Method for predicting skin condition
By measuring DNA damage repair enzyme expression levels in skin samples collected non-invasively, the method predicts skin characteristics for personalized cosmetic suggestions, addressing the limitations of existing methods in quantifying DNA damage repair enzymes for skin aging prevention.
Patent Information
- Application Number
- JP2024107293
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-07-03
- Publication Date
- 2026-01-16
AI Technical Summary
Existing methods fail to quantify DNA damage repair enzymes in the skin and use their expression levels to predict skin properties effectively, limiting the ability to suggest appropriate cosmetic use for preventing or improving skin aging.
A method involving the collection of skin samples using tape strips to measure the expression of genes encoding DNA damage repair enzyme proteins, such as NEIL1, OGG1, PCNA, XPC, XPG, and ERCC1, and using PCR to quantify their mRNA levels for predicting skin characteristics like collagen content, elasticity, wrinkles, and other properties.
Enables non-invasive prediction of skin properties, allowing for personalized cosmetic recommendations based on scientific evidence to prevent or improve skin aging.
Smart Images

Figure 2026007453000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to a method for predicting skin properties. [Background technology]
[0002] As we age, many functions of the body, such as metabolism and physical ability, decline. Until now, aging has been considered a natural phenomenon, something that everyone experiences as the years go by. However, recent research has revealed that aging is a complex process that involves a variety of factors, including genetic predisposition, constitution, lifestyle habits such as diet and exercise, and external environmental factors such as ultraviolet rays and air pollutants.
[0003] When comparing people of the same age, some people show signs of skin aging, such as wrinkles and sagging, while others do not. The causes of these differences in the progression of skin aging are difficult to generalize, as various factors, including genetics and living environment, may be involved. However, if we can predict the progression of skin aging, we can suggest appropriate cosmetic use methods. For example, if it is predicted that a person's skin is likely to darken or develop wrinkles and sagging in the future, careful use of anti-aging pharmaceuticals, quasi-drugs, and cosmetics could potentially prevent or improve skin darkening and wrinkles and sagging.
[0004] Skin, located as the outermost layer of the body, is more susceptible to external stimuli, particularly ultraviolet light, than other parts of the body. UV light induces characteristic base damage, such as cyclobutane pyrimidine dimers (CPDs) and (6-4) photoproducts, at sites where two consecutive pyrimidine bases (cytosine or thymine) are present in DNA (Non-Patent Document 1). When UV-induced DNA damage exceeds the body's ability to repair DNA, it is thought to cause skin aging and cancer (Non-Patent Document 2).
[0005] Several mechanisms for repairing DNA damage are known, including base excision repair (BER), which works to repair chemical modifications of single bases, such as damage caused by reactive oxygen species, alkylating agents, and hydrolysis (Non-Patent Document 3). Oxidative damage caused by reactive oxygen species is the most common type of damage that occurs in the genome, and is primarily repaired by BER.
[0006] Nucleotide excision repair (NER) is a mechanism that repairs DNA damage, primarily caused by UV rays (Non-Patent Document 4). In human cells, this is the mechanism that removes CPD and (6-4) photoproducts from DNA (Non-Patent Documents 5 and 6), and NER is thought to act as a major defense mechanism against UV-induced skin cancer.
[0007] Because DNA damage is fatal to living organisms, there are numerous enzymes that repair it. Examples include NEIL1 (Nei Like DNA Glycosylase 1) and OGG1 (8-Oxoguanine DNA Glycosylase), which have glycosidase activity that cleaves damage during BER; PCNA (Proliferating Cell Nuclear Antigen), which promotes the elongation reaction of DNA polymerase; and XPC (Xeroderma Pigmentosum, Complementation Group C), XPG (Xeroderma Pigmentosum, Complementation Group G), and ERCC1 (Excision Repair Cross-Complementation Group 1), which have endonuclease activity that cleaves damage during NER (Non-Patent Document 7). These repair enzymes work together to repair DNA damage.
[0008] Recent research has revealed that UV irradiation may also cause a decline in the function of enzymes that repair DNA damage caused by UV rays and other factors (Non-Patent Document 8). Because a decline in the function of DNA damage repair enzymes is thought to be one of the factors that accelerate skin aging, quickly restoring the decline in the function of DNA damage repair enzymes caused by UV irradiation is thought to be important for anti-aging.
[0009] To date, methods for predicting skin properties have been reported, such as a method for assessing the degree of skin aging in which a stimulating substance is added to a collagen gel embedded with skin fibroblasts collected by punch biopsy or the like and changes in the force generated in the cells are measured (Patent Document 1), a method for assessing skin age and a method for evaluating cosmetics using Raman spectroscopy (Patent Document 2), and a method for estimating skin age using MRI (magnetic resonance imaging) (Patent Document 3).However, no method is known that quantifies DNA damage repair enzymes in the skin and uses the resulting values as an index to predict skin properties. [Prior art documents] [Patent documents]
[0010] [Patent Document 1] Patent Publication No. 2004-354159 [Patent Document 2] Patent Publication No. 2014-180459 [Patent Document 3] Patent Publication No. 2016-106907 [Non-patent literature]
[0011] [Non-Patent Document 1] Brash DE,Photochem.Photobiol.,48:59-66(1988) [Non-patent document 2] Hadshiew IM et al,Am.J.Contact Dermat.,11:19-25(2000) [Non-patent document 3] Hiroshi Ide et al., Biophysics, 46:263-269(2006) [Non-patent document 4] D'Errico M et al, Cancer Res.,65:432-438(2005) [Non-patent document 5] Mitchell DL et al, Mutat.Res.,143:109-112(1985) [Non-patent document 6] Nishiwaki Y et al,J.Invest.Dermatol.,122:526-532(2004) [Non-Patent Document 7] Li P et al, Neuropharmacology, 134, 208-217(2018) [Non-patent document 8] Maeda T et al,J.Invest.Dermatol.,117,1490-1497(2001) Summary of the Invention [Problem to be solved by the invention]
[0012] The problem to be solved by the present invention is to provide a method for easily predicting skin properties. [Means for solving the problem]
[0013] As a result of intensive research aimed at solving the above problems, the present inventors have found that skin properties can be predicted by examining the expression of genes encoding DNA damage repair enzyme proteins. Furthermore, they have discovered that the expression products of these genes can be easily and non-invasively collected from the skin using tape strips or the like, leading to the completion of the present invention.
[0014] Specifically, the present invention relates to predicting various skin properties such as the collagen content, elasticity, wrinkles / sagging, brightness, melanin content, blood hemoglobin oxygen saturation, uneven skin tone, transepidermal water loss (TEWL), stratum corneum moisture content, and skin surface roughness of the papillary dermis using as an indicator the expression level of mRNA, which is the expression product of a gene encoding a protein of a DNA damage repair enzyme collected from the skin of a test subject using a tape strip or the like.
[0015] The present invention includes the following inventions. [1] A method for predicting skin characteristics based on the DNA damage repair ability of the skin, comprising: (1) quantifying the expression of a gene encoding a DNA damage repair enzyme protein in a skin sample obtained from a test subject; (2) measuring DNA damage repair ability using the gene expression levels measured in step (1); and (3) predicting skin properties based on the DNA damage repair ability calculated in step (2); A skin testing method comprising: [2] The skin testing method described in [1], wherein the quantification of the gene expression is carried out by polymerase chain reaction (PCR). [3] The skin testing method described in [1], wherein the skin sample is keratin collected from the skin of the test subject. [4] The skin testing method described in [1], wherein the DNA damage repair enzyme is one or more enzymes selected from NEIL1, OGG1, PCNA, XPC, XPG and ERCC1. [5] The skin testing method according to any one of [1] to [4], wherein the skin properties are one or more skin properties selected from the collagen amount of the papillary dermis, elasticity, wrinkles / sagging, brightness, melanin amount, blood hemoglobin oxygen saturation, uneven skin tone, TEWL, stratum corneum moisture content, and skin surface roughness. [Effects of the Invention]
[0016] The present invention provides a skin testing method for measuring DNA damage repair ability using the expression level of mRNA, which is the expression product of a gene encoding a protein of a DNA damage repair enzyme in the skin, as an index, and predicting various skin characteristics from the results, such as the collagen amount, elasticity, wrinkles / sagging, brightness, melanin amount, blood hemoglobin oxygen saturation, uneven skin tone, TEWL, stratum corneum moisture content, and skin surface roughness of the papillary dermis. If skin characteristics can be predicted noninvasively, it will be possible to suggest appropriate cosmetic usage methods, which has the advantage of enabling the prevention and improvement of skin aging. [Brief explanation of the drawings]
[0017] [Figure 1] 1 shows a graph illustrating the relationship between DNA damage repair enzymes and collagen levels in the papillary dermis in the cheek skin of 14 female subjects in an experimental example, along with representative images of collagen levels.
[0018] [Figure 2] 1 is a graph showing the relationship between DNA damage repair enzymes and elasticity in the cheek skin of 14 female subjects in an experimental example.
[0019] [Figure 3] 1 shows a graph illustrating the relationship between DNA damage repair enzymes and wrinkles under the eyes in the cheek skin of 14 female subjects in an experimental example, along with representative images of wrinkles.
[0020] [Figure 4] 1 is a graph showing the relationship between DNA damage repair enzymes and brightness in the cheek skin of 14 female subjects in an experimental example.
[0021] [Figure 5] 1 is a graph showing the relationship between DNA damage repair enzymes and melanin levels in the cheek skin of 14 female subjects in an experimental example.
[0022] [Figure 6]1 is a graph showing the relationship between DNA damage repair enzymes and blood hemoglobin oxygen saturation in the cheek skin of 14 female subjects in an experimental example.
[0023] [Figure 7] 1 shows a graph illustrating the relationship between DNA damage repair enzymes and uneven skin tone in the cheek skin of 14 female subjects in an experimental example, along with representative images of uneven skin tone.
[0024] [Figure 8] 1 is a graph showing the relationship between DNA damage repair enzymes and TEWL in the cheek skin of 14 female subjects in an experimental example.
[0025] [Figure 9] 1 is a graph showing the relationship between DNA damage repair enzymes and keratinocyte moisture content in the cheek skin of 14 female subjects in an experimental example.
[0026] [Figure 10] 1 shows a graph illustrating the relationship between DNA damage repair enzymes and skin surface roughness in the cheek skin of 14 female subjects in an experimental example, along with representative images of the roughness. DETAILED DESCRIPTION OF THE INVENTION
[0027] The present invention provides a skin testing method for measuring DNA damage repair ability using the expression level of mRNA, which is the expression product of a gene encoding a protein of a DNA damage repair enzyme in the skin, as an index, and predicting skin properties from the results. In the method for predicting skin properties of the present invention, DNA damage repair ability is measured by quantifying the expression of the gene encoding the protein of the DNA damage repair enzyme using a sample collected from the skin of a subject. Based on the results, various skin properties, such as collagen content, elasticity, wrinkles / sagging, brightness, melanin content, blood hemoglobin oxygen saturation, uneven skin tone, TEWL, stratum corneum moisture content, and skin surface roughness, of the papillary dermis are evaluated. Furthermore, non-invasive evaluation is possible by using stratum corneum as a sample collected using a tape strip or the like.
[0028] In the present invention, "predicting skin properties" means to predict various skin properties such as the amount of collagen in the papillary dermis, elasticity, wrinkles / sagging, brightness, melanin amount, blood hemoglobin oxygen saturation, uneven skin tone, TEWL, stratum corneum moisture content, and skin surface roughness based on scientific evidence.
[0029] In the present invention, the "skin of a subject" refers to skin in a region that is easily exposed to ultraviolet light and relatively susceptible to the effects of photoaging, such as the face, neck, back of the hand, or other regions that are not normally covered by clothing. Alternatively, the "skin of a subject" may be a culture of such a sample (tissue or cell).
[0030] The term "DNA damage repair enzyme" as used herein refers to an enzyme that repairs DNA damage involved in BER or NER, and examples of such enzymes that repair DNA damage involved in BER include NEIL1 (also known as Nei Like DNA Glycosylase 1, FPG1, HFPG1, NEI1, DNA-(Apurinic Or Apyrimidinic Site) Lyase Neil1, DNA Endonuclease Eight-Like Glycosylase 1, DNA Glycosylase / AP Lyase Neil1, Endonuclease VIII-Like 1, Endonuclease 8-Like 1, Nei-Like Protein 1, Nei Homolog 1, FLJ22402, NEH1, Nei Endonuclease VIII-Like 1, Endonuclease VIII), OGG1 (also known as 8-Oxoguanine DNA Glycosylase, OGH1, MUTM, HOGG1, HMMH, 8-Hydroxyguanine DNA Glycosylase), and HOGG1 (also known as 8-Hydroxyguanine DNA Glycosylase, HOGG1 ... Glycosylase, N-Glycosylase / DNA Lyase, DNA-Apurinic Or Apyrimidinic Site Lyase, OGG1 Type 1e, OGG1 Type 1d, OGG1 Type 1g, OGG1 Type 1h, OGG1 Type 1f, AP Lyase, MMH), PCNA (also known as: Proliferating Cell Nuclear Antigen, Cyclin, DNA Polymerase Delta Auxiliary) Protein, ATLD2), NER is XPC (also known as: XPC Complex Subunit, DNA Damage Recognition And Repair Factor, XPCC, RAD4, Xeroderma Pigmentosum,Complementation Group C, DNA Repair Protein Complementing XP-C Cells, P125, Xeroderma Pigmentosum Group C-Complementing Protein, Xeroderma Pigmentosum Group C Protein, Mutant Xeroderma Pigmentosum Group C, XP3), XPG (alias: ERCC5, ERCC Excision Repair 5, Endonuclease, ERCM2, XPGC, Excision Repair Cross-Complementing Rodent Repair Deficiency, Complementation Group 5, Xeroderma Pigmentosum, Complementation Group G, Excision Repair Cross-Complementation Group 5, DNA Repair Protein Complementing XP-G Cells, DNA Excision Repair Protein ERCC-5, Xeroderma Pigmentosum Group G-Complementing Protein, XPG-Complementing Protein, Cockayne Syndrome, ERCC5-201, COFS3, UVDR), ERCC1 (alias: ERCC Excision Repair 1, Endonuclease Non-Catalytic Subunit, RAD10, Excision Repair Cross-Complementing Rodent Repair Deficiency, Complementation Group 1, Excision Repair Cross-Complementation Group 1, DNA Excision Repair Protein ERCC-1, COFS4, UV20), etc. are included.,
[0031] In the present invention, "quantification of gene expression" refers to measuring the expression level of mRNA, which is a transcription product of a gene. Alternatively, the amount of protein, which is an expression product of a gene, may be measured.
[0032] To measure mRNA expression levels, microarray analysis, reverse transcription followed by PCR, and the like can be used. These methods can be performed according to standard procedures. Various protocols have been reported for each method, and those skilled in the art can construct and perform an appropriate measurement system according to a known protocol or by appropriately modifying or altering a known protocol. Details of quantification of gene expression by measuring mRNA expression levels will be described later.
[0033] On the other hand, for measuring protein levels, for example, immunostaining methods using fluorescent substances, dyes, enzymes, etc., Western blotting, immunoassays (e.g., ELISA and EIA), etc. can be used. These methods can also be carried out according to standard procedures. Various protocols have been reported for each method, and those skilled in the art can construct and carry out an appropriate measurement system according to a known protocol or by appropriately modifying or altering a known protocol.
[0034] In the present invention, "keratin" refers to cells in the stratum corneum, which is the outermost layer of skin. By analyzing the expression of genes encoding DNA damage repair enzyme proteins in the stratum corneum, which is the outermost layer of skin, the method for predicting skin properties of the present invention can be easily performed without significantly damaging the skin.
[0035] While the method for collecting stratum corneum from the skin is not particularly limited, it is preferable to employ a non-invasive collection method whenever possible. That is, when collecting stratum corneum, it is desirable to avoid damaging areas other than the stratum corneum, such as the granular layer and the spinous layer, as much as possible. Non-invasive collection methods include, for example, attaching adhesive tape or glue to the skin and then peeling it off, or rubbing the skin surface with a rough material (e.g., nonwoven fabric). The former method is particularly preferred because it can be carried out very easily. Note that there is no particular limitation on the material (adhesive component) used for the adhesive tape or glue, as long as it does not affect the subsequent quantification of gene expression.
[0036] The term "brightness" in the present invention refers to the brightness of a color. * a * b * Color space L * It is expressed as a value in the Munsell color system. Skin brightness decreases with an increase in melanin levels due to sunburn or pigmentation.
[0037] In this invention, "blood hemoglobin oxygen saturation" indicates the percentage of hemoglobin in the blood that is bound to oxygen. Hemoglobin bound to oxygen is called oxyhemoglobin (HbO2), and unbound hemoglobin is called reduced hemoglobin (Hb). HbO2 is bright red, the color of arterial blood, while Hb is dark red, the color of venous blood.
[0038] In the present invention, "uneven skin tone" refers to uneven skin tone caused by localized excess production of melanin pigments and hemoglobin pigments, which determine skin color. The cheeks on the face are known to be areas prone to uneven skin tone such as age spots, freckles, and dullness.
[0039] The method of predicting skin properties of the present invention is preferably carried out by the following series of steps (1) to (4). (1) preparing keratin collected from the skin of a subject; (2) quantifying gene expression using the mRNA extracted from the keratin as a sample, and calculating the expression level of a gene encoding a DNA damage repair enzyme protein; (3) measuring the DNA damage repair ability of the skin using the expression level calculated in step (2); and (4) A step of predicting various skin characteristics, such as the amount of collagen in the papillary dermis, elasticity, wrinkles and sagging, brightness, melanin amount, blood hemoglobin oxygen saturation, uneven skin tone, TEWL, stratum corneum moisture content, and skin surface roughness, based on the DNA damage repair capacity calculated in step (3).
[0040] In step (1), keratin is collected from the skin of a test subject. Preferably, the keratin is collected from the face, which is highly exposed to ultraviolet rays. Specific examples of methods for collecting keratin and extracting RNA are described below. (a) A portion of the stratum corneum, the outermost layer, is peeled off without damaging the stratum granulosum, stratum spinosum, etc. For example, adhesive tape is attached to the skin and then peeled off (repeated several times as necessary) to collect the stratum corneum. (b) The collected keratin is immersed in a lysis buffer containing SLS, β-mercaptoethanol, guanidine isothiocyanate, etc., and then a proteolytic enzyme is added to cause a reaction. (c) After the reaction is completed, the keratin is crushed by physical force, for example, using an ultrasonic crusher. (d) RNA is extracted from the solution containing the keratin fragments using a method based on a known nucleic acid extraction method or a commercially available kit, such as a method using guanidine isothiocyanate, phenol, or chloroform, or a kit such as RNAiso Plus from Takara Bio, ISOGEN from Nippon Gene, TRIzol Reagent or RNAqueous-4PCR Total RNA Isolation Kit from Thermo Fisher Scientific, or RNeasy Kit from QIAGEN. (e) If necessary, DNA is removed by reaction with a DNase. (f) If necessary, concentrate the RNA using a nucleic acid concentration method such as ethanol precipitation.
[0041] In step (2), gene expression is quantified using mRNA extracted from the collected keratin as a sample. The expression level of a specific gene is then calculated by quantifying the gene expression. In this manner, in one aspect of the present invention, gene expression is quantified using the expression level of mRNA remaining in the keratin as an index. In quantifying gene expression, the "expression level of a gene" is calculated as an absolute value or a relative value (such as a ratio or difference from a comparative or standard expression level).
[0042] There are many DNA damage repair enzymes whose expression levels can be examined in quantification of gene expression. For example, NEIL1 and OGG1 encode proteins with glycosidase activity that cleaves DNA damage, PCNA encodes proteins with endonuclease activity that cleaves DNA damage, and XPC, XPG, and ERCC1 encode proteins with endonuclease activity that cleaves DNA damage. Based on the expression results of genes encoding DNA damage repair enzymes, the present inventors successfully evaluated various skin characteristics, such as collagen content, elasticity, wrinkles / sagging, brightness, melanin content, blood hemoglobin oxygen saturation, uneven skin tone, TEWL, stratum corneum moisture content, and skin surface roughness, in the papillary dermis.
[0043] Here, a specific example of a method for quantifying gene expression using mRNA extracted from keratin is shown below.
[0044] RT-PCR method (a) cDNA is synthesized using the extracted RNA as a template with reverse transcriptase. (b) Using the cDNA as a template, a PCR reaction is carried out using primers corresponding to the target gene to obtain a DNA fragment corresponding to the gene of interest. (c) Reactions of genes that serve as internal standards (GAPDH, ACTB, 18SrRNA, etc.) are also carried out in parallel. (d) After electrophoresis of the obtained DNA fragments, staining with ethidium bromide or the like is performed, and the intensity of the band is measured, which is taken as the expression level of the gene. (e) If necessary, perform a quantitative PCR reaction using a fluorescent dye or a fluorescent probe to quantify the expression level. (f) Calculate the ratio of the expression level of the target gene to the expression level of the gene serving as an internal standard.
[0045] In step (3), using the expression level calculated in step (2), measure the DNA damage repair ability. For example, compare the calculated expression level with a preset reference expression level and calculate the ratio. Then, examine which of a plurality of categories associated with the evaluation of the DNA damage repair ability the ratio corresponds to. Specific examples regarding the setting of the categories are shown below. (Example 1) DNA damage repair ability (low): ratio < a, (moderate): a ≤ ratio < b, (high): b ≤ ratio
[0046] In (Example 1), the number of categories is set to 3, but the number of categories is not particularly limited. For example, the number of categories can be any of 2 to 10. The number of categories and the range of values of the reference expression level associated with each category can be arbitrarily set based on the results of preliminary experiments.
[0047] In step (4), predict various skin properties such as the amount of collagen, elasticity, wrinkles and sagging, lightness, amount of melanin, blood hemoglobin oxygen saturation, color unevenness, TEWL, amount of horny layer moisture, and roughness of the skin surface from the DNA damage repair ability calculated in step (3). Specific examples regarding the setting of the categories are shown in (Example 2) to (Example 11). (Example 2) Amount of collagen in the dermal papilla layer (low): low expression level of the gene of the DNA damage repair enzyme, (moderate): moderate expression level of the gene of the DNA damage repair enzyme, (high): high expression level of the gene of the DNA damage repair enzyme (Example 3) Elasticity (low): low expression level of the gene of the DNA damage repair enzyme, (moderate): moderate expression level of the gene of the DNA damage repair enzyme, (high): high expression level of the gene of the DNA damage repair enzyme (Example 4) Wrinkles and sagging (severe): low expression level of the gene of the DNA damage repair enzyme, (moderate): moderate expression level of the gene of the DNA damage repair enzyme, (mild): high expression level of the gene of the DNA damage repair enzyme (Example 5) Brightness (low): Low expression of DNA damage repair enzyme genes, (medium): Medium expression of DNA damage repair enzyme genes, (high): High expression of DNA damage repair enzyme genes (Example 6) Melanin amount (high): low expression of DNA damage repair enzyme genes, (moderate): medium expression of DNA damage repair enzyme genes, (low): high expression of DNA damage repair enzyme genes (Example 7) Blood hemoglobin oxygen saturation (low): low expression of DNA damage repair enzyme genes, (medium): medium expression of DNA damage repair enzyme genes, (high): high expression of DNA damage repair enzyme genes (Example 8) Color unevenness (high): Low expression of DNA damage repair enzyme genes, (medium): Medium expression of DNA damage repair enzyme genes, (low): High expression of DNA damage repair enzyme genes (Example 9) TEWL (high): low expression of DNA damage repair enzyme genes, (medium): medium expression of DNA damage repair enzyme genes, (low): high expression of DNA damage repair enzyme genes (Example 10) Moisture content of stratum corneum (low): low expression of DNA damage repair enzyme genes, (moderate): medium expression of DNA damage repair enzyme genes, (high): high expression of DNA damage repair enzyme genes (Example 11) Skin surface roughness (rough): low expression of DNA damage repair enzyme genes, (moderate): medium expression of DNA damage repair enzyme genes, (not rough): high expression of DNA damage repair enzyme genes
[0048] In Examples 2 to 11, the number of categories is 3. There is no particular limitation on the number of categories, but if there are too many categories, it becomes difficult to discern differences in various skin properties such as the amount of collagen in the papillary dermis, elasticity, wrinkles / sagging, brightness, melanin amount, blood hemoglobin oxygen saturation, uneven skin tone, TEWL, stratum corneum moisture content, and skin surface roughness, so the number of categories is preferably about 2 to 5.
[0049] The results obtained in steps (1) to (4) above can be used to suggest how to use cosmetics. For example, if it is predicted that a person's skin is prone to darkening or wrinkles and sagging, careful use of anti-aging drugs, quasi-drugs, and cosmetics can be expected to prevent or improve skin darkening and wrinkles and sagging. Another advantage is that appropriate drugs, quasi-drugs, and cosmetics can be suggested for people who are unsure of what cosmetics to use in the future. This evaluation method is highly objective and reliable because it is based on scientific evidence, such as the expression level of genes related to DNA damage repair enzymes in the skin. [Example]
[0050] In order to effectively explain the present invention, experimental examples will be given below, but the present invention is not limited thereto.
[0051] Experimental example: Measurement of the expression level of genes encoding proteins for DNA damage repair enzymes in the skin, and analysis of skin properties 1. Extraction of RNA from stratum corneum The cheeks of 14 female subjects (37-52 years old, AV 44.4 years old) were washed with facial cleanser and dried. Afterwards, adhesive tape (2cm x 2cm, Nichiban Co., Ltd.) was applied to each cheek using a tape strip, and keratin was removed. Total RNA was extracted from the keratin-adhered adhesive tape using RNAiso Plus (Takara Bio Inc.). The adhesive tape was placed in RNAiso Plus to remove the keratin, and then dispersed using an ultrasonic homogenizer. The tape was then removed, and total RNA was extracted. Two adhesive tapes were obtained per subject, one on each side, and both were placed in the same RNAiso Plus solution to extract a single sample.
[0052] 2. PCR analysis of RNA contained in stratum corneum mRNA expression levels were measured by real-time RT-PCR using total RNA extracted from cells. The QuantAccuracy RT-RamDA cDNA Synthesis Kit and THUNDERBIRD Next SYBR qPCR Mix (all from TOYOBO) were used. Specifically, total RNA was reverse transcribed and amplified, followed by PCR (95°C for 5 seconds, 60°C for 30 seconds, 50 cycles). Other procedures were performed according to established protocols. Expression levels of the DNA damage repair enzymes NEIL1, OGG1, PCNA, XPC, XPG, and ERCC1 were calculated as a ratio to the expression levels of the internal standards GAPDH, ACTB, or 18S rRNA. The average expression level of each gene across all subjects was set to 1.00.
[0053] Primer set for NEIL1 CTATGTTTCGTGGACATCCG (SEQ ID NO: 1) TAGCACATTCTCCCTGAACTG (SEQ ID NO: 2) Primer set for OGG1 AGAAATTCCAAGGTGTGCGA (SEQ ID NO: 3) GTAGGTGACATCATCAAGCTG (SEQ ID NO: 4) Primer set for PCNA GGAGATGCTGTTGTAATTTCCT (SEQ ID NO: 5) ATCTCTATGGTAACAGCTTCCTC (SEQ ID NO: 6) XPC primer set CTGCCATCCTTGGGTATTGT (SEQ ID NO: 7) GCCTCACCACTCTTGCTTTC (SEQ ID NO: 8) XPG primer set GAAGCAATGCCAGAGGAGTC (SEQ ID NO: 9) CGGATGTGTCCTGAATGTTG (SEQ ID NO: 10) Primer set for ERCC1 AGGTGGATGTGAAAGATCCC (SEQ ID NO: 11) CTCATAGGCCTTGTAGGTCTC (SEQ ID NO: 12) Primer set for GAPDH TGCACCACCAACTGCTTAGC (SEQ ID NO: 13) TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 14) Primer set for ACTB CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 15) GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 16) Primer set for 18S rRNA CCGAGCCGCCTGGATAC (SEQ ID NO: 17) CAGTTCCGAAAACCAACAAAATAGA (SEQ ID NO: 18)
[0054] 3. Measurement of collagen content in the papillary dermis The right cheek of the same female subject as in the above experimental example was photographed using an ultrasonic dermal imaging device, DermaLab (Cortex Technology), and the amount of collagen in the papillary dermis was calculated from the cross-sectional images obtained by quantitative analysis of image brightness.
[0055] The results of the cheek DNA damage repair enzyme mRNA expression levels and collagen levels, along with representative images, are shown in Figure 1. It was speculated that the mRNA expression levels of DNA damage repair enzymes (NEIL1, OGG1, PCNA, XPC, XPG, ERCC1) were positively correlated with the collagen levels in the papillary dermis. In other words, it was thought that higher mRNA expression levels of DNA damage repair enzymes in the cheek were associated with higher collagen levels in the papillary dermis in the cheek.
[0056] 4. Elasticity measurement The right cheek of the same female subject as in the above experimental example was measured using a viscoelasticity measuring device, Cutometer MPA580 (Courage+Khazaka), and the net elasticity (R5) was calculated.
[0057] The results for cheek DNA damage repair enzyme mRNA expression levels and net elasticity (R5) are shown in Figure 2. It was speculated that the mRNA expression levels of the DNA damage repair enzyme (NEIL1) were positively correlated with R5. In other words, it was thought that higher cheek DNA damage repair enzyme mRNA expression levels were associated with higher cheek elasticity.
[0058] 5. Wrinkle measurement A replica was taken from the area below the right eye of the same female subject as in the above experiment using the replicating agent SILFLO (Amic Group Co., Ltd.).The maximum depth of the maximum wrinkle was then calculated using stereomicroscope image analysis in accordance with the guidelines of the Japanese Cosmetic Science Society (Reference 1: Motoki Oguri, Journal of the Cosmetic Science Society, 32, 123-129 (2008)).
[0059] The results for the mRNA expression level of DNA damage repair enzymes in the cheek and the maximum depth of maximum wrinkles around the right eye are shown in Figure 3. It was speculated that the mRNA expression level of DNA damage repair enzymes (NEIL1) was negatively correlated with the maximum depth of maximum wrinkles. In other words, it was thought that when the mRNA expression level of DNA damage repair enzymes in the cheek was high, the wrinkles around the right eye were milder.
[0060] 6.Lightness (L * Measurement of (value) The right cheek of the same female subject as in the above experiment was measured for spectral reflectance using a spectrophotometer CM-2600d (KONICA MINOLTA), and the lightness (L * value) was calculated.
[0061] The brightness (L) calculated based on the mRNA expression level of DNA damage repair enzymes in the cheek and spectral reflectance * The results of the lightness (L value) are shown in Figure 4. The mRNA expression levels of DNA damage repair enzymes (NEIL1, OGG1, XPC, ERCC1) were correlated with the lightness (L * It was predicted that there is a positive correlation with the cheek lightness (L value). In other words, the higher the mRNA expression level of DNA damage repair enzymes in the cheek, the higher the cheek lightness (L value). * value) was considered to be high.
[0062] 7. Measuring melanin levels The spectral reflectance of the right cheek of the same female subject as in the above experimental example was measured using a spectrophotometer CM-2600d, and the amount of melanin was calculated {Reference 2: Wan S et al., Photochem. Photobiol., 34, 493-499 (1981); Reference 3: Masuda Y. et al., Journal of Cosmetic Technology, 35, 325-332 (2001)}.
[0063] Figure 5 shows the results of calculating the amount of melanin based on the mRNA expression levels of DNA damage repair enzymes in the cheek and spectral reflectance. It was speculated that the mRNA expression levels of DNA damage repair enzymes (NEIL1, ERCC1) were negatively correlated with the amount of melanin. In other words, it was thought that when the mRNA expression levels of DNA damage repair enzymes in the cheek were high, the amount of melanin in the cheek was low.
[0064] 8. Measurement of blood hemoglobin oxygen saturation The spectral reflectance of the right cheek of the same female subject as in the above experimental example was measured using a spectrophotometer CM-2600d, and the blood hemoglobin oxygen saturation was calculated (References 2 and 3).
[0065] Figure 6 shows the results of blood hemoglobin oxygen saturation calculated based on the mRNA expression levels of DNA damage repair enzymes in the cheek and spectral reflectance. It was speculated that the mRNA expression levels of DNA damage repair enzymes (NEIL1, OGG1, PCNA) were positively correlated with blood hemoglobin oxygen saturation. In other words, it was thought that if the mRNA expression levels of DNA damage repair enzymes in the cheek were high, the blood hemoglobin oxygen saturation in the cheek would be high. Hemoglobin turns bright red when it binds with oxygen, which is thought to result in a vibrant, rosy skin color.
[0066] 9. Measurement of color unevenness The right cheek of the same female subject as in the above experimental example was scored for uneven skin tone using the method described in JP 2022-20117 (calculated on a scale of 100 points, with the greater the unevenness, the higher the score, and conversely, the less uneven the skin tone, the closer to 100 points).
[0067] Figure 7 shows the mRNA expression levels of DNA damage repair enzymes in the cheek area and the results of uneven skin tone calculated based on the method described in JP 2022-20117, along with representative images. It was speculated that the mRNA expression levels of DNA damage repair enzymes (NEIL1, OGG1, PCNA, XPC) were positively correlated with uneven skin tone scores. In other words, it was thought that higher mRNA expression levels of DNA damage repair enzymes in the cheek area would result in less uneven skin tone in the cheek area.
[0068] 10. TEWL measurement The TEWL was measured on the right cheek of the same female subject as in the above experimental example using a transepidermal water loss measuring device, Tewameter TM300 (Courage+Khazaka).
[0069] The results of the cheek DNA damage repair enzyme mRNA expression levels and TEWL are shown in Figure 8. It was speculated that the mRNA expression levels of DNA damage repair enzymes (NEIL1, XPC) were negatively correlated with TEWL. In other words, it was thought that the higher the cheek DNA damage repair enzyme mRNA expression levels, the lower the cheek TEWL.
[0070] 11. Measurement of stratum corneum moisture content The moisture content of the keratinocyte was measured on the right cheek of the same female subject as in the above experimental example using a skin surface moisture measuring device, Corneometer CM825 (Courage+Khazaka).
[0071] The results for the mRNA expression levels of DNA damage repair enzymes and stratum corneum moisture content in the cheeks are shown in Figure 9. It was speculated that the mRNA expression levels of DNA damage repair enzymes (OGG1) were positively correlated with the moisture content of stratum corneum. In other words, it was thought that the higher the mRNA expression levels of DNA damage repair enzymes in the cheeks, the higher the moisture content of stratum corneum in the cheeks.
[0072] 12. Measuring skin surface roughness The right cheek of the same female subject as in the above experimental example was photographed using a skin analyzer, Antera 3D (Mirabex), and the roughness (Ra) of the skin surface was calculated.
[0073] The results of the cheek DNA damage repair enzyme mRNA expression level and skin surface roughness (Ra) and representative images are shown in Figure 10. It was speculated that the DNA damage repair enzyme (NEIL1) mRNA expression level was negatively correlated with Ra. In other words, it was thought that if the cheek DNA damage repair enzyme mRNA expression level was high, the cheek skin surface would be less rough.
[0074] Furthermore, experimental results suggest that the mRNA expression levels of DNA damage repair enzymes are correlated with collagen content, elasticity, wrinkles and sagging, skin brightness, melanin content, blood hemoglobin oxygen saturation, uneven skin tone, TEWL, keratinocyte moisture content, and skin surface roughness. Among DNA damage repair enzymes, NEIL1 in particular was highly correlated with various skin characteristics. Furthermore, among skin characteristics, high collagen content in the papillary dermis was particularly correlated with DNA damage repair enzymes. Thus, high DNA damage repair enzyme mRNA expression levels are associated with high collagen content and high elasticity, which in turn leads to milder wrinkles and sagging. Furthermore, brighter skin tone, less melanin, a vibrant complexion, less uneven skin tone, less water loss, more keratinocyte moisture content, and a smoother skin surface. These results suggest that the mRNA expression levels of DNA damage repair enzymes can be used as an indicator to predict the progression of skin aging.
[0075] Applying this experimental example makes it possible to suggest how to use cosmetics. In other words, if the current mRNA expression level of a DNA damage repair enzyme is measured and it is found to be lower than a preset standard expression level, it will be clear that pharmaceuticals, quasi-drugs, and cosmetics that prevent and improve wrinkles and sagging skin are suitable for that subject. It will also be possible to suggest appropriate pharmaceuticals, quasi-drugs, and cosmetics to people who are unsure what cosmetics to use in the future. [Industrial Applicability]
[0076] According to the method for assessing the progression of skin aging of the present invention, DNA damage repair ability is measured using the expression level of mRNA, which is the expression product of a gene encoding a protein of a skin DNA damage repair enzyme, as an indicator, and a skin testing method can be provided for predicting the progression of various skin aging conditions, such as collagen content, elasticity, wrinkles / sagging, brightness, melanin content, blood hemoglobin oxygen saturation, uneven skin tone, TEWL, stratum corneum moisture content, and skin surface roughness, in the papillary dermis. This method allows for non-invasive acquisition of skin samples without pain or other discomfort. Furthermore, if the progression of skin aging can be predicted, it will be possible to suggest appropriate cosmetic use methods, thereby preventing and improving skin aging.
Claims
1. A method for predicting skin properties based on the DNA damage repair ability of the skin, comprising: (1) quantifying the expression of a gene encoding a DNA damage repair enzyme protein in a skin sample obtained from a test subject; (2) measuring DNA damage repair ability using the gene expression level measured in step (1); and (3) predicting skin properties from the DNA damage repair ability calculated in step (2); A skin testing method comprising:
2. The skin testing method according to claim 1, wherein the quantification of gene expression is carried out by polymerase chain reaction (PCR).
3. The skin testing method according to claim 1, wherein the skin sample is keratin collected from the skin of the subject.
4. The skin testing method according to claim 1, wherein the DNA damage repair enzyme is one or more enzymes selected from NEIL1, OGG1, PCNA, XPC, XPG, and ERCC1.
5. The skin testing method according to any one of claims 1 to 4, wherein the skin properties are one or more skin properties selected from the collagen amount of the papillary dermis, elasticity, wrinkles / sagging, brightness, melanin amount, blood hemoglobin oxygen saturation, uneven skin tone, TEWL, stratum corneum moisture content, and skin surface roughness.
Citation Information
Patent Citations
Method for evaluating degree of skin aging
JP2004354159A
Evaluation method of skin age and evaluation method of cosmetics
JP2014180459A
Skin age estimation method
JP2016106907A