Enzymatic repair of cleaved RNA and method for detecting RNA

Abstract

The present disclosure relates to a method for enzymatically repairing nicked or at least partially cleaved RNA. The method includes providing a biological sample containing nicked or at least partially cleaved RNA, purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components, and treating the purified RNA with at least one of the following: (i) an enzyme exhibiting RNA 3' phosphatase or cyclic phosphatase activity, an enzyme exhibiting RNA 5' kinase activity, and an RNA ligase, or (ii) a 3'-5' RNA ligase, thereby forming repaired RNA from the nicked or at least partially cleaved RNA. The present disclosure also relates to a method for detecting RNA by enzymatically repairing the nicked or at least partially cleaved RNA and detecting the repaired RNA.

Description

[Technical Field]

[0001] This invention was made with government support under Grant No. UG3 / UH3CA241694 (Novel Separation Methods for exRNA Carriers: Extracellular Vesicles, Lipoprotein Particles, and Protein Aggregates) awarded by the National Institutes of Health (National Cancer Institute and Office of the Director). The United States Government has certain rights in this invention.

[0002] [CROSS-REFERENCE TO RELATED APPLICATIONS] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 402,523, filed August 31, 2022, which is incorporated herein by reference in its entirety.

[0003] [Sequence table] This application has been submitted in XML format and contains a Sequence Listing, which is incorporated herein by reference in its entirety. The XML copy was created on August 21, 2023, is named IPDM9PCT_SL.xml, and is 18625 bytes in size.

[0004] The present invention relates to enzymatic repair of nicked or partially cleaved RNA and methods for detecting RNA. [Background technology]

[0005] Nucleic acid-based disease monitoring (including diagnostics and prognostics) based on minimally invasive liquid biopsies has the potential to impact patient survival by detecting disease, recurrence, or resistance to treatment at early stages in patients, but has been primarily studied in the context of extracellular cell-free DNA (cfDNA).

[0006] Extracellular RNA (exRNA) can also reflect changes in gene expression across tissue and cell types, potentially providing more information than cfDNA. ExRNA circulating in human body fluids can predict disease before the onset of clinical symptoms. For example, exRNA has recently been successfully used to predict pre-eclampsia in pregnant women at a pre-symptomatic stage (Non-Patent Document 1).

[0007] However, exRNAs have been poorly studied, and fundamental knowledge about the types of exRNAs and their transporters in body fluids remains lacking. Research into the exRNA universe has revealed a population composed of nonvesicular ribosomes and full-length tRNAs (Non-Patent Document 2). Several studies have shown that exRNA profiles can contain tRNA halves to full-length tRNAs (Non-Patent Document 3). Furthermore, stress can induce the formation of intracellular tRNA half molecules, potentially upregulating extracellular tRNA half molecules within EVs (Non-Patent Document 4, Non-Patent Document 5). Once packaged in extracellular vesicles (EVs), these fragments can be transported to recipient cells (Non-Patent Document 6), where they can trigger pattern recognition receptor-mediated signaling (Non-Patent Document 7, Non-Patent Document 8). However, the majority of non-vesicular tRNA half molecules are generated directly in the extracellular space by endonucleolytic cleavage of extracellular full-length tRNAs (Non-Patent Document 3, Non-Patent Document 9, Non-Patent Document 2). Extracellular ribosomes can induce dendritic cell activation in vitro in an exRNA-dependent manner (Non-Patent Document 2).

[0008] Research on exRNA has largely focused on the idea that extracellular vesicles (EVs) protect exRNA from enzymatic degradation, because biological fluids contain numerous enzymes that degrade RNA. Nevertheless, it has long been known that the majority of exRNA circulating in human plasma or present in cell-conditioned media is not associated with EVs (Non-Patent Document 10, Non-Patent Document 11, Non-Patent Document 12). As a result of the robust ribonuclease activity that characterizes the extracellular space (Non-Patent Document 13), these non-vesicular exRNAs would be expected to be rapidly degraded if not protected by RNA-binding proteins. Therefore, it remains unclear how these non-vesicular exRNAs resist degradation, diffuse to recipient cells, induce downstream effects, or even remain measurable and serve as potential disease biomarkers. An explanation for some of these questions is provided in the present invention, in which the inventors have discovered a population of endogenously stable non-vesicular extracellular RNAs ("nicked exRNAs") that are characterized by the presence of broken phosphodiester bonds in their structure.

[0009] The challenge is that nicked exRNAs cannot be identified by conventional or currently available sequencing and / or amplification methods. Reverse transcriptase detaches upon exposure to broken phosphodiester bonds present in these RNAs. As a result, these RNAs are not represented in sequencing or RT-qPCR assays or appear as RNA fragments, thus losing important structural information and the physical association between the 5' and 3' fragments. [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Moufarrej et al., 2022 [Non-patent document 2] Tosar et al., 2020 [Non-patent document 3] Nechooshtan et al., 2020 [Non-patent document 4] Li et al., 2022 [Non-Patent Document 5] Tosar and Cayota, 2020 [Non-patent document 6] Gambaro et al., 2020 [Non-Patent Document 7] Pawar et al., 2020 [Non-patent document 8] Xiao et al., 2020 [Non-Patent Document 9] Sanadgol et al., 2022 [Non-Patent Document 10] Arroyo et al., 2011 [Non-Patent Document 11] Turchinovich et al., 2011 [Non-Patent Document 12] Tosar et al., 2015 [Non-Patent Document 13] Sorrentino, 2010 Summary of the Invention [Problem to be solved by the invention]

[0011] Thus, there remains a need in the art for effective methods to more accurately characterize these exRNAs, which were previously undetectable in biological samples due to limitations in currently available RNA detection technologies, to enable their detection and / or subsequent applications (e.g., reverse transcription, amplification, analysis, hybridization, sequencing, etc.). The present disclosure addresses this need. [Means for solving the problem]

[0012] One aspect of the present invention relates to a method for enzymatically repairing nicked or at least partially cleaved RNA, the method comprising providing a biological sample containing nicked or at least partially cleaved RNA, purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components, and subjecting the purified RNA to one of the following: and forming repaired RNA from the nicked or at least partially cleaved RNA by treatment with at least one of: (i) an enzyme exhibiting RNA 3' phosphatase or cyclic phosphatase activity, an enzyme exhibiting RNA 5' kinase activity, and an RNA ligase; or (ii) a 3'-5' RNA ligase.

[0013] Another aspect of the present invention relates to a method for detecting RNA from a biological sample, the method comprising: providing a biological sample containing nicked or at least partially cleaved RNA; purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; treating the purified RNA with at least one of the following enzymes: (i) an enzyme exhibiting RNA 3' phosphatase or cyclic phosphatase activity, an enzyme exhibiting RNA 5' kinase activity, and an RNA ligase; or (ii) a 3'-5' RNA ligase, thereby repairing at least a portion of the nicked or partially cleaved RNA; and detecting the repaired RNA.

[0014] Additional aspects, advantages, and features of the present invention are described herein and, in part, will become apparent to those skilled in the art from the discussion that follows or may be learned by practice of the invention. The invention disclosed in this application is not limited to any particular set or combination of aspects, advantages, and features. It is intended that various combinations of the stated aspects, advantages, and features constitute the invention disclosed in this application. [Brief explanation of the drawings]

[0015] [Figure 1] Figure 1 shows the results of identification of stable non-vesicular RNA. Northern blot of various rRNAs and tRNAs after incubating purified RNA from human cells in RPMI + 10% FBS for various amounts of time. [Figure 2] Naked tRNA half molecules are highly stable in human biological fluids. Figures A–C show Northern blots of several non-coding transcripts after incubating purified RNA from human cells in 10% FBS or with recombinant human RNase 1 (A), after incubation in human urine or 10% serum (B), or after incubation in undiluted human serum (C). T=0 corresponds to RNA spiked into serum and immediately placed on ice. [Figure 3] Figure 1 shows the results of RNA degradation with various concentrations of recombinant human RNase 1. (A) Northern blot analysis of TRIzol-purified total U2-OS RNA (NT) using a probe complementary to the 5' end of tRNAGly GCC after exposure to various concentrations of r-RNase 1 at 37°C for 60 minutes. (B) A cloverleaf diagram of human tRNAGly GCC-1 showing modified bases listed in the modomics database (http: / / genesilico.pl / modomics / ) and the predicted cleavage site based on the data presented in Example 1. [Figure 4] Northern blots corresponding to the assays shown in Figure 2A(A) and Figure 2B(B) are shown, but comparing the signals obtained using probes complementary to the 5' and 3' half molecules of tRNAGly GCC. [Figure 5]Figure 1 shows that the majority of tRNA half molecules identified by Northern blot are nicked tRNAs. tRNA half molecules were generated in vitro by incubating purified RNA from human cells with recombinant human RNase 1 for 60 minutes. (A) Northern blot analysis results for RNase 1-treated RNA incubated with T4 PNK, T4 PNK followed by T4 Rnl1, and T4 PNK followed by Rnl2, respectively. (B) Schematic diagram summarizing the repair strategy for nicked tRNAs. (C) 5' and 3' probes used in these assays, as well as a third probe targeting the anticodon loops of tRNAGly GCC and tRNAAsp GUC (ACL). The assays described in (A) were then used. (D) nicked tRNA formation was verified using the 5', 3', and ACL probes. Additional controls not included in (A) are also shown. NT: fragmented RNA not treated with the repair enzyme cocktail. Δ: heated. (-)PNK: T4 PNK lacking phosphatase activity. [Figure 6] FIG. 1 shows purification of RNase 1-treated RNA (with or without heat denaturation, Δ) by SPE according to the manufacturer's instructions (1 volume EtOH) or by adding twice the volume of ethanol to the binding buffer (2 volumes EtOH). [Figure 7]This figure shows that nicked tRNA protects tRNA half molecules from degradation, allowing them to be dissociated with phenol and repaired by RtcB. Figures A and B show that RNA purification with the miRNeasy Micro Kit (A) or TRIzol (TRI, B) impairs enzymatic (PNK + Rnl1) repair of nicked tRNA (light gray arrows). The right panel in B shows the size of the repair product estimated by the Rf method. Figure C shows the purification of RNase 1-treated RNA by SPE and re-exposure to RNase 1 with or without heating, followed by cooling of the RNA. Figure D shows a Northern blot of native gel separation of RNA purified by SPE, TRIzol, miRNeasy, or RNase 1-treated RNA heated before SPE purification. Figure E shows the one-step enzymatic repair of nicked tRNA using RtCB from Escherichia coli (E. coli). The right panel shows the size of the repair product estimated by the Rf method. For this and all subsequent figures, SPE was performed twice with the recommended volume of EtOH. [Figure 8]This shows that non-vesicular tRNA half molecules and intracellular tRNA-derived fragments circulating in serum are primarily nicked tRNA. (A) Purified RNA from arsenite-treated U2-OS cells was separated on a Superdex 75 column using an FPLC system. Inset: Northern blot of intracellular RNA demonstrating the presence of tRNA half molecules in the input. (A) Selected fractions from this separation are shown. (B)–(C) Selected fractions from (A) were analyzed by Northern blot (B) or stem-loop RT-qPCR (C). Fractions 2, 3, and 4 correspond to the elution volumes of full-length tRNA. Cq values ​​were normalized to the fraction containing the highest signal. (A) Lower panel: RNA was heated at 90°C and then cooled to room temperature before injection. (D) Cells were transfected with synthetic RNA 9GG / AA as described in (Tosar et al., 2018) and then lysed with SDS. Lysates were separated by SEC, and fractions were analyzed by SL-RT-qPCR using primers specific for the 9GG / AA oligonucleotide. (E) SEC separation of purified RNA from proteinase K-treated ultracentrifuged supernatants of human serum. Selected elution fractions were heated and analyzed by SL-RT-qPCR using primers specific for the 30-nt tRNAGly GCC5' half molecule (solid line) and miR-21-5p (dotted line). Detection of tRNA half molecules in the heated fractions corresponding to the elution volume of full-length tRNA demonstrates the presence of nicked tRNA in human serum. [Figure 9]Figure 1 shows that the enzymatic repair process enabled efficient reverse transcription and amplification (and therefore sequencing) of nicked tRNA. (A) End-point RT-PCR and quantitative reverse transcription-PCR (RT-qPCR) of full-length tRNAGly GCC reverse-transcribed at 50°C with a thermostable reverse transcriptase using the primers shown in the diagram on the left. Input: Total RNA from human cells. NT: RNase 1-treated total RNA (i.e., nicked tRNA) purified under non-denaturing conditions without enzymatic repair. PNK+Rnl1: RNase 1-treated RNA after enzymatic repair. Δ+PNK+RNl1: RNase 1-treated RNA heated before enzymatic repair. RT-qPCR results are expressed as fold change relative to input. The diagram on the left shows that reverse transcriptase (represented by a track) cannot read through the nick characteristic of nicked or damaged RNA. (B) Schematic of the mechanism of an exemplary enzymatic repair process. DETAILED DESCRIPTION OF THE INVENTION

[0016] The study of nicked or at least partially cleaved RNA remains difficult due to the artifacts induced by Northern blotting, a standard protocol for RNA extraction, and RNA sequencing. In this disclosure, the inventors have developed a method that enables reverse transcription, amplification, analysis, and / or sequencing of stable extracellular RNA without overlooking highly structured nicked or partially cleaved exRNA. Nicked or partially cleaved RNA is purified under non-denaturing conditions (e.g., phenol-free; without heating) and then enzymatically repaired to enable subsequent reverse transcription and / or various detections.

[0017] definition Unless otherwise defined, scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Allen et al., Remington: The Science and Practice of Pharmacy 22 nd ed., Pharmaceutical Press (Sep. 15, 2012), Hornyak et al., Introduction to Nanoscience and Nanotechnology, CRC Press (2008), Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology 3 rd ed., revised ed., J. Wiley & Sons (New York, NY 2006), Smith, March's Advanced Organic Chemistry Reactions, Mechanisms and Structure 7 th ed., J. Wiley & Sons (New York, NY 2013), Singleton, Dictionary of DNA and Genome Technology 3 rd ed., Wiley-Blackwell (Nov. 28, 2012), and Green and Sambrook, Molecular Cloning: A Laboratory Manual 4th ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, NY 2012), provide those of skill in the art with a general introduction to many of the terms used in this application.

[0018] Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present disclosure. Other features and advantages of the present disclosure will become apparent from the following detailed description, taken in conjunction with the accompanying drawings, in which various features of embodiments of the present invention are shown by way of example. Indeed, the present disclosure is in no way limited to the methods and materials described herein. For purposes of this disclosure, certain terms are defined below.

[0019] "Treated" or "treatment," as used herein in the context of an assay, means applying an effective amount of a substance under conditions that allow the substance to act. For example, as will be recognized by those skilled in the art, "treating a sample with an enzyme" means applying a sufficient amount of enzyme under appropriate conditions (buffer, temperature, etc.) to allow an enzymatic reaction.

[0020] "Nicked or partially cleaved RNA" or "nicked or at least partially cleaved RNA" generally refers to an RNA molecule that has a gap between adjacent nucleotides and / or has a portion removed from a parent full-length RNA. For example, nicked or partially cleaved RNA can refer to exRNA, such as tRNA, that has a cleaved phosphodiester bond in the anticodon loop. Nicked or partially cleaved RNA can also encompass scenarios in which an RNA has a region (e.g., a loop or overhang, or a portion thereof) removed from a parent full-length RNA. Nicked or partially cleaved RNA encompasses artificially generated RNA fragments, i.e., those generated by human intervention, e.g., some experimental and / or processing method that dissociates or completely cleaves nicked or partially cleaved RNA into fragments. However, if the RNA fragments are not generated by human intervention, i.e., in a biological sample used as input, different portions of nicked or partially cleaved RNA have already been fragmented and separated prior to collection of the sample and prior to any human intervention, such as experimental and / or processing methods, on the biological sample, then these RNA fragments are generally not considered to be nicked or partially cleaved RNA.

[0021] "Repaired RNA" refers to RNA regenerated by ligation of at least two portions or fragments (e.g., a 5' fragment and a 3' fragment) of a nicked or partially cleaved RNA resulting from cleavage of the parent RNA, thereby reconstituting the full-length or substantially full-length of the parent RNA. For example, with respect to a nicked or partially cleaved tRNA, after enzymatic repair as disclosed herein, the repaired RNA can refer to RNA regenerated by ligation of the 5' and 3' half molecules of the nicked or partially cleaved tRNA resulting from cleavage of the parent tRNA (or nicked or partially cleaved tRNA), thereby reconstituting the full-length or substantially full-length parent RNA. The repaired RNA can have the same length as the parent RNA, i.e., reconstituted to the full-length of the parent RNA. Alternatively, the repaired RNA can have substantially the same length as the parent RNA, i.e., reconstituted to the substantially full-length of the parent RNA. By "substantially" full length, the length of the repaired RNA can be at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or virtually 100% of the full length of the parent RNA. The repaired RNA can contain an identical or substantially identical nucleotide sequence to the parent RNA. By "substantially identical," the sequence of the repaired RNA can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or virtually 100% identical to the sequence of the parent RNA.

[0022] extracellular RNA Extracellular (exRNA) circulating in human body fluids can predict disease before the onset of clinical symptoms. Beyond their translational application as disease biomarkers in liquid biopsies (Heitzer et al., 2019), exRNAs are also involved in intercellular communication pathways between cells in different tissues (Thomou et al., 2017) and host-pathogen interactions (Buck et al., 2014; Cai et al., 2018; Garcia-Silva et al., 2014).

[0023] One of the key aspects governing both the functionality of exRNA and its usefulness as a biomarker is its stability against ubiquitous extracellular RNases (Tosar et al., 2021). This stability can be achieved by encapsulating the RNA inside extracellular vesicles (EVs), such as exosomes and microvesicles (Skog et al., 2008; Valadi et al., 2007). However, despite the functional relevance of RNA encapsulated in EVs (Mateescu et al., 2017) and biotechnological applications (O'Brien et al., 2020), the majority of exRNAs in cell culture (Non-Patent Document 12, Non-Patent Document 11, Wei et al., 2017, Zhang et al., 2021) and human plasma (Non-Patent Document 10, Geekiyanage et al., 2020, Non-Patent Document 11, Vickers et al., 2011) are not transported as part of EV cargo and are non-vesicular.

[0024] non-vesicular RNA Cells can release ribosomes and full-length tRNAs into the extracellular space, where they can induce immune cell activation. However, non-vesicular exRNAs are susceptible to the action of extracellular ribonucleases, making them unlikely to function as mediators of intercellular communication.

[0025] Contrary to conventional belief, the present inventors have discovered that certain extracellular non-vesicular RNAs are endogenously stable against enzymatic degradation and exhibit very long half-lives (from minutes to hours) when incubated in human biological fluids under physiological conditions (e.g., at 37°C). These endogenously stable non-vesicular RNAs circulate in human biological fluids and are not associated with EVs. Although these endogenously stable non-vesicular RNAs are highly abundant inside the majority of cells, some RNAs may have tissue-specific expression. Cell damage or cell death may be a major source of non-vesicular RNA in extracellular samples. Therefore, endogenously stable non-vesicular RNAs may increase in biological fluids in situations where unphysiological amounts of cell damage or cell death occur in the body (e.g., trauma, ischemia-reperfusion, cancer, autoimmunity, etc.).

[0026] Without being bound by theory, shared characteristics of intrinsically stable non-vesicular RNA include, but are not limited to, a) being highly structured, containing a high percentage of nucleobases in double-stranded form even in single-stranded forms, b) having modified nucleotides, and c) having broken phosphodiester bonds due to partial RNA cleavage by extracellular ribonucleases (RNases) (i.e., being "nicked RNA"). This partial cleavage is not sufficient to disrupt the structure of these molecules, and the molecules remain stabilized as dsRNA by several internal base-pairing interactions.

[0027] tRNA Transfer RNA (tRNA) is a small RNA molecule that plays a key role in protein synthesis. tRNA serves as a link (or adapter) between the messenger RNA (mRNA) molecule and the growing amino acid chain that makes up the protein. tRNAs are generally 70-100 (e.g., 76-90) nucleotides in length (in eukaryotes). tRNAs can be cleaved at the anticodon loop in a process facilitated by the enzyme angiogenin after the induction of stress to generate "tRNA half molecules" that are 30-35 nucleotides in length.

[0028] tRNA fragments can be used to refer to functional short non-coding RNAs produced from tRNA loci. tRNA fragments (tRFs) range in length from 10 nucleotides to over 40 nucleotides. The term "tRNA locus" refers to a genomic region that contains a tRNA gene and gives rise to a tRNA transcript.

[0029] Transfer RNA-derived RNAs (tDRs) are among the most abundant non-vesicular small RNAs in cell cultures (Non-Patent Document 12, Wei et al., 2017). Within cells, tRNA cleavage and the resulting upregulation of specific tDRs are conserved stress responses across all kingdoms of life (David et al., 1982, Li et al., 2008, Thompson et al., 2008). In humans, RNase A superfamily members, such as RNase 5 (angiogenin), are involved in stress-induced tRNA cleavage at the anticodon, generating stress-induced tRNA half molecules or tiRNAs (Fu et al., 2009, Yamasaki et al., 2009). tiRNAs can regulate gene expression at various levels, including widespread inhibition of translation initiation (Ivanov et al., 2011) through sequestration of eIF4G (Lyons et al., 2021). Other shorter tDRs can bind to mRNAs and regulate their translation ( Kim et al., 2017 ) or silence genes by a miRNA-like, Argonaute-dependent mechanism ( Kuscu et al., 2018 ).

[0030] Extracellular tDR was first reported in EVs derived from mouse immune cells (Nolte'T Hoen et al., 2012), but was later shown to exist primarily outside vesicles in mouse serum (Dhahbi et al., 2013; Zhang et al., 2014). In human cancer cell lines, tDR could be detected in vesicular fractions, but was overwhelmingly abundant in EV-depleted ultracentrifugation supernatants (Non-Patent Document 12). Although a heterogeneous population of tDR can be detected inside cells, extracellular non-vesicular tDR is primarily present in tRNAs. Gly and tRNA Glu These particular fragments are ubiquitous in human biological fluids (Srinivasan et al., 2019). The extracellular enrichment of these fragments is due to the 30-nt to 31-nt tRNA half molecules. Gly GCCThis may be due to their enhanced stability against degradation, as the 5' half molecules can form RNase-resistant homodimers in vitro (Tosar et al., 2018). However, we found that the form in which tDR is transported in biological fluids is likely nicked tRNA. Therefore, the increased stability of nicked tRNA against degradation contributes to the abundance of extracellular nonvesicular tDR.

[0031] Enzymatic RNA repair methods One aspect of the present invention relates to a method for enzymatically repairing nicked or at least partially cleaved RNA, the method comprising providing a biological sample containing nicked or at least partially cleaved RNA, purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components, and subjecting the purified RNA to one of the following: and forming repaired RNA from the nicked or at least partially cleaved RNA by treatment with at least one of: (i) an enzyme exhibiting RNA 3' phosphatase or cyclic phosphatase activity, an enzyme exhibiting RNA 5' kinase activity, and an RNA ligase; or (ii) a 3'-5' RNA ligase.

[0032] Biological samples containing nicked or at least partially cleaved RNA are purified to remove non-RNA components such as proteins, lipids, salts, etc. that may interfere with downstream analysis. Purification is performed under non-denaturing conditions.

[0033] In some embodiments, the non-denaturing conditions include solid phase extraction (SPE), chromatographic methods (e.g., size exclusion chromatography (SEC) or ion exchange chromatography), RNA precipitation (e.g., precipitation with a polar solvent such as acetone or an alcohol (e.g., ethanol or isopropanol)), or a combination thereof. In one embodiment, the non-denaturing conditions include SPE, e.g., a silica-based solid phase extraction column.

[0034] The method may include one or more separation steps to extract one or more specific types of RNA prior to enzymatic treatment. In one embodiment, the method further includes density gradient separation to isolate non-vesicular RNA. In one embodiment, the method further includes a chromatographic method to isolate non-vesicular RNA. In one embodiment, the method further includes native electrophoresis to fractionate RNAs based on their size.

[0035] The method may include one or more enrichment steps prior to enzymatic treatment, hi one embodiment, the method further includes gel purification to enrich for one or more RNAs or fragments having between 25 and 100 nucleotides.

[0036] In some embodiments, purification of biological samples and enzymatic treatment of purified RNA are carried out in the absence of conditions that would result in denaturation of RNA molecules. Conditions that would result in denaturation of RNA molecules may include heating, adapter ligation, chemical denaturants, or a combination thereof. In one embodiment, conditions that would result in denaturation of RNA molecules include the use of a chemical denaturant such as phenol. In one embodiment, conditions that would result in denaturation of RNA molecules include heating. Purification as used herein avoids denaturing conditions that may create artifacts, such as overlooking certain highly structured, nicked, or partially cleaved exRNAs, and instead detecting an increased population of degraded / denatured RNAs that are actually caused by the denaturing conditions.

[0037] In some embodiments, the method for enzymatically repairing nicked or at least partially cleaved RNA is performed in the absence of conditions that result in denaturation of the RNA molecule, hi one embodiment, the method is performed in the absence of conditions that include heating, adapter ligation, chemical denaturants, or a combination thereof.

[0038] As described above, a nicked or partially cleaved RNA can be an RNA molecule that has a gap between adjacent nucleotides and / or that has a portion removed from a parent full-length RNA. In one embodiment, a nicked or partially cleaved RNA comprises a tRNA that has a gap (e.g., a cleaved phosphodiester bond) between adjacent nucleotides in the anticodon loop of the tRNA. In one embodiment, a nicked or partially cleaved RNA comprises an RNA that has a region (e.g., a loop or overhang, or a portion thereof) removed from a parent full-length RNA.

[0039] Biological samples may contain various types of RNA and various types of nicked or partially cleaved RNA.All of the nicked or partially cleaved RNAs can be enzymatically repaired by this method, for example, simultaneously.Therefore, according to this method, the final product after enzymatic treatment disclosed herein can contain all of the RNAs originally contained in the biological sample, including the nicked or partially cleaved RNAs that have now been repaired.

[0040] In some embodiments, at least a portion of the nicked or partially cleaved RNA is formed from extracellular RNA. In some embodiments, at least a portion of the nicked or partially cleaved RNA is formed from intracellular RNA.

[0041] In some embodiments, at least a portion of the nicked or partially cleaved RNA is formed from non-vesicular RNA, hi some embodiments, at least a portion of the nicked or partially cleaved RNA is formed from vesicular RNA.

[0042] In some embodiments, the nicked or at least partially cleaved RNA comprises one or more RNAs selected from the group consisting of tRNA (e.g., nicked and full-length), rRNA, YRNA, 7SL RNA, 7SK RNA, snRNA, snoRNA, vaultRNA, Alu RNA, transposable element-derived RNA, pri-microRNA, pre-microRNA, mRNA exon, mRNA intron, 5'UTR, 3'UTR, and fragments and combinations thereof. These RNAs can be organized into either the nuclear genome or the genome of organelles (e.g., mitochondria). These RNAs are examples of endogenously stable, non-vesicular RNAs. These RNAs are typically longer than 40 nucleotides in length, but sometimes appear as relatively short RNA fragments in biological fluids due to the use of denaturing methods (e.g., sRNA-seq and / or Northern blotting) applied to nicked exRNA.

[0043] In some embodiments, the nicked or at least partially cleaved RNA comprises a tRNA, a tRNA fragment (tRF), a tRNA-derived RNA (tDR), and / or a tRNA half molecule.

[0044] In some embodiments, at least a portion of the nicked or at least partially cleaved RNA comprises single-stranded tRNA half molecules.

[0045] For the enzymatic repair process, one or more enzymes can be used. Without being bound by theory, the enzyme(s) used perform the functions of dephosphorylation (forming a 3'-OH) at the 3' end of nicked or at least partially cleaved RNA, phosphorylation (forming a 5'-phosphate) at the 5' end of nicked or at least partially cleaved RNA, and ligation of 5'-phosphate RNA and 3'-OH RNA. The enzymatic process can be carried out with one enzyme that has all of these functions, with two enzymes that, in combination, have all of these functions, or with three enzymes, each with a different function and all combined, have all of these functions.

[0046] In some embodiments, purified RNA is (i)(a) treated with polynucleotide kinase (PNK) and RNA ligase. In one embodiment, polynucleotide kinase is added together with RNA ligase. In one embodiment, polynucleotide kinase is added first, followed by RNA ligase. In one embodiment, the polynucleotide kinase used is T4 PNK. In one embodiment, the RNA ligase is T4 RNA ligase 1.

[0047] In some embodiments, purified RNA is treated by (i)(b) adding RNA 3' phosphatase or RNA 2',3' cyclic phosphatase, RNA 5' kinase, and RNA ligase, either together or sequentially. In one embodiment, RNA 3' phosphatase or RNA 2',3' cyclic phosphatase, RNA 5' kinase, and RNA ligase are all added together. In one embodiment, RNA 3' phosphatase or RNA 2',3' cyclic phosphatase and RNA 5' kinase are added first, followed by RNA ligase. In one embodiment, RNA 3' phosphatase or RNA 2',3' cyclic phosphatase is added first, followed by RNA 5' kinase and RNA ligase. In one embodiment, RNA 3' phosphatase or RNA 2',3' cyclic phosphatase is added first, followed by RNA 5' kinase, followed by RNA ligase. In one embodiment, the RNA ligase is T4 RNA ligase 1.

[0048] In some embodiments, the purified RNA is (ii) treated with a 3'-5' RNA ligase. In one embodiment, the 3'-5' RNA ligase is RtcB ligase.

[0049] In some embodiments, the treatment of purified RNA according to (i) (including (i)(a) and (i)(b)) or (ii) is performed at least in part in the presence of a cofactor. In one embodiment, the cofactor is adenosine triphosphate (ATP) or guanosine-5'-triphosphate (GTP).

[0050] Nicked or at least partially cleaved RNA contained in a biological sample is repaired to reconstitute the full-length or substantially full-length parent RNA. Using longer reads (and more complete reads of nicked or at least partially cleaved RNA) provides more important structural information and confers greater discriminatory power (especially in the case of tRNAs, which contain many highly similar isoacceptors and isodecoders that may have tissue- and cancer-specific expression).

[0051] In some embodiments, the repaired RNA comprises a nucleotide sequence that is identical or substantially identical over its entire length or substantially its entire length to the parent RNA from which the nicked or at least partially cleaved RNA was formed.

[0052] In one embodiment, the repaired RNA comprises a nucleotide sequence identical or substantially identical over its entire length to the parent RNA from which the nicked or at least partially cleaved RNA was formed.

[0053] In some embodiments, the repaired RNA comprises a nucleotide sequence identical or substantially identical over substantially the entire length to the parent RNA from which the nicked or at least partially cleaved RNA was formed. For example, the length of the repaired RNA can be at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or essentially 100% of the entire length of the parent RNA.

[0054] In one embodiment, the repaired RNA is 1 to 11 nucleotides shorter than the parent RNA from which the nicked or at least partially cleaved RNA was formed.

[0055] In one embodiment, the repaired RNA is 3 to 5 nucleotides shorter than the parent RNA from which the nicked or at least partially cleaved RNA was formed, and is missing a single-stranded overhang.

[0056] In one embodiment, the repaired RNA is 3 to 7 nucleotides shorter than the parent RNA from which the nicked or at least partially cleaved RNA was formed, and is missing the anticodon loop or a portion thereof.

[0057] The source of the biological sample may be a biological fluid, a cell, a tissue, an organ, or any combination thereof.

[0058] In some embodiments, the biological sample is derived from a cell. In one embodiment, the biological sample is derived from a cancerous cell. In one embodiment, the nicked or at least partially cleaved RNA is a precursor of a stress-inducible tRNA half molecule (tiRNA).

[0059] In some embodiments, the biological sample is derived from an extracellular biological fluid, for example, the extracellular biological fluid may be blood, serum, plasma, urine, lymph, saliva, synovial fluid, milk, cerebrospinal fluid, or a combination thereof.

[0060] In some embodiments, the method comprises further purifying the enzyme-treated RNA.

[0061] How to detect RNA The methods described herein can be used to detect RNA, such as extracellular RNA, in biological samples, with a particular focus on providing important information about highly structured RNA, such as nicked or partially truncated RNA, that is generally not identified by conventional or currently available sequencing and / or amplification methods. The methods can be used to monitor changes in gene expression in tissues by sequencing extracellular samples, and to monitor disease (diagnosis, prognosis, recurrence, response to treatment, etc.) based on the analysis of liquid biopsies.

[0062] Accordingly, another aspect of the present invention relates to a method for detecting RNA from a biological sample, the method comprising: providing a biological sample containing nicked or at least partially cleaved RNA; purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; treating the purified RNA with at least one of the following enzymes: (i) an enzyme exhibiting RNA 3' phosphatase or cyclic phosphatase activity, an enzyme exhibiting RNA 5' kinase activity, and an RNA ligase; or (ii) a 3'-5' RNA ligase, thereby repairing at least a portion of the nicked or partially cleaved RNA; and detecting the repaired RNA.

[0063] All of the above descriptions and all of the embodiments discussed in the above aspects regarding the method for enzymatically repairing nicked or at least partially cleaved RNA, including the biological sample, the nicked or at least partially cleaved RNA, various RNA purification, separation, and / or enrichment methods, non-denaturing conditions, various enzymatic treatment protocols, and various aspects of the structure and sequence of the repaired RNA, are applicable to this aspect of the invention regarding the method for detecting RNA from a biological sample.

[0064] The methods described herein can be applied to vesicle samples, non-vesicle samples, or whole extracellular samples. The methods described herein can be applied to patients suffering from various diseases or conditions or to healthy donors. The methods described herein can be applied to humans or, for veterinary purposes, to animals.

[0065] After enzymatic repair of nicked or at least partially cleaved RNA in a biological sample, the RNA can be further reverse transcribed using a conventional reverse transcriptase or a thermostable reverse transcriptase. In one embodiment, the RNA can be further reverse transcribed using a thermostable reverse transcriptase. Typical thermostable reverse transcriptases function at high temperatures, can disrupt the internal structure of RNA, and are more tolerant to modified bases. Exemplary thermostable reverse transcriptases suitable for application herein include, among others, retroelement-derived reverse transcriptases such as TGIRT III and retrovirus-derived reverse transcriptases such as Superscript IV.

[0066] After enzymatic repair of nicked or at least partially cleaved RNA in a biological sample, the RNA can be detected by a variety of detection methods known in the art.

[0067] In some embodiments, the method for detecting RNA from a biological sample is carried out in the absence of conditions that result in denaturation of RNA molecules. In one embodiment, the method is carried out in the absence of conditions that include heat, chemical denaturants, or a combination thereof.

[0068] Alternatively, in some embodiments, conditions that result in denaturation of the RNA molecule, such as heat, chemical denaturants, or a combination thereof, may be introduced, but if so, after the enzymatic repair step(s) described herein (i.e., the enzymatic treatment step(s)).

[0069] In some embodiments, the detection comprises sequencing, amplification, nucleic acid hybridization, or a combination thereof.

[0070] In some embodiments, detecting comprises quantitative RT-PCR (RT-qPCR).

[0071] In one embodiment, detection comprises a form of high throughput sequencing, which may be any form of high throughput sequencing including, but not limited to, sequencing by synthesis, nanopore sequencing, or any related technique available for obtaining nucleic acid sequences.

[0072] In one embodiment, the biological sample is treated with an RNase inhibitor before or after purifying the nicked or at least partially cleaved RNA contained in the biological sample. [Example]

[0073] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention in any way. Reference to specific materials is for illustrative purposes only and is not intended to limit the invention. One skilled in the art may develop equivalent methods or reactants without the exercise of inventive capacity and without departing from the scope of the invention.

[0074] Example 1 - Enzymatic repair of nicked tRNA in human biological samples Materials and Methods cell culture U2-OS cells were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco) without antibiotics, with 4.5 g / L D-glucose and 110 mg / L sodium pyruvate.

[0075] biological fluid samples Blood and urine samples were collected at the Pasteur Institute of Montevideo. Blood samples were obtained from healthy donors by venipuncture into serum collection tubes, centrifuged at 2500 rpm for 15 minutes to separate the serum, which was stored at -20°C until use.

[0076] Twenty milliliters of human urine samples were collected from healthy donors within one hour of collection into sterile containers. The samples were transferred to 10-mL Falcon tubes and centrifuged at 300 × g for 10 minutes at 4°C, followed by 2000 × g for 20 minutes at 4°C. The supernatant was then stored at -20°C until use.

[0077] RNA purification by solid phase extraction (SPE) SPE was performed using the Monarch RNA Cleanup Kit (10 μg binding capacity column, New England Biolabs, NEB) except for the Total RNA Miniprep Kit (NEB) used for the purification of stress-induced tRNA-derived fragments from U2-OS cells. Purification was performed according to the manufacturer's instructions, except that in some experiments, the volume of ethanol added to the binding buffer was doubled to avoid loss of small RNAs.

[0078] Stress-induced generation of tRNA half molecules and intracellular RNA purification To generate stress-inducible tRNA half molecules (tiRNAs), 500 μM freshly prepared sodium arsenite (Sigma-Aldrich) was added to U2-OS cells grown to 90% confluence in DMEM + 10% FBS. After 2 h at 37 °C, the medium was removed, the cells were washed with warm 1x PBS, and RNA was extracted using a Total RNA Miniprep Kit (NEB). The manufacturer's instructions were followed with two modifications: i) cell lysis was performed by adding 2 mL of lysis buffer directly to the cell monolayer, followed by a brief (5 min) incubation at room temperature; and ii) twice the indicated volume of ethanol was added to the RNA sample after elution from the RNA-binding column.

[0079] RNA degradation assay To determine RNA half-life in biological fluids, 1 μg of heated and refolded (90°C for 1 minute, then room temperature for 30 minutes) U2-OS total RNA was added to 50 μL of undiluted human urine, undiluted human serum, diluted human serum, or FBS (all 10% in 1x PBS). Additionally, 1 μg of heated and refolded total RNA was incubated with 0.5 μg / mL recombinant human RNase 1 (r-RNase 1; Bon Opus Bio) at 37°C for various amounts of time. The reaction was stopped by adding SPE binding buffer and RNA cleanup.

[0080] in vitro RNA digestion For in vitro generation of nicked tRNA and / or tDR, 1 μg of heated and refolded U2-OS total RNA was mixed with 40 μL of r-RNase 1 (diluted to 0.0625 μg / mL in PBS) and incubated at 37°C for 15, 30, or 60 minutes.

[0081] RNA ligation assay For ligation assays involving T4 RNA ligase, 5 μL of in vitro digested RNA (or purified RNA from CCM) was incubated for 1 h at 37°C in a 10 μL reaction containing 20 U of RI, 1 mM ATP, 1× T4 PNK reaction buffer, and the desired enzyme combination. The enzyme cocktail included 10 U of T4 RNA ligase 1 (Rnl1, NEB) or T4 RNA ligase 2 (Rnl2, NEB) and / or 10 U of T4 PNK (wild-type or 3' phosphatase-free, NEB).

[0082] As a control, RNA was heat denatured (90°C for 1 min followed immediately by placing on ice) before enzymatic treatment.

[0083] For RtcB ligation, the reaction mixture (10 μL; 1 h at 37°C) contained 5 μL of in vitro digested RNA (with or without prior heat denaturation), 20 U of RI, 1× RtcB ligase buffer, 1 mM GTP, 1 mM Mn 2+ , and 1 μM RtcB ligase from E. coli (NEB). Reactions were stopped by adding 2× RNA Loading Dye and analyzed by Northern blot.

[0084] Identification of nonvesicular nicked tRNA in biological fluids. 200 μL of healthy donor human serum sample was thawed, centrifuged at 2000 × g for 10 minutes at 4 °C, and diluted in 12 mL of PBS. EV depletion was performed by ultracentrifugation at 256,000 × g for 1 hour at 4 °C in an Optima XPN ultracentrifuge (Beckman Coulter) equipped with an SW 40 Ti rotor. The supernatant was then concentrated to 200 μL by ultrafiltration using a 10,000 MWCO Amicon Ultra-15 centrifugal filter (Merck). 440 μL of RNA Binding Buffer included in the RNA Cleanup Kit (NEB) was then added to the concentrated supernatant, which was then treated with 20 μL of proteinase K (QIAgen) at 37 °C for 30 minutes. Nucleic acids were then purified by SPE and eluted in 50 μL of nuclease-free HO (Invitrogen). The sample was analyzed by size exclusion chromatography using an FPLC system.

[0085] Size Exclusion Chromatography (FPLC) Non-vesicular samples from human serum or total RNA from U2-OS cells stressed with sodium arsenite (with or without heat denaturation and refolding) were diluted in 1x PBS (500 μL) and centrifuged at 10,000 x g for 10 min at 4°C before being injected onto a Superdex 75 10 / 300 column (GE).

[0086] Size-exclusion chromatography (SEC) was performed using an Aekta Pure FPLC system in 0.2 μm-filtered 1× PBS at 0.5 mL per minute, collecting 0.2 mL fractions while monitoring absorbance at 260 nm and 280 nm. Nucleic acids from selected fractions were precipitated with ethanol (700 μL absolute ethanol; 100 μL 3 M NaAc, pH 5.2; 0.5 μL Glycogen Blue) overnight at −20°C and centrifuged at 12,000 × g for 15 minutes at 4°C. The pellet was washed with 500 μL 75% ethanol, centrifuged at 12,000 × g for 15 minutes at 4°C, and resuspended in 10 μL nuclease-free water (Invitrogen) prior to Northern blot or stem-loop RT-qPCR.

[0087] Northern blotting Northern blots were performed using DIG-labeled DNA probes as described by Tosar (Non-Patent Document 2). Band intensities were obtained by densitometry using GelQuant 2.0 software.

[0088] For denaturing Northern blots, 5 μL of RNA was mixed with 5 μL of loading buffer containing 95% formamide, 1 mM EDTA, 0.02% SDS, 0.02% bromophenol blue, and 0.01% xylene cyanol, heated to 65°C for 5 minutes, and run on a 10 × 10 cm 10% polyacrylamide gel containing 7 M urea in 1× Tris-borate EDTA (TBE, pH 8.4).

[0089] For non-denaturing Northern blots, RNA samples were mixed with 1 μL of 6× native loading buffer and loaded onto a gel containing 1× Tris-borate (pH 8.3) and 10 mM MgCl (TB+Mg 2+ The gel was loaded with 0.5x TBE or 0.5x TB + Mg 2+Running buffer was run for 80 min at room temperature, stained with 1× SYBR Gold (Invitrogen), and then transferred to a positively charged nylon membrane (Roche) in 0.5× TBE using a semidry Trans-Blot Turbo Transfer System (Bio-Rad) at a constant I = 0.3 A for 30 min.

[0090] The membrane was UV-crosslinked and hybridized with a digoxigenin-labeled DNA probe in DIG Easy Hyb solution (Roche) for 16 hours at 42°C. After hybridization, the membrane was washed with low-stringency wash buffer (2x SSC / 0.1% SDS) for 5 minutes at room temperature, washed with high-stringency wash buffer (1x SSC / 0.1% SDS) for 5 minutes at 42°C, blocked with 1x blocking solution (Roche) for 30 minutes at room temperature, and probed with alkaline phosphatase-labeled anti-digoxigenin antibody (Roche) for 30 minutes. The membrane was washed twice for 5 minutes with 1x TBS-T and then incubated in detection buffer (Roche). Signals were then visualized using a pre-conditioned CDP-Star (Roche) and detected using an Amersham ImageQuant 800 imager (GE Healthcare / Cytiva). Probe (5' to 3'): rRNA 28S 5': CACGTCTGATCTGAGGTCGC (SEQ ID NO: 1) rRNA 18S 5':ATGCTACTGGCAGGATCAAC (SEQ ID NO: 2) rRNA 5.8S: CGCACGAGCCGAGTGATCCAC (SEQ ID NO: 3) rRNA 5S 5':GGTGGTATGGCCGTAGAC (SEQ ID NO: 4) 7SL:CACTACAGCCCAGAACTCCTGGACT (SEQ ID NO: 5) tRNA Gly GCC 5': CTACCACTGAACCACCCATGC (SEQ ID NO: 6) tRNALys UUU 5': CTGATGCTCTACCGACTGAGCTATCCGGGC (SEQ ID NO: 7) tRNA Asp GUC 5': TCACCACTATACTAACGAGGA (SEQ ID NO: 8) tRNA Glu GUC 5': TAACCACTAGACCACCAG (SEQ ID NO: 9) tRNA Gly GCC 3': GCCGGAATCGAACCCGGGCCTCCCGCG (SEQ ID NO: 10) tRNA Gly GCC / Asp GUC ACL: TCCCGCGTGGCAGGCGAGAA (SEQ ID NO: 11) tRNA Lys UUU ACL: CCTCAGATTAAAAGTCTGATG (SEQ ID NO: 12)

[0091] All oligonucleotides were obtained from Integrated DNA Technologies (IDT, USA) and labeled using the DIG Oligonucleotide Tailing Kit, second generation (Roche) according to the manufacturer's instructions.

[0092] Stem-loop RT-qPCR Small RNAs were amplified and quantified using stem-loop RT-qPCR according to the protocol of Tosar et al. (Tosar et al., 2018). Briefly, tRNA Gly GCCSpecific cDNAs for the 5' half molecule and miR-21-5p were obtained using SuperScript II (ThermoScientific). Purified RNA was heated to 90°C for 1 minute and immediately placed on ice before reverse transcription. qPCR was performed using the QuantStudio 3 Real Time PCR System (ThermoScientific) with FastStart Universal SYBR Green Master (Rox; Roche). -Cq Values ​​were obtained and normalized to the fraction containing the highest signal. Primer (5' to 3') Stem-loop RT primer ("X" indicates assay-specific 3' overhang): GTCGTATCCA GTGCAGGGTC CGAGGTATTC GCACTGGATA CGACXXXXXX (SEQ ID NO: 13) tRNA Gly GCC (5' half molecule, 35 nt, 3' overhang): GGCAGG tRNA Gly GCC (5' half molecule, 30 nt, 3' overhang): GCGAGA miR-21-5p(3' overhang):GTCAAC tRNA Gly GCC (5' half molecule, F-primer): CCGCATTGGTTCAGTGGT (SEQ ID NO: 14) miR-21-5p (F-primer): gccccgTAGCTTATCAGACTGATGT (SEQ ID NO: 15) 9 GG / AA (F-primer): gctcgGCATTGGTAATTCAGTGGTA (SEQ ID NO: 16) Universal reverse primer: GTGCAGGGTCCGAGGT (SEQ ID NO: 17)

[0093] All primers were obtained from Integrated DNA Technologies (IDT, USA). Lowercase letters in these primers indicate the presence of additional bases to increase the melting temperature.

[0094] RT-PCR for full-length tRNA Two microliters of 10 ng / μL U2-OS total RNA (input) or RNase 1-treated RNA (starting from an equivalent amount of input RNA) was mixed with 1 μL of 2 μM gene-specific RT primer and 1 μL of 10 mM (each) dNTP mix in an 11 μL reaction volume, incubated at 65°C for 5 min, and cooled on ice for at least 1 min. The annealed RNA was mixed with 4 μL of 5x SuperScript IV (SSIV, Thermo) buffer, 1 μL of 0.1 M DTT, 20 U of RI, and 20 U of SSIV RT. The reaction was incubated at 65°C for 10 min and then at 80°C for 10 min. The cDNA was diluted 1 / 2 before qPCR or 1 / 10 for endpoint PCR. tRNA Gly GCC Gene-specific RT primer for 1-4: GCGTCTCACTTATGCACAGCGAACTTGCATGGGCCGGG (SEQ ID NO: 18) tRNA Gly GCC -1 (F-primer): GCATGGGTGGTTCAGTGGTA (SEQ ID NO: 19) Universal tRNA reverse primer: GTCTCACTTATGCACAGCGAA (SEQ ID NO: 20)

[0095] result Identification of naked RNA stable in the presence of serum To explore endogenously stable RNAs in extracellular samples, abundant cellular transcripts were screened to determine whether they could resist degradation in serum-containing medium in the absence of their protein counterparts (Figure 1). As shown in Figure 1, naked rRNA was degraded in less than 1 minute, as exemplified by the absence of a Northern blot signal in the absence of added RNase inhibitor (RI). In contrast, full-length tRNA Lys UUU was present at input levels after 1.5 hours, suggesting that this tRNA is not efficiently targeted by serum RNases. Gly GCC This was not observed for other tRNAs such as Gly GCC Like rRNA, it became undetectable after 1 minute.

[0096] Naked full-length tRNA in biological fluids Lys UUU is intrinsically stable To precisely measure the tRNA half-life, we repeated the previous assay, which had better temporal resolution (Figure 2A). Lys UUU The half-life of tRNA (approximately 750 seconds) Gly GCC The half-life of tRNA was 58 times longer than that of rRNA or 7SL RNA (approximately 13 seconds), and was 125 times longer than that of rRNA or 7SL RNA (less than 6 seconds). Lys UUU The high stability of tRNA cannot be explained by association with serum-derived proteins, since incubation with recombinant human RNase 1 (r-RNase 1), which represents the most prevalent RNase in human blood, yielded virtually identical results (Figure 2A). Lys UUU It has been shown that RNase A is intrinsically resistant to the action of RNase A family members.

[0097] These assays were then repeated for human biological fluids containing urine, diluted serum, and undiluted serum (Figures 2B and 2C). Lys UUU The stability of was always higher than that of any of the other RNAs tested, regardless of sample type. Overall, there were significant differences in intrinsic extracellular stability not only between different RNA biotypes, but also within the same RNA biotype.

[0098] Glycine tRNA half molecules produced in biological fluids are highly stable. full length tRNA Gly GCC was almost completely degraded in less than 1 min in 10% FBS (Fig. 2A) and human biological fluids (Fig. 2B and Fig. 2C). However, its cleavage resulted in the formation of a 5' half molecule, which exhibited a significantly longer half-life, even in undiluted human serum.

[0099] Closer inspection of the data in these figures shows strong differences in the stability of fragments derived from the same parent tRNA but of slightly different lengths. Gly GCC was first cleaved in the anticodon loop, generating a 34-35 nt 5' half molecule, which rapidly disappeared. These fragments were then replaced by a highly stable shorter fragment of approximately 30-31 nt, with the cleavage site at the beginning of the anticodon loop. Using a lower r-RNase 1 concentration allowed us to identify and expose an additional cleavage site (position 54) in the TΨC loop (Figure 3). The cleavage sites at positions 30 and 34-35 may be independent, or cleavage at positions 34-35 may be required for efficient cleavage at position 30.

[0100] Overall, tRNAs appeared to be more resistant to degradation than other longer non-coding RNAs, but the difference in stability among tRNAs was substantial (>50-fold). GlyGCC The 5' half molecule could accumulate at higher RNase concentrations in biological fluids or after longer incubation.

[0101] Nicked tRNA is a source of 5' and 3' tRNA half molecules Next, the 5' tRNA Gly GCC Derived fragment and 3' tRNA Gly GCC The relative stability of the tRNA-derived fragments was compared, and the results are shown in Figure 4. Surprisingly, 30- to 35-nt 3' fragments were observed, and their degradation rates were comparable to those of their 5' counterparts. In certain biological fluids, such as FBS (Figure 4A) and urine (Figure 4B), 3' tRNA-derived fragments of less than 20 nt were observed at the first time point (1-5 min). However, these fragments exhibited very short half-lives, significantly different from the 5' and 3' halves.

[0102] Without being bound by theory, tRNA Gly GCC The 5' and 3' half molecules may remain physically associated with each other after RNase cleavage, thereby representing a full-length tRNA with a cleaved phosphodiester bond in the anticodon loop (i.e., a "nicked tRNA" form). This explains the similar degradation kinetics of each half molecule among different biological fluids. However, the introduction of any irreversible denaturing step, such as those used in standard molecular biology techniques, induces the dissociation of the nicked tRNA into single-stranded tRNA half molecules. This can be further tested by the new assays discussed herein, which allow for the investigation of oligomeric RNA complexes under native conditions.

[0103] Nicked tRNA is a natural substrate for T4 polynucleotide kinase (PNK) and T4 RNA ligase 1 (Rnl1) (Schwer et al., 2004). When Escherichia coli is infected with T4 phage, a bacterial anticodon nuclease called PrrC is activated to prevent the translation of viral proteins, leading to the nicking of host tRNA. Lys (Kaufmann, 2000). This results in a nicked tRNA with a 3' cyclic phosphate (3'cP) and a 5'-OH adjacent to the cleavage site. However, phages have evolved two enzymes capable of end-healing (PNK) and tRNA repair (Rnl1). These enzymes can be used to probe the native structure of human tRNA half molecules in extracellular samples.

[0104] Total RNA from cells was purified and incubated with r-RNase 1 for 0, 15, or 60 minutes (Figure 5A). Gly GCC The tRNA was completely degraded and converted into a set of tDRs (Figure 5A). The RNase 1 degradation products were purified by a silica-based solid-phase extraction (SPE) column and treated with either PNK alone, PNK followed by Rnl1, or PNK followed by Rnl2 (a dsRNA-specific ligase). Strikingly, treatment with PNK and Rnl1 in tandem again generated a single band approximately the size of the homologous full-length tRNA (Figure 5A-B), which was more efficient than ligation with Rnl2.

[0105] To demonstrate that the tRNA-sized religation product is indeed the repaired tRNA, we analyzed the tRNA Gly GCCA third probe (designated ACL, directed against the anticodon loop) that bridges both sides of the anticodon (Figure 5C) was designed so that the Tm of pairing with either the 5' or 3' half molecule was below the hybridization temperature of the assay (42°C). Thus, the ACL probe cannot detect the 5' or 3' tDR, but it can detect full-length or repaired tRNA. Gly GCC Due to the sequence similarity between tRNAs, the ACL should be able to hybridize with tRNA. Asp GUC However, these tRNAs migrate slightly differently in denaturing urea gels, thus allowing this assay to be multiplexed.

[0106] Strikingly, treatment of RNase 1-treated RNA with PNK and Rnl1 again generated tRNA-sized products observable using the 5', 3', or ACL probes (Fig. 5D). In the case of ACL, after treatment with the enzyme cocktail, tRNA was detected in a manner that was otherwise undetectable by Northern blot. Gly GCC and tRNA Asp GUC Two bands corresponding to the sizes of tRNA and nicked RNA were detected. In the absence of enzymatic repair, the sequence patch recognized by the ACL probe is too short, and this must be weighed against the possibility of ligation in trans between the tRNA half molecule and other RNAs present in the sample (artifactual ligation products). Furthermore, heating the RNase-treated RNA before adding the enzyme cocktail and then cooling prevented the generation of the tRNA-sized band, demonstrating that ligation occurred in cis (actual nicked RNA) under the assay conditions. Rnl1 alone or after incubation with a mutant version of T4 PNK lacking 3' phosphatase activity failed to reconstitute full-length tRNA.

[0107] In summary, nicked tRNAs were generated in vitro using various tRNAs as substrates. In an in vitro setting, these nicked tRNAs were enzymatically repaired to regenerate near-full-length tRNAs presumably lacking the 3' NCCA overhang (Akiyama et al., 2022). Although additional bases can be deleted after sustained exposure to extracellular RNases, these shorter forms are still repairable using the assays discussed herein.

[0108] Nicked tRNA is irreversibly melted by common RNA extraction methods Heating RNase-treated RNA prior to tandem incubation with PNK and Rnl1 prevented the formation of tRNA-sized bands, but this also affected the detection of monomeric 5' and 3' tRNA half molecules (Fig. 5D). We also observed that heating alone was sufficient to reduce the intensity of Northern blot bands corresponding to tRNA half molecules (Fig. 6).

[0109] The size cutoff of the SPE RNA cleanup column can be lowered by doubling the amount of ethanol added to the sample. Using two volumes of ethanol increased the amount of eluted tRNA half molecules, while eliminating the heat effect. This indicates that using one volume of ethanol, nicked tRNA (>70 nt) can bind to the SPE column, while monomeric 30-35 nt tRNA half molecules are lost in the flow-through. In contrast, doubling the amount of ethanol allows highly efficient capture of both nicked tRNA and heat-induced monomeric tRNA half molecules. The enzymatic repair assay was then repeated under conditions favorable for small RNAs (2x EtOH), and monomeric tRNA half molecules were still detectable in the control (i.e., heat) reaction (Figure 6).

[0110] Given that heating irreversibly affects nicked tRNAs, we tested the impact of various commonly used RNA extraction methods, many of which contain agents known to disrupt base-pairing interactions (e.g., phenol). A recent study of various RNA purification methods for liquid biopsies found that the miRNeasy kit (Qiagen) recovered a wide range of exRNAs associated with various carrier subclasses (Srinivasan et al., 2019). However, when RNase 1-treated RNA was purified using this kit according to the manufacturer's instructions, tRNA half molecules were recovered in acceptable yields but were no longer amenable to enzymatic repair (Figure 7A). Similar results were obtained when comparing phenol-free SPE-based purification with TRIzol (Figure 7B, left). Interestingly, adding a second SPE-based purification round resulted in nearly 100% recovery of repairable tRNA half molecules. Therefore, the guanidine salt contained in the SPE binding buffer does not affect the nicked tRNA, whereas heat and phenol induce irreversible separation of the nicked tRNA. f The tRNA fragments (estimated by the method, Figure 7B, right) were slightly (4-5 nt) shorter than the parent full-length tRNAs.

[0111] Nicked tRNA is resistant to RNase 1 cleavage in vitro Having observed that nicked tRNA could be purified by SPE, we generated, purified, and re-treated nicked tRNA with r-RNase 1 (Figure 7C). This treatment did not degrade the nicked tRNA (up to 30 min at 37°C). However, heating the nicked tRNA before exposure to r-RNase 1 and then cooling induced complete degradation of the tRNA half molecules, at which point they were in single-stranded form.

[0112] In conclusion, nicked tRNAs are stable reservoirs of tRNA half molecules that are susceptible to degradation upon dissociation from their 3′ counterparts.

[0113] tRNA half molecules generated in vitro are predominantly nicked tRNAs Enzymatically repaired tRNA in RNase 1-treated samples purified under optimized conditions Gly GCC 5' half molecule (light gray arrow) and intact tRNA Gly GCC Comparison of the intensities of the 5' half molecules (NT) (Fig. 7A-B) suggests that the majority of tDRs were indeed nicked tRNAs.

[0114] To further confirm this conclusion, RNA was extracted from native (TB-Mg 2+ ) Northern blot assays were also performed after running on a polyacrylamide gel (Figure 7D). Gly GCC The electrophoretic behavior of nicked tRNA was nearly identical to that of untreated full-length tRNA. Only less than 10% of the total signal in the treated lane corresponded to authentic tRNA. This confirms that the rapid disappearance of the full-length tRNA band observed in Figure 2A is indeed an artifact caused by the denaturing conditions, with more than 90% of the tRNA remaining as nicked tRNA after 1 hour of enzymatic digestion. Interestingly, the migration of nicked tRNA in the native gel was slightly faster than that of unnicked full-length tRNA. This is consistent with the irreversible loss of the NCCA 3' overhang predicted from previous assays (Figure 7B).

[0115] Furthermore, native Northern blot analysis confirmed that heating or standard RNA purification methods such as TRIzol or miRNeasy, but not phenol-free RNA cleanup columns (SPE), induced irreversible dissociation of nicked tRNAs (Figure 7D).

[0116] Nicked tRNAs can also be ligated by the 3'-5' RNA ligase RtcB RtcB is a ligase involved in tRNA splicing and RNA repair in all domains of life (Englert et al., 2011; Popow et al., 2011; Tanaka and Shuman, 2011). Unlike the 5'-3'T4 Rnl1, RtcB ligates tRNA with GTP and Mn 2+ In the presence of , the cleaved RNA is capped with a 2',3' cyclic phosphate (2,3-cP) and a 5'-OH terminus (Chakravarty et al., 2012). This enzyme actually catalyzes a two-step process in which the 2,3-cP is hydrolyzed to the 3' monophosphate, followed by ligation to the 5'-OH (Tanaka and Shuman, 2011).

[0117] Figure 7E (left) shows that one-step enzymatic repair of nicked tRNAs using E. coli RtCB was sufficient to repair RNase 1-treated RNA without prior end repair with T4 PNK. Indeed, when RtCB was incubated with RNase 1-treated RNA, a tRNA-sized band was regenerated, and the generation of this ligation product was inhibited by heating (Figure 7E, left). The repaired tRNA-sized band was 4 or 5 nucleotides shorter than the parent full-length tRNA (Figure 7E, right).

[0118] Nicked tRNA as a source of intracellular stress-induced tRNA half molecules. Enzymatic repair assays may be less effective at detecting the presence of nicked tRNAs inside cells when a large excess of full-length tRNAs is present in the intracellular sample. To separate stress-induced tRNA half molecules (tiRNAs) present inside cells (which are single-stranded fragments even when complexed with proteins) from their parent tRNAs, we used a different strategy (Figures 8A-8C) based on intracellular RNA fractionation under non-denaturing conditions by size-exclusion chromatography (SEC).

[0119] Based on the method described by Yamasaki et al. (2009), U2-OS cells were exposed to 500 μM sodium arsenite for 2 hours, and the presence of stress-induced tRNA half molecules was verified by Northern blot (Figure 8A). Stressed cells were then lysed using a phenol-free method, and intracellular RNA was purified by SPE and separated by SEC using an FPLC system. As a control, RNA was heat-denatured, cooled to room temperature, and injected in a parallel assay.

[0120] The tRNA peak was V, as evidenced by the recorded absorbance at 260 nm (Fig. 8A) and Northern blot (Fig. 8B). e The miR-21-5p consistently eluted at 9.80 mL. Surprisingly, Northern blot bands corresponding to the 5' tRNA half molecules (35 nt and 30 nt) were observed only in the fractions corresponding to the tRNA peak (Figure 8B). A more sensitive stem-loop RT-qPCR assay according to the method described by Tosar et al. (Non-Patent Document 12) was used to identify the tRNA half molecules in other fractions. miR-21-5p was found to be V e = 11.4 mL, while 30 nt tRNA Gly GCC The 5' half molecule is the V molecule from which the majority of full-length tRNAs are eluted. e The Northern blot signal of the full-length tRNA peak was reduced by heating the RNA before injection (Fig. 8B), but the tRNA GlyThe major SL-RT-qPCR peak of the 5' half molecule shifted to a higher elution volume. The majority of the 30-nt tRNA-derived fragment co-eluted with miR-21-5p in the heated sample.

[0121] These chromatography columns Gly GCC 5' half molecule is V e = 9.80 mL, which means that tRNA Gly GCC This could also be explained by dimerization of the 5' half molecules (Tosar et al., 2018). However, the 30-nt tRNA can dimerize in vitro. Gly GCC 9 GG / AA Transfection of cells with the mutants (Tosar et al., 2018) showed chromatographic elution consistent with their existence in a monomeric form (Figure 8D), suggesting that intracellular conditions were not favorable for homodimer formation or that the dimers dissociated during cell lysis.

[0122] Taken together, dimer formation does not explain the elution of intracellular tRNA half molecules in the chromatographic peak corresponding to RNA twice the predicted size. Therefore, our results suggest that at least some intracellular tiRNAs exist primarily in the form of nicked tRNAs. Alternatively, intracellular tiRNAs may be degraded upon cell lysis, leaving only the more stable nicked tRNAs.

[0123] Nonvesicular nicked tRNA circulates in human biological fluids. Having validated a method capable of separating nicked tRNA from single-stranded tRNA half molecules, we undertook this approach to further address the question of whether nicked tRNA circulates in human biological fluids.

[0124] 200 μL of human serum was diluted in PBS, and EVs were pelleted by ultracentrifugation. RNA was then isolated from the proteinase K-treated supernatant and fractionated by SEC. Surprisingly, a 30-nt tRNA fragment, which fell predominantly within the size range corresponding to full-length tRNAs, was not expected to be present in these samples (Figure 2B). Gly GCC The 5' half molecule could be amplified by SL-RT-qPCR (Figure 8E). These results demonstrate that non-vesicular nicked tRNAs are present in human serum.

[0125] Nicked tRNAs are reverse transcribed inefficiently unless repaired Cleavage of the phosphodiester bond can act as a blocker that inhibits reverse transcription (RT) of nicked tRNAs in their native state, thereby preventing analysis of nicked tRNAs by RT-PCR or sequencing. Gly GCC The forward and reverse PCR primers were designed to match the 3' end of tRNA 3′ (Figure 9A). Gly GCC The 30-nt 5'-tRNA fragments were located near the 5' and 3' ends of the RNase-1-treated RNA. Surprisingly, RNase-1-treated RNA was not amplified unless enzymatic repair (T4 PNK + T4 Rnl1) was performed before RT. Consistent with the Northern blot results shown in Figures 7A, 7B, and 7E, heating the sample before the enzymatic treatment step also inhibited RT-PCR amplification (see Figure 9A). Conversely, the 30-nt 5'-tRNA fragment in the RNase-1-treated sample was significantly amplified. Gly GCCHalf-molecules are increased 200- to 700-fold relative to the input, illustrating the limitations of small RNA expression analysis in samples containing nicked forms of their parent RNAs. Figure 9A shows that reverse transcriptase (represented by a track) is unable to read through the nick characteristic of nicked or damaged RNA, thus demonstrating the need for the enzymatic repair process disclosed herein for efficient reverse transcription and amplification (and thus sequencing) of nicked tRNAs.

[0126] Consideration It is widely believed that all RNAs are intrinsically unstable and cannot circulate in extracellular samples without the context of RNPs, lipoproteins, and / or EVs. While this is true for rRNA-derived fragments (Figure 1) and non-vesicular RNU2-derived small RNAs (Tosar et al., 2022), full-length or nicked tRNAs exhibited surprisingly long half-lives in human biological fluids, even when incubated in their naked form. While these RNAs can also exist as RNP complexes in the extracellular space, the results herein demonstrate that protein complex formation is not a prerequisite for their remarkable extracellular stability.

[0127] Importantly, differences in extracellular stability were observed among tRNAs. At one extreme, full-length tRNAs were stable regardless of sample type. Lys UUU was processed at a slower rate than any other RNA tested, as compared with, for example, the rapidly processed full-length tRNA Gly GCC One explanation is that post-transcriptionally modified bases are at least partially responsible for these different behaviors. Based on the modomics database, tRNA Gly GCC does not contain any modified bases in the anticodon loop except for mC at position 37. In contrast, at least in yeast, tRNA Lys UUUcontains mcm5s2U and t6A at positions 34 and 37, respectively. These modifications have been shown to facilitate cleavage by bacterial and yeast anticodon ribonucleases (Bacusmo et al., 2018; Lentini et al., 2018), whereas mammalian RNases are often inhibited by modified bases present in the anticodon (Lyons et al., 2018).

[0128] The difference in stability between tRNAs is less pronounced considering that nicked tRNAs, but not tDR, are stable degradation intermediates that determine the abundance of nonvesicular glycine tRNA half molecules. Gly GCC Although tRNA was efficiently cleaved at several positions by extracellular RNases, these cleavage events likely resulted in a molecule that still resembled tRNA, even if it had some broken phosphodiester bonds. Lys UUU and tRNA Gly GCC exhibit completely different behavior when analyzed by Northern blot after exposure to RNase, but this difference may be exaggerated because standard Northern blot techniques force nicked tRNAs to undergo denaturation. This is also true when RNA is purified using phenol and when RNA is heated at any stage of the protocol (e.g., RNA-seq). An important conclusion is that the majority of available analytical techniques involve a denaturation step at some point, and therefore do not necessarily capture RNA in its true native form.

[0129] tRNA Lys UUU The case of tRNA is also interesting. Lys UUUAlthough tDR is highly resistant to degradation, once it is cleaved by r-RNase 1 or FBS-derived RNase A, it does not survive as a nicked tRNA (Fig. 2A). This is related to extracellular RNases in the degradation of tDR (Non-Patent Document 4). In contrast, tRNA Gly GCC was sensitive to the initial cleavage event, but the resulting nicked tRNA was intrinsically stable. The differential stability among distinct tRNA sequences can be considered a novel example of the non-canonical "moonlighting" function of tRNAs, associated with the diversity of the tRNA isodecoder pool (Avcilar-Kucukgoze and Kashina, 2020).

[0130] Nicked tRNAs are not considered stable degradation intermediates in the literature (Chen et al., 2021). While stress-induced tRNA cleavage at the anticodon loop is considered an irreversible process, the reversibility of stress-induced nicked tRNA formation in cellulos raises an intriguing possibility. In clinical settings, double-stranded RNA typically requires encapsulation in lipid nanoparticles or GalNAc conjugation for efficient uptake, whereas single-stranded oligonucleotides are spontaneously internalized by endocytosis (Levin, 2019). Therefore, the mechanism of the enzymatic repair process disclosed herein, in which nonvesicular nicked tRNAs are the carriers of tRNA half molecules capable of transmitting information to recipient cells, is at least feasible (Figure 9B).

[0131] Disclosed herein is a novel analytical technique that can be used to analyze stable, non-vesicular RNAs circulating in biological fluids. While this example focuses primarily on tRNAs, closer examination of SYBR Gold-stained gels reveals additional bands that can be recovered by combined PNK and Rnl1 treatment and that were lost in heated samples (Figure 7B). This strongly suggests that the non-vesicular RNAome is much more complex than previously thought, based on recent discoveries (NPL 2). Many stable, non-vesicular RNAs are single-stranded molecules tightly bound to and protected by extracellular RNA-binding proteins (NPL 10; Tosar et al., 2022; NPL 11). However, other recoverable RNAs circulating in biological fluids may belong to a "new" category of endogenously stable extracellular RNAs (Tosar, 2021). These molecules are highly structured and nicked.

[0132] Sequencing methods exist that can efficiently handle highly structured RNA (Behrens et al., 2021; Qin et al., 2016). However, nicked RNA is more challenging because it contains obstacles to reverse transcriptase (i.e., broken phosphodiester bonds; Figure 9A) and because nicked RNA dissociates with phenol, heat, or other denaturants. Therefore, the enzymatic repair protocol disclosed herein expands the number and types of RNA molecules that can be analyzed and used as disease biomarkers.

[0133] In this example, protein-free RNAs were incubated in human biological fluids, and their degradation kinetics were measured by Northern blot. Certain naked tRNAs were found to be endogenously stable. The half-lives of several naked RNAs were measured. While typically rapidly eliminated, certain full-length tRNAs degrade relatively slowly in biological fluids. Furthermore, the stability of the 5' tRNA half molecules generated by endonucleolytic cleavage of unstable tRNAs is extremely high. However, these ultrastable tRNA-derived fragments (tDRs) do not exist as actual fragments in the majority of extracellular samples. In contrast, these ultrastable tRNAs circulate primarily as full-length tRNAs containing only a few broken phosphodiester bonds. Equally surprising, these ultrastable RNAs are not single-stranded.

[0134] Studying these nicked tRNAs remains challenging, despite their presence being confirmed by native gel analysis, due to the artifactual denaturation induced by standard RNA extraction protocols, such as Northern blotting and RNA-seq. In this study, we developed and utilized a different strategy: enzymatic repair and separation by electrophoresis or chromatography under native conditions. After phenol-free RNA purification, we used a two-step method based on enzymatic repair using T4 PNK and Rnl1 (or one-step ligation using recombinant RtcB). Heating the sample prior to enzymatic treatment inhibited nicked tRNA repair.

[0135] Nicked tRNAs were separated from tDR by chromatography under native conditions, and these protocols were used to identify nicked tRNAs inside stressed cells and in vesicle-depleted human biofluids.

[0136] The results also show that these RNAs exist natively as full-length tRNAs containing broken phosphodiester bonds. This is surprising and important, as these nicked or partially cleaved forms are not detected using commonly used RNA purification methods, sequencing, and Northern blotting, forcing them to melt into single-stranded tRNA half molecules. Furthermore, Figure 9 demonstrates that the enzymatic protocol described herein is required for efficient reverse transcription and amplification (and therefore sequencing) of nicked tRNAs. As shown in Figure 9A, when nicked RNAs are purified under native conditions without the enzymatic repair step, they are not efficiently reverse transcribed (and therefore not amplified or sequenced). This same conclusion also applies to nanopore-based direct RNA sequencing.

[0137] The method presented in this example is useful for revealing hidden layers of the extracellular RNAome, which is composed of highly structured RNAs containing endogenously stable nicks.

[0138] All documents and references cited herein, including but not limited to journal articles or abstracts, published or corresponding U.S. or international patent applications, issued U.S. or foreign patents, or any other documents, are each incorporated herein by reference in their entirety, including all data, tables, figures, and text contained in the cited documents and references.

[0139] References Akiyama, Y., Lyons, S.M., Fay, M.M., Tomioka, Y., Abe, T., Anderson, P.J., and Ivanov, P. (2022). Selective Cleavage at CCA Ends and Anticodon Loops of tRNAs by Stress-Induced RNases. Front. Mol. Biosci. 9. Arroyo, J.D., Chevillet, J.R., Kroh, E.M., Ruf, I.K., Pritchard, C.C., Gibson, D.F., Mitchell, P.S., Bennett, C.F., Pogosova-Agadjanyan, E.L., Stirewalt, D.L., et al. (2011). Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc. Natl. Acad. Sci. U. S. A. 108, 5003-5008. Avcilar-Kucukgoze, I., and Kashina, A. (2020). Hijacking tRNAs From Translation: Regulatory Functions of tRNAs in Mammalian Cell Physiology. Front. Mol. Biosci. 0, 388. Bacusmo, J.M., Orsini, S.S., Hu, J., DeMott, M., Thiaville, P.C., Elfarash, A., Paulines, M.J., Rojas-Benitez, D., Meineke, B., Deutsch, C., et al. (2018). The t6A modification acts as a positive determinant for the anticodon nuclease PrrC, and is distinctively nonessential in Streptococcus mutans. RNA Biol. 15, 508-517. Behrens, A., Rodschinka, G., and Nedialkova, D.D. (2021). High-resolution quantitative profiling of tRNA abundance and modification status in eukaryotes by mim-tRNAseq. Mol. Cell 81, 1802-1815.e7. Buck, A.H., Coakley, G., Simbari, F., McSorley, H.J., Quintana, J.F., Le Bihan, T., Kumar, S., Abreu-Goodger, C., Lear, M., Harcus, Y., et al. (2014). Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity. Nat. Commun. 5, 5488. Cai, Q., Qiao, L., Wang, M., He, B., Lin, F.-M., Palmquist, J., Huang, S.-D., and Jin, H. (2018). Plants send small RNAs in extracellular vesicles to fungal pathogen to silence virulence genes. Science 360, 1126-1129. Chakravarty, A.K., Subbotin, R., Chait, B.T., and Shuman, S. (2012). RNA ligase RtcB splices 3′-phosphate and 5′-OH ends via covalent RtcB-(histidinyl)-GMP and polynucleotide-(3′)pp(5′)G intermediates. Proc. Natl. Acad. Sci. U. S. A. 109. Chen, Q., Zhang, X., Shi, J., Yan, M., and Zhou, T. (2021). Origins and evolving functionalities of tRNA-derived small RNAs. Trends Biochem. Sci. 46, 790-804. David, M., Borasio, G.D., and Kaufmann, G. (1982). Bacteriophage T4-induced anticodon-loop nuclease detected in a host strain restrictive to RNA ligase mutants. Proc. Natl. Acad. Sci. 79, 7097-7101. Dhahbi, J.M., Spindler, S.R., Atamna, H., Yamakawa, A., Boffelli, D., Mote, P., and Martin, D.I.K. (2013). 5’ tRNA halves are present as abundant complexes in serum, concentrated in blood cells, and modulated by aging and calorie restriction. BMC Genomics 14, 298. Englert, M., Sheppard, K., Aslanian, A., Yates, J.R., and Soell, D. (2011). Archaeal 3′-phosphate RNA splicing ligase characterization identifies the missing component in tRNA maturation. Proc. Natl. Acad. Sci. U. S. A. 108. Fu, H., Feng, J., Liu, Q., Sun, F., Tie, Y., Zhu, J., Xing, R., Sun, Z., and Zheng, X. (2009). Stress induces tRNA cleavage by angiogenin in mammalian cells. FEBS Lett. 583, 437-442. Gambaro, F., Li Calzi, M., Fagundez, P., Costa, B., Greif, G., Mallick, E., Lyons, S., Ivanov, P., Witwer, K., Cayota, A., et al. (2020). Stable tRNA halves can be sorted into extracellular vesicles and delivered to recipient cells in a concentration-dependent manner. RNA Biol. 17, 1168-1182. Garcia-Silva, M.R., Cura Das Neves, R.F., Cabrera-Cabrera, F., Sanguinetti, J., Medeiros, L.C., Robello, C., Naya, H., Fernandez-Calero, T., Souto-Padron, T., De Souza, W., et al. (2014). Extracellular vesicles shed by Trypanosoma cruzi are linked to small RNA pathways, life cycle regulation, and susceptibility to infection of mammalian cells. Parasitol. Res. 113, 285-304. Geekiyanage, H., Rayatpisheh, S., Wohlschlegel, J.A., Brown, R., and Ambros, V. (2020). Extracellular microRNAs in human circulation are associated with miRISC complexes that are accessible to anti-AGO2 antibody and can bind target mimic oligonucleotides. Proc. Natl. Acad. Sci. U. S. A. 117, 24213-24223. Heitzer, E., Haque, I.S., Roberts, C.E.S., and Speicher, M.R. (2019). Current and future perspectives of liquid biopsies in genomics-driven oncology. Nat. Rev. Genet. 20, 71-88. Ivanov, P., Emara, M.M., Villen, J., Gygi, S.P., and Anderson, P. (2011). Angiogenin-induced tRNA fragments inhibit translation initiation. Mol. Cell 43, 613-623. Kaufmann, G. (2000). Anticodon nucleases. Trends Biochem. Sci. 25, 70-74. Kim, H.K., Fuchs, G., Wang, S., Wei, W., Zhang, Y., Park, H., Roy-Chaudhuri, B., Li, P., Xu, J., Chu, K., et al. (2017). A transfer-RNA-derived small RNA regulates ribosome biogenesis. Nature 552, 57-62. Kuscu, C., Kumar, P., Kiran, M., Su, Z., Malik, A., and Dutta, A. (2018). tRNA fragments (tRFs) guide Ago to regulate gene expression post-transcriptionally in a Dicer-independent manner. RNA 24, 1093-1105. Lentini, J.M., Ramos, J., and Fu, D. (2018). Monitoring the 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U) modification in eukaryotic tRNAs via the γ-toxin endonuclease. RNA 24, 749-758. Levin, A.A. (2019). Treating Disease at the RNA Level with Oligonucleotides. N. Engl. J. Med. 380, 57-70. Li, G., Manning, A.C., Bagi, A., Yang, X., Gokulnath, P., Spanos, M., Howard, J., Chan, P.P., Sweeney, T., Kitchen, R., et al. (2022). Distinct Stress-Dependent Signatures of Cellular and Extracellular tRNA-Derived Small RNAs. Adv. Sci. 9. Li, Y., Luo, J., Zhou, H., Liao, J.Y., Ma, L.M., Chen, Y.Q., and Qu, L.H. (2008). Stress-induced tRNA-derived RNAs: A novel class of small RNAs in the primitive eukaryote Giardia lamblia. Nucleic Acids Res. 36, 6048-6055. Lyons, S.M., Fay, M.M., and Ivanov, P. (2018). The role of RNA modifications in the regulation of tRNA cleavage. FEBS Lett. 592, 2828-2844. Lyons, S.M., Kharel, P., Akiyama, Y., Ojha, S., Dave, D., Tsvetkov, V., Merrick, W., Ivanov, P., and Anderson, P. (2021). eIF4G has intrinsic G-quadruplex binding activity that is required for tiRNA function. Nucleic Acids Res. 48, 6223-6233. Mateescu, B., Kowal, E.J.K., van Balkom, B.W.M., Bartel, S., Bhattacharyya, S.N., Buzas, E.I., Buck, A.H., de Candia, P., Chow, F.W.N., Das, S., et al. (2017). Obstacles and opportunities in the functional analysis of extracellular vesicle RNA - An ISEV position paper. J. Extracell. Vesicles 6, 1286095. Nechooshtan, G., Yunusov, D., Chang, K., and Gingeras, T.R. (2020). Processing by RNase 1 forms tRNA halves and distinct Y RNA fragments in the extracellular environment. Nucleic Acids Res. 48, 8035-8049. Nolte’T Hoen, E.N.M., Buermans, H.P.J., Waasdorp, M., Stoorvogel, W., Wauben, M.H.M., and ’T Hoen, P.A.C. (2012). Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions. Nucleic Acids Res. 40, 9272-9285. O’Brien, K., Breyne, K., Ughetto, S., Laurent, L.C., and Breakefield, X.O. (2020). RNA delivery by extracellular vesicles in mammalian cells and its applications. Nat. Rev. Mol. Cell Biol. 21, 585-606. Pawar, K., Shigematsu, M., Sharbati, S., and Kirino, Y. (2020). Infection-induced 5’-half molecules of tRNAHisGUG activate Toll-like receptor 7. PLoS Biol. 18, e3000982. Popow, J., Englert, M., Weitzer, S., Schleiffer, A., Mierzwa, B., Mechtler, K., Trowitzsch, S., Will, C.L., Luehrmann, R., Soell, D., et al. (2011). HSPC117 is the essential subunit of a human tRNA splicing ligase complex. Science (80-. ). 331, 760-764. Qin, Y., Yao, J., Wu, D.C., Nottingham, R.M., Mohr, S., Hunicke-Smith, S., and Lambowitz, A.M. (2016). High-throughput sequencing of human plasma RNA by using thermostable group II intron reverse transcriptases. RNA 22, 111-128. Sanadgol, N., Koenig, L., Drino, A., Jovic, M., and Schaefer, M.R. (2022). Experimental paradigms revisited: oxidative stress-induced tRNA fragmentation does not correlate with stress granule formation but is associated with delayed cell death. Nucleic Acids Res. 50, 6919-6937. Schwer, B., Sawaya, R., Ho, C.K., and Shuman, S. (2004). Portability and fidelity of RNA-repair systems. Proc. Natl. Acad. Sci. U. S. A. 101, 2788-2793. Skog, J., Wurdinger, T., van Rijn, S., Meijer, D.H., Gainche, L., Sena-Esteves, M., Curry, W.T.J., Carter, B.S., Krichevsky, A.M., and Breakefield, X.O. (2008). Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat. Cell Biol. 10, 1470-1476. Sorrentino, S. (2010). The eight human “canonical” ribonucleases: Molecular diversity, catalytic properties, and special biological actions of the enzyme proteins. FEBS Lett. 584, 2194-2200. Srinivasan, S., Yeri, A., Cheah, P.S., Chung, A., Danielson, K., De Hoff, P., Filant, J., Laurent, C.D., Laurent, L.D., Magee, R., et al. (2019). Small RNA Sequencing across Diverse Biofluids Identifies Optimal Methods for exRNA Isolation. Cell 177, 446-462. Tanaka, N., and Shuman, S. (2011). RtcB is the RNA ligase component of an Escherichia coli RNA repair operon. J. Biol. Chem. 286, 7727-7731. Thomou, T., Mori, M.A., Dreyfuss, J.M., Konishi, M., Sakaguchi, M., Wolfrum, C., Rao, T.N., Winnay, J.N., Garcia-Martin, R., Grinspoon, S.K., et al. (2017). Adipose-derived circulating miRNAs regulate gene expression in other tissues. Nature 542, 450-455. Thompson, D.M., Lu, C., Green, P.J., and Parker, R. (2008). tRNA cleavage is a conserved response to oxidative stress in eukaryotes. RNA 14, 2095-2103. Tosar, J.P. (2021). Die hard: resilient RNAs in the blood. Nat. Rev. Mol. Cell Biol. 22, 373-373. Tosar, J.P., and Cayota, A. (2020). Extracellular tRNAs and tRNA-derived fragments. RNA Biol. 17, 1149-1167. Tosar, J.P., Gambaro, F., Sanguinetti, J., Bonilla, B., Witwer, K.W., and Cayota, A. (2015). Assessment of small RNA sorting into different extracellular fractions revealed by high-throughput sequencing of breast cell lines. Nucleic Acids Res. 43, 5601-5616. Tosar, J.P., Gambaro, F., Darre, L., Pantano, S., Westhof, E., and Cayota, A. (2018). Dimerization confers increased stability to nucleases in 5’ halves from glycine and glutamic acid tRNAs. Nucleic Acids Res. 46, 9081-9093. Tosar, J.P., Segovia, M., Castellano, M., Gambaro, F., Akiyama, Y., Fagundez, P., Olivera, A., Costa, B., Possi, T., Hill, M., et al. (2020). Fragmentation of extracellular ribosomes and tRNAs shapes the extracellular RNAome. Nucleic Acids Res. 48, 12874-12888. Tosar, J.P., Witwer, K., and Cayota, A. (2021). Revisiting Extracellular RNA Release, Processing, and Function. Trends Biochem. Sci. 46, 438-445. Tosar, J.P., Cayota, A., and Witwer, K. (2022). Exomeres and supermeres: Monolithic or diverse? J. Extracell. Biol. 1, e45. Turchinovich, A., Weiz, L., Langheinz, A., and Burwinkel, B. (2011). Characterization of extracellular circulating microRNA. Nucleic Acids Res. 39, 7223-7233. Valadi, H., Ekstrom, K., Bossios, A., Sjostrand, M., Lee, J.J., and Lotvall, J.O. (2007). Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 9, 654-659. Vickers, K.C., Palmisano, B.T., Shoucri, B.M., Shamburek, R.D., and Remaley, A.T. (2011). MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat. Cell Biol. 13, 423-435. Wei, Z., Batagov, A.O., Schinelli, S., Wang, J., Wang, Y., El Fatimy, R., Rabinovsky, R., Balaj, L., Chen, C.C., Hochberg, F., et al. (2017). Coding and noncoding landscape of extracellular RNA released by human glioma stem cells. Nat. Commun. 8, 1145. Xiao, Y., Driedonks, T., Witwer, K.W., Wang, Q., and Yin, H. (2020). How does an RNA selfie work? EV-associated RNA in innate immunity as self or danger. J. Extracell. Vesicles 9, 1793515. Yamasaki, S., Ivanov, P., Hu, G.-F., and Anderson, P. (2009). Angiogenin cleaves tRNA and promotes stress-induced translational repression. J. Cell Biol. 185, 35-42. Zhang, Q., Jeppesen, D.K., Higginbotham, J.N., Graves-Deal, R., Trinh, V.Q., Ramirez, M.A., Sohn, Y., Neininger, A.C., Taneja, N., McKinley, E.T., et al. (2021). Supermeres are functional extracellular nanoparticles replete with disease biomarkers and therapeutic targets. Nat. Cell Biol. 23, 1240-1254. Zhang, Y., Zhang, Y., Shi, J., Zhang, H., Cao, Z., Gao, X., Ren, W., Ning, Y., Ning, L., Cao, Y., et al. (2014). Identification and characterization of an ancient class of small RNAs enriched in serum associating with active infection. J. Mol. Cell Biol. 6, 172-174.

Claims

1. 1. A method for enzymatically repairing nicked or at least partially cleaved RNA, comprising: providing a biological sample containing nicked or at least partially cleaved RNA; purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; The purified RNA was analyzed as follows: (i) one or more enzymes selected from the group consisting of an enzyme exhibiting RNA 3' phosphatase or cyclic phosphatase activity, an enzyme exhibiting RNA 5' kinase activity, and an RNA ligase; or (ii) a 3'-5' RNA ligase; forming repaired RNA from the nicked or at least partially cleaved RNA by treating the RNA with at least one of A method comprising:

2. 2. The method of claim 1, wherein the nicked or at least partially cleaved RNA comprises one or more RNAs selected from the group consisting of tRNA, rRNA, YRNA, 7SL RNA, 7SK RNA, snRNA, snoRNA, vaultRNA, Alu RNA, transposable element-derived RNA, pri-microRNA, pre-microRNA, mRNA exon, mRNA intron, 5'UTR, 3'UTR, and fragments and combinations thereof.

3. 3. The method of claim 2, wherein the nicked or at least partially cleaved RNA comprises tRNA, tRNA fragments (tRFs), tRNA-derived RNAs (tDRs), and / or tRNA half molecules.

4. 4. The method of claim 3, wherein at least a portion of the nicked or at least partially cleaved RNA comprises a single-stranded tRNA half molecule.

5. 2. The method of claim 1, wherein the repaired RNA comprises a nucleotide sequence that is identical or substantially identical over its entire length or substantially its entire length to the parent RNA from which the nicked or at least partially cleaved RNA was formed.

6. 2. The method of claim 1, wherein the treatment is with (i)(a) polynucleotide kinase (PNK) and RNA ligase.

7. 7. The method of claim 6, wherein the polynucleotide kinase is added together with or after the RNA ligase.

8. 8. The method of claim 6 or 7, wherein the polynucleotide kinase is T4 polynucleotide kinase (PNK).

9. 2. The method of claim 1, wherein the treatment is with (i)(b) an RNA 3' phosphatase or an RNA 2',3' cyclic phosphatase, an RNA 5' kinase, and an RNA ligase.

10. 10. The method of claim 9, wherein the RNA 3' phosphatase or RNA 2',3' cyclic phosphatase, the RNA 5' kinase, and the RNA ligase are added together or sequentially.

11. The method according to any one of claims 6 to 10, wherein the RNA ligase is T4 RNA ligase 1.

12. The method of claim 1, wherein the treatment is (ii) with a 3'-5' RNA ligase.

13. The method of claim 12, wherein the 3'-5' RNA ligase is RtcB ligase.

14. The method according to one of claims 6 to 10 and 12 to 13, wherein the treating is carried out at least in part in the presence of adenosine triphosphate (ATP) or guanosine-5'-triphosphate (GTP).

15. 10. The method of claim 1, wherein the non-denaturing conditions comprise silica-based solid phase extraction, chromatographic methods, RNA precipitation, or a combination thereof.

16. The method of claim 1, which is carried out in the absence of conditions that result in denaturation of RNA molecules.

17. 17. The method of claim 16, wherein the conditions comprise heating, adapter ligation, a chemical denaturant, or a combination thereof.

18. 17. The method of claim 16, wherein the conditions include the use of phenol.

19. 10. The method of claim 1, wherein the source of the biological sample is a biological fluid, a cell, a tissue, an organ, or any combination thereof.

20. The method of claim 1 , wherein the biological sample is derived from an extracellular biological fluid.

21. 21. The method of claim 20, wherein the extracellular biological fluid is blood, serum, plasma, urine, lymph, saliva, synovial fluid, milk, cerebrospinal fluid, or a combination thereof.

22. The method of claim 1 , wherein the biological sample is derived from a cell.

23. 23. The method of claim 22, wherein the biological sample is derived from a cancerous cell.

24. 23. The method of claim 22, wherein the nicked or at least partially cleaved RNA is a stress-inducible tRNA half molecule.

25. 2. The method of claim 1, wherein at least a portion of the nicked or partially cleaved RNA is formed from non-vesicular extracellular RNA.

26. 2. The method of claim 1, wherein at least a portion of the nicked or partially cleaved RNA is formed from extracellular RNA.

27. 6. The method of claim 5, wherein the repaired RNA comprises a nucleotide sequence identical or substantially identical in length to the parent RNA from which the nicked or at least partially cleaved RNA was formed.

28. 6. The method of claim 5, wherein the repaired RNA is 1 to 11 nucleotides shorter than the parent RNA from which the nicked or at least partially cleaved RNA was formed.

29. 6. The method of claim 5, wherein the repaired RNA is 3 to 5 nucleotides shorter than the parent RNA from which the nicked or at least partially cleaved RNA was formed and is missing a single-stranded overhang.

30. 6. The method of claim 5, wherein the repaired RNA is 3 to 7 nucleotides shorter than the parent RNA from which the nicked or at least partially cleaved RNA was formed, and is missing an anticodon loop or a portion thereof.

31. 1. A method for detecting RNA from a biological sample, comprising: providing a biological sample containing nicked or at least partially cleaved RNA; purifying the nicked or at least partially cleaved RNA contained in the biological sample under non-denaturing conditions to remove non-RNA components; The purified RNA was analyzed as follows: (i) one or more enzymes selected from the group consisting of an enzyme exhibiting RNA 3' phosphatase or cyclic phosphatase activity, an enzyme exhibiting RNA 5' kinase activity, and an RNA ligase; or (ii) a 3'-5' RNA ligase; repairing at least a portion of the nicked or partially cleaved RNA by treating it with at least one of detecting the repaired RNA; and A method comprising:

32. 32. The method of claim 31 , wherein the detecting comprises sequencing, amplification, nucleic acid hybridization, or a combination thereof.

33. 32. The method of claim 31 , wherein the detecting comprises quantitative RT-PCR (RT-qPCR).

34. 32. The method of claim 31 , wherein the detecting comprises a form of high-throughput sequencing.

35. 32. The method of claim 31 , wherein the biological sample is treated with an RNase inhibitor before or after the step of purifying the nicked or at least partially cleaved RNA contained in the biological sample.

36. 32. The method of claim 31 , wherein the nicked or at least partially cleaved RNA comprises one or more RNAs selected from the group consisting of tRNA, rRNA, YRNA, 7SL RNA, 7SK RNA, snRNA, snoRNA, vaultRNA, Alu RNA, transposable element-derived RNA, pri-microRNA, pre-microRNA, mRNA exon, mRNA intron, 5′ UTR, 3′ UTR, and fragments and combinations thereof.

37. 37. The method of claim 36, wherein the nicked or at least partially cleaved RNA comprises tRNA, tRNA fragments (tRFs), tRNA-derived RNAs (tDRs), and / or tRNA half molecules.

38. 38. The method of Claim 37, wherein at least a portion of the nicked or at least partially cleaved RNA comprises a single-stranded tRNA half molecule.

39. 32. The method of claim 31 , wherein the repaired RNA comprises a nucleotide sequence that is identical or substantially identical over its entire length or substantially its entire length to the parent RNA from which the nicked or at least partially cleaved RNA was formed.

40. 32. The method of claim 31, wherein the treatment is with (i)(a) polynucleotide kinase (PNK) and RNA ligase.

41. 41. The method of claim 40, wherein the polynucleotide kinase is added together with or after the RNA ligase.

42. 42. The method of claim 40 or 41, wherein the polynucleotide kinase is T4 polynucleotide kinase (PNK).

43. 32. The method of claim 31, wherein the treatment is with (i)(b) an RNA 3' phosphatase or an RNA 2',3' cyclic phosphatase, an RNA 5' kinase, and an RNA ligase.

44. 44. The method of claim 43, wherein the RNA 3' phosphatase or RNA 2',3' cyclic phosphatase, the RNA 5' kinase, and the RNA ligase are added together or sequentially.

45. The method according to one of claims 40 to 44, wherein the RNA ligase is T4 RNA ligase 1.

46. 32. The method of claim 31, wherein the treatment is (ii) with a 3'-5' RNA ligase.

47. 47. The method of claim 46, wherein the 3'-5' RNA ligase is RtcB ligase.

48. 48. The method according to one of claims 40 to 44 and 46 to 47, wherein the treatment is carried out at least in part in the presence of adenosine triphosphate (ATP) or guanosine-5'-triphosphate (GTP).

49. 32. The method of claim 31 , wherein the non-denaturing conditions comprise silica-based solid phase extraction, chromatographic methods, RNA precipitation, or a combination thereof.

50. 32. The method of claim 31, carried out in the absence of conditions that result in denaturation of RNA molecules.

51. 51. The method of claim 50, wherein the conditions comprise heat, a chemical denaturant, or a combination thereof.

52. 51. The method of claim 50, wherein the conditions include the use of phenol.

53. 32. The method of claim 31 , wherein the source of the biological sample is a biological fluid, a cell, a tissue, an organ, or any combination thereof.

54. 32. The method of claim 31 , wherein the biological sample is derived from an extracellular biological fluid.

55. 55. The method of claim 54, wherein the extracellular biological fluid is blood, serum, plasma, urine, lymph, saliva, synovial fluid, milk, cerebrospinal fluid, or a combination thereof.

56. 32. The method of claim 31 , wherein the biological sample is derived from a cell.

57. 57. The method of claim 56, wherein the biological sample is derived from a cancerous cell.

58. 57. The method of claim 56, wherein the nicked or at least partially cleaved RNA is a stress-inducible tRNA half molecule.

59. 32. The method of claim 31 , wherein at least a portion of the nicked or partially cleaved RNA is formed from non-vesicular extracellular RNA.

60. 32. The method of claim 31 , wherein at least a portion of the nicked or partially cleaved RNA is formed from extracellular RNA.

61. 40. The method of Claim 39, wherein the repaired RNA comprises a nucleotide sequence identical or substantially identical in length to the parent RNA from which the nicked or at least partially cleaved RNA was formed.

62. 40. The method of claim 39, wherein the repaired RNA is 1 to 11 nucleotides shorter than the parent RNA from which the nicked or at least partially cleaved RNA was formed.

63. 40. The method of claim 39, wherein the repaired RNA is 3 to 5 nucleotides shorter than the parent RNA from which the nicked or at least partially cleaved RNA was formed and is missing a single-stranded overhang.

64. 40. The method of claim 39, wherein the repaired RNA is 3 to 7 nucleotides shorter than the parent RNA from which the nicked or at least partially cleaved RNA was formed, and is missing an anticodon loop or portion thereof.

Images