to claim 21, wherein the disease or disorder associated with an OPA1 gene mutation is a hereditary optic neuropathy selected from autosomal dominant optic atrophy (ADOA), autosomal dominant optic atrophy plus (ADOA+), and Beer's syndrome.

24. 22. The nucleic acid OPA1 pre-mRNA trans-splicing molecule, or cloning vector, or cell, or pharmaceutical composition for use according to claim 21, wherein the disease or disorder associated with the OPA1 gene mutation is susceptibility to the optic neuropathy: normal tension glaucoma.

25. 22. The nucleic acid OPA1 pre-mRNA trans-splicing molecule, or cloning vector, or cell, or pharmaceutical composition for use according to claim 21, wherein the disease or disorder associated with the OPA1 gene mutation is associated with an extraocular disease selected from sensorineural hearing loss, peripheral neuropathy, Parkinsonism, and mitochondrial myopathy.

26. 26. The nucleic acid OPA1 pre-mRNA trans-splicing molecule, or cloning vector, or cell, or pharmaceutical composition for use according to claim 25, wherein the mitochondrial myopathy is mitochondrial depletion syndrome 14.

Images