Use of Muscodor albus strains to produce volatile organic compounds
Muscodor albus strain SA-13 produces VOCs that enhance plant growth by increasing biomass and promoting early flowering, addressing the limitations of existing methods and improving plant health.
Patent Information
- Application Number
- JP2025531682
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-12-01
- Filing Date
- 2023-12-01
- Publication Date
- 2025-12-11
AI Technical Summary
Existing methods for promoting plant growth, increasing biomass, and inducing early flowering are inadequate, and there is a need for effective biological agents that can enhance these processes.
The use of Muscodor albus strains, specifically strain SA-13, to produce volatile organic compounds (VOCs) that are applied to plants, seeds, or substrates to increase biomass, induce flowering, and upregulate resistance pathways.
The Muscodor albus strain SA-13 effectively increases plant biomass, promotes early flowering, and enhances systemic acquired resistance pathways, leading to improved growth and nitrogen levels in leaf tissue.
Smart Images

Figure 2025540111000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 429,513, filed December 1, 2022 (hereinafter the "'513 Provisional Application"). The contents of the '513 Application are incorporated herein in their entirety.
[0002] The present disclosure relates generally to isolated Muscodor albus strains that produce volatile organic compounds (VOCs), as well as cultures and compositions of said strains and metabolites or cultures derived therefrom, as well as methods for obtaining said compositions, metabolites and volatiles, and methods for using them to promote plant growth, including increased height and / or biomass, and including early fruiting and flowering. Summary of the Invention [Means for solving the problem]
[0003] In various aspects, methods for promoting plant growth are disclosed.
[0004] The methods of the disclosure include increasing plant biomass by applying to the plant and / or seed and / or substrate used to grow the plant an effective amount of a composition comprising a fermentation product of Muscodor albus strain SA-13 (NRRL Accession No. B-50774).
[0005] According to another aspect, a method for inducing early flowering in a plant comprises applying to the plant and / or the seed and / or the substrate used to grow the plant an effective amount of a composition comprising a Muscodor albus strain.
[0006] A method for increasing plant biomass can include applying grain inoculated with Muscodor albus strain SA-13 to a substrate used to grow the plant. In another embodiment, the method includes placing the plant in communication with a substrate containing grain inoculated with Muscodor albus strain SA-13 and / or treating the plant directly and / or indirectly with one or more volatile compounds produced by Muscodor albus strain SA-13.
[0007] According to another aspect, a method for increasing nitrogen in leaf tissue comprises directly and / or indirectly treating leaf tissue with one or more volatile compounds produced by a Muscodor albus strain.
[0008] According to another aspect, a method for upregulating genes in the systemic acquired resistance pathway comprises applying to a substrate used to grow plants grain inoculated with a Muscodor albus strain. A method for upregulating genes in the jasmonic acid pathway can comprise applying to a substrate used to grow plants grain inoculated with Muscodor albus strain SA-13.
[0009] According to yet another aspect, a method for increasing plant biomass comprises applying to a plant and / or a seed and / or a substrate used to grow said plant an effective amount of a composition comprising a fermentation product of Muscodor albus strain SA-13 (NRRL Accession No. B-50774), said strain producing volatile compounds including 3-octanone, (-)aristrene, acetic acid 2-methylpropyl ester, propanoic acid 2-methyl-methyl ester, and propanoic acid 2-methyl-butyl ester.
[0010] Other aspects of the disclosed subject matter, as well as features and advantages of various aspects of the disclosed subject matter, will become apparent to those skilled in the art upon review of the ensuing description, the accompanying drawings, and the appended claims. [Brief explanation of the drawings]
[0011] [Figure 1] FIG. 1 provides a representation of one embodiment of an experimental setup for measuring the effect of Muscodor albus strains on lettuce. [Figure 2] Photographs of treated and untreated lettuce showing the effect of Muscodor albus strains on growth. [Figure 3] 1 is a chart showing the digital biomass of treated and untreated tomatoes. [Figure 4] FIG. 1 provides a representation of an embodiment of an experimental setup for measuring the effect of Muscodor albus strains on tomato. [Figure 5] Photographs of treated and untreated tomatoes showing the effect of Muscodor albus strains on growth. [Figure 6] Photographs of treated and untreated tomatoes showing the effect of Muscodor albus strains on growth. [Figure 7] Photographs of treated and untreated tomatoes showing the effect of Muscodor albus strains on growth. [Figure 8] 1 is a chart of the average digital biomass of treated and untreated tomatoes showing the effect of Muscodor albus strains on growth. [Figure 9] 1 is a chart of the average digital biomass of treated and untreated tomatoes showing the effect of Muscodor albus strains on growth. [Figure 10] 1 is a chart of the average digital biomass of treated and untreated tomatoes showing the effect of Muscodor albus strains on growth. [Figure 11] 1 shows a chart of nitrogen levels in leaf tissue of treated and untreated tomatoes. [Figure 12] 1 shows a chart of gene expression measured for changes in the SAR pathway in treated and untreated tomatoes. [Figure 13] 1 shows a chart of gene expression measured for changes in the jasmonate pathway in treated and untreated tomatoes. [Figure 14] Figure 10 is a chart summarizing findings regarding the expression levels of microbial pathways that were upregulated in the rhizosphere of plants treated directly or indirectly with Muscodor albus strains. [Figure 15] 1 is a chart showing the number of genes overexpressed by the rhizosphere microbial community of plants treated directly or indirectly with Muscodor albus strains. [Figure 16] 1 is a chart showing the relative abundance of various bacteria in the rhizosphere of treated and untreated plants. [Figure 17] 1 is another chart showing the relative abundance of various bacteria in the rhizosphere of treated and untreated plants. [Figure 18] Photographs of treated and untreated strawberries showing the effect of Muscodor albus on the induction of flowering and fruit set. [Figure 19] 1 is a chart showing digital biomass over time for treated and untreated strawberries, showing the effect of Muscodol strains on digital biomass. [Figure 20] 1 is another chart showing digital biomass over time for treated and untreated strawberries, illustrating the effect of Muscodol strains on digital biomass. [Figure 21] 1 is a chart showing the number of fruits and flowers produced 4 weeks after treatment for treated and untreated strawberry plants, illustrating the effect of Muscodol strains on the induction of fruit set and flowering. [Figure 22] Layout of field treatments for broccoli trials is shown. [Figure 23] 1 shows plots selected for analysis in the broccoli trial. [Figure 24] Figure 1 shows the total mean biomass (in grams) of broccoli plants treated with different batch treatments of high, medium, and low application rates of Muscodor albus formulations compared to the control. [Figure 25] Figure 1 shows the total mean biomass (in grams) of broccoli plants treated with different batch treatments of high, medium, and low application rates of Muscodor albus formulations compared to the control. [Figure 26] Figure 1 shows the total mean biomass (in grams) of broccoli plants treated with different batch treatments of high, medium, and low application rates of Muscodor albus formulations compared to the control. [Figure 27] Figure 1 shows the total mean head weight (in grams) of broccoli plants treated with different batch treatments of high, medium, and low application rates of Muscodol albus formulations compared to the control. [Figure 28] Figure 1 shows the total mean head weight (in grams) of broccoli plants treated with different batch treatments of high, medium, and low application rates of Muscodol albus formulations compared to the control. [Figure 29] Figure 1 shows the total mean head weight (in grams) of broccoli plants treated with different batch treatments of high, medium, and low application rates of Muscodol albus formulations compared to the control. [Figure 30] Figure 1 shows the total nitrogen content (%) of broccoli treated with different batch treatments of Muscodor albus formulations at high, medium, and low application rates compared to the control. [Figure 31] Figure 1 shows the total nitrogen content (%) of broccoli treated with different batch treatments of Muscodor albus formulations at high, medium, and low application rates compared to the control. [Figure 32] Figure 1 shows the total nitrogen content (%) of broccoli treated with different batch treatments of Muscodor albus formulations at high, medium, and low application rates compared to the control. [Figure 33] Figure 1 shows the diversity index of soil samples taken from the rhizosphere of broccoli plants treated with various Muscodor albus batch formulations at 50 lb (22.7 kg) per acre (4046.86 m2). [Figure 34] Figure 1. Fungal and bacterial ratios in rhizosphere soil samples from broccoli plants treated with different batch formulations of Muscodor albus at 50 lb (22.7 kg) per acre (4046.86 m2). [Figure 35]Total viable microbial biomass in ng / g is shown for rhizosphere soil samples taken from broccoli plants treated with different formulations of Muscodor albus at 50 lb (22.7 kg) per acre. [Figure 36] Figure 1 shows the partitioning of total fungi into arbuscular mycorrhizal and saprophytic fungi in rhizosphere soil samples taken from broccoli treated with different formulations of Muscodor albus at 22.7 kg (50 lb) per 4046.86 m2 (1 acre). DETAILED DESCRIPTION OF THE INVENTION
[0012] The endophytic fungus Muscodor albus (CZ-620) inhibits the growth of a wide range of pathogenic fungi and bacteria, as well as some nematode and arthropod species. This inhibition is due to the complex mixture of volatile organic compounds (VOCs) secreted by Muscodor albus into the headspace of the culture. Volatile compounds emitted by Muscodor albus and other closely related organisms in the genus, as monitored by gas chromatography-mass spectrometry (GC-MS), consist of a combination of short-chain alcohols, organic acids, esters, ketones, and some aromatic hydrocarbons. The compounds range from 2 to 9 carbons and include both straight- and branched-chain varieties. The larger aromatic products are predicted to be sesquiterpenes and derivatives of naphthalene and azulene. Many fungal species have been reported to produce VOCs, but none have demonstrated the broad range of biological activity seen with Muscodor albus isolates.
[0013] Muscodor albus strains can be used to further promote plant growth, including height, biomass, fruit and flowers.
[0014] Method of production As described above, compounds, metabolites, or volatiles can be obtained, obtainable, or derived from organisms having one or more distinguishing characteristics of the Muscodor strain described above. The method involves culturing these organisms and isolating these compounds from the cultures of these organisms to obtain the compounds and / or compositions of the present invention. In particular, the organisms are cultured in a nutrient medium using methods known in the art. The organisms can be cultured in a suitable medium and under conditions that allow cell growth, or in laboratory or industrial fermentation equipment carried out on a solid substrate such as agar, by shaking or non-shaking culture, small-scale or large-scale fermentation (including, but not limited to, continuous fermentation, batch fermentation, fed-batch fermentation, or solid-state fermentation). Culturing can be carried out in an appropriate nutrient medium containing a carbon source, a nitrogen source, and inorganic salts, using procedures known in the art. Suitable media are available, commercially available, or can be prepared according to published compositions. In certain embodiments, and as described in the Examples, Muscodor albus strains can be cultured on agar media such as potato dextrose agar (PDA) (D. Ezra et al., 2004, Microbiology 150:4023) or in various grain media, such as barley grain, by inoculating the grain with PDA plugs grown with the strain.
[0015] After cultivation, the supernatant, filtrate, volatiles, and / or extracts of or derived from the muscodor strain (e.g., Muscodor albus SA-13) can be used in formulating compositions. Alternatively, after cultivation, the compounds, volatiles, and / or metabolites can be extracted from the culture broth. Its detailed structure and method of manufacture are described in PCT / US2013 / 061531 and U.S. Patent No. 10,869,482, which are incorporated herein by reference in their entireties.
[0016] As used herein, the term "muscodor strain" refers to any muscodor strain from any Muscodor subspecies (Muscodor ssp.), or any combination of strains of Muscodor subspecies. For example, this may include, but is not limited to, the SA-13, MBI-601, 620, Ca22, E6, A3-5, N1-5, 205, N1-25, 100, N6, 21, GBA, 105, 5917A, and / or AR-30 strains of Muscodor albus. In some embodiments, a muscodor strain composition for application according to the present methods is prepared by isolating the whole cell broth at the end of fermentation and applying it to sterilized grain, such as barley. The methods and formulations of the present disclosure can also be used with other muscodor subspecies strains, and these are also contemplated herein. NRRL Accession No. B-50774 is an example of a strain that can be used, and the strain can be prepared as described below or by other known methods for preparing strains of the Muscodor subspecies.
[0017] Muscodor subspecies strains can be prepared according to the following method. In one embodiment, SA-13 was originally isolated in June 2007 in South Africa from the stems of the host plant Prosopis glandulosa Torr. (commonly known as honey mesquite) and identified by Dr. Gary Strobel through microscopy and ITS-5.8s sequencing. MBI-601 material is prepared by applying end-of-fermentation whole-cell broth to sterilized barley by soaking the barley in the end-of-fermentation whole-cell broth. Pearled barley is sterilized by autoclaving for a minimum of 30 minutes and added to excess whole-cell broth obtained at the end of fermentation. The barley is soaked in the whole-cell broth for 18 hours, the excess liquid is removed, and the barley is dried in a biosafety cabinet until the moisture level is below 14%. Batch PP211018-01 was prepared using this process with the addition of 1% w / w molasses and 1% w / w soy flour. Batch C-220303-02 was prepared using the above process without the addition. Other methods, including the use of alternative Muscodor albus strains, infected barley or other grains such as corn, rye, rice, and wheat, are possible and contemplated herein.
[0018] For example, methods can be used that shorten the "soaking" time. The time can typically be from about 5 minutes to about 2 hours, although shorter and longer times can be used as desired. Additionally, the grain can optionally be "treated seed" by adding a small amount of culture directly to the grain (e.g., about 2 mL of culture per 30 grams of grain, or about 4 mL of culture per 30 grams of grain).
[0019] composition The composition may include barley or other grains treated with a whole broth, liquid, or solid culture, or suspension of a Muscodor subspecies strain, such as a Muscodor albus strain or another Muscodor subspecies strain. In one embodiment, the composition includes a Muscodor strain having at least one distinguishing characteristic of the Muscodor albus SA-13 strain, as well as a supernatant, filtrate, and / or extract, or one or more, more particularly a plurality of (i) metabolites, (ii) isolated compounds, or (iii) volatiles, derived from the Muscodor albus SA-13 strain.
[0020] The compositions described above can be formulated in any manner. Non-limiting examples of formulations include, but are not limited to, dry grains such as barley, corn, rye, rice, and wheat, emulsifiable concentrates (EC), wettable powders (WP), soluble liquids (SL), aerosols, ultra-low volume concentrates (ULV), soluble powders (SP), microencapsulated, water-dispersible granules (WDG), flowables (FL), microemulsions (ME), and nanoemulsions (NE). In any of the formulations described herein, the percentage of active ingredient is in the range of 0.01% to 99.99%.
[0021] The composition may be in liquid, gel, or solid form. Solid compositions can be prepared by immersing a solid carrier in a solution of the active ingredient(s) and drying the suspension under mild conditions, such as evaporation at room temperature or vacuum evaporation at 65°C or below. The solid composition may also be dried grain grown using the strain. The composition may further contain a surfactant used for purposes such as emulsifying, dispersing, wetting, spreading, integrating, controlling disintegration, stabilizing the active ingredient, and improving flowability. In certain embodiments, the surfactant is a non-phytotoxic nonionic surfactant, preferably belonging to EPA List 4B. In another embodiment, the nonionic surfactant is polyoxyethylene (20) monolaurate. The concentration of the surfactant can range from 0.1 to 35% of the total formulation, with a preferred range being 5 to 25%. The selection and amount of dispersing and emulsifying agents, such as nonionic, anionic, amphoteric, and cationic dispersing and emulsifying agents, are determined by the nature of the composition and the agent's ability to promote dispersion of the compositions of the present invention.
[0022] The above compositions can be combined with other microorganisms and / or pesticides (eg, nematicides, bactericides, fungicides, insecticides). The microorganisms may include, but are not limited to, agents derived from Bacillus spp., Paecilomyces spp., Pasteuria spp., Pseudomonas spp., Brevacillus spp., Lecanicillium spp., non-Ampelomyces spp., Pseudozyma spp., Streptomyces spp., Burkholderia spp., Trichoderma spp., Gliocladium spp., or other Muscodone strains. Alternatively, the agent may be a natural oil or oil product having nematicidal, fungicidal, bactericidal and / or insecticidal activity (e.g., paraffin oil, tea tree oil, lemongrass oil, clove oil, cinnamon oil, citrus oil, rosemary oil, pyrethrum).
[0023] Additionally, the pesticide may be a monocytofungal agent, including, but not limited to, benzimidazoles, demethylation inhibitors (DMIs) (e.g., imidazoles, piperazines, pyrimidines, triazoles), morpholines, hydroxypyrimidines, anilinopyrimidines, phosphorothiolates, quinone outside inhibitors, and the like. Demethylation inhibitors selected from the group consisting of quinolines, dicarboximides, carboximides, phenylamides, anilinopyrimidines, phenylpyrroles, aromatic hydrocarbons, cinnamic acids, hydroxyanilides, antibiotics, polyoxins, acylamines, phthalimides, benzenoids (xylylalanines), imidazoles, piperazines, pyrimidines, and triazoles (e.g., bitertanol, myclobutanil, penconazole, propiconazole, triadimefon, bromuconazole, cyproconazole, diniconazole, fenbuconazole, hexaconazole, tebuconazole, tetraconazole), myclobutanil, and quinone external inhibitors (e.g., strobilurins). Strobilurins may include, but are not limited to, azoxystrobin, kresoxim-methoyl, or trifloxystrobin. In yet another specific embodiment, the antifungal agent is a quinone, such as quinoxyfen (5,7-dichloro-4-quinolyl 4-fluorophenyl ether). The antifungal agent may also be derived from a Reynoutria extract.
[0024] The fungicide may also be a multi-site non-inorganic chemical fungicide selected from the group consisting of chloronitriles, quinoxalines, sulfamides, phosphonates, phosphites, dithiocarbamates, chloroalkylthios, phenylpyridinamines, and cyanoacetamide oximes.
[0025] As noted above, the composition may further comprise a nematicide, which may include, but is not limited to, chemicals such as organophosphates, carbamates, and fumigants, microbial products such as avermectins, Myrothecium spp., Bacillus firmus, Pasteuria spp., and Paecilomyces spp., and organic products such as saponins and vegetable oils.
[0026] If the composition is applied to seeds, the composition can be applied to the seeds as one or more coatings prior to planting using methods known in the art using one or more seed coatings including, but not limited to, ethylene glycol, polyethylene glycol, chitosan, carboxymethyl chitosan, peat moss, resins and waxes, or chemical fungicides or fungicides with single-site, multi-site, or unknown modes of action.
[0027] The composition can be coated onto conventional seeds as described above. In a specific embodiment, the composition can be coated onto barley seeds. The coated barley seeds can further contain a protein-based ingredient such as milk, whey protein, or a high-protein-based flour derived from rice or wheat, for example, to extend the shelf life of the seeds. Alternatively, the composition can be coated onto genetically modified seeds, such as Liberty Link® (Bayer CropScience), Roundup Ready® seeds (Monsanto), or other herbicide-resistant seeds and / or seeds engineered to be insect-resistant, or seeds "integrated" with two or more genes for herbicide, disease, and insect resistance, or other stresses, such as drought, cold, and salt tolerance traits.
[0028] use As mentioned above, the above-mentioned compositions can be applied using methods known in the art.These compositions can be applied to plants or plant parts and around plants or plant parts, or can be applied to the soil adjacent to plants or plants.For example, infected grains can be placed in the soil adjacent to plants.In this specification, "plants" should be understood to mean all plants and plant groups, such as desired and undesired wild plants or crop plants (including naturally occurring crop plants).
[0029] The composition can be placed in communication with the plant and need not be in direct contact with either the plant or the substrate the plant is growing in. For example, "in communication" can mean that the composition is in a container separate from the plant, but the composition produces volatiles that can reach the plant.
[0030] Crop plants may be plants that can be obtained by conventional plant breeding and optimization methods, by biotechnology and genetic engineering methods, or by a combination of these methods, including transgenic plants and plant cultivars that may or may not be protected by plant breeder's rights. Plant parts are understood to mean all above- and below-ground plant parts and organs, such as shoots, leaves, flowers, and roots, including leaves, needles, stems, trunks, flowers, fruiting bodies, fruits, seeds, roots, tubers, and rhizomes. Plant parts also include, but are not limited to, harvested material, vegetative propagation material, and reproductive propagation material, such as cuttings, tubers, rhizomes, offshoots, and seeds.
[0031] Plants that may be treated include, but are not limited to: (A) staple food crops, which include, but are not limited to: (1) cereals (African rice, barley, durum wheat, einkorn, emmer wheat, finger millet, foxtail millet, large crabgrass, barnyard millet, Japanese barnyard millet, corn, nance, oats, pearl millet, millet, rice, rye, sorghum, Sorghum spp.); spp.), rye, spelt); (2) fruits (e.g., abiu, acerola, achacha, African mangosteen, Alpine currant, ambarella, American gooseberry, American persimmon, apple, apricot, araza, Asian palmyra palm, Asian pear, atemoya, Australian dessert raisin, avocado, azarole, babaco, bael, banana, Barbados gooseberry, bergamot, betel nut, bignay, bilberry, bilimbi, binjai, biriba, bitter orange, black chokeberry, black mulberry, black sapote, blackberry, blueberry, honeysuckle, borojo, breadfruit, murmese grape grape), button mangosteen, cacao, calamandine, canistel, cantaloupe melon, cape gooseberry, cashew nut, cassa banana, cempedak, charichuelo, cherimoya, cherry, Rio Grande cherry, cherry plum, Chinese hawthorn, Chinese white pear, chokeberry, citron, cocona, coconut, coco plum, coffee, Arabica coffee, Robusta coffee, Costa Rican pitahaya, currant, custard apple, date palm, date plum, dog rose, dragon fruit, durian, Elderberry, elephant apple, Ethiopian eggplant, European nettle tree, European wild apple, feijoa, fig, gac, genipap, giant granadilla, gooseberry, gummi, grape, grapefruit, great morinda, green gage, guava, wild pear, hog plum, horned melon, horse mango, giant hogweed, Indian jujube, jaboticaba, jackberry, jackfruit, persimmon, shrimp strawberry, jocote, jujube, kaffir lime, caranda, kaprie apple, keppel apple,Key lime, kitenbila, kiwifruit, korlan, kubal vine, kwini mango, kwaimuk, langsat, large cranberry, lemon, Liberian coffee, longan, loquat, lychee, Malay apple, mamey sapote, mamey apple, mango, mangosteen, mapulan, marang, medlar, melon, mirabelle plum, miracle fruit, monkey jack, molliche palm, mountain papaya, mountain soursop, mulberry, naranjila, Natal plum, northern highbush blueberry, olive, Otaheite gooseberry, oval kumquat, papaya, paraguava, passion fruit, pawpaw, peach, peach palm, pear, pepino, pineapple, pitomba (Eugenia luschnathiana), pitomba (Talisia esculenta) esculenta), plantain, plum, pomegranate, pomelo, pulasan, purple chokeberry, quince, rambutan, ramonchi, raspberry, red chokeberry, red currant, red mulberry, red fruit strawberry guava, rhubarb, rose apple, roselle, safflower, salak, salmonberry, santol, sapodilla, satsuma, sea grape, soncoya, sour cherry, soursop, Spanish lime, Spanish tamarind, star apple, star fruit, strawberry, strawberry guava, strawberry tree, sugar apple, Suriname cherry, sweet briar, sweet granadilla, sweet lime, tamarillo, tamarind, tangerine, tomatillo, tucuma palm, Vaccinium spp.), velvet apple, wampy, watermelon, water rose apple, wax apple, white currant, mulberry, white sapote, white star apple, wolfberry (Lyceum barbarum, Lycium chinense), yellow mombin, yellow pitaya, yellow fruit strawberry, guava, (3) vegetables (e.g., ackee, agat, air potato, Amaranthus spp., American peanut, antroyeva, Armenian cucumber, arracacha,Arrowleaf elephant ear, arrowroot, artichoke, wax gourd, asparagus, avocado, adzuki beans, Bambara groundnut, bamboo, banana, Barbados gooseberry, beet, beetroot, bitter gourd, bitter vetch, bitter leaf, black mustard, black radish, black salsify, blanched celery, breadfruit, broad beans, broccoli, Brussels sprouts, plantain, buttercup squash, butternut squash, cabbage, caigua, calabash, caraway seeds, carob, carrot, cassava, pea, cauliflower, celeriac, celery, celtuce, chard, chayote, chickpea, chicory, chilacayote, chili pepper (Capsicum annuum) annuum), Capsicum baccatum, Capsicum chinense, Capsicum frutescens, Capsicum pubescens, Chinese cabbage, arrowhead, Chinese yam, chives, chufa sedge, cruciferous vegetables, kidney beans, purslane, radish, cowpeas, watercress, cucumber, kale pumpkin, moringa, wild taro, eggplant, elephant jasmine, elephant garlic, endive, ensete, Ethiopian eggplant, Florence fennel, loofah, gac, arugula, garlic, zeocarpa beans, Good King Henry beans, grass peas, groundnuts, guar beans, horse gram, horseradish, hyacinth beans, ice cream Plants, giant taro, purple jasmine, vegetable melon, Jerusalem artichoke, jacamar, jute, kale, kohlrabi, konjac, krato, leek, lentil, lettuce, lima bean, lotus, loofah, maca, corn, mangelwurzel, mashua, moso bamboo, moth bean, mung bean, Chinese cabbage, neem, okra, yam Chickpeas, olives, onions, parsnips, peas, pigeon peas, plantains, patulas, potatoes, pumpkins, squash, quinoa, radishes, rapeseed, red amaranth, rhubarb, loofah, kudzu beans, root parsley, runner beans, rutabaga, sago palm, salsify, leeks, sea kale, shallots, snake gourd, snow peas, sorrel,(4) food crops (e.g., abiu, acerola, achacha, ackee, African mangosteen, African rice, agave, agave, agave, agave slaw ... spp.), ambarella, American gooseberry, American groundnut, American persimmon, antroyeva, apple, apricot, araza, Armenian cucumber, arracacha, arrowleaf elephant ear, arrowroot, artichoke, wax gourd, Asian palmyra palm, Asian pear, asparagus, atemoya, Australian dessert raisin, avocado, azarole, adzuki bean, babaco, bael, Bambara groundnut, bamboo, banana, Barbados gooseberry, barley, beet, beetroot, bergamot, betel nut, bignay, bilberry, bilimbi, binjai, biriba, bitter melon, bitter orange, bittervetch, bitterleaf, black chokeberry, blackcurrant, black mulberry, black trout Turd, black radish, black salsify, black sapote, blackberry, blanched celery, blueberry, honeysuckle, borojo, breadfruit, broad beans, broccoli, Brussels sprouts, plantain, buckwheat, Burmese grapes, buttercup squash, butternut squash, button mangosteen, cabbage, cacao, caigua, calabash, calamandine, canistel, cantaloupe, Cape gooseberry, caraway seeds, carob, carrots, cashew nuts, cassava, field peas, cauliflower, celeriac, celery, celtuce, cempedak, chard, charichuelo, chayote, cherimoya, cherry, Rio Grande cherry, cherry plum, chickpea, chicory, chilacayote,Chili peppers (Capsicum annuum, Capsicum baccatum, Capsicum chinense, Capsicum frutescens, Capsicum pubescens), Chinese cabbage, Chinese hawthorn, arrowhead, white pear, yam, chives, chokeberry, chufasedge, citron, coconut, coconut, cocoplum, coffee, coffee (Arabica and Robusta), cruciferous crops, common beans, purslane, radish, Costa Rican pitahaya, cowpea, watercress, Cucumber, currant, kabocha squash, custard apple, date palm, date plum, dog rose, dragon fruit, moringa, durian, durum wheat, wild taro, eggplant, einkorn, elderberry, elephant apple, elephant yam, elephant garlic, emmer wheat, endive, ensete, Ethiopian eggplant, European nettle tree, European wild apple, feijoa, fig, finger millet, Florence fennel, loofah, foxtail millet, gac, arugula, garlic, genipapo, Zeocarpa bean, Giant Granadilla, Good King Henry, Gooseberry, Gummy, Grape, Grapefruit, Grass pea, Great Morinda, Greengage, Groundnut, Gurmichama, Guar bean, Guava, Hairy crabgrass, Ardisia arbutifolia, Hog plum, Horned melon, Horse gram, Horse mango, Horseradish, Hyacinth bean, Ice plant, Indian barnyard grass, Giant hoken, Indian jujube, Purple jasmine, Vegetable gourd, Jaboticaba, Jackalberry, Jackfruit, Jumble, Japanese barnyard grass, Persimmon, Ebigara strawberry, Jerusalem artichoke, Jokote, Jujube, Jute, Kaffir lime, Kale, Karanda, Kay apple, Keppel apple, Key lime, Kitenbira, Kiwi fruit, Kohlrabi, Konjac, Kolan, Kbalvain, Kulat, Kwini mango, Kwaimuk, Langsat, Large cranberry, Leek, Lemon, Lentil, Lettuce, Liberian coffee, Lima bean, Longan, Loquat, Lotus, Luffa, Lychee, Maca, Corn, Malay apple, Mamey sapote, Mamey apple, Mangelwurzel, Mango,Mangosteen, maplan, marang, mashua, medlar, melon, mirabelle plum, miracle fruit, monk fruit, monkey jack, morriche palm, moso bamboo, moth bean, mountain papaya, mountain soursop, mulberry, mung bean, mushroom, nanse, Chinese cabbage, naranghi, La, Natal plum, neem, northern highbush blueberry, oats, oka, oil palm, okra, mung bean, olive, onion, orange, Otaheite gooseberry, oval kumquat, papaya, paraguava, parsnip, passion fruit, pawpaw, pea, peach, peach palm, pear, pearl millet, pepino, pea, pineapple, pitomba (Eugenia russiana, Thalicia esculenta) kurenta), plantain, plum, patula, pomegranate, pomelo, potato, proso millet, prasang, pumpkin and squash, purple chokeberry, quince, quinoa, radish, rambutan, ramonchi, rapeseed, raspberry, red amaranth, red chokeberry, red currant, red mulberry, red fruit strawberry, guava, rhubarb, loofah, rice, rice bean, root parsley, rose apple, rosé Ru, runner bean, rutabaga, rye, safflower, sago palm, salak, salmonberry, salsify, santol, sapodilla, satsuma, leek, sea kale, sea grape, shallot, snake gourd, snow pea, soncoya, sorghum, sorrel, sour cherry, soursop, soybean, Spanish lime, Spanish tamarind, spelt, spilanthes, spinach, spinach beet, star apple, star fruit Fruits, strawberries, strawberry guavas, strawberry trees, sugar apples, sugar beets, sugarcane, Suriname cherry, sweet briar, sweet granadilla, sweet lime, sweet potato, tamarillo, tamarind, tangerine, taro, tarwi, eggplant, teff, tepary bean, tinda, tomatillo, tomato, peas, tucuma palm, turnip, chervil root, urad beans, Vaccinium spp., velvet apple, wampy, water chestnut (Trapa bicornis, T. natans), water morning glory, watercress, watermelon, water rose apple, wax apple, Welsh onion, West African okra, West Indian gherkin, wheat, white currant, white goosefoot, mulberry, white sapote, white star apple, white yam, winged bean, winter purslane,(B) other food crops, including, but not limited to: (1) herbs (e.g., absinthium, alexander, basil, bay laurel, betel nut, chamomile, chervil, chili pepper (Capsicum annuum)), yacon, yam, yam mei, yam, yellow mombin, yellow pitaya, yellow fruit strawberry guava, zucchini; (2) herbs (e.g., absinthium, alexander, basil, bay laurel, betel nut, chamomile, chervil, chili pepper (Capsicum annuum)); annuum), Capsicum baccatum, Capsicum chinense, Capsicum frutescens, Capsicum pubescens), chili pepper, chives, cissey, common rue, common thyme, coriander, watercress, culantro, curly leaf parsley, dill, epazote, fennel, flat leaf parsley, ginseng, gray santolina, herb hyssop, holy basil, hops, jasmine, kaffir lime, lavender, lemon balm, lemon Basil, lemongrass, lovage, marjoram, mint, oregano, parsley, peppermint, shiso, pot marigold, rooibos, rosemary, sage, shineleaf buckthorn, sorrel, spearmint, summer savory, tarragon, Thai basil, valerian, watercress, wild betel, winter savory, yerba mate; (2) spices (e.g., ajowan, allspice, anise, bay laurel, black cardamom, black mustard, black pepper, capers, caraway seeds, cardamom, chili pepper (Capsicum annuum)); annuum), Capsicum baccatum (C. baccatum), Capsicum chinense (C. chinense), Capsicum frutescens (C. frutescens), Capsicum pubescens (C. pubescens), chili pepper, cinnamon, cloves, Juniper, coriander, cumin, fennel, fenugreek, garlic, ginger, kaffir lime, licorice, nutmeg, oregano, pandan, parsley, saffron, star anise, turmeric, vanilla,(2) medicinal plants (e.g., absinthium, alfalfa, aloe vera, anise, artichoke, basil, bay laurel, betel nut, betel nut, bilberry, black cardamom, black mustard, black pepper, blue gum, borojo, chamomile, caper, cardamom, castor bean, chili pepper, yam, chive, cola nut, common jasmine, common lavender, common myrrh, common rue, coriander, cumin, dill, dog rose, epazote, fennel, fenugreek, gac, garlic, ginger, gray santolina, and aloe) (3) irritants (e.g., betel leaf, betel nut, betel nut, lavender, lemongrass, licorice, lovage, marijuana, marjoram, monk fruit, neem, opium, oregano, peppermint, pot marigold, quinine, red acacia, red currant, rooibos, safflower, sage, shineleaf buckthorn, sorrel, spilanthes, star anise, tarragon, tea, turmeric, valerian, mucuna bean, watercress, white mustard, white sapote, wild betel nut, goji berry (Lyceum barbarum, Lycium chinense), mate tea); (4) irritants (e.g., betel leaf, betel nut, cacao, chili pepper (Capsicum annuum)); annuum, Capsicum baccatum, Capsicum chinense, Capsicum frutescens, Capsicum pubescens), chili pepper, coffee, coffee (Arabica, Robusta), cola nut, khat, Liberian coffee, tea, tobacco, wild betel nut, yerba mate; (4) nuts (e.g., almonds, betel nuts, Brazil nuts, cashew nuts, chestnuts, water chestnuts, coconuts, cola nuts, walnuts, peanuts, hazelnuts, oak, macadamia nuts, nutmeg, paradise nuts, pecan nuts, pistachio nuts, walnuts); (5) edible seeds (e.g., black pepper, Brazil nuts, chilacayote, cola nuts, loofah, lotus, opium, quinoa, sesame, sunflower,(6) vegetable oils (e.g., black mustard, camelina, castor, coconut, cotton, linseed, corn, neem, yellow sage, oil palm, olive, opium, rapeseed, safflower, sesame, soybean, sunflower, tuna, turnip); (7) sugar crops (e.g., Asian palmyra palm, silver date palm, sorghum, sugar beet, sugarcane); (8) pseudocereals (e.g., amaranth, buckwheat, quinoa, red amaranth); (9) aphrodisiacs (e.g., borojo, celery, durian, arugula, ginseng, maca, red acacia, mucuna bean); (C) nonfood categories, including, but not limited to: (1) forage crops and deciduous crops (dodder (1) Fiber crops (e.g., coconut, cotton, ficus, hemp, henequen, jute, kapok, kenaf, flaxseed, abaca, ramie, roselle, sisal, and mulberry); (2) Energy crops (e.g., bluegum, camelina, cassava, corn, rapeseed, sorghum, soybean, sudan grass, sugar beet, sugarcane, and wheat); (3) Alcohol production (e.g., barley, plum, potato, and sausage) (5) dye crops (e.g., chai root, henna, eye, old fustic, safflower, saffron, turmeric); (6) essential oils (e.g., allspice, bergamot, bitter orange, blue gum, chamomile, citronella, clove, common jasmine, common juniper, common lavender, common myrrh, field mint, freesia, gray santolina, herb hyssop, holy basil, incense tree, jasmine, lavender, lemon, marigold, mint, orange, peppermint, pot marigold, spearmint, ylang-ylang); (6) green manures (e.g., alfalfa, clover, lacey phacelia, sunhemp, trefoil,(7) Erosion control (e.g., bamboo, cocoplum); (8) Soil improvement (e.g., lupine, vetch); (9) Cover crops (e.g., alfalfa, lacey phacelia, radish); (10) Botanical insecticides (e.g., jicama, marigold, neem, pyrethrum); (11) Cut flowers (e.g., carnation, chrysanthemum, daffodil, dahlia, freesia, gerbera, marigold, rose, sunflower, tulip); (12) Ornamental plants (e.g., African mangosteen, aloe vera, gooseberry, aster, black chokeberry, breadfruit, calamandine, carnation, banana, castor bean, cherry plum, chokeberry, chrysanthemum, cocoplum, common lavender, crocus, daffodil, dahlia, freesia, gerbera, hyacinth, edulis, jasmine, lace phacelia, lotus, lupine, marigold, mao orchid, opium, purple chokeberry, ramie, red chokeberry, rose, sunflower, tulip, mulberry; (D) trees, including, but not limited to, abelia, almond, apple, apple Ricot, American oak, arborvitae, ash, aspen, azalea, bald cypress, beetle, beetle, beetle, birch, black tupelo, blackberry, blueberry, boxwood, horse chestnut, buddleia, walnut, camellia, catalpa, cedar, cherry, chestnut, coffee tree, Japanese laurel, crab apple, crape myrtle, cypress, dogwood, Douglas-fir, ebony, American elder, elm, fir, forsythia, ginkgo, golden rain tree, hackberry, hawthorn, hazelnut, hemlock, hickory, holly, honey locust, horse chestnut, hydrangea I, juniper, lilac, linden, magnolia, maple, syringa, rowan, oak, olive, peach, pear, pecan, pine, pistachio, sycamore, plum, poplar, pivet, raspberry, redbud, red cedar, redwood, rhododendron, rose of Sharon, sassafras, sequoia, serviceberry, smoketree, soapberry, sourwood, spruce, strawberry tree, wintersweet, sycamore, tulip tree, ciborium, walnut, nettle, willow, winterberry, witch hazel, zelkova; (E) turf,This includes, but is not limited to, Kentucky bluegrass, tall fescue, Bermudagrass, lawngrass, perennial ryegrass, fine fescue (e.g., creeping red, chewings, hard fescue, sheep fescue).
[0032] Plants and plant parts can be treated with the above-described compositions directly or by applying the compositions to their surroundings, habitats, or storage spaces. For example, if infected grain is placed adjacent to a plant, the release of VOCs adjacent to the plant can affect its surroundings. The compositions can also be applied to soil using methods known in the art. These include, but are not limited to, (a) drip irrigation or chemical irrigation, (b) soil incorporation, and (c) seed treatment. For example, Muscodor albus strains can be incorporated into soil at the desired rate. The above-described compositions, cultures, supernatants, metabolites, and compounds can be used as growth promoters, alone or in combination with one or more of the above-described insecticides, and can be applied to the above-described plants, plant parts, plant growth substrates, or seeds.
[0033] The compositions, cultures, supernatants, metabolites and compounds described above can be combined with other enhancing compounds for the compositions, such as, but not limited to, amino acids, chitosan, chitin, starch, hormones, minerals, synergistic microorganisms to enhance efficacy and promote benefit to the plant. [Example]
[0034] Test 1. Effect of Muscodor albus on growth promotion of lettuce To determine the effect of Muscodor albus on promoting lettuce growth, four treatment groups were performed in two separate environments. For Group 1, the untreated control, plants were placed in a separate environment (using a plant growth chamber obtained from Conviron®) to avoid contact with the plants or Muscodor albus volatiles. For each treatment group, nine pots (88.9 mm (3.5 in)) were filled with a 50:50 mixture of autoclaved sand and a standard potting soil mixture (45% topsoil-river sand, 5% vermiculite, 35% peat moss, and 15% perlite). The following treatments were incorporated into the soil for each treatment group:
[0035] [Table 1]
[0036] The additive was mixed into the soil, flooded with water, and placed in a Conviron® plant growth chamber (28°C, 16 hours light, 8 hours dark). Treatments were separated into separate environments to prevent crosstalk. Conviron® 1 contained the UTC plants in group 1, while Conviron® 2 contained the treated neighbors in group 2, the treated (low rate) plants in group 3, and the treated (high rate) plants in group 4. Figure 1 shows the experimental setup for Conviron® 1 and Conviron® 2. After 1 week of incubation, lettuce (Bubba) was directly sown into each pot and thinned to one plant per pot 7 days after sowing.
[0037] One of the goals of this experiment was to determine the overall growth effect of Muscodor albus strains on lettuce (Muscodor albus strain MBI-601 was used in this particular experiment, but other strains can also be used). Figure 2 shows photographs of each plant in groups 1 through 4 after two weeks. Figure 3 shows the biomass (mm ) of all plants in groups 1 through 4 after four weeks. 3A chart of biomass (units) is shown. Plants were nondestructively scanned using a Phenospex PlantEye multispectral 3D scanner at 2 and 4 weeks after planting. As can be seen from the figures and data presented in Figures 2 and 3, plants directly exposed to MBI-601 (Group 3 "MBI-601 Low Rate" and Group 4 "MBI-601 High Rate") or indirectly exposed to MBI-601 (Group 2 "MBI-601T-Adjacent") showed enhanced growth and increased biomass compared to plants not exposed to MBI-601 (Group 1 "UTC").
[0038] Study 2. Effects of Muscodor albus on tomato growth and gene pathway analysis To determine the effects of Muscodor albus and the gene pathways involved in tomato growth promotion, four treatment groups were established in three separate environments. For each treatment group, six pots (88.9 mm (3.5 inches) deep) were filled with a standard potting soil mixture (45% topsoil-river sand, 5% vermiculite, 35% peat moss, and 15% perlite) and planted with Roma tomato seeds. Plants were thinned 18 days after germination and transferred to a plant growth chamber (28°C, 70% humidity, 16 hours of light, 22°C, 70% humidity, 8 hours of darkness) for 7 days of acclimation. After 7 days, the following treatments were incorporated into the soil for each treatment group:
[0039] [Table 2]
[0040] Figure 4 shows the experimental setup for Conviron® 1-3. For the indirect treatment of Conviron® 2, the plants were not directly treated. A separate treatment pot was placed next to the plants in the pot, so that volatiles produced by the treatment pot contacted the indirectly treated plants only through the leaves.
[0041] For the Conviron® 3 treatment, two sets of plants are measured. The first set (601T) is treated directly with MBI-601. Volatiles can induce plants through root or leaf tissue. The second set (601T-adjacent) is left untreated but placed next to the treated plants (601T) within the same Conviron®. These plants can be induced by MBI-601 volatiles (as indirectly) or by plant-to-plant communication from adjacent treated plants.
[0042] MBI-601 from batch PP211018-01 was used for the MBI-601 treatments. While MBI-601 was used for this particular experiment, it will be understood that other strains of Muscodor albus may also be used. MBI-601 was watered to field capacity. Plants were analyzed using a Phenospex PlantEye multispectral 3D scanner at days 3, 6, and 10 after treatment for replicate 1 and at days 3, 6, and 11 after treatment for replicate 2. Additionally, the fourth compound leaf from the growing tip was harvested and submitted to the Devalle Laboratory (Davis, CA) for plant tissue nutritional analysis.
[0043] One of the objectives of this experiment was to measure the overall growth effects of Muscodor albus on tomato. Figure 5 shows photographs of plants in each treatment group in replicate 1, 3 days after treatment. Figure 6 shows photographs of plants in each treatment group in replicate 1, 6 days after treatment, and Figure 7 shows photographs of plants in each treatment group in replicate 1, 10 days after treatment. Figure 8 shows a chart of the average height of each treatment group in replicate 1, 3, 6, and 10 days after treatment. Figure 9 shows a chart of the average height of each treatment group in replicate 2, 3, 6, and 10 days after treatment. Figure 10 shows the average biomass (mm) of each treatment group in replicate 1, 3, 6, and 10 days after treatment, respectively. 3 A chart of nitrogen levels in leaf tissue at 3 and 6 days after treatment is shown in Figure 11. Leaf nitrogen levels for each treatment group were also measured at 3 and 6 days. Figure 11 shows a chart of nitrogen levels in leaf tissue at 3 and 6 days after treatment for each treatment group.
[0044] As can be seen in the figures and data presented in Figures 5-10, plants directly exposed to MBI-601 ("MBI-601") and indirectly exposed plants ("Indirect" and "MBI-601T Adjacent") showed enhanced growth and increased biomass compared to plants not exposed to MBI-601 ("UTC"). MBI-601-treated plants also had higher nitrogen levels in leaf tissue.
[0045] Another objective of this experiment was to measure the effects of MBI-601 on various gene pathways in tomato, including genes in the systemic acquired resistance (SAR) pathway and the jasmonate pathway. SAR is a long-distance signaling mechanism that provides broad and durable resistance to secondary infection throughout the plant. This unique feature makes SAR a desirable trait in crop production. Jasmonic acid and jasmonates (JA) are also involved in the regulation of important growth and developmental processes. JA can effectively mediate responses to environmental stress by inducing the expression of a series of genes.
[0046] Tissue samples (100 mg) for qPCR-based gene expression analysis were collected from plants in replicate 1 and snap-frozen in liquid nitrogen on days 3, 6, and 10. Total RNA was extracted using the Qiagen RNAeasy Plant Mini Kit (Germany). Total RNA (1 μg) was converted to cDNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA). Gene expression analysis was performed on the cDNA using primers for the gene targets listed in Table 1. Quantitative reverse transcription was performed using PerfeCTa SYBR Green FastMix (Quantabio, Beverly, MA) (10 μl PerfeCTa SYBR Green FastMix, 2 μl cDNA, 250 mM forward primer, 250 mM reverse primer, and water to a final volume of 20 μl) in a BioRad CFX96 thermocycler (Hercules, CA) under the following cycling conditions: initial denaturation for 30 seconds at 95°C; 40 cycles of 5 seconds at 95°C and 30 seconds at 60°C; 10 minutes at 72°C extension and a melting curve from 65°C to 95°C in 0.5°C increments. Gene expression analysis was performed in 2 -ΔΔCt This was carried out using the method (Livak and Schmittgen 2001).
[0047] [Table 3]
[0048] <SequenceData?sequenceIDNumber="1"> <insdseq> <INSDSeq_length> 21< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..21< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q2"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> aacgctcacaatgcagctcgt< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="2"> <insdseq> <INSDSeq_length> 20< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q4"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> aaggtccaccagagtgttgc< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="3"> <insdseq> <INSDSeq_length> 18< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..18< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q6"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gggaaagatagcagcacg< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="4"> <insdseq> <INSDSeq_length>21< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..21< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q8"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>gtccacacaaacacacacatc< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="5"> <insdseq> <INSDSeq_length> 22< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..22< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q10"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> cgcagggaatagaggtttggag< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="6"> <insdseq> <INSDSeq_length>24< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..24< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q12"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>agcactctcttccaagtacacacc< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="7"> <insdseq> <INSDSeq_length> 22< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..22< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q14"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gcttagtaccacaggtgaaggc< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="8"> <insdseq> <INSDSeq_length> 22< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..22< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q16"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> tggagcacaacagtctcaacag< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="9"> <insdseq> <INSDSeq_length> 20< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q18"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gcaacaacctgtccatacacc< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="10"> <insdseq> <INSDSeq_length>20< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..20< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q20"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>agactccaccaccaatcacc< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="11"> <insdseq> <INSDSeq_length> 22< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..22< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q22"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gactggtccaagttcacgatcc< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="12"> <insdseq> <INSDSeq_length> 25< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..25< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q24"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> atgtgctgccaatataaatggttcc< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="13"> <insdseq> <INSDSeq_length> 22< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..22< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q26"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> ttggcttagcagttgttgaaag< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="14"> <insdseq> <INSDSeq_length>22< / INSDSeq_length> <INSDSeq_moltype>DNA< / INSDSeq_moltype> <INSDSeq_division>PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..22< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q28"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence>tacgtatcgtggctgtgttaca< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="15"> <insdseq> <INSDSeq_length> 25< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..25< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q30"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> ggtggaagacaagtggttggaacac< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="16"> <insdseq> <INSDSeq_length> 24< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..24< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q32"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> cgtctggctgaacaaaaggattgg< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="17"> <insdseq> <INSDSeq_length> 22< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..22< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q34"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> atggagttttgagtctctgc< / INSDSeq_sequence> < / insdseq> <SequenceData?sequenceIDNumber="18"> <insdseq> <INSDSeq_length> 19< / INSDSeq_length> <INSDSeq_moltype> DNA< / INSDSeq_moltype> <INSDSeq_division> PAT< / INSDSeq_division> <INSDSeq_feature-table> <insdfeature> <INSDFeature_key>source< / INSDFeature_key> <INSDFeature_location>1..19< / INSDFeature_location> <INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name> <INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <INSDQualifier?id="q36"> <INSDQualifier_name>organism< / INSDQualifier_name> <INSDQualifier_value>Solanum lycopersicum< / INSDQualifier_value> < / INSDFeature_quals> < / insdfeature> < / INSDSeq_feature-table> <INSDSeq_sequence> gctgcgtttctggcttagg< / INSDSeq_sequence> < / insdseq>
[0049] Tissue samples (100 mg) for RNAseq analysis were collected from replicate 2 plants and flash-frozen in liquid nitrogen on days 3, 6, and 10. Total RNA was extracted using the Qiagen RNAeasy Plant Mini Kit (Germany). mRNA was isolated using the NEBnext™ Poly(A) mRNA Magnetic Isolation Module in combination with the NEBnext™ Ultra II Directional RNA Library Prep Kit (Ipswich, MA). Sequencing libraries were sequenced on a single NovaSeq S4 lane. The total yield was 1.1 billion reads (approximately 22 million reads per sample), exceeding 341 Gb. The Solanum lycopersicum genome assembly and annotation for SL3.0 was downloaded from RefSeq (accession number GCF_000188115.4) and used as a reference. Data were processed through an in-house analysis pipeline using the following packages: Trimmomatic, Bowtie2, and Subread feature, which trim adapter sequences, map reads to the reference genome, and generate count tables for each gene in the genome. Differential expression analysis was performed in R using the EdgeR and Limma packages. Genes were determined to be significantly overexpressed or underexpressed using a fold change of log2 >1 or <-1 and a p-value cutoff of 0.1. TopGO was used for gene ontology analysis, which determines whether functional groups of genes are enriched. The p-values of GO terms were determined using the elimKS method, and GO terms were determined to be significantly up- or downregulated using a p-value cutoff of 0.05.
[0050] FIG. 12 shows a chart of measured changes in gene expression of the PR-1, NPR1, Chi, Ch5, and PR-5 genes of the systemic acquired resistance pathway in each treatment group at days 3, 6, and 10 post-treatment for replicate 2.
[0051] FIG. 13 shows a chart of measured changes in gene expression of LoxD and Opr3 genes in the jasmonate pathway in each treatment group at days 3, 6, and 10 after treatment for Replicate 2.
[0052] Another objective of this experiment was to determine the effect of Muscodor albus on the microbiota of treated plants. Specifically, the expression levels of microbial pathways were upregulated in Muscodor albus-treated plants, and genes were overexpressed in the rhizosphere microbial community of Muscodor albus-treated plants.
[0053] Rhizosphere microorganisms were isolated from tomato plants 14 days after treatment and immediately frozen. Briefly, tomato roots were carefully removed from the soil, friable soil removed, and sonicated three times in sterile 1x phosphate-buffered saline. The soil from each sonication step was collected by centrifugation, pooled, and flash-frozen in liquid nitrogen. Total RNA was extracted from the soil pellet using the Qiagen RNeasy PowerSoil Total RNA Kit (Germany). Illumina sequencing libraries were prepared from ribosomal-depleted RNA and sequenced on the Illumina NovaSeq platform. Data were processed using MG-RAST (mg-rast.org), and reads were mapped to various databases (KEGG, Subsystems, Silva SSU, Refseq). EdgeR was used to identify pathways significantly upregulated in the rhizosphere using cutoff values of log2FC>1, p<0.05, and FDR<0.05.
[0054] Figure 14 summarizes findings regarding the expression levels of upregulated microbial pathways in the rhizosphere of MBI-601-treated plants 14 days after treatment. Figure 15 is a chart showing the number of genes overexpressed by the microbial community in the rhizosphere of MBI-601-treated plants 14 days after treatment. Figures 16 and 17 show the relative abundance of various bacteria in the rhizosphere of treated (MBI-601) and untreated (UTC1-3) plants.
[0055] Test 3. Effect of Muscodor albus on plant growth promotion of strawberry Four pots (29.2 cm (11.5 in)) per treatment were filled with 75% standard potting soil mix (45% topsoil-river sandy soil, 5% vermiculite, 35% peat moss, 15% perlite) and 25% sand. Six separate treatments were tested: an untreated control at low and high irrigation conditions, MB-601 treatments applied at field rates at low and high irrigation conditions, and MB-601 treatments applied at semi-field rates at low and high irrigation conditions.
[0056] [Table 4]
[0057] MBI-601 (Batch C-220303-02) was applied at a field application rate of 1.3 g / pot (4046.86 m 2 (equivalent to 56.7 kg (125 lbs) per acre), and 0.65 g / pot (4046.86 m) for MN-601 at semi-field rates. 2 MBI-601 was incorporated into the soil at a rate equivalent to 62.5 pounds (28.35 kg) per acre. MBI-601 was initially watered to field capacity and incubated under greenhouse conditions for 7 days. After 7 days, Albion strawberries were transplanted (one plant per pot) and maintained under normal / high irrigation conditions (2 gallons (7.57 L) / day) or low irrigation conditions (1 gallon (3.785 L) / day). Plants were analyzed using a Phenospex PlantEye multispectral 3D scanner at the time of transplanting and weekly thereafter for 6 weeks. After 4 weeks, total fruit and flower counts were also performed.
[0058] One of the goals of this experiment was to measure the effect of Muscodor albus on the fruit and flowers and biomass of strawberry plants. Figure 18 shows photographs of plants in each treatment group after 4 weeks. Figure 19 shows the biomass (mm 319 shows a chart of biomass (units). The data on the left side of Figure 19 shows biomass for plants with low irrigation rates, and the data on the right shows biomass for plants with high irrigation rates. "0" shows the untreated control, "0.5" shows MB-601 applied at a half-field rate, and "1" shows MB-601 applied at a field rate. Figure 20 summarizes the same data as Figure 19, with plants at both irrigation rates combined on one graph.
[0059] Figure 21 shows a graph of the combined number of flowers and fruits on plants after 4 weeks for each treatment group. No fruits or flowers were observed on UTC plants at either low or high irrigation. As can be seen from the figures and data shown in Figures 18-21, plants directly exposed to Muscodor albus and irrigated at either low or high irrigation rates showed increased fruit and flowers compared to plants not exposed to Muscodor albus (Group 1, "UTC"). Muscodor albus appears to induce both early flowering and increased biomass in plants.
[0060] Study 4. Field evaluation of Muscodor albus foliar nutrient accumulation, fresh biomass yield, and soil PLFA analysis in broccoli A field trial was conducted to determine the effects of Muscodor albus on leaf nutrient accumulation, fresh biomass yield, and phospholipid fatty acid (PFLA) content of soil samples. Various batches / lots of Muscodor albus treatments were prepared and applied to the field. All batches were prepared using (a) Great River Organic Milling unmalted / pearl barley, (b) MA'AM-11 unadjusted pH fermentation or shake flasks (with aging), and (c) a 1 kg preparation. For all four lots, the unmalted pearl barley was sterilized for a minimum of 30 minutes before adding the whole-cell broth from fermentation. For all four lots, the barley was dried in a biosafety cabinet after adding the whole-cell broth to a moisture level of less than 14% as measured by a grain moisture meter.
[0061] [Table 5]
[0062] Lot 5-S2H was prepared using end-of-fermentation whole-cell broth without pH adjustment. Sterilized barley was soaked for 2 hours, after which excess liquid was removed and dried. Lot 5-ST-L was prepared as a seed treatment using sterilized barley as "seed" and adding 2 mL of end-of-fermentation whole-cell broth without pH adjustment per 20 g of sterilized barley. Lot 5-ST-H was prepared in the same manner as 2022110-ST-L, but with a higher application rate of 4 mL of end-of-fermentation whole-cell broth without pH adjustment per 20 g of sterilized barley. Lot 2-R was prepared using another whole-cell broth fermentation with unadjusted pH, but with added amino acids (niacin 0.3 g / L, thiamin hydrochloride 0.3 g / L, L-valine 1.3 g / L, and threonine 1.2 g / L). Sterilized barley was briefly soaked in whole cell broth supplemented with amino acids for 5 min, after which excess liquid was removed and the barley was dried.
[0063] The treatment field was divided into 1.8 meter (6 foot) plots with 0.15 meter (1 / 2 foot) on each side for boundaries. The treatment field layout is shown in Figure 22. Treatments were applied to the following plots of the field at the following rates:
[0064] [Table 6]
[0065] Test dates included: (1) November 10, 2022, when each batch lot was prepared according to the table above; (2) November 23, 2022, when each treatment batch was manually applied to the soil and irrigated; (3) November 30, 2022, when broccoli (variety Green Magic) was transplanted into the field; (4) January 27, 2023, when plant stand counts were performed; (5) January 25, 2023, when mid-season leaf nutrient analysis was performed; (6) April 12, 2023, when broccoli live biomass analysis was performed; (7) April 13, 2023, when broccoli post-harvest leaf nutrient analysis was performed; and (8) April 19, 2023, when bulk soil was sampled for PLFA testing.
[0066] Harvest was conducted on April 12, 2023, to determine broccoli fresh biomass analysis (leaf and head weight). Three representative plants were taken from each plot and fresh biomass was collected. This was repeated three times. Selected plots are highlighted in gray in Figure 23. Figures 24-26 show the results of the high application rate (4046.86 m in Figure 24) compared to the control (UTC is the untreated control). 2 (56.7 kg (125 lb) per acre), medium application rate (Figure 25, 4046.86 m 2 (38.556 kg (85 lb) per acre), and low application rates (Figure 26, 4046.86 m 2 Figure 1 shows the total average biomass (in grams) of broccoli treated with various treatments of Muscodor albus formulations at 22.7 kg (50 lbs) per acre. Average biomass refers to the weight of leaf tissue in the broccoli and the entire aboveground part. The average biomass for UTC was 2800 g, but exceeded 3000 g for all Muscodor albus treatments. The average biomass for low and medium treatments (4046.86 m, respectively) was 1.25 g. 2 22.7 kg (50 lb) and 4046.86 m per acre 2The immersion treatment (5-S2H) at both rates (38.556 kg (85 lb) per acre) resulted in the highest average biomass of 4000 g, at least 40% higher than UTC. Other Muscodor albus treatments generally had biomass increases of 18-30%. There was no correlation between application rate and biomass, and high application rates often had the lowest effect per treatment.
[0067] The average head formation was also measured and Figures 27-29 show the effect of high application rates of Muscodor albus formulations (Figure 27, 4046.86 m) on various treatments compared to the control (UTC is the untreated control). 2 (56.7 kg (125 lb) per acre), medium application rate (Figure 28, 4046.86 m 2 (38.556 kg (85 lb) per acre), low application rate (Figure 29, 4046.86 m 2 Figure 1 shows the overall average head size (in grams) for broccoli treated at 22.7 kg (50 lb) per acre. A similar trend was observed when measuring only the raw head weight of the broccoli, which was 800 g for UTC and approximately 1100 g for the medium and low soaking rates. Interestingly, the high soaking rate resulted in head weights very close to UTC, which explains the difference in head weight from the soaking treatment (4046.86 m). 2 The results suggest that 56.7 kg (125 lbs) per acre had no yield benefit, whereas lower application rates did have a benefit. Most other treatments had increases in the range of 50 g to 150 g.
[0068] Additionally, leaf nutrient analyses were performed mid-season and one day after harvest. Mid-season leaf nutrient analyses were performed at the end of January to examine the effect of 601 application rate and treatment method on nutrient accumulation in the newest, fully developed leaves. Tissues were sent to the Dellavalle Laboratory for analysis. Guidelines were provided for each crop:
[0069] [Table 7]
[0070] In the macronutrient profile of broccoli, nitrogen and phosphorus were significantly higher in the rinse treatment (2-R) and the seed treatments (5-ST-L and 5-ST-H) at low application rates (4046.86 m 2 (22.7 kg (50 lb) per acre) treatment was higher. Leaf micronutrient profiles showed no significant increases with the Muscodor albus treatment, although iron tended to be higher. Summarizing the key findings of the mid-season leaf nutrient analysis, the Muscodor albus treatment had crop-specific increases in: (1) nitrogen, which is essential for high yield because broccoli requires an early nitrogen supply for maximum leaf growth; and (2) phosphorus, which is important during the early growing period, especially for root growth and flowering.
[0071] The day after harvest analysis, the most newly grown leaves (at least 10 leaves per treatment were pooled) were collected from the remaining plants and sent to the Dellavalle Laboratory for analysis. Figures 30-32 show the effect of high application rates (Figure 30, 4046.86 m) of various treatments of Muscodor albus formulations compared to the control (UTC is the untreated control). 2 (56.7 kg (125 lb) per acre), medium application rate (Figure 31, 4046.86 m 2 (38.556 kg (85 lb) per acre), and low application rates (Figure 32, 4046.86 m 2 The total nitrogen content (%) in broccoli treated with 22.7 kg (50 lb) per acre is shown. No particular trends were observed in terms of application rate and leaf nutrient content.
[0072] Soil health was also measured. In particular, an increase in beneficial microorganisms was observed. Beneficial microorganisms include bacteria, fungi, protozoa, endophytes, mycorrhizal fungi, nitrogen-fixing bacteria, saprophytes, and symbiotic fungi. To analyze soil health, broccoli seedlings were removed on April 19, 2023, and soil samples were taken immediately adjacent to where the roots were 15.24–20.32 cm (6–8 in.) deep. For each treatment, a low application rate (4046.86 m) of broccoli was used. 2 Only 22.7 kg (50 lb) per acre was analyzed. Sampling was performed on three plants per block. After mixing the soil, approximately 200 g was sent to the Ward Laboratory (Kearney, Nebraska) for phospholipid fatty acid (PLFA) analysis. PLFA provides a snapshot of the structure and abundance of viable microorganisms in the soil sample. The analytical process included: (1) lipid extraction from the soil sample with a single-phase chloroform mixture; (2) fractionation using solid-phase extraction columns to isolate phospholipids; (3) methanol analysis of the phospholipids to generate fatty acid methyl esters (FAMEs); and (4) FAME analysis by capillary gas chromatography (GC-FID).
[0073] Figure 33 is 4046.86m 2 Figure 34 shows the diversity index of soil samples taken from the rhizosphere of broccoli plants treated with different Muscodor albus batch formulations at 22.7 kg (50 lb) per acre. Functional diversity encompasses genetic diversity within taxa, as well as the number (richness) and relative abundance (evenness) within taxa and functional groups in the community. All treatments fall within the good category, therefore, Muscodor albus does not adversely affect functional diversity. Figure 34 shows the diversity index of 4046.86 m with different batch formulations of Muscodor albus. 2 The ratio of fungi to bacteria in rhizosphere soil samples from broccoli treated at 22.7 kg (50 lb) per acre.
[0074] The fungal and bacterial composition scale for soil typically ranges from 0 to 1, with 1 representing a highly productive soil with a balanced community. However, this is rare in modern agriculture, where processes such as tillage and fertilization create bacterially dominated soil communities. Conventional soils typically have values between 0.1 and 0.3, characterized by high nitrogen and low carbon content, favoring bacteria that can more efficiently utilize nitrogen. All treatments (>0.35) have a more balanced fungal and bacterial community compared to UTC (0.3–0.35). Therefore, soil fungal composition is a good indicator of soil health and is becoming a growing priority among growers. The table below shows the results of soil irrigation using different formulations of MBI-601. 2 Comparison of bacterial vs. fungal rhizosphere composition in relation to biomass gain from UTC in broccoli treated at 50 lbs (22.7 kg) per acre. This table shows that the STL-L treatment resulted in the most balanced fungal:bacterial community.
[0075] [Table 8]
[0076] Figure 35 is 4046.86m 2 Total viable microbial biomass (ng / g) from rhizosphere soil samples taken from broccoli plants treated with different formulations of Muscodor albus at 50 lb (22.7 kg) per acre is shown. Indicators of total viable microbial biomass include (a) Gram-positive (Actinomycetes) and Gram-negative (Rhizobia) bacteria, (b) fungi (Arbuscular Mycorrhizae and Saprophytes), (c) protozoa, and (d) undifferentiated organisms. All treatments except the high-rate seed treatment (5-STH) increased total viable microbial biomass.
[0077] Figure 36 is 4046.86m 2Figure 36 shows the partitioning of total fungi into arbuscular mycorrhizal fungi and saprophytes in rhizosphere soil samples taken from broccoli plants treated with different formulations of Muscodor albus at 22.7 kg (50 lb) per acre. All Muscodor albus treatments resulted in an increase in total fungal populations, with the immersion samples nearly doubling the fungal population compared to UTC. Both arbuscular mycorrhizal fungi (AM) (shown in the bottom left graph in Figure 36) and saprophytes (shown in the bottom right graph in Figure 36) increased, with saprophytes accounting for the majority of the increase in fungal population. AM fungi play an important role in enabling better nutrient acquisition by the plant, while saprophytes recycle nutrients and prey on soil-dwelling pathogens.
[0078] The above examples are presented to illustrate the embodiments and utilities of the present disclosure and are not intended to limit the present invention unless specifically stated in the claims appended hereto. While the present disclosure provides many details, these should not be construed as limiting any of the claims that follow, but merely as providing illustrations of some embodiments of the elements and features of the disclosed subject matter. Other embodiments of the disclosed subject matter and their elements and features may be devised without departing from the spirit or scope of any of the claims. Features from different embodiments may be combined and used. Accordingly, the scope of each claim is limited only by its express language and its legal equivalents.
Claims
1. 1. A method for increasing plant biomass, comprising applying to the plant and / or seed and / or substrate used to grow said plant an effective amount of a composition comprising a fermentation product of Muscodor albus strain SA-13 (NRRL Accession No. B-50774).
2. 10. The method of claim 1, comprising applying grain inoculated with Muscodor albus strain SA-13 to a substrate used to grow plants.
3. 3. The method of claim 1 or claim 2, wherein the composition comprising Muscodor albus strain SA-13 (NRRL Accession No. B-50774) is prepared by steeping barley in fermented whole cell broth, removing excess liquid, and drying the barley.
4. The method according to any one of claims 1 to 3, wherein the plant is selected from tomato, broccoli, lettuce, corn, and strawberry.
5. 1. A method for increasing the amount of beneficial microorganisms in soil, comprising applying to the soil, to plants growing in the soil, and / or to seeds and / or substrates used to grow plants in the soil, an effective amount of a composition comprising a fermentation product of Muscodor albus strain SA-13 (NRRL Accession No. B-50774).
6. 6. The method of claim 5, comprising applying grain inoculated with Muscodor albus strain SA-13 to a substrate used to grow plants in soil.
7. The method of claim 6, wherein the plant is broccoli.
8. 8. The method of any one of claims 5 to 7, wherein the composition comprising Muscodor albus strain SA-13 (NRRL Accession No. B-50774) is prepared by steeping barley in fermented whole cell broth, removing excess liquid, and drying the barley.
9. 1. A method for inducing early flowering in a plant, the method comprising the step of applying to the plant and / or seed and / or substrate used to grow said plant an effective amount of a composition comprising a fermentation product of Muscodor albus strain SA-13 (NRRL Accession No. B-50774).
10. 10. The method of claim 9, comprising applying grain inoculated with Muscodor albus strain SA-13 to a substrate used to grow plants.
11. 10. The method of claim 9, wherein the composition comprising Muscodor albus strain SA-13 (NRRL Accession No. B-50774) is prepared by steeping barley in fermented whole cell broth, removing excess liquid, and drying the barley.
12. 10. The method of claim 9, wherein the plant is a tomato and / or a strawberry.