UPF1 expression construct

Abstract

Provided herein are improved expression constructs for the expression of UPF1 and vectors containing such constructs. Also provided are methods for treating neurodegenerative diseases, including, but not limited to, amyotrophic lateral sclerosis (ALS).

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. §119(e) of the earlier filing date of U.S. Provisional Patent Application No. 63 / 379,109, filed October 11, 2022, which is incorporated herein by reference in its entirety.

[0002] Electronic Sequence Listing Reference The contents of the electronic sequence listing (162027-49376-SeqList.xml, size: 122,000 bytes, and creation date: October 2, 2023) are incorporated herein by reference in their entirety.

[0003] The present disclosure relates generally to the fields of molecular biology and medicine. More specifically, the methods and compositions herein are useful for treating neurodegenerative diseases. [Background technology]

[0004] RNA metabolism is important for the function and maintenance of neurons and other cell types. RNA-binding proteins regulate all aspects of RNA metabolism, including transcription, splicing, transport, translation, and degradation. In line with the essential nature of RNA metabolism, deficiencies or abnormalities in RNA-binding proteins underlie the neurodegenerative disorders amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).

[0005] The UPF1 (upframeshift 1) gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation terminates upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. UPF1 is an RNA helicase involved in NMD. UPF1 was identified through an unbiased screen for proteins that can prevent cell death in a yeast model of ALS / FTD. See Ju et al., A yeast model of FUS / TLS-dependent cytotoxicity. PLoS Biol. 2011 Apr;9(4):e1001052. Overexpression of UPF1 has been shown to prevent neurodegeneration in an animal model of ALS with TDP-43 and FUS toxicity. See Jackson et al., Preservation of forelimb function by UPF1 gene therapy in a rat model of TDP-43-induced motor paralysis. Gene Ther. 2015 Jan;22(1):20-8.

[0006] Therefore, there is an urgent need for UPF1 expression constructs for the treatment of neurodegenerative diseases in animals, including humans. Summary of the Invention

[0007] Provided herein are improved expression constructs for the expression of UPF1, vectors containing such constructs, and methods of using such constructs and vectors.

[0008] In one aspect, an expression construct is provided that includes: (a) a promoter; (b) a sequence encoding UPF1 operably linked to the promoter; and (c) a polyadenylation signal.

[0009] In some embodiments, the promoter comprises a sequence at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 3-17. In some embodiments, the promoter comprises a sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 3-17. In some embodiments, the promoter comprises a sequence at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 3-17. In some embodiments, the promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 3-17. In some embodiments, the promoter comprises a sequence at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 5-7. In some embodiments, the promoter comprises a sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5-7. In some embodiments, the promoter comprises a sequence at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 5-7. In some embodiments, the promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 5-7. In some embodiments, the promoter comprises a sequence at least 80% identical to SEQ ID NO: 7. In some embodiments, the promoter comprises a sequence at least 90% identical to SEQ ID NO: 7. In some embodiments, the promoter comprises a sequence at least 95% identical to SEQ ID NO: 7. In one embodiment, the promoter comprises SEQ ID NO:7.

[0010] In some embodiments, the sequence encoding the UPF1 protein is codon-optimized. In some embodiments, the sequence encoding UPF1 comprises a sequence at least 80% identical to any one of SEQ ID NOs: 19-22. In some embodiments, the sequence encoding UPF1 comprises a sequence at least 90% identical to any one of SEQ ID NOs: 19-22. In some embodiments, the sequence encoding UPF1 comprises a sequence at least 95% identical to any one of SEQ ID NOs: 19-22. In some embodiments, the sequence encoding UPF1 comprises a sequence selected from the group consisting of any one of SEQ ID NOs: 19-22. In some embodiments, the sequence encoding UPF1 comprises a sequence at least 80% identical to SEQ ID NO: 21. In some embodiments, the sequence encoding UPF1 comprises a sequence at least 90% identical to SEQ ID NO: 21. In some embodiments, the sequence encoding UPF1 comprises a sequence at least 95% identical to SEQ ID NO: 21. In one embodiment, the sequence encoding UPF1 comprises SEQ ID NO: 21.

[0011] In some embodiments, the sequence encoding UPF1 encodes a protein comprising a sequence at least 80% identical to SEQ ID NO: 38. In some embodiments, the sequence encoding UPF1 encodes a protein comprising a sequence at least 90% identical to SEQ ID NO: 38. In some embodiments, the sequence encoding UPF1 encodes a protein comprising a sequence at least 95% identical to SEQ ID NO: 38. In one embodiment, the sequence encoding UPF1 encodes a protein comprising SEQ ID NO: 38.

[0012] In some embodiments, the expression construct further comprises a 5' untranslated region (UTR). In some embodiments, the 5' UTR comprises a sequence that is at least 90% identical to SEQ ID NO: 18. In some embodiments, the 5' UTR comprises a sequence that is at least 95% identical to SEQ ID NO: 18. In one embodiment, the 5' UTR comprises SEQ ID NO: 18.

[0013] In some embodiments, the expression construct further comprises a post-transcriptional regulatory element. In some embodiments, the post-transcriptional regulatory element comprises a sequence at least 80% identical to any one of SEQ ID NOs:23-26. In some embodiments, the post-transcriptional regulatory element comprises a sequence at least 90% identical to any one of SEQ ID NOs:23-26. In some embodiments, the post-transcriptional regulatory element comprises a sequence at least 95% identical to any one of SEQ ID NOs:23-26. In some embodiments, the post-transcriptional regulatory element comprises any one of SEQ ID NOs:23-26. In some embodiments, the post-transcriptional regulatory element comprises a sequence at least 80% identical to SEQ ID NO:24 or SEQ ID NO:25. In some embodiments, the post-transcriptional regulatory element comprises a sequence at least 90% identical to SEQ ID NO:24 or SEQ ID NO:25. In some embodiments, the post-transcriptional regulatory element comprises a sequence at least 95% identical to SEQ ID NO:24 or SEQ ID NO:25. In some embodiments, the post-transcriptional regulatory element comprises SEQ ID NO:24 or SEQ ID NO:25. In some embodiments, the post-transcriptional regulatory element comprises a sequence at least 80% identical to SEQ ID NO:24. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO: 24. In some embodiments, the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO: 24. In one embodiment, the post-transcriptional regulatory element comprises SEQ ID NO: 24.

[0014] In some embodiments, the expression construct further comprises a miRNA binding site (miRBS) that is at least 80% identical to SEQ ID NO: 27. In some embodiments, the expression construct comprises a miRBS that is at least 90% identical to SEQ ID NO: 27. In some embodiments, the expression construct comprises a miRBS that is at least 95% identical to SEQ ID NO: 27. In one embodiment, the expression construct comprises SEQ ID NO: 27.

[0015] In some embodiments, the polyadenylation signal comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 28-30. In some embodiments, the polyadenylation signal comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 28-30. In some embodiments, the polyadenylation signal comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 28-30. In some embodiments, the polyadenylation signal comprises any one of SEQ ID NOs: 28-30. In some embodiments, the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO: 29. In some embodiments, the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO: 29. In some embodiments, the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO: 29. In one embodiment, the polyadenylation signal comprises SEQ ID NO: 29.

[0016] In one aspect, a vector is provided comprising an expression construct disclosed herein. In one embodiment, the vector is a viral vector. In one embodiment, the vector is an AAV vector. In one aspect, a vector is provided comprising a nucleic acid sequence comprising (i) an expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITRs). In one embodiment, the nucleic acid sequence comprises a 5'ITR and a 3'ITR. In one embodiment, the 5'ITR and the 3'ITR are derived from adeno-associated virus (AAV) serotype AAV2. In some embodiments, the sequence of the 5'ITR is at least 80% identical to any one of SEQ ID NOs: 1, 54, or 55. In some embodiments, the sequence of the 5'ITR is at least 90% identical to any one of SEQ ID NOs: 1, 54, or 55. In some embodiments, the sequence of the 5'ITR is at least 95% identical to any one of SEQ ID NOs: 1, 54, or 55. In some embodiments, the sequence of the 5' ITR comprises any one of SEQ ID NOs: 1, 54, or 55. In some embodiments, the sequence of the 3' ITR is at least 80% identical to SEQ ID NO: 2 or SEQ ID NO: 56. In some embodiments, the sequence of the 3' ITR is at least 90% identical to SEQ ID NO: 2 or SEQ ID NO: 56. In some embodiments, the sequence of the 3' ITR is at least 95% identical to SEQ ID NO: 2 or SEQ ID NO: 56. In some embodiments, the sequence of the 3' ITR comprises SEQ ID NO: 2 or SEQ ID NO: 56. In one embodiment, the 5' ITR comprises SEQ ID NO: 1 and the 3' ITR comprises SEQ ID NO: 2. In some embodiments, a vector comprising an expression construct is provided, wherein the vector comprises a sequence 80% identical to any one of SEQ ID NOs: 32-37. In some embodiments, the vector comprises a sequence 90% identical to any one of SEQ ID NOs: 32-37. In some embodiments, the vector comprises a sequence 95% identical to any one of SEQ ID NOs: 32-37. In some embodiments, the vector comprises any one of SEQ ID NOs: 32-37. In some embodiments, the vector comprises a sequence that is 80% identical to SEQ ID NO: 34. In some embodiments, the vector comprises a sequence that is 90% identical to SEQ ID NO: 34.In some embodiments, the vector comprises a sequence 95% identical to SEQ ID NO: 34. In one embodiment, the vector comprises SEQ ID NO: 34. In some embodiments, the vector comprises a capsid from or derived from AAV7m8, AAV9, AAV2-retro, or AAVrh.10. In some embodiments, the vector comprises a capsid comprising capsid proteins from or derived from both AAV2-retro and AAVrh.10.

[0017] In one aspect, a cell is provided comprising an expression construct or vector disclosed herein.

[0018] In one aspect, a pharmaceutical composition is provided that includes (i) an expression construct or vector disclosed herein, and (ii) a pharmaceutically acceptable carrier.

[0019] In one aspect, a method is provided for reducing transactive response DNA binding protein 43 (TDP43) toxicity in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. In one aspect, a method is provided for reducing C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. In one aspect, a method is provided for reducing intrasarcoma fusion / intraceliosarcoma translocation (FUS / TLS) toxicity in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. In one aspect, a method is provided for treating a neurodegenerative disease in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. In some embodiments, the neurodegenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Alzheimer's disease (sporadic and familial), dementia with Lewy bodies with or without Alzheimer's disease, Down's syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson's disease with and without dementia, Parkinson's disease with LRKK2 mutations, Perry syndrome with DCTN1 mutations, Guam ALS-Parkinson-Dementia Complex, Huntington's disease, and myopathy. In one aspect, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS). In one aspect, the neurodegenerative disease is FTD. In one aspect, provided is a method for treating a neurodegenerative disease associated with TDP43 toxicity in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein.In one aspect, a method is provided for treating a neurodegenerative disease associated with C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. In one aspect, a method is provided for treating a neurodegenerative disease associated with FUS / TLS toxicity in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. In one aspect, a method is provided for treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof, the method comprising administering to the subject a vector or pharmaceutical composition disclosed herein. In some embodiments, the subject is a human. In some embodiments, the vector or pharmaceutical composition is administered by intracisternal administration.

[0020] In some embodiments, a vector or pharmaceutical composition described herein is provided for use in a method of reducing transactive response DNA binding protein 43 (TDP43) toxicity in a subject in need thereof. In some embodiments, a vector or pharmaceutical composition described herein is provided for use in a method of reducing C9orf72 toxicity in a subject in need thereof. In some embodiments, a vector or pharmaceutical composition described herein is provided for use in a method of reducing intrasarcoma fusion / intrasarcoma translocation (FUS / TLS) toxicity in a subject in need thereof. In some embodiments, a vector or pharmaceutical composition described herein is provided for use in a method of treating a neurodegenerative disease in a subject in need thereof. In some embodiments, the neurodegenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Alzheimer's disease (sporadic and familial), dementia with Lewy bodies with or without Alzheimer's disease, Down's syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson's disease with and without dementia, Parkinson's disease with LRKK2 mutations, Perry syndrome with DCTN1 mutations, Guam ALS-Parkinsonism-Dementia Complex, Huntington's disease, and myopathy. In some embodiments, the disease is amyotrophic lateral sclerosis (ALS). In some embodiments, a vector or pharmaceutical composition described herein is provided for use in a method of treating a neurodegenerative disease associated with TDP43 toxicity in a subject in need of such treatment. In some embodiments, a vector or pharmaceutical composition described herein is provided for use in a method of treating a neurodegenerative disease associated with C9orf72 toxicity in a subject in need of such treatment.In some embodiments, provided is a vector or pharmaceutical composition described herein for use in a method for treating a neurodegenerative disease associated with FUS / TLS toxicity in a subject in need thereof. In some embodiments, the subject is a human.

[0021] In some embodiments, the vector or pharmaceutical composition is administered by intracisternal administration.

[0022] In some embodiments, there is provided a use of a vector or pharmaceutical composition described herein for the manufacture of a medicament for reducing transactive response DNA binding protein 43 (TDP43) toxicity in a subject in need thereof. In some embodiments, there is provided a use of a vector or pharmaceutical composition described herein for the manufacture of a medicament for reducing C9orf72 toxicity in a subject in need thereof. In some embodiments, there is provided a use of a vector or pharmaceutical composition described herein for the manufacture of a medicament for reducing intrasarcoma fusion / intrasarcoma translocation (FUS / TLS) toxicity in a subject in need thereof. In some embodiments, there is provided a use of a vector or pharmaceutical composition described herein for the manufacture of a medicament for treating a neurodegenerative disease in a subject in need thereof. In some embodiments, the neurodegenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Alzheimer's disease (sporadic and familial), dementia with Lewy bodies with or without Alzheimer's disease, Down's syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson's disease with and without dementia, Parkinson's disease with LRKK2 mutations, Perry syndrome with DCTN1 mutations, ALS-Parkinsonism-Dementia Complex of Guam, Huntington's disease, and myopathy. In some embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

[0023] In some embodiments, there is provided a use of a vector or pharmaceutical composition described herein for the manufacture of a medicament for treating a neurodegenerative disease associated with TDP43 toxicity in a subject in need of such treatment.

[0024] In some embodiments, there is provided a use of a vector or pharmaceutical composition described herein for the manufacture of a medicament for treating a neurodegenerative disease associated with C9orf72 toxicity in a subject in need thereof.

[0025] In some embodiments, there is provided a use of a vector or pharmaceutical composition described herein for the manufacture of a medicament for treating a neurodegenerative disease associated with FUS / TLS toxicity in a subject in need thereof. In some embodiments, the subject is a human. In some embodiments, the vector or pharmaceutical composition is administered by intracisternal administration. [Brief explanation of the drawings]

[0026] [Figure 1A] The expression construct optimization process is shown in Figure 1A. Direct comparison of UPF1 expression levels with different UPF1 construct variants. Western blot data were quantified and plotted against endogenous levels. UPF1 expression constructs were expressed in Neuro2A (N2A) cells for 2 days by chemical transfection and analyzed by Western blotting. Pop-out frame: y-axis replotted to display a subset of samples. "Endo": Endogenous UPF1 expression levels from control wells transfected with EGFP. Mean ± standard deviation, n = 3 experiments. Figure 1B shows that the CMVe-JeT(MD)-MVMi promoter (right bar) was stronger than the CAG promoter (left bar), even in the context of other cis-regulatory elements. For further details regarding the expression constructs shown in Figures 1A and 1B, see Table 1. [Figure 1B]The expression construct optimization process is shown in Figure 1A. Direct comparison of UPF1 expression levels with different UPF1 construct variants. Western blot data were quantified and plotted against endogenous levels. UPF1 expression constructs were expressed in Neuro2A (N2A) cells for 2 days by chemical transfection and analyzed by Western blotting. Pop-out frame: y-axis replotted to display a subset of samples. "Endo": Endogenous UPF1 expression levels from control wells transfected with EGFP. Mean ± standard deviation, n = 3 experiments. Figure 1B shows that the CMVe-JeT(MD)-MVMi promoter (right bar) was stronger than the CAG promoter (left bar), even in the context of other cis-regulatory elements. For further details regarding the expression constructs shown in Figures 1A and 1B, see Table 1. [Figure 2A]Survival of TDP43M337Vi neurons expressing UPF1 variants at different dose concentrations is shown. TDP43M337Vi neurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique identifier to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates with at least four biological replicates. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 for cumulative hazard ratios in TDP43 mutant i neurons relative to V2-GFP. TDP43M337Vi neurons showed significant toxicity (***M337V:V2-GFP-250 vs. WT:V2-GFP-250, p<0.17x10-8), whereas UPF1 expression by AAV9 transduction reduced the risk of death for all UPF1 variants at different dose concentrations (V2-GFP-250 vs. V1-RKW-250, ***HR=0.54, p=0.0009; Figure 2A vs. V3-MeiraA-50, ***HR=0.33, p=0.0007 and vs. V3-MeriaA-250, *HR=0.54, p=0.0115; Figure 2B vs. V4-MeiraB-50, *HR=0.0008). 62, p=0.0460 and vs. V4-MeiraB-100, **HR=0.39, p=0.0011; Figure 2C vs. V5-UPF1_11-50, ***HR=0.16, p=0.0003 and vs. V5-UPF1_11-100, *HR=56, p=0.0386 and vs. V5-UPF1_11-250, **HR=0.36, p=-0.0010; Figure 2D vs. V6-UPF1_6-50, ***HR=0.29, p=0.0007; Figure 2E vs. V7-UPF1_11h-250, **HR=0.43, p=0.0073; Figure 2F vs. V8-UPF1_11i-50, *HR=0.51, p=0.0217). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 2A shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V3-MeiraA-100; V3-MeiraA-250; V1-RKW-positive control; GFP-healthy control (WT TDP43); V3-MeiraA-50. Figure 2B shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Figure 2C shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V1-RKW positive control; V5-UPF1_11-100; GFP healthy control (WT TDP43); V5-UPF1_11-250; V5-UPF1_11-50. Figure 2D. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT TDP43); V6-UPF1_6-50. Figure 2E. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V7-UPF1_11h-50; V7-UPF1_11h-100; V1-RKW positive control; GFP healthy control (WT TDP43); V7-UPF1_11h-250. Figure 2F. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT TDP43). [Figure 2B]Survival of TDP43M337Vi neurons expressing UPF1 variants at different dose concentrations is shown. TDP43M337Vi neurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique identifier to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates with at least four biological replicates. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 for cumulative hazard ratios in TDP43 mutant i neurons relative to V2-GFP. TDP43M337Vi neurons showed significant toxicity (***M337V:V2-GFP-250 vs. WT:V2-GFP-250, p<0.17x10-8), whereas UPF1 expression by AAV9 transduction reduced the risk of death for all UPF1 variants at different dose concentrations (V2-GFP-250 vs. V1-RKW-250, ***HR=0.54, p=0.0009; Figure 2A vs. V3-MeiraA-50, ***HR=0.33, p=0.0007 and vs. V3-MeriaA-250, *HR=0.54, p=0.0115; Figure 2B vs. V4-MeiraB-50, *HR=0.0008). 62, p=0.0460 and vs. V4-MeiraB-100, **HR=0.39, p=0.0011; Figure 2C vs. V5-UPF1_11-50, ***HR=0.16, p=0.0003 and vs. V5-UPF1_11-100, *HR=56, p=0.0386 and vs. V5-UPF1_11-250, **HR=0.36, p=-0.0010; Figure 2D vs. V6-UPF1_6-50, ***HR=0.29, p=0.0007; Figure 2E vs. V7-UPF1_11h-250, **HR=0.43, p=0.0073; Figure 2F vs. V8-UPF1_11i-50, *HR=0.51, p=0.0217). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 2A shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V3-MeiraA-100; V3-MeiraA-250; V1-RKW-positive control; GFP-healthy control (WT TDP43); V3-MeiraA-50. Figure 2B shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Figure 2C shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V1-RKW positive control; V5-UPF1_11-100; GFP healthy control (WT TDP43); V5-UPF1_11-250; V5-UPF1_11-50. Figure 2D. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT TDP43); V6-UPF1_6-50. Figure 2E. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V7-UPF1_11h-50; V7-UPF1_11h-100; V1-RKW positive control; GFP healthy control (WT TDP43); V7-UPF1_11h-250. Figure 2F. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT TDP43). [Figure 2C]Survival of TDP43M337Vi neurons expressing UPF1 variants at different dose concentrations is shown. TDP43M337Vi neurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique identifier to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates with at least four biological replicates. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 for cumulative hazard ratios in TDP43 mutant i neurons relative to V2-GFP. TDP43M337Vi neurons showed significant toxicity (***M337V:V2-GFP-250 vs. WT:V2-GFP-250, p<0.17x10-8), whereas UPF1 expression by AAV9 transduction reduced the risk of death for all UPF1 variants at different dose concentrations (V2-GFP-250 vs. V1-RKW-250, ***HR=0.54, p=0.0009; Figure 2A vs. V3-MeiraA-50, ***HR=0.33, p=0.0007 and vs. V3-MeriaA-250, *HR=0.54, p=0.0115; Figure 2B vs. V4-MeiraB-50, *HR=0.0008). 62, p=0.0460 and vs. V4-MeiraB-100, **HR=0.39, p=0.0011; Figure 2C vs. V5-UPF1_11-50, ***HR=0.16, p=0.0003 and vs. V5-UPF1_11-100, *HR=56, p=0.0386 and vs. V5-UPF1_11-250, **HR=0.36, p=-0.0010; Figure 2D vs. V6-UPF1_6-50, ***HR=0.29, p=0.0007; Figure 2E vs. V7-UPF1_11h-250, **HR=0.43, p=0.0073; Figure 2F vs. V8-UPF1_11i-50, *HR=0.51, p=0.0217). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 2A shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V3-MeiraA-100; V3-MeiraA-250; V1-RKW-positive control; GFP-healthy control (WT TDP43); V3-MeiraA-50. Figure 2B shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Figure 2C shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V1-RKW positive control; V5-UPF1_11-100; GFP healthy control (WT TDP43); V5-UPF1_11-250; V5-UPF1_11-50. Figure 2D. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT TDP43); V6-UPF1_6-50. Figure 2E. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V7-UPF1_11h-50; V7-UPF1_11h-100; V1-RKW positive control; GFP healthy control (WT TDP43); V7-UPF1_11h-250. Figure 2F. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT TDP43). [Figure 2D]Survival of TDP43M337Vi neurons expressing UPF1 variants at different dose concentrations is shown. TDP43M337Vi neurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique identifier to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates with at least four biological replicates. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 for cumulative hazard ratios in TDP43 mutant i neurons relative to V2-GFP. TDP43M337Vi neurons showed significant toxicity (***M337V:V2-GFP-250 vs. WT:V2-GFP-250, p<0.17x10-8), whereas UPF1 expression by AAV9 transduction reduced the risk of death for all UPF1 variants at different dose concentrations (V2-GFP-250 vs. V1-RKW-250, ***HR=0.54, p=0.0009; Figure 2A vs. V3-MeiraA-50, ***HR=0.33, p=0.0007 and vs. V3-MeriaA-250, *HR=0.54, p=0.0115; Figure 2B vs. V4-MeiraB-50, *HR=0.0008). 62, p=0.0460 and vs. V4-MeiraB-100, **HR=0.39, p=0.0011; Figure 2C vs. V5-UPF1_11-50, ***HR=0.16, p=0.0003 and vs. V5-UPF1_11-100, *HR=56, p=0.0386 and vs. V5-UPF1_11-250, **HR=0.36, p=-0.0010; Figure 2D vs. V6-UPF1_6-50, ***HR=0.29, p=0.0007; Figure 2E vs. V7-UPF1_11h-250, **HR=0.43, p=0.0073; Figure 2F vs. V8-UPF1_11i-50, *HR=0.51, p=0.0217). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 2A shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V3-MeiraA-100; V3-MeiraA-250; V1-RKW-positive control; GFP-healthy control (WT TDP43); V3-MeiraA-50. Figure 2B shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Figure 2C shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V1-RKW positive control; V5-UPF1_11-100; GFP healthy control (WT TDP43); V5-UPF1_11-250; V5-UPF1_11-50. Figure 2D. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT TDP43); V6-UPF1_6-50. Figure 2E. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V7-UPF1_11h-50; V7-UPF1_11h-100; V1-RKW positive control; GFP healthy control (WT TDP43); V7-UPF1_11h-250. Figure 2F. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT TDP43). [Figure 2E]Survival of TDP43M337Vi neurons expressing UPF1 variants at different dose concentrations is shown. TDP43M337Vi neurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique identifier to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates with at least four biological replicates. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 for cumulative hazard ratios in TDP43 mutant i neurons relative to V2-GFP. TDP43M337Vi neurons showed significant toxicity (***M337V:V2-GFP-250 vs. WT:V2-GFP-250, p<0.17x10-8), whereas UPF1 expression by AAV9 transduction reduced the risk of death for all UPF1 variants at different dose concentrations (V2-GFP-250 vs. V1-RKW-250, ***HR=0.54, p=0.0009; Figure 2A vs. V3-MeiraA-50, ***HR=0.33, p=0.0007 and vs. V3-MeriaA-250, *HR=0.54, p=0.0115; Figure 2B vs. V4-MeiraB-50, *HR=0.0008). 62, p=0.0460 and vs. V4-MeiraB-100, **HR=0.39, p=0.0011; Figure 2C vs. V5-UPF1_11-50, ***HR=0.16, p=0.0003 and vs. V5-UPF1_11-100, *HR=56, p=0.0386 and vs. V5-UPF1_11-250, **HR=0.36, p=-0.0010; Figure 2D vs. V6-UPF1_6-50, ***HR=0.29, p=0.0007; Figure 2E vs. V7-UPF1_11h-250, **HR=0.43, p=0.0073; Figure 2F vs. V8-UPF1_11i-50, *HR=0.51, p=0.0217). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 2A shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V3-MeiraA-100; V3-MeiraA-250; V1-RKW-positive control; GFP-healthy control (WT TDP43); V3-MeiraA-50. Figure 2B shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Figure 2C shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V1-RKW positive control; V5-UPF1_11-100; GFP healthy control (WT TDP43); V5-UPF1_11-250; V5-UPF1_11-50. Figure 2D. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT TDP43); V6-UPF1_6-50. Figure 2E. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V7-UPF1_11h-50; V7-UPF1_11h-100; V1-RKW positive control; GFP healthy control (WT TDP43); V7-UPF1_11h-250. Figure 2F. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT TDP43). [Figure 2F]Survival of TDP43M337Vi neurons expressing UPF1 variants at different dose concentrations is shown. TDP43M337Vi neurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique identifier to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates with at least four biological replicates. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 for cumulative hazard ratios in TDP43 mutant i neurons relative to V2-GFP. TDP43M337Vi neurons showed significant toxicity (***M337V:V2-GFP-250 vs. WT:V2-GFP-250, p<0.17x10-8), whereas UPF1 expression by AAV9 transduction reduced the risk of death for all UPF1 variants at different dose concentrations (V2-GFP-250 vs. V1-RKW-250, ***HR=0.54, p=0.0009; Figure 2A vs. V3-MeiraA-50, ***HR=0.33, p=0.0007 and vs. V3-MeriaA-250, *HR=0.54, p=0.0115; Figure 2B vs. V4-MeiraB-50, *HR=0.0008). 62, p=0.0460 and vs. V4-MeiraB-100, **HR=0.39, p=0.0011; Figure 2C vs. V5-UPF1_11-50, ***HR=0.16, p=0.0003 and vs. V5-UPF1_11-100, *HR=56, p=0.0386 and vs. V5-UPF1_11-250, **HR=0.36, p=-0.0010; Figure 2D vs. V6-UPF1_6-50, ***HR=0.29, p=0.0007; Figure 2E vs. V7-UPF1_11h-250, **HR=0.43, p=0.0073; Figure 2F vs. V8-UPF1_11i-50, *HR=0.51, p=0.0217). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 2A shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V3-MeiraA-100; V3-MeiraA-250; V1-RKW-positive control; GFP-healthy control (WT TDP43); V3-MeiraA-50. Figure 2B shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Figure 2C shows endpoints from top to bottom: GFP-negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1-RKW-positive control; GFP-healthy control (WT TDP43); V4-MeiraA-100. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V1-RKW positive control; V5-UPF1_11-100; GFP healthy control (WT TDP43); V5-UPF1_11-250; V5-UPF1_11-50. Figure 2D. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT TDP43); V6-UPF1_6-50. Figure 2E. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V7-UPF1_11h-50; V7-UPF1_11h-100; V1-RKW positive control; GFP healthy control (WT TDP43); V7-UPF1_11h-250. Figure 2F. Endpoints from top to bottom: GFP negative control (TDP43 M337V); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT TDP43). [Figure 3A]Survival of C9orf72 ineurons expressing UPF1 variants at different dose concentrations is shown. C9orf72 ineurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique ID to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates of at least four biological replicates. For cumulative hazard ratios relative to V2-GFP C9orf72 ineurons, *p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001. C9orf72 i neurons showed significant toxicity (***C9:V2-GFP-250 vs. WT:V2-GFP-250, p<0.0001), whereas UPF1 expression by AAV9 transduction was significantly reduced (V2-GFP-250 vs. V1-RKW-250, **HR=0.49, p=0.0004; Figure 3A vs. V3-MeiraA-50, **HR=0.43, p=0.0097 and vs. V3-MeiraA-100, *HR=0.52, p=0.0447 and vs. V3-MeiraA-250, **HR=0.35, p=0.0078; Figure 3B vs. V4-MeiraB-50, **HR=0.36, p=0.0056 and vs. V4-MeiraB-250, *HR=0.001). Figure 3C vs. V5-UPF1_11-50, ***HR=0.35, p=0.0010 and vs. V5-UPF1_11-100, **HR=0.37, p=0.0012; Figure 3D vs. V6-UPF1_6-50, ***HR=0.28, p=0.0002 and vs. V6-UPF_6-100, ***HR=0.33, p=0.0006; Figure 3E vs. V7-UPF1_11h-50, nsHR=0.61, p=0.0073; Figure 3F vs. V8-UPF1_11i-50, **HR=0.35, p=0.0012). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 3A shows endpoints from top to bottom: GFP-negative control (C9orf72); V3-MeiraA-100; V1-RKW-positive control; V3-MeiraA-50; V3-MeiraA-250; GFP-healthy control (WT). Figure 3B shows endpoints from top to bottom: GFP-negative control (C9orf72); V4-MeiraB-100; V1-RKW-positive control; V4-MeiraB-250; V4-MeiraB-50; GFP-healthy control (WT). Figure 3C shows endpoints from top to bottom: GFP negative control (C9orf72); V5-UPF1_11-250; V1-RKW positive control; V5-UPF1_11-100; V5-UPF1_11-50; GFP healthy control (WT). Figure 3D shows endpoints from top to bottom: GFP negative control (C9orf72); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT); V6-UPF1_6-50. Figure 3E shows endpoints from top to bottom: GFP negative control (C9orf72); V7-UPF1_11h-100; V7-UPF1_11h-250; V7-UPF1_11h-50; V1-RKW positive control; GFP healthy control (WT). Figure 3F. Endpoints from top to bottom: GFP negative control (C9orf72); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT). [Figure 3B]Survival of C9orf72 ineurons expressing UPF1 variants at different dose concentrations is shown. C9orf72 ineurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique ID to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates of at least four biological replicates. For cumulative hazard ratios relative to V2-GFP C9orf72 ineurons, *p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001. C9orf72 i neurons showed significant toxicity (***C9:V2-GFP-250 vs. WT:V2-GFP-250, p<0.0001), whereas UPF1 expression by AAV9 transduction was significantly reduced (V2-GFP-250 vs. V1-RKW-250, **HR=0.49, p=0.0004; Figure 3A vs. V3-MeiraA-50, **HR=0.43, p=0.0097 and vs. V3-MeiraA-100, *HR=0.52, p=0.0447 and vs. V3-MeiraA-250, **HR=0.35, p=0.0078; Figure 3B vs. V4-MeiraB-50, **HR=0.36, p=0.0056 and vs. V4-MeiraB-250, *HR=0.001). Figure 3C vs. V5-UPF1_11-50, ***HR=0.35, p=0.0010 and vs. V5-UPF1_11-100, **HR=0.37, p=0.0012; Figure 3D vs. V6-UPF1_6-50, ***HR=0.28, p=0.0002 and vs. V6-UPF_6-100, ***HR=0.33, p=0.0006; Figure 3E vs. V7-UPF1_11h-50, nsHR=0.61, p=0.0073; Figure 3F vs. V8-UPF1_11i-50, **HR=0.35, p=0.0012). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 3A shows endpoints from top to bottom: GFP-negative control (C9orf72); V3-MeiraA-100; V1-RKW-positive control; V3-MeiraA-50; V3-MeiraA-250; GFP-healthy control (WT). Figure 3B shows endpoints from top to bottom: GFP-negative control (C9orf72); V4-MeiraB-100; V1-RKW-positive control; V4-MeiraB-250; V4-MeiraB-50; GFP-healthy control (WT). Figure 3C shows endpoints from top to bottom: GFP negative control (C9orf72); V5-UPF1_11-250; V1-RKW positive control; V5-UPF1_11-100; V5-UPF1_11-50; GFP healthy control (WT). Figure 3D shows endpoints from top to bottom: GFP negative control (C9orf72); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT); V6-UPF1_6-50. Figure 3E shows endpoints from top to bottom: GFP negative control (C9orf72); V7-UPF1_11h-100; V7-UPF1_11h-250; V7-UPF1_11h-50; V1-RKW positive control; GFP healthy control (WT). Figure 3F. Endpoints from top to bottom: GFP negative control (C9orf72); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT). [Figure 3C]Survival of C9orf72 ineurons expressing UPF1 variants at different dose concentrations is shown. C9orf72 ineurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique ID to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates of at least four biological replicates. For cumulative hazard ratios relative to V2-GFP C9orf72 ineurons, *p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001. C9orf72 i neurons showed significant toxicity (***C9:V2-GFP-250 vs. WT:V2-GFP-250, p<0.0001), whereas UPF1 expression by AAV9 transduction was significantly reduced (V2-GFP-250 vs. V1-RKW-250, **HR=0.49, p=0.0004; Figure 3A vs. V3-MeiraA-50, **HR=0.43, p=0.0097 and vs. V3-MeiraA-100, *HR=0.52, p=0.0447 and vs. V3-MeiraA-250, **HR=0.35, p=0.0078; Figure 3B vs. V4-MeiraB-50, **HR=0.36, p=0.0056 and vs. V4-MeiraB-250, *HR=0.001). Figure 3C vs. V5-UPF1_11-50, ***HR=0.35, p=0.0010 and vs. V5-UPF1_11-100, **HR=0.37, p=0.0012; Figure 3D vs. V6-UPF1_6-50, ***HR=0.28, p=0.0002 and vs. V6-UPF_6-100, ***HR=0.33, p=0.0006; Figure 3E vs. V7-UPF1_11h-50, nsHR=0.61, p=0.0073; Figure 3F vs. V8-UPF1_11i-50, **HR=0.35, p=0.0012). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 3A shows endpoints from top to bottom: GFP-negative control (C9orf72); V3-MeiraA-100; V1-RKW-positive control; V3-MeiraA-50; V3-MeiraA-250; GFP-healthy control (WT). Figure 3B shows endpoints from top to bottom: GFP-negative control (C9orf72); V4-MeiraB-100; V1-RKW-positive control; V4-MeiraB-250; V4-MeiraB-50; GFP-healthy control (WT). Figure 3C shows endpoints from top to bottom: GFP negative control (C9orf72); V5-UPF1_11-250; V1-RKW positive control; V5-UPF1_11-100; V5-UPF1_11-50; GFP healthy control (WT). Figure 3D shows endpoints from top to bottom: GFP negative control (C9orf72); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT); V6-UPF1_6-50. Figure 3E shows endpoints from top to bottom: GFP negative control (C9orf72); V7-UPF1_11h-100; V7-UPF1_11h-250; V7-UPF1_11h-50; V1-RKW positive control; GFP healthy control (WT). Figure 3F. Endpoints from top to bottom: GFP negative control (C9orf72); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT). [Figure 3D]Survival of C9orf72 ineurons expressing UPF1 variants at different dose concentrations is shown. C9orf72 ineurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique ID to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates of at least four biological replicates. For cumulative hazard ratios relative to V2-GFP C9orf72 ineurons, *p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001. C9orf72 i neurons showed significant toxicity (***C9:V2-GFP-250 vs. WT:V2-GFP-250, p<0.0001), whereas UPF1 expression by AAV9 transduction was significantly reduced (V2-GFP-250 vs. V1-RKW-250, **HR=0.49, p=0.0004; Figure 3A vs. V3-MeiraA-50, **HR=0.43, p=0.0097 and vs. V3-MeiraA-100, *HR=0.52, p=0.0447 and vs. V3-MeiraA-250, **HR=0.35, p=0.0078; Figure 3B vs. V4-MeiraB-50, **HR=0.36, p=0.0056 and vs. V4-MeiraB-250, *HR=0.001). Figure 3C vs. V5-UPF1_11-50, ***HR=0.35, p=0.0010 and vs. V5-UPF1_11-100, **HR=0.37, p=0.0012; Figure 3D vs. V6-UPF1_6-50, ***HR=0.28, p=0.0002 and vs. V6-UPF_6-100, ***HR=0.33, p=0.0006; Figure 3E vs. V7-UPF1_11h-50, nsHR=0.61, p=0.0073; Figure 3F vs. V8-UPF1_11i-50, **HR=0.35, p=0.0012). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 3A shows endpoints from top to bottom: GFP-negative control (C9orf72); V3-MeiraA-100; V1-RKW-positive control; V3-MeiraA-50; V3-MeiraA-250; GFP-healthy control (WT). Figure 3B shows endpoints from top to bottom: GFP-negative control (C9orf72); V4-MeiraB-100; V1-RKW-positive control; V4-MeiraB-250; V4-MeiraB-50; GFP-healthy control (WT). Figure 3C shows endpoints from top to bottom: GFP negative control (C9orf72); V5-UPF1_11-250; V1-RKW positive control; V5-UPF1_11-100; V5-UPF1_11-50; GFP healthy control (WT). Figure 3D shows endpoints from top to bottom: GFP negative control (C9orf72); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT); V6-UPF1_6-50. Figure 3E shows endpoints from top to bottom: GFP negative control (C9orf72); V7-UPF1_11h-100; V7-UPF1_11h-250; V7-UPF1_11h-50; V1-RKW positive control; GFP healthy control (WT). Figure 3F. Endpoints from top to bottom: GFP negative control (C9orf72); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT). [Figure 3E]Survival of C9orf72 ineurons expressing UPF1 variants at different dose concentrations is shown. C9orf72 ineurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique ID to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates of at least four biological replicates. For cumulative hazard ratios relative to V2-GFP C9orf72 ineurons, *p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001. C9orf72 i neurons showed significant toxicity (***C9:V2-GFP-250 vs. WT:V2-GFP-250, p<0.0001), whereas UPF1 expression by AAV9 transduction was significantly reduced (V2-GFP-250 vs. V1-RKW-250, **HR=0.49, p=0.0004; Figure 3A vs. V3-MeiraA-50, **HR=0.43, p=0.0097 and vs. V3-MeiraA-100, *HR=0.52, p=0.0447 and vs. V3-MeiraA-250, **HR=0.35, p=0.0078; Figure 3B vs. V4-MeiraB-50, **HR=0.36, p=0.0056 and vs. V4-MeiraB-250, *HR=0.001). Figure 3C vs. V5-UPF1_11-50, ***HR=0.35, p=0.0010 and vs. V5-UPF1_11-100, **HR=0.37, p=0.0012; Figure 3D vs. V6-UPF1_6-50, ***HR=0.28, p=0.0002 and vs. V6-UPF_6-100, ***HR=0.33, p=0.0006; Figure 3E vs. V7-UPF1_11h-50, nsHR=0.61, p=0.0073; Figure 3F vs. V8-UPF1_11i-50, **HR=0.35, p=0.0012). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 3A shows endpoints from top to bottom: GFP-negative control (C9orf72); V3-MeiraA-100; V1-RKW-positive control; V3-MeiraA-50; V3-MeiraA-250; GFP-healthy control (WT). Figure 3B shows endpoints from top to bottom: GFP-negative control (C9orf72); V4-MeiraB-100; V1-RKW-positive control; V4-MeiraB-250; V4-MeiraB-50; GFP-healthy control (WT). Figure 3C shows endpoints from top to bottom: GFP negative control (C9orf72); V5-UPF1_11-250; V1-RKW positive control; V5-UPF1_11-100; V5-UPF1_11-50; GFP healthy control (WT). Figure 3D shows endpoints from top to bottom: GFP negative control (C9orf72); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT); V6-UPF1_6-50. Figure 3E shows endpoints from top to bottom: GFP negative control (C9orf72); V7-UPF1_11h-100; V7-UPF1_11h-250; V7-UPF1_11h-50; V1-RKW positive control; GFP healthy control (WT). Figure 3F. Endpoints from top to bottom: GFP negative control (C9orf72); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT). [Figure 3F]Survival of C9orf72 ineurons expressing UPF1 variants at different dose concentrations is shown. C9orf72 ineurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign a unique ID to each cell. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to create cumulative hazard plots showing the risk of neuronal death over time in each population. Each line summarizes experiments pooled from six technical replicates of at least four biological replicates. For cumulative hazard ratios relative to V2-GFP C9orf72 ineurons, *p ≤ 0.05, **p ≤ 0.01, and ***p ≤ 0.001. C9orf72 i neurons showed significant toxicity (***C9:V2-GFP-250 vs. WT:V2-GFP-250, p<0.0001), whereas UPF1 expression by AAV9 transduction was significantly reduced (V2-GFP-250 vs. V1-RKW-250, **HR=0.49, p=0.0004; Figure 3A vs. V3-MeiraA-50, **HR=0.43, p=0.0097 and vs. V3-MeiraA-100, *HR=0.52, p=0.0447 and vs. V3-MeiraA-250, **HR=0.35, p=0.0078; Figure 3B vs. V4-MeiraB-50, **HR=0.36, p=0.0056 and vs. V4-MeiraB-250, *HR=0.001). Figure 3C vs. V5-UPF1_11-50, ***HR=0.35, p=0.0010 and vs. V5-UPF1_11-100, **HR=0.37, p=0.0012; Figure 3D vs. V6-UPF1_6-50, ***HR=0.28, p=0.0002 and vs. V6-UPF_6-100, ***HR=0.33, p=0.0006; Figure 3E vs. V7-UPF1_11h-50, nsHR=0.61, p=0.0073; Figure 3F vs. V8-UPF1_11i-50, **HR=0.35, p=0.0012). N = number of cells per group pooled from 6 technical replicates and at least 4 biological replicates.Each row summarizes an experiment using a UPF1 variant at a dose concentration and is identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250). Figure 3A shows endpoints from top to bottom: GFP-negative control (C9orf72); V3-MeiraA-100; V1-RKW-positive control; V3-MeiraA-50; V3-MeiraA-250; GFP-healthy control (WT). Figure 3B shows endpoints from top to bottom: GFP-negative control (C9orf72); V4-MeiraB-100; V1-RKW-positive control; V4-MeiraB-250; V4-MeiraB-50; GFP-healthy control (WT). Figure 3C shows endpoints from top to bottom: GFP negative control (C9orf72); V5-UPF1_11-250; V1-RKW positive control; V5-UPF1_11-100; V5-UPF1_11-50; GFP healthy control (WT). Figure 3D shows endpoints from top to bottom: GFP negative control (C9orf72); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT); V6-UPF1_6-50. Figure 3E shows endpoints from top to bottom: GFP negative control (C9orf72); V7-UPF1_11h-100; V7-UPF1_11h-250; V7-UPF1_11h-50; V1-RKW positive control; GFP healthy control (WT). Figure 3F. Endpoints from top to bottom: GFP negative control (C9orf72); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT). [Figure 4] Figures 4A and 4B show the expression of UPF1 variants in patient-derived C9orf72 iPSNs. The fold enrichment of exogenous UPF1 RNA levels in C9Orf72 iPSNs after transduction with each of the UPF1 variant constructs was compared to untransduced cells, as measured by qRT-PCR. All experiments were performed with AAV2 retroviruses unless otherwise specified. Graphs in Figures 4A and 4B represent two independent experimental replicates. n = 4 for each condition in each experiment. NT: untransduced. C9: C9Orf72. WT: wild type. ns: not significant. iPSN: induced pluripotent stem cell (iPSC)-derived neurons. [Figure 5] Expression of UPF1 variants increases motor neuron survival in a FUS-ALS knock-in mouse model. The number of ChAT-positive motor neurons (MNs) at lumbar levels 4 and 5 at P180 in FUS-ALS knock-in mice (MN-P517L / Δ14) treated at P1 with intracerebroventricular (ICV) injection of AAV2 retroviruses to express UPF1 variant constructs (V1, V3-V9) was counted and normalized to the number of MNs in C14 (WT) mice expressing GFP control. V9: Meira C, n=4, p=0.0738; V3: Meira A, n=4, p=0.0023; V4: Meira B, n=3, p=0.0285; V1: RKW, n=5, p=0.0010; V5: UPF1_11, n=5, p=0.0178; V6: UPF1_6, n=4, p=0.0050; V7: UPF1_11h, n=3, p=0.0055; V8: UPF1_11i, n=4, p=0.0055. One-way ANOVA with Fisher's LSD post-hoc test was used. Data are shown as mean ± standard deviation. DETAILED DESCRIPTION OF THE INVENTION

[0027] Provided herein are improved expression constructs for the expression of UPF1, vectors containing such constructs, and methods of using such constructs and vectors. In embodiments, the expression constructs disclosed herein exhibit enhanced UPF1 expression, thus allowing a lower MOI (multiplicity of infection) of virus to be used clinically. In some embodiments, the expression constructs disclosed herein exhibit reduced size, which allows for improved AAV genome packaging and production efficiency.

[0028] Expression constructs In one aspect, (a) a promoter; (b) a sequence encoding UPF1 operably linked to a promoter; and (c) a polyadenylation signal.

[0029] As used herein, "operably linked" refers to a first molecule linked to a second molecule, the molecules being positioned so that the first molecule affects the function of the second molecule. The two molecules may or may not be part of a single, continuous molecule, and may or may not be adjacent. For example, if a promoter regulates the transcription of a transcribable polynucleotide molecule of interest in a cell, the promoter is operably linked to the transcribable polynucleotide molecule. In addition, two portions of a transcriptional regulatory element are operably linked to each other if they are linked such that the transcriptional activation function of one portion is not adversely affected by the presence of the other portion. Two transcriptional regulatory elements may be operably linked to each other via a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operably linked to each other without any intervening nucleotides.

[0030] In one aspect, (a) a promoter; (b) 5' untranslated region (UTR); (c) a sequence encoding UPF1 operably linked to a promoter; (d) post-transcriptional regulatory elements; (e) miRNA binding site (miRBS), and / or (f) a polyadenylation signal.

[0031] In one aspect, (a) a promoter; (b) 5'UTR; (c) a sequence encoding UPF1 operably linked to a promoter; and (d) a polyadenylation signal.

[0032] In one aspect, (a) a promoter; (b) a sequence encoding UPF1 operably linked to a promoter; and (c) post-transcriptional regulatory elements; (d) a polyadenylation signal.

[0033] In one embodiment, from 5' to 3': (a) a promoter; (b) 5'UTR, (c) a sequence encoding UPF1 operably linked to a promoter; (d) post-transcriptional regulatory elements; (e) miRBS, and / or (f) a polyadenylation signal.

[0034] As used herein, the term "5' to 3'" refers to the order of specific genetic elements in a nucleic sequence. In some embodiments, specific genetic elements are linked to each other by linker nucleic acids (e.g., intervening non-coding nucleic acids). In some embodiments, specific genetic elements are linked to each other without any intervening nucleotides. In some embodiments, some of the specific genetic elements are linked to each other by linker nucleic acids, while other genetic elements are linked to each other without any intervening nucleotides.

[0035] In some embodiments, the expression construct comprises a promoter sequence comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 3-17. In some embodiments, the expression construct comprises a promoter sequence comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 5-7. In some embodiments, the expression construct comprises a promoter sequence comprising any one of SEQ ID NOs: 5-7. In some embodiments, the expression construct comprises a promoter sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:7.

[0036] In some embodiments, the expression construct comprises a sequence encoding UPF1 that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 19-22. In some embodiments, the expression construct comprises any one of SEQ ID NOs: 19-22.

[0037] In some embodiments, the expression construct comprises a sequence encoding UPF1 that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 21. In some embodiments, the expression construct comprises SEQ ID NO:21.

[0038] In some embodiments, the expression construct comprises a sequence encoding UPF1, which encodes a UPF1 protein comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:38 or SEQ ID NO:39. In some embodiments, the expression construct comprises a sequence encoding UPF1, which encodes a UPF1 protein comprising SEQ ID NO:38 or SEQ ID NO:39.

[0039] In some embodiments, the expression construct comprises a sequence encoding UPF1, wherein the sequence encodes a UPF1 protein comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 38. In some embodiments, the expression construct comprises a sequence encoding UPF1, wherein the sequence encodes a UPF1 protein comprising SEQ ID NO: 38.

[0040] In some embodiments, the expression construct comprises a 5'UTR and a 3'UTR. In some embodiments, the expression construct comprises a 5'UTR comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 18. In some embodiments, the expression construct comprises a 5'UTR comprising SEQ ID NO: 18.

[0041] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 40-53. In some embodiments, the expression construct comprises any one of SEQ ID NOs: 40-53.

[0042] In some embodiments, the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 42. In some embodiments, the expression construct comprises SEQ ID NO:42.

[0043] In some embodiments, the expression construct comprises a 3'UTR, which comprises a polyadenylation signal and, optionally, one or more of a post-transcriptional regulatory element and a miRBS.

[0044] In some embodiments, the expression construct comprises a post-transcriptional regulatory element. In some embodiments, the expression construct comprises a post-transcriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 23-26. In some embodiments, the expression construct comprises a post-transcriptional regulatory element comprising any one of SEQ ID NOs: 23-26.

[0045] In some embodiments, the expression construct comprises a post-transcriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 24 or SEQ ID NO: 25. In some embodiments, the expression construct comprises a post-transcriptional regulatory element comprising SEQ ID NO: 24 or SEQ ID NO: 25.

[0046] In some embodiments, the expression construct comprises a post-transcriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 24. In some embodiments, the expression construct comprises a post-transcriptional regulatory element comprising SEQ ID NO:24.

[0047] In some embodiments, the expression construct comprises a miRBS that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 27. In some embodiments, the expression construct comprises SEQ ID NO:27.

[0048] In some embodiments, the expression construct comprises a polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 28-30. In some embodiments, the expression construct comprises a polyadenylation signal comprising any one of SEQ ID NOs: 28-30.

[0049] In some embodiments, the expression construct comprises a polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 29. In some embodiments, the expression construct comprises a polyadenylation signal comprising SEQ ID NO: 29.

[0050] In one embodiment, from 5' to 3': (a) a promoter comprising SEQ ID NO: 5; (b) a sequence encoding UPF1 operably linked to a promoter comprising SEQ ID NO: 21; and (c) a post-transcriptional regulatory element comprising SEQ ID NO: 25; and (d) a polyadenylation signal comprising SEQ ID NO: 28.

[0051] In one embodiment, from 5' to 3': (a) a promoter comprising SEQ ID NO: 5; (b) a sequence encoding UPF1 operably linked to a promoter comprising SEQ ID NO: 20; and (c) a post-transcriptional regulatory element comprising SEQ ID NO: 25; and (d) a polyadenylation signal comprising SEQ ID NO: 28.

[0052] In one embodiment, from 5' to 3': (a) a promoter comprising SEQ ID NO: 7; (b) a 5'UTR comprising SEQ ID NO: 18; and (c) a sequence encoding UPF1 operably linked to a promoter comprising SEQ ID NO: 21; and (d) a post-transcriptional regulatory element comprising SEQ ID NO: 24; and (e) a polyadenylation signal comprising SEQ ID NO:29.

[0053] In one embodiment, from 5' to 3': (a) a promoter comprising SEQ ID NO: 6; (b) a 5'UTR comprising SEQ ID NO: 18; and (c) a sequence encoding UPF1 operably linked to a promoter comprising SEQ ID NO: 21; and (d) a post-transcriptional regulatory element comprising SEQ ID NO: 24; and (e) a miRBS comprising SEQ ID NO: 27; and (f) a polyadenylation signal comprising SEQ ID NO: 30.

[0054] In one embodiment, from 5' to 3': (a) a promoter comprising SEQ ID NO: 7; (b) a 5'UTR comprising SEQ ID NO: 18; and (c) a sequence encoding UPF1 operably linked to a promoter comprising SEQ ID NO: 21; and (d) a post-transcriptional regulatory element comprising SEQ ID NO: 24; and (e) a polyadenylation signal comprising SEQ ID NO:29.

[0055] In one embodiment, from 5' to 3': (a) a promoter comprising SEQ ID NO: 7; (b) a 5'UTR comprising SEQ ID NO: 18; and (c) a sequence encoding UPF1 operably linked to a promoter comprising SEQ ID NO: 19; and (d) a post-transcriptional regulatory element comprising SEQ ID NO: 24; and (e) a polyadenylation signal comprising SEQ ID NO:29.

[0056] Provided herein are expression constructs that include the elements listed in Tables 1, 2, 6, and 7.

[0057] vector In one aspect, a recombinant vector for introducing a transgene or expression construct into a cell and its use are provided. In some embodiments, the recombinant vector comprises a recombinant DNA (or RNA) construct. In addition to the UPF1 coding sequence, the DNA construct comprises additional DNA elements, including, for example, DNA segments that provide appropriate levels of DNA replication in host cells and expression of target genes in target cells. Those skilled in the art will understand that expression control sequences (promoters, enhancers, etc.) are selected based on their ability to promote expression of target genes in target cells.

[0058] As used herein, "vector" refers to a vehicle containing a polynucleotide that is delivered to a host cell either in vitro or in vivo. Non-limiting examples of vectors include a recombinant plasmid, yeast artificial chromosome (YAC), minichromosome, DNA minicircle, or virus (containing a viral-derived sequence). A vector may also refer to a virion containing a nucleic acid that is delivered to a host cell either in vitro, ex vivo, or in vivo. In some embodiments, a vector refers to a virion containing a recombinant viral genome, where the viral genome includes one or more ITRs and a transgene.

[0059] In one embodiment, the recombinant vector is a viral vector or a combination of viral vectors. In one aspect, a vector is provided comprising any of the expression constructs disclosed herein.

[0060] viral vectors Viral vectors for expressing target genes in target cells, tissues, or organisms are known in the art and include, for example, AAV vectors, adenoviral vectors, lentiviral vectors, retroviral vectors, poxvirus vectors, baculovirus vectors, herpes simplex virus vectors, vaccinia virus vectors, or synthetic viral vectors (e.g., chimeric, mosaic, or pseudotyped viruses, and / or viruses containing foreign proteins, synthetic polymers, nanoparticles, or small molecules).

[0061] AAV vectors Adeno-associated viruses (AAVs) are small, single-stranded DNA viruses that require a helper virus to promote efficient replication. The 4.7-kb genome of AAV is characterized by two inverted terminal repeats (ITRs) and two open reading frames encoding the Rep and Cap proteins, respectively. The Rep reading frame encodes four proteins with molecular weights of 78 kD, 68 kD, 52 kD, and 40 kD. These proteins primarily function in AAV replication and rescue, as well as in regulating AAV integration into host cell chromosomes. The Cap reading frame encodes three structural proteins with molecular weights of 85 kD (VP1), 72 kD (VP2), and 61 kD (VP3), which form the virion capsid. VP3 accounts for more than 80% of the total protein in AAV virions. Adjacent to the 5' and 3' ends of the Rep and Cap open reading frames are inverted terminal repeats (ITRs) approximately 145 bp long. The two ITRs are the only cis elements essential for AAV replication, rescue, packaging, and integration of the AAV genome. The entire rep and cap domains can be excised and replaced with therapeutic or reporter transgenes.

[0062] Recombinant adeno-associated virus "rAAV" vectors include any vector derived from any adeno-associated virus serotype. rAAV vectors can have one or more of the AAV wild-type genes, preferably the Rep and / or Cap genes, deleted in whole or in part, but retain functional flanking ITR sequences.

[0063] In some embodiments, the viral vector is a rAAV virion comprising a rAAV genome and one or more capsid proteins. In some embodiments, the rAAV genome comprises an expression construct disclosed herein.

[0064] In some embodiments, the viral vectors disclosed herein comprise a nucleic acid comprising AAV 5' and 3' ITRs (and associated 5' and 3' UTRs) located 5' and 3', respectively, of the sequence encoding UPF1. However, in certain embodiments, it may be desirable for the nucleic acid to contain 5' and 3' ITR sequences arranged in tandem, e.g., 5'-3', or head-to-tail, or in another alternative configuration. In still other embodiments, it may be desirable for the nucleic acid to contain multiple copies of the ITRs or to have the 5' ITR (or conversely, the 3' ITR) located both 5' and 3' to the sequence encoding UPF1. The ITR sequences may be located immediately upstream and / or downstream of the heterologous molecule, or intervening sequences may be present. The ITRs need not be wild-type nucleotide sequences and can be modified (e.g., by nucleotide insertion, deletion, or substitution) so long as the sequences provide functional rescue, replication, and packaging. The ITRs can be selected from AAV2 or from other AAV serotypes, as described herein.

[0065] In some embodiments, a vector is provided comprising a nucleic acid sequence comprising (i) an expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITRs). In one embodiment, the nucleic acid sequence comprises a 5'ITR and a 3'ITR. In one embodiment, the 5'ITR and the 3'ITR are derived from adeno-associated virus (AAV) serotype AAV2.

[0066] In one embodiment, the 5' ITR comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 1, 54, or 55. In one embodiment, the 5' ITR sequence comprises any one of SEQ ID NOs: 1, 54, or 55.

[0067] In one embodiment, the 3' ITR sequence comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2 or SEQ ID NO: 56. In one embodiment, the 3' ITR sequence comprises SEQ ID NO: 2 or SEQ ID NO: 56.

[0068] Provided herein are vectors comprising a nucleic acid sequence comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 32-37. Provided herein are vectors comprising a nucleic acid sequence comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 34. Provided herein are vectors comprising a nucleic acid sequence comprising SEQ ID NO: 34.

[0069] In some embodiments, the viral vector is an AAV vector, e.g., AAV1 (i.e., AAV containing AAV1 ITRs and AAV1 capsid protein), AAV2 (i.e., AAV containing AAV2 ITRs and AAV2 capsid protein), AAV3 (i.e., AAV containing AAV3 ITRs and AAV3 capsid protein), AAV4 (i.e., AAV containing AAV4 ITRs and AAV4 capsid protein), AAV5 (i.e., AAV containing AAV5 ITRs and AAV5 capsid protein), AAV6 (i.e., AAV containing AAV6 ITRs and AAV6 capsid protein), AAV7 (i.e., AAV containing AAV7 ITRs and AAV7 capsid protein), AAV8 (i.e., AAV containing AAV8 ITRs and AAV8 capsid protein), AAV9 (i.e., AAV9 ITRs and AAV9 capsid protein), AAVrh.74 (i.e., an AAV containing AAVrh74 ITRs and AAVrh74 capsid protein), AAVrh.8 (i.e., an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid protein), or AAVrh.10 (i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid protein).

[0070] In some embodiments, the viral vector is a pseudotyped AAV vector containing ITRs from one AAV serotype and capsid proteins from a different AAV serotype. In some embodiments, the pseudotyped AAV is AAV2 / 9 (i.e., an AAV containing AAV2 ITRs and AAV9 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 10 (i.e., an AAV containing AAV2 ITRs and AAV10 capsid proteins).

[0071] In some embodiments, the pseudotyped AAV is AAV2 / 7m8 (i.e., an AAV containing AAV2 ITRs and AAV 7m8 capsid proteins).

[0072] In some embodiments, the AAV vector contains a recombinant capsid protein, such as a capsid protein containing a chimera of one or more capsid proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh74, AAVrh.8, or AAVrh.10. In embodiments, the capsid is a variant AAV capsid, such as the AAV2 variant rAAV2-retro (SEQ ID NO: 44 from WO2017 / 218842, incorporated herein by reference in its entirety).

[0073] In some embodiments, the AAV vector contains two or more capsid proteins selected from different serotypes. In some embodiments, the AAV vector contains rAAV2-retro and AAVrh.10 capsid proteins. In some embodiments, the AAV vector contains rAAV2-retro and AAVrh.10 capsid proteins at a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50, respectively. In some embodiments, the AAV vector contains AAVrh.10 and rAAV2-retrocapsid proteins at a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50, respectively.

[0074] In some embodiments, a mixture of (1) an AAV vector comprising rAAV2-retro and (2) an AAV vector comprising AAVrh.10 is used. In some embodiments, a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50, respectively, of (1) an AAV vector comprising rAAV2-retro and (2) an AAV vector comprising AAVrh.10 is used. In some embodiments, a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50, respectively, of (1) an AAV vector comprising AAVrh.10 and (2) an AAV vector comprising rAAV2-retro is used.

[0075] Other viral vectors Other viral vectors include adenovirus (AV) vectors, such as those based on human adenovirus type 2 and human adenovirus type 5, which have been rendered replication-deficient by deletion of the E1 and E3 regions. A transcription cassette can be inserted into the E1 region to obtain an E1 / E3-deleted recombinant AV vector. Adenovirus vectors also include helper-dependent, large-capacity adenovirus vectors (also known as large-capacity, "gutless" or "gutted" vectors) that do not contain viral coding sequences. These vectors contain cis-acting elements necessary for viral DNA replication and packaging, primarily inverted terminal repeats (ITRs) and packaging signals (CYs). These helper-dependent AV vector genomes have the potential to carry foreign DNA from several hundred base pairs to approximately 36 kb.

[0076] Alternatively, other systems, such as lentiviral vectors, can be used. Lentiviral-based systems can transduce not only non-dividing cells but also dividing cells, making them useful for targeting non-dividing cells in the CNS, for example. Lentiviral vectors are derived from the human immunodeficiency virus and, like that virus, integrate into the host genome, providing the potential for very long-term gene expression.

[0077] Polynucleotides, including plasmids, YACs, minichromosomes, and minicircles, carrying target genes containing expression cassettes can also be introduced into cells or organisms by non-viral vector systems, for example, using cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) polymer and polyethyleneimine (PEI) polymer systems can also be used to deliver vectors into cells. Other methods for delivering vectors into cells include hydrodynamic injection and electroporation, as well as the use of ultrasound, for both cell cultures and organisms. For a review of viral and non-viral delivery systems for gene delivery, see Nayerossadat, N. et al. (Adv Biomed Res. 2012;1:27), the entire contents of which are incorporated herein by reference.

[0078] rAAV virion production The rAAV virions disclosed herein can be constructed and produced using materials and methods described herein and known to those of skill in the art. Such engineering methods used to construct any embodiment of the present disclosure are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al., "Molecular Cloning. A Laboratory Manual," 2nd ed., Cold Spring Harbor Laboratory, New York (1989), and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989, and International Patent Publication No. WO 95 / 13598. Additionally, suitable methods for producing rAAV cassettes within adenovirus capsids are described in U.S. Patent Nos. 5,856,152 and 5,871,982.

[0079] Briefly, to package the rAAV genome into rAAV virions, host cells containing sequences necessary for expressing AAV rep and AAV cap or functional fragments thereof, as well as helper genes essential for AAV production, are used. The AAV rep and cap sequences are obtained from AAV sources found herein. The AAV rep and cap sequences can be introduced into host cells by any method known to those skilled in the art, including, but not limited to, transfection, electroporation, liposome delivery, membrane fusion techniques, high-speed DNA-coated pellets, viral infection, and protoplast fusion. In one embodiment, the rep and cap sequences can be transfected into host cells via one or more nucleic acid molecules and stably present in the cells as episomes. In another embodiment, the rep and cap sequences are stably integrated into the cell's genome. In another embodiment, the rep and cap sequences are transiently expressed in the host cell. For example, a nucleic acid molecule useful for such transfection comprises, from 5' to 3', a promoter, an optional spacer inserted between the promoter and the start of the rep gene sequence, an AAV rep gene sequence, and an AAV cap gene sequence.

[0080] The rep and cap sequences, along with their expression control sequences, may be provided on a single vector, or each sequence may be provided on its own vector. Preferably, the rep and cap sequences are provided on the same vector. Alternatively, the rep and cap sequences may be provided on a vector containing other DNA sequences that can be introduced into host cells. Preferably, the promoter used in this construct may be any suitable constitutive, inducible, or native promoter known to those skilled in the art. The molecule providing the rep and cap proteins may be in any form that transfers these components into host cells. Desirably, this molecule is in the form of a plasmid, which may contain other non-viral sequences, such as sequences of marker genes. This molecule does not contain AAV ITRs and generally does not contain AAV packaging sequences. To avoid the occurrence of homologous recombination, other viral sequences, particularly adenoviral sequences, are avoided in this plasmid. Desirably, this plasmid is constructed so that it can be stably transfected into cells.

[0081] Although the molecules providing rep and cap can be transiently transfected into host cells, it is preferred that the host cells be stably transformed with the sequences necessary to express functional rep / cap proteins in the host cell, e.g., as an episome or by integration into the host cell chromosome. Depending on the promoter controlling expression in such stably transfected host cells, the rep / cap proteins can be transiently expressed (e.g., through the use of an inducible promoter).

[0082] Methods used to construct embodiments of the present disclosure are conventional genetic or recombinant engineering techniques, as described in the references cited above. For example, rAAV can be produced using a triple transfection method using either the calcium phosphate method (Clontech) or Effectene reagent (Qiagen, Valencia, Calif.), according to the manufacturer's instructions. See Herzog et al., 1999, Nature Medic., 5(1):56-63, for the method used in the following examples, which employs a plasmid carrying the transgene, a helper plasmid containing AAV rep and cap, and a plasmid supplying the adenoviral helper functions of E2A, E4Orf6, and VA. While the present specification provides illustrative examples of specific constructs using the information provided herein, those skilled in the art will be able to select and design other suitable constructs using their selection of spacers, promoters, and other elements, including at least one translational start and stop signal, and the optional addition of a polyadenylation site.

[0083] rAAV virions are then produced by culturing host cells containing the rAAV virus described herein, which contains the rAAV genome packaged into rAAV virions, AAV rep sequences, and AAV cap sequences, under the control of regulatory sequences that direct its expression. Suitable viral helper genes, such as adenovirus E2A, E4Orf6, and VA, among other possible helper genes, can be provided to the culture by various methods known in the art, preferably on separate plasmids. Recombinant AAV virions directing the expression of the UPF1 transgene are then isolated from the cells or cell culture in the absence of contaminating helper virus or wild-type AAV.

[0084] The expression of UPF1 transgene can be measured by methods known in the art.For example, target cells can be infected in vitro, and the copy number of the transgene in cells can be monitored by Southern blotting or quantitative polymerase chain reaction (PCR).RNA expression level can be monitored by Northern blotting or quantitative reverse transcriptase (RT)-PCR; and protein expression level can be monitored by Western blotting, immunohistochemistry, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or by the specific method detailed in the following examples.

[0085] Pharmaceutical Composition Provided herein are pharmaceutical compositions comprising any of the vectors disclosed herein and a pharmaceutically acceptable excipient.

[0086] In some embodiments, the rAAV containing the gene encoding UPF1 is assessed for contamination by conventional methods and then formulated into a pharmaceutical composition suitable for storage and / or administration to a patient.

[0087] Formulation of the vectors disclosed herein involves the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier, such as buffered saline or other buffers, e.g., HEPES, to maintain pH at an appropriate physiological level.

[0088] The vectors of the present disclosure can be formulated into pharmaceutical compositions. These compositions may contain, in addition to the vector, pharmaceutically and / or physiologically acceptable excipients, carriers, buffers, stabilizers, antioxidants, preservatives, or other additives known to those skilled in the art. Such materials must be non-toxic and not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other materials can be determined by one of ordinary skill in the art according to the route of administration. Pharmaceutical compositions are typically in liquid form. Liquid pharmaceutical compositions generally contain a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil, or synthetic oil. Additional carriers are provided in International Patent Publication No. WO 00 / 15822, the entire contents of which are incorporated herein by reference. Physiological saline, magnesium chloride, dextrose, or other sugar solutions, or glycols such as ethylene glycol, propylene glycol, or polyethylene glycol may also be included. In some cases, surfactants, such as 0.001% pluronic acid (PF68), may be used. In some cases, Ringer's solution, lactated Ringer's solution, or Hartmann's solution is used. Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included, as required.

[0089] For delayed release, the vectors may be included in pharmaceutical compositions formulated for delayed release, such as microcapsules formed from biocompatible polymers or liposome carrier systems, according to methods known in the art.

[0090] For long-term storage of the vector, the vector may be frozen in the presence of glycerol.

[0091] Treatment method Provided herein are methods of treating a disease in a subject in need thereof using the expression constructs, vectors, and pharmaceutical compositions disclosed herein.

[0092] In some embodiments, the subject is a mammal. As used herein, the term "mammal" is intended to include, but is not limited to, humans, laboratory animals, domestic pets, and farm animals. Mammals include, but are not limited to, humans or non-human mammals, such as cows, horses, dogs, sheep, or cats. An "individual" or "patient" is also a subject herein.

[0093] As used herein, the terms "treat," "treated," "treating," or "treatment" refer to therapeutic treatment, the purpose of which is to slow (alleviate) an undesirable physiological condition, disorder, or disease, or to obtain a beneficial or desired clinical result. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; reduction in the severity of the condition, disorder, or disease; stabilization (i.e., not worsening) of the pathological condition, disorder, or disease state; delay in the onset of the condition, disorder, or disease, or delay in the progression of the condition, disorder, or disease; improvement in one or more symptoms of the condition, disorder, or disease state; and remission (partial or complete), or improvement or amelioration of the condition, disorder, or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival compared to the expected survival if not receiving treatment.

[0094] The terms "prevent", "preventing", and the like refer to acting before the onset of an overt disease or disorder to prevent the onset of the disease or disorder, minimize the extent of the disease or disorder, or delay the course of its development.

[0095] Disclosed herein are methods for treating neurological diseases such as amyotrophic lateral sclerosis, frontotemporal dementia, other dementias associated with TDP43 and / or FUS / TLS inclusions, including but not limited to Alzheimer's disease (sporadic and familial), Lewy body dementia with or without Alzheimer's disease, Down's syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson's disease (including but not limited to Parkinson's disease with and without dementia, Parkinson's disease with LRKK2 mutations, Perry syndrome with DCTN1 mutations, and ALS-Parkinsonism-Dementia Complex of Guam), polyglutamine diseases such as Huntington's disease, and myopathies.

[0096] ALS is a progressive neurodegenerative disease distinguished by the specific loss of motor neurons in the brain, brainstem, and spinal cord. Early symptoms of loss of motor neuron activity, including distal muscle weakness and wasting, increased muscle tone with hyperreflexia, and diaphragmatic and / or bulbar weakness, are first noticed at an average age of 55 years. Death results from respiratory failure an average of four years after disease onset. ALS exists in both inherited and random forms. Most forms of ALS are sporadic and idiopathic (sALS), but approximately 10% of cases are inherited in a Mendelian manner and are designated familial ALS (fALS). The present disclosure provides compositions and methods useful for treating ALS.

[0097] Using genetic analysis, several genes that cause fALS have been identified. The first mutations were identified in SOD1, which encodes the ubiquitously expressed copper / zinc superoxide dismutase. These variants are responsible for approximately 20% of fALS cases worldwide (Rosen et al., Nature 362:59-62 (1993)). Other genes involved in fALS include alsin (ALS2), vesicle-associated membrane protein B (VAPB) (Nishimura et al., Am. J. Hum. Genet. 75:822-831 (2004)), senataxin (SETX) (Chen et al., Am. J. Hum. Genet. 74:1128-1135 (2004)), TAR-DNA binding protein (TDP-43) (Sreedharan et al., Science 319:1668-1672 (2008)), and intrasarcoma fusion / liposarcoma translocation (FUS / TLS) (Kwiatkowski et al., Science 323:1205-1208 (2009); Vance et al., Science 323:1208-1211 (2009)) and optineurin (OPTN) (Maruyama et al., Nature 465:223-226 (2010)). FUS / TLS is a nucleic acid-binding protein that, when mutated, can cause a subset of fALS and may also increase the risk of sporadic disease. FUS / TLS is normally located primarily in the nucleus, but pathogenic mutant forms of FUS / TLS transport to, and form inclusions within, the cytoplasm of affected spinal motor neurons or glia.

[0098] The intronic GGGGCC repeat expansion in C9ORF72 is a common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). The repeat expansion reduces C9ORF72 expression and C9ORF72-associated activity, inducing neurodegeneration through two mechanisms. First, glutamate receptors accumulate in motor neurons (MNs) and spinal motor neurons in vivo, leading to glutamate-induced excitotoxicity due to neuronal hyperexcitability. Second, the clearance of dipeptide repeat proteins generated from the expansion is impaired, enhancing their neurotoxicity. Thus, cooperation between gain-of-function and loss-of-function mechanisms leads to neurodegeneration. The (GGGGCC) repeat expansion in the C9ORF72 gene reduces C9ORF72 expression and C9ORF72-associated activity, inducing neurodegeneration through two mechanisms. First, glutamate receptors accumulate in motor neurons (MNs) and spinal motor neurons in vivo, leading to glutamate-induced excitotoxicity due to neuronal hyperexcitability. Second, the clearance of dipeptide repeat proteins generated from the expansion is impaired, enhancing their neurotoxicity. Therefore, cooperation between gain-of-function and loss-of-function mechanisms leads to neurodegeneration. n Provided herein are expression constructs and vectors that can rescue or compensate for defects associated with repeat expansions.

[0099] Provided herein are methods of treating a neurological disease, including but not limited to, ALS or frontotemporal dementia, comprising administering to a subject in need of neurological disease treatment an expression construct, vector, or pharmaceutical composition disclosed herein. In some embodiments, provided are vectors, expression constructs, or pharmaceutical compositions described herein for use in methods of treating a neurological disease, including but not limited to, ALS or frontotemporal dementia, in a subject in need of neurological disease treatment. In some embodiments, provided is use of a vector, expression construct, or pharmaceutical composition described herein in the manufacture of a medicament for treating a neurological disease, including but not limited to, ALS or frontotemporal dementia, in a subject in need of neurological disease treatment.

[0100] Provided herein are methods of treating a subject suffering from a neurological disease, including, but not limited to, ALS or frontotemporal dementia, the method comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein.

[0101] Provided herein are methods for preventing a neurological disease, including but not limited to, ALS or frontotemporal dementia, comprising administering an expression construct, vector, or pharmaceutical composition disclosed herein to a subject in need thereof. In some embodiments, provided are vectors, expression constructs, or pharmaceutical compositions described herein for use in methods for preventing a neurological disease, including but not limited to, ALS or frontotemporal dementia, in a subject in need thereof. In some embodiments, provided is use of a vector, expression construct, or pharmaceutical composition described herein in the manufacture of a medicament for preventing a neurological disease, including but not limited to, ALS or frontotemporal dementia, in a subject in need thereof.

[0102] In some embodiments, treatment refers to partial or complete alleviation, amelioration, reduction, inhibition, delay in onset, reduction in severity and / or incidence of neurological disorders in patients suffering from or susceptible to ALS or FTD. As used herein, the term "neurological disorders" includes various symptoms associated with disorders of the central nervous system (e.g., brain and spinal cord). Symptoms of neurological disorders can include, for example, developmental delay, progressive cognitive impairment, hearing loss, impaired language development, lack of motor skills, hyperactivity, aggression, and / or sleep disorders, among others.

[0103] In some embodiments, treatment refers to reduced toxicity of various cells or tissues. In some embodiments, treatment refers to a reduction in neurotoxicity caused by FUS / TLS or TDP-43 in brain target tissues, spinal cord neurons, and / or peripheral target tissues. In certain embodiments, toxicity is reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more compared to a control. In some embodiments, toxicity is reduced by at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold compared to a control. In some embodiments, toxicity is measured by tests known to those skilled in the art, including, but not limited to, neuroimaging (e.g., CT scan, MRI, functional MRI, etc.).

[0104] In certain embodiments, treatment according to the present disclosure results in a reduction (e.g., about a 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, 97.5%, 99% or more reduction) or complete elimination, or alternatively, accumulation, of one or more pathological, clinical, or biological markers associated with ALS. For example, in some embodiments, when administered to a subject, the pharmaceutical compositions described herein exhibit or achieve a reduction in muscle loss, muscle spasms, muscle weakness, convulsions, abnormal tendon reflexes, Babinski sign, breathing problems, facial weakness, slurred speech, loss of perception, loss of reasoning, loss of judgment, and / or loss of imagination.

[0105] In some embodiments, treatment refers to increased survival (e.g., survival time). For example, treatment can result in an increased life expectancy of a patient. In some embodiments, treatment can result in an increased life expectancy of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 10%, about 12%, about 14%, about 16%, about 18%, about 20%, about 22%, about 24%, about 26%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 45 ...

[0013] In some embodiments, treatment results in an increase in patient life expectancy of more than 0%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, about 150%, about 155%, about 160%, about 165%, about 170%, about 175%, about 180%, about 185%, about 190%, about 195%, about 200% or more. In some embodiments, treatment results in an increase in patient life expectancy of more than about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, about 10 years or more, compared to the life expectancy of one or more control individuals with ALS who are not receiving treatment. In some embodiments, treatment results in long-term survival of the patient. As used herein, the term "long-term survival" refers to a survival time or life expectancy of greater than about 40, 45, 50, 55, 60 years or more.

[0106] In embodiments, the subject has a risk of developing a neurological disease, including, but not limited to, ALS. In some cases, the subject being treated has a genetic predisposition to developing ALS. For example, the subject being treated has a mutation in the SOD1 gene, the ALS2 gene, the VAPB gene, the SETX gene, the TDP-43 gene, the FUS / TLS gene, the C9orf72 gene, and / or the OPTN gene.

[0107] Provided herein are methods for treating ALS, the methods comprising administering an expression construct, vector, or pharmaceutical composition disclosed herein to a subject in need thereof, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS / TLS gene. In some embodiments, an expression construct, vector, or pharmaceutical composition described herein is provided for use in a method for treating a neurological disease, including, but not limited to, ALS or one or more symptoms of ALS, in a subject in need thereof, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS / TLS gene. In some embodiments, a use of an expression construct, vector, or pharmaceutical composition described herein in the manufacture of a medicament for treating a neurological disease, including, but not limited to, ALS or one or more symptoms of ALS, in a subject in need thereof, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS / TLS gene. In embodiments, the subject in need of a method disclosed herein (including administration of a vector or pharmaceutical composition disclosed herein) does not have a mutation in the SOD1 gene.

[0108] Provided herein are methods for reducing TDP43 toxicity in a subject in need thereof, the methods comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In some embodiments, provided are expression constructs, vectors, or pharmaceutical compositions described herein for use in methods for reducing TDP43 toxicity in a subject in need thereof. In some embodiments, provided is use of an expression construct, vector, or pharmaceutical composition described herein in the manufacture of a medicament for reducing TDP43 toxicity in a subject in need thereof.

[0109] Provided herein are methods for reducing FUS / TLS toxicity in a subject in need thereof, the methods comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In some embodiments, provided are expression constructs, vectors, or pharmaceutical compositions described herein for use in methods for reducing FUS / TLS toxicity in a subject in need thereof. In some embodiments, provided is use of an expression construct, vector, or pharmaceutical composition described herein in the manufacture of a medicament for reducing FUS / TLS toxicity in a subject in need thereof.

[0110] Provided herein are methods for reducing C9orf72 toxicity in a subject in need thereof, the methods comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In some embodiments, provided are expression constructs, vectors, or pharmaceutical compositions described herein for use in methods for reducing C9orf72 toxicity in a subject in need thereof. In some embodiments, provided is use of an expression construct, vector, or pharmaceutical composition described herein in the manufacture of a medicament for reducing C9orf72 toxicity in a subject in need thereof.

[0111] Provided herein are methods for preventing or delaying the onset or progression of a neurological disease (including a neurological disease disclosed herein, such as ALS or FTD), the method comprising administering an expression construct, vector, or pharmaceutical composition disclosed herein to a subject in need thereof, wherein the subject has a mutation in the SOD1 gene, TDP-43 gene, or FUS / TLS gene. In embodiments, the subject does not have a mutation in the SOD1 gene. In some embodiments, provided are expression constructs, vectors, or pharmaceutical compositions described herein for use in methods for preventing or delaying the onset or progression of a neurological disease (including a neurological disease disclosed herein, such as ALS or FTD) in a subject in need thereof. In some embodiments, provided is use of an expression construct, vector, or pharmaceutical composition described herein in the manufacture of a medicament for preventing or delaying the onset or progression of a neurological disease (including a neurological disease disclosed herein, such as ALS or FTD) in a subject in need thereof.

[0112] Provided herein are methods for preventing or delaying the onset or progression of TDP43 toxicity in a subject in need thereof, the methods comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In some embodiments, provided are expression constructs, vectors, or pharmaceutical compositions disclosed herein for use in methods for preventing or delaying the onset or progression of TDP43 toxicity in a subject in need thereof. In some embodiments, provided is use of an expression construct, vector, or pharmaceutical composition described herein in the manufacture of a medicament for preventing or delaying the onset or progression of TDP43 toxicity in a subject in need thereof.

[0113] Provided herein are methods for preventing or delaying the onset or progression of FUS / TLS toxicity in a subject in need thereof, the methods comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In some embodiments, provided are expression constructs, vectors, or pharmaceutical compositions described herein for use in methods for preventing or delaying the onset or progression of FUS / TLS toxicity in a subject in need thereof. In some embodiments, provided is use of an expression construct, vector, or pharmaceutical composition described herein in the manufacture of a medicament for preventing or delaying the onset or progression of FUS / TLS toxicity in a subject in need thereof.

[0114] Provided herein are methods for preventing or delaying the onset or progression of C9orf72 toxicity in a subject in need thereof, the methods comprising administering to the subject an expression construct, vector, or pharmaceutical composition disclosed herein. In some embodiments, provided are expression constructs, vectors, or pharmaceutical compositions described herein for use in methods for preventing or delaying the onset or progression of C9orf72 toxicity in a subject in need thereof. In some embodiments, provided is use of an expression construct, vector, or pharmaceutical composition described herein in the manufacture of a medicament for preventing or delaying the onset or progression of C9orf72 toxicity in a subject in need thereof.

[0115] Combination therapy In some embodiments, the expression constructs or vectors described herein are administered to a subject in combination with one or more additional therapies to treat a neurological disease, including, but not limited to, ALS or one or more symptoms of ALS. In some embodiments, an expression construct or vector described herein is provided for use in a method of treating a neurological disease, including, but not limited to, ALS or one or more symptoms of ALS, in a subject in need of such treatment. In some embodiments, the use of an expression construct or vector described herein in the manufacture of a medicament for treating a neurological disease, including, but not limited to, ALS or one or more symptoms of ALS, in a subject in need of such treatment is provided. For example, the expression construct or vector may be administered in combination with riluzole (Rilutek®, Sanofi-Aventis, Bridgewater, NJ), baclofen, diazepam, trihexyphenidyl, amitriptyline, or sodium phenylbutyrate / taurursodiol (Relyvrio®).

[0116] In some embodiments, the combined administration of the expression construct or vector and the second agent results in a greater degree of amelioration of ALS or its symptoms than that produced by either the expression construct or vector or the second agent alone. The difference between the combined effect and the effect of each agent alone can be statistically significant.

[0117] In some embodiments, co-administration of an expression construct or vector with a second agent allows the second agent to be administered at a reduced dose, a reduced number of doses, and / or a reduced dosing frequency compared to the standard approved dosing regimen for the second agent. For example, the standard approved regimen for Rilutek® is 50 mg every 12 hours. Thus, when administered in combination with an expression construct or vector, a therapeutically effective amount of Rilutek® may be at a dosage of less than about 50 mg and / or more frequently than about every 12 hours.

[0118] In some embodiments, immunosuppressants known to those skilled in the art may be administered to a subject in combination with an expression construct or vector described herein. Exemplary immunosuppressants include, but are not limited to, cyclosporine, FK506, rapamycin, CTLA4-Ig, anti-TNF agents (such as etanercept), daclizumab (e.g., Zenapax™), anti-CD2 agents, anti-CD4 agents, and anti-CD40 agents.

[0119] Route and method of administration Methods of administration include, but are not limited to, intracisternal, intracerebroventricular, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intrathecal, intravaginal, transdermal, rectal, by inhalation, or topical, particularly to the ear, nose, eye, or skin. The mode of administration is left to the discretion of the practitioner.

[0120] In some cases, the expression constructs or vectors disclosed herein can effectively cross the blood-brain barrier and enter the brain. In other cases, the expression constructs or vectors disclosed herein can be delivered using techniques designed to enable or enhance the ability of the formulation to cross the blood-brain barrier. Such techniques are known in the art (e.g., WO89 / 10134, Cloughesy et al., J. Neurooncol. 26:125-132 (1995), and Begley, J. Pharm. Pharmacol. 48:136-146 (1996)). Components of the formulation can also be modified (e.g., chemically) using methods known in the art to facilitate their entry into the central nervous system (CNS). For example, physical methods of transporting a composition across the blood-brain barrier include, but are not limited to, bypassing the blood-brain barrier entirely or creating an opening in the blood-brain barrier. Methods of circumvention include, but are not limited to, direct injection into the brain (see, e.g., Papanastassiou et al., Gene Therapy 9:398-406 (2002)) and implantation of a delivery device into the brain (see, e.g., Gill et al., Nature Med. 9:589-595 (2003) and Gliadel Wafers™, Guildford Pharmaceutical).Methods for creating openings in the barrier include, but are not limited to, ultrasound (see, e.g., U.S. Patent Publication No. 2002 / 0038086), osmotic pressure (e.g., by administration of hypertonic mannitol (Neuwelt, EA, Implications of the Blood-Brain Barrier and Its Manipulation, Vols 1 & 2, Plenum Press, NY (1989))), permeabilization with, for example, bradykinin or permeabilizing agent A-7 (see, e.g., U.S. Patent Nos. 5,112,596, 5,268,164, 5,506,206, and 5,686,416), and transfection of neurons across the blood-brain barrier with expression constructs and vectors containing a gene encoding UPF1 (see, e.g., U.S. Patent Publication No. 20030083299).

[0121] Lipid-based methods can also be used to transport the expression constructs or vectors disclosed herein across the blood-brain barrier. Exemplary, non-limiting methods include encapsulating the expression constructs or vectors in liposomes bound to a targeting agent (e.g., an antibody that binds to a receptor on the vascular endothelium of the blood-brain barrier) (see, e.g., U.S. Patent Publication No. 20020025313). In certain other embodiments, the targeting agent is coated with low-density lipoprotein particles (see, e.g., U.S. Patent Publication No. 20040204354) or apolipoprotein E (see, e.g., U.S. Patent Publication No. 20040131692).

[0122] In some embodiments, the expression constructs or vectors described herein are delivered to the CNS of a subject in need of treatment, for example, by administration into the cerebrospinal fluid (CSF). As used herein, intrathecal administration (also referred to as intrathecal injection) refers to injection into the spinal canal (the intrathecal space surrounding the spinal cord). Various techniques can be used, including, but not limited to, burr hole or lateral ventricular injection via the cisterna magna or lumbar puncture. Exemplary methods are described in Lazorthes et al., Adv. Tech. Stand. Neurosurg. 18:143-192 (1991) and Omaya, Cancer Drug Deliv. 1:169-179 (1984).

[0123] In some cases, an expression construct or vector described herein is administered locally. This can be achieved, for example, by local infusion during surgery, by topical application (e.g., in a cream or lotion), by injection, by catheter, by suppository or enema, or by implant, which is a porous, non-porous, or gel-like material, including membranes such as silastic membranes or fibers. In some situations, an expression construct or vector described herein is introduced into the central nervous system, circulatory system, or gastrointestinal tract by any suitable route, including intraventricular injection, intrathecal injection, paraspinal injection, epidural injection, enema, and injection adjacent to a peripheral nerve.

[0124] The compositions described herein can be administered as a single dose or multiple doses. Such compositions can be administered at regular intervals depending on the nature, severity, and extent of the subject's condition (e.g., ALS). In some embodiments, a therapeutically effective amount of an expression construct or vector is administered intrathecally at regular intervals (e.g., once a year, once every six months, once every five months, once every three months, every two months, every other month (every month), every month (every month), every other week (every two weeks), or every week).

[0125] The amount of the expression construct or vector described herein that is effective in treating a disease can be determined using standard clinical techniques known to those skilled in the art. In addition, in vitro or in vivo assays can optionally be used to help identify optimal dosage ranges. The precise dose employed will also depend on the route of administration, the condition, the severity of the condition being treated, and various physical factors related to the individual being treated, and can be decided according to the judgment of a medical professional.

[0126] An effective amount of rAAV carrying a nucleic acid sequence encoding UPF1 under the control of a promoter is, for example, about 1×10 9 ~Approx. 1×10 14 The rAAV may be present in a range of about 1 x 10 rAAV genome particles (vg) / kg body weight. A "genome particle" is defined herein as an AAV capsid containing a single-stranded DNA molecule that can be quantified by a sequence-specific method (such as qPCR or ddPCR). In some embodiments, the rAAV is present in a range of about 1 x 10 12 ~Approx. 1×10 13 In some embodiments, the rAAV is administered at about 5 x 10 11 ~Approx. 5×10 12 In some embodiments, the rAAV is administered in a total of about 7.5 x 10 vg / mL of cerebrospinal fluid (CSF) volume per patient. 13 ~7.5×10 14 It is administered in vg.

[0127] In some embodiments, the rAAV is about 1 x 10 11 ~Approx. 1×10 14 rAAV genome particles (vg) / kg body weight are administered to animals.

[0128] In some embodiments, the rAAV genome particles are provided in a volume of about 20 uL to about 50 mL. In some embodiments, the rAAV genome particles are provided in a volume of about 30 uL to about 30 mL. In some embodiments, the rAAV genome particles are provided in a volume of about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 200, about 300, about 400, about 500, about 600, about 700, about 800, about 900, or about 1000 uL. In some embodiments, the rAAV genome particles are provided in a volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 mL.

[0129] Still other doses within these ranges can be selected by the attending physician. It is understood that for any particular subject, specific dosage regimens can be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the expression constructs or vectors, and that dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed disclosure.

[0130] The expression constructs or vectors disclosed herein can also be advantageously provided to cells ex vivo, followed by administering live cells to a subject. Methods for treating disease by transplanting cells modified to express recombinant proteins are also well known. See, for example, U.S. Patent No. 5,399,346, which discloses a method for introducing nucleic acids into primary human cells for introduction into humans. In some embodiments, the use of human cells for ex vivo therapy is preferred, although other cells, such as bacterial cells, may be transplanted into a subject's vasculature to continuously release therapeutic agents. See, for example, U.S. Patent Nos. 4,309,776 and 5,704,910.

[0131] Manufactured Products and Kits Kits or articles of manufacture for use in the methods described herein are also provided. In embodiments, the kits include a composition described herein (e.g., a composition for delivering a UPF1-encoding transgene) in suitable packaging. Suitable packaging for the compositions described herein (e.g., injectable ophthalmic compositions) is known in the art and includes, for example, vials (e.g., sealed vials), containers, ampoules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles of manufacture may be further sterilized and / or sealed.

[0132] Kits containing the compositions described herein are also provided. These kits may further include instruction(s) regarding methods of using the compositions, such as the uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for administering the compositions or performing any of the methods described herein. For example, in some embodiments, the kits include an rAAV for expressing a transgene encoding UPF1 in target cells, a pharmaceutically acceptable carrier suitable for injection, and one or more of a buffer, diluent, filter, needle, syringe, and package insert with instructions for performing the injection.

[0133] All methods described herein may be performed in any suitable order unless otherwise indicated herein or clearly contradicted by context. For any of the methods provided, the method steps may occur simultaneously or sequentially. When method steps occur sequentially, the steps may occur in any order unless otherwise specified.

[0134] Where the method includes a combination of steps, unless otherwise stated herein, each and every combination or subcombination of steps is encompassed within the scope of the present disclosure.

[0135] It is understood that this invention is not limited to the particular molecules, compositions, methodologies, or protocols described, as these may vary. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this invention. Furthermore, it should be understood that the disclosure of the invention herein includes all possible combinations of such particular features. For example, if a particular feature is disclosed in connection with a particular aspect or embodiment of the invention, or with a particular claim, that feature can also be used in combination with and / or in connection with other specific aspects and embodiments of the invention, and in the invention generally, to the extent possible.

[0136] All other referenced patents and applications are incorporated herein by reference in their entirety. Furthermore, to the extent that the definition or use of a term in a reference incorporated herein by reference is inconsistent with or contradicts the definition of that term provided herein, the definition of that term provided herein shall apply and the definition of that term in the reference shall not apply.

[0137] To facilitate a better understanding of the present invention, the following examples of specific embodiments are given, which should not be construed as limiting or defining the entire scope of the invention. [Example]

[0138] Example 1: AAV Vector Engineering and Screening An enhanced UPF1 expression construct was designed by rationally optimizing cis-regulatory elements, including: (1) an enhancer (size-optimized, tissue-specific, and potent), (2) a promoter (size-optimized, tissue-specific, and potent), (3) a 5' UTR (translation control motifs, mRNA stabilization motifs), (4) a UPF1 coding sequence (codon-optimized), (5) post-transcriptional regulatory elements (translation efficiency, mRNA stability, tissue detargeting motifs, and mRNA translocation enhancement), and (6) a polyadenylation signal sequence (enhancing RNA stability). The vector "RK" (Figure 1B), used in Jackson et al. (2015), was used as a control.

[0139] Vector development DNA fragments consisting of enhancer / promoter combinations and cis-regulatory elements such as the 5' UTR, as well as posttranscriptional regulatory elements (including the WPRE) and poly(A) sequences, were synthesized (using VectorBuilder or GenScript). In addition to the wild-type UPF1 codon set, two additional codon sets were synthesized: "opti" and "co2." The "opti" codon set was optimized based on the codon adaptation index (CAI) using a human codon usage table. The "co2" codon set was optimized based on minimizing the presence of CpGs and sequences predicted to activate host immunity through Toll-like receptor 9 (TLR9) signaling. The enhancer / promoter, other cis-regulatory elements, and UPF1 coding sequences were cloned into AAV expression vectors in various combinations (Table 1) to minimize construct size and increase vector efficacy. For sequences, see Tables 2 and 6-8. SEQ ID NO: 49 was not assigned to the sequence. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 2-1] [Table 2-2]

[0140] Cell culture and transfection Low-passage HEK293 (ATCC) and N2A (ATCC) cells were routinely cultured in Opti-MEM™ with GlutaMAX™ formulation (Gibco) supplemented with 5% fetal bovine serum (FBS) and penicillin / streptomycin (Gibco) at 1 × 10 per well of a 24-well plate. 5 Cells were seeded at an average density of 1000 cells per well to achieve 60-90% confluence at the time of transfection. Approximately 24 hours after plating, cells were transfected using TurboFect transfection reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. Typically, 1.5 µg of DNA of the UPF1 reporter construct was transfected per well. pcDNA3.1-EGFP plasmid was transfected as a control. After 48 hours, cells were mechanically harvested and pelleted by centrifugation at 300 x g for 5 minutes. The pellet was stored at -80°C.

[0141] Western blotting For Western blotting experiments, pellets were thawed on ice and then lysed using CST lysis buffer (Cell Signaling Technology) supplemented with protease inhibitors (Thermo Fisher) and universal nuclease (Pierce) for cell lysis. Soluble proteins were extracted by high-speed centrifugation, and concentrations were determined by the BCA (bicinchoninic acid) assay (Thermo Fisher) against a bovine serum albumin (BSA) standard curve (Thermo Fisher). The concentration of each sample was adjusted to the same target concentration using phosphate-buffered saline ("PBS") at pH 7.2–7.4.

[0142] Samples were diluted in lithium dodecyl sulfate (LDS) buffer supplemented with 100 mM dithiothreitol (DTT) in preparation for reducing SDS-PAGE. Samples were boiled at 95°C for 10 minutes and allowed to cool to room temperature (RT). Each sample was then loaded onto 4-15% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad) in Tris-glycine-SDS ("TGS") buffer at the same final protein concentration and run at 150V for 45-60 minutes based on migration of a prestained ladder (VWR, #102971-126). Transfer to nitrocellulose membranes was completed using the Bio-Rad Trans-Blot Turbo Transfer System's high molecular weight protocol (instrument settings: 1.3A, 21V, 12 minutes), with the device pre-cooled to 4°C.

[0143] Nitrocellulose membranes were cut based on band size (124 kDa for UPF1 and 42 kDa for actin) and blocked in pre-made buffer (Licor, #103749-018) for 1 hour at room temperature. They were then incubated overnight at 4°C in a solution of Rb α UPF1 monoclonal antibody (Abcam, #133564, 1:10,000 dilution) or Ms α β-actin monoclonal antibody (VWR, #102673-370, 1:10,000 dilution) in pre-made antibody buffer (Licor, #103761-208). The next day, blots were washed three times with PBS-T and then incubated in donkey infrared secondary antibody (Licor) for 1 hour, protected from light. After three PBS-T washes followed by a final wash with PBS, blots were scanned on a Licor Odyssey CLx.

[0144] The raw data was exported to Microsoft Excel. The intensity data from the UPF1 band was normalized to the β-actin control band of the corresponding sample, and this UPF1 / actin ratio for each sample was normalized to the ratio of the EGFP transfection control (representing the endogenous UPF1 protein level), thereby providing the UPF1 overexpression level relative to the transfection control. The results were plotted in GraphPad Prism 9.

[0145] result Protein expression levels quantified by Western blotting for various optimized UPF1 expression constructs after transfection in Neuro2A (N2A) cells or HEK293T cells, respectively. As shown in Tables 1 and 3 and Figure 1, optimization of cis-regulatory elements (e.g., promoter, UTR) within the UPF1 expression constructs substantially reduced AAV vector size while improving expression efficiency. [Table 3-1] [Table 3-2]

[0146] Example 2: UPF1 expression constructs protect induced neurons (i-neurons) against TDP-43 toxicity. The i-neuron model can be used as a model system for neurodegenerative diseases. We first investigated the ability of a UPF1-expressing construct to protect against TDP-43 toxicity. Briefly, iPSC-derived neural progenitor cells (NPCs) with a WT phenotype for TDP43 or the isogenic disease mutation M337V were plated and differentiated into motor neurons. Neurons were transduced with AAV9 containing the optimized UPF1 construct at different dose levels with an MOI of 50, 100, or 250K and then monitored for survival.

[0147] i Neuron differentiation and transduction Day 0. Induced pluripotent stem cells (iPSCs) were washed in PBS and incubated in prewarmed Accutase (Sigma A6964) at 37°C for 8 minutes. Four volumes of E8 medium were added to the plate, and the cells were harvested and pelleted at 200 x g for 5 minutes. The medium was aspirated, and the pellet was resuspended in 1 ml of fresh E8 medium. Cells were counted using a hemocytometer, diluted, and plated at a density of 20,000 cells / ml in E8 medium containing ROCK inhibitor (Y-27632) and incubated overnight at 37°C. Day 1. The medium was changed to N-2 medium (1x N-2 supplement (Gibco 17502-048), 1x NEAA supplement (Gibco 11140-050), 10 ng / ml BDNF (Peprotech 450-02), 10 ng / ml N-T3 (Peprotech 450-03), 0.2 μg / ml laminin (Sigma L2020), 2 mg / ml doxycycline (Sigma D3447) in E8 medium) on day 2. The medium was changed to transition medium (1x N2 supplement, 1x NEAA supplement, 10 ng / ml BDNF, 10 ng / ml N-T3, 0.2 μg / ml laminin, 2 mg / ml doxycycline in half E8 medium, half DMEM / F12 (Gibco 11320-033) on day 3). The medium was changed to B-27™ medium (1x B-27™ supplement (Gibco 17504-044), 1x GlutaMAX™ supplement (Gibco 35050-061), 10 ng / ml BDNF, 10 ng / ml N-T3, 0.2 μg / ml laminin, 2 mg / ml doxycycline, and 1x Culture One (Gibco A33202-01) in Neurobasal-A (Gibco 12349-015)). On day 6, cells were transduced with AAV9 at an MOI of 50K, 100K, or 250K. Cells were maintained in the same medium for the remainder of the experiment.

[0148] Longitudinal fluorescence microscopy and image analysis Automated longitudinal fluorescence microscopy was initiated on day 14 for 10 days. Briefly, images were acquired with an inverted Nikon Ti microscope equipped with a 20x objective, a PerfectFocus system, a Lambda XL xenon lamp (Sutter) with a 5 mm liquid light guide (Sutter), and an Andor iXon3 897 EMCCD camera or an Andor Zyla4.2(+) sCMOS camera. All stage, shutter, and filter wheel movements were performed by custom code written in publicly available software (μManager, ImageJ).

[0149] Image processing was performed using scripts written in Python on the ImageJ macro language. Survival analysis was performed manually to identify surviving neurons and track them over the imaging interval, and cell death was determined for each neuron by tracking the somatic degeneration process.

[0150] result UPF1 expression by AAV9 transduction reduced the lethality risk of all UPF1 variants at different dose levels (Figures 2A-2F). V5-UPF1_11 was the most potent vector protecting against TDP-43 toxicity at all dose levels, demonstrating maximal survival at the lowest MOI of 50K (Figure 2C).

[0151] Example 3: UPF1 expression constructs protect neurons from C9orf72 toxicity Next, we examined the ability of the UPF1 expression construct to protect against C9orf72 toxicity in C9orf72-expressing i-neurons. C9orf72 i-neurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged using a semi-automated microscope. A custom script was used to identify neuronal cell bodies and assign each cell a unique ID. Neuronal loss was indicated by cell body lysis or rounding, dendritic beading, or loss of fluorescence. The time to death of each cell was used to generate cumulative hazard plots showing the risk of neuronal death over time in each population. For more detailed materials and methods, see Example 2.

[0152] result: UPF1 expression by AAV transduction reduced the lethality risk of most UPF1 variants at different dose levels (Figures 3A-3F). In the i-neuron model (Figure 3D), V6-UPF_6 was the most potent vector for reducing C9orf72 toxicity. V5-UPF1_11 was also a potent vector that protected against C9orf72 toxicity at the two lowest MOIs of 50K and 100K, indicating that this vector also protects against additional forms of ALS toxicity (Figure 3C).

[0153] Example 4: Expression of UPF1 variants in patient-derived C9orf72 iPSNs cell culture iPSCs were grown in 6-well plates on rhLaminin-521 (Thermo Fisher) using Essential 8™ medium (Gibco) and passaged using Versene (Gibco). Wild-type iPSCs were derived from human neonatal fibroblasts (Lonza) by nucleofection with OCT3 / 4, hSK, hUL, and mIR. C9orf72 iPSCs were obtained from the NINDS (National Institute of Neurological Disorders and Stroke) cell line ND50000. Cell cultures were maintained at 37°C and 5% CO2.

[0154] Motor neuron differentiation Motor neurons were derived from iPSCs according to Hall, C.E., et al. Progressive motor neuron pathology and the role of astrocytes in a human stem cell model of VCP-related ALS. Cell Reports 19, 1739-1749 (2017). Briefly, iPSCs were grown to confluency and induced for neural induction using N-2 / B2-7™ medium (equal volumes of Neurobasal Medium and DMEM / F12 + GlutaMAX, plus 1% B-27™ supplement, 0.5% N-2 supplement, 0.5% non-essential amino acids, 1 mM L-glutamine (all from Gibco), and 2.5 μg / ml insulin (Sigma)) supplemented with 1 μM dosomorphin (Millipore), 2 μM SB431542 (Tocris Bioscience), and 3 μM CHIR99021 (Miltenyi Biotec). On day 8, the neuroepithelial layer was dissociated with 1 mg / ml dispase (Gibco), removed from the underlying cells, and plated onto laminin-coated plates. Neuroepithelia were patterned in N-2 / B2-7™ with 0.5 μM retinoic acid and 1 μM purmorphamine until day 14, at which point they were treated with N-2 / B2-7™ + 1 μM purmorphamine for 4 days and N-2 / B2-7™ + 0.1 μM Compound E until terminal differentiation.

[0155] Transduction For UPF1 vector transduction assays, cells were seeded into 12-well plates and subjected to terminal differentiation at a density of 200,000 cells / well. On day 4 of terminal differentiation, AAV was added to the medium at an MOI of 500,000. Cells were harvested using Accutase (Stemcell) 7 days after transduction.

[0156] RT-qPCR RNA was extracted from the harvested cells using the RNeasy Plus Mini Kit (Qiagen). cDNA was then transcribed from 250 ng of purified RNA using Superscript IV VILO Master Mix (Thermo Fisher). RT-qPCR was performed using a Taqman primer / probe set. Exogenous UPF1 gene levels were measured by targeting the WPRE region of the synthetic UPF1 transcript. Each sample was compared to β-actin and GAPDH control reactions.

[0157] UPF1 primer (5'-3'): Forward primer: TGGTATTCTTAACTATGTTGCTCCT (SEQ ID NO: 57)

[0158] Reverse primer: AAGCCATACGGGAAGCAATAG (SEQ ID NO: 58)

[0159] Probe: FAM-ACGCTATGTGGATACGCTGCTTT (SEQ ID NO: 59)

[0160] result The fold enrichment of exogenous UPF1 RNA levels in C9Orf72 iPSNs after transduction of each of the UPF1 variant constructs was compared to untransduced cells as measured by qRT-PCR. Figures 4A and 4B show the results of two independent experiments.

[0161] Example 5: Expression of UPF1 variants increases motor neuron survival in a FUS-ALS knock-in mouse model Mouse strains and procedures Mutant FUS knock-in mice were generated as described in Korobeynikov et al., Antisense oligonucleotide silencing of FUS expression as a therapeutic approach in amyotrophic lateral sclerosis, Nat Med. 2022 Jan;28(1):104-116. For ICV injection, neonatal animals were first anesthetized on ice, and then 5 μL of AAV2 retrovirus at a concentration of 1.0 × 10^13 vg / mL was injected into the right lateral ventricle (2 mm anterior, 1 mm anterolateral) using a Hamilton Neuro syringe. After injection, animals were placed on a heating pad and monitored until recovery. The VP1 capsid variant AAV2 retrovirus is described in PCT publication WO2017218842 (SEQ ID NO: 44 of WO2017218842), which is incorporated herein in its entirety.

[0162] To collect fixed tissue samples, animals were perfused transcardially with PBS-heparin solution, followed by administration of 4% paraformaldehyde, and brain and spinal cord tissues were dissected.

[0163] Immunofluorescence Spinal cord samples were sectioned at 70 μm thickness on a Leica VT 1000S vibratome. Tissue sections were incubated in primary antibodies (1:250 chicken anti-GFP, Thermo Fisher A10262; 1:250 goat anti-ChAT, Millipore AB144P; 1:250 rabbit anti-Iba1, Wako 019-19741; 1:300 rabbit anti-GFAP, Agilent Z0334) diluted in 5% normal donkey serum in Tris-buffered saline with 0.5% Triton X-100 (TBS-T) overnight at 4°C. Sections were then washed three times with TBS-T and incubated for 1 hour with the corresponding secondary antibodies (Alexa 488 anti-chicken, Thermo Fisher; Alexa 594 anti-goat, Thermo Fisher A110058; Alexa 647 anti-rabbit, Thermo Fisher A31573) at 1:100. After three washes with TBS-T, sections were mounted in aqueous medium (Fluoromount G, Southern Biotech) and imaged using a Leica SP8 confocal microscope. Images were analyzed using the LAS X and ImageJ software packages.

[0164] result To evaluate the ability of UPF1 expression constructs to inhibit FUS-associated toxicity, FUS-ALS knock-in mice (MN-P517L / Δ14) were treated at P1 with intracerebroventricular (ICV) injection of AAV2 retroviruses expressing UPF1 variant constructs (V1, V3-9). The number of ChAT-positive motor neurons (MNs) at lumbar levels 4 and 5 at P180 was normalized to the number of MNs in C14 (WT) mice expressing GFP control. The results are shown in Figure 5.

[0165] A summary of the in vitro and in vivo experiments of constructs V1 and V3-V8 can be found in Tables 4 and 5.

[0166] A summary of the nucleic acid and protein sequences disclosed herein can be found in Tables 6-8. [Table 4]

Table 5

Table 6-1

Table 6-2

Table 6-3

Table 6-4

Table 6-5

Table 6-6

Table 6-7

Table 6-8

Table 6-9

Table 6-10

Table 6-11

Table 6-12

Table 6-13

Table 6-14

Table 6-15

Table 6-16

Table 6-17

Table 6-18

Table 6-19

Table 7-1

Table 7-2

Table 7-3

Table 7-4

Table 7-5

Table 7-6

Table 8-1

Table 8-2

Table 8-3

Table 8-4

Table 8-5

Table 8-6

Table 8-7

Table 8-8

Table 8-9

Table 8-10

Table 8-11

Table 8-12

Table 8-13

Table 8-14

Table 8-15

Table 8-16

Table 8-17

Table 8-18

Table 8-19

Table 8-20

Table 8-21

Table 8-22

Table 8-23

Table 8-24

Table 8-25

Table 8-26

Table 8-27

Table 8-28

Table 8-29

Table 9-1

Table 9-2

Claims

1. (a) a promoter; (b) a sequence encoding UPF1 operably linked to the promoter; and (c) a polyadenylation signal.

2. 2. The expression construct of claim 1, wherein the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 3-17.

3. 3. The expression construct of claim 2, wherein the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 3-17.

4. 4. The expression construct of claim 3, wherein the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 3-17.

5. 5. The expression construct of claim 4, wherein the promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 3-17.

6. 2. The expression construct of claim 1, wherein the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 5-7.

7. 7. The expression construct of claim 6, wherein the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5-7.

8. 8. The expression construct of claim 7, wherein the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 5-7.

9. 9. The expression construct of claim 8, wherein the promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 5-7.

10. 2. The expression construct of claim 1, wherein the promoter comprises a sequence that is at least 80% identical to SEQ ID NO:

7.

11. 11. The expression construct of claim 10, wherein the promoter comprises a sequence that is at least 90% identical to SEQ ID NO:

7.

12. 12. The expression construct of claim 11, wherein the promoter comprises a sequence that is at least 95% identical to SEQ ID NO:

7.

13. 13. The expression construct of claim 12, wherein the promoter comprises SEQ ID NO:

7.

14. 14. The expression construct of any one of claims 1 to 13, wherein the sequence encoding UPF1 is codon-optimized.

15. 14. The expression construct of any one of claims 1 to 13, wherein the sequence encoding UPF1 comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 19 to 22.

16. 16. The expression construct of claim 15, wherein the sequence encoding UPF1 comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 19-22.

17. 17. The expression construct of claim 16, wherein the sequence encoding UPF1 comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 19-22.

18. 18. The expression construct of claim 17, wherein the sequence encoding UPF1 comprises a sequence selected from the group consisting of SEQ ID NOs: 19-22.

19. 14. The expression construct of any one of claims 1 to 13, wherein the sequence encoding UPF1 comprises a sequence that is at least 80% identical to SEQ ID NO:

21.

20. 20. The expression construct of claim 19, wherein the sequence encoding UPF1 comprises a sequence that is at least 90% identical to SEQ ID NO:

21.

21. 21. The expression construct of claim 20, wherein the sequence encoding UPF1 comprises a sequence that is at least 95% identical to SEQ ID NO:

21.

22. 22. The expression construct of claim 21, wherein the sequence encoding UPF1 comprises SEQ ID NO:

21.

23. 10. An expression construct according to any one of the preceding claims, wherein the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 80% identical to SEQ ID NO:

38.

24. 24. The expression construct of claim 23, wherein the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 90% identical to SEQ ID NO:

38.

25. 25. The expression construct of claim 24, wherein the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 95% identical to SEQ ID NO:

38.

26. 26. The expression construct of claim 25, wherein the sequence encoding UPF1 encodes a protein comprising SEQ ID NO:

38.

27. 10. The expression construct of any one of the preceding claims, wherein the expression construct further comprises a 5' untranslated region (UTR).

28. 28. The expression construct of claim 27, wherein the 5'UTR comprises a sequence that is at least 90% identical to SEQ ID NO:

18.

29. 29. The expression construct of claim 28, wherein the 5'UTR comprises a sequence that is at least 95% identical to SEQ ID NO:

18.

30. 30. The expression construct of claim 29, wherein the 5'UTR comprises SEQ ID NO:

18.

31. 10. The expression construct of any one of the preceding claims, wherein the expression construct further comprises a post-transcriptional regulatory element.

32. 32. The expression construct of claim 31, wherein the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 23-26.

33. 33. The expression construct of claim 32, wherein the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 23-26.

34. 34. The expression construct of claim 33, wherein the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 23-26.

35. 35. The expression construct of claim 34, wherein the post-transcriptional regulatory element comprises any one of SEQ ID NOs: 23-26.

36. 32. The expression construct of claim 31 , wherein the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:24 or SEQ ID NO:

25.

37. 37. The expression construct of claim 36, wherein the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:24 or SEQ ID NO:

25.

38. 38. The expression construct of claim 37, wherein the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:24 or SEQ ID NO:

25.

39. 39. The expression construct of claim 38, wherein the post-transcriptional regulatory element comprises SEQ ID NO:24 or SEQ ID NO:

25.

40. 32. The expression construct of claim 31 , wherein the post-transcriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:

24.

41. 41. The expression construct of claim 40, wherein the post-transcriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:

24.

42. 42. The expression construct of claim 41, wherein the post-transcriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:

24.

43. 43. The expression construct of claim 42, wherein the post-transcriptional regulatory element comprises SEQ ID NO:

24.

44. 10. The expression construct of any one of the preceding claims, wherein the expression construct further comprises a miRNA binding site (miRBS) that is at least 80% identical to SEQ ID NO:

27.

45. 45. The expression construct of claim 44, wherein the expression construct comprises a miRBS that is at least 90% identical to SEQ ID NO:

27.

46. 46. ​​The expression construct of claim 45, wherein the expression construct comprises a miRBS that is at least 95% identical to SEQ ID NO:

27.

47. 47. The expression construct of claim 46, wherein the expression construct comprises SEQ ID NO:

27.

48. 48. The expression construct of any one of claims 1 to 47, wherein the polyadenylation signal comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 28 to 30.

49. 49. The expression construct of claim 48, wherein the polyadenylation signal comprises a sequence that is at least 90% identical to any one of SEQ ID NOs: 28-30.

50. 50. The expression construct of claim 49, wherein the polyadenylation signal comprises a sequence that is at least 95% identical to any one of SEQ ID NOs: 28-30.

51. 51. The expression construct of claim 50, wherein the polyadenylation signal comprises any one of SEQ ID NOs: 28-30.

52. 48. The expression construct of any one of claims 1 to 47, wherein the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:

29.

53. 53. The expression construct of claim 52, wherein the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:

29.

54. 54. The expression construct of claim 53, wherein the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:

29.

55. 55. The expression construct of claim 54, wherein the polyadenylation signal comprises SEQ ID NO:

29.

56. A vector comprising an expression construct according to any one of claims 1 to 55.

57. 57. The vector of claim 56, wherein the vector is a viral vector.

58. 58. The vector of claim 57, wherein the vector is an AAV vector.

59. 56. A vector comprising a nucleic acid sequence comprising: (i) an expression construct according to any one of claims 1 to 55; and (ii) one or more inverted terminal repeats (ITRs).

60. 60. The vector of claim 59, wherein the nucleic acid sequence comprises a 5' ITR and a 3' ITR.

61. 61. The vector of claim 60, wherein the 5' ITR and the 3' ITR are derived from adeno-associated virus (AAV) serotype AAV2.

62. 62. The vector of claim 61, wherein the sequence of the 5' ITR is at least 80% identical to any one of SEQ ID NOs: 1, 54, or 55.

63. 63. The vector of claim 62, wherein the sequence of the 5' ITR is at least 90% identical to any one of SEQ ID NOs: 1, 54, or 55.

64. 64. The vector of claim 63, wherein the sequence of the 5' ITR is at least 95% identical to any one of SEQ ID NOs: 1, 54, or 55.

65. 65. The vector of claim 64, wherein the sequence of the 5' ITR comprises any one of SEQ ID NOs: 1, 54, or 55.

66. 66. The vector of any one of claims 60 or 62 to 65, wherein the sequence of the 3' ITR is at least 80% identical to SEQ ID NO: 2 or SEQ ID NO:

56.

67. 67. The vector of claim 66, wherein the sequence of the 3' ITR is at least 90% identical to SEQ ID NO:2 or SEQ ID NO:

56.

68. 68. The vector of claim 67, wherein the sequence of the 3' ITR is at least 95% identical to SEQ ID NO:2 or SEQ ID NO:

56.

69. 69. The vector of claim 68, wherein the sequence of the 3' ITR comprises SEQ ID NO:2 or SEQ ID NO:

56.

70. 61. The vector of claim 60, wherein the 5' ITR comprises SEQ ID NO:1 and the 3' ITR comprises SEQ ID NO:

2.

71. 10. A vector comprising the expression construct of claim 1, wherein the vector comprises a sequence that is 80% identical to any one of SEQ ID NOs: 32-37.

72. 72. The vector of claim 71, wherein the vector comprises a sequence that is 90% identical to any one of SEQ ID NOs: 32-37.

73. 73. The vector of claim 72, wherein the vector comprises a sequence that is 95% identical to any one of SEQ ID NOs: 32-37.

74. 74. The vector of claim 73, wherein the vector comprises any one of SEQ ID NOs: 32-37.

75. 10. A vector comprising the expression construct of claim 1, wherein the vector comprises a sequence that is 80% identical to SEQ ID NO:

34.

76. 76. The vector of claim 75, wherein the vector comprises a sequence that is 90% identical to SEQ ID NO:

34.

77. 77. The vector of claim 76, wherein the vector comprises a sequence that is 95% identical to SEQ ID NO:

34.

78. 78. The vector of claim 77, wherein the vector comprises SEQ ID NO:

34.

79. 71. The vector of any one of claims 58-70, wherein the vector comprises a capsid derived from AAV7m8, AAV9, AAV2-retro, or AAVrh.

10.

80. 71. The vector of any one of claims 58 to 70, wherein the vector comprises a capsid comprising capsid proteins from AAV2-retro and AAVrh.

10.

81. A cell comprising an expression construct according to any one of claims 1 to 55 or a vector according to any one of claims 56 to 80.

82. 81. A pharmaceutical composition comprising: (i) an expression construct according to any one of claims 1 to 55, or a vector according to any one of claims 56 to 80; and (ii) a pharmaceutically acceptable carrier.

83. 10. A method for reducing transactive response DNA binding protein 43 (TDP43) toxicity in a subject in need thereof, the method comprising administering to the subject a vector described in any one of claims 56 to 80, or a pharmaceutical composition described in claim 82.

84. 82. A method for reducing C9orf72 toxicity in a subject in need thereof, said method comprising administering to said subject a vector described in any one of claims 56 to 80, or a pharmaceutical composition described in claim 82.

85. 82. A method for reducing intrasarcoma fusion / liposarcoma translocation (FUS / TLS) toxicity in a subject in need thereof, the method comprising administering to the subject a vector described in any one of claims 56 to 80, or a pharmaceutical composition described in claim 82.

86. 82. A method of treating a neurodegenerative disease in a subject in need thereof, said method comprising administering to said subject a vector according to any one of claims 56 to 80, or a pharmaceutical composition according to claim 82.

87. 87. The method of claim 86, wherein the neurodegenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Alzheimer's disease (sporadic and familial), dementia with Lewy bodies with or without Alzheimer's disease, Down's syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson's disease with and without dementia, Parkinson's disease with LRKK2 mutations, Perry syndrome with DCTN1 mutations, ALS-Parkinsonism-Dementia Complex of Guam, Huntington's disease, and myopathy.

88. 88. The method of claim 87, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

89. 82. A method for treating a neurodegenerative disease associated with TDP43 toxicity in a subject in need of such treatment, the method comprising administering to the subject a vector described in any one of claims 56 to 80, or a pharmaceutical composition described in claim 82.

90. 82. A method for treating a neurodegenerative disease associated with C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject a vector according to any one of claims 56 to 80, or a pharmaceutical composition according to claim 82.

91. A method for treating a neurodegenerative disease associated with FUS / TLS toxicity in a subject in need of such treatment, the method comprising administering to the subject a vector described in any one of claims 56 to 80 or a pharmaceutical composition described in claim 82.

92. The method of any one of claims 83 to 91, wherein the subject is a human.

93. 93. The method of any one of claims 83 to 92, wherein the vector or pharmaceutical composition is administered by intracisternal administration.

Images