Small interfering RNA targeting C3 and uses thereof
Isolated siRNAs targeting specific regions of the C3 mRNA sequence reduce C3 expression, addressing diseases associated with elevated complement levels, offering a therapeutic solution for complement-related disorders.
Patent Information
- Application Number
- JP2025521112
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-10-14
- Filing Date
- 2023-10-16
- Publication Date
- 2025-10-17
Smart Images

Figure 2025534701000001_ABST
Abstract
Description
[Technical Field]
[0001] Related Applications This application claims priority to and the benefit of U.S. Provisional Application No. 63 / 416,070, filed October 14, 2022, the contents of which are incorporated herein by reference in their entirety.
[0002] Electronic Sequence Listing Reference The contents of the electronic sequence listing (SANB_016_001WO_SeqList_ST26.xml; Size: 592,264 bytes; and Date of Creation: October 14, 2023) are incorporated herein by reference in their entirety. [Background technology]
[0003] The complement system is part of the innate immune system, consisting of multiple soluble proteins present in serum as inactive precursors. Upon activation, these complement components form an amplifying cascade that leads to the generation of bioactive effector compounds. This cascade plays a central role in maintaining cellular integrity and tissue homeostasis through the removal of damaged or dead cells, immune complexes, and cellular debris. It also plays a role in immune regulation, metabolism, inflammation, and host defense against pathogens. The complement system has three activation pathways, all of which revolve around the proteolytic cleavage of a central component, C3, which serves as a convergence point for downstream effector functions. C3's central role in the complement cascade makes it an ideal target for complement regulation.
[0004] Deficiency or loss-of-function mutations in common complement components can result in dysregulation of normal complement system function and the potential for overproduction of complement components. Excessive production and / or dysregulation is associated with chronic diseases, including, but not limited to, neurological, hematological, ocular, renal, and autoimmune diseases and / or disorders, as well as an increased number of infectious diseases. Therefore, there is a need for therapies for subjects with diseases, disorders, and symptoms associated with elevated levels of complement C3 expression. The present disclosure provides compositions targeting C3 and methods for reducing C3 expression for the treatment of subjects with complement-related diseases, disorders, or symptoms. Summary of the Invention
[0005] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.
[0006] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19 to 25 nucleotides between any one of the following nucleotide positions from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625.
[0007] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region comprising 19 to 25 nucleotides from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, between any one of nucleotide positions selected from a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625.
[0008] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region between any one of nucleotide positions selected from a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0009] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of nucleotide positions selected from a) 1281-1301; b) 1797-1817; c) 2862-2882; d) 4402-4424; and e) 4520-4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0010] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0011] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region comprising the sequence between any one of nucleotide positions selected from a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0012] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence between any one of nucleotide positions selected from a) 772-801; b) 2424-2444; c) 3784-3805; d) 4123-4169; e) 4438-4509; and f) 4558-4621 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0013] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0014] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence substantially identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0015] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0016] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0017] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of C3 mRNA.
[0018] In some embodiments of the isolated oligonucleotide of the present disclosure, sense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, antisense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, both sense strand and antisense strand are single-stranded RNA molecules.
[0019] In some embodiments of the isolated oligonucleotide of the present disclosure, the single-stranded RNA molecule of the sense strand comprises a 3' overhang. In some embodiments, in the single-stranded RNA molecule of the sense strand, the 3' overhang comprises at least one nucleotide. In some embodiments, in the single-stranded RNA molecule of the sense strand, the 3' overhang comprises two nucleotides.
[0020] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense single-stranded RNA molecule comprises a 3' overhang. In some embodiments, in the antisense single-stranded RNA molecule, the 3' overhang comprises at least one nucleotide. In some embodiments, in the antisense single-stranded RNA molecule, the 3' overhang comprises two nucleotides.
[0021] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine (CC), guanine-guanine (GG), or uracil-uracil (UU).
[0022] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence at least 20 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises an RNA sequence 20 nucleotides in length.
[0023] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence at least 22 nucleotides in length. In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises an RNA sequence 22 nucleotides in length.
[0024] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region is 19-21 nucleotides in length. In some embodiments of the present disclosure, the double-stranded region is 20 nucleotides in length.
[0025] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any one of the antisense and sense strand sequence pairs in Table 1, as described herein.
[0026] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-31.
[0027] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 32-61.
[0028] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-31, and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 32-61, and the antisense and sense strand sequences have sufficient complementarity to allow the formation of a double-stranded region between the antisense and sense strands.
[0029] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 1281-1301; b) 1797-1817; c) 2862-2882; d) 4402-4424; and e) 4520-4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of inhibiting C3 at a dose of 0.1 nM. Attenuate mRNA expression by at least 50% (e.g., 50%–55%, 55%–60%, 60%–65%, 65%–70%, 70%–75%, 75%–80%, 80%–85%, 85%–90%, 90%–95% or 95%–99%, 99%–100%).
[0030] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, 45% to 50%) at a dose of 0.01 nM.
[0031] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 1281-1301; b) 1797-1817; c) 2862-2882; d) 4402-4424; and e) 4520-4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of inhibiting C3 at a dose of 0.01 nM. Attenuate mRNA expression by at least 50% (e.g., 50%–55%, 55%–60%, 60%–65%, 65%–70%, 70%–75%, 75%–80%, 80%–85%, 85%–90%, 90%–95% or 95%–99%, 99%–100%).
[0032] The present disclosure also provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand is a sequence of: a) 33 to 53; b) 237 to 260; c) 444 to 480; d) 583 to 879; e) 1118 to 1328; f) 1409 to 1542; g) 1619 to 1648; h) 1754 to 1816; i) 2232 to 2256; j) 2300 to 2368; k) 2423 to 2452; l) 2518 to 2726; m) 2860 to 2883; n) 2981 to 3043; o) 3125 to 3239 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1. p) 3298-3437; q) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.
[0033] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 a) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054; wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by 20%-50% (e.g., 20%-25%, 25%-30%, 30%-35%, 35%-40%, 40%-45%, 45%-50%) at a dose of 0.1 nM.
[0034] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 a) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-100%) at a dose of 0.1 nM.
[0035] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 a) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054; wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by 20%-50% (e.g., 20%-25%, 25%-30%, 30%-35%, 35%-40%, 40%-45%, 45%-50%) at a dose of 0.01 nM.
[0036] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 a) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-100%) at a dose of 0.01 nM.
[0037] The present disclosure also provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand or the antisense strand or both comprise one or more modified nucleotides.
[0038] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the antisense strand comprises a monomethyl-protected phosphate mimic (5'-MeEP).
[0039] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand or the antisense strand, or both, terminal or internal nucleotides are linked to a targeting ligand. In some embodiments, the targeting ligand comprises at least one GalNAc G1b moiety.
[0040] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the antisense strand comprises nucleotides modified with 2'-F modifications and nucleotides modified with 2'-O-methyl modifications according to the formula: 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15'.
[0041] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises nucleotides modified with 2'-F modifications and nucleotides modified with 2'-O-methyl modifications according to the formula: 5'(M)o(F)o(M)5(F)1(M)1(F)4(M)93'.
[0042] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the antisense strand is i) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 451 (5'[mUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC] 3'); ii) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 452 (5'[mUs][fGs][fU][mA][fG][mU][fA][mG][mA][fA] [mU][mU][mU][fC][mU][fC][mU][mG][mU][mAs][mGs][mG]3'); iii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 453 (5'[mUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mU][mA]3'); iv) the antisense strand of the nucleic acid sequence of SEQ ID NO: 454 (5'[mUs][fAs][fU][mA][fG][m A][fU][mG][mU][fA][mG][mU][mA][fG][mA][fA][mU][mU][mU][mCs][mUs][mC] 3'); v) the antisense strand of the nucleic acid sequence of SEQ ID NO: 455 (5'[mUs][fAs][fU][mG][fA][mA][fG][mC][mA][fA][mU][mU][mC][fU][mC][fC][mU][mC][mA][mGs][mCs][mA] 3'); vi) the antisense strand of the nucleic acid sequence of SEQ ID NO: 456 (5'[mUs][fU vii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 457 (5'[MeEPmUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC]3'); vii) the antisense strand of the nucleic acid sequence of SEQ ID NO: 457 (5'[MeEPmUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC]3');viii) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 458 (5'[MeEPmUs][fGs][fU][mA][fG][mU][fA][mG][mA][fA][mU][mU][mU][fC][mU][fC][mU][mG][mU][mAs][mGs][mG]3'); or ix) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 459 (5'[MeEPmUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mU][mA]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl-protected phosphate mimic;
[0043] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is the sense strand of a nucleic acid sequence according to SEQ ID NO: 444 (5'[mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][Glb][Glb][Glb]3'); ii) the sense strand of a nucleic acid sequence according to SEQ ID NO: 445 (5'[mUs][mAs][mC][mA][mG][fA][mG][fA][fA][ fA][fU][mU][mC][mU][mA][mC][mU][mAs][mCs][mA][Glb][Glb][Glb]3'); iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 446 (5'[mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mU][mA][Glb][Glb]3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 447 (5'[mGs][mAs] [mA][mA][mU][fU][mC][fU][fA][fC][fU][mA][mC][mA][mU][mC][mU][mAs][mUs][mA][Glb][Glb][Glb]3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 448 (5'[mCs][mUs][mG][mA][mG][fG][mA][fG][fA][fA][fU][mU][mG][mC][mU][mU][mC][mAs][mUs][mA][Glb][Glb]3'); the sense strand; or vi) any one of the sense strands of a nucleic acid sequence according to SEQ ID NO: 449 (5'[mGs][mAs][mG][mA][mA][fU][mU][fG][fC][fU][fU][mC][mA][mU][mA][mC][mA][mAs][mAs][mA][Glb][Glb][Glb]3'), wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "Glb" is a GalNAc Glb moiety.
[0044] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the double-stranded region comprises i) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 451 (5'[mUs][fUs][fA][mG][fU][mA][fG][mA][mA][fU][mU][mU][mC][fU][mC][fU][mG][mU][mA][mGs][mGs][mC]3') and i) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 444 (5'[mCs][mUs][m A][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b]3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 453 (5'[mUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs ][mUs][mA]3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 446 (5'[mCs][mAs][mG][mA][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][G1b][G1b][G1b]3'); iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 457 (5'[MeEPmUs][fUs][fA][mG][fU][mA][fG][mA][mA the antisense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5'[mCs][mUs][mA][mC][mA][fG][mA][fG][fA][fA][fA][mU][mU][mC][mU][mA][mC][mUs][mAs][mA][G1b][G1b][G1b]3');or iv) comprising an antisense strand of a nucleic acid sequence according to SEQ ID NO: 459 (5'[MeEPmUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mUs][mA] 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 446 (5'[mCs][mAs][mG][mA][mG][mG][fA][mA][fA][fU][fU][fC][mU][mA][mC][mU][mA][mC][mAs][mUs][mA][Glb][Glb] 3');
[0045] The present disclosure also provides vectors encoding the isolated nucleotides disclosed herein.
[0046] The present disclosure also provides a delivery system comprising the isolated oligonucleotide or vector disclosed herein.
[0047] The present disclosure also provides a pharmaceutical composition comprising an isolated oligonucleotide, vector or delivery system disclosed herein and a pharmaceutically acceptable carrier, diluent or excipient.
[0048] The present disclosure also provides kits comprising an isolated oligonucleotide, vector, delivery system, or pharmaceutical composition disclosed herein.
[0049] The present disclosure also provides a method for inhibiting or downregulating the expression or levels of C3 in a subject in need thereof, the method comprising administering to the subject an effective amount of at least one isolated oligonucleotide, vector, delivery system or pharmaceutical composition disclosed herein.
[0050] The present disclosure also provides a method for treating or preventing a disease or disorder associated with abnormal or increased expression or activity of C3, or a disease or disorder in which C3 is involved, in a subject in need thereof, the method comprising administering to the subject an effective amount of at least one isolated oligonucleotide, vector, delivery system, or pharmaceutical composition disclosed herein. [Brief explanation of the drawings]
[0051] [Figure 1] Figure 1 is a graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human complement C3 in cultured Huh-7 cells. Compounds were transfected into cells at 0.01 nM concentrations. Data are presented as the percentage of remaining human C3 mRNA compared to mock transfection, normalized to Gapdh mRNA levels (mean, + / - SEM). Each bar represents a single compound tested.
[0052] [Figure 2] Figure 2 is a graph showing the efficacy of the siRNA compounds listed in Table 2 in silencing human complement C3 in cultured Huh-7 cells. Compounds were transfected into cells at 0.1 nM concentrations. Data are presented as the percentage of remaining human C3 mRNA compared to mock transfection, normalized to Gapdh mRNA levels (mean, + / - SEM). Each bar represents a single compound tested.
[0053] [Figure 3] Figure 3 is a graph showing the in vivo efficacy of a subset of the compounds listed in Table 2 in mouse HDI livers 4 days after administration at 1 mg / kg. Data are presented as % of remaining human C3 mRNA compared to PBS when normalized to NeoR mRNA levels (mean, + / - SEM).
[0054] [Figure 4]Figure 4 is a graph showing the in vivo dose response in mouse HDI livers 4 days after administration of 0.25, 0.5, or 1 mg / kg of a subset of the compounds listed in Table 2. Data are presented as % of remaining human C3 mRNA compared to PBS when normalized to NeoR mRNA levels (mean, + / - SEM).
[0055] [Figure 5A] Figure 5A is a graph showing the in vivo efficacy evaluation of the compounds listed in Table 3 in cynomolgus monkeys after a single 3 mg / kg sc dose. Liver residual Cyno C3 mRNA (Figure 5A) and serum residual C3 protein (Figure 5B) were measured over time. Data were normalized to pre-dose mRNA or protein levels for each animal. [Figure 5B] Figure 5B is a graph showing the in vivo efficacy evaluation of the compounds listed in Table 3 in cynomolgus monkeys after a single 3 mg / kg sc dose. Liver residual Cyno C3 mRNA (Figure 5A) and serum residual C3 protein (Figure 5B) were measured over time. Data were normalized to pre-dose mRNA or protein levels for each animal.
[0056] [Figure 6] FIG. 6 is a graph showing human C3 mRNA remaining in human primary hepatocytes after treatment with compounds of Table 3. DETAILED DESCRIPTION OF THE INVENTION
[0057] The present disclosure provides isolated oligonucleotides (oligonucleotides), preferably small interfering RNAs (siRNAs), that form a double-stranded region and can reduce complement C3 mRNA expression, subsequently resulting in a reduction in the level of C3 protein expression in target cells. The oligonucleotides of the present disclosure may have therapeutic applications in modulating C3 expression for the treatment of complement component-associated diseases, including, but not limited to, paroxysmal nocturnal hemoglobinuria (PNH), rheumatoid arthritis, ischemia-reperfusion injury, multiple sclerosis (MS), Guillain-Barré syndrome, systemic lupus erythematosus, C3 glomerulonephritis (C3G), atypical hemolytic uremic syndrome (aHUS), myasthenia gravis (MG), neuromyelitis optica (NMOSD), dense deposit disease (DDD), age-related macular degeneration (AMD), IgA nephropathy, multifocal motor neuropathy (MMN), organ transplantation, and neurodegenerative diseases.
[0058] In some embodiments, the present invention provides compositions and methods for treating a subject having a disorder that would benefit from reduced complement C3 expression. In some embodiments, the methods disclosed herein prevent at least one symptom in a subject having a disease or disorder that would benefit from reduced complement C3 expression.
[0059] The present disclosure has identified specific regions within C3 mRNA that provide targets for binding of double-stranded oligonucleotides, such as siRNA, that result in a reduction in the expression level of C3 mRNA.
[0060] The C3 mRNA sequence described herein is the mRNA sequence encoded by the complement C3 gene according to GenBank accession number NM_64.4. AAGAGGGAGAGGCTGAAATCCCCAGCCGCCTCACCTGCAGCTCAGCTCCATCCTACTTGAAACCTCACCTGTTCCCCGCATTTTCTCCTGGCGTTCGCCTGCTAGTGTG (SEQ ID NO: 1)
[0061] The present disclosure provides an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.
[0062] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19 to 25 nucleotides between any one of the following nucleotide positions from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1: a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625.
[0063] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region comprising 19 to 25 nucleotides from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, between any one of nucleotide positions selected from a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625.
[0064] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region between any one of nucleotide positions selected from a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0065] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of nucleotide positions selected from a) 1281-1301; b) 1797-1817; c) 2862-2882; d) 4402-4424; and e) 4520-4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0066] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0067] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence substantially identical to a region comprising the sequence between any one of nucleotide positions selected from a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0068] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence between any one of nucleotide positions selected from a) 772-801; b) 2424-2444; c) 3784-3805; d) 4123-4169; e) 4438-4509; and f) 4558-4621 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0069] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0070] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence substantially identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0071] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0072] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588 to 608; b) 773 to 800; c) 2533 to 2585; d) 3778 to 3836; e) 4492 to 4512; and f) 4600 to 4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0073] The C3 mRNA sequence according to SEQ ID NO: 1 described herein is any heterologous mRNA sequence having sufficient identity to C3 according to Accession No. NM_64.4 to allow binding to the antisense strand of an oligonucleotide of the present disclosure, as described herein.
[0074] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is capable of inducing degradation of C3 mRNA.
[0075] In some embodiments of the isolated oligonucleotide of the present disclosure, sense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, antisense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, both sense strand and antisense strand are single-stranded RNA molecules.
[0076] In some embodiments, the isolated oligonucleotide of the present disclosure is a small interfering RNA (siRNA). Thus, the present disclosure provides an siRNA, wherein the siRNA comprises a sense region and an antisense region complementary to the sense region, which together form an RNA duplex, and the sense region comprises a sequence at least 70% to 100% identical to the C3 mRNA sequence.
[0077] definition "RNAi" or "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing mediated by double-stranded RNA (dsRNA). The duplex RNAs siRNA (small interfering RNA), miRNA (microRNA), shRNA (short hairpin RNA), ddRNA (DNA-dependent RNA), piRNA (Piwi-interacting RNA), or rasiRNA (repeat-associated siRNA), as well as their modified forms, can all mediate RNA interference. These dsRNA molecules can be purchased commercially or designed and prepared based on known sequence information. The antisense strand of these molecules can comprise RNA, DNA, PNA, or a combination thereof. These DNA / RNA chimeric polynucleotides include, but are not limited to, double-stranded polynucleotides composed of DNA and RNA that inhibit the expression of target genes. These dsRNA molecules can also contain one or more modified nucleotides, which can be incorporated into either strand, as described herein.
[0078] In RNAi gene silencing or knockdown process, dsRNA is introduced into organism, which comprises the first (antisense) strand that is complementary to a part of target gene, and the second (sense) strand that is completely or partially complementary to the first antisense strand.After being introduced into organism, target gene-specific dsRNA is processed into relatively small fragments (siRNA), which are then distributed throughout organism, and can reduce the messenger RNA of target gene, and can cause the phenotype that can closely resemble the phenotype that results from the complete or partial deletion of target gene.
[0079] Certain dsRNAs in cells can be acted upon by the Dicer enzyme, a ribonuclease III enzyme. Dicer can process dsRNA into shorter dsRNA fragments, i.e., siRNAs. RNAi also involves an endonuclease complex known as the RNA-induced silencing complex (RISC). Following cleavage by Dicer, the siRNA enters the RISC complex and directly cleaves the single-stranded RNA target that has a sequence complementary to the antisense strand of the siRNA duplex. The other strand of the siRNA is the passenger strand. Cleavage of the target RNA occurs in the center of the region complementary to the antisense strand of the siRNA duplex. Therefore, siRNA can downregulate or knock down gene expression by mediating RNA interference in a sequence-specific manner.
[0080] As used herein, " target gene " or " target sequence " refers to the gene or gene sequence whose corresponding RNA is targeted by using dsRNA or siRNA as described herein to be degraded through RNAi pathway.For example, to target a gene using siRNA, siRNA comprises the antisense region that is complementary or substantially complementary to at least a part of target gene or sequence, and the sense strand that is complementary to the antisense strand.When introduced into cell, siRNA cuts the RNA that comprises target sequence, thereby instructing RISC complex to degrade RNA.
[0081] As used herein, the terms "oligonucleotide," "nucleic acid," "nucleotide sequence," and "polynucleotide" are used interchangeably and encompass both RNA and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g., chemically synthesized) DNA or RNA, and chimeras of RNA and DNA. The terms polynucleotide, nucleotide sequence, or nucleic acid refer to a chain of nucleotides regardless of the length of the chain. A nucleic acid can be double-stranded or single-stranded. If single-stranded, the nucleic acid can be the sense strand or the antisense strand. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such oligonucleotides can be used to prepare nucleic acids with, for example, altered base-pairing abilities or increased nuclease resistance. The present disclosure further provides nucleic acids that are complements (which can be either full complements or partial complements) of the nucleic acids, nucleotide sequences, or polynucleotides of the present disclosure. When dsRNA is synthetically produced, less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine, etc. can also be used for antisense, dsRNA and ribozyme pairing.Other modifications, such as phosphodiester backbone or 2'-fluoro, 2'-hydroxy or 2'O-methyl in the ribose sugar group of RNA, can also be made.
[0082] The term "isolated" can refer to a nucleic acid, nucleotide sequence, or polypeptide that is substantially free of cellular material, viral material, and / or culture medium (if produced by recombinant DNA technology), or chemical precursors or other chemicals (if chemically synthesized). Furthermore, an "isolated fragment" is a fragment of a nucleic acid, nucleotide sequence, or polypeptide that is not naturally occurring as a fragment and would not be found in the natural state. "Isolated" does not imply that the preparation is technically pure (homogeneous), but rather that the polypeptide or nucleic acid is sufficiently pure to provide a form that can be used for its intended purpose.
[0083] The terms "region" and "fragment" are used interchangeably and apply to oligonucleotides.
[0084] A C3 mRNA sequence as described herein will be understood to refer to the full-length C3 mRNA nucleotide sequence unless otherwise indicated. In some embodiments, a C3 mRNA sequence may be a nucleotide sequence of a C3 mRNA sequence that is shorter in length than a reference nucleic acid or nucleotide sequence, comprising, consisting essentially of, and / or consisting of a nucleotide sequence of consecutive nucleotides identical or nearly identical (e.g., 60%, 70%, 80%, 90%, 92%, 95%, 98%, or 99% identical) to the reference nucleic acid or nucleotide sequence. Such nucleic acid fragments according to the present disclosure may be included in a larger polynucleotide of which they are a component, as appropriate. In some embodiments, such fragments may comprise, consist essentially of, and / or consist of an oligonucleotide having a length of at least about 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more consecutive nucleotides of a nucleic acid or nucleotide sequence according to the present disclosure.
[0085] As used herein, a "complementary" polynucleotide is one that can base-pair according to standard Watson-Crick complementarity rules. Specifically, purines base-pair with pyrimidines to form combinations such as guanine and cytosine (G:C), and adenine and either thiamine (A:T) in DNA or adenine and uracil (A:U) in RNA. For example, the sequence "AGT" binds to the complementary sequence "TCA." It is understood that two polynucleotides can hybridize to each other even if they are not perfectly complementary to each other, as long as each has at least one region that is substantially complementary to the other.
[0086] As used herein, the term "substantially complementary" refers to at least 90% (e.g., 91, 92, 93, 94, 95, 96, 97, 98, or 99%) complementary to the sense strand that is substantially identical to a nucleotide sequence within a defined region of SEQ ID NO: 1. As used herein, the term "substantially complementary" means that two nucleic acid sequences are complementary over at least about 90%, 95%, or 99% of their nucleotides.
[0087] In some embodiments, two nucleic acid sequences can be complementary over at least 90%, 95%, 96%, 97%, 98%, 99% or more of their nucleotides. In some embodiments, two nucleic acid sequences can be 90%-95% complementary, 70%-100% complementary, 95%-96% complementary, 90%-100% complementary, 96%-97% complementary, 60%-80% complementary, 97%-98% complementary, 70%-90% complementary, 98%-99% complementary, 80%-100% complementary, or 99%-100% complementary.
[0088] The term "substantially complementary" can also mean that two nucleic acid sequences, sense and antisense, have sufficient complementarity to allow binding between the sense and antisense strands to form a double-stranded region comprising 19 to 25 nucleotides in length. The term "substantially complementary" can also mean that two nucleic acid sequences can hybridize under high stringency conditions, such conditions being well known in the art.
[0089] As used herein, the terms "substantially identical" or "sufficient identity," used interchangeably herein, refer to a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% (e.g., 70% to 80%, 8% to 90%, or 90% to 95%, or 95% to 99%, or 99% to 100%) identical to a nucleotide sequence within a defined region of SEQ ID NO:1.
[0090] As used herein, the term "identity" refers to the following comparison of sequences. To determine the percentage identity of two nucleic acid sequences, the sequences can first be aligned with each other, allowing for the comparison of these sequences. For this purpose, for example, gaps can be inserted into the sequence of the first nucleic acid sequence, and the nucleotide can be compared with the corresponding position of the second nucleic acid sequence. If a position in the first nucleic acid sequence is occupied by the same nucleotide as a position in the second sequence, the two sequences are identical at this position. The percentage identity between two sequences is a function of the number of identical positions divided by the number of all positions compared in the examined sequences.
[0091] "Percent identity" or "% identity," as used interchangeably herein with respect to aligned segments of a test sequence and a reference sequence, is the percent of identical elements shared by the two aligned sequences divided by the total number of elements in the reference sequence segment, i.e., the entire reference sequence or a smaller, defined portion of the reference sequence.
[0092] "Nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein unless otherwise indicated.
[0093] The percentage identity of two sequences can be determined using a mathematical algorithm.A preferred, but non-limiting example of a mathematical algorithm that can be used to compare two sequences is the algorithm of Karlin et al. (1993), PNAS USA, 90:5873-5877.Such an algorithm is incorporated into the NBLAST program, and can identify the sequence with the desired identity with the sequence disclosed herein.To obtain the gapped alignment described herein, the "Gapped BLAST" program can be used, as described in Altschul et al. (1997), Nucleic Acids Res, 25:3389-3402.When using BLAST and Gapped BLAST programs, the preset parameters of the specific program (for example, NBLAST) can be used. Sequences can be further aligned using the Genetic Computing Group's GAP (Global Alignment Program) version 9, using a preset (BLOSUM62) matrix (values -4 to +11) with a gap open penalty of -12 (for the first zero in a gap) and a gap extension penalty of -4 (for each additional consecutive zero in a gap). After alignment, percentage identity is calculated by expressing the number of matches as a percentage of the nucleic acid content in the claimed sequence. The described methods for determining the percentage identity of two nucleic acid sequences can also be used for encoded amino acid sequences, if desired.
[0094] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)), and Carillo, H., and Lipton, D., (Applied Math 48:1073 (1988)). More specifically, preferred computer programs for determining sequence identity include, but are not limited to, the Basic Local Alignment Search Tool (BLAST) program, publicly available from the National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health, Bethesda, Md. 20894. See BLAST Manual, Altschul et al., NCBI, NLM, NIH; (Altschul et al., J. Mol. Biol. 215:403-410 (1990)). BLAST program version 2.0 and above allows for the introduction of gaps (deletions and insertions) into the alignment. For peptide sequences, BLASTX can be used to determine sequence identity. For polynucleotide sequences, BLASTN can be used to determine sequence identity. Percent identity can be 70% identity or greater, e.g., at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 98% identity, at least 99% identity, or 100% identity.
[0095] As used herein, "heterologous" refers to a nucleic acid sequence that originates from another species, or originates from the same species or organism, but is modified from either its original form or the form primarily expressed in the cell. Thus, a nucleotide sequence that originates from an organism or species different from the cell into which it is introduced is heterologous with respect to that cell and its progeny. Furthermore, a heterologous nucleotide sequence originates from the same native original cell type and contains the nucleotide sequence inserted therein, but exists in a non-natural state, for example, in a different copy number and / or under the control of regulatory sequences different from those found in nature.
[0096] Double-stranded RNA targeting human complement C3
[0097] The present disclosure provides an isolated oligonucleotide comprising a double-stranded RNA (dsRNA) duplex region that targets the C3 mRNA sequence for degradation. The double-stranded RNA molecule of the present disclosure can be in the form of any type of RNA interference molecule known in the art. In some embodiments, the double-stranded RNA molecule is a small interfering RNA (siRNA). In other embodiments, the double-stranded RNA molecule is a short hairpin RNA (shRNA) molecule. In other embodiments, the double-stranded RNA molecule is a Dicer substrate that is processed in cells to produce siRNA. In other embodiments, the double-stranded RNA molecule is part of a microRNA precursor molecule.
[0098] In some embodiments, the dsRNA is a small interfering RNA (siRNA) that targets the C3 mRNA sequence for degradation. In some embodiments, the siRNA that targets C3 is packaged into a delivery system (e.g., nanoparticle) as described herein.
[0099] The isolated oligonucleotides of the present disclosure that target C3 for degradation can comprise a sense strand that is at least 70% identical to any fragment of C3 mRNA, for example, SEQ ID NO: 1. In some embodiments, the sense strand comprises, or essentially consists of, a sequence at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to any fragment of SEQ ID NO: 1. The siRNAs that target C3 for degradation can comprise an antisense strand that is at least 70% identical to a sequence complementary to any fragment of C3 mRNA, for example, SEQ ID NO: 1. In some embodiments, the antisense strand comprises, or essentially consists of, a sequence at least 70%, at least 80%, at least 90%, at least 95%, or 100% identical to a sequence complementary to any fragment of SEQ ID NO: 1. In some embodiments, the sense and antisense regions are complementary and base-pair to form an RNA duplex structure. The fragment of the C3 mRNA that has percent identity to the sense region of the siRNA and is complementary to the antisense region of the siRNA can be the protein coding sequence of the mRNA, the untranslated region (UTR) of the mRNA (5'UTR or 3'UTR), or both.
[0100] In some embodiments, the isolated oligonucleotide of the present disclosure comprises a sense region and an antisense region complementary to the sense region, which together form an RNA duplex, and the sense region comprises a sequence that is at least 70% identical to the C3 mRNA sequence. In some embodiments, the sense region is identical to the C3 mRNA sequence.
[0101] As used herein, the term "sense strand" or "sense region" refers to the nucleotide sequence of an siRNA molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand or antisense region of the siRNA molecule.The sense strand of the isolated oligonucleotide of the disclosed molecule can comprise a nucleic acid sequence that has a certain degree of identity with a target nucleic acid sequence, such as the C3 mRNA sequence.In some cases, the sense region can have 100% identity, i.e., complete identity or homology, with the target nucleic acid sequence.In other cases, there can be one or more mismatches between the sense region and the target nucleic acid sequence.For example, there can be 1, 2, 3, 4, 5, 6 or 7 mismatches between the sense region and the target nucleic acid sequence.
[0102] As used herein, the term "antisense strand" or "antisense region" refers to the nucleotide sequence of an isolated oligonucleotide of the present disclosure that is partially or completely complementary to at least a portion of a target nucleic acid sequence. The antisense strand of an isolated oligonucleotide of the disclosed molecule can comprise a nucleic acid sequence that is complementary to at least a portion of the corresponding sense strand of the isolated oligonucleotide.
[0103] In some embodiments, the sense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 as disclosed herein. In some embodiments, the sense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 as disclosed herein. In some embodiments, the sense region comprises a sequence identical to the sequence of SEQ ID NO:1 or a region of SEQ ID NO:1 as disclosed herein.
[0104] In some embodiments, the sense region of an isolated oligonucleotide of the present disclosure targeting C3 has one or more mismatches between the sequence of the isolated oligonucleotide and the C3 sequence. For example, the sequence of the sense region may have one, two, three, four, or five mismatches between the sequence of the sense region of the isolated oligonucleotide and the C3 sequence. In some embodiments, the C3 sequence is the C3 3' untranslated region sequence (3' UTR). Without wishing to be bound by theory, siRNAs targeting the 3' UTR are believed to have a higher mismatch tolerance compared to mismatches in isolated oligonucleotides targeting the coding region of a gene. Furthermore, the isolated oligonucleotide RNA may be tolerant to mismatches outside the seed region. As used herein, the "seed region" of an isolated oligonucleotide refers to base pairs 2 to 8 of the antisense region of the isolated oligonucleotide, i.e., the strand of the isolated oligonucleotide that is complementary to and hybridizes to the target mRNA.
[0105] In some embodiments, the antisense region comprises a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% identical, or 100% identical to the sequence of SEQ ID NO:1 or a sequence complementary to a region of SEQ ID NO:1, as disclosed herein. In some embodiments, the antisense region consists essentially of a sequence that is at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 97% identical, at least 99% or 100% identical to the sequence of SEQ ID NO:1 or a sequence complementary to a region of SEQ ID NO:1. In some embodiments, the sense region consists essentially of the sequence of SEQ ID NO:1 or a sequence complementary to a region of SEQ ID NO:1.
[0106] The antisense region of the isolated oligonucleotide of the present disclosure that targets C3 is complementary to the sense region.In some embodiments, the sense region and the antisense region are completely complementary (no mismatch).In some embodiments, the antisense region is partially complementary to the sense region, that is, there are 1, 2, 3, 4 or 5 mismatches between the sense region and the antisense region.
[0107] Generally, the isolated oligonucleotides of the present disclosure comprise an RNA duplex about 16 to about 25 nucleotides in length. In some embodiments, the RNA duplex is about 17 to about 24 nucleotides in length, about 18 to about 23 nucleotides in length, or about 19 to about 22 nucleotides in length. In some embodiments, the RNA duplex is 19 nucleotides in length. In some embodiments, the RNA duplex is 20 nucleotides in length.
[0108] In some embodiments of the isolated oligonucleotide of the present disclosure, sense strand is a single-stranded RNA molecule.In some embodiments of the isolated oligonucleotide of the present disclosure, antisense strand is a single-stranded RNA molecule.In some embodiments, both sense strand and antisense strand are single-stranded RNA molecules.In some embodiments, the isolated oligonucleotide of the present disclosure is siRNA that targets C3, and comprises two different single-stranded RNAs, one comprises sense region, and the second comprises antisense region, and they hybridize to form RNA duplex.
[0109] In some embodiments, the isolated oligonucleotides of the present disclosure can have one or more overhangs from the double-stranded region. In some embodiments, the overhangs, which are non-base-paired single-stranded regions, can be 1 to 8 nucleotides in length or more. In some embodiments, the overhangs can be 3' overhangs, where the 3' end of the strand has a single-stranded region of 1 to 8 nucleotides. In some embodiments, the overhangs can be 5' overhangs, where the 5' end of the strand has a single-stranded region of 1 to 8 nucleotides. In some embodiments, the overhangs of the isolated oligonucleotides are the same length. In some embodiments, the overhangs of the isolated oligonucleotides are different lengths.
[0110] In some embodiments of the isolated oligonucleotide of the present disclosure, the single-stranded RNA molecule of the sense strand comprises a 3' overhang. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the sense strand comprises at least one nucleotide. In some embodiments, the 3' overhang of the single-stranded RNA molecule of the sense strand comprises two nucleotides.
[0111] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense single-stranded RNA molecule comprises a 3' overhang. In some embodiments, the 3' overhang of the antisense single-stranded RNA molecule comprises at least one nucleotide. In some embodiments, the 3' overhang of the antisense single-stranded RNA molecule comprises two nucleotides.
[0112] In some embodiments of the isolated oligonucleotide of the present disclosure, both ends of the isolated oligonucleotide have overhangs, for example, 3' dinucleotide overhangs at each end. In some embodiments, the overhangs at the 5' and 3' ends are different lengths. In some embodiments, the overhangs at the 5' and 3' ends are the same length.
[0113] In some embodiments of the isolated oligonucleotides of the present disclosure, the overhang may comprise one or more deoxyribonucleotides, one or more ribonucleotides, or a combination of deoxyribonucleotides and ribonucleotides. In some embodiments, one or both of the overhanging nucleotides of the siRNA may be 2'-deoxyribonucleotides.
[0114] In some embodiments of the isolated oligonucleotides of the present disclosure, the first single-stranded RNA molecule comprises a first 3' overhang. In some embodiments, the second single-stranded RNA molecule comprises a second 3' overhang. In some embodiments, the first and second 3' overhangs comprise a dinucleotide.
[0115] In some embodiments of the isolated oligonucleotides of the present disclosure, the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine (CC), guanine-guanine (GG), or uracil-uracil (UU). In some embodiments, the isolated oligonucleotides of the present disclosure, the 3' overhang comprises a thymidine-thymidine (dTdT) or uracil-uracil (UU) overhang. In some embodiments, the 3' overhang comprises a uracil-uracil (UU) overhang. Without wishing to be bound by theory, it is believed that 3' overhangs, for example, dinucleotide overhangs, enhance siRNA-mediated mRNA degradation by enhancing siRNA-RISC complex formation and / or the rate of cleavage of the target mRNA by the siRNA-RISC complex.
[0116] In some embodiments, the isolated oligonucleotide of the present disclosure can have one or more blunt ends, where double-stranded region ends without overhang, and strand forms base pairs with the end of double-stranded region.In some embodiments, the isolated oligonucleotide of the present disclosure can have one or more blunt ends, or can have one or more overhangs, or can have a combination of blunt ends and overhang ends.For example, the 5' end of siRNA can be blunt, and the 3' end of the same isolated oligonucleotide can comprise overhang, or vice versa.
[0117] In some embodiments, both ends of an isolated oligonucleotide of the present disclosure are blunt ended.
[0118] In some embodiments of the isolated oligonucleotides of the present disclosure, the double-stranded region comprises an antisense strand and a sense strand according to any one of the antisense and sense strand sequence pairs in Table 1, as described below.
[0119] complement system
[0120] The complement system is a key component of the innate immune system and comprises a group of proteins that are normally inactive and are organized into three activation pathways: the classical pathway, the lectin pathway, and the alternative pathway.
[0121] Molecules from microorganisms, antibodies, or cellular components can activate these pathways, leading to the formation of protease complexes known as C3 and C5 convertases. The first enzyme activation cascade, known as the classical pathway, is a calcium / magnesium-dependent cascade that is usually activated by the formation of antigen-antibody complexes. It can also be activated antibody-independently by the binding of C-reactive protein complexed to a ligand and by many pathogens, including Gram-negative bacteria.
[0122] As described in U.S. Patent No. 8,703,136, the classical pathway includes several components: C1, C4, C2, C3, and C5 (listed in order within the pathway). Initiation of the classical pathway of the complement system occurs after binding and activation of the first complement component (C1) by both immune and non-immune activators. C1 comprises a calcium-dependent complex of components C1q, C1r, and C1s and is activated by binding of the C1q component. C1q contains six identical subunits, each containing three chains (A, B, and C chains). Each chain has a globular head region connected to a collagen-like tail. Binding and activation of C1q by antigen-antibody complexes occurs via the C1q headgroup region. Many non-antibody C1q activators, including proteins, lipids, and nucleic acids, bind and activate C1q through distinct sites on the collagen-like stalk region. The C1qrs complex then catalyzes the activation of complement components C4 and C2 to form the C4b2a complex, which functions as a C3 convertase.
[0123] The second enzyme activation cascade, known as the alternative pathway, is a rapid, antibody-independent pathway for complement system activation and amplification. The alternative pathway is a magnesium-dependent cascade that is activated by the deposition and activation of C3 on certain sensitive surfaces (e.g., yeast and bacterial cell wall polysaccharides, as well as certain biopolymer materials). The alternative pathway involves several components, including C3, factor B, and factor D (listed in order within the pathway). Activation of the alternative pathway occurs when a proteolytically cleaved form of C3, C3b, binds to an activating surface agent, such as bacteria. Factor B then binds to C3b and is cleaved by factor D to yield the active enzyme Ba. The enzyme Ba then cleaves more C3 to generate more C3b, resulting in widespread deposition of C3b-Ba complexes on activating surfaces.
[0124] Therefore, both the classical and alternative complement pathways generate C3 convertases, which cleave factor C3 into C3a and C3b. At this point, both C3 convertases further assemble into C5 convertases (C4b2a3b and C3b3bBb). These complexes then cleave the complement component C5 into two components: the C5a polypeptide (9 kDa) and the C5b polypeptide (170 kDa). The C5a polypeptide binds to a seven-transmembrane receptor, which is originally associated with leukocytes and is now known to be expressed on various tissues, including hepatocytes and neurons. The C5a molecule is the primary chemotactic component of the human complement system and can trigger various biological responses, including leukocyte chemotaxis, smooth muscle contraction, activation of intracellular signaling pathways, neutrophil-endothelial adhesion, cytokine and lipid mediator release, and oxidant formation.
[0125] The larger C5b fragment sequentially binds to subsequent components of the complement cascade, C6, C7, C8, and C9, to form the C5b-9 membrane attack complex (MAC). The lipophilic C5b-9 MAC can directly lyse red blood cells, and in higher amounts, it can lyse white blood cells and damage tissues such as muscle, epithelial, and endothelial cells. At sublytic doses, the C5b-9 MAC can stimulate upregulation of adhesion molecules, intracellular calcium increases, and cytokine release. Furthermore, at sublytic concentrations, the C5b-9 MAC can stimulate cells such as endothelial cells and platelets without causing cell lysis. The nonlytic effects of C5a and C5b-9 MAC are comparable and interchangeable.
[0126] The lectin pathway is initiated when pattern recognition molecules (MBL, CL-K1 and ficolins) bind to so-called pathogen-associated molecular patterns (PAMPs) (D-mannose, N-acetyl-D-glucosamine, or acetyl groups), on the surface of pathogens, or on apoptotic or necrotic cells ( Beltrame et.al, 2015 ).
[0127] The complement system plays an important role in maintaining health, but also has the potential to cause or contribute to disease.
[0128] Complement-targeting drugs have been approved by the U.S. Food and Drug Administration (FDA) and the European Medicines Agency for routine clinical use in four diseases (Garred et al., 2021). The mAb eculizumab (Soliris), which blocks C5 cleavage, was shown to be highly effective in protecting against hemolysis in PNH in 2007 (Brodsky et al., 2008; Parker, 2009), followed by the treatment of atypical hemolytic uremic syndrome (aHUS) (Tschumi et al., 2011; Loirat et al., 2016). More recently, it has also been approved for the neurological disorders generalized myasthenia gravis (Dhillon, 2018) and neuromyelitis optica spectrum disorder (Selmaj and Selmaj, 2019).
[0129] Eculizumab was the only complement inhibitor approved for routine use until the recent introduction of ravulizumab (Ultomiris) and zilucoplan. Ravulizumab is a second-generation eculizumab, which incorporates several small amino acid modifications to the eculizumab molecule, thereby substantially extending its half-life and allowing treatment intervals to be extended from every 2 weeks to every 8 weeks. It shares the same binding site for C5 as eculizumab (i.e., blocks its cleavage, thereby preventing the release of C5a and the formation of C5b-9) (Kulasekararaj et al., 2019; Lee et al., 2019; McKeage, 2019; Stern and Connell, 2019; Lee and Kulasekararaj, 2020).
[0130] Zilcoplan is a structurally distinct drug from the antibodies mentioned above, but its primary function is the same. It is a self-administered subcutaneous synthetic macrocyclic peptide inhibitor that primarily functions similarly to eculizumab, blocking C5 cleavage (Beecher et al., 2019; Albazli et al., 2020; Howard et al., 2020). A phase 2 randomized, double-blind, placebo-controlled, multicenter clinical trial demonstrated that zilcoplan administration resulted in rapid, significant, and sustained improvement over 12 weeks in a broad population of patients with moderate to severe acetylcholine receptor antibody-positive generalized myasthenia gravis (Howard et al., 2020). A close analog of zilcoplan (RA101495), RA101295, has been used in animal studies and has been shown to increase survival in baboon E. coli sepsis (Keshari et al., 2017).
[0131] Thus, the isolated oligonucleotides disclosed in the present disclosure are useful for treating or preventing diseases or disorders associated with abnormal or increased expression or activity of C3, or diseases or disorders in which C3 is involved. Exemplary isolated oligonucleotides of the present disclosure are set forth in Table 1. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence selected from any one of the groups of sense strand / passenger strand sequences listed in Tables 1, 2, and 3. In some embodiments, the antisense strand comprises a sequence selected from any one of the groups of antisense strand / guide strand sequences listed in Tables 1, 2, and 3. In some embodiments, the sense and antisense regions comprise complementary sequences selected from the groups listed in Tables 1, 2, and 3.
[0132] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-31.
[0133] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 32-61.
[0134] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2-31, and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 32-61, and the antisense and sense strand sequences have sufficient complementarity to allow the formation of a double-stranded region between the antisense and sense strands.
[0135] Sequences of the present disclosure
[0136] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region between any one of nucleotide positions selected from a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.
[0137] The present disclosure provides isolated oligonucleotides comprising sense and antisense strands, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0138] The present disclosure provides isolated oligonucleotides comprising sense and antisense strands, wherein the sense strand comprises a nucleotide sequence identical to a region comprising 19 to 25 nucleotides between any one of nucleotide positions selected from a) 588 to 608; b) 772 to 801; c) 1281 to 1301; d) 1797 to 1817; e) 2424 to 2444; f) 2533 to 2585; g) 2862 to 2882; h) 3778 to 3836; i) 4123 to 4169; and j) 4402 to 4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0139] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence substantially identical to a region between any one of nucleotide positions selected from a) 1281-1301; b) 1797-1817; c) 2862-2882; d) 4402-4424; and e) 4520-4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0140] The present disclosure provides isolated oligonucleotides comprising sense and antisense strands, wherein the sense strand comprises a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of nucleotide positions selected from a) 1281-1301; b) 1797-1817; c) 2862-2882; d) 4402-4424; and e) 4520-4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO:1.
[0141] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region comprising a sequence between any one of nucleotide positions selected from a) 1281 to 1301; b) 1797 to 1817; c) 2862 to 2882; d) 4402 to 4424; and e) 4520 to 4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0142] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 1281-1301; b) 1797-1817; c) 2862-2882; d) 4402-4424; and e) 4520-4540 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region is selected from: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UGUGUGUUGAUGCUGAGUUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5' AAACUCAGCAUCAACACACA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5' UCUAUCUUCAGGGUCAUCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5' CAGAUGACCCUGAAGAUAGA 3'); iii) the antisense strand of SEQ ID NO: 15 (5' iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UGAGUGUGAGACCUUGUCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5' UGGACAAGGUCUCACACUCA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5' UCAGAGUGUGAGACCUUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5' GACAAGGUCUCACACUCUGA 3'); or vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5' UGUAGAACCGGGUACAGCUUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5' AAGCUGUACCCGGUUCUACA 3').
[0143] The present disclosure provides isolated oligonucleotides comprising sense and antisense strands, wherein the sense strand comprises a sequence substantially identical to a region comprising a sequence between any one of nucleotide positions selected from a) 772-801; b) 2424-2444; c) 3784-3805; d) 4123-4169; e) 4438-4509; and f) 4558-4621 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0144] The present disclosure provides isolated oligonucleotides comprising sense and antisense strands, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising a sequence between any one of nucleotide positions selected from a) 772-801; b) 2424-2444; c) 3784-3805; d) 4123-4169; e) 4438-4509; and f) 4558-4621 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0145] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region comprising a sequence between any one of nucleotide positions selected from a) 772 to 801; b) 2424 to 2444; c) 3784 to 3805; d) 4123 to 4169; e) 4438 to 4509; and f) 4558 to 4621 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0146] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region comprising a sequence between any one of nucleotide positions selected from a) 772-801; b) 2424-2444; c) 3784-3805; d) 4123-4169; e) 4438-4509; and f) 4558-4621 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region is selected from i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UGAUGUAGUAGAAUUUCUCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' AGAGAAAUUCUACUACAUCA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5' UUUAUAGAUGUAGUAGAAUUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5' AAUUCUACUACAUCUAUAAA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5' UAAAAUAUAUUCAUGAGCUUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5' AAGCUCAUGAAUAUAUUUUA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5' UAAGUCAAAGUCUUUUAGCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5' vii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5' UAAAGUCAAAGUCUUUUAGCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5' GCUAAAAGACUUUGACUUUA 3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5' UAAUUUAUUACAGGUGAGUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5' AACUCACCUGUAAUAAAUUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5' UCUGGUUUUAUGGUGACCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5' AAGGUCACCAUAAAACCAGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5' UUAUUGGUGAACUUUGAAAGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5' CUUUCAAAGUUCACCAAUAA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5' UUAAUAGGCGUAGACCUUGACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5' UCAAGGUCUACGCCUAUUAA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5' UCAGAGCUUGUUCAGCUUUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5' GAAAGCUGAACAAGCUCUGA 3'); or xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5' UUAUGAAGCAAUUCUCCUCAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5' UGAGGAGAAUUGCUUCAUAA 3');
[0147] The present disclosure provides isolated oligonucleotides comprising sense and antisense strands, wherein the sense strand comprises a sequence substantially identical to a region comprising a sequence between any one of nucleotide positions selected from a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0148] The present disclosure provides isolated oligonucleotides comprising sense and antisense strands, wherein the sense strand comprises a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising a sequence between any one of nucleotide positions selected from a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0149] The present disclosure provides an isolated oligonucleotide comprising a sense and an antisense strand, wherein the sense strand comprises a nucleotide sequence identical to a region comprising a sequence between any one of nucleotide positions selected from a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1.
[0150] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a sequence identical to a region comprising a sequence between any one of nucleotide positions selected from a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region is selected from i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UGAGAAGACAAGGAGUCCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5' CAGGACUCCUUGUCUUCUCA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' UUAUAGAUGUAGUAGAAUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AAAUUCUACUACAUCUAUAA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5' UAUGAAGAAGUCCUGCAUUACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5' UAAUGCAGGACUUCUUCAUA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5' UUUCGAACAACAGAGUAGGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5' vii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5' UAAGUCUUUUAGCUGCAGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5' UACUGCAGCUAAAAGACUUA 3');viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5' UGUUCAUUGAGCCAACGCACGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5' GUGCGUUGGCUCAAUGAACA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5' UUUGUAAUAGGCGUAGACCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5' AGGUCUACGCCUAUUACAAA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCCUCAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3'); or xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3') the sense strand of the nucleic acid sequence;
[0151] At least 50% C3 knockdown at 0.1 nM
[0152] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of inhibiting C3 at a dose of 0.1 nM. Attenuate mRNA expression by at least 50% (e.g., 50%–55%, 55%–60%, 60%–65%, 65%–70%, 70%–75%, 75%–80%, 80%–85%, 85%–90%, 90%–95% or 95%–99%, 99%–100%).
[0153] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of inhibiting C3 at a dose of 0.1 nM. and attenuating mRNA expression by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%), wherein the double-stranded region comprises: i) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 9 (5' UUUAUAGAUGUAGUAGAAUUUC 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 39 (5' AAUUCUACUACAUCUAUAAA 3'); ii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3'); iii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5' UAAAGUCAAAGUCUUUUAGCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5' GCUAAAAGACUUUGACUUUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3');vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5' UUUGUAAUAGGCGUAGACCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5' AGGUCUACGCCUAUUACAAA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5' UUAAUAGGCGUAGACCUUGACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5' UCAAGGUCUACGCCUAUUAA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UGAGUGUGAGACCUUGUCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5' UGGACAAGGUCUCACACUCA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' UUAUAGAUGUAGUAGAAUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AAAUUCUACUACAUCUAUAA3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5' UCAGAGUGUGAGACCUUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5' GACAAGGUCUCACACUCUGA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UGAUGUAGUAGAAUUUCUCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' AGAGAAAUUCUACUACAUCA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5' UAAGUCAAAGUCUUUUAGCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5' xiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5' UCAGAGCUUGUUCAGCUUUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5' GAAAGCUGAACAAGCUCUGA 3');xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UGUGUGUUGAUGCUGAGUUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5' AAACUCAGCAUCAACACACA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UGAGAAGACAAGGAGUCCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5' CAGGACUCCUUGUCUUCUCA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5' UAAAAUAUAUUCAUGAGCUUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5' AAGCUCAUGAAUAUAUUUUA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5' UUAUGAAGCAAUUCUCCUCAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5' UGAGGAGAAUUGCUUCAUAA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCCUCAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5' UAUGAAGAAGUCCUGCAUUACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5' UAAUGCAGGACUUCUUCAUA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5' UUUCGAACAACAGAGUAGGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5' CCCUACUCUGUUGUUCGAAA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5' UGUUCAUUGAGCCAACGCACGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5' GUGCGUUGGCUCAAUGAACA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5' UAAUUUAUUACAGGUGAGUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5' AACUCACCUGUAAUAAAUUA 3');xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5' UUUUUGUUCAUUCUGAUUCCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5' GGAAUCAGAAUGAACAAAAA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5' UCUGGUUUUAUGGUGACCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5' AAGGUCACCAUAAAACCAGA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5' UCUAUCUUCAGGGUCAUCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5' CAGAUGACCCUGAAGAUAGA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5' UAAGUCUUUUAGCUGCAGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5' UACUGCAGCUAAAAGACUUA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5' UUAUUGGUGAACUUUGAAAGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5' CUUUCAAAGUUCACCAAUAA 3'); or xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5' UGUAGAACCGGGUACAGCUUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5' AAGCUGUACCCGGUUCUACA 3');
[0154] 20-50% C3 knockdown at 0.1 nM
[0155] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of inhibiting C3 at a dose of 0.1 nM. Attenuate mRNA expression by 20%–50% (e.g., 20%–25%, 25%–30%, 30%–35%, 35%–40%, 40%–45%, 45%–50%).
[0156] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is 0.At a dose of 1 nM, the expression of C3 mRNA is attenuated by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, 45% to 50%), and the double-stranded region is composed of: i) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 11 (5' UCUAUCUUCAGGGUCAUCUGCU 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 41 (5' CAGAUGACCCUGAAGAUAGA 3'); ii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 24 (5' UUAUUGGUGAACUUUGAAAGCU 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 54 (5' CUUUCAAAGUUCACCAAUAA 3'); iii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCCU 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5' UAAGUCUUUUAGCUGCAGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5' UACUGCAGCUAAAAGACUUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5' UAAAAUAUAUUCAUGAGCUUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5' AAGCUCAUGAAUAUAUUUUA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5' UUUUUGUUCAUUCUGAUUCCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5' GGAAUCAGAAUGAACAAAAA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5' UAUGAAGAAGUCCUGCAUUACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5' UAAUGCAGGACUUCUUCAUA 3'); or viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UGUGUGUUGAUGCUGAGUUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5' AAACUCAGCAUCAACACACA 3').
[0157] At least 50% C3 knockdown at 0.01nM
[0158] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of inhibiting C3 at a dose of 0.01 nM. Attenuate mRNA expression by at least 50% (e.g., 50%–55%, 55%–60%, 60%–65%, 65%–70%, 70%–75%, 75%–80%, 80%–85%, 85%–90%, 90%–95% or 95%–99%, 99%–100%).
[0159] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a sequence identical to a region comprising the sequence between any one of nucleotide positions selected from a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of inhibiting C3 at a dose of 0.01 nM. and attenuating mRNA expression by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%), wherein the double-stranded region comprises: i) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3'); ii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCCUCAGCA 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3'); iii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 25 (5' UUAAUAGGCGUAGACCUUGACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5' UCAAGGUCUACGCCUAUUAA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5' UUUAUAGAUGUAGUAGAAUUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5' AAUUCUACUACAUCUAUAAA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' UUAUAGAUGUAGUAGAAUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AAAUUCUACUACAUCUAUAA 3');vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5' UUUGUAAUAGGCGUAGACCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5' AGGUCUACGCCUAUUACAAA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5' UAAGUCAAAGUCUUUUAGCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5' AGCUAAAAGACUUUGACUUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5' UAAAGUCAAAGUCUUUUAGCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5' GCUAAAAGACUUUGACUUUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5' UCAGAGCUUGUUCAGCUUUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5' GAAAGCUGAACAAGCUCUGA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UGAGUGUGAGACCUUGUCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5' xiv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5' UUUCGAACAACAGAGUAGGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5' CCCUACUCUGUUGUUCGAAA 3');xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5' UCAGAGUGUGAGACCUUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5' GACAAGGUCUCACACUCUGA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UGAUGUAGUAGAAUUUCUCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' AGAGAAAUUCUACUACAUCA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5' UGUUCAUUGAGCCAACGCACGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5' GUGCGUUGGCUCAAUGAACA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5' UAAUUUAUUACAGGUGAGUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5' AACUCACCUGUAAUAAAUUA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5' UUAUGAAGCAAUUCUCCUCAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5' UGAGGAGAAUUGCUUCAUAA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UGAGAAGACAAGGAGUCCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5' CAGGACUCCUUGUCUUCUCA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5' UGUAGAACCGGGUACAGCUUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5' AAGCUGUACCCGGUUCUACA 3'); or xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5' UCUGGUUUUAUGGUGACCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5' AAGGUCACCAUAAAACCAGA 3') the sense strand of the nucleic acid sequence;
[0160] The present disclosure provides isolated oligonucleotides comprising a sense strand and an antisense strand, wherein the sense strand is a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1. p) 3298-3437; q) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region.
[0161] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 a) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054; wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by 20%-50% (e.g., 20%-25%, 25%-30%, 30%-35%, 35%-40%, 40%-45%, 45%-50%) at a dose of 0.1 nM.
[0162] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 r) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from: r) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is The expression of mRNA is attenuated by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, 45% to 50%), and the double-stranded region is selected from the group consisting of: i) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 71 (5' UGUAGAUGGUCUUGUCUGUCUG 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 236 (5' GACAGACAAGACCAUCUACA 3'); ii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 106 (5' UUGAUGCUCAAGGGCUUCUGGC 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 271 (5' CAGAAGCCCUUGAGCAUCAA 3'); iii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 97 (5' UAAGAUGACAAAGGCAGUUCCC 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 262 (5' GAACUGCCUUUGUCAUCUUA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5' UCAAAGUCAAAGUCUUUUAGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 333 (5' CUAAAAGACUUUGACUUUGA 3');v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5' UGAAGGAAGGGAUGAAGUCGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 280 (5' CGACUUCAUCCCUUCCUUCA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5' UCUUUUGGUAUUGAGCCAAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 338 (5' CUUGGCUCAAUACCAAAAGA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5' UUUCUGACUGGCCGCUUUUUAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5' AAAAAGCGGCCAGUCAGAAA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5' UCACAAAGUCAAAGUCUUUUAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5' AAAAGACUUUGACUUUGUGA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5' UGUUUUUUGCCUGGGAAGUCGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5' GACUUCCCAGGCAAAAAACA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5' UUGAAGGCCAGCUGCUGGGUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 318 (5' ACCCAGCAGCUGGCCUUCAA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5' UCUGUUUCCGGUGCUGGUUUUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5' AAACCAGCACCGGAAACAGA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5' UUGUUGAUGCUGAGUUUGGCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5' xiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5' UGUCCAACCUGCACCUCAUCCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 390 (5' GAUGAGGUGCAGGUUGGACA 3');xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5' UAUCUUCAGGGUCAUCUGCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 282 (5' AGCAGAUGACCCUGAAGAUA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5' UCAUAGUAGGCUCGGAUCUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5' AAGAUCCGAGCCUACUAUGA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5' UGUUUCGAACAACAGAGUAGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 298 (5' CUACUCUGUUGUUCGAAACA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5' UCAGGUAAUUGUUGGAGUUGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5' CAACUCCAACAAUUACCUGA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5' UGUCUGUCUGGAUGAAGAGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5' CCUCUUCAUCCAGACAGACA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5' UGUACUCGUCAAAGUCAUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5' CAAUGACUUUGACGAGUACA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5' UGGAUUGUGGAGUAGUUCCACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5' UGGAACUACUCCACAAUCCA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5' UGGAAGUCUCCUGCUUUAGUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 323 (5' xxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5' UUUUCAUAGUAGGCUCGGAUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5' AUCCGAGCCUACUAUGAAAA 3');xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5' UCAGGAUCAGCCAUUUAACAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 321 (5' UGUUAAAUGGCUGAUCCUGA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5' UCUUGUCCAGGUAGAUGAUGAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' CAUCAUCUACCUGGACAAGA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5' UGACAGUGCAGGGUCAGAGGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5' CCUCUGACCCUGCACUGUCA 3'); xxvi) SEQ ID NO: 202 (5' UCUAUCGGAGAAGGCUUUGUCC 3'); and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367 (5' ACAAAGCCUUCUCCGAUAGA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5' UCUUCCACUGGCCCAUGUUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5' CAACAUGGGCCAGUGGAAGA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 174 (5' UGAUUCCCAGUGGAUACGGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 339 (5' ACCGUAUCCACUGGGAAUCA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5' UUUUUUUGCCUGGGAAGUCGUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5' CGACUUCCCAGGCAAAAAAA 3'); xxx) the antisense strand of SEQ ID NO: 214 (5' 379 (5' GUCUACGCCUAUUACAACCA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5' UCUGCAGAAGGCUGGAUUGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5' ACAAUCCAGCCUUCUGCAGA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5' UCUCUGUAGGCUCCACUAUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5' CAUAGUGGAGCCUACAGAGA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5' UGAAACUGGGCAGCACGUACUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5' GUACGUGCUGCCCAGUUUCA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5' UCUGCAGUAGGGCCAAGAGGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 330 (5' CCUCUUGGCCCUACUGCAGA 3');xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5' UCUGGAUUGUGGAGUAGUUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 305 (5' GAACUACUCCACAAUCCAGA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5' UCUUUUCCUUCAGCUGUGACUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 348 (5' GUCACAGCUGAAGGAAAAGA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5' UCUGUGAAACCCUCAUUUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 344 (5' GAAAAUGAGGGUUUCACAGA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5' UCAUUACUGUGACCUCGAAGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 292 (5' CUUCGAGGUCACAGUAAUGA 3') the sense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5' UGAGGUCGAAUUUAUUACAGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 350 (5' CUGUAAUAAAUUCGACCUCA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5' UCAUUCGCAGGAGGAAGUUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5' CAACUUCCUCCUGCGAAUGA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5' UGUAUCACGGGCGCAUCCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 322 (5' GAGGAUGCGCCCGUGAUACA 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5' UCAGCAAUGGCCACAGUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 329 (5' xLiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5' UCACUAUGACCUCGAAACUGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5' CAGUUUCGAGGUCAUAGUGA 3');xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5' UGUACUCCUUCACCUCAAACUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5' GUUUGAGGUGAAGGAGUACA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5' UCUCAUACUUGGAGAUGUAUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 364 (5' AUACAUCUCCAAGUAUGAGA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5' UCUUAGCAUGGUACAUUGUCAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 349 (5' GACAAUGUACCAUGCUAAGA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 400 (5' UUGUAGUUGCAGCAGUCCAGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 426 (5' xLiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5' UGAGGAAGUUGACGUUGAGGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5' CCUCAACGUCAACUUCCUCA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 (5' UGGCAUCCUCUGUCAUCUGGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5' CCAGAUGACAGAGGAUGCCA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5' UUUUUGUAUGAAGCAAUUCUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' AGAAUUGCUUCAUACAAAAA 3'); Li) SEQ ID NO: 138 (5' UGAUUGUGGAGUAGUUCCACCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 303 (5' GUGGAACUACUCCACAAUCA 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5' UGAUGAAGUCGGUGGUGAUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5' CAUCACCACCGACUUCAUCA 3');Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5' UCUCCUUCACCUCAAACUCAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5' UGAGUUUGAGGUGAAGGAGA 3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 (5' UCUUCUUGAUGAGCUCCAAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 317 (5' CUUGGAGCUCAUCAAGAAGA 3'); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 402 (5' UCUCAUCCAGGUUACUCCUGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 428 (5' CAGGAGUAACCUGGAUGAGA 3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 (5' UCUUGGUUCUGCCGGUAAUUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5' AAUUACCGGCAGAACCAAGA Lvii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5' UGACCUUGUCCAGGUAGAUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5' CAUCUACCUGGACAAGGUCA 3'); or Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 412 (5' UCUCUGGGAACUCACUUCGGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 438 (5' CCGAAGUGAGUUCCCAGAGA 3');
[0163] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 a) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-100%) at a dose of 0.01 nM.
[0164] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 r) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from: r) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of inhibiting C3 The double-stranded region is selected from the group consisting of: i) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 94 (5' UUAGAUGUAGUAGAAUUUCUCU 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 259 (5' AGAAAUUCUACUACAUCUAA 3'); ii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 74 (5' UGACAAGGAGUCCUGCUUGACC 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 239 (5' UCAAGCAGGACUCCUUGUCA 3'); iii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 70 (5' UUAGAUGGUCUUGUCUGUCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5' AGACAGACAAGACCAUCUAA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5' UUUUUUGCCUGGGAAGUCGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5' ACGACUUCCCAGGCAAAAAA 3');v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5' UUAGUAUCUCUGUUCAUUGAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5' UCAAUGAACAGAGAUACUAA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5' UGUCAGUUGGGGCACCCAAAGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5' UUUGGGUGCCCCAACUGACA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5' UUUGUAUGAAGCAAUUCUCCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' GGAGAAUUGCUUCAUACAAA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5' UGAACAACAGAGUAGGGUAGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 296 (5' CUACCCUACUCUGUUGUUCA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5' UAUCAGGUAGGUGUAGUAGCGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5' GCUACUACACCUACCUGAUA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5' UAUUACUGUGACCUCGAAGGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 291 (5' CCUUCGAGGUCACAGUAAUA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5' UGAAUUCUGGUCUCAGACUCGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5' GAGUCUGAGACCAGAAUUCA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5' UGUAUCUCUGUUCAUUGAGCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5' xiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5' UUUUCAAAAAUAUAUUCAUGAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5' CAUGAAUAUAUUUUUGAAAA 3');xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5' UAGUAGAAUUUCUCUGUAGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5' CCUACAGAGAAAUUCUACUA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5' UCUUUCAAAAAUAUAUUCAUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5' AUGAAUAUAUUUUUGAAAGA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5' UCAUACUUGGAGAUGUAUCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5' AGAUACAUCUCCAAGUAUGA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5' UAAUUCUGGUCUCAGACUCGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 310 (5' xviii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5' UGUUUUAUGGUGACCUUGAGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5' CUCAAGGUCACCAUAAAACA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5' UCUGUCUGGAUGAAGAGGUACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5' UACCUCUUCAUCCAGACAGA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5' UUGUAGAUGGUCUUGUCUGUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5' ACAGACAAGACCAUCUACAA 3'); xxi) the antisense strand of SEQ ID NO: 159 (5' UAAGGAAGUCUCCUGCUUUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 324 (5' UAAAGCAGGAGACUUCCUUA 3'); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5' UUUCCUUCAGCUGUGACUGUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5' ACAGUCACAGCUGAAGGAAA 3');xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5' UGAGAUGCAGGUAAUUGUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5' CAACAAUUACCUGCAUCUCA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5' UAGAUGACAAAGGCAGUUCCCU 3'); and the sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5' GGAACUGCCUUUGUCAUCUA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5' UGAAGAAGUCCUGCAUUACUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5' AGUAAUGCAGGACUUCUUCA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5' UUACUUGGAGAUGUAUCUGUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5' ACAGAUACAUCUCCAAGUAA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5' UUUCAAAAAUAUAUUCAUGAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5' UCAUGAAUAUUUUUGAAA 3'); xxviii) SEQ ID NO: 160 (5' 325 (5' UUGAAGCCAACUACAUGAAA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5' UAUCUCUGUAGGUUCAUGUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5' UACAUGAACCUACAGAGAUA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5' UGUGUUGAUGCUGAGUUUGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5' CCAAACUCAGCAUCAACACA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5' UCUUUGUCCAGCUCAUACUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366 (5' AAGUAUGAGCUGGACAAAGA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5' UUUUUGCCUGGGAAGUCGUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5' CACGACUUCCCAGGCAAAAA 3');xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5' UCAUUUUCCUUGGUCUCUUCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5' GAAGAGACCAAGGAAAAUGA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5' UUUCCUAUCGGAGAAGGCUUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5' AAGCCUUCUCCGAUAGGAAA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5' UGAAGCAAUUCUCCUCAGCACA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' UGCUGAGGAGAAUUGCUUCA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5' UGUACACAUAGUCCACUCCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' AGGAGUGGACUAUGUGUACA 3'); xxxvii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5' UUAUCUUCAGGGUCAUCUGCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5' GCAGAUGACCCUGAAGAUAA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5' UUAGACAUAGUGGCAUCCUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5' CAGGAUGCCACUAUGUCUAA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5' UUACACAUAGUCCACUCCUGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' CAGGAGUGGACUAUGUGUAA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5' UGUCUUGGUGAAGUGGAUCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 264 (5' xLi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5' UAAGACCUUGACCACGUAGGCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 319 (5' CCUACGUGGUCAAGGUCUUA 3');xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5' UAGUAUCUCUGUUCAUUGAGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5' CUCAAUGAACAGAGAUACUA 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5' UCAGUCAUCAUGGAUAUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5' GACAUAUCCAUGAUGACUGA 3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5' UGUGUAGAUGGUCUUGUCUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 238 (5' CAGACAAGACCAUCUACACA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5' UUUCAGCUGUGACUGUGAAACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5' UUUCACAGUCACAGCUGAAA 3'); xLvi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5' UUUCUCUGUAGGCUCCACUAUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 257 (5' UAGUGGAGCCUACAGAGAAA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5' UAAGACAAGGAGUCCUGCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5' AAGCAGGACUCCUUGUCUUA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5' UGUAGUUCCACCCUCACCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 302 (5' AAGGUGAGGGUGGAACUACA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5' UCUAUGACCUCGAAACUGGGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5' CCCAGUUUCGAGGUCAUAGA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5' UGAUGAAGAAGUCCUGCAUUAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5' AAUGCAGGACUUCUUCAUCA 3');Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5' UUUGUCUGUCUGGAUGAAGAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5' UCUUCAUCCAGACAGACAAA 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5' UUUUUCCUUGGUCUCUUCUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 341 (5' CAGAAGAGACCAAGGAAAAA 3'); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5' UGAGGUCAAAGGGCAUUCCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5' AGGAAUGCCCUUUGACCUCA 3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5' UUUCAUAGUAGGCUCGGAUCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5' Lv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5' UGUAAUAGGCGUAGACCUUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' CAAGGUCUACGCCUAUUACA 3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5' UAUCAUAGUGUUCUUGGCAUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356 (5' AUGCCAAGAACACUAUGAUA 3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5' UUGUAGGUUCAUGUAGUUGGCU 3'); and the sense strand of the nucleic acid sequence according to SEQ ID NO: 326 (5' CCAACUACAUGAACCUACAA 3'); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5' UGUGUAGUAGCGGAUCUUGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5' CCAAGAUCCGCUACUACACA 3'); Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5' UUUCUUGAUGAGCUCCAAGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5' CCUUGGAGCUCAUCAAGAAA 3'); Lx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5' UGUUGUAAUAGGCGUAGACCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5' GGUCUACGCCUAUUACAACA 3'); Lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5' UGAUGAUGAGGGUGUUCCUAUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' UAGGAACACCCUCAUCAUCA 3'); Lxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5' UGAGAGAAGACCUUGACCACGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 320 (5' GUGGUCAAGGUCUUCUCUCA 3'); Lxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5' UUUGUUCAUUCUGAUUCCUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 308 (5' AAGGAAUCAGAAUGAACAAA 3'); Lxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5' UCAAGGAUCAUAGUGUUCUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358 (5' AAGAACACUAUGAUCCUUGA 3'); Lxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5' the antisense strand of the nucleic acid sequence according to SEQ ID NO: 328 (5' CUACAGAGAUCCUACACUGA 3');Lxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5' UUUCAUCCAGGUAAUGCACAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 314 (5' UGUGCAUUACCUGGAUGAAA 3'); Lxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5' UUUUGUCCAGCUCAUACUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5' CAAGUAUGAGCUGGACAAAA 3'); Lxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5' UCUCAGAGUGUGAGACCUUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5' CAAGGUCUCACACUCUGAGA 3'); Lxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5' UUGUUCAGCUUUCCAUCCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 380 (5' GAGGAUGGAAAGCUGAACAA Lxx) the sense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5' UCUUGGUGAAGUGGAUCUGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5' CCAGAUCCACUUCACCAAGA 3'); Lxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5' UUUUUCCUUCAGCUGUGACUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5' AGUCACAGCUGAAGGAAAAA 3'); Lxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5' UGUUUCAUCCAGGUAAUGCACA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 315 (5' UGCAUUACCUGGAUGAAACA 3'); Lxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5' UAUGAUGUACUCGUCAAAGUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5' ACUUUGACGAGUACAUCAUA 3'); Lxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5' UAUUUUCCUUGGUCUCUUCUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 342 (5' AGAAGAGACCAAGGAAAAUA 3');Lxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5' UGAAGUCCUGCAUUACUGUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5' CACAGUAAUGCAGGACUUCA 3'); Lxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5' UCUCAUCCGAGCCUGACUUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5' CAAGUCAGGCUCGGAUGAGA 3'); Lxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5' UAUGAUGAGGGUGUUCCUAUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' AUAGGAACACCCUCAUCAUA 3'); Lxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5' UUUUAUGGUGACCUUGAGGUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5' ACCUCAAGGUCACCAUAAAA Lxxix) the sense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5' UGACGAGUUCCGGAAUGUCCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5' GGACAUUCCGGAACUCGUCA 3'); Lxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5' UAUACUUGGAGAUGUAUCUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5' CAGAUACAUCUCCAAGUAUA 3'); Lxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5' UGUUAUAGAUGUAGUAGAAUUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5' AUUCUACUACAUCUAUAACA 3'); Lxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5' UUUGACGAGUUCCGGAAUGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5' Lxxxiii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5' UAACACCAUGAGGUCAAAGGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5' CCUUUGACCUCAUGGUGUUA 3');Lxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5' UGUUGACGAGUUCCGGAAUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5' CAUUCCGGAACUCGUCAACA 3'); Lxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5' UGUCUUGUACACAUAGUCCACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5' UGGACUAUGUGUACAAGACA 3'); Lxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5' UGUCUUUUAGCUGCAGUAGGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 332 (5' CCUACUGCAGCUAAAAGACA 3'); Lxxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5' UCAAACUCAGUGGAGAAGACCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 249 (5' Lxxxviii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5' UGUUUUGUUCAUUCUGAUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 309 (5' GAAUCAGAAUGAACAAAACA 3'); Lxxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5' UUCUUUUAGCUGCAGUAGGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5' CCCUACUGCAGCUAAAAGAA 3'); xc) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5' UUUCUGAGAAGACAAGGAGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5' ACUCCUUGUCUUCUCAGAAA 3'); xci) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5' UGUGUUCCUAUCGGAGAAGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5' CCUUCUCCGAUAGGAACACA 3'); xcii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5' UCAUCCUCAGAGUGUGAGACCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' GUCUCACACUCUGAGGAUGA 3');xciii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5' UUUUCGAACAACAGAGUAGGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 297 (5' CCUACUCUGUUGUUCGAAAA 3'); xciv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5' UGGAUGGUUACGGUCUGCUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 307 (5' CAGCAGACCGUAACCAUCCA 3'); xcv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5' UCAGGUAAUGCACAGCGAUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 313 (5' CAUCGCUGUGCAUUACCUGA 3'); xcvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5' UGUAGAUGAUGAGGGUGUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' GAACACCCUCAUCAUCUACA 3'); xcvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5' UUACUCCUUCACCUCAAACUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5' AGUUUGAGGUGAAGGAGUAA 3'); xcviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5' UAAGGAUCAUAGUGUUCUUGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5' CAAGAACACUAUGAUCCUUA 3'); xcix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5' UCAGAUUCCCAGUGGAUACGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 340 (5' CGUAUCCACUGGGAAUCUGA 3'); c) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5' UUUUUAUGGUGACCUUGAGGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5' CCUCAAGGUCACCAUAAAAA 3'); ci) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5' UCUGAGAGAUGCAGGUAAUUGU 3'); and the sense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5' AAUUACCUGCAUCUCUCAGA 3'); cii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5' UGACUCGGUAGGCUGGAGAGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 267 (5' CUCUCCAGCCUACCGAGUCA 3'); ciii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5' UCAAAAAUAUAUUCAUGAGCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5' GCUCAUGAAUAUAUUUUUGA 3'); civ) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5' UGAUUUCCACCUGCUCGUUUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 299 (5' AAACGAGCAGGUGGAAAUCA 3'); cv) SEQ ID NO: 135 (5' cvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5' UGAUGCUCAAGGGCUUCUGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5' CCAGAAGCCCUUGAGCAUCA 3'); cvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5' UGUCUUUCAAAAAUAUAUUCAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 290 (5' GAAUAUAUUUUUGAAAGACA 3'); cviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5' UGUGUUCUUGGCAUCCUGAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 355 (5' CUCAGGAUGCCAAGAACACA 3'); cix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5' UAUGUAGUUGCAGCAGUCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 284 (5' UGGACUGCUGCAACUACAUA 3');cx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5' UGUGAUGUAGUUGCAGCAGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5' ACUGCUGCAACUACAUCACA 3'); or cxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 394 (5' UAAAUAUAUUCAUGAGCUUCGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 420 (5' GAAGCUCAUGAAUAUAUUUA 3');
[0165] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 a) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054; wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by 20%-50% (e.g., 20%-25%, 25%-30%, 30%-35%, 35%-40%, 40%-45%, 45%-50%) at a dose of 0.01 nM.
[0166] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 r) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from: r) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of inhibiting C3 The expression of mRNA is attenuated by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, 45% to 50%), and the double-stranded region is selected from the group consisting of: i) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 96 (5' UAGAUGACAAAGGCAGUUCCCU 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 261 (5' GGAACUGCCUUUGUCAUCUA 3'); ii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 217 (5' UUUGUAUGAAGCAAUUCUCCUC 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 382 (5' GGAGAAUUGCUUCAUACAAA 3'); iii) an antisense strand of a nucleic acid sequence according to SEQ ID NO: 70 (5' UUAGAUGGUCUUGUCUGUCUGG 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 235 (5' AGACAGACAAGACCAUCUAA 3'). 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5' UCAUACUUGGAGAUGUAUCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5' AGAUACAUCUCCAAGUAUGA 3');v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5' UAUCAGGUAGGUGUAGUAGCGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5' GCUACUACACCUACCUGAUA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5' UAUUACUGUGACCUCGAAGGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 291 (5' CCUUCGAGGUCACAGUAAUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5' UGUAUCUCUGUUCAUUGAGCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5' GCUCAAUGAACAGAGAUACA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5' UUUUCAAAAAUAUAUUCAUGAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5' CAUGAAUAUAUUUUUGAAAA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5' UGUCAGUUGGGGCACCCAAAGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5' UUUGGGUGCCCCAACUGACA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5' UCUGUCUGGAUGAAGAGGUACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5' UACCUCUUCAUCCAGACAGA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5' UUAGUAUCUCUGUUCAUUGAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5' UCAAUGAACAGAGAUACUAA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5' UGACAAGGAGUCCUGCUUGACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5' UCAAGCAGGACUCCUUGUCA 3'); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5' UUUUUUGCCUGGGAAGUCGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5' ACGACUUCCCAGGCAAAAAA 3');xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5' UUUCCUUCAGCUGUGACUGUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5' ACAGUCACAGCUGAAGGAAA 3'); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5' UGAACAACAGAGUAGGGUAGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 296 (5' CUACCCUACUCUGUUGUUCA 3'); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5' UUACUUGGAGAUGUAUCUGUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5' ACAGAUACAUCUCCAAGUAA 3'); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5' UGAAGAAGUCCUGCAUUACUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5' AGUAAUGCAGGACUUCUUCA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5' UGUAAUAGGCGUAGACCUUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' CAAGGUCUACGCCUAUUACA 3'); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5' UAGUAGAAUUUCUCUGUAGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5' CCUACAGAGAAAUUCUACUA 3'); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5' UUAGACAUAGUGGCAUCCUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5' CAGGAUGCCACUAUGUCUAA 3'); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5' UAAGACCUUGACCACGUAGGCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 319 (5' xxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5' UGAGAUGCAGGUAAUUGUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5' CAACAAUUACCUGCAUCUCA 3');xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5' UUGUAGAUGGUCUUGUCUGUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5' ACAGACAAGACCAUCUACAA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5' UUUGACGAGUUCCGGAAUGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5' ACAUUCCGGAACUCGUCAAA 3'); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5' UCAUCCUCAGAGUGUGAGACCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' GUCUCACACUCUGAGGAUGA 3'); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5' UGUUUUAUGGUGACCUUGAGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5' CUCAAGGUCACCAUAAAACA 3'); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5' UCUUUCAAAAAUAUAUUCAUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5' AUGAAUAUAUUUUUGAAAGA 3'); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5' UAAGGAAGUCUCCUGCUUUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 324 (5' UAAAGCAGGAGACUUCCUUA 3'); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5' UCUUGUCCAGGUAGAUGAUGAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' CAUCAUCUACCUGGACAAGA 3'); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5' UGUAGUUCCACCCUCACCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 302 (5' AAGGUGAGGGUGGAACUACA 3'); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5' UUUCAAAAAUAUAUUCAUGAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5' UCAUGAAUAUAUUUUUGAAA 3'); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5' UUUUUGCCUGGGAAGUCGUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5' CACGACUUCCCAGGCAAAAA 3'); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5' UUACACAUAGUCCACUCCUGGC 3') and the sense strand of SEQ ID NO: 384 (5' CAGGAGUGGACUAUGUGUAA 3'); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5' UCAGUCAUCAUGGAUAUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5' GACAUAUCCAUGAUGACUGA 3');xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5' UGUUAUAGAUGUAGUAGAAUUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5' AUUCUACUACAUCUAUAACA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5' UGAAUUCUGGUCUCAGACUCGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5' GAGUCUGAGACCAGAAUUCA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5' UGUACACAUAGUCCACUCCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' AGGAGUGGACUAUGUGUACA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5' UUUCUUGAUGAGCUCCAAGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5' CCUUGGAGCUCAUCAAGAAA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5' UUAUCUUCAGGGUCAUCUGCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5' GCAGAUGACCCUGAAGAUAA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5' UUUCAGCUGUGACUGUGAAACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5' UUUCACAGUCACAGCUGAAA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5' UCUCAGAGUGUGAGACCUUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5' CAAGGUCUCACACUCUGAGA 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5' UUUUUAUGGUGACCUUGAGGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5' CCUCAAGGUCACCAUAAAAA 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5' UAUCUCUGUAGGUUCAUGUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5' UACAUGAACCUACAGAGAUA 3');xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5' UAAUUCUGGUCUCAGACUCGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 310 (5' CGAGUCUGAGACCAGAAUUA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5' UCUUUGUCCAGCUCAUACUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366 (5' AAGUAUGAGCUGGACAAAGA 3'); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5' UCAUAGUAGGCUCGGAUCUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5' AAGAUCCGAGCCUACUAUGA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5' UGAUGAUGAGGGUGUUCCUAUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' xLviii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5' UUGUUCAGCUUUCCAUCCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 380 (5' GAGGAUGGAAAGCUGAACAA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5' UGUUGUAAUAGGCGUAGACCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5' GGUCUACGCCUAUUACAACA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5' UCUGUUUCCGGUGCUGGUUUUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5' AAACCAGCACCGGAAACAGA 3'); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5' UGUAGAUGAUGAGGGUGUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' GAACACCCUCAUCAUCUACA 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5' UGGAUUGUGGAGUAGUUCCACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5' UGGAACUACUCCACAAUCCA 3');Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5' UUUGUUCAUUCUGAUUCCUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 308 (5' AAGGAAUCAGAAUGAACAAA 3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5' UCAUUUUCCUUGGUCUCUUCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5' GAAGAGACCAAGGAAAAUGA 3'); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5' UGAAGUCCUGCAUUACUGUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5' CACAGUAAUGCAGGACUUCA 3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5' UUUCAUGUAGUUGGCUUCAAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5' UUGAAGCCAACUACAUGAAA Lvii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5' UUUUUCCUUGGUCUCUUCUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 341 (5' CAGAAGAGACCAAGGAAAAA 3'); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5' UCUUCCACUGGCCCAUGUUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5' CAACAUGGGCCAGUGGAAGA 3'); Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5' UUUCCUAUCGGAGAAGGCUUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5' AAGCCUUCUCCGAUAGGAAA 3'); Lx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5' UGUACUCCUUCACCUCAAACUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5' GUUUGAGGUGAAGGAGUACA 3'); Lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5' UGUGUUGAUGCUGAGUUUGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5' CCAAACUCAGCAUCAACACA 3'); Lxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5' UUUGUCUGUCUGGAUGAAGAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5' UCUUCAUCCAGACAGACAAA 3'); Lxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5' UAUACUUGGAGAUGUAUCUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5' CAGAUACAUCUCCAAGUAUA 3'); Lxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5' UAUGAUGUACUCGUCAAAGUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5' ACUUUGACGAGUACAUCAUA 3'); Lxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5' UGGAUGGUUACGGUCUGCUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 307 (5' CAGCAGACCGUAACCAUCCA 3'); Lxvi) SEQ ID NO: 138 (5' UGAUUGUGGAGUAGUUCCACCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 303 (5' GUGGAACUACUCCACAAUCA 3'); Lxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5' UAAGACAAGGAGUCCUGCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5' AAGCAGGACUCCUUGUCUUA 3');Lxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5' UCAGUGUAGGAUCUCUGUAGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 328 (5' CUACAGAGAUCCUACACUGA 3'); Lxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5' UUUCUGACUGGCCGCUUUUUAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5' AAAAAGCGGCCAGUCAGAAA 3'); Lxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5' UGUGUAGUAGCGGAUCUUGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5' CCAAGAUCCGCUACUACACA 3'); Lxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5' UGUGUUCCUAUCGGAGAAGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5' Lxxii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5' UCACAAAGUCAAAGUCUUUUAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5' AAAAGACUUUGACUUUGUGA 3'); Lxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5' UGUCUUGGUGAAGUGGAUCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 264 (5' AGAUCCACUUCACCAAGACA 3'); Lxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5' UCUGGAUUGUGGAGUAGUUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 305 (5' GAACUACUCCACAAUCCAGA 3'); Lxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5' UGAUGAAGAAGUCCUGCAUUAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5' AAUGCAGGACUUCUUCAUCA 3'); Lxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5' UGUCUGUCUGGAUGAAGAGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5' CCUCUUCAUCCAGACAGACA 3');Lxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5' UGUGUAGAUGGUCUUGUCUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 238 (5' CAGACAAGACCAUCUACACA 3'); Lxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5' UGAGGUCAAAGGGCAUUCCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5' AGGAAUGCCCUUUGACCUCA 3'); Lxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5' UAUGAUGAGGGUGUUCCUAUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' AUAGGAACACCCUCAUCAUA 3'); Lxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5' UAUGUAGUUGCAGCAGUCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 284 (5' UGGACUGCUGCAACUACAUA Lxxxi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5' UUUCAUAGUAGGCUCGGAUCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5' GAUCCGAGCCUACUAUGAAA 3'); Lxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5' UGUUGACGAGUUCCGGAAUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5' CAUUCCGGAACUCGUCAACA 3'); Lxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5' UAGUAUCUCUGUUCAUUGAGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5' CUCAAUGAACAGAGAUACUA 3'); Lxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5' UUUUUCCUUCAGCUGUGACUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5' Lxxxv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5' UUGAAGGCCAGCUGCUGGGUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 318 (5' ACCCAGCAGCUGGCCUUCAA 3');Lxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5' UUUUAUGGUGACCUUGAGGUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5' ACCUCAAGGUCACCAUAAAA 3'); Lxxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5' UAUCAUAGUGUUCUUGGCAUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356 (5' AUGCCAAGAACACUAUGAUA 3'); Lxxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5' UCUGCAGAAGGCUGGAUUGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5' ACAAUCCAGCCUUCUGCAGA 3'); Lxxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5' UGUUUUGUUCAUUCUGAUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 309 (5' XC) the sense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5' UUUUGUCCAGCUCAUACUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5' CAAGUAUGAGCUGGACAAAA 3'); XCi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5' UCUAUGACCUCGAAACUGGGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5' CCCAGUUUCGAGGUCAUAGA 3'); XCii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5' UGUGAUGUAGUUGCAGCAGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5' ACUGCUGCAACUACAUCACA 3'); XCiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5' UUACUCCUUCACCUCAAACUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5' AGUUUGAGGUGAAGGAGUAA 3'); XCiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5' UUCUUUUAGCUGCAGUAGGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5' CCCUACUGCAGCUAAAAGAA 3'); XCv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5' UAACACCAUGAGGUCAAAGGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5' CCUUUGACCUCAUGGUGUUA 3'); XCvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5' UUGUAGGUUCAUGUAGUUGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 326 (5' CCAACUACAUGAACCUACAA 3'); XCvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5' UCAGAUUCCCAGUGGAUACGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 340 (5' CGUAUCCACUGGGAAUCUGA 3'); XCviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5' UUUCAUCCAGGUAAUGCACAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 314 (5' UGUGCAUUACCUGGAUGAAA 3'); XCix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5' UGGUUGUAAUAGGCGUAGACCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' GUCUACGCCUAUUACAACCA 3');or C) comprising the antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5' UGACAGUGCAGGGUCAGAGGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5' CCUCUGACCCUGCACUGUCA 3');
[0167] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 a) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by at least 50% (e.g., 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, or 95%-100%) at a dose of 0.01 nM.
[0168] In some embodiments of the isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand is selected from the group consisting of: a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1 r) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide comprises a nucleotide sequence substantially identical to a region comprising 19-25 nucleotides between any one of nucleotide positions selected from: r) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054, wherein the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide is capable of inhibiting C3 The double-stranded region comprises: i) an antisense strand of SEQ ID NO: 94 (5' UUAGAUGUAGUAGAAUUUCUCU 3') and a sense strand of a nucleic acid sequence of SEQ ID NO: 259 (5' AGAAAUUCUACUACAUCUAA 3'); or ii) an antisense strand of a nucleic acid sequence of SEQ ID NO: 216 (5' UGAAGCAAUUCUCCUCAGCACA 3') and a sense strand of a nucleic acid sequence of SEQ ID NO: 381 (5' UGCUGAGGAGAAUUGCUUCA 3').
[0169] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 3, 4, 5, 7, 29, or 31.
[0170] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 33, 34, 35, 37, 59, or 61.
[0171] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 3, 4, 5, 7, 29, or 31, and the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 33, 34, 35, 37, 59, or 61, and the antisense and sense strand sequences have sufficient complementarity to allow the formation of a double-stranded region between the antisense and sense strands.
[0172] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides comprise: (a) a sense strand comprising X1 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein X1 is an integer selected from 13 to 36, and the first modification and the second modification are different; and (b) an antisense strand comprising X2 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein X2 is an integer selected from 18 to 31, and the third modification and the fourth modification are different.
[0173] In some embodiments, the X1 nucleotide in the sense strand of an isolated oligonucleotide of this disclosure is 18-21, and the X2 nucleotide in the antisense strand of an isolated oligonucleotide of this disclosure is 20-23. In some embodiments, the X1 nucleotide in the sense strand of an isolated oligonucleotide of this disclosure is 20 or 21, and the X2 nucleotide in the antisense strand of an isolated oligonucleotide of this disclosure is 22 or 23. In some embodiments, the X2 nucleotide in the antisense strand of an isolated oligonucleotide of this disclosure is equal to the X1 nucleotide in the sense strand of an isolated oligonucleotide of this disclosure + 2. In some embodiments, the X1 nucleotide in the sense strand of an isolated oligonucleotide of this disclosure is 21, and the X2 nucleotide in the antisense strand of an isolated oligonucleotide of this disclosure is 23. In some embodiments, the X1 nucleotide in the sense strand of an isolated oligonucleotide of this disclosure is 20, and the X2 nucleotide in the antisense strand of an isolated oligonucleotide of this disclosure is 22.
[0174] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides comprise: (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein the first and second modifications are the same or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third and fourth modifications are the same or different.
[0175] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide of the present disclosure comprises at least one nucleotide with a modified phosphate backbone. In some embodiments, the modified phosphate backbone in the sense strand, antisense strand, or both the sense strand and the antisense strand of the isolated oligonucleotide of the present disclosure comprises a modified phosphodiester linkage. In some embodiments, the modified phosphodiester linkage is modified by replacing one or more oxygen atoms with a moiety, which is attached to the phosphorus atom in the phosphodiester linkage using a carbon, nitrogen, or sulfur atom in the moiety or by forming a 2'-5' bond. In some embodiments, the modified phosphodiester linkage comprises a phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate diester, mesylphosphoramidate, or phosphonoacetate.
[0176] In some embodiments, the isolated oligonucleotide of the present disclosure comprises one or more unnatural base-containing nucleotides, locked nucleotides, or abasic nucleotides. In some embodiments, the 5'-terminal nucleotide of the isolated oligonucleotide of the present disclosure comprises a phosphate mimic. In some embodiments, the 5'-phosphate mimic is an ethyl phosphonate, a vinyl phosphonate, or an analog thereof.
[0177] In some embodiments, the antisense strand of the isolated oligonucleotide of the present disclosure comprises at least two single-stranded nucleotides at the 3' end. In some embodiments, the antisense strand of the isolated oligonucleotide of the present disclosure comprises two single-stranded nucleotides at the 3' end.
[0178] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 774 and 792 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3').
[0179] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 775 and 793 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3').
[0180] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 777 and 795 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3').
[0181] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 781 and 799 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3').
[0182] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 4602 and 4620 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCCUCAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3').
[0183] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 4607 and 4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3').
[0184] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 774 to 799; and b) 4602 to 4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by 20% to 50% (e.g., 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, 45% to 50%) at a dose of 0.01 nM.
[0185] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 774 to 799; and b) 4602 to 4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, which attenuates expression of C3 mRNA by 20% to 50% at a dose of 0.01 nM, and the double-stranded region is comprised of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCCUCAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3'); or vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCCU 3') and the sense strand of SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3') of the sense strand of the nucleic acid sequence.
[0186] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 774 to 799; and b) 4602 to 4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the isolated oligonucleotide attenuates C3 mRNA expression by at least 50% (e.g., 50% to 55%, 55% to 60%, 60% to 65%, 65% to 70%, 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, or 95% to 100%) at a dose of 0.1 nM.
[0187] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 774 to 799; and b) 4602 to 4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, which attenuates expression of C3 mRNA by at least 50% at a dose of 0.1 nM, and the double-stranded region is comprised of: i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCCUCAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3'); or vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCCU 3') and the sense strand of SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3') of the sense strand of the nucleic acid sequence.
[0188] In some embodiments, the isolated oligonucleotides of the present disclosure can include a linker, sometimes referred to as a loop. siRNAs containing a linker or loop are sometimes referred to as short hairpin RNAs (shRNAs). In some embodiments, both the sense and antisense regions of an siRNA are encoded by single-stranded RNA. In these embodiments, the antisense and sense regions hybridize to form a duplex region. The sense and antisense regions are connected by a linker sequence to form a "hairpin" or "stem-loop" structure. An siRNA can have complementary sense and antisense regions at opposite ends of a single-stranded molecule, such that the molecule can form a duplex region with the complementary sequence portion, with the strands connected at one end of the duplex region by a linker. The linker can be a nucleotide linker, a non-nucleotide linker, or a combination thereof. The linker can interact with the first strand and, optionally, the second strand, via covalent or non-covalent interactions.
[0189] Any suitable nucleotide linker sequence is considered to be within the scope of the present disclosure.The siRNA of the present disclosure can comprise nucleotide, non-nucleotide or mixed nucleotide / non-nucleotide linker that connects the sense region of nucleic acid with the antisense region of nucleic acid.Nucleotide linker can be 2 nucleotides or more in length, for example, about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides in length.
[0190] Examples of non-nucleotide linkers include abasic nucleotides, polyethers, polyamines, polyamides, peptides, carbohydrates, lipids, polyhydrocarbons, or other polymeric agents, such as polyethylene glycol, for example, those having 2 to 100 ethylene glycol units. Some examples are described in Seela et al., Nucleic Acids Research, 1987, Vol. 15, pp. 3113-3129; Cload et al., J. Am. Chem. Soc., 1991, Vol. 113, pp. 6324-6326; Jaeschke et al., Tetrahedron Lett., 1993, Vol. 34, pp. 301; Arnold et al., WO 1989 / 002439; Usman et al., WO 1995 / 006731; Dudycz et al., WO 1995 / 011910, and Ferentz et al., J. Am. Chem. Soc., 1991, Vol. 113, pp. 4000-4002.
[0191] Examples of nucleotide linker sequences include, but are not limited to, AUG, CCC, UUCG, CCACC, AAGCAA, CCACACC, and UUCAAGAGA.
[0192] In some embodiments, the isolated oligonucleotides of the present disclosure are siRNAs, which can be dsRNAs of a suitable length as Dicer substrates, which can be processed to generate RISC-active siRNA molecules. See, e.g., Rossi et al., US2005 / 0244858.
[0193] Dicer substrate double-stranded RNA (dsRNA) can be of sufficient length to be processed by Dicer to generate active siRNA and can further comprise one or more of the following properties: (i) Dicer substrate dsRNA can be asymmetric, e.g., have a 3' overhang on the antisense strand; (ii) Dicer substrate dsRNA can have a modified 3' end on the sense strand, e.g., incorporation of one or more DNA nucleotides, to direct Dicer binding and processing of the dsRNA into active siRNA; and (iii) the first and second strands of the Dicer substrate dsRNA can be 19-30 bp in length.
[0194] In some embodiments, the isolated oligonucleotide of the present disclosure comprises at least one modified nucleotide. In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand, the antisense strand, or both comprise one or more modified nucleotide sequences. In some embodiments, only the sense strand comprises one or more modified nucleotides. In some embodiments, only the antisense strand comprises one or more modified nucleotides. In some embodiments, both the sense strand and the antisense strand comprise one or more modified nucleotides. In some embodiments, the isolated oligonucleotide is partially chemically modified. In some embodiments, the isolated oligonucleotide is completely chemically modified.
[0195] In some embodiments, the isolated oligonucleotide comprises at least two modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least three modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least four modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least five modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least six modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least seven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eight modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least nine modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least ten modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least eleven modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least twelve modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fourteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least fifteen modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least six modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least 17 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least 18 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least 19 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises at least 20 modified nucleotides.In some embodiments, the isolated oligonucleotide comprises more than 20 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises 20-30 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises 30-40 modified nucleotides. In some embodiments, the isolated oligonucleotide comprises 40-50 modified nucleotides.
[0196] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one modified nucleotide. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least nine modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 10 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 11 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 12 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 13 modified nucleotides.In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 14 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 15 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 16 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 17 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 18 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 19 modified nucleotides. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 20 modified nucleotides.
[0197] In some embodiments, the isolated oligonucleotide comprises a plurality of modified nucleotides, wherein at least a first nucleotide comprises a first modification and at least a second nucleotide comprises a second modification. In some embodiments, the first modification and the second modification are different. In some embodiments, the at least a first nucleotide and the at least a second nucleotide are located on different strands of the isolated oligonucleotide. In some embodiments, the at least a first nucleotide and the at least a second nucleotide are located on the same strand of the isolated oligonucleotide.
[0198] In some embodiments of the isolated oligonucleotide, the isolated oligonucleotide comprises multiple modified nucleotides, wherein at least a first modified nucleotide comprises a first modification, at least a second modified nucleotide comprises a second modification, and at least a third nucleotide comprises a third modification. In some embodiments, the isolated oligonucleotide comprises a first, a second, a third, and a fourth modification. In some embodiments, the isolated oligonucleotide comprises more than four modifications. In some embodiments, all modifications are on the sense strand. In some embodiments, all modifications are on the antisense strand. Any combination of modification positions between the sense strand and the antisense strand is contemplated within the isolated oligonucleotide of the present disclosure.
[0199] In some embodiments, the modified nucleotides are located contiguously in the sense strand, the antisense strand, or both. In some embodiments, some, but not all, of the modified nucleotides are located contiguously in the sense strand, the antisense strand, or both. In some embodiments, the modified nucleotides in the sense strand, the antisense strand, or both are not located contiguously.
[0200] The present disclosure contemplates that any nucleotide on sense strand or antisense strand can be modified.In some embodiments, any nucleotide on antisense strand can be modified.In some embodiments, any nucleotide on antisense strand can be modified.
[0201] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand, the antisense strand, or both contain one or more modified nucleotide sequences. In some embodiments, only the sense strand contains one modified nucleotide. In some embodiments, only the sense strand contains one or more modified nucleotides. In some embodiments, only the antisense strand contains one or more modified nucleotides. In some embodiments, only the antisense strand contains one or more modified nucleotides.
[0202] In some embodiments, the isolated oligonucleotide of the present disclosure comprises at least one modified nucleotide.In some embodiments, one or more modified nucleotides increase the stability or efficacy or both of the isolated oligonucleotide.In some embodiments, one or more modified nucleotides increase the stability of RNA duplex and siRNA.
[0203] Modifications that increase RNA stability include, but are not limited to, locked nucleic acids. As used herein, the term "locked nucleic acid" or "LNA" includes, but is not limited to, modified RNA nucleotides containing a methylene bridge connecting the 2' oxygen and 4' carbon of the ribose moiety. This methylene bridge locks the ribose in the 3' end confirmation, also known as the north confirmation, found in A-form RNA duplexes. The term "inaccessible RNA" can be used interchangeably with LNA. LNAs with 2'-4' cyclic linkages are described in International Publication Nos. 99 / 14226, 00 / 56746, 00 / 56748, and 00 / 66604, the contents of which are incorporated herein by reference.
[0204] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand, the antisense strand, or both contain at least one nucleotide with a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide contains at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide contains at least one nucleotide with a modified phosphate backbone. In some embodiments, the isolated oligonucleotides of the present disclosure contain a modified phosphate backbone, and the modified phosphate backbone contains a modified phosphodiester linkage. In some embodiments, the modified phosphodiester linkage is modified by replacing one or more oxygen atoms with a moiety, and the moiety is attached to the phosphorus atom in the phosphodiester linkage using a carbon, nitrogen, or sulfur atom in the moiety or by forming a 2'-5' bond. In some embodiments, the modified phosphodiester linkage comprises a phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate diester, mesylphosphoramidate, or phosphonoacetate.
[0205] In some embodiments, the isolated oligonucleotide of the present disclosure comprises one or more unnatural base-containing nucleotides, locked nucleotides, or abasic nucleotides. In some embodiments, the one or more modified nucleotides comprise phosphorothioate derivatives or acridinine-substituted nucleotides. In some embodiments, the isolated oligonucleotide of the present disclosure comprises a phosphate mimic at the 5'-end of the antisense strand, including, but not limited to, vinyl phosphonate or other phosphate analogs. In some embodiments, the 5'-phosphate mimic is ethyl phosphonate, vinyl phosphonate, or an analog thereof.
[0206] In some embodiments, the modified nucleotides are 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylketone, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methyl -aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-isopentenyladenine, uracil-5-oxyacetic acid(v), wybutoxysine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid(v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, or 2,6-diaminopurine.
[0207] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand, the antisense strand, or both comprise terminal or internal nucleotides linked to one or more targeting ligands. In some embodiments, the terminal or internal nucleotides are directly linked to one or more targeting ligands. In some embodiments, the terminal or internal nucleotides are indirectly linked to one or more targeting ligands via a linker. In some embodiments, the one or more targeting ligands directly or indirectly linked to the terminal or internal nucleotides can further comprise a PK modulator. In some embodiments, the PK modulator is a competitive modulator, a positive allosteric modulator, a negative allosteric modulator, or a neutral allosteric modulator. In some embodiments, the targeting ligand is selected from one or more of a carbohydrate, a peptide, a lipid, an antibody or fragment thereof, an aptamer, albumin, fibrinogen, and folate.
[0208] Nucleotide Modifications
[0209] The isolated oligonucleotides provided herein include (a) a sense strand comprising X1 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein X1 is an integer selected from 13 to 36, and the first modification and the second modification are different; and (b) an antisense strand comprising X2 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein X2 is an integer selected from 18 to 31, and the third modification and the fourth modification are different.
[0210] In some embodiments, the X1 nucleotide in the sense strand of an isolated oligonucleotide of this disclosure is 18-21, and the X2 nucleotide in the antisense strand of an isolated oligonucleotide of this disclosure is 20-23. In some embodiments, the X1 nucleotide in the sense strand of an isolated oligonucleotide of this disclosure is 20 or 21, and the X2 nucleotide in the antisense strand of an isolated oligonucleotide of this disclosure is 22 or 23. In some embodiments, the X2 nucleotide in the antisense strand of an isolated oligonucleotide of this disclosure is equal to the X1 nucleotide in the sense strand of an isolated oligonucleotide of this disclosure + 2. In some embodiments, the X1 nucleotide in the sense strand of an isolated oligonucleotide of this disclosure is 21, and the X2 nucleotide in the antisense strand of an isolated oligonucleotide of this disclosure is 23. In some embodiments, the X1 nucleotide in the sense strand of an isolated oligonucleotide of this disclosure is 20, and the X2 nucleotide in the antisense strand of an isolated oligonucleotide of this disclosure is 22.
[0211] In some embodiments of the isolated oligonucleotides of the present disclosure, the isolated oligonucleotides comprise: (a) a sense strand comprising 20 nucleotides, wherein at least one nucleotide is modified with a first modification and each of the remaining nucleotides is independently modified with a second modification, wherein the first and second modifications are the same or different; and (b) an antisense strand comprising 22 nucleotides, wherein at least one nucleotide is modified with a third modification and each of the remaining nucleotides is independently modified with a fourth modification, wherein the third and fourth modifications are the same or different.
[0212] In some embodiments, the first modification is a modification of the sugar moiety of at least one nucleotide at the 2' position selected from a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, a 2'-deoxy modification, and equivalents thereof, and combinations thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, or a 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the first modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof.
[0213] In some embodiments, the second modification is a modification of one or more sugar moieties of the remaining nucleotides at the 2' position selected from a 2'-C1-C6 alkyl, a 2'-OR modification (where R is a C1-C6 alkyl optionally substituted with a C1-C6 alkoxy, acetamido, phenyl, or heteroaryl containing a 5- or 6-membered ring and 1 or 2 heteroatoms selected from N, O, and S), a 2'-amino, and a morpholino substitution, and equivalents thereof, and combinations thereof. In some embodiments, the second modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the second modification is a 2'-OR modification. In some embodiments, the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the second modification is a 2'-O-methyl modification. In some embodiments, the second modification is a morpholino substitution.
[0214] In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the first modification is a 2'-F modification or a stereoisomer thereof, and the second modification is a 2'-O-methyl modification.
[0215] In some embodiments, the third modification is a modification of the sugar moiety of at least one nucleotide at the 2' position selected from a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, a 2'-deoxy modification, and equivalents thereof, and combinations thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, a 2'-N3 modification, or a 2'-deoxy modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof. In some embodiments, the third modification is a 2'-F modification, a 2'-CN modification, or a 2'-N3 modification, or a stereoisomer thereof.
[0216] In some embodiments, the fourth modification is a modification of one or more sugar moieties of the remaining nucleotides at the 2' position selected from a 2'-C1-C6 alkyl, a 2'-OR modification (where R is a C1-C6 alkyl optionally substituted with a C1-C6 alkoxy, acetamido, phenyl, or heteroaryl containing a 5- or 6-membered ring and 1 or 2 heteroatoms selected from N, O, and S), a 2'-amino, and a morpholino substitution, and equivalents thereof, and combinations thereof. In some embodiments, the fourth modification is a 2'-OR modification, or a morpholino substitution, or a combination thereof. In some embodiments, the fourth modification is a 2'-OR modification. In some embodiments, the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the fourth modification is a 2'-O-methyl modification. In some embodiments, the fourth modification is a morpholino substitution.
[0217] In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification or a 2'-methoxyethoxy modification. In some embodiments, the third modification is a 2'-F modification or a stereoisomer thereof, and the fourth modification is a 2'-O-methyl modification.
[0218] Sense strand
[0219] In some embodiments of the isolated oligonucleotide of the present disclosure, including sense strand and antisense strand, at least three nucleotides are modified with first modification in the sense strand of the isolated oligonucleotide of the present disclosure.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least two of the at least three nucleotides that are modified with first modification are located consecutively.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least three of the at least three nucleotides that are modified with first modification are located consecutively.
[0220] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least four nucleotides in the sense strand are modified with first modification.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least three of the at least four nucleotides that are modified with first modification are located consecutively.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least four of the at least four nucleotides that are modified with first modification are located consecutively.
[0221] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least 5 nucleotides in the sense strand are modified with first modification.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least 3 of the at least 5 nucleotides that are modified with first modification are located consecutively.In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least 4 of the at least 5 nucleotides that are modified with first modification are located consecutively.
[0222] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, at least three nucleotides, at least four nucleotides, or at least five nucleotides modified with a first modification are located between positions 10 and 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.
[0223] In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, two of the at least three nucleotides modified with the first modification are located at positions selected from 10, 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, three of the at least three nucleotides modified with the first modification are located at positions selected from 10, 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of the isolated oligonucleotide of the disclosure, one of the at least three nucleotides modified with the first modification is located at position 11 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand.
[0224] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 12, 13, and 14 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, three of the at least three nucleotides modified with the first modification are located at positions 10, 11, and 12 from the nucleotide complementary to the first nucleotide at the 5'-end of the antisense strand.
[0225] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 10 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 11 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 12 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 13 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 14 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, one of the at least four nucleotides modified with the first modification is located at position 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.
[0226] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, the at least four nucleotides modified with the first modification are located at positions 10, 11, 12, and 13 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.
[0227] In some embodiments, in the sense strand of an isolated oligonucleotide of the present disclosure, the at least five nucleotides modified with the first modification are located at positions 10, 11, 12, 13, and 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.
[0228] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises five nucleotides modified with a first modification, and the five nucleotides modified with the first modification are located at positions 10, 11, 12, 13, and 15 from the nucleotide complementary to the first nucleotide at the 5' end of the antisense strand.
[0229] In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least three, at least four, or at least five nucleotides modified with the first modification are not all consecutively located. In some embodiments, in the sense strand of the isolated oligonucleotide of the present disclosure, at least three, at least four, or at least five nucleotides are modified with a 2'-F modification.
[0230] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.
[0231] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand of the isolated oligonucleotide has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93'.
[0232] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 33, 34, 35, 36, 37, 59, or 61.
[0233] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 33.
[0234] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 33 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 3.
[0235] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 34.
[0236] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 34 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 4.
[0237] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 35.
[0238] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 35 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 5.
[0239] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 37.
[0240] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 37 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 7.
[0241] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO:59.
[0242] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO:59 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO:29.
[0243] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0-16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 61.
[0244] In some embodiments, the sense strand of the isolated oligonucleotide of the present disclosure has the formula: 5'(M) g (F) f (M) e (F) d (M) c (F) b (M) a 3'), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, and g are any one of 0 to 16, and the sense strand is 5'(M)0(F)0(M)5(F)1(M)1(F)4(M)93', wherein the sense strand comprises a nucleotide sequence according to SEQ ID NO: 61 and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 31.
[0245] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 774 and 792 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3').
[0246] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 775 and 793 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3').
[0247] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 777 and 795 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3').
[0248] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 781 and 799 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3').
[0249] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 4602 and 4620 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCCUCAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3').
[0250] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to the region between nucleotide positions 4607 and 4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the double-stranded region comprises the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3').
[0251] antisense strand
[0252] In some embodiments, up to seven nucleotides in the antisense strand of an isolated oligonucleotide of the disclosure are modified with a third modification.
[0253] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, up to four of the up to seven nucleotides modified with a tertiary modification are located at positions 2-8 from the first nucleotide at the 5'-end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, at least one of the up to seven nucleotides modified with a tertiary modification is located at position 2 from the first nucleotide at the 5'-end of the antisense strand.
[0254] In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, up to two of the up to seven nucleotides modified with a third modification are located consecutively. In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, up to two of the up to seven nucleotides modified with a third modification are located consecutively at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.
[0255] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, at least one of the up to seven nucleotides modified with a tertiary modification is located at position 14 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two or three of the up to seven nucleotides modified with a tertiary modification are located at a position selected from positions 2, 3, 5, and 6 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, three of the up to seven nucleotides modified with a tertiary modification are located at a position selected from positions 2, 3, 5, and 6 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with a tertiary modification are located at positions 2 and 5 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with a third modification are located at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand.
[0256] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, three of the up to seven nucleotides modified with a third modification are located at positions 2, 3, and 5 from the first nucleotide at the 5' end of the antisense strand.
[0257] In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one or two of the up to seven nucleotides modified with a tertiary modification are located at positions selected from positions 14 and 16 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with a tertiary modification are located at positions 14 and 16 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, up to seven nucleotides are modified with a 2'-F modification. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 14 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, two of the up to seven nucleotides modified with a tertiary modification are located at positions 14 and 16 from the first nucleotide at the 5' end of the antisense strand.
[0258] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises up to seven nucleotides modified with a tertiary modification, and up to seven nucleotides are modified with a 2'-F modification. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 2 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 3 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 5 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of the isolated oligonucleotides of the present disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 7 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 10 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 14 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, one of the up to seven nucleotides modified with a tertiary modification is located at position 16 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, in the antisense strand of an isolated oligonucleotide of the present disclosure, the up to seven nucleotides modified with a tertiary modification are located at positions 2, 3, 5, 7, 10, 14, and 16 from the first nucleotide at the 5' end of the antisense strand.
[0259] In some embodiments, in the antisense strand of the isolated oligonucleotide of the present disclosure, the antisense strand has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The 5' strand comprises a nucleotide modified with a 2'-F modification ("F") and a nucleotide modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15'.
[0260] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) oand a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 3, 4, 5, 7, 29, or 31.
[0261] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 3.
[0262] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o The 5' strand comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', wherein the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 3 and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 33.
[0263] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o5', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 4.
[0264] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', wherein the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 4 and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 34.
[0265] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 5.
[0266] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o5', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', wherein the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 5 and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 35.
[0267] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 7.
[0268] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M)a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', wherein the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 7 and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 37.
[0269] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o5', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 29.
[0270] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', wherein the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 29 and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 59.
[0271] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o 5', comprising nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', and the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 31.
[0272] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand of the isolated oligonucleotide has the formula: 3'(M) a (F) b (M) c (F) d (M) e (F) f (M) g (F) h (M) i (F) j (M) k (F) l (M) m (F) n (M) o5' comprises nucleotides modified with a 2'-F modification ("F") and nucleotides modified with a 2'-O-methyl modification ("M"), wherein M is a 2'-O-methyl modified nucleotide, F is a 2'-F modified nucleotide, and a, b, c, d, e, f, g, h, i, j, k, l, m, n, and o are any one of 0 to 16, and the antisense strand is any one of 3'(M)0(F)0(M)6(F)1(M)1(F)1(M)3(F)1(M)2(F)1(M)1(F)1(M)1(F)2(M)15', wherein the antisense strand comprises a nucleotide sequence according to SEQ ID NO: 31 and the sense strand comprises a nucleotide sequence according to SEQ ID NO: 61.
[0273] Targeting Ligands
[0274] In some embodiments, the terminal or internal nucleotides of the sense strand or antisense strand, or both, of the isolated oligonucleotide of the present disclosure are linked to a targeting ligand.In some embodiments, the targeting ligand is linked to one or more nucleotides at the 5' end of the sense strand of the isolated oligonucleotide of the present disclosure.In some embodiments, the targeting ligand is linked to one or more nucleotides at the 3' end of the sense strand of the isolated oligonucleotide of the present disclosure.In some embodiments, the targeting ligand is linked to one or more nucleotides at the 5' end of the antisense strand of the isolated oligonucleotide of the present disclosure.In some embodiments, the targeting ligand is linked to one or more nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the present disclosure.In some embodiments, the targeting ligand is linked to one or more nucleotides of at least two single-stranded nucleotides at the 3' end of the antisense strand of the isolated oligonucleotide of the present disclosure.
[0275] In some embodiments, the targeting ligand is selected from one or more of carbohydrates, peptides, lipids, antibodies or their fragments, aptamers, albumin, fibrinogen and folate.In some embodiments, the targeting ligand binds to a surface protein on the cell that expresses the target mRNA of the isolated oligonucleotide of the present disclosure.In some embodiments, the targeting ligand mediates the entry of the isolated oligonucleotide of the present disclosure into the cell that expresses the target mRNA of the isolated oligonucleotide of the present disclosure.
[0276] In some embodiments, the targeting ligand is a therapeutic ligand. In some embodiments, the targeting ligand is a therapeutic antibody.
[0277] In some embodiments, the targeting ligand is linked to the isolated oligonucleotide of the present disclosure by a linker.In some embodiments, the linker is any one of protein, DNA, RNA or chemical compound.In some embodiments, the isolated oligonucleotide of the present disclosure, linker and targeting ligand form a scaffold.As used herein, the term "scaffold" refers to a compound or complex that includes the linker of the present disclosure, and the linker is covalently bound to the ligand or the isolated oligonucleotide or both.
[0278] In some embodiments, the isolated oligonucleotide of the present disclosure, the linker, and the targeting ligand form a conjugate. As used herein, the term "conjugate" refers to a compound or complex comprising an isolated oligonucleotide covalently attached to a ligand via a linker of the present disclosure.
[0279] As used herein, the term "targeting ligand" or "ligand," when covalently attached to a GalNAc oligonucleotide, refers to a moiety that can mediate its entry into, or facilitate or enable its delivery to, a target site (e.g., a target cell or tissue). In some embodiments, the targeting ligand comprises a sugar ligand moiety (e.g., N-acetylgalactosamine (GalNAc)) that can direct uptake of the oligonucleotide into the liver.
[0280] In some embodiments, the targeting ligand binds to the asialoglycoprotein receptor (ASGPR). In some embodiments, the targeting ligand binds to the liver, e.g., liver parenchymal cells (e.g., via ASGPR).
[0281] Suitable targeting ligands include, but are not limited to, those disclosed in Winkler (Ther. Deliv., 2013, 4(7):791-809), PCT Patent Application Publication Nos. WO 2016 / 100401, WO 2012 / 089352 and WO 2009 / 082607, and U.S. Patent Application Publication Nos. 2009 / 0239814, 2012 / 0136042, 2013 / 0158824 and 2009 / 0247608, each of which is incorporated by reference.
[0282] In some embodiments, the targeting ligand comprises a carbohydrate moiety.
[0283] As used herein, a "carbohydrate moiety" refers to a moiety comprising one or more monosaccharide units, each having at least six carbon atoms (which may be linear, branched, or cyclic), with an oxygen, nitrogen, or sulfur atom attached to each carbon atom. In some embodiments, the carbohydrate moiety comprises a monosaccharide, disaccharide, trisaccharide, or tetrasaccharide. In some embodiments, the carbohydrate moiety comprises an oligosaccharide containing about 4-9 monosaccharide units. In some embodiments, the carbohydrate moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or a polysaccharide gum).
[0284] In some embodiments, the carbohydrate moiety comprises a monosaccharide, disaccharide, trisaccharide, or tetrasaccharide. In some embodiments, the carbohydrate moiety comprises an oligosaccharide (e.g., containing about 4 to about 9 monosaccharide units). In some embodiments, the carbohydrate moiety comprises a polysaccharide (e.g., starch, glycogen, cellulose, or a polysaccharide gum).
[0285] In some embodiments, the ligand is capable of binding to a human asialoglycoprotein receptor (ASGPR), such as human asialoglycoprotein receptor 2 (ASGPR2).
[0286] In some embodiments, the carbohydrate moiety comprises a sugar (e.g., 1, 2, or 3 sugars). In some embodiments, the carbohydrate moiety comprises galactose or a derivative thereof (e.g., 1, 2, or 3 galactose or a derivative thereof). In some embodiments, the carbohydrate moiety comprises N-acetylgalactosamine or a derivative thereof (e.g., 1, 2, or 3 N-acetylgalactosamine or a derivative thereof). In some embodiments, the carbohydrate moiety comprises N-acetyl-D-galactosylamine or a derivative thereof (e.g., 1, 2, or 3 N-acetyl-D-galactosylamine or a derivative thereof).
[0287] In some embodiments, the carbohydrate moiety comprises an N-acetylgalactosamine (e.g., one, two, or three N-acetylgalactosamines). In some embodiments, the carbohydrate moiety comprises an N-acetyl-D-galactosylamine (e.g., one, two, or three N-acetyl-D-galactosylamines).
[0288] In some embodiments, the carbohydrate moiety comprises mannose or a derivative thereof (e.g., mannose-6-phosphate). In some embodiments, the carbohydrate moiety further comprises a linking moiety that connects one or more sugars (e.g., N-acetyl-D-galactosylamine) with the linker.
[0289] In some embodiments, the linker comprises a thioether (e.g., thiosuccinimide, or a hydrolysis analog thereof), a disulfide, a triazole, a phosphorothioate, a phosphodiester, an ester, an amide, or any combination thereof. In some embodiments, the linker is a triantennary linking moiety. Suitable targeting ligands include, but are not limited to, those disclosed in PCT Patent Application Publications WO 2015 / 006740, WO 2016 / 100401, WO 2017 / 214112, WO 2018 / 039364, and WO 2018 / 045317, each of which is incorporated herein by reference.
[0290] In some embodiments, the targeting ligand comprises a lipid or lipid moiety (e.g., 1, 2, or 3 lipid moieties). In some embodiments, the lipid moiety comprises a C8-C24 fatty acid, cholesterol, a vitamin, a sterol, a phospholipid, or any combination thereof (e.g., 1, 2, or 3 of them).
[0291] In some embodiments, the targeting ligand comprises a peptide or peptide moiety (e.g., one, two, or three peptide moieties). In some embodiments, the peptide moiety comprises an integrin, insulin, glucagon-like peptide, or any combination thereof (e.g., one, two, or three thereof). In some embodiments, the targeting ligand comprises an antibody or antibody moiety (e.g., transferrin). In some embodiments, the targeting ligand comprises one, two, or three antibody moieties (e.g., transferrin).
[0292] In some embodiments, the targeting ligand comprises an oligonucleotide (e.g., an aptamer or CpG). In some embodiments, the targeting ligand comprises one, two, or three oligonucleotides (e.g., an aptamer or CpG).
[0293] In some embodiments, the ligand comprises one, two, or three sugars (e.g., N-acetyl-D-galactosylamine), one, two, or three lipid moieties, one, two, or three peptide moieties, one, two, or three antibody moieties, one, two, or three oligonucleotides, or any combination thereof.
[0294] In some embodiments, the linker is attached to the isolated oligonucleotide of the present disclosure via a phosphate group or an analog of a phosphate group in the isolated oligonucleotide.
[0295] In some embodiments, the ligand comprises a sugar ligand moiety (e.g., N-acetylgalactosamine (GalNAc)) that can direct uptake of the oligonucleotide into the liver.
[0296] In some embodiments, the ligand comprises GalNAc or a derivative thereof. In some embodiments, the ligand comprises the GalNAc G1b structure shown below. [ka]
[0297] In some embodiments, the ligand comprises three GalNAc moieties or three derivatives thereof. In some embodiments, the ligand comprises three GalNAc G1b moieties. In some embodiments, the ligand comprises three GalNAc G1b moieties, the GalNAc G1b moieties are positioned consecutively. In some embodiments, the consecutively positioned GalNAc G1b moieties are positioned at the 3'-end of the sense strand. In some embodiments, the ligand comprises three consecutively positioned GalNAc G1b ("G1b") moieties, the first G1b moiety is linked to the second G1b moiety, and the second G1b is linked to the third G1b moiety. In some embodiments, the first GalNAc G1b moiety is linked to the sense strand of an isolated oligonucleotide of the present disclosure.
[0298] In some embodiments of the isolated oligonucleotide of the present disclosure, the ligand comprises three GalNAc Glb ("Glb") moieties, wherein a first GalNAc Glb moiety is linked to the sense strand of the isolated oligonucleotide, the first GalNAc Glb moiety is also linked to a second GalNAc Glb moiety, and the second Glb moiety is linked to a third Glb moiety. In some embodiments where the ligand comprises three GalNAc Glb moieties, the three GalNAc Glb moieties are located consecutively at the 3'-end of the sense strand.
[0299] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide is linked to a ligand (e.g., GalNAc G1b or three GalNAc G1b moieties). In some embodiments, the isolated oligonucleotide is linked to the ligand via an internal or terminal nucleotide of the isolated oligonucleotide. In some embodiments, the isolated oligonucleotide is linked to the ligand via a ligand linker. In some embodiments,
[0300] In some embodiments of the isolated oligonucleotide of the present disclosure, the isolated oligonucleotide comprises a sense strand and an antisense strand, and the ligand comprises three GalNAc G1b moieties, the three GalNAc G1b moieties are located consecutively at the 3'-end of the sense strand, and the ligand is linked to the terminal nucleotide on the sense strand of the isolated oligonucleotide. In some embodiments, the ligand is linked to the terminal nucleotide on the sense strand via a ligand linker. In some embodiments, the ligand linker is a monovalent linker. In some embodiments, the ligand linker is a bivalent linker. In some embodiments, the ligand linker is a trivalent linker.
[0301] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 774-799; and b) 4602-4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the targeting ligand is attached to the 3' end of the sense strand. In some embodiments, the targeting ligand comprises three GalNAc G1b moieties.
[0302] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 774-799; and b) 4602-4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, the targeting ligand comprises three GalNAc Glb moieties attached to the 3' end of the sense strand, and the sense strand is selected from the group consisting of SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3'); SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3'); SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3'); SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3'); SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3'); or SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3').
[0303] The linkage at the 3'-end of the isolated oligonucleotide of the present disclosure can be direct via the 5', 3', or 2' hydroxyl group, or indirect via a non-nucleotide linker or nucleoside, utilizing either the 2' or 3' hydroxyl position of the nucleoside. Linkage can also utilize a functionalized sugar or nucleobase of the 3'-terminal nucleotide. In some embodiments, the ligands described herein can be linked to the isolated oligonucleotide of the present disclosure using various ligand linkers, which can be cleavable or non-cleavable.
[0304] Modification of phosphate groups
[0305] Modified terminal phosphate group
[0306] The present disclosure further provides oligonucleotides and conjugates containing modified phosphate groups (also called phosphate mimics or phosphate derivatives) for nucleic acid delivery.The present disclosure also relates to the use of oligonucleotides and conjugates containing modified phosphate groups, for example, in the delivery of nucleic acids and / or the treatment or prevention of diseases.
[0307] In some embodiments, the present disclosure provides a phosphate mimic of the 5'-terminal nucleotide. Without wishing to be bound by theory, it is understood that when incorporated into an oligonucleotide (for example, at the 5'-end of the antisense strand), the phosphate mimic can improve Ago2 binding / loading and enhance the metabolic stability of the oligonucleotide, thus enhancing the efficacy and duration of the isolated oligonucleotide (for example, dsRNA or siRNA).
[0308] In some embodiments of the isolated oligonucleotide of the present disclosure, the oligonucleotide comprises a 5'-end nucleotide modification.In some embodiments, the 5'-end modification provides the functional effect of phosphate group, but is more stable in the environmental conditions that the oligonucleotide is exposed to when administered to a subject.In some embodiments, the isolated oligonucleotide comprises a phosphate mimic that is more resistant to phosphatase and other enzymes, but minimizes the adverse effect on the function of the oligonucleotide (for example, when used as an RNAi inhibitor molecule, minimizes the reduction of gene target knockdown).
[0309] In some embodiments, the 5'-end modification is a chemical modification, hi some embodiments, the chemical modification enhances stability against nucleases or other enzymes that degrade or interfere with the structure or activity of the isolated oligonucleotide.
[0310] In some embodiments, the sense strand or antisense strand of an isolated oligonucleotide of the present disclosure comprises a 5'-terminal phosphate group. In some embodiments, the 5'-terminal phosphate group comprises an unmodified phosphate having the formula: -OP(=O)(OH)OH. In some embodiments, the 5'-terminal phosphate group comprises a modified phosphate. In some embodiments, the 5'-terminal phosphate group comprises a modified phosphate having the formula: -CH2-P(=X)(OR 1 ) OR 2 wherein X is O or S, and R 1 is H or C1-C6 alkyl, and R 2 is H or C1-C6 alkyl. In some embodiments, the modified phosphates are referred to as "phosphate mimetics."
[0311] The term "halo" or "halogen" as used herein refers to fluoro, chloro, bromo and iodo.
[0312] As used herein, the term "aryl" includes groups having aromaticity, including "conjugated" or polycyclic systems having one or more aromatic rings, and does not include heteroatoms in the ring structure. The term aryl includes both monovalent and divalent species. Examples of aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl, and the like. Conveniently, the aryl is phenyl.
[0313] As used herein, the term "alkyl" or "C1-C6 alkyl" is intended to include C1, C2, C3, C4, C5, or C6 straight-chain (linear) saturated aliphatic hydrocarbon groups and C3, C4, C5, or C6 branched saturated aliphatic hydrocarbon groups. For example, C1-C6 alkyl is intended to include C1, C2, C3, C4, C5, and C6 alkyl groups. Examples of alkyl include, but are not limited to, moieties having 1 to 6 carbon atoms, such as methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, i-pentyl, or n-hexyl. In some embodiments, a straight-chain or branched alkyl has 6 or fewer carbon atoms (e.g., C1-C6 for straight chain, C3-C6 for branched chain), and in other embodiments, a straight-chain or branched alkyl has 4 or fewer carbon atoms. In some embodiments, a straight-chain alkyl has 1 carbon atom. In some embodiments, a straight-chain alkyl has 2 carbon atoms.
[0314] In some embodiments, the phosphate mimetic is linked to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula: [ka] During the ceremony: B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is O or S, Y 2 is O or S, Z is H, halogen, or -OR Z and R Z is H, C1-C6 alkyl, or -(C1-C6 alkyl)-(C6-C 10 aryl), and is C1-C6 alkyl or -(C1-C6 alkyl)-(C6-C 10 aryl) can be one or more R Za may be substituted with Each R Za are independently halogen, C1-C6 alkyl, or —O—(C1-C6 alkyl), wherein C1-C6 alkyl or —O—(C1-C6 alkyl) is optionally substituted with one or more halogens; [ka] indicates binding of an isolated oligonucleotide (eg, siRNA) to a nucleotide.
[0315] In some embodiments, the phosphate mimetic is linked to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula: [ka] During the ceremony: B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, Y 1 is O or S, Y 2 is O or S, [ka] indicates binding of an isolated oligonucleotide (eg, siRNA) to a nucleotide.
[0316] In some embodiments, the phosphate mimetic is linked to the 5' end of an isolated oligonucleotide (e.g., siRNA) as shown in the following formula: [ka] During the ceremony: B is H or a nucleobase moiety; X is O or S; R 1 is H or C1-C6 alkyl, R 2 is H or C1-C6 alkyl, [ka] indicates binding of an isolated oligonucleotide (eg, siRNA) to a nucleotide.
[0317] In some embodiments, X is O.
[0318] In some embodiments, X is S.
[0319] In some embodiments, R 1 is H.
[0320] In some embodiments, R 1 is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).
[0321] In some embodiments, R 1 is methyl.
[0322] In some embodiments, R 2 is H.
[0323] In some embodiments, R 2 is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).
[0324] In some embodiments, R 2 is methyl.
[0325] In some embodiments, Y 1 is O.
[0326] In some embodiments, Y 1 is S.
[0327] In some embodiments, Y 2 is O.
[0328] In some embodiments, Y 2 is S.
[0329] In some embodiments, Z is H.
[0330] In some embodiments, Z is not H.
[0331] In some embodiments, Z is halogen (eg, F, Cl, Br, or I).
[0332] In some embodiments, Z is F or Cl.
[0333] In some embodiments, Z is F.
[0334] In some embodiments, Z is -OR Z is.
[0335] In some embodiments, Z is —OH.
[0336] In some embodiments, Z is not —OH.
[0337] In some embodiments, Z is —O—(C 1 -C 6 alkyl) (eg, where C 1 -C 6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).
[0338] In some embodiments, Z is —OCH 3 .
[0339] In some embodiments, Z is —O—(C1-C6 alkyl)-O—(C1-C6 alkyl) (e.g., where C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).
[0340] In some embodiments, Z is —OCH 2 CH 2 OCH 3 .
[0341] In some embodiments, Z is one or more R Za -O-(C1-C6 alkyl)-(C6-C 10 aryl).
[0342] In some embodiments, Z is —O—(C-C alkyl)-(C-C 10 aryl).
[0343] In some embodiments, Z is [ka] is.
[0344] In some embodiments, Z is one or more R Za may be substituted with [ka] is.
[0345] In some embodiments, Z is optionally substituted with one or more halogens. [ka] is.
[0346] In some embodiments, Z is optionally substituted with one or more C1-C6 alkyl or -O-(C1-C6 alkyl). [ka] wherein the C1-C6 alkyl or -O-(C1-C6 alkyl) may be substituted with one or more halogens.
[0347] In some embodiments, R Z is H.
[0348] In some embodiments, R Z is not H.
[0349] In some embodiments, R Z is one or more R Za and C1-C6 alkyl (for example, methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) optionally substituted with.
[0350] In some embodiments, R Z is C-C alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl) optionally substituted with one or more halogens (e.g., F, Cl, Br or I), or —O—(C-C alkyl) optionally substituted with one or more halogens (e.g., C-C alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl).
[0351] In some embodiments, R Zis C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).
[0352] In some embodiments, R Z is methyl, ethyl or propyl.
[0353] In some embodiments, R Z is methyl.
[0354] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).
[0355] In some embodiments, R Z is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl) substituted with one or more -O-(C1-C6 alkyl) (e.g., C1-C6 alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl or hexyl), where -O-(C1-C6 alkyl) is optionally substituted with one or more halogens.
[0356] In some embodiments, R Z is one or more R Za -(C1-C6 alkyl)-(C6-C 10 aryl).
[0357] In some embodiments, R Zis optionally substituted with one or more halogens (e.g., F, Cl, Br, or I), C-C alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl), or —O—(C-C alkyl) (e.g., C-C alkyl is methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl). 10 aryl), wherein C1-C6 alkyl or -O-(C1-C6 alkyl) may be substituted with one or more halogens.
[0358] In some embodiments, R Z is (C1-C6 alkyl)-(C6-C 10 aryl).
[0359] In some embodiments, at least one R Za is a halogen (e.g., F, Cl, Br, or I).
[0360] In some embodiments, at least one R Za is F or Cl.
[0361] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) optionally substituted with one or more halogens (e.g., F, Cl, Br, or I).
[0362] In some embodiments, at least one R Za is C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl).
[0363] In some embodiments, at least one R Zais C1-C6 alkyl (e.g., methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, s-butyl, t-butyl, pentyl, or hexyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).
[0364] In some embodiments, at least one R Za is —O—(C1-C6 alkyl) optionally substituted with one or more halogens (e.g., F, Cl, Br, or I).
[0365] In some embodiments, at least one R Za is O—(C1-C6 alkyl).
[0366] In some embodiments, at least one R Za is —O—(C1-C6 alkyl) substituted with one or more halogens (e.g., F, Cl, Br, or I).
[0367] In some embodiments, B is H.
[0368] In some embodiments, B is a nucleobase moiety.
[0369] As used herein, the term "nucleobase moiety" refers to a nucleobase that is attached to the remainder of an isolated oligonucleotide (e.g., dsRNA or siRNA) of the disclosure, e.g., via an atom of the nucleobase or its functional group.
[0370] In some embodiments, the nucleobase moiety is adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U).
[0371] In some embodiments, the nucleobase moiety is uracil (U).
[0372] In some embodiments, the phosphate mimetic is linked to the 5' end of the isolated oligonucleotide, as shown in the following formula: [ka] During the ceremony, B is a nucleobase moiety, the nucleobase moiety is uracil (U), the uracil is at position 1 from the 5' end of the sense strand or position 1 from the 5' end of the antisense strand; X is O, R 1 is a C1 alkyl, R 2 is H, [ka] indicates binding of an isolated oligonucleotide (eg, siRNA) to a nucleotide.
[0373] In some embodiments of the isolated oligonucleotide of the present disclosure, a phosphate mimetic is attached to the 5' end of the antisense strand of the isolated oligonucleotide.
[0374] In some embodiments, the phosphate mimetic is attached to the 5'-terminal uridine of the antisense strand of the isolated oligonucleotide and has the following structure: (5'-MeEPmU). [ka] where "mU" is a 2'-O-methyl modified uridine nucleotide and "MeEP" is a monomethyl protected phosphate mimic.
[0375] In some embodiments, the phosphate mimetic is attached to the 5' terminal uridine of the antisense strand of the isolated oligonucleotide and has the following structure: (5'-MeEPmUs). [ka] where "mU" is a 2'-O-methyl modified uridine nucleotide, "MeEP" is a monomethyl protected phosphate mimic, and "s" is a phosphorothioate internucleotide linkage.
[0376] In some embodiments, the phosphate mimetic is attached to the 5'-terminal uridine of the antisense strand of the isolated oligonucleotide and has the following structure (5'-EPmUs): [ka] where "mU" is a 2'-O-methyl modified uridine nucleotide, "EP" is a phosphate mimetic, and "s" is a phosphorothioate internucleotide linkage.
[0377] The terms "5'-MeEP," "5'-MeEP," and "5'MeEP" are used interchangeably herein.
[0378] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 774 to 799 and b) 4602 to 4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the antisense strand comprises a monomethyl-protected phosphate mimic (MeEP). In some embodiments, MeEP is linked to the 5' end of the antisense strand (5'-MeEP).
[0379] In some embodiments where MeEP is linked to the 5' end of the antisense strand, the phosphate mimetic is attached to the 5' terminal uridine of the antisense strand.
[0380] In some embodiments, the 5'-terminal uridine is a 2'-O-methyl modified nucleotide.
[0381] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 774 to 799; and b) 4602 to 4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, and the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, and the antisense strand comprises a 5'-MeEP moiety linked to the 5' end of the antisense strand, and the antisense strand is substantially complementary to a nucleotide sequence of SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3'); SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3'); SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3'); SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3'); SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCCUCAGCA 3'); or SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCCU 3').
[0382] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand comprises a nucleotide sequence identical to a region between any one of nucleotide positions selected from a) 774 to 799; and b) 4602 to 4625 from the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, the antisense strand is substantially complementary to the sense strand such that the sense strand and the antisense strand together form a double-stranded region, the antisense strand comprises 5'-MeEP linked to the 5' end of the antisense strand, and the sense strand comprises a targeting ligand comprising three GalNAc G1b attached to the 3' end of the sense strand.
[0383] Modified backbone phosphate / phosphodiester linkages
[0384] In some embodiments of the isolated oligonucleotide of the present disclosure, the sense strand or the antisense strand, or both, contain at least one nucleotide with a modified phosphate backbone. In some embodiments, the sense strand of the isolated oligonucleotide contains at least one nucleotide with a modified phosphate backbone. In some embodiments, the antisense strand of the isolated oligonucleotide contains at least one nucleotide with a modified phosphate backbone. In some embodiments, the isolated oligonucleotide of the present disclosure contains a modified phosphate backbone, and the modified phosphate backbone contains a modified phosphodiester bond. The phosphodiester bond is represented by the formula: [ka] and a bond having the formula: [ka] represents the bond to the 3' carbon of the first nucleotide in an isolated oligonucleotide of the disclosure, [ka] indicates the linkage to the 5' carbon of the second nucleotide in the isolated oligonucleotide of the disclosure. In some embodiments, the phosphodiester linkage is unmodified and Z 1 is O and Z 2 is OH or O - In some embodiments, the phosphodiester bond is modified to give Z 1 is O, S, NH, or N(C1-C6 alkyl), and Z 2 OH, SH, NH2, NH(C1-C6 alkyl), O - , S - , H.N. - or (C1-C6 alkyl)N - and Z 1 If is O, then Z 2 is OH or O - isn't it.
[0385] In some embodiments, Z 1 is O.
[0386] In some embodiments, Z 1 is S.
[0387] In some embodiments, Z1 is NH.
[0388] In some embodiments, Z1 is N(C1-C6 alkyl).
[0389] In some embodiments, Z2 is OH.
[0390] In some embodiments, Z2 is SH.
[0391] In some embodiments, Z2 is NH2.
[0392] In some embodiments, Z2 is NH(C1-C6 alkyl).
[0393] In some embodiments, Z2 is SH, NH2, or NH(C1-C6 alkyl).
[0394] In some embodiments, Z2 is O - is.
[0395] In some embodiments, Z2 is S - is.
[0396] In some embodiments, Z2 is HN - is.
[0397] In some embodiments, Z2 is (C1-C6 alkyl)N - is.
[0398] In some embodiments, Z2 is S - , H.N. - , or (C1-C6 alkyl)N - is.
[0399] In some embodiments, Z 1 is O and Z 2 is SH.
[0400] In some embodiments, Z1 is O and Z2 is NH2.
[0401] In some embodiments, Z1 is O and Z2 is NH(C1-C6 alkyl).
[0402] In some embodiments, Z 1 is S and Z 2 is OH.
[0403] In some embodiments, Z1 is S and Z2 is SH.
[0404] In some embodiments, Z1 is S and Z2 is NH2.
[0405] In some embodiments, Z1 is S and Z2 is NH(C1-C6 alkyl).
[0406] In some embodiments, Z 1 is NH and Z 2 is OH.
[0407] In some embodiments, Z1 is NH and Z2 is SH.
[0408] In some embodiments, Z1 is NH and Z2 is NH2.
[0409] In some embodiments, Z1 is NH and Z2 is NH(C1-C6 alkyl).
[0410] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is OH.
[0411] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is SH.
[0412] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH2.
[0413] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is NH(C1-C6 alkyl).
[0414] In some embodiments, Z1 is O and Z2 is S - is.
[0415] In some embodiments, Z1 is O and Z2 is HN - is.
[0416] In some embodiments, Z1 is O and Z2 is (C1-C6 alkyl)N - is.
[0417] In some embodiments, Z1 is S and Z2 is O. - is.
[0418] In some embodiments, Z1 is S and Z2 is S - is.
[0419] In some embodiments, Z1 is S and Z2 is HN - is.
[0420] In some embodiments, Z1 is S and Z2 is (C1-C6 alkyl)N - is.
[0421] In some embodiments, Z1 is NH and Z2 is O - is.
[0422] In some embodiments, Z1 is NH and Z2 is S - is.
[0423] In some embodiments, Z1 is NH and Z2 is HN - is.
[0424] In some embodiments, Z1 is NH and Z2 is (C1-C6 alkyl)N - is.
[0425] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is O - is.
[0426] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is S - is.
[0427] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is HN - is.
[0428] In some embodiments, Z1 is N(C1-C6 alkyl) and Z2 is (C1-C6 alkyl)N - is.
[0429] In some embodiments, the modified phosphodiester linkage comprises a phosphorothioate internucleotide linkage.
[0430] In some embodiments, the modified phosphodiester bond is [ka] or [ka] wherein [ka] represents the bond to the 3' carbon of the first nucleotide in an isolated oligonucleotide of the disclosure, [ka] indicates the linkage to the 5' carbon of the second nucleotide in an isolated oligonucleotide of the disclosure.
[0431] In some embodiments, the modified phosphodiester bond is [ka] wherein [ka] represents the bond to the 3' carbon of the first nucleotide in an isolated oligonucleotide of the disclosure, [ka] indicates the linkage to the 5' carbon of the second nucleotide in an isolated oligonucleotide of the disclosure.
[0432] In some embodiments, the modified phosphodiester bond is [ka] wherein [ka] represents the bond to the 3' carbon of the first nucleotide in an isolated oligonucleotide of the disclosure, [ka] indicates the linkage to the 5' carbon of the second nucleotide in an isolated oligonucleotide of the disclosure.
[0433] In some embodiments, the isolated oligonucleotides of the present disclosure contain at least one modified phosphodiester bond. In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand, the antisense strand, or both contain one or more modified phosphodiester bonds. In some embodiments, only the sense strand contains one or more modified phosphodiester bonds. In some embodiments, only the antisense strand contains one or more modified phosphodiester bonds. In some embodiments, both the sense strand and the antisense strand contain one or more modified phosphodiester bonds.
[0434] In some embodiments, the isolated oligonucleotide comprises at least two modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least three modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least four modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least five modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least six modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least seven modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least eight modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least nine modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least ten modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least eleven modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least twelve modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least thirteen modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least fourteen modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 15 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 16 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 17 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 18 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises at least 19 modified phosphodiester linkages.In some embodiments, the isolated oligonucleotide comprises at least 20 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises more than 20 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises 20-30 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises 30-40 modified phosphodiester linkages. In some embodiments, the isolated oligonucleotide comprises 40-50 modified phosphodiester linkages.
[0435] In some embodiments, the isolated oligonucleotide comprises at least two phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least three phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least four phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least five phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least six phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least seven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eight phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least nine phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least ten phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least eleven phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least twelve phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 13 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 14 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 15 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 16 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 17 phosphorothioate internucleotide linkages.In some embodiments, the isolated oligonucleotide comprises at least 18 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 19 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises at least 20 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises more than 20 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises 20-30 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises 30-40 phosphorothioate internucleotide linkages. In some embodiments, the isolated oligonucleotide comprises 40-50 phosphorothioate internucleotide linkages.
[0436] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one modified phosphodiester bond. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least eight modified phosphodiester bonds. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 9 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 10 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 11 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 12 modified phosphodiester linkages.In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 13 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 14 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 15 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 16 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 17 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 18 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 19 modified phosphodiester linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 20 modified phosphodiester linkages.
[0437] In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least one phosphorothioate internucleotide linkage. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least two phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least three phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least four phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least five phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least six phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least seven phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 8 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 9 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 10 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 11 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprises at least 12 phosphorothioate internucleotide linkages.In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprise at least 13 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprise at least 14 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprise at least 15 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprise at least 16 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprise at least 17 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprise at least 18 phosphorothioate internucleotide linkages. In some embodiments, the sense strand and / or antisense strand of the isolated oligonucleotide each comprise at least 19 phosphorothioate internucleotide linkages. In some embodiments, the sense and / or antisense strands of the isolated oligonucleotide each comprise at least 20 phosphorothioate internucleotide linkages.
[0438] In some embodiments, the modified phosphodiester linkages are located contiguously in the sense strand, the antisense strand, or both. In some embodiments, some, but not all, of the modified phosphodiester linkages are located contiguously in the sense strand, the antisense strand, or both. In some embodiments, the modified phosphodiester linkages in the sense strand, the antisense strand, or both are not located contiguously.
[0439] Within the present disclosure, isolated oligonucleotides are envisioned, in which any phosphodiester bond on the sense strand or antisense strand can be modified.In some embodiments, any phosphodiester bond on the antisense strand can be modified.In some embodiments, any phosphodiester bond on the antisense strand can be modified.
[0440] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand comprises 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages. In some embodiments, the 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises fewer than 5 modified phosphodiester linkages. In some embodiments, the antisense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages. In some embodiments, the antisense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages, and the 1, 2, 3, or 4 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises 4 modified phosphodiester linkages. In some embodiments, the antisense strand comprises 4 modified phosphodiester linkages, and the modified phosphodiester linkages comprise phosphorothioate.
[0441] In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, which link nucleotides at positions 1 and 2 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, which link nucleotides at positions 2 and 3 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, which link nucleotides at positions 20 and 21 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages linking nucleotides at positions 21 and 22 from the first nucleotide at the 5' end of the antisense strand. In some embodiments, the antisense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester linkages, the modified phosphodiester linkages comprising phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages being located between nucleotides 1 and 2, 2 and 3, 20 and 21, and 21 and 22 from the first nucleotide at the 5' end of the antisense strand.
[0442] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand comprises at least 1, at least 2, at least 3, or at least 4 phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand.
[0443] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the antisense strand comprises at least four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand.
[0444] In some embodiments of the isolated oligonucleotide of the present disclosure, the antisense strand comprises four phosphorothioate internucleotide linkages. In some embodiments in which the antisense strand comprises four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand.
[0445] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages. In some embodiments, the 1 to 20, 1 to 15, 1 to 10, 1 to 5, or fewer than 5 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the sense strand comprises fewer than 5 modified phosphodiester linkages. In some embodiments, the sense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages. In some embodiments, the sense strand comprises 1, 2, 3, or 4 modified phosphodiester linkages, and the 1, 2, 3, or 4 modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the sense strand comprises 4 modified phosphodiester linkages. In some embodiments, the sense strand comprises 4 modified phosphodiester linkages, and the modified phosphodiester linkages comprise phosphorothioate internucleotide linkages.
[0446] In some embodiments, the sense strand comprises at least one, at least two, at least three, or at least four modified phosphodiester linkages, wherein the modified phosphodiester linkages comprise phosphorothioate internucleotide linkages. In some embodiments, the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, wherein the phosphorothioate internucleotide linkages link nucleotides at positions 1 and 2 from the first nucleotide at the 5' end of the sense strand. In some embodiments, the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, wherein the phosphorothioate internucleotide linkages link nucleotides at positions 2 and 3 from the first nucleotide at the 5' end of the sense strand. In some embodiments, the sense strand comprises at least one, at least two, at least three, or at least four phosphorothioate internucleotide linkages, wherein the phosphorothioate internucleotide linkages link nucleotides at positions 18 and 19 from the first nucleotide at the 5' end of the sense strand. In some embodiments, the sense strand comprises at least 1, at least 2, at least 3, or at least 4 phosphorothioate internucleotide linkages, which link nucleotides at positions 19 and 20 from the first nucleotide at the 5' end of the sense strand. In some embodiments, the sense strand comprises at least 1, at least 2, at least 3, or at least 4 modified phosphodiester linkages, which link nucleotides at positions 1 and 2, 2 and 3, 18 and 19, and 19 and 20 from the first nucleotide at the 5' end of the sense strand.
[0447] In some embodiments of the isolated oligonucleotides of the present disclosure, wherein the sense strand comprises at least 1, at least 2, at least 3, or at least 4 phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.
[0448] In some embodiments of the isolated oligonucleotide of the present disclosure, wherein the sense strand comprises at least four phosphorothioate internucleotide linkages, the at least four phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.
[0449] In some embodiments of the isolated oligonucleotides of the present disclosure, the sense strand comprises four phosphorothioate internucleotide linkages. In some embodiments where the sense strand comprises four phosphorothioate internucleotide linkages, the phosphorothioate internucleotide linkages are located between nucleotides 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.
[0450] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand and the sense strand comprise four phosphorothioate internucleotide linkages, the antisense strand comprising phosphorothioate internucleotide linkages located between nucleotides 1-3 and 20-22 from the first nucleotide at the 5' end of the antisense strand, and the sense strand comprising phosphorothioate internucleotide linkages located between nucleotides 1-3 and 18-20 from the first nucleotide at the 5' end of the sense strand.
[0451] In some embodiments of the isolated oligonucleotides of the present disclosure, the antisense strand is i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 451 (5'[mUs][fUs][fA][...
Claims
1. An isolated oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 a nucleotide sequence that is substantially identical to a region comprising 19 to 25 nucleotides between any one of the nucleotide positions selected from An isolated oligonucleotide, wherein the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.
2. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 2. The isolated oligonucleotide of claim 1, comprising a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising 19 to 25 nucleotides between any one of said nucleotide positions selected from:
3. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588-608; b) 772-801; c) 1281-1301; d) 1797-1817; e) 2424-2444; f) 2533-2585; g) 2862-2882; h) 3778-3836; i) 4123-4169; and j) 4402-4625 2. The isolated oligonucleotide of claim 1, comprising a nucleotide sequence identical to a region comprising 19 to 25 nucleotides between any one of said nucleotide positions selected from:
4. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281-1301; b) 1797-1817; c) 2862-2882; d) 4402-4424; and e) 4520-4540 4. The isolated oligonucleotide of claim 1, comprising a nucleotide sequence substantially identical to a region between any one of said nucleotide positions selected from:
5. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281-1301; b) 1797-1817; c) 2862-2882; d) 4402-4424; and e) 4520-4540; 5. The isolated oligonucleotide of claim 4, comprising a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region between any one of the nucleotide positions selected from:
6. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 1281-1301; b) 1797-1817; c) 2862-2882; d) 4402-4424; and e) 4520-4540 5. The isolated oligonucleotide of claim 4, comprising a nucleotide sequence identical to the region between any one of the nucleotide positions selected from:
7. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772-801; b) 2424-2444; c) 3784-3805; d) 4123-4169; e) 4438-4509; and f) 4558-4621 4. The isolated oligonucleotide of claim 1, comprising a nucleotide sequence substantially identical to a region comprising said sequence between any one of said nucleotide positions selected from:
8. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772-801; b) 2424-2444; c) 3784-3805; d) 4123-4169; e) 4438-4509; and f) 4558-4621 8. The isolated oligonucleotide of claim 7, comprising a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising said sequence between any one of said nucleotide positions selected from:
9. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 772-801; b) 2424-2444; c) 3784-3805; d) 4123-4169; e) 4438-4509; and f) 4558-4621 8. The isolated oligonucleotide of claim 7, comprising a nucleotide sequence identical to a region comprising said sequence between any one of said nucleotide positions selected from:
10. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 4. The isolated oligonucleotide of claim 1, comprising a sequence substantially identical to a region comprising said sequence between any one of said nucleotide positions selected from:
11. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 8. The isolated oligonucleotide of claim 7, comprising a sequence that is at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% identical to a region comprising said sequence between any one of said nucleotide positions selected from:
12. the sense strand comprises a sequence from the 5' end of the human complement C3 mRNA sequence according to SEQ ID NO: 1: a) 588-608; b) 773-800; c) 2533-2585; d) 3778-3836; e) 4492-4512; and f) 4600-4625 8. The isolated oligonucleotide of claim 7, comprising a sequence identical to a region comprising said sequence between any one of said nucleotide positions selected from:
13. The isolated oligonucleotide of any one of claims 1 to 12, wherein the isolated oligonucleotide is capable of inducing degradation of the C3 mRNA.
14. The isolated oligonucleotide of any one of claims 1 to 13, wherein the sense strand is a single-stranded RNA molecule.
15. The isolated oligonucleotide of any one of claims 1 to 13, wherein the antisense strand is a single-stranded RNA molecule.
16. The isolated oligonucleotide of any one of claims 1 to 13, wherein both the sense strand and the antisense strand are single-stranded RNA molecules.
17. 17. The isolated oligonucleotide of claim 15 or 16, wherein the antisense strand comprises a 3' overhang.
18. 18. The isolated oligonucleotide of claim 17, wherein the 3' overhang comprises at least one nucleotide.
19. 20. The isolated oligonucleotide of claim 18, wherein the 3' overhang comprises two nucleotides.
20. 20. The isolated oligonucleotide of claim 19, wherein the 3' overhang comprises any one of thymidine-thymidine (dTdT), adenine-adenine (AA), cysteine-cysteine (CC), guanine-guanine (GG), or uracil-uracil (UU).
21. 21. The isolated oligonucleotide of any one of claims 1 to 20, wherein the sense strand comprises an RNA sequence at least 20 nucleotides in length.
22. 22. The isolated oligonucleotide of claim 21, wherein the sense strand comprises an RNA sequence 20 nucleotides in length.
23. 23. The isolated oligonucleotide of any one of claims 1 to 22, wherein the antisense strand comprises an RNA sequence of at least 22 nucleotides in length.
24. 24. The isolated oligonucleotide of claim 23, wherein the antisense strand comprises an RNA sequence 22 nucleotides in length.
25. 25. The isolated oligonucleotide of any one of claims 1 to 24, wherein the double-stranded region is 19 to 21 nucleotides in length.
26. 26. The isolated oligonucleotide of claim 25, wherein the double-stranded region is 20 nucleotides in length.
27. 27. The isolated oligonucleotide of any one of claims 1 to 26, wherein the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 2 to 31.
28. 25. The isolated oligonucleotide of any one of claims 1 to 24, wherein the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 32 to 61.
29. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UGUGUGUUGAUGCUGAGUUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5' AAACUCAGCAUCAACACACA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5' UCUAUCUUCAGGGUCAUCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5' CAGAUGACCCUGAAGAUAGA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5' UUUUUGUUCAUUCUGAUUCCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5' GGAAUCAGAAUGAACAAAA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UGAGUGUGAGACCUUGUCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5' UGGACAAGGUCUCAACACUCA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5' UCAGAGUGUGAGACCUUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5' GACAAGGUCUCAACACUCUGA 3'); or vi) The isolated oligonucleotide of claim 6, comprising the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5' UGUAGAACCGGGUACAGCUUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5' AAGCUGUACCCGGUUCUACA 3').
30. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UGAUGUAGUAGAAUUUCUCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' AGAGAAAUUCUACUACAUCA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5' UUUAUAGAUGUAGUAGAAUUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5' AAUUCUACUACAUCUAUAAA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5' UAAAAUAUAUUCAUGAGCUUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5' AAGCUCAUGAAUAUAUUUUUA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5' UAAGUCAAAGUCUUUUAGCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5' AGCUAAAGACUUUGACCUUA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5' UAAAGUCAAAGUCUUUUAGCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5' GCUAAAGACUUUGACCUUUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5' UAAUUUAUUACAGGUGAGUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5' AACUCACCUGUAAUAAAUUA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5' UCUGGUUUUAUGGUGACCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5' AAGGUCACCAUAAAACCAGA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5' UUAUUGGUGAACUUUGAAAGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5' CUUUCAAAGUUCACCAAUAA 3'); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5' UUAAUAGGCGUAGACCUUGACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5' UCAAGGUCUACGCCUAUUAA 3'); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5' UCAGAGCUUGUUCAGCUUUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5' GAAAGCUGAACAAGCUCUGA 3'); or xiii) The isolated oligonucleotide of claim 9, comprising the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5' UUAUGAAGCAAUUCUCCUCUCAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5' UGAGGAGAAUUGCUUCAUAA 3').
31. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UGAGAAGACAAGGAGUCCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5' CAGGACUCCUUGUCUUCUCA 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' UUAUAGAUGUAGUAGAAUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AAAUUCUACUACAUCUAUAA 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5' UAUGAAGAAGUCCUGCAUUACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5' UAAUGCAGGACUUCUUCAUA 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5' UUUCGAACAACAGAGUAGGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5' CCCUACUCUGUUGUUCGAAA 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5' UAAGUCUUUUAGCUGCAGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5' UACUGCAGCUAAAAGACUUA 3'); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5' UGUUCAUUGAGCCAACGCACGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5' GUGCGUUGGCUCAAUGAACA 3'); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5' UUUGUAAUAGGCGUAGACCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5' AGGUCUACGCCUAUUACAAA 3'); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCUCUCAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3'); or xi) The isolated oligonucleotide of claim 12, comprising the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3').
32. 32. The isolated oligonucleotide of any one of claims 1 to 31, wherein the isolated oligonucleotide attenuates C3 mRNA expression by at least 50% at a dose of 0.1 nM.
33. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5' UUUAUAGAUGUAGUAGAAUUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5' AAUUCUACUACAUCUAUAAA 3') (87.0); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3') (89.2); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3') (88.9); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5' UAAAGUCAAAGUCUUUUAGCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5' GCUAAAGACUUUGACCUUUA 3') (87.6); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3') (87.6); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5' UUUGUAAUAGGCGUAGACCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5' AGGUCUACGCCUAUUACAAA 3') (85.8); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5' UUAAUAGGCGUAGACCUUGACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5' UCAAGGUCUACGCCUAUUAA 3') (85.1); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UGAGUGUGAGACCUUGUCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5' UGGACAAGGUCUCAACACUCA 3') (84.2); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3') (84.0); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' UUAUAGAUGUAGUAGAAUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AAAUUCUACUACAUCUAUAA 3') (89.2); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5' UCAGAGUGUGAGACCUUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5' GACAAGGUCUCAACACUCUGA 3') (83.8); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UGAUGUAGUAGAAUUUCUCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' AGAGAAAUUCUACUACAUCA 3') (83.8); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5' UAAGUCAAAGUCUUUUAGCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5' AGCUAAAGACUUUGACCUUA 3') (83.0); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5' UCAGAGCUUGUUCAGCUUUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5' GAAAGCUGAACAAGCUCUGA 3') (82.8); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UGUGUGUUGAUGCUGAGUUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 40 (5' AAACUCAGCAUCAACACACA 3') (82.0); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UGAGAAGACAAGGAGUCCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5' CAGGACUCCUUGUCUUCUCA 3') (82.0); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5' UAAAAUAUAUUCAUGAGCUUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5' AAGCUCAUGAAUAUAUUUUUA 3') (81.9); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5' UUAUGAAGCAAUUCUCCUCAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5' UGAGGAGAAUUGCUUCAUAA 3') (81.8); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCUCUCAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3') (81.3); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5' UAUGAAGAAGUCCUGCAUUACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5' UAAUGCAGGACUUCUUCAUA 3') (81.2); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5' UUUCGAACAACAGAGUAGGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5' CCCUACUCUGUUGUUCGAAA 3') (81.1); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5' UGUUCAUUGAGCCAACGCACGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5' GUGCGUUGGCUCAAUGAACA 3') (80.8); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5' UAAUUUAUUACAGGUGAGUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5' AACUCACCUGUAAUAAAUUA 3') (80.8); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5' UUUUUGUUCAUUCUGAUUCCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5' GGAAUCAGAAUGAACAAAA 3') (80.5); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5' UCUGGUUUUAUGGUGACCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 51 (5' AAGGUCACCAUAAAACCAGA 3') (80.2); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3') (79.2); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5' UCUAUCUUCAGGGUCAUCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5' CAGAUGACCCUGAAGAUAGA 3') (78.9); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5' UAAGUCUUUUAGCUGCAGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5' UACUGCAGCUAAAAGACUUA 3') (78.8); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5' UUAUUGGUGAACUUUGAAAGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5' CUUUCAAAGUUCACCAAUAA 3') (78.6); or xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5' UGUAGAACCGGGUACAGCUUUC 3') and the sense strand (78.4) of the nucleic acid sequence according to SEQ ID NO: 57 (5' AAGCUGUACCCGGUUCUACA 3').
34. 32. The isolated oligonucleotide of any one of claims 1 to 31, wherein the isolated oligonucleotide attenuates C3 mRNA expression by 20% to 50% at a dose of 0.01 nM.
35. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 11 (5' UCUAUCUUCAGGGUCAUCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 41 (5' CAGAUGACCCUGAAGAUAGA 3') (47.9); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 24 (5' UUAUUGGUGAACUUUGAAAGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 54 (5' CUUUCAAAGUUCACCAAUAA 3') (46.7); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 31 (5' UUUUGUAUGAAGCAAUUCUCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 61 (5' GAGAAUUGCUUCAUACAAAA 3') (46.6); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 16 (5' UAAGUCUUUUAGCUGCAGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 46 (5' UACUGCAGCUAAAAGACUUA 3') (46.6); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 12 (5' UAAAAUAUAUUCAUGAGCUUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 42 (5' AAGCUCAUGAAUAUAUUUUUA 3') (45.7); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 15 (5' UUUUUGUUCAUUCUGAUUCCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 45 (5' GGAAUCAGAAUGAACAAAA 3') (45.7); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 13 (5' UAUGAAGAAGUCCUGCAUUACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 43 (5' UAAUGCAGGACUUCUUCAUA 3') (42.4); or viii) The isolated oligonucleotide of claim 34, comprising the antisense strand of the nucleic acid sequence according to SEQ ID NO: 10 (5' UGUGUGUUGAUGCUGAGUUUGG 3') and the sense strand (41.5) of the nucleic acid sequence according to SEQ ID NO: 40 (5' AAACUCAGCAUCAACACACA 3').
36. 32. The isolated oligonucleotide of any one of claims 1 to 31, wherein the isolated oligonucleotide attenuates C3 mRNA expression by at least 50% at a dose of 0.01 nM.
37. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 3 (5' UUAGUAGAAUUUCUCUGUAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 33 (5' CUACAGAGAAAUUCUACUAA 3') (71.3); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 29 (5' UAUGAAGCAAUUCUCUCUCAGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 59 (5' CUGAGGAGAAUUGCUUCAUA 3') (68.5); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 25 (5' UUAAUAGGCGUAGACCUUGACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 55 (5' UCAAGGUCUACGCCUAUUAA 3') (67.6); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 9 (5' UUUAUAGAUGUAGUAGAAUUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 39 (5' AAUUCUACUACAUCUAUAAA 3') (59.1); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 8 (5' UUAUAGAUGUAGUAGAAUUUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 38 (5' AAAUUCUACUACAUCUAUAA 3') (66.9); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 26 (5' UUUGUAAUAGGCGUAGACCUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 56 (5' AGGUCUACGCCUAUUACAAA 3') (66.8); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 5 (5' UAUGUAGUAGAAUUUCUCUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 35 (5' CAGAGAAAUUCUACUACAUA 3') (60.9); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 17 (5' UAAGUCAAAGUCUUUUAGCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 47 (5' AGCUAAAGACUUUGACCUUA 3') (59.4); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 7 (5' UAUAGAUGUAGUAGAAUUUCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 37 (5' GAAAUUCUACUACAUCUAUA 3') (59.1); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 18 (5' UAAAGUCAAAGUCUUUUAGCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 48 (5' GCUAAAGACUUUGACCUUUA 3') (58.9); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 4 (5' UGUAGUAGAAUUUCUCUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 34 (5' UACAGAGAAAUUCUACUACA 3') (57.2); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 28 (5' UCAGAGCUUGUUCAGCUUUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 58 (5' GAAAGCUGAACAAGCUCUGA 3') (56.8); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 22 (5' UGAGUGUGAGACCUUGUCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 52 (5' UGGACAAGGUCUCAACACUCA 3') (56.2); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 14 (5' UUUCGAACAACAGAGUAGGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 44 (5' CCCUACUCUGUUGUUCGAAA 3') (56.0); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 23 (5' UCAGAGUGUGAGACCUUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 53 (5' GACAAGGUCUCAACACUCUGA 3') (55.5); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 6 (5' UGAUGUAGUAGAAUUUCUCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 36 (5' AGAGAAAUUCUACUACAUCA 3') (55.3); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 19 (5' UGUUCAUUGAGCCAACGCACGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 49 (5' GUGCGUUGGCUCAAUGAACA 3') (53.4); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 20 (5' UAAUUUAUUACAGGUGAGUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 50 (5' AACUCACCUGUAAUAAAUUA 3') (53.4); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 30 (5' UUAUGAAGCAAUUCUCCUCAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 60 (5' UGAGGAGAAUUGCUUCAUAA 3') (52.9); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 2 (5' UGAGAAGACAAGGAGUCCUGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 32 (5' CAGGACUCCUUGUCUUCUCA 3') (50.9); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 27 (5' UGUAGAACCGGGUACAGCUUUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 57 (5' AAGCUGUACCCGGUUCUACA 3') (50.9); or xxii) The isolated oligonucleotide of claim 36, comprising the antisense strand of the nucleic acid sequence according to SEQ ID NO: 21 (5' UCUGGUUUUAUGGUGACCUUGA 3') and the sense strand of the nucleic acid sequence (50.9) according to SEQ ID NO: 51 (5' AAGGUCACCAUAAAACCAGA 3').
38. a sense strand and an antisense strand, wherein the sense strand is From the 5' end of the C3 mRNA sequence according to SEQ ID NO: 1, a) 33-53; b) 237-260; c) 444-480; d) 583-879; e) 1118-1328; f) 1409-1542; g) 1619-1648; h) 1754-1816; i) 2232-2256; j) 2300-2368; k) 2423-2452; l) 2518-2726; m) 2860-2883; n) 2981-3043; o) 3125-3239; p) 3298-3437; q) 3567-3638; r) 3767-3913; s) 3985-4430; and t) 4490-5054 and a nucleotide sequence substantially identical to a region comprising 19 to 25 nucleotides between any one of said nucleotide positions selected from An isolated oligonucleotide, wherein the antisense strand is substantially complementary to the sense strand, such that the sense strand and the antisense strand together form a double-stranded region.
39. 39. The isolated oligonucleotide of claim 38, wherein the isolated oligonucleotide attenuates C3 mRNA expression by 20% to 50% at a dose of 0.1 nM.
40. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 71 (5' UGUAGAUGGUCUUGUCUGUCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 236 (5' GACAGACAAGACCAUCUACA 3') (49.9); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 106 (5' UUGAUGCUCAAGGGCUUCUGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 271 (5' CAGAAGCCCUUGAGCAUCAA 3') (49.2); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 97 (5' UAAGAUGACAAAGGCAGUUCCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 262 (5' GAACUGCCUUUGUCAUCUUA 3') (49.1); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 168 (5' UCAAAGUCAAAGUCUUUUAGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 333 (5' CUAAAGACUUUGACCUUUGA 3') (49.1); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 115 (5' UGAAGGAAGGGAUGAAGUCGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 280 (5' CGACUUCAUCCCUUCCUUCCA 3') (48.8); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 173 (5' UCUUUUGGUAUUGAGCCAAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 338 (5' CUUGGCUCAAUACCAAAAGA 3') (48.2); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5' UUUCUGACUGGCCGCUUUUUAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5' AAAAAAGCGGCCAGUCAGAAA 3') (47.4); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5' UCACAAAGUCAAAGUCUUUUAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5' AAAAGACUUUGACCUUUGUGA 3') (47.1); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 66 (5' UGUUUUUUGCCUGGGAAGUCGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 231 (5' GACUUCCCAGGCAAAAAAACA 3') (46.5); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5' UUGAAGGCCAGCUGCUGGGUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 318 (5' ACCCAGCAGCUGGCCUUCAA 3') (46.3); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5' UCUGUUUCCGGUGCUGGUUUUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5' AAACCAGCACCGGAAACAGA 3') (45.6); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 103 (5' UUGUUGAUGCUGAGUUUGGCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 268 (5' GCCAAACUCAGCAUCAACAA 3') (45.1); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 225 (5' UGUCCAACCUGCACCUCAUCCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 390 (5' GAUGAGGUGCAGGUUGGACA 3') (44.5); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 117 (5' UAUCUUCAGGGUCAUCUGCUGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 282 (5' AGCAGAUGACCCUGAAGAUA 3') (44.5); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5' UCAUAGUAGGCUCGGAUCUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5' AAGAUCCGAGCCUACUAUGA 3') (44.4); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 133 (5' UGUUUCGAACAACAGAGUAGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 298 (5' CUACUCUGUUGUUCGAAACA 3') (43.9); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 107 (5' UCAGGUAAUUGUUGGAGUUGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 272 (5' CAACUCCAACAAUUACCUGA 3') (43.0); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5' UGUCUGUCUGGAUGAAGAGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5' CCUCUUCAUCCAGACAGACA 3') (42.6); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 222 (5' UGUACUCGUCAAAGUCAUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 387 (5' CAAUGACUUUGACGAGUACA 3') (42.5); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5' UGGAUUGUGGAGUAGUUCCACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5' UGGAACUACUCCAACAAUCCA 3') (41.8); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 158 (5' UGGAAGUCUCCUCCUGCUUUAGUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 323 (5' ACUAAAGCAGGAGACUUCCA 3') (40.3); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 83 (5' UUUUCAUAGUAGGCUCGGAUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 248 (5' AUCCGAGCCUACUAUGAAAA 3') (40.0); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 156 (5' UCAGGAUCAGCCAUUUAAAACAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 321 (5' UGUUAAAUGGCUGAUCCUGA 3') (39.9); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5' UCUUGUCCAGGUAGAUGAUGAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' CAUCAUCUACCUGGACAAGA 3') (39.4); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5' UGACAGUGCAGGGUCAGAGGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 227 (5' CCUCUGACCCUGCACUGUCA 3') (39.3); xxvi) the sense strand of the nucleic acid sequence according to SEQ ID NO: 202 (5' UCUAUCGGAGAAGGCUUUGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 367 (5' ACAAAGCCUUCUCCCGAUAGA 3') (39.2) xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5' UCUUCCACUGGCCCAUGUUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5' CAACAUGGGCCAGUGGAAGA 3') (39.2); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 174 (5' UGAUUCCCAGUGGAUACGGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 339 (5' ACCGUAUCCACUGGGAAUCA 3') (38.5); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 65 (5' UUUUUUUGCCUGGGAAGUCGUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 230 (5' CGACUUCCCAGGCAAAAAAA 3') (38.3); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5' UGGUUGUAAUAGGCGUAGACCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' GUCUACGCCUAUUACAACCA 3') (38.3); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5' UCUGCAGAAGGCUGGAUUGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5' ACAAUCCAGCCUUCUGCAGA 3') (37.4); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 91 (5' UCUCUGUAGGCUCCACUAUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 256 (5' CAUAGUGGAGCCUACAGAGA 3') (34.8); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 88 (5' UGAAACUGGGCAGCACGUACUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 253 (5' GUACGUGCUGCCCAGUUUCA 3') (34.5); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 165 (5' UCUGCAGUAGGGCCAAGAGGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 330 (5' CCUCUUGGCCCUACUGCAGA 3') (33.3); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5' UCUGGAUUGUGGAGUAGUUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 305 (5' GAACUACUCCACAAUCCAGA 3') (32.2); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 183 (5' UCUUUUCCUUCAGCUGUGACUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 348 (5' GUCACAGCUGAAGGAAAAGA 3') (32.0); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 179 (5' UCUGUGAAACCUCAUUUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 344 (5' GAAAUGAGGGUUUCACAGA 3') (31.6); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 127 (5' UCAUUACUGUGACCUCGAAGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 292 (5' CUUCGAGGUCACAGUAAUGA 3') (31.2); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 185 (5' UGAGGUCGAAUUUAUUACAGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 350 (5' CUGUAAUAAAUUCGACCUCA 3') (31.1); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 111 (5' UCAUUCGCAGGAGGAAGUUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 276 (5' CAACUUCCUCCUGCGAAUGA 3') (30.7); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 157 (5' UGUAUCACGGGCGCAUCCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 322 (5' GAGGAUGCGCCCGUGAUACA 3') (29.7); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 164 (5' UCAGCAAUGGCCACAGUGUAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 329 (5' UACACUGUGGCCAUUGCUGA 3') (28.3); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 90 (5' UCACUAUGACCUCGAAACUGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 255 (5' CAGUUUCGAGGUCAUAGUGA 3') (27.5); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5' UGUACUCCUUCACCUCAAACUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5' GUUUGAGGUGAAGGAGUACA 3') (26.9); xLv) The antisense strand of the nucleic acid sequence according to SEQ ID NO: 199 (5' UCUCAUACUUGGAGAUGUAUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 364 (5' AUACAUCUCCAAGUAUGAGA 3') (26.7) xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 184 (5' UCUUAGCAUGGUACAUUGUCAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 349 (5' GACAAUGUACCAUGCUAAGA 3') (26.3); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 400 (5' UUGUAGUUGCAGCAGUCCAGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 426 (5' CUGGACUGCUGCAACUACAA 3') (41.9); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 110 (5' UGAGGAAGUUGACGUUGAGGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 275 (5' CCUCAACGUCAACUUCCUCA 3') (23.4); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 147 (5' UGGCAUCCUCUGUCAUCUGGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 312 (5' CCAGAUGACAGAGGAUGCCA 3') (23.3); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 218 (5' UUUUUGUAUGAAGCAAUUCUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 383 (5' AGAAUUGCUUCAUACAAAA 3') (22.5); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5' UGAUUGUGGAGUAGUUCCACCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 303 (5' GUGGAACUACUCCACAAUCA 3') (22.5); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 114 (5' UGAUGAAGUCGGUGGUGAUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 279 (5' CAUCACCACCGACUUCAUCA 3') (21.4); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 85 (5' UCUCCUUCACCUCAAACUCAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 250 (5' UGAGUUUGAGGUGAAGGAGA 3') (21.3); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 152 (5' UCUUCUUGAUGAGCUCCAAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 317 (5' CUUGGAGCUCAUCAAGAAGA 3') (20.8); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 402 (5' UCUCAUCCAGGUUACUCCUGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 428 (5' CAGGAGUAACCUGGAUGAGA 3') (40.4); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 136 (5' UCUUGGUUCUGCCGGUAAUUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 301 (5' AAUUACCGGCAGAACCAAGA 3') (20.7); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 209 (5' UGACCUUGUCCAGGUAGAUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 374 (5' CAUCUACCUGGACAAGGUCA 3') (20.3); or Lviii) The isolated oligonucleotide of claim 39, comprising the antisense strand of the nucleic acid sequence according to SEQ ID NO: 412 (5' UCUCUGGGAACUCACUUCGGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 438 (5' CCGAAGUGAGUUCCCAGAGA 3').
41. 39. The isolated nucleotide of claim 38, wherein the isolated oligonucleotide attenuates C3 mRNA expression by at least 50% at a dose of 0.1 nM.
42. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 94 (5' UUAGAUGUAGUAGAAUUUCUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 259 (5' AGAAAUUCUACUACAUCUAA 3') (89.3); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5' UGACAAGGAGUCCUGCUUGACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5' UCAAGCAGGACUCCUUGUCA 3') (80.4); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5' UUAGAUGGUCUUGUCUGUCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5' AGACAGACAAGACCAUCUAA 3') (79.7); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5' UUUUUUGCCUGGGAAGUCGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5' ACGACUUCCCAGGCAAAAAA 3') (78.7); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5' UUAGUAUCUCUGUUCAUUGAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5' UCAAUGAACAGAGAUACUAA 3') (78.4); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5' UGUCAGUUGGGGCACCCAAAGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5' UUUGGGGUGCCCCCAACUGACA 3') (78.3); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5' UUUGUAUGAAGCAAUUCUCCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' GGAGAAUUGCUUCAUACAAA 3') (78.0); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5' UGAACAACAGAGUAGGGUAGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 296 (5' CUACCCUACUCUGUUGUUCA 3') (77.9); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5' UAUCAGGUAGGUGUAGUAGCGG 3') and SEQ ID NO: 278 (5' GCUACUACACCUACCUGAUA 3') (77.8); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5' UAUUACUGUGACCUCGAAGGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 291 (5' CCUUCGAGGUCACAGUAAUA 3') (77.6); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5' UGAAUUCUGGUCUCAGACUCGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5' GAGUCUGAGACCAGAAUUCA 3') (77.6); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5' UGUAUCUCUGUUCAUUGAGCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5' GCUCAAUGAACAGAGAUACA 3') (76.8); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5' UUUUCAAAAUAUAUAUUCAUGAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5' CAUGAAUAUAUUUUUUGAAAA 3') (76.6); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5' UAGUAGAAUUUCUCUGUAGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5' CCUACAGAGAAAUUCUACUA 3') (76.5); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5' UCUUUCAAAAUAUAUAUUCAUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5' AUGAAUAUAUUUUUGAAAGA 3') (76.1); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5' UCAUACUUGGAGAUGUAUCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5' AGAUACAUCUCCAAGUAUGA 3') (76.0); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5' UAAUUCUGGUCUCAGACUCGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 310 (5' CGAGUCUGAGACCAGAAUUA 3') (75.5); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5' UGUUUUAUGGUGACCUUGAGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5' CUCAAGGUCACCAUAAAACA 3') (75.5); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5' UCUGUCUGGAUGAAGAGGUACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5' UACCUCUUCAUCCAGACAGA 3') (75.1); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5' UUGUAGAUGGUCUUGUCUGUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5' ACAGACAAGACCAUCUACAA 3') (75.0); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5' UAAGGAAGUCUCUCUGCUUUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 324 (5' UAAAGCAGGAGACUUCCUUA 3') (74.7); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5' UUUCCUUCAGCUGUGACUGUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5' ACAGUCACAGCUGAAGGAAA 3') (74.6); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5' UGAGAUGCAGGUAAUUGUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5' CAACAAUUACCUGCAUCUCA 3') (74.6); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5' UAGAUGACAAAGGCAGUUCCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5' GGAACUGCCUUUGUCAUCUA 3') (74.0); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5' UGAAGAAGUCCUGCAUUACUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5' AGUAAUGCAGGACUUCUUCA 3') (72.9); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5' UUACUUGGAGAUGUAUCUGUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5' ACAGAUACAUCUCCAAGUAA 3') (72.5); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5' UUUCAAAAUAUAUUCAUGAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5' UCAUGAAUAUAUUUUUUGAAA 3') (72.4); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5' UUUCAUGUAGUUGGCUUCAAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5' UUGAAGCCAACUACAUGAAA 3') (72.2); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5' UAUCUCUGUAGGUUCAUGUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5' UACAUGAACCUACAGAGAUA 3') (71.9); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5' UGUGUUGAUGCUGAGUUUGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5' CCAAACUCAGCAUCAACACA 3') (71.7); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5' UCUUUGUCCAGCUCAUACUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366 (5' AAGUAUGAGCUGGACAAAGA 3') (71.3); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5' UUUUUGCCUGGGAAGUCGUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5' CACGACUUCCCAGGCAAAA 3') (71.1); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5' UCAUUUUCCUUGGUCUCUUCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5' GAAGAGACCAAGGAAAAUGA 3') (71.0); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5' UUUCCUAUCGGAGAAGGCUUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5' AAGCCUUCUCCGAUAGGAAA 3'); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5' UGAAGCAAUUCUCCUCAGCACA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 381 (5' UGCUGAGGAGAAUUGCUUCA 3'); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5' UGUACACAUAGUCCACUCCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' AGGAGUGGACUAUGUGUACA 3'); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5' UUAUCUUCAGGGUCAUCUGCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5' GCAGAUGACCCUGAAGAUAA 3'); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5' UUAGACAUAGUGGCAUCCUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5' CAGGAUGCCACUAUGUCUAA 3'); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5' UUACACAUAGUCCACUCCUGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' CAGGAGUGGACUAUGUGUAA 3'); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5' UGUCUUGGUGAAGUGGAUCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 264 (5' AGAUCCACUUCACCAAGACA 3'); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5' UAAGACCUUGACCACGUAGGCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 319 (5' CCUACGUGGGUCAAGGUCUUA 3'); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5' UAGUAUCUCUGUUCAUUGAGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5' CUCAAUGAACAGAGAUACUA 3'); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5' UCAGUCAUCAUGGAUAUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5' GACAUAUCCAUGAUGACUGA 3'); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5' UGUGUAGAUGGUCUUGUCUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 238 (5' CAGACAAGACCAUCUACACA 3'); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5' UUUCAGCUGUGACUGUGAAAACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5' UUUCACAGUCACAGCUGAAA 3'). xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 92 (5' UUUCUCUGUAGGCUCCACUAUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 257 (5' UAGUGGAGCCUACAGAGAAA 3'); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5' UAAGACAAGGAGUCCUGCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5' AAGCAGGACUCCUUGUCUUA 3'); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5' UGUAGUUCCACCCUCACCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 302 (5' AAGGUGAGGGUGGAACCUACA 3'); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5' UCUAUGACCUCGAAACUGGGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5' CCCAGUUUCGAGGUCAUAGA 3'); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5' UGAUGAAGAAGUCCUGCAUUAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5' AAUGCAGGACUUCUUCAUCA 3'); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5' UUUGUCUGUCUGGAUGAAGAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5' UCUUCAUCCAGACAGACAAA 3'); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5' UUUUUCCUUGGUCUCUUCUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 341 (5' CAGAAGAGACCAAGGAAAA 3'); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5' UGAGGUCAAAGGGCAUUCCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5' AGGAAUGCCCUUUGACCUCA 3'); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5' UUUCAUAGUAGGCUCGGAUCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5' GAUCCGAGCCUACUAUGAAA 3'); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5' UGUAAUAGGCGUAGACCUUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' CAAGGUCUACGCCUAUUACA 3'); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5' UAUCAUAGUGUUCUUGGCAUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356 (5' AUGCCAAGAACACUAUGAUA 3'); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5' UUGUAGGUUCAUGUAGUUGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 326 (5' CCAACUACAUGAACCUACAA 3'); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5' UGUGUAGUAGCGGAUCUUGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5' CCAAGAUCCGCUACUACACA 3'); Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5' UUUCUUGAUGAGCUCCAAGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5' CCUUGGAGCUCAUCAAGAAA 3'); Lx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5' UGUUGUAAUAGGCGUAGACCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5' GGUCUACGCCUAUUACAACA 3'); Lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5' UGAUGAUGAGGGUGUUCCUAUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' UAGGAACACCCUCAUCAUCA 3'); Lxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 155 (5' UGAGAGAAGACCUUGACCACGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 320 (5' GUGGUCAAGGUCUUCUCUCUCA 3'); Lxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5' UUUGUUCAUUCUGAUUCCUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 308 (5' AAGGAAUCAGAAUGAACAAA 3'); Lxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 193 (5' UCAAGGAUCAUAGUGUUCUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 358 (5' AAGAACACUAUGAUCCUUGA 3'); Lxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5' UCAGUGUAGGAUCUCUGUAGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 328 (5' CUACAGAGAUCCUACACUGA 3'); Lxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5' UUUCAUCCAGGUAAUGCACAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 314 (5' UGUGCAUUACCUGGAUGAAA 3'); Lxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5' UUUUGUCCAGCUCAUACUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5' CAAGUAUGAGCUGGACAAAA 3'); Lxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5' UCUCAGAGUGUGAGACCUUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5' CAAGGUCUCACACUCUGAGA 3'); Lxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5' UUGUUCAGCUUUCCAUCCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 380 (5' GAGGAUGGAAAGCUGAACAA 3'); Lxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 98 (5' UCUUGGUGAAGUGGAUCUGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 263 (5' CCAGAUCCACUUCACCAAGA 3'); Lxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5' UUUUUCCUUCAGCUGUGACUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5' AGUCACAGCUGAAGGAAAA 3'); Lxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 150 (5' UGUUUCAUCCAGGUAAUGCACA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 315 (5' UGCAUUACCUGGAUGAAACA 3'); Lxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5' UAUGAUGUACUCGUCAAAGUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5' ACUUUGACGAGUACAUCAUA 3'); Lxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 177 (5' UAUUUUCCUUGGUCUCUUCUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 342 (5' AGAAGAGACCAAGGAAAAUA 3'); Lxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5' UGAAGUCCUGCAUUACUGUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5' CACAGUAAUGCAGGACUUCA 3'); Lxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 224 (5' UCUCAUCCGAGCCUGACCUUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 389 (5' CAAGUCAGGCUCGGAUGAGA 3'); Lxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5' UAUGAUGAGGGUGUUCCUAUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' AUAGGAACACCCUCAUCAUA 3'); Lxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5' UUUUAUGGUGACCUUGAGGUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5' ACCUCAAGGUCACCAUAAAA 3'); Lxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 77 (5'UGACGAGUUCCGGAAUGUCCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 242 (5'GGACAUUCCGGAACUCGUCA 3'); Lxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5' UAUACUUGGAGAUGUAUCUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5' CAGAUACAUCUCCAAGUAUA 3'); Lxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5' UGUUAUAGAUGUAGUAGAAUUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5' AUUCUACUACAUCUAUAACA 3'); Lxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5' UUUGACGAGUUCCGGAAUGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5' ACAUUCCGGAACUCGUCAAA 3'); Lxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5' UAACACCAUGAGGUCAAAGGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5' CCUUUGACCUCAUGGUGUUA 3'); Lxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5' UGUUGACGAGUUCCGGAAUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5' CAUUCCGGAACUCGUCAACA 3'); Lxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 221 (5' UGUCUUGUACACAUAGUCCACU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 386 (5' UGGACUAUGUGUACAAGACA 3'); Lxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 167 (5' UGUCUUUUAGCUGCAGUAGGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 332 (5' CCUACUGCAGCUAAAAGACA 3'); Lxxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 84 (5' UCAAACUCAGUGGAGAAGACCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 249 (5' GUCUUCUCCACUGAGUUUGA 3'); Lxxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5' UGUUUUGUUCAUUCUGAUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 309 (5' GAAUCAGAAUGAACAAAACA 3'); Lxxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5' UUCUUUUAGCUGCAGUAGGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5' CCCUACUGCAGCUAAAAGAA 3') (54.9); xc) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 76 (5' UUUCUGAGAAGACAAGGAGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 241 (5' ACUCCUUGUCUUCUCAGAAA 3') (54.9); xci) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5' UGUGUUCCUAUCGGAGAAGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5' CCUUCUCCGAUAGGAACACA 3') (54.9); xcii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5' UCAUCCUCAGAGUGUGAGACCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' GUCUCACACUCUGAGGAUGA 3') (54.7); xciii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 132 (5' UUUUCGAACAACAGAGUAGGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 297 (5' CCUACUCUGUUGUUCGAAAA 3') (54.3); xciv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5' UGGAUGGUUACGGUCUGCUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 307 (5' CAGCAGACCGUAACCAUCCA 3') (53.9); xcv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 148 (5' UCAGGUAAUGCACAGCGAUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 313 (5' CAUCGCUGUGCAUUACCUGA 3') (53.9); xcvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5' UGUAGAUGAUGAGAGGGUGUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' GAACACCCUCAUCAUCUACA 3') (53.5); xcvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5' UUACUCCUUCACCUCAAACUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5' AGUUUGAGGUGAAGGAGUAA 3') (53.2); xcviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 192 (5' UAAGGAUCAUAGUGUUCUUGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 357 (5' CAAGAACACUAUGAUCCUUA 3') (52.6); xcix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5' UCAGAUUCCCAGUGGAUACGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 340 (5' CGUAUCCACUGGGAAUCUGA 3') (52.4); c) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5' UUUUUAUGGUGACCUUGAGGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5' CCUCAAGGUCACCAUAAAA 3') (52.4); ci) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 109 (5' UCUGAGAGAUGCAGGUAAUUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 274 (5' AAUUACCUGCAUCUCUCAGA 3') (52.2); cii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 102 (5' UGACUCGGUAGGCUGGAGAGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 267 (5' CUCUCCAGCCUACCGAGUCA 3') (51.9). ciii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 121 (5' UCAAAAUAUAUUCAUGAGCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 286 (5' GCUCAUGAAUAUAUUUUUGA 3') (51.8); civ) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 134 (5' UGAUUUCCACCUGCUCGUUUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 299 (5' AAACGAGCAGGUGGAAAUCA 3') (51.4); cv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 135 (5' UUUGGUUCUGCCGGUAAUUGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 300 (5' CAAUUACCGGCAGAACCAAA 3') (51.0); cvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 105 (5' UGAUGCUCAAGGGCUUCUGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 270 (5' CCAGAAGCCCUUGAGCAUCA 3') (50.7); cvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 125 (5' UGUCUUUCAAAAUAUAUUCAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 290 (5' GAAUAUAUUUUUGAAAGACA 3') (50.3); cviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 190 (5' UGUGUUCUUGGCAUCCUGAGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 355 (5' CUCAGGAUGCCAAGAACACA 3') (50.2); cix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5' UAUGUAGUUGCAGCAGUCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 284 (5' UGGACUGCUGCAACUACAUA 3') (70.4); cx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5' UGUGAUGUAGUUGCAGCAGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5' ACUGCUGCAACUACAUCACA 3') (67.2); or cxi) The isolated oligonucleotide of claim 41, comprising the antisense strand of the nucleic acid sequence according to SEQ ID NO: 394 (5' UAAAUAUAUUCAUGAGCUUCGU 3') and the sense strand (50.6) of the nucleic acid sequence according to SEQ ID NO: 420 (5' GAAGCUCAUGAAUAUAUUUUA 3').
43. 43. The isolated oligonucleotide of any one of claims 38 to 42, wherein the isolated oligonucleotide attenuates the expression of the C3 mRNA by 20% to 50% at a dose of 0.01 nM.
44. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 96 (5' UAGAUGACAAAGGCAGUUCCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 261 (5' GGAACUGCCUUUGUCAUCUA 3') (45.5); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 217 (5' UUUGUAUGAAGCAAUUCUCCUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 382 (5' GGAGAAUUGCUUCAUACAAA 3') (45.3); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 70 (5' UUAGAUGGUCUUGUCUGUCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 235 (5' AGACAGACAAGACCAUCUAA 3') (44.9); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 198 (5' UCAUACUUGGAGAUGUAUCUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 363 (5' AGAUACAUCUCCAAGUAUGA 3') (44.7); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 113 (5' UAUCAGGUAGGUGUAGUAGCGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 278 (5' GCUACUACACCUACCUGAUA 3') (42.9); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 126 (5' UAUUACUGUGACCUCGAAGGGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 291 (5' CCUUCGAGGUCACAGUAAUA 3') (42.3); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 170 (5' UGUAUCUCUGUUCAUUGAGCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 335 (5' GCUCAAUGAACAGAGAUACA 3') (42.0); viii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 123 (5' UUUUCAAAAUAUAUAUUCAUGAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 288 (5' CAUGAAUAUAUUUUUUGAAAA 3') (41.7); ix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 226 (5' UGUCAGUUGGGGCACCCAAAGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 391 (5' UUUGGGGUGCCCCCAACUGACA 3') (41.5); x) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 67 (5' UCUGUCUGGAUGAAGAGGUACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 232 (5' UACCUCUUCAUCCAGACAGA 3') (41.1); xi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 172 (5' UUAGUAUCUCUGUUCAUUGAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 337 (5' UCAAUGAACAGAGAUACUAA 3') (41.0); xii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 74 (5' UGACAAGGAGUCCUGCUUGACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 239 (5' UCAAGCAGGACUCCUUGUCA 3') (40.6); xiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 64 (5' UUUUUUGCCUGGGAAGUCGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 229 (5' ACGACUUCCCAGGCAAAAAA 3') (39.5); xiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 181 (5' UUUCCUUCAGCUGUGACUGUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 346 (5' ACAGUCACAGCUGAAGGAAA 3') (39.2); xv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 131 (5' UGAACAACAGAGUAGGGUAGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 296 (5' CUACCCUACUCUGUUGUUCA 3') (39.1); xvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 196 (5' UUACUUGGAGAUGUAUCUGUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 361 (5' ACAGAUACAUCUCCAAGUAA 3') (38.8); xvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 129 (5' UGAAGAAGUCCUGCAUUACUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 294 (5' AGUAAUGCAGGACUUCUUCA 3'); xviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 212 (5' UGUAAUAGGCGUAGACCUUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 377 (5' CAAGGUCUACGCCUAUUACA 3') (37.7); xix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 93 (5' UAGUAGAAUUUCUCUGUAGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 258 (5' CCUACAGAGAAAUUCUACUA 3') (37.2); xx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 194 (5' UUAGACAUAGUGGCAUCCUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 359 (5' CAGGAUGCCACUAUGUCUAA 3') (37.1); xxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 154 (5' UAAGACCUUGACCACGUAGGCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 319 (5' CCUACGUGGGUCAAGGUCUUA 3') (36.6); xxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 108 (5' UGAGAUGCAGGUAAUUGUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 273 (5' CAACAAUUACCUGCAUCUCA 3'); xxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 72 (5' UUGUAGAUGGUCUUGUCUGUCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 237 (5' ACAGACAAGACCAUCUACAA 3'); xxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 78 (5' UUUGACGAGUUCCGGAAUGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 243 (5' ACAUUCCGGAACUCGUCAAA 3') (36.3); xxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 211 (5' UCAUCCUCAGAGUGUGAGACCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 376 (5' GUCUCACACUCUGAGGAUGA 3') (35.6); xxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 188 (5' UGUUUUAUGGUGACCUUGAGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 353 (5' CUCAAGGUCACCAUAAAACA 3') (35.6); xxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 124 (5' UCUUUCAAAAUAUAUAUUCAUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 289 (5' AUGAAUAUAUUUUUGAAAGA 3') (35.5); xxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 159 (5' UAAGGAAGUCUCUCUGCUUUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 324 (5' UAAAGCAGGAGACUUCCUUA 3') (35.5); xxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 208 (5' UCUUGUCCAGGUAGAUGAUGAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 373 (5' CAUCAUCUACCUGGACAAGA 3') (33.9); xxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 137 (5' UGUAGUUCCACCCUCACCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 302 (5' AAGGUGAGGGUGGAACUACA 3') (33.6); xxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 122 (5' UUUCAAAAUAUAUAUUCAUGAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 287 (5' UCAUGAAUAUAUUUUUUGAAA 3') (33.4); xxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 63 (5' UUUUUGCCUGGGAAGUCGUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 228 (5' CACGACUUCCCAGGCAAAA 3') (33.2); xxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 219 (5' UUACACAUAGUCCACUCCUGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 384 (5' CAGGAGUGGACUAUGUGUAA 3') (32.9); xxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 195 (5' UCAGUCAUCAUGGAUAUGUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 360 (5' GACAUAUCCAUGAUGACUGA 3') (32.5); xxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 95 (5' UGUUAUAGAUGUAGUAGAAUUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 260 (5' AUUCUACUACAUCUAUAACA 3') (32.3); xxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 146 (5' UGAAUUCUGGUCUCAGACUCGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 311 (5' GAGUCUGAGACCAGAAUUCA 3') (32.2); xxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 220 (5' UGUACACAUAGUCCACUCCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 385 (5' AGGAGUGGACUAUGUGUACA 3') (32.1); xxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 151 (5' UUUCUUGAUGAGCUCCAAGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 316 (5' CCUUGGAGCUCAUCAAGAAA 3') (31.9); xxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 118 (5' UUAUCUUCAGGGUCAUCUGCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 283 (5' GCAGAUGACCCUGAAGAUAA 3') (31.9); xL) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 180 (5' UUUCAGCUGUGACUGUGAAAACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 345 (5' UUUCACAGUCACAGCUGAAA 3') (31.8); xLi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 210 (5' UCUCAGAGUGUGAGACCUUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 375 (5' CAAGGUCUCACACUCUGAGA 3') (31.7); xLii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 187 (5' UUUUUAUGGUGACCUUGAGGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 352 (5' CCUCAAGGUCACCAUAAAA 3') (31.7); xLiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 162 (5' UAUCUCUGUAGGUUCAUGUAGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 327 (5' UACAUGAACCUACAGAGAUA 3') (31.3); xLiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 145 (5' UAAUUCUGGUCUCAGACUCGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 310 (5' CGAGUCUGAGACCAGAAUUA 3') (30.9); xLv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 201 (5' UCUUUGUCCAGCUCAUACUUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 366 (5' AAGUAUGAGCUGGACAAAGA 3') (30.3); xLvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 81 (5' UCAUAGUAGGCUCGGAUCUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 246 (5' AAGAUCCGAGCCUACUAUGA 3') (29.9); xLvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 206 (5' UGAUGAUGAGGGUGUUCCUAUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 371 (5' UAGGAACACCCUCAUCAUCA 3') (29.7); xLviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 215 (5' UUGUUCAGCUUUCCAUCCUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 380 (5' GAGGAUGGAAAGCUGAACAA 3') (29.5); xLix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 213 (5' UGUUGUAAUAGGCGUAGACCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 378 (5' GGUCUACGCCUAUUACAACA 3') (29.3); L) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 189 (5' UCUGUUUCCGGUGCUGGUUUUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 354 (5' AAACCAGCACCGGAAACAGA 3') (28.9); Li) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 207 (5' UGUAGAUGAUGAGAGGGUGUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 372 (5' GAACACCCUCAUCAUCUACA 3') (28.3); Lii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 139 (5' UGGAUUGUGGAGUAGUUCCACC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 304 (5' UGGAACUACUCCAACAAUCCA 3') (27.5); Liii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 143 (5' UUUGUUCAUUCUGAUUCCUUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 308 (5' AAGGAAUCAGAAUGAACAAA 3') (27.4); Liv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 178 (5' UCAUUUUCCUUGGUCUCUUCUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 343 (5' GAAGAGACCAAGGAAAAUGA 3') (27.4); Lv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 128 (5' UGAAGUCCUGCAUUACUGUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 293 (5' CACAGUAAUGCAGGACUUCA 3') (27.3); Lvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 160 (5' UUUCAUGUAGUUGGCUUCAAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 325 (5' UUGAAGCCAACUACAUGAAA 3') (27.3); Lvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 176 (5' UUUUUCCUUGGUCUCUUCUGAU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 341 (5' CAGAAGAGACCAAGGAAAA 3') (27.2); Lviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 80 (5' UCUUCCACUGGCCCAUGUUGAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 245 (5' CAACAUGGGCCAGUGGAAGA 3') (27.0); Lix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 203 (5' UUUCCUAUCGGAGAAGGCUUUG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 368 (5' AAGCCUUCUCCGAUAGGAAA 3') (26.9); Lx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 87 (5' UGUACUCCUUCACCUCAAACUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 252 (5' GUUUGAGGUGAAGGAGUACA 3') (26.3); Lxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 104 (5' UGUGUUGAUGCUGAGUUUGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 269 (5' CCAAACUCAGCAUCAACACA 3') (26.1); Lxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 69 (5' UUUGUCUGUCUGGAUGAAGAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 234 (5' UCUUCAUCCAGACAGACAAA 3') (25.9); Lxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 197 (5' UAUACUUGGAGAUGUAUCUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 362 (5' CAGAUACAUCUCCAAGUAUA 3') (25.9); Lxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 223 (5' UAUGAUGUACUCGUCAAAGUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 388 (5' ACUUUGACGAGUACAUCAUA 3') (25.8); Lxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 142 (5' UGGAUGGUUACGGUCUGCUGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 307 (5' CAGCAGACCGUAACCAUCCA 3') (25.5); Lxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 138 (5' UGAUUGUGGAGUAGUUCCACCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 303 (5' GUGGAACUACUCCACAAUCA 3') (25.4); Lxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 75 (5' UAAGACAAGGAGUCCUGCUUGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 240 (5' AAGCAGGACUCCUUGUCUUA 3') (25.2); Lxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 163 (5' UCAGUGUAGGAUCUCUGUAGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 328 (5' CUACAGAGAUCCUACACUGA 3') (24.6); Lxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 116 (5' UUUCUGACUGGCCGCUUUUUAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 281 (5' AAAAAAGCGGCCAGUCAGAAA 3') (24.6); Lxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 112 (5' UGUGUAGUAGCGGAUCUUGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 277 (5' CCAAGAUCCGCUACUACACA 3') (24.4); Lxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 204 (5' UGUGUUCCUAUCGGAGAAGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 369 (5' CCUUCUCCGAUAGGAACACA 3') (24.4); Lxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 169 (5' UCACAAAGUCAAAGUCUUUUAG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 334 (5' AAAAGACUUUGACUUUGUGA 3') (24.4); Lxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 99 (5' UGUCUUGGUGAAGUGGAUCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 264 (5' AGAUCCACUUCACCAAGACA 3') (24.4); Lxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 140 (5' UCUGGAUUGUGGAGUAGUUCCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 305 (5' GAACUACUCCAACAAUCCAGA 3') (24.4); Lxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 130 (5' UGAUGAAGAAGUCCUGCAUUAC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 295 (5' AAUGCAGGACUUCUUCAUCA 3') (24.3); Lxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 68 (5' UGUCUGUCUGGAUGAAGAGGUA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 233 (5' CCUCUUCAUCCAGACAGACA 3') (24.2); Lxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 73 (5' UGUGUAGAUGGUCUUGUCUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 238 (5' CAGACAAGACCAUCUACACA 3') (23.9); Lxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 100 (5' UGAGGUCAAAGGGCAUUCCUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 265 (5' AGGAAUGCCCUUUGACCUCA 3') (23.9); Lxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 205 (5' UAUGAUGAGGGUGUUCCUAUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 370 (5' AUAGGAACACCCUCAUCAUA 3') (23.9); Lxxx) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 119 (5' UAUGUAGUUGCAGCAGUCCAGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 284 (5' UGGACUGCUGCAACUACAUA 3') (23.8); Lxxxi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 82 (5' UUUCAUAGUAGGCUCGGAUCUU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 247 (5' GAUCCGAGCCUACUAUGAAA 3') (23.5); Lxxxii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 79 (5' UGUUGACGAGUUCCGGAAUGUC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 244 (5' CAUUCCGGAACUCGUCAACA 3') (23.2); Lxxxiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 171 (5' UAGUAUCUCUGUUCAUUGAGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 336 (5' CUCAAUGAACAGAGAUACUA 3') (23.1); Lxxxiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 182 (5' UUUUUCCUUCAGCUGUGACUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 347 (5' AGUCACAGCUGAAGGAAAA 3') (23.1); Lxxxv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 153 (5' UUGAAGGCCAGCUGCUGGGUGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 318 (5' ACCCAGCAGCUGGCCUUCAA 3') (22.9); Lxxxvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 186 (5' UUUUAUGGUGACCUUGAGGUCG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 351 (5' ACCUCAAGGUCACCAUAAAA 3') (22.9); Lxxxvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 191 (5' UAUCAUAGUGUUCUUGGCAUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 356 (5' AUGCCAAGAACACUAUGAUA 3') (22.4); Lxxxviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 141 (5' UCUGCAGAAGGCUGGAUUGUGG 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 306 (5' ACAAUCCAGCCUUCUGCAGA 3') (21.7); Lxxxix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 144 (5' UGUUUUGUUCAUUCUGAUUCCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 309 (5' GAAUCAGAAUGAACAAAACA 3') (21.5); XC) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 200 (5' UUUUGUCCAGCUCAUACUUGGA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 365 (5' CAAGUAUGAGCUGGACAAAA 3') (21.1); XCi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 89 (5' UCUAUGACCUCGAAACUGGGCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 254 (5' CCCAGUUUCGAGGUCAUAGA 3') (20.8); XCii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 120 (5' UGUGAUGUAGUUGCAGCAGUCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 285 (5' ACUGCUGCAACUACAUCACA 3') (20.8); XCiii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 86 (5' UUACUCCUUCACCUCAAACUCA 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 251 (5' AGUUUGAGGUGAAGGAGUAA 3') (20.8); XCiv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 166 (5' UUCUUUUAGCUGCAGUAGGGCC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 331 (5' CCCUACUGCAGCUAAAAGAA 3') (20.6); XCv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 101 (5' UAACACCAUGAGGUCAAAGGGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 266 (5' CCUUUGACCUCAUGGUGUUA 3') (20.6); XCvi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 161 (5' UUGUAGGUUCAUGUAGUUGGCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 326 (5' CCAACUACAUGAACCUACAA 3') (20.4); XCvii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 175 (5' UCAGAUUCCCAGUGGAUACGGU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 340 (5' CGUAUCCACUGGGAAUCUGA 3') (20.3); XCviii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 149 (5' UUUCAUCCAGGUAAUGCACAGC 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 314 (5' UGUGCAUUACCUGGAUGAAA 3') (20.2); XCix) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 214 (5' UGGUUGUAAUAGGCGUAGACCU 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 379 (5' GUCUACGCCUAUUACAACCA 3') (20.2); or C) The isolated oligonucleotide of claim 43, comprising the antisense strand of the nucleic acid sequence according to SEQ ID NO: 62 (5' UGACAGUGCAGGGUCAGAGGGA 3') and the sense strand (19.9) of the nucleic acid sequence according to SEQ ID NO: 227 (5' CCUCUGACCCUGCACUGUCA 3').
45. 43. The isolated oligonucleotide of any one of claims 38 to 42, wherein the isolated oligonucleotide attenuates C3 mRNA expression by at least 50% at a dose of 0.01 nM.
46. the double-stranded region i) an antisense strand according to SEQ ID NO: 94 (5' UUAGAUGUAGUAGAAUUUCUCU 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 259 (5' AGAAAUUCUACUACAUCUAA 3') (79.3); or ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 216 (5' UGAAGCAAUUCUCUCUCAGCACA 3') and the sense strand (51.6) of the nucleic acid sequence according to SEQ ID NO: 381 (5' UGCUGAGGAGAGAAUUGCUUCA 3').
47. 47. The isolated oligonucleotide of any one of claims 1 to 46, wherein the sense strand or the antisense strand or both comprise one or more modified nucleotide sequences.
48. 48. The isolated oligonucleotide of claim 47, wherein the antisense strand comprises a monomethyl-protected phosphate mimic (5'-MeEP).
49. 49. The isolated oligonucleotide of any one of claims 1 to 48, wherein a terminal or internal nucleotide in the sense strand or the antisense strand or both is linked to a targeting ligand.
50. 50. The isolated oligonucleotide of claim 49, wherein the targeting ligand comprises at least one GalNAc Glb moiety.
51. The antisense strand has the formula: 3' (M) 0 (F) 0 (M) 6 (F) 1 (M) 1 (F) 1 (M) 3 (F) 1 (M) 2 (F) 1 (M) 1 (F) 1 (M) 1 (F) 2 (M) 1 51. The isolated oligonucleotide of any one of claims 1 to 50, comprising nucleotides modified with 2'-F modifications and nucleotides modified with 2'-O-methyl modifications by 5'.
52. The sense strand has the formula: 5' (M) 0 (F) 0 (M) 5 (F) 1 (M) 1 (F) 4 (M) 9 52. The isolated oligonucleotide of any one of claims 1 to 51, comprising nucleotides modified with 2'-F modifications and nucleotides modified with 2'-O-methyl modifications by 3'.
53. The antisense strand is i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 451 (5' [mUs] [fUs] [fA] [mG] [fU] [mA] [fG] [mA] [mA] [fU] [mU] [mU] [mC] [fU] [mC] [fU] [mG] [mU] [mA] [mGs] [mGs] [mC] 3'); ii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 452 (5' [mUs] [fGs] [fU] [mA] [fG] [mU] [fA] [mG] [mA] [fA] [mU] [mU] [mU] [fC] [mU] [fC] [mU] [mG] [mU] [mAs] [mGs] [mG] 3'); iii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 453 (5' [mUs] [fAs] [fU] [mG] [fU] [mA] [fG] [mU] [mA] [fG] [mA] [mA] [mU] [fU] [mU] [fC] [mU] [mC] [mU] [mGs] [mUs] [mA] 3'); iv) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 454 (5' [mUs] [fAs] [fU] [mA] [fG] [mA] [fU] [mG] [mU] [fA] [mG] [mU] [mA] [fG] [mA] [fA] [mU] [mU] [mU] [mCs] [mUs] [mC] 3'); v) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 455 (5' [mUs] [fAs] [fU] [mG] [fA] [mA] [fG] [mC] [mA] [fA] [mU] [mU] [mC] [fU] [mC] [fC] [mU] [mC] [mA] [mGs] [mCs] [mA] 3'); vi) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 456 (5' [mUs] [fUs] [fU] [mU] [fG] [mU] [fA] [mU] [mG] [fA] [mA] [mG] [mC] [fA] [mA] [fU] [mU] [mC] [mU] [mCs] [mCs] [mU] 3'); vii) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 457 (5' [MeEPmUs] [fUs] [fA] [mG] [fU] [mA] [fG] [mA] [mA] [fU] [mU] [mU] [mC] [fU] [mC] [fU] [mG] [mU] [mA] [mGs] [mGs] [mC] 3'); viii) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 458 (5'[MeEPmUs][fGs][fU][mA][fG][mU][fA][mG][mA][fA][mU][mU][mU][fC][mU][fC][mU][mG][mU][mAs][mGs][mG]3'); or ix) comprising any one of the antisense strands of a nucleic acid sequence according to SEQ ID NO: 459 (5'[MeEPmUs][fAs][fU][mG][fU][mA][fG][mU][mA][fG][mA][mA][mU][fU][mU][fC][mU][mC][mU][mGs][mU][mA] 3'); 53. The isolated oligonucleotide of any one of claims 1 to 52, wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "MeEP" is a monomethyl protected phosphate mimic.
54. the sense strand is the sense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5' [mCs] [mUs] [mA] [mC] [mA] [fG] [mA] [fG] [fA] [fA] [mU] [mU] [mC] [mU] [mA] [mC] [mUs] [mAs] [mA] [G1b] [G1b] [G1b] 3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 445 (5' [mUs] [mAs] [mC] [mA] [mG] [fA] [mG] [fA] [fA] [fA] [fU] [mU] [mC] [mU] [mA] [mC] [mU] [mA] [mCs] [mA] [G1b] [G1b] [G1b] 3'); iii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 446 (5' [mCs] [mAs] [mG] [mA] [mG] [fA] [mA] [fA] [fU] [fU] [fC] [mU] [mA] [mC] [mU] [mA] [mC] [mAs] [mUs] [mA] [Glb] [Glb] [Glb] 3'); iv) the sense strand of the nucleic acid sequence according to SEQ ID NO: 447 (5' [mGs] [mAs] [mA] [mA] [mU] [fU] [mC] [fU] [fA] [fC] [fU] [mA] [mC] [mA] [mU] [mC] [mU] [mAs] [mUs] [mA] [Glb] [Glb] [Glb] 3'); v) the sense strand of the nucleic acid sequence according to SEQ ID NO: 448 (5' [mCs] [mUs] [mG] [mA] [mG] [fG] [mA] [fG] [fA] [fA] [fU] [mU] [mG] [mC] [mU] [mU] [mC] [mAs] [mUs] [mA] [Glb] [Glb] [Glb] 3'); or vi) comprising any one of the sense strands of the nucleic acid sequence according to SEQ ID NO: 449 (5' [mGs] [mAs] [mG] [mA] [mA] [fU] [mU] [fG] [fC] [fU] [fU] [mC] [mA] [mU] [mA] [mC] [mA] [mAs] [mA] [mA] [Glb] [Glb] [Glb] 3'); 54. The isolated oligonucleotide of any one of claims 1 to 53, wherein "m" is a 2'-O-methyl modified nucleotide, "f" is a 2'-F modified nucleotide, "s" is a phosphorothioate internucleotide linkage, and "Glb" is a GalNac Glb moiety.
55. the double-stranded region i) the antisense strand of the nucleic acid sequence according to SEQ ID NO: 451 (5' [mUs] [fUs] [fA] [mG] [fU] [mA] [fG] [mA] [mA] [fU] [mU] [mU] [mC] [fU] [mC] [fU] [mG] [mU] [mA] [mGs] [mGs] [mC] 3') and the sense strand of the nucleic acid sequence according to SEQ ID NO: 444 (5' [mCs] [mUs] [mA] [mC] [mA] [fG] [mA] [fG] [mA] [fG] [fA] [fA] [mU] [mU] [mC] [mU] [mA] [mC] [mUs] [mAs] [mA] [Glb] [Glb] [Glb] 3'); ii) the sense strand of the nucleic acid sequence according to SEQ ID NO: 453 (5' [mUs] [fAs] [fU] [mG] [fU] [mA] [fG] [mU] [mA] [fG] [mA] [mU] [fU] [mU] [fC] [mU] [mC] [mU] [mGs] [mU] [mA] 3') and SEQ ID NO: 446 (5' [mCs] [mAs] [mG] [mA] [mG] [mA] [mG] [fA] [mA] [fA] [fU] [fU] [fC] [mU] [mA] [mC] [mU] [mA] [mC] [mAAs] [mU] [mA] [Glb] [Glb] [Glb] 3'); iii) the antisense strand of a nucleic acid sequence according to SEQ ID NO: 457 (5' [MeEPmUs] [fUs] [fA] [mG] [fU] [mA] [fG] [mA] [mA] [fU] [mU] [mU] [mC] [fU] [mC] [fU] [mG] [mU] [mA] [mGs] [mGs] [mC] 3') and the sense strand of a nucleic acid sequence according to SEQ ID NO: 444 (5' [mCs] [mUs] [mA] [mC] [mA] [fG] [mA] [fG] [mA] [fG] [fA] [fA] [mU] [mU] [mC] [mU] [mA] [mC] [mU] [mAs] [mA] [Glb] [Glb] [Glb] 3'); or iv) the isolated oligonucleotide of claim 45, comprising an antisense strand of a nucleic acid sequence according to SEQ ID NO: 459 (5' [MeEPmUs] [fAs] [fU] [mG] [fU] [mA] [fG] [mU] [mA] [fG] [mA] [mU] [fG] [mA] [mU] [fU] [mU] [fC] [mU] [mC] [mU] [mGs] [mUs] [mA] 3') and a sense strand of a nucleic acid sequence according to SEQ ID NO: 446 (5' [mCs] [mAs] [mG] [mA] [mG] [mA] [mG] [fA] [mA] [fA] [fU] [fU] [fC] [mU] [mA] [mC] [mU] [mA] [mC] [mAs] [mUs] [mA] [Glb] [Glb] [Glb] 3').
56. A vector encoding the isolated oligonucleotide of any one of claims 1 to 55.
57. A delivery system comprising the isolated oligonucleotide of any one of claims 1 to 55 or the vector of claim 56.
58. 58. A pharmaceutical composition comprising at least one isolated oligonucleotide according to any one of claims 1 to 55, a vector according to claim 56, a delivery system according to claim 57, and a pharmaceutically acceptable carrier, diluent or excipient.
59. 59. A kit comprising at least one isolated oligonucleotide according to any one of claims 1 to 55, a vector according to claim 56, a delivery system according to claim 57, or a pharmaceutical composition according to claim 58.
60. 58. A method of inhibiting or downregulating expression or levels of C3 in a subject in need thereof, comprising administering to the subject an effective amount of at least one isolated oligonucleotide according to any one of claims 1 to 55, a vector according to claim 56, a delivery system according to claim 57 or a pharmaceutical composition according to claim 58.
61. 58. A method for treating or preventing a disease or disorder associated with abnormal or increased expression or activity of C3, or a disease or disorder in which C3 is involved, in a subject in need thereof, comprising administering to the subject an effective amount of at least one isolated oligonucleotide according to any one of claims 1 to 55, a vector according to claim 56, a delivery system according to claim 57 or a pharmaceutical composition according to claim 58.