Combination Therapies for the Treatment of Cancer
Combining AKT, PI3K-α, or mTOR inhibitors with KDM5C inhibitors addresses resistance in breast cancer treatments, enhancing efficacy and delaying resistance onset.
Patent Information
- Application Number
- JP2025526521
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-11-11
- Filing Date
- 2023-11-10
- Publication Date
- 2025-12-03
AI Technical Summary
Current treatments for breast cancer, including endocrine therapies and targeted therapies like AKT inhibitors, may lose efficacy due to tumor resistance, necessitating new methods to enhance treatment effectiveness and prevent resistance development.
Combining AKT, PI3K-α, or mTOR inhibitors with a KDM5C inhibitor to synergistically treat cancer, potentially increasing sensitivity and overcoming resistance.
Enhances anti-proliferative effects in breast cancer by sensitizing cancer cells to AKT inhibition, delaying resistance onset, and improving treatment efficacy.
Smart Images

Figure 2025539034000001_ABST
Abstract
Description
[Technical Field]
[0001] The present specification relates to the use of an AKT inhibitor, a PI3K-α inhibitor or an mTOR (eg, mTORC1) inhibitor in combination with a KDM5C inhibitor to treat cancer, for example, breast cancer. [Background technology]
[0002] Breast cancer remains a leading cause of death. Although effective treatments (especially endocrine therapies such as aromatase inhibitors and selective estrogen modulators) have been developed over the past 50 years, they may not be effective in all cancer types or may lose efficacy over time due to the development of tumor resistance. Therefore, new methods for treating cancer (especially advanced or metastatic cancer) remain needed.
[0003] One modern approach to treating breast cancer relies on the use of targeted therapies, such as receptor tyrosine kinase inhibitors (TKIs), to address cancers that are not controlled under current paradigms or to overcome pathways by which cancer cells evolve resistance. For example, AKT is a serine / threonine-specific protein kinase that functions as part of the PI3K / AKT / PTEN pathway and plays a critical role in multiple cellular processes, including glucose metabolism, apoptosis, cell proliferation, transcription, and cell migration. Mammalian cells express three closely related AKT isoforms encoded by different genes: AKT1 (protein kinase Bα), AKT2 (protein kinase Bβ), and AKT3 (protein kinase Bγ). Capivasertib (also known as AZD5363 and by the chemical name (S)-4-amino-N-(1-(4-chlorophenyl)-3-hydroxypropyl)-1-(7H-pyrrolyl[2,3-d]pyrimidin-4-yl)piperidine-4-carboxamide) is a selective inhibitor of all three AKT isoforms. Capivasertib is currently being evaluated in clinical studies for use in the treatment of cancer, including breast cancer, where (among other applications) it may be used to overcome drug resistance. However, the evolutionary nature of cancer means that resistance to capivasertib treatment itself may develop over time, reducing its effectiveness.
[0004] The KDM5C gene encodes lysine-specific demethylase 5C, a member of the α-ketoglutarate-dependent hydroxylase superfamily of enzymes. Genome-scale CRISPR screening has identified KDM5C as a gene that, when "knocked out," increases sensitivity to capivasertib in estrogen receptor-positive (ER-positive) breast cancer cell lines. Thus, the present specification discloses that inhibiting KDM5C may further sensitize certain types of cancer cells to AKT inhibition, potentially providing a method for increasing the efficacy of drugs such as capivasertib, both before and after resistance to previous capivasertib-based therapies has developed.
[0005] Similar beneficial effects are also disclosed when KDM5C inhibitors are combined with two other drug classes that target PI3K / AKT / PTEN and mTOR pathways: PI3K-α inhibitors (such as selective PI3K-α inhibitors or specific PI3K-α inhibitors) and mTOR inhibitors (such as selective mTORC1 inhibitors).Therefore, it has been determined that treatment with KDM5C inhibitors can overcome resistance and resensitize cancer to the therapeutic effects of inhibiting AKT, PI3K-α or mTOR.Therefore, the combination of AKT, PI3K-α or mTOR inhibitors and KDM5C inhibitors can act synergistically together in treatment to prevent or delay the onset of resistance. Summary of the Invention
[0006] The present disclosure provides a means for enhancing the anti-proliferative effects of AKT, PI3K-α and mTOR treatment in cancer (eg, breast cancer) utilizing KDM5C inhibitors in combination with AKT, PI3K-α and mTOR inhibitors.
[0007] In one aspect, a compound is provided for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0008] In one aspect, there is provided a compound for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, and the compound is an AKT inhibitor.
[0009] In one aspect, there is provided a compound for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, and the compound is a PI3K-α inhibitor.
[0010] In one aspect, a compound is provided for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, and the compound is an mTOR inhibitor.
[0011] The terms "treat," "treating," and "treatment" refer to at least partially alleviating, inhibiting, preventing, and / or ameliorating a condition, disorder, or disease, such as breast cancer. The term "treatment of cancer" includes both in vitro and in vivo treatments, including treatment in warm-blooded animals such as humans. The effectiveness of cancer treatment can be evaluated in various ways, including, but not limited to, inhibiting cancer cell proliferation (including reversing cancer growth), promoting cancer cell death (e.g., by promoting apoptosis or another cell death mechanism), symptom improvement, duration of response to treatment, delay in disease progression, and prolongation of survival. Treatment can also be evaluated with respect to the nature and extent of side effects associated with treatment. Furthermore, effectiveness can be evaluated with respect to biomarkers, such as levels of expression or phosphorylation of proteins known to be associated with particular biological phenomena. Other evaluations of effectiveness are known to those of skill in the art.
[0012] The phrase "in combination with" and similar terms encompasses the administration of two or more active pharmaceutical ingredients to a subject, including simultaneous administration in separate compositions, administration at different times in separate compositions, or administration in a composition in which more than one active pharmaceutical ingredient is present.
[0013] In embodiments, the compound and the KDM5C inhibitor are administered separately, sequentially, or simultaneously.
[0014] In embodiments, the compound and the KDM5C inhibitor are administered separately.
[0015] In embodiments, the compound and the KDM5C inhibitor are administered sequentially.
[0016] In an embodiment, the compound and the KDM5C inhibitor are administered simultaneously.
[0017] In a further aspect, there is provided a use of a compound in the manufacture of a medicament for the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, and wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0018] In a further aspect, there is provided a method of treating cancer in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a compound, wherein the compound is administered in combination with a therapeutically effective amount of a KDM5C inhibitor, and wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0019] The term "therapeutically effective amount" refers to an amount of a compound or combination of compounds described herein sufficient to effect the intended application, including, but not limited to, disease treatment. A therapeutically effective amount may vary depending on the intended application (in vitro or in vivo), or the subject and disease state being treated (e.g., the subject's weight, age, and sex), the severity of the disease state, the mode of administration, etc., but can be readily determined by one of ordinary skill in the art. The term also applies to a dose that induces a specific response in target cells (e.g., the amount of apoptosis). The specific dose will vary depending on the particular compound selected, the dosing regimen to be followed, whether the compound is co-administered with other compounds, the timing of administration, the tissue to which it is administered, and the physical delivery system by which the compound is delivered.
[0020] In a further aspect, there is provided a method of treating cancer in a patient in need thereof, comprising administering to the patient a first amount of a compound and a second amount of a KDM5C inhibitor, wherein the first amount and the second amount together comprise a therapeutically effective amount, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0021] In a further aspect, there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0022] The term "pharmaceutically acceptable" is used to specify that a subject (e.g., a salt, a dosage form (such as a tablet or capsule), or an excipient (such as a diluent or carrier)) is suitable for use in patients. Exemplary lists of pharmaceutically acceptable salts can be found in "Handbook of Pharmaceutical Salts: Properties, Selection and Use", P.H. Stahl and C.G. Wermuth, editors, Weinheim / Zurich: Wiley-VCH / VFiCA, 2002 or later editions.
[0023] Pharmaceutically acceptable acid addition salts can be formed using inorganic and organic acids. Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid. Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicylic acid. Pharmaceutically acceptable base addition salts can be formed using inorganic and organic bases. Inorganic bases from which salts can be derived include, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum. Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins. Examples include isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine and ethanolamine. [Brief explanation of the drawings]
[0024] [Figure 1]KDM5C was identified as a capivasertib sensitizer in genome-wide CRISPR screening. KDM5C was identified as a capivasertib sensitizer in MCF7, T47D, and CAMA-1 ER-positive breast cancer cell lines, whereas no other KDM5 demethylases were identified. [For Figures 2–19, ns = P > 0.05, * = P ≤ 0.05, ** = P ≤ 0.01] [Figure 2] Cell proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to capivasertib in PIK3CA-mutated estrogen receptor-positive (ER-positive) breast cancer. [Figure 3] Confluence at the end of the study from a cell proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to capivasertib in PIK3CA-mutated, ER-positive breast cancer. [Figure 4] Cell proliferation assay in MCF7 KDM5C KO clonal cell lines. KDM5C KO increases sensitivity to capivasertib in PIK3CA-mutated, ER-positive breast cancer. [Figure 5] Confluence at the end of the study from a cell proliferation assay in an MCF7 KDM5C KO clonal cell line. KDM5C KO increases sensitivity to capivasertib in PIK3CA-mutated, ER-positive breast cancer. [Figure 6] Cell proliferation assay in MCF7 KDM5C KO clonal cell lines. KDM5C KO increases sensitivity to the combination of fulvestrant and capivasertib in PIK3CA-mutated ER-positive breast cancer. [Figure 7] Cell proliferation assay in MCF7 KDM5C KO clonal cell line. KDM5C KO increases sensitivity to the combination of camizestrant and capivasertib in PIK3CA-mutated ER-positive breast cancer. [Figure 8]End-stage confluence from cell proliferation assays in MCF7 KDM5C KO clonal cell lines. KDM5C KO increases sensitivity to the combination of fulvestrant and capivasertib in PIK3CA-mutated, ER-positive breast cancer. [Figure 9] Cell proliferation assay in CAMA-1 KDM5C KO pooled cell line. KDM5C KO increases sensitivity to capivasertib in PTEN-deficient, ER-positive breast cancer. [Figure 10] Confluence at the end of the study from a cell proliferation assay in the CAMA-1 KDM5C KO pooled cell line. KDM5C KO increases sensitivity to capivasertib in PTEN-deficient, ER-positive breast cancer. [Figure 11] Cell proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to alpelisib in PIK3CA-mutated, ER-positive breast cancer. [Figure 12] Confluence at the end of the study from a cell proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to alpelisib in PIK3CA-mutated, ER-positive breast cancer. [Figure 13] Cell proliferation assay in MCF7 KDM5C KO clonal cell lines. KDM5C KO increases sensitivity to alpelisib in PIK3CA-mutated, ER-positive breast cancer. [Figure 14] Confluence at the end of the study from a cell proliferation assay in an MCF7 KDM5C KO clonal cell line. KDM5C KO increases sensitivity to alpelisib in PIK3CA-mutated, ER-positive breast cancer. [Figure 15] Cell proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to everolimus in PIK3CA-mutated, ER-positive breast cancer. [Figure 16]Confluence at the end of the study from a cell proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increases sensitivity to everolimus in PIK3CA-mutated, ER-positive breast cancer. [Figure 17] Acute KDM5C KO increases sensitivity to capivasertib and its combination with fulvestrant in PIK3CA-mutated ER-positive breast cancer (MCF7 cells). [Figure 18] This is the confluence at the end of the study from Figure 17. [Figure 19] Acute KDM5C knockout increases sensitivity to capivasertib in PTEN-deficient, ER-positive breast cancer (CAMA1 cells). [For Figures 20-30, ns = P > 0.05, * = P ≤ 0.05, ** = P ≤ 0.01, *** = P ≤ 0.001] [Figure 20] Combination study in MCF7 (PIK3CA mutant) cells. A KDM5 inhibitor was combined with capivasertib in ER-positive breast cancer with a PIK3CA mutation. [Figure 21] Combination study in CAMA-1 (PTEN-deficient) cells. A KDM5 inhibitor was combined with capivasertib in PTEN-deficient, ER-positive breast cancer. [Figure 22] Combination study in MCF7 ESR1 Y537S cells. A KDM5 inhibitor was combined with capivasertib in PIK3CA-mutated, ER-positive breast cancer cells harboring an ESR1 mutation. [Figure 23] Combination study in MCF7 100F P2 cells. The KDM5 inhibitor was combined with capivasertib in PIK3CA-mutated, ER-positive breast cancer cells that are less sensitive to fulvestrant. [Figure 24] Combination study in T47D 100F1P P1 cells. A KDM5 inhibitor was combined with capivasertib in PIK3CA-mutated, ER-positive breast cancer cells resistant to fulvestrant. [Figure 25]Combination study in T47D 100F1P P2 cells. A KDM5 inhibitor was combined with capivasertib in PIK3CA-mutated ER+ breast cancer cells resistant to fulvestrant and palbociclib. [Figure 26] Combination study in T47D 100F1P P1 cells. A KDM5 inhibitor was combined with alpelisib in PIK3CA-mutated, ER-positive breast cancer cells resistant to fulvestrant. [Figure 27] Combination study in T47D 100F1P P2 cells. A KDM5 inhibitor was combined with alpelisib in PIK3CA-mutated, ER-positive breast cancer cells resistant to fulvestrant and palbociclib. [Figure 28] Combination study in T47D 100F1P P2 cells. A KDM5 inhibitor was combined with everolimus in PIK3CA-mutated, ER-positive breast cancer cells resistant to fulvestrant and palbociclib. [Figure 29] This is a controlled study showing the effect of fulvestrant in resistant PIK3CA-mutated MCF7 ER-positive breast cancer cells. [Figure 30] This is a controlled study demonstrating the efficacy of fulvestrant in resistant PIK3CA-mutated T47D ER-positive breast cancer cells. DETAILED DESCRIPTION OF THE INVENTION
[0025] Cancer treatment In embodiments, the treatment of cancer is treatment of an animal cancer (eg, a mammalian cancer, such as a human cancer).
[0026] In embodiments, the cancer is a hormone-sensitive cancer (e.g., an estrogen- or androgen-sensitive cancer). "Estrogen- or androgen-sensitive" means that the growth of the cancer is driven, at least in part, by the respective hormone pathway, such that blocking the hormone attenuates growth and has a therapeutic effect.
[0027] In embodiments, the cancer is breast cancer (e.g., advanced or metastatic breast cancer).
[0028] In embodiments, the cancer is advanced breast cancer.
[0029] In embodiments, the cancer is metastatic breast cancer.
[0030] In embodiments, the cancer is hormone-sensitive breast cancer.
[0031] In embodiments, the cancer is estrogen-sensitive breast cancer.
[0032] In embodiments, the cancer is ovarian cancer.
[0033] In embodiments, the cancer is estrogen-sensitive ovarian cancer.
[0034] In embodiments, the cancer is endometrial cancer.
[0035] In embodiments, the cancer is estrogen-sensitive endometrial cancer.
[0036] In embodiments, the cancer is prostate cancer.
[0037] In embodiments, the cancer is androgen-sensitive prostate cancer.
[0038] Patient Selection and Diagnostic Methods In embodiments, the patient is a human patient or an animal (eg, mammalian) patient.
[0039] In an embodiment, the patient is a human patient.
[0040] In embodiments, the cancer is estrogen receptor positive (ER positive) breast cancer.
[0041] An "estrogen receptor positive" cancer includes tumors that have estrogen receptors (e.g., in at least 1%, at least 10%, at least 20%, or at least 50% of tumor cells) and are able to metabolize estrogen and grow. ER-positive status can be determined by methods known in the art, for example, by IHC (immunohistochemistry) testing.
[0042] In embodiments, the cancer is PTEN-deficient (e.g., comprises cancerous cells (e.g., a population of cancerous cells, such as a majority of cancerous cells in a given population) that have a reduced normal amount or function of the PTEN tumor suppressor protein (e.g., compared to non-cancerous cells of the same patient). PTEN status can be determined by methods known in the art.
[0043] In embodiments, the cancer is characterized by a PIK3CA mutation (e.g., a gain-of-function mutation, or a deletion, substitution, or insertion mutation, e.g., PIK3CA E542K , PIK3CA E545K , PIK3CA Q546R , PIK3CA 1047L , or PIK3CA H1047R PIK3CA mutation status can be determined by methods known in the art.
[0044] In embodiments, the PIK3CA mutation is selected from one or more of R88Q, N345K, C420R, E542K, E545A, E545D, E545Q, E545K, E545G, Q546E, Q546K, Q546R, Q546P, M1043V, M1043I, H1047Y, H1047R, H1047L and G1049R.
[0045] In embodiments, the PIK3CA mutation is E545K.
[0046] In embodiments, the patient is a postmenopausal or premenopausal woman.
[0047] A female is an adult human female whose sex is designed to produce large gametes (eggs).
[0048] In an embodiment, the patient is a postmenopausal woman.
[0049] In embodiments, the patient is a premenopausal woman.
[0050] In embodiments, the patient has previously received treatment with a selective estrogen receptor degrader (SERD), a selective estrogen receptor modulator (SERM), or an aromatase inhibitor (AI).
[0051] In embodiments, the patient's cancer has reached a stage of maximal response (minimal residual disease) during or after treatment with a selective estrogen receptor degrader, selective estrogen receptor modulator, or aromatase inhibitor.
[0052] In embodiments, the cancer is resistant to treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator, or an aromatase inhibitor.
[0053] In embodiments, the patient's cancer has progressed during or after prior treatment with a selective estrogen receptor degrader, selective estrogen receptor modulator, and / or aromatase inhibitor. When cancer growth has "progressed," its growth is no longer adequately controlled by the subject's treatment.
[0054] In embodiments, the patient has previously been treated with a CDK4 / 6 inhibitor.
[0055] In embodiments, the patient's cancer has reached the stage of maximal response (minimal residual disease) during or after treatment with a CDK4 / 6 inhibitor.
[0056] In embodiments, the cancer is resistant to treatment with a CDK4 / 6 inhibitor.
[0057] In embodiments, the patient's cancer has progressed during or after prior treatment with a CDK4 / 6 inhibitor.
[0058] Triple and quadruple drug combinations In one embodiment, a compound is provided for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor and a SERD, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0059] In embodiments, the compound, KDM5C inhibitor and SERD are administered separately, sequentially, or simultaneously.
[0060] In embodiments, the compound, the KDM5C inhibitor and the SERD are administered separately.
[0061] In embodiments, the compound, the KDM5C inhibitor and the SERD are administered sequentially.
[0062] In embodiments, the compound, KDM5C inhibitor and SERD are administered simultaneously.
[0063] In one embodiment, a compound is provided for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor and fulvestrant or a pharmaceutically acceptable salt thereof, or camizestrant or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0064] In one embodiment, a compound is provided for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor and fulvestrant or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0065] In one embodiment, a compound is provided for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor and camizestrant, or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0066] In one embodiment, a compound is provided for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, a SERD and a CDK4 / 6 inhibitor, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0067] In embodiments, the compound, KDM5C inhibitor, SERD and CDK4 / 6 inhibitor are administered separately, sequentially or simultaneously.
[0068] In embodiments, the compound, the KDM5C inhibitor, the SERD and the CDK4 / 6 inhibitor are administered separately.
[0069] In embodiments, the compound, the KDM5C inhibitor, the SERD and the CDK4 / 6 inhibitor are administered sequentially.
[0070] In embodiments, the compound, the KDM5C inhibitor, the SERD and the CDK4 / 6 inhibitor are administered simultaneously.
[0071] In one embodiment, a compound is provided for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, or camizestrant or a pharmaceutically acceptable salt thereof and palbociclib or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0072] AKT inhibitors In embodiments, an AKT inhibitor is any molecule that binds to and inhibits the activity of one or more AKT isoforms (e.g., a pIC of >4.5, >5, >6, >7, >8, or >9 against the isoform(s) in question when tested in a standard potency assay, such as those described in WO 2009 / 047563). 50 (having).
[0073] In embodiments, the AKT inhibitor is a proteolysis targeting chimera (PROTAC).
[0074] In embodiments, the AKT inhibitor is milansertib (ARQ-092) or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, volsertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib (GSK2110183) or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, and ipatasertib (GDC-0068) or a pharmaceutically acceptable salt thereof.
[0075] In embodiments, the AKT inhibitor is selected from capivasertib or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, and ipatasertib or a pharmaceutically acceptable salt thereof.
[0076] In embodiments, the AKT inhibitor is selected from capivasertib or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib (GSK2110183) or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, and ipatasertib (GDC-0068) or a pharmaceutically acceptable salt thereof.
[0077] In embodiments, the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof.
[0078] Capivasertib has the following chemical structure:
[0079] [ka]
[0080] The free base of capivasertib is known by the chemical name (S)-4-amino-N-(1-(4-chlorophenyl)-3-hydroxypropyl)-1-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)piperidine-4-carboxamide). Capivasertib is disclosed in WO 2009 / 047563, which discloses capivasertib (Example 9) and describes its synthesis.
[0081] Perifosine has the following chemical structure:
[0082] [ka]
[0083] Perifosine is known by the chemical name 1,1-dimethylpiperidinium-4-yl octadecyl phosphate. Perifosine is disclosed in U.S. Patent No. 8,383,607.
[0084] MK-2206 has the following chemical structure:
[0085] [ka]
[0086] The free base of MK-2206 is known by the chemical name 8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f][1,6]naphthyridin-3(2H)-one. MK-2206 is disclosed in WO2008070016.
[0087] GSK690693 has the following chemical structure:
[0088] [ka]
[0089] The free base of GSK690693 is known by the chemical name 4-(2-(4-amino-1,2,5-oxadiazol-3-yl)-1-ethyl-7-{[(3S)-3-piperidinylmethyl]oxy}-1H-imidazo[4,5-c]pyridin-4-yl)-2-methyl-3-butyn-2-ol. GSK690693 is disclosed in WO2007058850.
[0090] Afuresertib (GSK2110183) has the following chemical structure:
[0091] [ka]
[0092] The free base of afuresertib is known by the chemical name N-[(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide. Afuresertib is disclosed in WO2008098104.
[0093] Uprosertib (GSK2141795) has the following chemical structure:
[0094] [ka]
[0095] The free base of uprosertib is known by the chemical name N-[(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide. Uprosertib is disclosed in WO2008098104.
[0096] Ipatasertib has the following chemical structure:
[0097] [ka]
[0098] The free base of ipatasertib is known by the chemical name 2-(4-chlorophenyl)-1-(4-((5R,7R)-7-hydroxy-5-methyl-6,7-dihydro-5H-cyclopenta[d]pyrimidin-4-yl)piperazin-1-yl)-3-(isopropylamino)propan-1-one. Ipatasertib is disclosed in WO2008006040.
[0099] PI3K-α inhibitors In embodiments, a PI3K-α inhibitor is any molecule that binds to and inhibits the activity of PI3K-α (e.g., a pIC of >4.5, >5, >6, >7, >8, or >9 against PI3K-α when tested in a standard potency assay, such as that described in WO2010029082). 50 (having).
[0100] In embodiments, the PI3K-α inhibitor is a PI3K-α selective inhibitor that has greater activity against PI3K-α (e.g., >10-fold, >100-fold, or >1000-fold activity) than against any other PI3K-α isoform.
[0101] In embodiments, the PI3K-α inhibitor is selective for one or more PI3K-α mutant isoforms (eg, H1047X, such as H1047R or H1047L) relative to any other PI3K-α isoforms.
[0102] In embodiments, the PI3K-α inhibitor is a PI3K-α-specific inhibitor. A PI3K-α-specific inhibitor has activity against PI3K-α but no appreciable activity against any other PI3K isoform (e.g., measurable using a standard potency assay, e.g., pIC 50 is ≦4.5).
[0103] In embodiments, the PI3K-α inhibitor is selected from LOXO-783 or a pharmaceutically acceptable salt thereof, RLY-2608 or a pharmaceutically acceptable salt thereof, STX-478 or a pharmaceutically acceptable salt thereof, alpelisib (e.g., piqray®) or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof, and selavelisib or a pharmaceutically acceptable salt thereof.
[0104] The PI3K-α inhibitor is selected from alpelisib (e.g., piqray®) or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof, and selavelisib or a pharmaceutically acceptable salt thereof.
[0105] Alpelisib has the following chemical structure:
[0106] [ka]
[0107] The free base of alpelisib is known by the chemical name (2S)-1-N-[4-methyl-5-[2-(1,1,1-trifluoro-2-methylpropan-2-yl)pyridin-4-yl]-1,3-thiazol-2-yl]pyrrolidine-1,2-dicarboxamide. Alpelisib is disclosed in WO 2010 / 029082.
[0108] Inavolisib has the following chemical structure:
[0109] [ka]
[0110] The free base of inavolisib is known by the chemical name (2S)-2-[[2-[(4S)-4-(difluoromethyl)-2-oxo-1,3-oxazolidin-3-yl]-5,6-dihydroimidazo[1,2-d][1,4]benzoxazepin-9-yl]amino]propanamide. Inavolisib is disclosed in WO2017001645.
[0111] Seravelisib (GDC-0077, RG6114) has the following chemical structure:
[0112] [ka]
[0113] The free base of ceravelisib is known by the chemical name [6-(2-amino-1,3-benzoxazol-5-yl)imidazo[1,2-a]pyridin-3-yl](4-morpholinyl)methanone. Seravelisib is disclosed in WO2011022439.
[0114] In embodiments, the PI3K-α inhibitor is alpelisib or a pharmaceutically acceptable salt thereof.
[0115] In embodiments, the PI3K-α inhibitor is inavolisib or a pharmaceutically acceptable salt thereof.
[0116] In embodiments, the PI3K-α inhibitor is ceravelisib or a pharmaceutically acceptable salt thereof.
[0117] mTOR inhibitors In embodiments, an mTOR inhibitor is any molecule that binds to mTOR and inhibits the activity of mTOR (e.g., a pIC of >4.5, >5, >6, >7, >8, or >9 against mTOR when tested in a standard potency assay). 50 (having).
[0118] In embodiments, the mTOR inhibitor is an mTORC1 inhibitor.
[0119] In embodiments, the mTOR inhibitor is an mTORC1-selective inhibitor. An mTORC1-selective inhibitor has greater activity against mTORC1 (e.g., >10-fold, >100-fold, or >1000-fold activity) than against any other mTOR complex.
[0120] In embodiments, the mTOR inhibitor is selected from everolimus (e.g., afinitor®) or a pharmaceutically acceptable salt thereof and temsirolimus (e.g., torisel®) or a pharmaceutically acceptable salt thereof.
[0121] Everolimus has the following chemical structure:
[0122] [ka]
[0123] Everolimus is disclosed in WO9409010.
[0124] Temsirolimus has the following chemical structure:
[0125] [ka]
[0126] Temsirolimus is disclosed in WO9528406.
[0127] In embodiments, the mTOR inhibitor is everolimus or a pharmaceutically acceptable salt thereof.
[0128] In embodiments, the mTOR inhibitor is temsirolimus or a pharmaceutically acceptable salt thereof.
[0129] KDM5C inhibitors In embodiments, a KDM5C inhibitor is any molecule that binds to and inhibits the activity of KDM5C (e.g., a pIC of >4.5, >5, >6, >7, >8, or >9 against KDM5C when tested in a standard potency assay, such as those described in WO2015035062, WO2015135094, or WO2016057924). 50 (having).
[0130] In embodiments, the KDM5C inhibitor is selected from any compound disclosed in WO2015035062, WO2015135094, or WO2016057924.
[0131] In embodiments, the KDM5C inhibitor is selected from C70 or a pharmaceutically acceptable salt thereof, KDOAM25 (Tumber et al., Cell Chemical Biology 2017, 24, 371-380) or a pharmaceutically acceptable salt thereof, CPI-455 (Vinogradova et al., Nature Chemical Biology 2016, 12, 531-538) or a pharmaceutically acceptable salt thereof, GS-701644 or a pharmaceutically acceptable salt thereof, GS-5801 or a pharmaceutically acceptable salt thereof, and CPI-48 or a pharmaceutically acceptable salt thereof.
[0132] In embodiments, the KDM5C inhibitor is CPI-48 or a pharmaceutically acceptable salt thereof.
[0133] CPI-48 has the following chemical structure:
[0134] [ka]
[0135] The free base of CPI-48 is known by the chemical name 5-(1-(tert-butyl)-1H-pyrazol-4-yl)-6-isopropyl-7-oxo-4,7-dihydropyrazolo[1,5-a]pyrimidine-3-carbonitrile. CPI-48 is disclosed in Liang, J. et al., Bioorg. & Med. Chem. Lett. 2016, 26(15), 4036-4041 (https: / doi.org / 10.1016 / j.bmcl.2016.06.078).
[0136] CDK4 / 6 inhibitors In embodiments, a CDK4 / 6 inhibitor is any molecule that binds to and inhibits the activity of CDK4 and CDK6 (e.g., a pIC of >4.5, >5, >6, >7, >8, or >9 against CDK4 and CDK6 when tested in a standard potency assay such as those described in WO 03062236, WO 2010020675, or WO 2010075074). 50In embodiments, the CDK4 / 6 inhibitor is selected from palbociclib (e.g., ibrance®) or a pharmaceutically acceptable salt thereof, ribociclib (e.g., kisqali®) or a pharmaceutically acceptable salt thereof, and abemaciclib (e.g., verzenois®) or a pharmaceutically acceptable salt thereof.
[0137] Palbociclib has the following chemical structure:
[0138] [ka]
[0139] The free base of palbociclib is known by the chemical name 6-acetyl-8-cyclopentyl-5-methyl-2-{[5-(1-piperazinyl)-2-pyridinyl]amino}pyrido[2,3-d]pyrimidin-7(8H)-one. Palbociclib is disclosed in WO 03062236.
[0140] Ribociclib has the following chemical structure:
[0141] [ka]
[0142] The free base of ribociclib is known by the chemical name 7-cyclopentyl-N,N-dimethyl-2-{[5-(1-piperazinyl)-2-pyridinyl]amino}-7H-pyrrolo[2,3-d]pyrimidine-6-carboxamide. Ribociclib is disclosed in WO2010020675.
[0143] Abemaciclib has the following chemical structure:
[0144] [ka]
[0145] The free base of abemaciclib is known by the chemical name N-{5-[(4-ethyl-1-piperazinyl)methyl]-2-pyridinyl}-5-fluoro-4-(4-fluoro-1-isopropyl-2-methyl-1H-benzimidazol-6-yl)-2-pyrimidinamine.
[0146] Palbociclib is disclosed in WO2010075074.
[0147] In embodiments, the CDK4 / 6 inhibitor is palbociclib or a pharmaceutically acceptable salt thereof.
[0148] In embodiments, the CDK4 / 6 inhibitor is ribociclib or a pharmaceutically acceptable salt thereof.
[0149] In embodiments, the CDK4 / 6 inhibitor is abemaciclib or a pharmaceutically acceptable salt thereof.
[0150] Endocrine therapy "Selective estrogen degraders" (SERDs) downregulate estrogen receptors by binding to them and degrading them.
[0151] In embodiments, the SERD is selected from fulvestrant or a pharmaceutically acceptable salt thereof, amsenestrant or a pharmaceutically acceptable salt thereof, gildedestrant or a pharmaceutically acceptable salt thereof, elacestrant or a pharmaceutically acceptable salt thereof, imrunestrant or a pharmaceutically acceptable salt thereof, and camizestrant or a pharmaceutically acceptable salt thereof.
[0152] Amsenestrant (SAR439859) has the following chemical structure:
[0153] [ka]
[0154] The free base of amsenestrant is known by the chemical name 6-(2,4-dichlorophenyl)-5-[4-[(3S)-1-(3-fluoropropyl)pyrrolidin-3-yl]oxyphenyl]-8,9-dihydro-7H-benzo[7]annulene-2-carboxylic acid. Amsenestrant is disclosed in WO2017140669.
[0155] Camizestrant (AZD9833) has the following chemical structure:
[0156] [ka]
[0157] The free base of camizestrant is known by the chemical name N-(1-(3-fluoropropyl)azetidin-3-yl)-6-((6S,8R)-8-methyl-7-(2,2,2-trifluoroethyl)-6,7,8,9-tetrahydro-3H-pyrazolo[4,3-f]isoquinolin-6-yl)pyridin-3-amine. Camizestrant is disclosed in WO2018077630A1.
[0158] Elacestrant has the following chemical structure:
[0159] [ka]
[0160] The free base of elacestrant is known by the chemical name (6R)-6-[2-(ethyl{4-[2-(ethylamino)ethyl]benzyl}amino)-4-methoxyphenyl]-5,6,7,8-tetrahydro-2-naphthalenol. Elacestrant is disclosed in WO 2008002490.
[0161] Imulnestrand (LY-3484356) has the following chemical structure:
[0162] [ka]
[0163] The free base of imrunestrant is known by the chemical name 5R-5-[4-[2-[3-(fluoromethyl)azetidin-1-yl]ethoxy]phenyl]-8-(trifluoromethyl)-5H-chromeno[4,3-c]quinolin-2-ol. Imulnestrant is disclosed in WO2020014435.
[0164] Giledestrant (GDC-9545) has the following chemical structure:
[0165] [ka]
[0166] The free base of giledestrant is known by the chemical name 3-[(1R,3R)-1-[2,6-difluoro-4-[[1-(3-fluoropropyl)azetidin-3-yl]amino]phenyl]-3-methyl-1,3,4,9-tetrahydropyrido[3,4-b]indol-2-yl]-2,2-difluoropropan-1-ol. Giledestrant is disclosed in WO 2016097072(A1).
[0167] In embodiments, the SERD is fulvestrant or a pharmaceutically acceptable salt thereof.
[0168] In embodiments, the SERD is amsenestrant or a pharmaceutically acceptable salt thereof.
[0169] In embodiments, the SERD is giledestrant or a pharmaceutically acceptable salt thereof.
[0170] In embodiments, the SERD is elacestrant or a pharmaceutically acceptable salt thereof.
[0171] In embodiments, the SERD is imrunestrant or a pharmaceutically acceptable salt thereof.
[0172] In embodiments, the SERD is camizestrant or a pharmaceutically acceptable salt thereof.
[0173] "Selective estrogen modulators" (SERMs) are compounds that agonize or antagonize estrogen receptors, often depending on the tissue they act on. In embodiments, selective estrogen modulators have anti-estrogenic effects against cancer. In embodiments, the selective estrogen receptor modulator is selected from tamoxifen (e.g., nolvadex®) or a pharmaceutically acceptable salt thereof, toremifene (e.g., fareston®) or a pharmaceutically acceptable salt thereof, and raloxifene (e.g., evista®) or a pharmaceutically acceptable salt thereof.
[0174] In embodiments, the SERM is tamoxifen or a pharmaceutically acceptable salt thereof.
[0175] In embodiments, the SERM is toremifene or a pharmaceutically acceptable salt thereof.
[0176] In embodiments, the SERM is raloxifene or a pharmaceutically acceptable salt thereof.
[0177] An "aromatase inhibitor" is a compound that blocks the biosynthesis of estrogen. In embodiments, the aromatase inhibitor is selected from anastrozole (e.g., Arimidex®) or a pharmaceutically acceptable salt thereof, letrozole (e.g., Femara®) or a pharmaceutically acceptable salt thereof, and exemestane (e.g., Aromasin®) or a pharmaceutically acceptable salt thereof.
[0178] In embodiments, the aromatase inhibitor is anastrozole or a pharmaceutically acceptable salt thereof.
[0179] In embodiments, the aromatase inhibitor is letrozole or a pharmaceutically acceptable salt thereof.
[0180] In embodiments, the aromatase inhibitor is exemestane or a pharmaceutically acceptable salt thereof.
[0181] Specific combination use In one aspect, there is provided a compound for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor selected from C70 or a pharmaceutically acceptable salt thereof, KDOAM25 or a pharmaceutically acceptable salt thereof, CPI-455 or a pharmaceutically acceptable salt thereof, GS-701644 or a pharmaceutically acceptable salt thereof, GS-5801 or a pharmaceutically acceptable salt thereof, and CPI-48 or a pharmaceutically acceptable salt thereof, wherein the compound is selected from milansertib or a pharmaceutically acceptable salt thereof, BAY112 or a pharmaceutically acceptable salt thereof, 5976 or a pharmaceutically acceptable salt thereof, volsertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib or a pharmaceutically acceptable salt thereof, uprosertib or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, and ipatasertib or a pharmaceutically acceptable salt thereof wherein the PI3K-α inhibitor is selected from LOXO-783 or a pharmaceutically acceptable salt thereof, RLY-2608 or a pharmaceutically acceptable salt thereof, STX-478 or a pharmaceutically acceptable salt thereof, alpelisib or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof, and ceravelisib or a pharmaceutically acceptable salt thereof; or the mTOR inhibitor is selected from everolimus or a pharmaceutically acceptable salt thereof, and temsirolimus or a pharmaceutically acceptable salt thereof.
[0182] In one aspect, there is provided a compound for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, wherein the compound is selected from the group consisting of milansertib or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, volsertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib or a pharmaceutically acceptable salt thereof, uprosertib or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, and ipatasertib or a pharmaceutically acceptable salt thereof.
[0183] In one aspect, there is provided a compound for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, wherein the compound is a PI3K-α inhibitor selected from LOXO-783 or a pharmaceutically acceptable salt thereof, RLY-2608 or a pharmaceutically acceptable salt thereof, STX-478 or a pharmaceutically acceptable salt thereof, alpelisib or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof, and ceravelisib or a pharmaceutically acceptable salt thereof.
[0184] In one aspect, a compound is provided for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, and the compound is an mTOR inhibitor selected from everolimus or a pharmaceutically acceptable salt thereof, and temsirolimus or a pharmaceutically acceptable salt thereof.
[0185] In one aspect, there is provided a compound for use in the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor that is CPI-48 or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor that is capivasertib or a pharmaceutically acceptable salt thereof, a PI3K-α inhibitor that is alpelisib or a pharmaceutically acceptable salt thereof, or an mTOR inhibitor that is everolimus or a pharmaceutically acceptable salt thereof.
[0186] Pharmaceutical Compositions and Dosage Forms In one embodiment, a pharmaceutical composition is provided comprising a compound, a KDM5C inhibitor, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0187] A "pharmaceutically acceptable excipient" includes a diluent, a disintegrant, or a lubricant. In further embodiments, the pharmaceutical composition comprises one or more pharmaceutical diluents, one or more pharmaceutical disintegrants, or one or more pharmaceutical lubricants.
[0188] In one embodiment, a pharmaceutical composition is provided comprising a compound, a KDM5C inhibitor, a SERD, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0189] In one embodiment, a pharmaceutical composition is provided comprising a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, or camizestrant or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0190] In one embodiment, a pharmaceutical composition is provided comprising a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0191] In one embodiment, a pharmaceutical composition is provided comprising a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0192] In one embodiment, a pharmaceutical composition is provided comprising a compound, a KDM5C inhibitor, a SERD, a CDK4 / 6 inhibitor, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0193] In one embodiment, a pharmaceutical composition is provided comprising a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, or camizestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0194] In one embodiment, a pharmaceutical composition is provided comprising a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0195] In one embodiment, a pharmaceutical composition is provided comprising a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
[0196] In one embodiment, a pharmaceutical composition is provided comprising a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, capivasertib, palbociclib or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is capivasertib or a pharmaceutically acceptable salt thereof.
[0197] In an embodiment, the composition is in an oral dosage form.
[0198] In an embodiment, the composition is in the form of a tablet or capsule.
[0199] In the compositions disclosed herein, capivasertib or a pharmaceutically acceptable salt thereof is generally administered to a subject at a daily dose of about 100 mg to about 1600 mg.
[0200] In one embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 150 mg to about 1500 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 200 mg to about 1400 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 300 mg to about 1300 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 400 mg to about 1200 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 500 mg to about 1100 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 600 mg to about 1000 mg. In embodiments, capivasertib or a pharmaceutically acceptable salt thereof is administered to a subject once daily (Quaque Die, QD).
[0201] In embodiments, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 100 mg to about 1000 mg.
[0202] In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 150 mg to about 900 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 200 mg to about 850 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 250 mg to about 800 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 300 mg to about 750 mg.
[0203] In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 350 mg to about 700 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 400 mg to about 650 mg.
[0204] In an embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered to a subject twice daily (Bis In Die, BID). In one embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 50 mg to about 900 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 100 mg to about 875 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 200 mg to about 850 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 250 mg to about 825 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 150 mg to about 250 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 250 mg to about 350 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 350 mg to about 450 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 450 mg to about 550 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 550 mg to about 650 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 650 mg to about 750 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 750 mg to about 850 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 160 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 200 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 240 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 280 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 320 mg twice daily.In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 360 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 400 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 440 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 480 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 520 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 560 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 600 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 640 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 680 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 720 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 760 mg twice daily. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered at a dosage of about 800 mg twice daily.
[0205] In embodiments, capivasertib or a pharmaceutically acceptable salt thereof is administered under a continuous dosing schedule. In one embodiment, for example, capivasertib or a pharmaceutically acceptable salt thereof is administered for more than 1 day, more than 2 days, more than 3 days, more than 4 days, more than 5 days, more than 6 days, more than 7 days, more than 14 days, more than 21 days, more than 28 days, more than 35 days, more than 42 days, more than 49 days, or more than 56 days. In another embodiment, the dosing cycle is 28 days. Administration of capivasertib or a pharmaceutically acceptable salt thereof, and repetition of the dosing cycle, can continue as long as is tolerable and beneficial to the subject.
[0206] In an embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily (QD) on a continuous dosing schedule. In an embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on a continuous dosing schedule at a dose of about 100 mg to about 900 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on a continuous dosing schedule at a dose of about 150 mg to about 875 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on a continuous dosing schedule at a dose of about 175 mg to about 850 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on a continuous dosing schedule at a dose of about 200 mg to about 825 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on a continuous dosing schedule at a dose of about 225 mg to about 800 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on a continuous dosing schedule at a dose of about 250 mg to about 750 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on a continuous dosing schedule at a dose of about 275 mg to about 700 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on a continuous dosing schedule at a dose of about 300 mg to about 650 mg. In an embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily (BID) on a continuous dosing schedule. In one embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 100 mg to about 800 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 150 mg to about 750 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 200 mg to about 700 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 225 mg to about 650 mg.In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 250 mg to about 650 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 300 mg to about 600 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 200 mg to about 300 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 300 mg to about 400 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 400 mg to about 500 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 500 mg to about 600 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 600 mg to about 700 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 700 mg to about 800 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 160 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 200 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 240 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 280 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 320 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 360 mg.In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 400 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 440 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 480 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 520 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 580 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 600 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 640 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 680 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 720 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 760 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on a continuous dosing schedule at a dose of about 800 mg. In an embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered to a subject on an intermittent dosing schedule. Administering capivasertib or a pharmaceutically acceptable salt thereof on an intermittent dosing schedule may have greater efficacy and / or tolerability than, for example, a continuous dosing schedule. In embodiments, capivasertib or a pharmaceutically acceptable salt thereof is intermittently dosed on a 1 day on / 6 days off schedule (i.e., capivasertib or a pharmaceutically acceptable salt thereof is administered for 1 day, followed by 6 days off).In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is dosed intermittently on a 2-day on / 5-day off schedule (i.e., capivasertib or a pharmaceutically acceptable salt thereof is administered for 2 days followed by 5 days off). In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is dosed intermittently on a 3-day on / 4-day off schedule (i.e., capivasertib or a pharmaceutically acceptable salt thereof is administered for 3 days followed by 4 days off). In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is dosed intermittently on a 4-day on / 3-day off schedule (i.e., capivasertib or a pharmaceutically acceptable salt thereof is administered for 4 days followed by 3 days off). In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is dosed intermittently on a 5-day on / 2-day off schedule (i.e., capivasertib or a pharmaceutically acceptable salt thereof is administered for 5 days followed by 2 days off). In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is dosed intermittently on a 6-day on / 1-day off schedule (i.e., capivasertib or a pharmaceutically acceptable salt thereof is administered for 6 days followed by 1 day off). The dosing cycles of such embodiments are then repeated as long as tolerated and beneficial to the subject. In an embodiment, the dosing cycle is 7 days. In an embodiment, the dosing cycle is 14 days. In another embodiment, the dosing cycle is 21 days. In another embodiment, the dosing cycle is 28 days. In another embodiment, the dosing cycle is 2 months. In another embodiment, the dosing cycle is 6 months. In another embodiment, the dosing cycle is 1 year.
[0207] In embodiments, the dosing cycle is 28 days, but capivasertib or a pharmaceutically acceptable salt thereof is not co-administered to the subject during week 4 of the dosing cycle (i.e., there is a capivasertib or a pharmaceutically acceptable salt thereof holiday during the final week of the dosing cycle).
[0208] In an embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily (QD) on an intermittent dosing schedule. In an embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 100 mg to about 900 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 150 mg to about 850 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 175 mg to about 800 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 200 mg to about 750 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 225 mg to about 725 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 250 mg to about 700 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 275 mg to about 675 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 300 mg to about 650 mg. In an embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily (BID) on an intermittent dosing schedule. In one embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 100 mg to about 800 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 150 mg to about 750 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 200 mg to about 700 mg.In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 225 mg to about 675 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 250 mg to about 650 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 300 mg to about 625 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 200 mg to about 300 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 300 mg to about 400 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 400 mg to about 500 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 500 mg to about 600 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 600 mg to about 700 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 700 mg to about 800 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 160 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 200 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 240 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 280 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 320 mg.In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 360 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 400 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 440 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 480 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 520 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 580 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 600 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 640 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 680 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 720 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 760 mg. In another embodiment, capivasertib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 800 mg.
[0209] In any embodiment referring to a marketed or approved drug, the marketed or approved drug may be administered according to its dosage instructions (e.g., as approved by the U.S. Food and Drug Administration (FDA) or any other similar regulatory agency).
[0210] In any embodiment referring to a drug being investigated in a human clinical trial, the drug may be administered according to the dosing regimen described in any of its published clinical trial protocols (e.g., as described on clinicaltrials.gov or the like). [Example]
[0211] The following specific examples, which refer to the accompanying drawings, are provided for illustrative purposes only and are not to be construed as limiting the teachings herein.
[0212] Example 1: Generation of cell lines 1A. HEK-293T Cell Line: HEK-293T is an epithelial-like cell line isolated from human fetal kidney and expresses large T antigen. This cell line was purchased from GeneHunter Corporation (Catalog No. Q401) and used for virus production. HEK-293T cells were routinely cultured in DMEM medium supplemented with 10% fetal calf serum (FCS) and 1% L-glutamine and incubated at 37°C and 5% CO2.
[0213] 1B Cas9 lentivirus generation. HEK-293T cells were cultured in 75cm plates pre-coated with 0.1% gelatin. 2 Plated in a 75cm flask. 2 Number of HEK-293T cells per flask: 8 million cells 1 x 75 cm 2Flask setup). Cells were cultured in DMEM medium + 10% FCS + 2 mM glutamine (10% Glutamax). HEK-293T cells should be approximately 80-90% confluent on the day of transfection. On the day of transfection (day 0), the Cas9 gRNA lentiviral vector (pKLV2-EF1a-Cas9-Bsd-W), packaging mix, and Opti-MEM PLUS were added to a 15 mL canonical tube (see table below for volumes) and mixed for 2 seconds by either pipetting or vortexing. They were then incubated at room temperature for 5 minutes.
[0214] [Table 1]
[0215] Lipofectamine LTX was then added to the DNA-containing solution and mixed for 2 seconds by either pipetting or vortexing. The resulting solution was incubated at room temperature for 30 minutes. The old medium was aspirated, and the cells were washed once with 10 mL of Opti-MEM medium. 7 mL of Opti-MEM was then added to a 75 cm 2 The flask was then filled with the DNA / Lipofectamine complex using a pipette and swirled very gently. Finally, the contents were incubated at 37°C for 6 hours, and the transfection medium was replaced with 30 mL of DMEM containing 10% FCS and 2% glutamine. After 48 hours (day 2), the Cas9 lentiviral supernatant was collected using 10 mL syringes (3 syringes in total) and filtered through a 0.45 μm filter cartridge. The HEK-293T plate was then disposed of appropriately according to risk assessment. The Cas9 lentiviral supernatant was aliquoted into 1.5 mL cryovials (400 μL per cryovial, 75 cryovials in total) for storage at -80°C.
[0216] 1C. T-47D Stable Cell Line Expressing spCas9: T-47D is a cell line derived from pleural fluid / effusion obtained from a patient with ductal carcinoma of the breast (also referred to herein as T47D). The cell line was derived from ATCC HTB-133 and harbors an activating mutation in PIK3CA E545K. T47D cells were routinely cultured in RPMI medium (Gibco #11835-063) supplemented with 5% fetal calf serum (FCS) and 1% L-glutamine and incubated at 37°C and 5% CO2. T47D cells constitutively expressing spCas9 were prepared in 6-well plates using the following protocol: 1. The lentivirus was removed from the -80°C freezer and thawed at room temperature. 2. Viral transduction mixtures were prepared in 1.5 mL Eppendorf tubes. For each cell line, Cas9 mixtures and no-virus control mixtures were prepared as described below.
[0217] [Table 2] 3. 100,000 cells were seeded in a 6-well plate (3 wells per cell line) in a total volume of 1 mL of medium per well, 2 wells per cell line (T47D) - one well was labeled "Cas9" and the other well was labeled "no virus control." 4. Immediately after plating the cells, 1 mL of the transduction mix (Cas9 or no virus control) was added to each well of cells. The 6-well plate was gently rocked to mix and placed in the incubator. 5. 24 hours after transduction, the medium containing the rvirus was removed from each well and replaced with 3 mL of fresh medium. 6. 72 hours after transduction, all cells from each well (no Cas9 or virus control) were transferred to a T75 flask with blasticidin selection (using 40 μg / mL blasticidin). 7. Cells were selected with blasticidin until no viable cells remained in the virus-free control flask. When cells became confluent during selection, they were transferred to a T175 and continued blasticidin selection. 8. After blastosin selection of the Cas9 cell line was completed, the cells were grown for at least one week before testing for Cas9 activity.
[0218] The Cas9 activity of the new Cas9 cell lines was determined using a reporter assay. The Cas9 activity assay consists of two separate lentiviral vectors. A sgRNA targeting GFP is introduced into the cell line using a lentivirus labeled with BFP and GFP (pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W). In the absence of functional Cas9, cells transduced with this lentivirus express both BFP and GFP. However, in the presence of Cas9, the gRNA targets GFP and the cells no longer express GFP (BFP+GFP-). Cas9 activity in the cells is the percentage of transduced cells that are BFP-positive but GFP-negative. Cas9 cells transduced with a control reporter virus (pKLV2-U6gRNA5(empty)-PGKBFP2AGFP-W) should express both BFP and GFP. The total number of transduced cells is determined as BFP+-GFP+ double-positive cells + BFP+ cells. Cas9 activity (%) in the bulk population of cells is determined as (BFP+ positive cells) / (total number of transduced cells). Cas9 activity in T-47D cells constitutively expressing spCas9 was determined in 6-well plates using the following protocol. 1. The lentivirus was removed from the -80°C freezer and thawed at room temperature. 2. Viral transduction mixtures were prepared in 1.5 mL Eppendorf tubes as described in Table 3. For each cell line, three separate mixtures were prepared: 1) BFP-GFP (empty), 2) BFP-GFP (gRNA GFP), and 3) a no-virus control.
[0219] [Table 3] 3. 100,000 cells were seeded into 6-well plates (3 wells per cell line) in a total volume of 1 mL of medium per well. 4. Immediately after plating the cells, 1 mL of transduction mixture (BFP-GFP empty, BFP-GFP gRNA GFP, and virus control) was added to each well of cells. The 6-well plate was gently rocked to mix and placed in the incubator. 4. 24 hours after transduction, the virus-containing medium was removed from each well and replaced with 3 mL of fresh medium. 5. 72 hours after transduction, cells were fixed and BFP-GFP expression (BFP-GFP empty, BFP-GFP gRNA GFP, and virus control) was measured by flow cytometry on a MaxQuant VYB (Cambridge Institute Flow cytometry facility). "No virus control" cells were used to gate on BFP-GFP-negative cells. 6. Cas9 activity was calculated for each cell line as follows: Cas9 activity in bulk population of cells (%) = (BFP+ positive cells) / (total number of transduced cells). Cell lines with Cas9 activity greater than 7.75% were expanded into bank stocks.
[0220] 1D. MCF7 stable cell line expressing spCas9: MCF7 is a cell line derived from pleural fluid / effusion obtained from a patient with ductal carcinoma of the breast. The cell line was obtained from ATCC HTB-22 and harbors an activating mutation at PIK3CA E545K. MCF7 cells were routinely cultured in RPMI medium (Gibco #11835-063) supplemented with 5% fetal calf serum (FCS) and 1% L-glutamine and incubated at 37°C and 5% CO2. The MCF7 cell line from ATCC HTB-22 was used in Figure 20. The MCF7 stable cell line expressing spCas9 was prepared by the same method as in 1B, except that cells were selected using 10 μg / mL blasticidin.
[0221] 1E. CAMA-1 stable cell line expressing spCas9: CAMA-1 is a cell line derived from pleural fluid / effusion obtained from a patient with breast adenocarcinoma. The cell line was obtained from ATCC HTB-21 and harbors the PTEN D92H / F278fs loss-of-function mutation. CAMA-1 cells were routinely cultured in RPMI medium (Gibco #11835-063) supplemented with 5% fetal calf serum (FCS) and 1% L-glutamine and incubated at 37°C and 5% CO2. The CAMA1 stable cell line expressing spCas9 was prepared by a method similar to that in 1B, except that cells were selected using 25 μg / mL blasticidin.
[0222] 1F. MCF7 ESR1 Y537S (mut / - / -) cell line: The MCF7 ESR1 Y537S (mut / - / -) cell line was generated from the parental ATCC HTB-22 stock. Cells were cultured as described in Example 1D. Cells were transfected with the sgRNA CAS9 T2A GFP vector and a donor vector carrying a neomycin cassette as a non-digested plasmid at a 2:1 ratio using Fugene (Promega). The gRNA sequence was ctccagcagcaggtcataga [SEQ ID NO: 35]. The donor cassette contained an 800-bp and 1-kb homology region for integration of the Y537S mutation via homologous directed repair (HDR). Between the homology regions, a neomycin resistance gene was encoded, which was expressed under the PKG promoter and used for selection of HDR events 48 hours after transfection. After two weeks of selection, single-cell clones were generated and characterized. To confirm the knock-in, digital droplet PCR was performed using ddPCR primers (Fwd:AAGGCATGGAGCATCTGT [SEQ ID NO: 1] & Rev:GCTAGTGGGCGCATGTA [SEQ ID NO: 2]) and specific probes C{C}CTC{TAT}GACC{T}G [SEQ ID NO: 3] and CTC{T}AT{GGC}C{T}GC [SEQ ID NO: 4]. The insertion location was confirmed using junction PCR with the following primer pairs: FwdTTAGATCATGCTGTAGGCCCTG [SEQ ID NO: 5] & RevCTGGAACCCATGACCGGAAAG [SEQ ID NO: 6], FwdGCAGATCCAGGGGGCATTTA [SEQ ID NO: 7] & RevGATGTGGAATGTGTGCGAGC [SEQ ID NO: 8], and FwdGGATCAATTCTCTAGAGCTCGC [SEQ ID NO: 9] & RevCTGGAACCCATGACCGGAAAG [SEQ ID NO: 6]. TIDE analysis was used to confirm a frameshift mutation in the second ESR1 allele.Targeted Locus Amplification (TLA) sequencing (de Vree et al., 2014) confirmed the genotype of the three ESR1 alleles (knock-in, single-base insertion knock-out, and inactivating 48-bp deletion, mut / - / -).
[0223] 1G. MCF7 100F P2 Cell Line: The MCF7 100F P2 cell line was generated from the parental ATCC HTB-22 stock. Cells were cultured as described in Example 1D. To prepare the first treatment flask, the medium was removed from the T175 flask, the cells were washed with 10 mL of DPBS, and 2 mL of trypsin was added to detach the cells. After detachment, the cells were resuspended in 10 mL of growth medium and counted using trypan blue and a Countess™ Cell Counter (ThermoFisher). The 10 mL was then diluted with 3.0 x 10 4 3 x T25 flasks were added at 1 / mL cells, one treated with DMSO to assess the growth of the resistant cell pool relative to cells in the same % DMSO, and two flasks were treated with fulvestrant to generate a resistant pool. Cells were transferred to an incubator and allowed to adhere overnight. Cells were initially treated with 30 nM fulvestrant, with the goal of increasing the concentration to 100 nM once cells began to proliferate. The medium in the flask was removed and replaced with 10 mL of fulvestrant-containing medium (2.2 μL of 300 μM fulvestrant stock was added to 22 mL of growth medium, diluted 1:10,000 to yield a final concentration of 30 nM). Cells were re-treated twice weekly. After one week, cells began to proliferate, and the fulvestrant concentration was increased to 100 nM. Cells were re-treated twice weekly for 15 days. After that point, cells were expanded to generate stocks for cryopreservation.
[0224] 1H. T47D 100F1P P1 and T47D 100F1P P2 Cell Lines: The T47D 100F1P P1 and P2 cell lines were generated from the parental ATCC HTB-133 stock. Cells were cultured as described in Example 1C. To prepare the first treatment flask, the medium was removed from the T175 flask, the cells were washed with 10 mL of DPBS, and 2 mL of trypsin was added to detach the cells. After detachment, the cells were resuspended in 10 mL of growth medium and counted using trypan blue and a Countess™ Cell Counter (Thermo Fisher). The 10 mL was then diluted with 2.0 x 10 4 3 x T25 flasks were seeded with 30 nM fulvestrant and 300 nM palbociclib at 1 / mL cells per flask. One flask was dosed with DMSO to assess growth of the resistant cell pool relative to cells in the same % DMSO. Two flasks were dosed with 30 nM fulvestrant and 300 nM palbociclib to generate a resistant pool. Cells were transferred to an incubator and allowed to adhere overnight. Cells were initially dosed with 30 nM fulvestrant and 300 nM palbociclib, with the goal of increasing the dose to 100 nM fulvestrant + 1 μM palbociclib once cells began to proliferate. The medium in the flask was removed and replaced with 10 mL of fulvestrant / palbociclib-containing medium (fulvestrant: 2.2 μL of 300 μM fulvestrant stock was added to 22 mL of growth medium and diluted 1:10,000 to give a final concentration of 30 nM; palbociclib: 2.2 μL of 3 mM stock was added to 22 mL of growth medium and diluted 1:10,000 to give a final concentration of 300 nM). Cells were re-fed twice weekly and maintained for 6 months as they slowly grew from a small viable cell fraction. Cells were expanded into T75 flasks and the dose was increased to 100 nM fulvestrant + 1 μM palbociclib. Cells were then grown for 40 days to generate stocks for cryopreservation.
[0225] 11. MCF7 KDM5C KO Clone A9 Cell Line: KO of KDM5C was performed in parental MCF7 breast cancer cells. The KDM5C KO pool was established through RNP delivery of spCas9 protein and guiding as follows. 1. Guide RNA (gRNA) duplexes were prepared by combining crRNA and tracrRNA in a PCR tube (Table 4), incubated at 95°C for 5 minutes in a thermocycler, and allowed to cool to room temperature.
[0226] [Table 4] 2. Recombinant spCas9 protein was diluted as follows:
[0227] [Table 5] 3. The crRNA:tracrRNA:Cas9 RNP complex was generated by mixing the gRNA duplex with recombinant spCas9 in a low-binding tube. The mixture was incubated at room temperature for 15 minutes until the solution became clear.
[0228] [Table 6] 4. A single cell suspension of MCF7 cells was prepared for neon electroporation as follows: Cells were washed with PBS, detached with Accutase® solution, and resuspended in culture medium. 5 x 10 5 The cells were resuspended in 10.8 μL Neon Buffer R for electroporation. 5. The electroporation mix was prepared according to Table 7. 10 mL of the mixture was collected with a Neon 10 ul tip and placed into a Neon™ Transfection System (ThermoScientific), avoiding the formation of air bubbles. Electroporation was performed using the program 1250 volts, 20 ms, 2 pulses.
[0229] [Table 7] ( *) Electroporation Enhancer or Carrier Oligo-IDT Enhancer CCA GCA GAA CAC CCC CAT CGG CGACGG CCC CGT GCT GCT GCC CGA CAACCA CTA CCT GAG CAC CCA GTC CGCCCT GAG CAA AGA CCC CAA CGA GA [SEQ ID NO: 11] 6. After electroporation, cells were immediately plated onto 12-well tissue culture plates containing 1 mL of medium. 100 mL aliquots were plated onto 24-well plates for genomic DNA extraction and KO validation by TIDE. After 7.48 hours, the medium was removed from the 24-well plates, the cells were washed with PBS, and DNA was extracted with 80 mL of DirectPCR lysis buffer (Viagen BioTech) according to the manufacturer's protocol. 8. Primers were designed around the guide RNA binding site to generate an amplicon suitable for TIDE analysis of KO efficiency (PCR product size 307 bp). PCR reactions were prepared using the following mixture: 7.5 mL HO, 10 mL 2x Phusion Mix, 0.5 mL forward primer (5'-CGATCTGCCATACCCAGGAC-3', [SEQ ID NO: 12], 10 mM), 0.5 mL reverse primer (5'-AGCCCAGTCATTCCCTCTCT-3', [SEQ ID NO: 13], 10 mM), and 1.5 mL genomic DNA. Amplification was performed using the following conditions: i. 98°C for 1 minute; ii. 30 cycles: 98°C for 5 seconds, 65°C for 5 seconds, 72°C for 10 seconds; iii. 72°C for 1 minute. 9. PCR products were verified using a 1% agarose gel, purified using the GFX Illustra PCR Purification Kit (Cytiva), and Sanger sequenced using the forward primer. Gene editing efficiency in the target region was assessed using TIDE analysis (64.7% efficiency for the pool). 10. Single cell cloning from the MCF7 KDM5C KO pool was performed 4 days after electroporation using the cellenONE® platform (Scienion). 11. Cells were washed with PBS and detached with 200 mL of Accutase® solution to obtain a single-cell suspension. 100 mL of the single-cell suspension was transferred to an Eppendorf tube and diluted with up to 500 mL of PBS. The suspension was mixed by gently pipetting up and down, and 50 mL was loaded into a 384-well sciSourceplate (Scienion). 12. Single cell clones were stamped into 384-well tissue culture plates (Corning) containing 50 mL of 30% conditioned medium (pre-dispensed using a Multidrop Combi) as follows: samples were loaded into cellenONE, mapped to determine appropriate particle size / elongation parameters for sorting, and stamped using the CellenONE Basic Destatic Target program. Clonal growth was analyzed using Cell Metric (Solentin) at 13.0 hours and then every 7 days, and conditioned medium was changed once a week. 14. The single-cell clones we expanded were verified for a high percentage of KDM5C KOs by performing TIDE analysis of Sanger sequencing traces as follows: PCR products with primers surrounding the guide RNA binding site were generated as described above and Sanger sequenced. Sequencing traces were compared to wild-type sequences using TIDE. 15. Clones with high TIDE efficacy (>85%) and no in-frame indels were then analyzed for KDM5C protein depletion by Western blot using anti-KDM5C antigen antibody (Abcam, ab190180, 1:1000 dilution) and anti-vinculin antigen antibody (Cell Signaling, #13907, 1:1000 dilution) as loading controls.
[0230] Example 2: Pooled CRISPR knockout screening The experiments in this example were conducted to identify genes that modulate response to capivasertib following gene knockout in ER-positive breast cancer cells. A genome-wide pooled CRISPR knockout screen was performed in MCF7, CAMA-1, and T47D stable cell lines expressing spCas9, leading to the identification of KDM5C as a capivasertib sensitizer across all three cell lines.
[0231] Cell lines were recovered from frozen stocks prior to screening, cultured with 1% Pen / Strep, and reselected with blasticidin, as described in Examples 1C, 1D, and 1E. A total of 120 million cells (T47D / MCF7) or 200 million cells (CAMA-1) were plated in 5-layer stacks (Corning #CLS3319-2EA) and transduced with the Yusa V3 human lentiviral library in duplicate using polybrene at a multiplicity of infection (MOI) of approximately 0.3 and at least 150x coverage (human improved genome-wide knockout CRISPR library). The following day, the medium was changed, and the cells were cultured for 2 days. Transduced cells were then selected with puromycin (2 μg / mL) and expanded to maintain approximately 750x expression. Transduction efficiency was monitored by analyzing the percentage of BFP-positive cells using a FACS Melody™ system. After selection, cells were pooled and counted in replicates maintained separately. Each replicate was resuspended in batches of 100 million cells for MCF7 / T47D and 150 million cells for CAMA-1 in a total volume of 625 mL using a five-layer stack. Batches were treated with either DMSO or capivasertib at 750 nM for MCF7 / T47D and 400 nM for CAMA-1. Pellets containing approximately 50 million cells were also prepared and frozen as baseline measurements. Cells were then cultured until the end of the screen by serial passaging and reseeding at 100 million cells (MCF7 / T47D) and 150 million cells (CAMA-1). Cells were treated with fresh compound twice weekly (or every 3–4 days). After 24 days for MCF7, 23 days for T47D, and 29 days for CAMA-1, cells were harvested and pelleted for genomic DNA extraction.
[0232] To prepare and generate Illumina® libraries for deep sequencing, genomic DNA was extracted using the QiAMP Blood DNA MAxi Kit (Qiagen, #51194), and the sgRNA cassettes were amplified by PCR using the Q5 Hot Start High-Fidelity 2x Master Mix and primers specific to the sgRNA lentiviral CRISPR backbone. The PCR products were purified with a QIAquick PCR Purification Kit. During this amplification step, Illumina 5' and 3' adapters were added to the 5' and 3' ends of the sgRNA cassettes. Ideally, we aimed to use an amount of DNA for the first PCR corresponding to 200x coverage of the pooled sgRNA library (150 μg / sample for the Yusa V3 CRISPR library). A second PCR was performed to add Illumina indexes to the gRNA libraries, allowing for pooling of individual samples for sequencing (barcodes for demultiplexing). This second PCR was performed using the ThruPLEX® DNA-seq 48 Dual Index Kit (Takara #R400406) with Kapa HiFi HotStart Mix and Illumina®-compatible dual index. PCR products were purified using AMPure XP beads. DNA concentration was measured using Qubit (HS ds DNA kit) according to the manufacturer's instructions, and quality was confirmed using a Bioanalyzer equipped with a high-sensitivity DNA chip. Up to six libraries were pooled to a final concentration of 10–15 nM in a total volume of 20 μL and subjected to sequencing.
[0233] The results in Figure 1 were generated from sequencing data by determining the gRNA count in each sample for 6x sgRNAs in the Yusa V3 human library targeting KDM5A, B, C, and D. Figure 1 plots the fold change in gRNA count between cells treated with capivasertib and the DMSO control. The data show that gRNAs targeting the KDM5C gene, but not KDM5A, B, or D, are significantly depleted when MCF7, T47D, and CAMA-1 cells are treated with capivasertib compared to DMSO. Thus, the results indicate that loss of KDM5C sensitizes MCF7, T47D, and CAMA-1 cells to capivasertib.
[0234] Example 3: Array CRISPR knockout experiments Experiments in this example were conducted to validate KDM5C as a drug sensitizer in ER-positive breast cancer cells. KDM5C was knocked out in ER-positive breast cancer cell lines generated through different methodologies, and proliferation assays were performed to determine whether loss of KDM5C reduced cell proliferation and increased the antiproliferative effects of capivasertib, fulvestrant in combination with capivasertib, alpelisib, and everolimus.
[0235] 2A. CRISPR Knockout of KDM5C Using a gRNA Lentiviral Expression Vector. The experiment involves three major steps: (1) cloning a gRNA targeting KDM5C into an expression vector to produce KDM5C gRNA lentivirus, (2) using the lentivirus to generate and validate KDM5C knockout ER-positive breast cancer cell lines (CAMA-1, T47D, MCF7), and then (3) performing proliferation assays comparing KDM5C knockout and wild-type ER-positive breast cancer cells with DMSO (control), capivasertib, alpelisib, and everolimus.
[0236] 1. Construction of CRISPR gRNA lentiviral expression vector: The KDM5C guide RNA (gRNA) was cloned into the Yusa CRISPR lentiviral expression vector according to the following protocol. This protocol describes how to synthesize individual gRNAs and clone them into a CRISPR lentiviral single guide RNA (sgRNA) expression vector to target a single genomic locus. These vectors can then be transfected into HEK-293T cells to generate infectious sgRNA lentivirus for transduction into human or mouse cells, generating a heterogeneous population of cells harboring a mixture of CRISPR-induced indels, known as a knockout cell pool. Knockout efficiency in cell pools is typically 80-90%. After analyzing knockout (KO) efficiency in the pool, the cells can be immediately used for assays while remaining a heterogeneous population.
[0237] [Table 8]
[0238] [Table 9]
[0239] gRNA and Oligonucleotide Design: Six gRNAs targeting the KDM5C gene were selected from the V3 Yusa CRISPR knockout gRNA library. The gRNA oligonucleotides listed in Table 10 were ordered from IDT in 100 nM ready-to-use solutions (standard desalted). The oligonucleotides for the gRNAs were designed to have the following configurations: Forward oligonucleotide: 5'CACCG---19bp gRNA---3' Reverse oligonucleotide: 5'AAAC---19bp gRNA---C 3'
[0240] Working Example: Genome: 5'-tggcgtgTAAGAGAGCATCATGGGCCACGGcagagaa-3' [SEQ ID NO: 14] Guide RNA: 5'-GAAGAGAGCATCATGGGCCA-3' [SEQ ID NO: 15] Forward oligonucleotide: 5'-CACCGAAGAGAGCATCATGGGCCA-3' [SEQ ID NO: 16] Reverse oligonucleotide: 3'-CTTCTCTCGTAGTACCCGGTCAAA-5' [SEQ ID NO: 17]
[0241] The forward and reverse oligonucleotides paired with each other, resulting in two overhangs (5'CACC and 5'AAAC) that could be ligated into a linearized (BbsI) gRNA expression vector. The two oligonucleotides were designed as reverse complements, as they were cloned into the vector as an annealed oligo pair.
[0242] [Table 10]
[0243] Vector linearization and gRNA cloning into CRISPR lentiviral expression vectors: The CRISPR gRNA expression vector was linearized with the restriction enzyme BbsI according to the manufacturer's instructions (New England Biolabs, NEB). The linearized vector was separated on an agarose gel, purified from the gel, and quantified using a NanoDrop (Thermo Fisher). The concentration was adjusted to 20 ng / µL. gRNA oligonucleotide cloning was initiated by phosphorylation and annealing of the forward and reverse oligonucleotides. For this purpose, the components listed in Table 11 were mixed in a PCR tube strip. The strip was placed in a PCR machine and the program was run: start at 37°C for 30 min, then 95°C for 50 min, ramping down to 25°C at 0.1°C / s.
[0244] [Table 11]
[0245] To ligate double-stranded oligonucleotides (ds-oligos) into the vector, they were first diluted on ice in EB buffer (Qiagen) as follows: First dilution (142 fmol / μL): 139 μL EB buffer + 2 μL 10 μM ds-oligo Second diluent (7.1 pmol / μL): 57 μL EB buffer + 3 μL first diluent
[0246] Ligation reactions were performed by mixing the volumes listed in Table 12 in a PCR tube on ice. A negative control (linearized CRISPR vector without annealed oligos) was created by adding 2 μL of nuclease-free water instead of ds-oligos. The annealed oligos were ligated to the vector by incubating the linearized vector / oligo mixture at 16°C for 4 hours to overnight.
[0247] [Table 12]
[0248] To transform bacteria with the ligated vector, 5 μL of the ligation mixture was placed in a 1.5 mL microtube and kept on ice. 50 μL of DH5α chemically competent cells was added to the tube and mixed with the ligation mixture by vortexing for 1 second. The mixture was incubated on ice for 10 minutes and immediately heat-shocked at 42°C for 30 seconds. The bacterial mixture was then incubated on ice for an additional 2 minutes. 400 μL of SOC medium was then added to the transformed bacteria and incubated in a shaking incubator at 37°C for 30 minutes. The transformed bacteria were plated on LB agar plates containing ampicillin antibiotic and incubated overnight at 37°C. The next day, the plates were inspected for colony growth, and the negative control plate (ligation of linearized CRISPR vector without annealed sgRNA oligos) showed no colony growth. Using a sterile pipette, two colonies for each KDM5C gRNA construct were picked and placed in 2 mL of 2xTY medium (+50 μg / mL ampicillin) in a 15 mL Falcon tube. The bacteria were incubated in an orbital shaker at 37°C for 14–16 hours. The bacterial culture was then centrifuged at 4000 rpm for 10 minutes, and the supernatant was discarded. Plasmids were isolated using a Qiagen mini-prep kit according to the manufacturer's instructions and eluted in 50 μL of EB buffer. DNA concentrations were determined using a NanoDrop (ThermoFisher), and the plasmids were stored at -20°C.
[0249] 2. Production of KDM5C gRNA-expressing lentivirus in HEK-293T cells. Infectious KDM5C gRNA lentiviral particles were produced for transduction of ER-positive breast cancer cells according to the following procedures and materials described in Tables 14, 15, and 16.
[0250] [Table 13]
[0251] [Table 14]
[0252] [Table 15]
[0253] HEK-293T cells were cultured in DMEM medium containing 1x GlutaMAX and 10% fetal bovine serum (FBS) at 37°C with 5% CO2 and maintained according to the manufacturer's recommendations (GenHunter, catalog number Q401). To passage, the medium was aspirated and the cells were rinsed by gently adding 5 mL of TrypLE to the side of the T225 flask, without removing the cells. TrypLE was removed, and the cells were incubated in the flask at 37°C for 4-5 minutes until the cells began to detach. Next, 10 mL of warm culture medium was added to the flask, and the cells were dissociated by gently pipetting up and down. The cells were transferred to a 50 mL Falcon tube. HEK293T cells were passaged at a 1:4 ratio every two days, never reaching more than 70% confluency. For lentivirus production, the cells were maintained until passage number was less than 10.
[0254] On day 0, plate 8 x 10 HEK-293T cells per well in a 6-well plate. 5Cells were plated at 1000 x 1000 cells per well. Cells should be 80-90% confluent on the day of transfection, and each well produced 3 mL of lentivirus. On the morning of Day 1, the CRISPR gRNA lentiviral vector listed in Table 16, the packaging mix vectors (psPAX2 and pMG2.G) listed in Table 15, and the PLUS reagent, as listed in Table 17, were mixed with Opti-MEM medium in a 15 mL tube. The transfection mixture was mixed for 2 seconds by either pipetting or vortexing and incubated at room temperature for 5 minutes. Lipofectamine LTX was added, mixed for 2 seconds by either pipetting or vortexing, and incubated at room temperature for 30 minutes. The old medium in the wells was aspirated, and the cells were washed once with 2 mL of Opti-MEM medium per well. HEK-293T cells loosely adhere to the culture vessel, so be careful not to dislodge the cells during this step. 1.5 mL of Opti-MEM medium was added to each well. The DNA / Lipofectamine complex was added dropwise to each well using a pipette and swirled very gently. The cells were incubated with the transfection solution at 37°C for 5-7 hours. If the cells were less than 80% confluent at the time of transfection, shorten the transfection incubation time to 5 hours to prevent excessive cell death. The medium was then replaced with 2.5 mL of fresh cell culture medium (DMEM GlutaMAX + 10% FBS).
[0255] [Table 16]
[0256] Before harvesting the lentivirus, HEK-293T cells were examined under a fluorescence microscope to detect BFP expression and evaluate transduction efficiency and viral production success. On day 3, 48 h after transfection, the viral supernatant was collected with a 10 mL disposable syringe and filtered through a 0.45 μm filter cartridge. The HEK-293T plates were discarded according to the appropriate waste disposal route. 1 mL of the supernatant was aliquoted into labeled cryovials and stored at -80 °C.
[0257] 3. Infection and generation of MCF7, T47D, and CAMA-1 Cas9-expressing cell lines with KDM5C gRNA lentivirus. The goal of this protocol is to generate pooled KDM5C KO cell lines from MCF7, T47D, and CAMA-1 Cas9 stable lentivirus pools (Example 1B, Example 1C, and Example 1D). Each Cas9-expressing cell line was transduced with three different KDM5C gRNA lentiviruses (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3) in a 6-well plate (each well of cells was transduced with a different KDM5C gRNA lentivirus). Cells were also transduced with the empty vector pKLV-2, a lentivirus that does not contain a gRNA targeting KDM5C. These are the wild-type cell lines used in growth experiments. The KDM5C gRNA lentivirus was thawed at room temperature, and the viral transduction mix was prepared in a 1.5 mL Eppendorf tube as described in Table 18. 250,000 cells were seeded per well in a 6-well plate in a total of 1 mL of medium. Immediately after plating the cells, 1 mL of the transduction mixture was added to each well of cells, and the plate was gently mixed and placed in an incubator. 24 hours after transduction, the virus-containing medium was removed from each well and replaced with 3 mL of fresh medium. 72 hours after transduction, cells were expanded from each well into T75 flasks with puromycin selection. The concentration of puromycin used for each cell line is listed in Table 19. Cells were maintained under puromycin selection until no viable cells remained in the virus-free control flask. After puromycin selection of the KDM5C KO cell lines was completed, the cell lines were grown for at least one week, after which KDM5C protein levels were tested using Western blot.
[0258] [Table 17]
[0259] [Table 18]
[0260] Western blotting was used to confirm that the KDM5C gene had been edited in the cell lines. Protein was extracted from cells in a T25 flask with 200 μL of lysis buffer (25 mM Tris-HCl, 3 mM EDTA, 3 mM EGTA, 50 mM NaF, 2 mM orthovanadate, 0.27 M sucrose, 10 mM β-glycerophosphate, 5 mM pyrophosphate, 0.5% Triton X-100, 0.1% β-mercaptoethanol, deionized water) supplemented with a protease inhibitor cocktail. Lysates were clarified by centrifugation and quantified using the BCA assay. Protein concentrations were normalized between samples and prepared in NuPAGE LDS sample buffer (4x). Samples were boiled and loaded onto a 4-12% NuPAGE BisTris gel. Proteins were separated by electrophoresis in a gel tank (XCell Surelock™ Mini-Cell) running NuPAGE MOPS SDS running buffer for 1 hour. Proteins in the gel were transferred to a nitrocellulose membrane using an Iblot2 dry blotting system, according to the manufacturer's instructions, at program P3 20V for 10 minutes. Total protein in the membrane was assessed by Ponceau S staining, and the membrane was blocked with 5% nonfat dry milk in TBST buffer (TBS plus 0.05% Tween). The membrane was stained with primary antibodies (KDM5C antibody: 1:250, Abcam ab34718; vinculin antibody: 1:1000, Cell Signaling Technology #4650) overnight at 4°C with shaking. The next day, the membrane was washed three times with TBST for 5 minutes each time. The membrane was incubated with a secondary antibody (1:2000) conjugated to HRP peroxidase from the appropriate species for 1 hour at room temperature with shaking. The membrane was washed three times with TBST for 5 minutes each time. Finally, the membrane was incubated with a chemiluminescently detectable substrate (Pierce Supersignal kit), and images were developed using a CCD camera in a Sygene G box.
[0261] 4. Incucyte® proliferation assay using MCF7 and CAMA-1 KDM5C KO lentiviral pools. The following protocol was used to set up proliferation assays and analyze the resulting data (Figures 2, 3, 9-12, 15, and 16). CAMA-1 cell line: CAMA-1 WT (parental cell line) and KDM5C KO lentiviral pools were seeded at 25,000 cells / well in 48-well plates. Plates were placed in an incubator to allow cells to attach. After 24 hours, cells were treated with DMSO as a vehicle control or 400 nM capivasertib, and immediately after compound addition, plates were placed on an Incucyte® S3 (day 0 reading). Cells were imaged on days 2, 5, 6, 7, 9, 12, 14, 16, 20, and 21 (end of assay).
[0262] MCF7 cell line: MCF7 WT (parental cell line) and KDM5C KO lentiviral pools were seeded at 60,000 and 90,000 cells / well in two replicate 24-well plates. The plates were placed in an incubator to allow cells to attach. After 24 hours, cells were treated with DMSO as a vehicle control, 750 nM capivasertib, 750 nM alpelisib, or 10 nM everolimus. Immediately after compound addition, the plates were placed on an Incucyte® Zoom (day 0 reading). Cells were imaged every 4 hours for 8 days.
[0263] For both cell lines, multiple fields were acquired per well and the average % confluency per well was quantified using Incucyte® analysis software. Values from all time points were normalized to day 0. Normalized values were plotted as a line graph (X-axis = days of growth, Y-axis = % cell confluence), while endpoint values (last day imaged) were plotted as a bar graph.
[0264] 2, 3, 9, 10, 11, 12, 13 and 16 show the following: ·Knockout of KDM5C affects the proliferation of MCF7 cells. · KDM5C knockout sensitizes MCF7 cells to capivasertib, alpelisib, or everolimus monotherapy. ·Knockout of KDM5C sensitizes CAMA-1 cells to capivasertib monotherapy.
[0265] 2B. Incucyte® Proliferation Assay Using MCF7 KDM5C KO Clonal Cell Line. The following protocol was used to set up the proliferation assay and analyze the data obtained in Figures 4-8, 13, and 14. MCF7 WT (parental cell line) and MCF7 KDM5C KO clone A9 were seeded into replicate 48-well plates at 50,000 cells / well (2 plates) and 75,000 cells / well (3 plates). Plates were placed in an incubator to allow cells to attach. After 24 hours, cells were treated with DMSO as a vehicle control, capivasertib (500 nM or 1 μM), alpelisib (500 nM or 1 μM), fulvestrant (10 nM), and camizestrant (10 nM). Plates were placed on an Incucyte® S3 or Zoom (day 0 reading) immediately after compound addition. Cells were imaged for 14 days, with images taken every 4 hours for plates seeded with 75,000 cells / well and on days 4, 8, 10, and 14 for plates seeded with 50,000 cells / well. Multiple fields per well were acquired, and the average % confluency per well was quantified using Incucyte® analysis software. Values from all time points were normalized to day 0. Normalized values were plotted as a line graph (X-axis = days of growth, Y-axis = % cell confluence), while endpoint values (last day imaged) were plotted as a bar graph. Statistical analysis was performed on Prism using data from multiple plates. Ns = p>0.05, * = p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, ****P≦0.0001 significance was determined using a two-tailed t-test.
[0266] 4 to 8, 13 and 14 illustrate the following. ·Knockout of KDM5C affects the proliferation of MCF7 cells. · KDM5C knockout sensitizes MCF7 cells to capivasertib and alpelisib monotherapy and to the combination of capivasertib and fulvestrant or camizestrant.
[0267] 2C. Incucyte® Proliferation Assay with Acute Knockout (KO) of KDM5C. The following protocol was used to set up the proliferation assay and analyze the data obtained from Figures 2-19.
[0268] Acute KO of KDM5C was achieved in MCF7 and CAMA-1 cell lines stably expressing spCas9 by reverse transfecting a pool of 4x different synthetic single guide RNAs (sgRNAs) targeting KDM5C exon 3. An sgRNA targeting the safe harbor locus AAVS1 (adeno-associated virus integration site 1) was used as a reference control.
[0269] [Table 19]
[0270] Prior to initiating the proliferation assay, 350 nL of pooled KDM5C sgRNA or single AAVS1 sgRNA was administered per well in a 96-well plate (Thermo Fisher Scientific #165305) using acoustic dispensing with an Echo® 650 (Beckman) to achieve a final concentration of 25 nM / well in a final volume of 140 μL.
[0271] MCF7 and CAMA-1 cells were cultured in phenol-red-free RPMI supplemented with 5% fetal bovine serum (FBS), 1× Glutamax, and 1 / 100 Pen / Strep (P / S) and incubated at 37°C with 5% CO2. After dispensing sgRNA into 96-well plates, cells were resuspended from T25 or T75 flasks by washing with PBS at room temperature and incubating with Accutase™ for 5 minutes. Cell suspensions were collected in a Falcon and counted using a Vi-CELL counter (Beckman). MCF7 cells were diluted to 85714.29 cells / mL with medium and seeded at 9,000 cells per well, while CAMA-1 cells were diluted to 100,000 cells / mL with medium and seeded at 7,000 cells per well. Reverse transfection was initiated by incubating synthetic sgRNA with Lipofectamine RNAiMAX (Thermo Fisher Scientific #13778150). 35 μL of 1% Lipofectamine RNAiMAX diluted in serum-free RPMI medium was added to each well using a Multidrop™ Combi™ with a standard cassette. The sgRNA:Lipofectamine mixture was incubated at room temperature for 45 minutes. Immediately after, 105 μL of cell suspension was added to the top using a Multidrop™ Combi™ with a standard cassette at low speed. Cells were distributed into duplicate plates containing multiple replicate wells for each treatment. Wells at the edges of the plate were excluded (rows A and H, columns 1 and 12). After cell seeding, the plates were placed on an Incucyte® Zoom in the incubator, and scheduled brightfield imaging scans were performed every 5 hours using a 10x objective. After 3 days, the medium was removed with a multichannel aspirator, and the wells were refilled with fresh medium (140 μL final volume) using a Multidrop™ Combi equipped with a standard cassette at low speed. The plates were subjected to different treatments using a Tecan D300 digital dispenser (HP). Dimethyl sulfoxide (DMSO) was used as a vehicle to dilute the drugs and as a neutral control.
[0272] MCF7 cells were treated with two concentrations of capivasertib (500 nM and 750 nM) and 100 nM fulvestrant in combination with 500 nM capivasertib. The cells were placed back on the Incucyte® and imaged over the next 10 days with drug treatment. After 4 days, the medium was replaced with fresh cell culture medium containing the drug. The medium was removed from the plate as described above, and the plate was re-administered at the same starting concentration using a Tecan D300 digital dispenser (HP). The medium was replaced again after 3 days using the same procedure and maintained until the end of the assay.
[0273] CAMA-1 cells were treated with 400 nM capivasertib monotherapy. The cells were placed back on Incucyte® and imaged over the next 7 days with drug treatment. After 3 days, the medium was replaced with fresh cell culture medium containing the drug and maintained until the end of the assay. The medium was removed from the plate as described above, and the plate was re-administered at the same starting concentration using a Tecan D300 digital dispenser (HP).
[0274] For both cell lines, four fields per well were acquired and the average % confluency per well was quantified using Incucyte® Zoom analysis software starting from day 1 (24 hours after reverse transfection) to the end of the assay at 13 days (MCF7 cells) or 10 days (CAMA-1 cells). The % confluency between time points was normalized to day 1 after reverse transfection.
[0275] The growth results, plotted either as growth curves (FIGS. 17 and 19) or as a bar graph with confluency at the end of the study (FIG. 18), show the following: · Acute knockout of KDM5C affects proliferation of MCF7 cells. Acute knockout of KDM5C sensitizes MCF7 cells (PIK3CA E545K) to capivasertib monotherapy and the combination of fulvestrant and capivasertib. Acute knockout of KDM5C sensitizes CAMA-1 cells (PTEN-deficient) to capivasertib monotherapy.
[0276] Example 4: KDM5 inhibition and drug combination studies The experiments in this example were conducted to verify the drug-sensitizing effect of KDM5 inhibition by the CPI-48 compound in PIK3CA-mutated and PTEN-deficient ER-positive breast cancer cell lines (MCF7 and CAMA-1) and PIK3CA-mutated cell lines (MCF7 and T47D) resistant to fulvestrant or fulvestrant plus palbociclib.
[0277] Proliferation assay using KDM5 inhibitor CPI-48: The following protocol was used to set up the proliferation assay and analyze the data obtained from Figures 20-30.
[0278] All cell lines were cultured in phenol-red-free RPMI supplemented with 5% fetal bovine serum (FBS), 1x Glutamax, and 1 / 100 Pen / Strep (P / S) and incubated at 37°C with 5% CO2. Cells were first resuspended from T75 flasks by washing with PBS at room temperature and incubating with 2 mL of Accutase™ for 5 minutes. The cell suspension was collected in a Falcon and counted using a Vi-CELL counter (Beckman). The resuspended cell stock was diluted to the appropriate cell density with medium and seeded at 50 μL / well into 384-well plates (Greiner #781090) using a Multidrop™ Combi with standard cassettes. The following cell numbers per well were seeded: MCF7 parental and MCF7 100F P2 (600 cells / well), MCF7 ESR1 (Y537S / - / -) (500 cells / well), T47D 100F1P P1, T47D 100F1P P2 (1000 cells / well), and CAMA-1 (2000 cells / well). Cells were seeded in columns (3 columns per cell line), and each plate was replicated to contain technical replicates. Edge wells were excluded (rows A and P, columns 1 and 24). Each cell line had at least six DMSO wells per plate (12 in total across two replicate plates) and at least three samples for each drug treatment and plate. Only fulvestrant and fulvestrant with palbociclib had at least one sample for each cell line and plate. After cell seeding, plates were placed in an incubator until drug treatment.
[0279] T47D 100F1P P1 (Figures 24, 26, and 30), T47D 100F1P P2 (Figures 25, 27, 28, and 30), and CAMA-1 (Figure 21) cells were treated with drugs 36 hours after seeding. Dimethyl sulfoxide (DMSO) was used as a vehicle to dilute the drugs and as a neutral control. Cells were subjected to different treatments using a Tecan D300 digital dispenser (HP). Cells were treated with a four-point dose response of CPI-48 (1 μM, 5 μM, 10 μM, 15 μM), two concentrations of capivasertib (T47D: 400 nM and 600 nM, CAMA-1: 200 nM and 400 nM), two concentrations of alpelisib (300 nM and 500 nM), 10 nM everolimus, 100 nM fulvestrant, and 100 nM fulvestrant in combination with 400 nM palbociclib. Cells were returned to the incubator and allowed to grow with the drugs for 10 days. After two days, the medium was replaced with fresh medium containing the drugs. The medium was removed from the plates using a Bravo automated liquid handling platform (Agilent), and immediately thereafter, 50 μL of fresh medium was added using a Multidrop™ Combi with standard cassettes at low speed. The cells were then treated again with fresh DMSO and drugs at the same starting concentrations as above. After 4 days, the medium was again replaced with fresh medium containing drugs, following the same procedure.
[0280] MCF7 (Figures 20 and 29), MCF7 100F P2 (Figures 23 and 29), and MCF7 ESR1 (Y537S / - / -) (Figures 22 and 29) cells were treated with drugs 20 hours after seeding. Dimethyl sulfoxide (DMSO) was used as a vehicle to dilute the drugs and as a neutral control. Cells were subjected to different treatments using a Tecan D300 digital dispenser (HP). Cells were treated with a four-point dose response of CPI-48 (1 μM, 5 μM, 10 μM, 15 μM), two concentrations of capivasertib (500 nM and 750 nM), 100 nM fulvestrant, and 100 nM fulvestrant in combination with 400 nM palbociclib. As described above for the T47D and CAMA-1 cell lines, the medium was replaced twice with fresh medium containing the drug, 3 and 7 days after the first administration.
[0281] After 10 days of continuous drug treatment, all proliferation assays were terminated by fixing the cells with 50 μL of 8% paraformaldehyde (4% final) for 45 minutes at room temperature. The paraformaldehyde was removed, and the plates were washed four times with 75 μL / well of PBS using a BioTek EL406 microplate washer. The plates were stored at 4°C.
[0282] To quantify cell number, cell nuclei were stained with Hoechst 33342 (Thermo Fisher Scientific #H3570), imaged, and counted. Cells were permeabilized and blocked for 60 minutes at room temperature using modified blocking buffer (1 liter: 8 g sodium chloride, 0.2 g potassium chloride, 1.44 g disodium hydrogen phosphate, 0.2 g potassium dihydrogen phosphate, 11 g 1.1% BSA, 1 g 0.1% Triton X-100, deionized water). 20 μL of Hoechst dye diluted 1 / 2000 in modified blocking buffer was added to the plate using a Multidrop™ Combi with a small cassette at low speed. The plate was protected from light and incubated for 2 hours at room temperature. The plate was then washed four times with 75 μL / well of PBS using a BioTek EL406 microplate washer. Images were acquired using a Cell Voyager 7000 (Yokogawa) spinning disk confocal microscope. Images were acquired with 2x2 binning using a 10x dry objective. Four fields per well were acquired at the optimal z-position (1x z-stack). Images were analyzed with a Columbus™ image analysis system (PerkinElmer). In the analysis sequence for counting cell nuclei, nuclei were identified using Hoechst intensity (Method A with a common threshold of 0.7 (T47D cells / CAMA-1 cells) or 0.3 (MCF7 cells) and a division factor of 4 (T47D cells / CAMA-1 cells) or 3 (MCF7 cells). Objects at the image border were excluded, and morphological and intensity characteristics were calculated for the remaining nuclear objects. Nuclear objects were filtered to remove artifacts. For T47D cells, the nuclear area was calculated using the Hoechst intensity method (Method A with a common threshold of 0.7 (T47D cells / CAMA-1 cells) or 0.3 (MCF7 cells) and a division factor of 4 (T47D cells / CAMA-1 cells) or 3 (MCF7 cells). 2 >60 and strength <20000 and> 350), and for CAMA-1 cells (nuclear area μm 2 >70 and strength <20000 and> 350), and for MCF7 cells (nuclear area μm 2 >70 and strength <50000 and>350 and circularity >0.75). The mean cell number per well was normalized to the mean cell number of the DMSO sample for each cell line within the plate and plotted as fold change relative to DMSO using Prism v8 (GraphPad). Statistical analysis was performed in Prism v8. One-way ANOVA with Bonferroni post-hoc test (ns = P > 0.05, * = P ≤ 0.05, ** = P ≤ 0.01, *** =P≦0.001) was used to calculate statistical differences between (A) CPI-48 monotherapy samples versus DMSO, (B) CPI-48 in combination with capivasertib, alpelisib, or everolimus versus capivasertib, alpelisib, or everolimus monotherapy (Figures 20-28), and (C) parental and resistant cell lines (Figures 29 and 30).
[0283] Proliferation assays showed the following: Inhibition of KDM5, in combination with capivasertib, suppresses the growth of both PIK3CA-mutated (MCF7) and PTEN-deficient (CAMA-1) ER-positive breast cancer cell lines (Figures 20 and 21). KDM5 inhibition exhibits monotherapy activity in MCF7 and T47D cell models harboring the PIK3CA E545K mutation (Figures 20, 23-27). Inhibition of KDM5 in combination with capivasertib increases its antiproliferative effect in cell lines with lower sensitivity or resistance to fulvestrant and fulvestrant in combination with palbociclib (Figures 22-25). Inhibition of KDM5, in combination with alpelisib and everolimus, suppresses growth in T47D cell models resistant to their combination with fulvestrant or palbociclib (Figures 26-28). The MCF7 Y537S mutant and 100F P2 cell lines are less sensitive to 100 nM fulvestrant than the parental WT cell line (Figure 29). The T47D 100F1P P1 and T47D 100F1P P2 cell lines are insensitive to fulvestrant or its combination with palbociclib (Figure 30).
Claims
1. A compound for use in the treatment of cancer, wherein said compound is administered in combination with a KDM5C inhibitor, and said compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
2. 2. The compound for use according to claim 1, wherein the compound is an AKT inhibitor.
3. The compound for use according to claim 1, wherein the compound is a PI3K-α inhibitor.
4. 2. The compound for use according to claim 1, wherein the compound is an mTOR inhibitor.
5. The compound for use according to any one of claims 1 to 4, wherein said compound and said KDM5C inhibitor are administered separately, sequentially or simultaneously.
6. The compound for use according to any one of claims 1 to 5, wherein the cancer is PTEN deficient.
7. The compound for use according to any one of claims 1 to 6, wherein the cancer comprises a PIK3CA mutation.
8. 8. The compound for use according to claim 7, wherein the PIK3CA mutation is selected from one or more of R88Q, N345K, C420R, E542K, E545A, E545D, E545Q, E545K, E545G, Q546E, Q546K, Q546R, Q546P, M1043V, M1043I, H1047Y, H1047R, H1047L and G1049R.
9. The compound for use according to any one of claims 1 to 8, wherein the cancer is breast cancer.
10. The compound for use according to any one of claims 1 to 9, wherein the cancer is advanced or metastatic breast cancer.
11. 11. The compound for use according to claim 9 or 10, wherein the breast cancer is estrogen receptor positive breast cancer.
12. The compound for use according to any one of claims 1 to 11, wherein the patient is a postmenopausal or premenopausal woman.
13. 13. The compound for use according to any one of claims 9 to 12, wherein the breast cancer is resistant to treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator, or an aromatase inhibitor.
14. 14. The compound for use according to any one of claims 9 to 13, wherein the patient's breast cancer has progressed during or after previous treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator and / or an aromatase inhibitor.
15. The compound for use according to claim 13 or 14, wherein the selective estrogen receptor degrader is selected from fulvestrant or a pharmaceutically acceptable salt thereof, amsenestrant or a pharmaceutically acceptable salt thereof, camizestrant or a pharmaceutically acceptable salt thereof and elacestrant or a pharmaceutically acceptable salt thereof.
16. 16. The compound for use according to any one of claims 13 to 15, wherein the selective estrogen receptor modulator is selected from tamoxifen or a pharmaceutically acceptable salt thereof, toremifene or a pharmaceutically acceptable salt thereof and raloxifene or a pharmaceutically acceptable salt thereof.
17. 17. The compound for use according to any one of claims 13 to 16, wherein the aromatase inhibitor is selected from anastrozole or a pharmaceutically acceptable salt thereof, letrozole or a pharmaceutically acceptable salt thereof and exemestane or a pharmaceutically acceptable salt thereof.
18. The compound for use according to any one of claims 9 to 17, wherein the breast cancer is resistant to treatment with a CDK4 / 6 inhibitor.
19. The compound for use according to any one of claims 9 to 18, wherein the breast cancer has progressed during or after previous treatment with a CDK4 / 6 inhibitor.
20. 20. The compound for use according to claim 18 or 19, wherein the CDK4 / 6 inhibitor is selected from palbociclib or a pharmaceutically acceptable salt thereof, ribociclib or a pharmaceutically acceptable salt thereof, and abemaciclib or a pharmaceutically acceptable salt thereof.
21. The AKT inhibitor is selected from the group consisting of milansertib (ARQ-092) or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, volsertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or 21. The compound for use according to any one of claims 1, 2 or 5 to 20, selected from MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib (GSK2110183) or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, and ipatasertib (GDC-0068) or a pharmaceutically acceptable salt thereof.
22. 22. The compound for use according to claim 21, wherein the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof.
23. 23. The compound for use according to any one of claims 1, 3 or 5 to 22, wherein the PI3K-α inhibitor is a PI3K-α selective inhibitor.
24. 24. The compound for use according to claim 23, wherein the PI3K-α inhibitor is a PI3K-α specific inhibitor.
25. 25. The compound for use according to claim 23 or 24, wherein the PI3K-α inhibitor is selected from alpelisib or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof, and selavelisib or a pharmaceutically acceptable salt thereof.
26. 26. The compound for use according to any one of claims 1 or 4 to 25, wherein the mTOR inhibitor is an mTORC1 inhibitor.
27. 27. The compound for use according to claim 26, wherein the mTOR inhibitor is an mTORC1 selective inhibitor.
28. 28. The compound for use according to claim 26 or 27, wherein the mTOR inhibitor is selected from everolimus or a pharmaceutically acceptable salt thereof, and temsirolimus or a pharmaceutically acceptable salt thereof.
29. The compound for use according to any one of claims 1 to 28, wherein the KDM5C inhibitor is CPI-48 or a pharmaceutically acceptable salt thereof.
30. 30. The compound for use according to any one of claims 1 to 29, wherein said compound and said KDM5C inhibitor are administered in combination with a SERD.
31. 31. The compound for use according to claim 30, wherein said compound, said KDM5C inhibitor, and said SERD are administered separately, sequentially or simultaneously.
32. 32. The compound for use according to any one of claims 30 to 31, wherein the compound and the KDM5C inhibitor are administered in combination with fulvestrant or a pharmaceutically acceptable salt thereof, or camizestrant or a pharmaceutically acceptable salt thereof and palbociclib or a pharmaceutically acceptable salt thereof.
33. 33. The compound for use according to claim 32, wherein the compound, the KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, or camizestrant, a pharmaceutically acceptable salt thereof and palbociclib or a pharmaceutically acceptable salt thereof are administered separately, sequentially or simultaneously.
34. Use of a compound in the manufacture of a medicament for the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
35. 1. A method of treating cancer in a patient in need thereof, comprising administering to said patient a therapeutically effective amount of a compound, wherein said compound is administered in combination with a therapeutically effective amount of a KDM5C inhibitor, and wherein said compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
36. 1. A method of treating cancer in a patient in need thereof comprising administering to said patient a first amount of a compound and a second amount of a KDM5C inhibitor, wherein said first amount and said second amount together comprise a therapeutically effective amount, and said compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
37. A pharmaceutical composition comprising a compound, a KDM5C inhibitor, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.
38. 38. The pharmaceutical composition of claim 37, comprising fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof.
39. 39. The pharmaceutical composition of claim 38, comprising a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is capivasertib or a pharmaceutically acceptable salt thereof.
40. 40. The pharmaceutical composition of claim 38 or 39, comprising palbociclib or a pharmaceutically acceptable salt thereof.