Autologous cell replacement therapy for parkinson's disease

The generation of autologous midbrain dopamine progenitor cells from induced pluripotent stem cells using microRNAs and reprogramming factors, followed by a 'spotting-based' differentiation, addresses the limitations of current Parkinson's disease treatments by safely and effectively reinnervating the brain and halting disease progression.

JP2026012673APending Publication Date: 2026-01-27THE MCLEAN HOSPITAL CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025153269
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-12-18
Filing Date
2025-09-16
Publication Date
2026-01-27

AI Technical Summary

Technical Problem

Current pharmacological treatments for Parkinson's disease, such as dopamine substitution therapies, while improving quality of life, often lead to undesirable side effects and motor fluctuations due to prolonged use, and there is a need for a safe and effective therapeutic strategy to address the degeneration of midbrain dopamine neurons.

Method used

A method for generating clinical-grade, autologous midbrain dopamine progenitor cells using induced pluripotent stem cells, combined with microRNAs and reprogramming factors, followed by a 'spotting-based' in vitro differentiation process to produce functional and safe dopaminergic cells, which are characterized by specific markers and electrical activity, and are suitable for transplantation.

Benefits of technology

The generated cells significantly reinnervate the host brain, halt the disease process, and do not form tumors, providing a robust therapeutic effect without redistribution, suitable for personalized cell replacement therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026012673000029
    Figure 2026012673000029
  • Figure 2026012673000030
    Figure 2026012673000030
  • Figure 2026012673000031
    Figure 2026012673000031
Patent Text Reader

Abstract

To provide methods for generating midbrain dopamine (mDA) neural progenitor cells useful for autologous cell therapy in Parkinson's disease, compositions comprising the cells, and methods of use thereof.SOLUTION: Provided is a method of producing a population of mesencephalic dopaminergic progenitor cells (mDAP), comprising the steps of providing a population of induced pluripotent stem cells (iPSC), preferably human iPSC, seeding said population of cells in discrete regions within a biological matrix hydrogel support at a density of about 5,000 to 20,000, preferably about 10,000 cells per region with a distance between said regions sufficient to maintain separation between said regions, and maintaining said cells under conditions sufficient for said iPSC to differentiate into mDAP.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Priority claims This application is a continuation of U.S. Provisional Patent Application No. 62 / 852,008, filed May 23, 2019. No. 62 / 949,906, filed December 18, 2019, which claims the benefit of The entire contents of the foregoing are incorporated herein by reference.

[0002] Federally sponsored research or development This invention was made under Grant No. NS070577 awarded by the National Institutes of Health. This invention was made with government support. The U.S. Federal Government has certain rights in this invention.

[0003] Described herein are midbrain dopamine receptors useful for autologous cell therapy in Parkinson's disease (PD). (mDA) METHODS FOR GENERATING NEURAL PRECURSOR CELLS, COMPOSITIONS COMPRISING THE CELLS, AND USE THEREOF The following will be described. [Background technology]

[0004] Parkinson's disease (PD) is characterized by both motor and non-motor pathology. It is the second most common neurodegenerative disorder after Alzheimer's disease. Approximately 1% of the population is affected, and its prevalence will increase the burden on society. As a result, by 2030, more than 14 million people worldwide will be affected by PD. Since its introduction in the 1960s, dopamine (DA) Substitution therapies (e.g., L-DOPA and DA agonists) are the gold standard of pharmacological treatment. While significantly improving the quality of life of PD patients, these medical Prolonged use of the drug commonly (>80%) leads to undesirable side effects, such as movement disorders and motor fluctuations. To produce an effect (2). Summary of the Invention [Means for solving the problem]

[0005] Parkinson's disease (PD) is caused by the degeneration of midbrain dopamine (mDA) neurons in the substantia nigra. A common neurodegenerative disorder associated with subsequent loss of intrastriatal dopamine and cell migration. Human induced pluripotent stem cell (hiPSC)-based transplantation for PD is a promising therapeutic strategy. To establish autologous cell therapy for mD as a safe and effective therapeutic agent, the present inventors We have developed a core technology platform for the generation of A progenitor cells. First, metabolic regulation By combining microRNAs with reprogramming factors, the inventors have Clinical-grade iPS cells, as evidenced by their system integrity and unbiased pluripotency potential. Second, we have developed a method for generating functional and "Spot" technology allows healthy mDA cells to be generated in an expandable form with significantly less cell loss. Third, we established a "feeding"-based in vitro differentiation method. A chemical that can efficiently and safely eliminate potentially undifferentiated cells from the final product. The dopaminergic cells generated in this way are highly characterized. They express specific mDA markers, produce and secrete dopamine, and exhibit the electrical activity typical of mDA cells. Furthermore, transplantation of these cells into rodent models of PD has shown While resulting in significant reinnervation of the host brain, there was no evidence of tumor formation or damage to the implanted cells. The ataxia was robustly reversed without any redistribution of cells. Implantation of the derived cells into humans with PD halts the disease process and presumably (See Example 10.) The form is suitable for the successful implementation of personalized, autologous, cell replacement therapy for PD.

[0006] Thus, as used herein, differentiated cells, e.g., neurons, e.g., midbrain dopamine A method for generating a population of mDAPs is presented. The method comprises generating induced pluripotent stem cells. providing a population of iPSCs, preferably human iPSCs; The distance between the regions is sufficient to maintain separation between the regions within the hydrogel support. The cell population is then deposited in a discrete area, preferably a substantially circular area ("spot"). Seed at a density of approximately 5,000 to 20,000 cells per area, e.g., approximately 10,000 cells. and differentiating the iPSCs into, for example, neurons, e.g., mDAPs. The method includes maintaining the cells under conditions sufficient to induce cell proliferation.

[0007] In some embodiments, the biological matrix hydrogel support is a basement membrane extract, or It is a composite matrix.

[0008] In some embodiments, the cells are suspended in, for example, about 10 μl of gel prior to seeding. can be.

[0009] In some embodiments, the region is about 2-10 mm in diameter, for example, about 5 mm.

[0010] In some embodiments, the distance between the regions is 1-3 cm.

[0011] In some embodiments, the iPSCs are engineered to express alkaline phosphatase (AP) and TRA-1 Expresses -60.

[0012] In some embodiments, the mDAP is selected from the group consisting of FOXA2, OTX2, LMX1A, and / or EN1, preferably at least one, two, or more of FOXA2 and LMX1A. or more markers; optionally, mDAP expresses FOXA2, LMX1 A, and TH+ cells co-expressing NURR1.

[0013] In some embodiments, iPSCs are obtained by obtaining a population of primary cells from a subject, Preferably, the primary cells are fibroblasts, hair keratinocytes, or the like. nocytes), blood cells, or bone marrow mesenchymal stem cells (MSCs); At least OCT4, KLF4, and SOX2, and / or L-MY inducing expression of C and / or C-MYC; and The present invention is produced by a method comprising maintaining cells under conditions sufficient to result in C.

[0014] In some embodiments, at least OCT4, KLF4, and SOX2, and / or Alternatively, the step of inducing expression of L-MYC and / or C-MYC in primary cells may be , human Oct4 linked to foot-and-mouth disease virus 2A sequence (OCT4-F2A), KLF4 , and SOX2 linked to the porcine teschovirus 2A sequence (SOX2-P2A). , and / or the coding sequence of L-MYC, and / or the coding sequence of C-MYC The method comprises transfecting a polycistronic episomal vector comprising:

[0015] In some embodiments, the iPSCs express miR-106a, miR-106b, miR-136s, miR-200c, miR-302s, miR-369s, and m one or more exogenous microRNAs selected from the group consisting of iR-371 / 373 miR-302s are produced by a method comprising the step of expressing miRNA A (miRNA). and five miRNs, including 302a, 302b, 302c, 302d, and 367. The miR-302 cluster encompassing A is indicated.

[0016] In some embodiments, the miRNA is one of miR-302s and miR-200c. Or both.

[0017] In some embodiments, the method includes delivering miR-302s and miR-200c to a cell. The method comprises introducing an episomal vector containing the coding sequence.

[0018] In some embodiments, the iPSCs express OCT4, KLF4, SOX2, m iR-302s, and miR-200c; or OCT4, KLF4, SOX2 , L-MYC / C-MYC, miR-302s, and miR-200c-expressing stem cells It is produced by a method including the steps.

[0019] In some embodiments, the method comprises: introducing into the cell (i) a 2A sequence of foot and mouth disease virus (OCT4 -F2A) linked to human Oct4, KLF4, and porcine teschovirus 2A sequences ( SOX2-P2A) and the coding sequence of L-MYC, and C-MYC viral vectors (e.g., lentivirus, adenovirus, or or AAV vectors) or polycistronic episomal vectors, or Oct 4. One or more of KLF4, SOX2, and L-MYC / C-MYC mature RNAs, or the corresponding proteins, and (ii) miR-302s and mi miR-200c, or sequences encoding mature miR-302s and mature miR-200c any one or more of the following: viral vectors or episomal vectors, including The method includes introducing:

[0020] In some embodiments, the cell is a human cell. Instead, C-MYC is used, and / or vice versa.

[0021] In some embodiments, the methods described herein preferably involve the detection of the BIRC5 gene. This includes reducing undifferentiated iPSCs by inhibiting

[0022] Also provided herein are cells containing mDAP produced by the methods described herein. Populations and compositions comprising the cells are also provided. In some embodiments, the cells are primary cells. have one or more somatic mutations not present in and / or causally related to cancer It has no known somatic mutations.

[0023] Further, as used herein, there is provided a method for treating Parkinson's disease (PD), comprising administering to a patient a therapeutically effective amount of PD-1000 or PD-10000. A method of using the cells to treat a subject at risk is presented. The method preferably comprises: , subjects with or at risk of developing PD, or autologous transplant subjects. obtaining somatic cells and generating iPSCs from the primary cells; preferably SOX1-positive cells, KI67 positive cells, SOX1 / KI67 double positive cells, SOX1 / PAX6 double positive cells sufficient time to reduce the number of gonadotropin-positive cells and SOX1 / PAX6 / KI67 triple-positive cells treating iPSCs with quercetin for a period of time; and administering the cell population to a subject. In some embodiments, the cells may optionally be analyzed by magnetic resonance imaging. Using imaging-guided stereotaxic surgery, the subject's brain is preferably implanted directly into or adjacent to the affected region. Preferably, the implant is bilaterally implanted into one or more of the caudate nucleus, putamen, and substantia nigra. It is administered by swallowing.

[0024] In some embodiments, the cells are injected into the cerebral cortex at a single injection site, preferably in the superior parasagittal region. Preferably, three injection channels are used to create a column spanning the sagittal extent of the putamen. Preferably, the device (e.g., Schweitzer et al., Oper Neurosurg (Hagerstow n) administered via injection as described in 2019. , dosage approximately 1 million pieces, 2 million pieces, 3 million pieces, 4 million pieces, 5 million pieces, 6 million pieces, 7 million or 8 million cells are administered, preferably by three injection routes. In some embodiments, the cells are administered in a single treatment. In some embodiments, the cells are administered in two or more treatments.

[0025] In some embodiments, both hemispheres of the brain are treated and the cells are administered to the first hemisphere in the first treatment. In some embodiments, the therapeutic agent is administered to one hemisphere and in a second treatment to the other hemisphere. The time between the first and second treatments can be approximately 2 weeks, 1 month, 2 months, 3 months, 4 months, or 5 months. months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months , 12 months, 18 months, 24 months, 30 months, 36 months, 48 ​​months, 54 months months, or 60 months.

[0026] In some embodiments, at least one antibiotic is administered pre-operatively, intra-operatively, and / or procedurally. It is administered after surgery.

[0027] Also provided herein are methods for culturing cells, e.g., for use in the methods described herein. A culture dish for culturing cells, the back of which has grid lines spaced 1 A grid of 0.5 to 2.5 cm, for example, about 2 cm, e.g., a 2 x 2 cm grid Also presented are culture dishes in which the grid has been printed on the backside. In some embodiments, the surface is formed as part of a dish, such as a metal plate or an etched surface. Dishes are available in polystyrene, polyethylene, polypropylene, polycarbonate, and In some embodiments, the dish comprises a thermoplastic resin made of polyvinyl. A biomatrix hydrogel support, preferably a basement membrane extract or a synthetic The composite matrix layer comprises:

[0028] Appendices 1 and 2 and all publications, patent applications, patents, Sequences, database entries, and other references are the property of their respective owners, for any and all purposes. No. 6,239,693, filed on Oct. 1, 2004, which are incorporated herein by reference in their entireties.

[0029] Unless otherwise specified, all technical terms used herein and scientific terms have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. For use in the present invention, the methods and materials described herein have the same meaning. However, other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and are intended to be limiting. All publications, patent applications, patents, sequences, databases, and other information mentioned herein are not to be construed as an endorsement of the invention. Source entries, and other references are incorporated by reference in their entirety. occurs, the present specification, including definitions, governs.

[0030] Other features and advantages of the invention will become apparent from the following detailed description and drawings, as well as the claims. It will be clear from the scope. [Brief explanation of the drawings]

[0031] [Figures 1A-1D]Figure 1 shows an improved reprogramming method combining Y4F with metabolically regulated miRNAs. (A-D) Screening for miRNAs that enhance hiPSC-like colony generation from hDFs by Y3F (A), Y4F (B), Y3F+3 (C), or Y4F+3 (D) compared with empty vector (mock) controls. Mean ± standard deviation, n = 5, *p < 0.05; **p < 0.01, one-way ANOVA with Tukey's post-hoc test. (E-F) Time course of OCR (E) and ECAR (F) in hDFs infected with Y4F, miR-302s, and / or miR-200c. Mean ± standard deviation, n = 3, *p < 0.05; **p < 0.01; ***p < 0.005, two-way ANOVA with Tukey's post-hoc test. (G) Percentage of TRA-1-60+ colonies among AP+ colonies after infection with lentiviruses encoding Y4F, Y4F+3, or Y4F+3+2. Mean ± standard deviation, n = 6, ***p < 0.005, two-way ANOVA with Tukey's post-hoc test. (H) Percentage of TRA-1-60+ colonies among AP+ colonies after transfection with episomal vectors encoding Y4F, Y4F+3, or Y4F+3+2. Mean ± standard deviation, n = 4, **p < 0.01, two-way ANOVA with Tukey's post-hoc test. [Figures 1E-1H] (As mentioned above.) [Figure 2A-2B]Figures show high-quality hiPSC cell lines generated from our improved reprogramming method. (A) Heatmap depicting gene expression levels of pluripotency markers in established hiPSC cell lines compared to the original hDF and hESC cell lines (H9) (n=3). (B) Immunostaining of hiPSC cell lines generated with different combinations with specific antibodies against pluripotency markers (e.g., OCT4, NANOG, TRA-1-60, and SOX2) along with nuclear staining with Hoechst 33342 (inset). Scale bar: 100 μm. (C) Immunostaining for lineage-specific markers for ectoderm (OTX2), mesoderm (BRACHYURY), and endoderm (SOX17) after 7 days of spontaneous differentiation. Scale bar: 100 μm. (D) Heatmap depicting gene expression levels of early differentiation markers of ectoderm (PAX6 and MAP2), endoderm (FOXA2, SOX17, and CK8), and mesoderm (MSX1, MYL2A, and COL6A2) in hiPSC cell lines generated with pY4F, pY4F+3, or pY4F+3+2 (n=2). [Figures 2C-2D] (As mentioned above.) [Figure 3A-3B]Genomic integrity of hiPSC cell lines derived from skin biopsies of sporadic PD patients. (A) Somatic mutations found in four hiPSC cell lines. The bar graphs show the number of singleton mutations in each hiPSC cell line (different colors for each hiPSC cell line) and the number of unique mutations found in two or more hiPSC cell lines (black bar). A dotted line connecting the ends of each bar indicates hiPSC cell lines that share a mutation. The bottom left bar represents the total number of mutations, including both singleton mutations and mutations found in two or more hiPSC cell lines. C4 had the lowest number of somatic mutations (n ​​= 92), of which 80 were singletons and 12 were found in C4 and the other hiPSC cell lines. (B) Mutation burden in coding regions and cancer-related genes was compared with published datasets. The number of nonsynonymous mutations in our hiPSC cell lines was significantly smaller than that in our hESC cell lines. On average, the number of nonsynonymous mutations in the iPSC cell lines from the HipSci Project was similar to that in our hiPSC cell lines. Overall, C4 showed the lowest mutation burden (red). Regarding somatic mutations in cancer-related genes, no somatic mutations were found in two widely used hESC cell lines (H1 and H9, blue) and the C4 hiPSC cell line (red) (right panel). (C) Distribution of minor allele frequencies (MAFs) for all somatic mutations in the four hiPSC cell lines. The peak near a MAF of 0.5 represents clonal somatic mutations. The second peak with a lower MAF of 0.1 represents subclonal mutations. For each plot, a density curve with two peaks indicates the distribution of MAFs of somatic mutations, and the color of the curve matches (A) for each hiPSC cell line; the curve with a different color (peaking near a MAF of 0.0) is the curve for somatic mutations detected by other hiPSC cell lines. [Figure 3C] (As mentioned above.) [Figure 4A-4B]This figure shows that spotting-based in vitro differentiation improves the yield and quality of the resulting dopamine cells. (A) Experimental scheme for finding optimized physical culture conditions. From days 0 to 15, all cells, regardless of viability, were quantified by FACS and / or manual cell counting, as indicated by the arrows. On day 15, cells were either replated onto coverslips for immunocytochemical analysis or harvested for quantitative real-time PCR. (B-C) Comparison of the conventional monolayer-based method and the spotting-based method for the extent of cell loss (due to detachment) from days 1 to 14 and cell harvest at day 15 (B), as well as the percentage of dead cells at day 15 (C), for both hESCs (H9 and H7) and hiPSCs (C4 and N3). Cell densities of 11,000 cells per cm and 10,000 cells per spot were used for the conventional and spotting-based methods, respectively. Data presented reflect experiments with measurable outcomes (see caption for Figure 13A). Mean ± standard deviation, n = 4, one-way ANOVA. (D) Quantification of dying cells from the final harvested cells on day 15 using immunocytochemistry analysis. An antibody against cleaved caspase 3 was used to detect apoptotic cells. Hoechst 33342 staining visualized nuclear condensation to detect dead or dying cells. Cells seeded by spotting showed a significant reduction in the number of cleaved caspase 3-positive cells. Scale bar: 100 μm. [Figure 4C] (As mentioned above.) [Figure 4D] (As mentioned above.) [Figures 5A-5C]Figure 1 shows the effects of quercetin treatment on undifferentiated and differentiated cells. (A) Screening to determine optimal quercetin treatment conditions. After treatment with different quercetin concentrations and durations, viable hiPSCs were counted using a hemocytometer. (B-C) Dopaminergic cell viability (B) and total cell number (C) on day 11 after quercetin treatment on day 9. Cultures were treated with 5, 10, 20, 40, and 100 μM for 16 hours. Mean ± standard deviation, n = 4, one-way ANOVA. (D) Colony formation by 10-fold serially diluted hiPSCs at 105 to 1 with a constant number of fibroblasts (105). Cells were treated with 40 μM quercetin (QC) for 16 hours or left untreated, then cultured for 6 days and stained for alkaline phosphatase activity. Representative results from two separate experiments. (E) The final number of colonies counted is plotted against the original input number of hiPSCs. (F) A standard curve for OCT4 copy number versus input number of hiPSCs was generated by qRT-PCR. OCT4 copy number was measured by qRT-PCR and calculated from 10-fold serially diluted hiPSCs at 10-10 cells. (G) The number of OCT4-positive cells in mDA cells differentiated from hiPSCs at various time points with or without QC treatment was measured using OCT4 qRT-PCR. Mean ± standard deviation, n = 2, ***p < 0.005, two-way ANOVA. [Figure 5D-5E] (As mentioned above.) [Figure 5F-5G] (As mentioned above.) [Figure 6A]Figure 1 shows the molecular, cellular, and physiological characterization of in vitro differentiated C4 hiPSCs. (A) Schematic diagram of the mDA differentiation method based on the spotting protocol. Numbers represent concentrations in ng / ml, and numbers in parentheses represent concentrations in μM. AA: ascorbic acid; β-mer: beta-mercaptoethanol; BDNF: brain-derived neurotrophic factor; CHIR: CHIR99021; dbcAMP: dibutyl cyclic adenosine monophosphate; FGF-8, fibroblast growth factor 8; GDNF: glial cell line-derived neurotrophic factor; KSR: knockout serum replacement; LDN: LDN193189; L-Glu: L-glutamine; NEAA: non-essential amino acids; PMN: purmorphamine; QC: quercetin; SB: SB431542; SHH: sonic hedgehog; TGF-β3, transforming growth factor beta 3. (B) Heatmap of gene expression of stage-specific neural markers in mDA-differentiated cells. (C) Progressive increase in gene expression of FOXA2, LMX1A, NURR1, and TH during differentiation. (D) Immunofluorescence staining for neural progenitor marker (NESTIN), mDAP marker (FOXA2 / LMX1A / TH), mDAN marker (MAP2, NURR1 / TH), and proliferation marker PAX6 / SOX1 / KI67 in differentiated D28 cells. Scale bar: 100 μm. (E) Percentage of NESTIN+ cells, MAP2+ cells, TH+ cells, and NURR1+ cells among total D28 cells (n = 6). (F) Percentage of FOXA2+ cells, LMXA1+ cells, and FOXA2+ / LMX1A+ cells among total D28 cells (n = 6). (G) Percentage of FOXA2+ / LMX1A+ and NURR1+ cells among TH+ D28 cells (n=6). (H) Percentage of PAX6+, SOX1+, and PAX6+ / SOX1+ / KI67+ cells among total D28 cells (n=6). ND: Not detected. (I) HPLC analysis of KCl-induced release of dopamine and a dopamine metabolite (3,4-dihydroxyphenylacetic acid (DOPAC)) at day 47. Data are presented as mean ± SEM. [Figures 6B-6D](As mentioned above.) [Figures 6E-6I] (As mentioned above.) [Figure 7A-7C] Figure 1 shows the safety of C4-derived mDA cells in NOD-SCID mice in vivo. (A) H&E staining of NOD-SCID mouse brains after intrastriatal transplantation of C4 iPS cells (day 0, left) or C4-derived mDA progenitor cells on day 14 (center) or day 28 (right). Open circles in the D14 group identify rosette-like structures. (B) Quantification of the percentage of teratoma formation without quercetin (n=4), day 0 (n=4), and day 14, and with quercetin treatment on days 14 (n=19) and 28 (n=23). QC = quercetin. (C) Quantification of rosette formation on day 14 of differentiation without quercetin, and on days 14 and 28 with quercetin treatment. (D) Immunohistochemistry for vimentin in the D14 and D28 groups. (E-F) Immunofluorescence staining for SOX1, PAX6, and KI67 in groups D14 (E) and D28 (F). (G) Quantification of the SOX1+, KI67+, SOX1+ / KI67+, SOX1+ / PAX6+, and SOX1+ / PAX6+ / KI67+ populations in groups D14 and D28. Data are presented as mean ± SEM, n = 4, ***p < 0.001, Student's t-test. (H) Biodistribution assay. RT-PCR for human- or mouse-specific gene expression in the "brain mix" (a mixture of olfactory bulb and cerebellum), spinal cord, lung, heart, spleen, kidney, and liver of NOD SCID mice that had received intrastriatal hiPSC-derived D28 dopaminergic progenitor cell transplants for 6 months. hiPSCs were used as a positive control. The human-specific gene is located on chromosome 10, at positions 29125650-29125967. The mouse-specific gene is part of mouse TNFα. ND: Not detected. All scale bars indicate 100 μm unless otherwise specified. [Figure 7D-7E] (As mentioned above.) [Figures 7F-7H] (As mentioned above.) [Figure 8A-8B] Figure 1 shows the survival and function of C4 hiPSC-derived mDA cells in vivo. (A-D) Behavioral assessments (n=9) in the D28 and cryopreserved ("frozen") D28 groups using the drug-induced rotational behavior test (A), the corridor test (B), the cylinder test (C), and the stepping test (D). (E-F) Overview of graft-derived hNCAM+ and TH+ innervation in the host brain. (G-L) Innervation of the STR, NAc, and PFC by graft-derived hNCAM+ neurons (G-I) or TH+ neurons (J-L) in the intact, transplanted, and lesioned non-transplanted host. (M) High-magnification images showing graft-derived innervation. (N) Immunofluorescence staining for human-specific synaptic markers, synaptophysin, TH, and DARPP32, within transplanted neurons. All graft analysis data (E-M) were obtained 26 weeks after transplantation. AC: anterior commissure; cc: corpus callosum; dSTR: dorsal striatum; LV: lateral ventricle; NAc: nucleus accumbens; PFC: prefrontal cortex; T: transplant. Data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p<0.001, Student's t-test. Scale bars: 500 μm (G-L); 100 μm (M-N). [Figures 8C-8F] (As mentioned above.) [Figure 8G-8L] (As mentioned above.) [Figure 8M-8N] (As mentioned above.) [Figures 9A-9C]Figure 1 shows an improved reprogramming method based on the identification of microRNAs regulating metabolic reprogramming and their combination with Y4F. (A-B) Using the XFp analyzer, the oxygen consumption rate (OCR) (A) and extracellular acidification rate (ECAR) (B) of hDFs transfected with microRNA mimics were assessed 3 days after transfection for control (Scr) or miR-200c (200c). Mean ± standard deviation, n = 3, *p < 0.05, unpaired two-tailed t-test. (C) OXPHOS capacity of hDFs transfected with Scr or miR-200c 3 days after transfection. Mean ± standard deviation (n = 3). (D-E) Basal respiration, ATP turnover, maximal respiration, oxidative reserve capacity (D), or relative OCR change (E) after FCCP injection. Mean ± standard deviation, n = 3, *p < 0.05, unpaired two-tailed t-test. (F–G) OCR is shown for hDFs infected with lentivirus expressing Y4F and / or miR-200c (200c) 3 (F) or 8 (G) days after transduction. Mean ± standard deviation (n = 3). (H–I) Basal respiration, ATP turnover, maximal respiration, and oxidative reserve capacity (OCR) for hDFs 3 (H) or 8 (I) days after transduction, as shown in Figure 9F–G. Mean ± standard deviation, n = 3. *p < 0.05; **p < 0.01; ***p < 0.005, one-way ANOVA with Tukey's post-hoc test. (J–K) OCR / ECAR ratio (J) or relative OCR change (K) for transduced hDFs after FCCP injection, as shown in Figure 9F–G. Mean ± standard deviation, n = 3, *p < 0.05; **p < 0.01, two-way ANOVA with Tukey's post-hoc test. (L-M) OCR (L) and ECAR (M) in hDFs transduced with lentiviruses expressing individual miRNAs 3 days after transduction. Mean ± standard deviation, n = 9, *p < 0.05; **p < 0.01; ***p < 0.005, one-way ANOVA with Tukey's post-hoc test. (N) OCR / ECAR ratios, as shown in Figure 9L-M.Mean ± standard deviation, n=9, ***p<0.005, one-way ANOVA with Tukey's post-hoc test. [Figure 9D-9G] (As mentioned above.) [Figures 9H-9K] (As mentioned above.) [Figures 9L-9N] (As mentioned above.) [Figure 10A] Figure 1. Identification of the Y4F+3+2 reprogramming protocol. (A) Representative photographs of TRA-1-60+ colonies (top) or AP-positive colonies (bottom) 14 days after transduction. (B) Percentage of TRA-1-60+ colonies among AP+ colonies after lentiviral transduction of human adult fibroblasts (GM03529) with Y4F, Y4F+3, or Y4F+3+2. Mean ± standard deviation, n = 6, **p < 0.01, two-way ANOVA with Tukey's post-hoc test. (C-D) Maps of plasmids encoding pY4F (OCT4, SOX2, KLF4, and L-MYC) (C) and miR-302s and miR-200c (p3+2) (D). (E) Schematic diagram of the episome system-based reprogramming method established by the present inventors, which uses a single transfection of pY4F and pY3+2. [Figure 10B] (As mentioned above.) [Figures 10C-10E] (As mentioned above.) [Figure 11A] Figure 1 shows immunocytochemical staining of hiPSC cell lines generated by our improved reprogramming method. Immunocytochemical staining of human iPSCs generated by our episome method from diverse human adult fibroblasts derived from multiple sources, including nine fibroblast cell lines from the Coriell Institute (three familial PD, three sporadic PD, and three healthy subjects: A) and four samples from fresh skin biopsies (three healthy subjects and one sporadic PD patient: B). [Figure 11B] (As mentioned above.) [Figure 12A]Figure 1 shows the characterization of hiPSC cell lines generated by our improved reprogramming method. (A) Standard curve for the detection of the EBNA-1-specific sequence (EB-01) by qRT-PCR. (B) No residual plasmid DNA was detected in the cytoplasm of any hiPSC cell line. Samples derived from the original fibroblasts (Fib), the human ESC cell line (H9), and a negative control (distilled water: DW) were also examined. Plasmid-specific primers based on the EBNA sequence (EB-01) were used for qRT-PCR analysis. (C) Detection of plasmid DNA integrated into the host genome. One cell line (N17) was found to have integrated the plasmid DNA sequence into the host chromosomal DNA. (D) qRT-PCR analysis of the integrated plasmid sequence. Mean ± standard deviation, n = 3, ***p < 0.005, one-way ANOVA. (E) Chromosomal genotype analysis of a hiPSC cell line (MCL540) derived from a skin biopsy of a sporadic PD patient. The patterns were compared with samples derived from the original fibroblasts (Fib) and hESC cell line (H9) as positive and negative controls, respectively. DW: distilled water. (F) Representative images of normal karyotypes of C4 and N3. (G) Representative images of teratoma formation from WiCell's 19-9-11T hiPSC cell line (top), C4 (middle), and N3 (bottom), and the three germ layer tissues derived from them. Scale bar: 100 μm. [Figures 12B-12E] (As mentioned above.) [Figure 12F] (As mentioned above.) [Figure 12G] (As mentioned above.) [Figure 13A]Figure 1 shows a schematic diagram of the spotting-based differentiation protocol. (A) Successful differentiation rates of hESCs and hiPSCs using the monolayer-based or spotting-based method (n=76 for hESCs and n=48 for hiPSCs). In vitro differentiation was considered successful if 1) cells could survive at >50% confluency on day 15, and 2) cells could be harvested and seeded onto coverslips for further characterization by immunocytochemistry. (B-C) Spotting schematic diagrams for a 6 cm culture plate with 6 spots and a 10 cm culture plate with 12 spots. [Figures 13B-13C] (As mentioned above.) [Figure 14A] Figure 1 shows a comparison of spotting-based and monolayer-based in vitro differentiation. (A) Comparison of the ratio of cell loss to cell yield at day 15 of differentiation for C4 and H9 (n=4) using the monolayer-based and spotting-based in vitro differentiation methods. Cell loss and cell harvest were obtained by FACS. (B) Comparison of the pH values ​​of supernatants collected at different time points for both C4 and H9 (n=4). (C) Comparison of morphological features for C4 at days 4, 8, 12, and 15. Scale bars represent 20 μm. Data are presented as mean ± SEM, *p<0.05; ***p<0.005. Statistical significance was determined using a paired two-tailed t-test (A) and one-way ANOVA with Tukey's multiple comparison test (B). [Figure 14B] (As mentioned above.) [Figure 14C] (As mentioned above.) [Figure 15A]Figure 1 shows the elimination of undifferentiated hiPSCs by quercetin treatment. (A) FACS analysis of undifferentiated hiPSCs serially diluted 10-fold with fibroblasts in 100 × 10 total cells with anti-SSEA-4 and anti-TRA-1-60. (B) Plot of the number of input hiPSCs versus the percentage of resulting SSEA-4+ / TRA-1-60+ cells. (C) Immunostaining for NANOG in D14 cells with or without quercetin treatment. Scale bar: 100 μm. [Figures 15B-15C] (As mentioned above.) [Figures 16A-16B] Characterization of in vitro differentiated C4 hiPSCs. (A) Brightfield images of differentiated cells at days 3 to 40. (B) Immunofluorescence staining and percentages of neural progenitor (NESTIN), mDAP (FOXA2 / LMX1A), mDAN (MAP2 and TH), GABAergic neuron (GABA), and serotonergic neuron (5-HT) positive cells at days 14, 21, 28, and 50 of mDA differentiation. Scale bar: 100 μm. Data are presented as mean ± SEM (n = 6). [Figures 17A-17B] Figure 1 shows cell fate analysis of in vitro differentiated C4 hiPSCs. (A) Immunofluorescence staining of electrophysiologically recorded D70 cells co-expressing TH, MAP2, SYP (synaptophysin), DAT (dopamine transporter), VMAT2 (vesicular monoamine transporter 2), and PITX3. Scale bar: 100 μm. (B) Immunofluorescence staining for ALDH1A1, GIRK2, and calbindin with TH-positive cells. Scale bar: 100 μm. [Figures 18A-18C]Electrophysiological characteristics of in vitro differentiated C4 hiPSCs. (A) Representative voltage traces for action potentials induced by depolarizing current injection (500 ms) at day 70. (B) Representative current traces evoked by voltage pulses in voltage-clamp mode. Left: Transient inward currents and sustained outward currents (100 ms duration) induced by voltage pulses from -70 mV to +40 mV in 10 mV increments. Middle: Inward currents were completely blocked by TTX (1 μM). Right: Traces recorded in the presence of TTX were subtracted from those recorded under control conditions to isolate voltage-dependent Na+ currents at different membrane potentials. (C) Spontaneous postsynaptic currents recorded at -70 mV in voltage-clamp mode. (D) Spontaneous firing of a differentiated cell at a resting membrane potential in current-clamp mode. (E) Immunofluorescence staining of an individual recorded cell. Neurobiotin-filled cells (red) indicate TH positivity (green). Scale bar: 100 μm. (F) Cumulative activity maps and spiking activity of in vitro differentiated C4 hiPSCs at days 30, 37, and 44 using a multi-electrode array. (G-H) Average spike counts (G) and active electrode counts (H) of D44-differentiated C4 hiPSCs with or without treatment with a combination of glutamate receptor antagonist NBQX+AP5 and GABAA receptor antagonist picrotoxin. Data are presented as mean ± SEM (n = 4). [Figure 18D-18E] (As mentioned above.) [Figure 18F] (As mentioned above.) [Figures 18G-18H] (As mentioned above.) [Figure 19A]Figure 1 shows an analysis of transplantation outcomes in an in vivo athymic rat model of PD. (A) Amphetamine-induced rotational behavior testing of 6-hydroxydopamine-lesioned Taconic rats before and 4, 8, 12, and 16 weeks after transplantation of C4-derived D28 DA progenitor cells (100,000 or 300,000 cells). Data are presented as mean ± SEM. * * denotes p<0.01, and *** denotes p<0.001. (B) H&E staining of athymic rat brains 6 months after D28 cell transplantation. (C) Immunohistochemistry for hNCAM reveals extensive fiber extension to multiple regions throughout the host brain in serial coronal sections. (D-G) High-magnification hNCAM staining illustrates the outgrowth pattern of the graft into the prefrontal cortex (D), septal nuclei (E), nucleus accumbens (F), and corpus callosum (G). (H-J) Histological analysis of TH+ dopaminergic neurons within grafts generated from D28 DA progenitor cells 6 months after transplantation. Note the A9-like neuron shape (I) with its large, angular cell body, as well as the small, spherical A10-like neuron (J). (K) Schematic of an in vivo experiment in athymic rats from Charles River. (L) Comparison of cell viability and the number of FOXA2-, LMX1A-, and TH-positive cells between freshly prepared D28 cells and frozen D28 cells thawed after 1 week in liquid nitrogen (n = 3-4). (M) Amphetamine-induced rotational behavior test 24–52 weeks after transplantation of D28 cells and frozen D28 cells (n=3–4). Data are presented as mean ± SEM. *p<0.05, **p<0.01, ***p<0.001, Student's t-test. AC: anterior commissure; cc: corpus callosum; NAc: nucleus accumbens; PFC: prefrontal cortex. All scale bars indicate 100 μm unless otherwise noted. [Figures 19B-19C] (As mentioned above.) [Figures 19D-19K] (As mentioned above.) [Figures 19L-19M] (As mentioned above.) [Figure 20A] Figure 1 shows functional and innervation analyses of in vivo transplants. (A) Amphetamine-induced rotational behavior test after transplantation of H9 hESC-derived D28 cells and C4 hiPSC-derived D28 cells (n = 5-8). (B) Representative images of 6-hydroxydopamine-lesioned brains from each group. (C) High-magnification images of innervation of the grafts to the STR and NAc. Data are presented as mean ± SEM. *p < 0.05, **p < 0.01, ** *p < 0.001, Student's t-test. STR: striatum; NAc: nucleus accumbens. [Figures 20B-20C] (As mentioned above.) [Figures 21A-21C]Graft analysis after transplantation of C4-derived mDA cells. (A) Immunostaining for TH+ neurons (both A9-like and A10-like neurons) in D28 grafts and frozen D28 grafts. (B) Estimation of the number of surviving TH+ neurons in D28 grafts and frozen D28 grafts (n=4). (C) Estimation of graft volume in D28 grafts and frozen D28 grafts (n=4). (D-F) Immunofluorescent co-staining for FOXA2, LMX1A (D), and NURR1 (E) with TH in D28 grafts (n=4). (F) Quantification of TH+ neurons co-expressing FOXA2, LMX1A, both of these markers, or NURR1 in D28 grafts and frozen D28 grafts (n=4). (G) Immunofluorescent co-staining for DAT and TH. (H) Immunofluorescent staining for PAX6, SOX1, and Ki67 in transplanted neurons. (I) Quantification of PAX6+, SOX1+, and Ki67+ cells in D28 and frozen D28 grafts (n=4). (J-L) Immunofluorescent co-staining of GIRK2+ neurons (J) and calbindin+ neurons (K) with TH in D28 and frozen D28 grafts (n=4). (L) Quantification of calbindin+ and GIRK2+ neurons in D28 and frozen D28 grafts. (M-O) Immunofluorescent co-staining for TH+, ALDH1A1+, and SOX6+ (M), TH+, ALDH1A1+, and GIRK2+ (N), TH+, ALDH1A1+, and calbindin+ (O) in D28 grafts. For Taconic rats, all graft analysis data were obtained 18 weeks after transplantation. For Charles River rats, all graft analysis data were obtained 26 weeks after transplantation. AC: anterior commissure; cc: corpus callosum; NAc: nucleus accumbens; PFC: prefrontal cortex; SNpc: substantia nigra pars compacta; STR: striatum; T: transplant; VTA: ventral putamen area. Scale bars: 50 μm (A); 100 μm (D-O). [Figures 21D-21L] (As mentioned above.) [Figures 21M-21O] (As mentioned above.) [Figure 22A] Figure 1 shows an overview and quality control results for the GMP differentiation protocol. (A) Schematic diagram for the GMP differentiation protocol, with cell yield at each stage shown in red. QC indicates quality control. (B) D0 immunocytochemistry QC staining for OCT4 and SSEA-4. (C) D0 QC for mRNA expression levels of Oct4 and Nanog using qRT-PCR. (D) DNA fingerprinting QC for C4 D26 shows the original fibroblasts in the same pattern, while the negative control has a different pattern, confirming that C4 iPS cells from the working cell bank are derived from patient fibroblasts. Fib: fibroblasts. M: DNA marker. (E) D26 QC for mRNA expression levels of FOXA2, LMX1A, and TH using qRT-PCR. (F) D26 immunocytochemistry QC staining for FOXA2, LMX1A, and Nurr1, using D0 undifferentiated cells as a negative control. (G) Quantification of FOXA2, LMX1A, and Nurr1 expression by (F). (H) D26 immunocytochemistry quality control staining for TH, 5-HT, TPH, OCT4, and SSEA-4, using staining for OCT4 and SSEA-4 of D0 undifferentiated cells as a negative control. (I) Quantification of TH, 5-HT, TPH, OCT4, and SSEA-4 expression by (H). Some cells were harvested on day 26 for immunocytochemistry QC to allow cells to adhere to coverslips and complete staining and analysis before final harvest on day 28. Scale bar: 100 μm. n = 3 for each experiment. [Figures 22B-22D] (As mentioned above.) [Figures 22E-22F] (As mentioned above.) [Figures 22G-22I] (As mentioned above.) [Figures 23A-23C]Figure 1 shows the immunogenicity of mDA progenitor cells in humanized mice. (A) and (B) show mouse brain sections stained with antibodies against hNCAM (A) and TH / hNCAM (B) 2 weeks after autologous and allogeneic mDAP transplantation to detect the presence of viable grafts and dopaminergic differentiation. (C) Anti-CD4 staining confirms significant cell loss and T cell infiltration only in the allografts transferred to patient-humanized animals. All scale bars indicate 100 μm. NSG: NOD / SCID / IL2rγ null mice; C4-hu: NSG mice humanized with patient-derived PBMCs; K1-hu: NSG mice humanized with volunteer-derived PBMCs. C4-mDAP: patient-derived mDAP; H9-mDAP: human embryonic cell line-derived mDAP. [Figures 24A-24B] Figure 1. Imaging. (A) Axial 18F-DOPA PET images in the basal ganglia reference plane at the indicated time points: baseline (4 months before the first surgery), 3 months after left-side implantation, 6 months after right-side implantation and 12 months after left-side implantation, and 24 months after left-side implantation and 18 months after right-side implantation. An initial, transient decrease in 18F-DOPA uptake 3 months after left-side implantation was followed by a small, progressive increase in dopamine uptake (greater on the right side than on the left side) bilaterally, primarily in the posterior putamen near the implantation site. (B) T2-blade MR images 18 months after left-side implantation and 12 months after right-side implantation. Arrows indicate the location of the implant. [Figures 25A-25B] Longitudinal clinical assessment of motor and non-motor function and quality of life associated with Parkinson's disease. Time points for the first hemispheric implant (left) and the second hemispheric implant (right) are indicated by vertical dotted lines. (A) MDS-UPDRS Part III motor scores after an overnight levodopa withdrawal ("off") and at the peak levodopa dose ("on"). (B) Time course for the indicated PDQ rating scale; lower numbers indicate less severe symptoms. DETAILED DESCRIPTION OF THE INVENTION

[0032] Selective degeneration of A9mDA neurons (mDANs) in the substantia nigra (SN) is a key factor in Parkinson's disease. dopamine is a key pathological feature of the disorder and is directly related to the primary motor symptoms of the disease. Transplantation of agonist cells has been proposed as a potential therapeutic strategy (3). Previous interventions have shown remarkable success, with many grafts lasting for 20 years or more. Reinnervation of the target area with varying degrees of functional recovery, including some patients showing recovery The successful proof-of-concept studies underscore this (4-7). Despite encouraging results, tissue derived from aborted human fetuses remains a poor candidate for the treatment of PD. As a source of cells, it has fundamental ethical, practical, and medical limitations.

[0033] In 2006, Yamanaka et al. reported that four transcription factors, namely Oct4, Sox2, and Klf4, , and c-Myc (hereinafter referred to as Y4F (Yamanaka 4 factor)) By this method, mammalian fibroblasts can be transformed into embryonic stem cell (ESC)-like induced pluripotent stem cells (i Yamanaka published a groundbreaking study showing that the cellulose can be converted into PSC (Protein-Stimulating Cellular Structure). group, and two other research groups have developed human somatic cells into human iPSCs (hiPSCs). achieved this feat for human somatic cells by reprogramming them into blastocysts (9-1 1), opening up the possibility of generating patient-specific stem cells. Despite this initial excitement, It remains uncertain whether iPSC technology can be readily used in autologous cell therapy. Indeed, the primary goal of most hiPSC research ranges from personalized cell therapy to human There is a shift towards mechanistic studies of disease and pathogenesis (12). There are several major obstacles to the implementation of C-based cell therapy. First, perhaps: Due to our limited understanding of the reprogramming process, individual There is a wide variation among the differentiation potential of PSC cell lines (13, 14). The safety of iPSC-based cell therapy has not yet been fully established. Any hiPSC that is undifferentiated or harbors a subclonal tumorigenic mutation Because PSCs have neoplastic potential (15, 16), it is important to develop therapeutic agents that can transform such cells. Therefore, it is extremely important to completely eliminate them. Safe clinical use, as exemplified by one of two patients in 17), Genomic integrity of iPSCs is confirmed by whole genome / exome sequencing (WGS / WES) Third, it requires that the results be confirmed by multiple studies from multiple laboratories. In vitro differentiation protocol of hiPSCs into functional mDNA is still suboptimal, increasing the variability of the final product ( 7 , 18 ). Finally, to benefit as many patients as possible, long-term cost-effectiveness and reproducibility are essential. Presence will also be necessary.

[0034] The present disclosure addresses these challenges and demonstrates the application of hiPSC-based personalized cell therapy to the treatment of PD. First, we have demonstrated that during the reprogramming process, We identified multiple microRNAs (miRNAs) that directly regulate metabolic changes and analyzed these miRNAs. Canonical reprogramming factors of NA (miR-302s and miR-200c) The optimal combination of these two factors can efficiently and reliably generate high-quality iPSCs. This new episome reprogramming method was developed to generate episomal reprogramming vectors derived from 13 different sources. It has been successfully applied to generate multiple hiPSCs using adult human fibroblasts. It was created as a result of using fibroblasts derived from a skin biopsy of a single sporadic PD patient. Whole exome sequencing (WES) and karyotype analysis of isolated hiPSCs exhibits stable chromosomal and genomic integrity without any known oncogenic mutations. Second, we demonstrated that undifferentiated hiPSCs can be efficiently and reliably depleted. We have established a chemical method (quercetin method) that can eliminate tumor formation after transplantation. , see U.S. Patent No. 20160002604. Third, the present inventors have Results in dramatically reduced cell loss and increased healthy cell yield compared to conventional monolayer methods Efficient in vitro differentiation based on a novel "spotting" method resulting in Fourth, we established a protocol for the differentiation of blastocysts produced by this in vitro differentiation protocol. Transplantation of mDA cells using fresh or cryopreserved cells is Regardless, it produced robust correction of ataxia in an athymic rat model of PD. The mice showed significant reinnervation of the host brain. The platform complies with the Good Manufacturing Practice (GMP) for pharmaceuticals and quasi-drugs. This was carried out in a compliant facility and we succeeded in producing a large amount of high-quality mDA cells. Thus, the core technology described herein constitutes a personalized, autologous, cell replacement therapy for PD. Suitable protocols for successful implementation are provided.

[0035] PD is characterized by selective degeneration of a well-characterized cell type (A9 mDAN) leading to ataxia and Because they are the primary cause of related conditions, they are particularly promising targets for cell replacement therapy. Researchers have access to a variety of cell sources, including fetal tissue, adult autologous stem cells, and allogeneic mDA cells. (5-7, 54) are investigating cell therapy for PD. ,hiP,due to its inherent advantages in ethical, practical, and medical,problems. Focusing on SC-derived autologous cell replacement: Potential for personalized autologous cell therapy for PD To help realize this potential, we have analyzed current trends in the implementation of this therapeutic strategy. attempted to address the technical / scientific obstacles of

[0036] Personalized cell therapy involves the generation of clinical-grade hiPSCs derived from each patient treated. Therefore, a reproducible process that allows for the efficient and reliable generation of such cell lines is required. It is extremely important to establish a programming technique. canonical Yamanaka binding miRNAs (miR-302s and miR-200c) The combination of this factor with the Y4F gene facilitates the generation of hiPSCs that meet strict quality standards. First, we found that our hiPSC cell line expresses OCT4, SOX2, and NANO. G, ESRRB, REX1, GDF3, ECAT1, GBX2, and TRA-1-60 The expression levels of bona fide pluripotency markers, including α- and β-glucanase, were similar to those of H9 (Figure 1). 2A and 2B). Second, immunostaining and gene analysis for three germ layer-specific markers were performed. As determined by expression, H 9 hESC and hiPSC cell lines have been shown to differentiate well and uniformly into all three germ layer cell lineages. The cell lines generated by Y4F or Y4F+3 were differentiated in the same manner. Third, the present invention provides a method for producing hDF-derived cells. Our hiPSC cell lines exhibited well-defined, typical hESC-like condensed colony morphology. The robustness of this method was demonstrated in 13 different adult hDF This has been validated by the successful generation of multiple hiPSC cell lines from different sources. e.g., mature RNA / miRNA or Sendai virus), and in other cell types (e.g. , blood cells, and urine cells) to see what results this same combination produces. Further research is needed to determine whether this is the case.

[0037] Before hiPSCs can be used for therapeutic purposes, their genomic integrity should be established. For example, Merkle et al. have shown that several hESC cell lines, including H9, The TP53 gene, which encodes the tumor suppressor P53, is a commonly found mutation in cancer. (28) reported that mutations in the first hiP gene were generated. In the SC-based human trial, hiPSCs derived from one of the two patients were harboring minor oncogenic mutations that result in discontinuation of cell treatment in some patients (17) To confirm the genome integrity, we performed karyotyping, q RT-PCR and WES analyses identified five independent hi A PSC cell line (MCL540 in Table C) was analyzed, and four of the five clones Three (C4, N3, C11, and C5) do not contain integrated plasmid DNA and are not cancer-specific. The finding that the gene does not contain a causally implicated somatic mutation is reprogramming method reliably generates clinically viable hiPSC cell lines These four hiPSC clones were identified by Merkle et al. (28). significantly fewer mutations per cell line compared to the 140 more studied hESC cell lines. In particular, these four hiPSC clones were identified in the COSMIC database. The reported genes contained significantly fewer coding variants (Figure 3). Another crucial safety issue facing SC-based therapies is the potential for neoplastic transformation. It is necessary to eliminate residual undifferentiated cells. In this study, we investigated the effect of hPSC-specific B We established a chemical method using quercetin to target IRC5 (40). However, it eliminated undifferentiated PSCs with >99.99% efficiency (Figure 5). Theoretical calculations based on qRT-PCR analysis of the expression of D2 after quercetin treatment showed that 8 We predict 0.0017 undifferentiated cells per 10 million cells. The natural incidence of gliomas of this type is 4.67 to 5.73 cases per 100,000 people. Given that the range of incidence of gliomas is 55, the risk of tumor formation is approximately proportional to the spontaneous incidence of gliomas. This method is simple, effective, and does not require cell sorting or gamma irradiation. (45, 56) and other further manipulations are not required, making it easy to comply with GMP standards. However, quercetin treatment may directly eliminate neural overgrowth from rosette-forming epithelial cells. The fact that quercetin treatment does not result in loss of cells suggests that sufficient in vitro differentiation (e.g. This paper emphasizes the importance of combining the treatment with steroids (for 28 days) (Figure 7).

[0038] The method uses physical separation into high cell density spots to allow a small number of initial cells to grow. and differentiated, efficient in vitro differentiation based on the "spotting" method The protocol results in reduced cell loss compared to traditional confluent monolayer methods. This resulted in a significant reduction in the amount of dead or dying cells, and the production of healthy mDA cells. Importantly, the monolayer culture medium effectively reduces the number of cells per 100 cells, regardless of the frequency of medium changes (Figure 4). This may contribute to poor cell health in monolayer cultures, whereas the ATP-dependent ATP synthesis may be significantly acidic (Fig. 14B). However, the spotting culture medium should not be acidified. Upon further differentiation in vitro, D28 cells matured and by day 47, Dopamine was significantly released (3.1 ng / ml) by day 70, a characteristic of mDAN. These data indicate that the differentiation of 28-day-old oocytes from the oocytes was achieved by day 28 of this differentiation protocol. The cultures consisted mostly of authentic mDAPs and represented a promising source for transplantation. The inventors have scaled up this protocol in a GMP facility. We successfully produced clinically relevant quantities of high-quality mDAP (Figures 22A-22C). F).

[0039] Numerous studies have demonstrated highly efficient differentiation of hESCs / hiPSCs to the mDA phenotype. However, their in vivo efficacy is variable at best. However, there is often little correlation with in vitro data (7). Previous clinical trials have first subjected drugs to extensive functional validation in appropriate animal models. Transplantation of uninfected DA-producing cells has not provided clinical benefit (5, 6). The efficacy of the cell grafts described in [2] has been demonstrated in vivo and in animal models of PD. For example, several criteria were used: (1) sufficient amounts of mDNA were differentiated within the graft; (2) these mDANs target regions within the host striatum; and (3) ataxia in multiple appropriate behavioral tests. This has been confirmed by the substantial improvement in the D28 C4 cells. Taconic athymic rats or Charley rats unilaterally lesioned with dopamine When transplanted into SS River athymic rats, DA yield was high and the grafts were The transplants demonstrated extensive and adequate reinnervation of the structures. This resulted in a complete recovery of DA. , the ratio of transplanted cells to the number of transplanted cells), and the degree of behavioral recovery were significantly different between comparable hiPSCs. This was significantly higher than in the baseline studies (Table 4) (44, 45, 57-64). Notably, the recovery of rotational behavior was maintained for up to 52 weeks (Fig. 19M), and spontaneous rotational behavior was also maintained. Because it is not pharmacologically stimulated, it may be an approximation of clinical PD symptoms. Several tests, including corridor tests, cylinder tests, and stepping tests, A significant recovery was also observed (Figure 8).

[0040] To establish the clinical validity of hiPSC-based personalized cell therapy, therapeutic agents will be developed and tested in established clinical trials. It is important to compare with the established "gold standard." ESCs represent this standard for human pluripotent stem cells, while human fetal VM cells Cells have become the gold standard as a source of transplantable cells for PD. Parmar et al. have evaluated the efficacy of H9-derived guinea pigs in restoring motor function in vivo. By carefully comparing the efficacy of mDA cells with human fetal VM cells, we were able to confirm the efficacy of H9-derived dopamine. This study demonstrated that human fetal VM cells are as effective as human fetal VM cells (53). The study was conducted using both H9 (hESC) and C4 (hiPSC) sources. The same degree and time course of recovery of rotational behavior was confirmed (Fig. 20A). Therefore, these data support the idea that our protocol can be used to generate patient-derived hiPSCs. We strongly believe that the resulting dopamine cells are functionally as effective as fetal VM cells. A recent study by Takahashi et al. showed that in a monkey model lesioned with MPTP, We have exquisitely demonstrated that hiPSC-derived DA cells survive and improve motor behavior (65 ) However, due to the different types of platforms used, these results may differ from those of the present invention. This precludes direct comparison with the studies of the authors. Fresh and cryopreserved C4 D28 cells produced similar yields of viable DA. The resulting improvements in neurons and behavior were observed in hiPSC-derived m DAP can be cryopreserved, stored, and shipped to a surgical center for transplantation. The importance of developing practical, cost-effective clinical treatments is This cannot be emphasized enough.

[0041] Thus, the present method provides a clinically applicable personalized autologous cell therapy for PD.

[0042] Also, U.S. Patent No. 20180371422; U.S. Patent No. 2012012865 No. 5; U.S. Patent No. 20130052268; U.S. Patent No. 20160002 604; U.S. Patent No. 20140199274; and U.S. Patent No. 200 In addition to the specification of U.S. Pat. No. 90226401, U.S. Pat. No. 9657273 and U.S. Pat. See also US Pat. No. 9,750,768.

[0043] Autologous cell generation for cell therapy The methods described herein may be used in conjunction with methods known in the art or described herein. For example, induced pluripotent stem cells similar to neurogenic floor plate cells can be generated using the method described above. In some embodiments, the method may involve the use of human induced pluripotent stem (hiPSC) cells. The method involves collecting an initial sample from a subject, e.g., a subject suffering from PD and in need of treatment for PD. Preferably, the subject is a mammal, e.g., a human. In some embodiments, the somatic cells are fibroblasts. Fibroblasts can be, for example, Using known biopsy techniques, connective tissue within a mammalian body, such as skin, eyelids, ears, etc., may be biopsied. Skin originating from the posterior, scar (e.g., abdominal cesarean section scar), or groin (e.g., Fe (See, e.g., rnandes et al., Cytotechnology. 2016 Mar; 68(2): 223-228) Another source of somatic cells for hiPSCs is hair keratinocytes (Raab et al. ., Stem Cells Int. 2014;2014:768391), blood cells, or bone marrow mesenchymal stem cells (MSCs) (Streckfuss-Bomeke et al., Eur Heart J. 2013 Sep;34(33):2618-29).

[0044] According to this method, cells (e.g., fibroblasts) are induced to reprogram into iPSCs. Other protocols for programming (e.g., those in the art) are available. Although other known methods or methods described herein may be used, in a preferred embodiment The method involves the detection of four transcription factors, namely, Oct4, Sox2, Klf4, and LM. In some embodiments, the method comprises introducing into the cell OCT4, KL yc. Polycistronic episomal vectors expressing F4, SOX2, and L-MYC a target, for example, having an intervening sequence encoding a "self-cleaving" 2A peptide between the coding sequences The method further comprises transfecting an episomal vector containing the 2A peptide. is an 18- to 22-amino acid long protein that mediates the cleavage of polypeptides during translation in eukaryotic cells. 2A peptides are viral peptides. F2A (foot-and-mouth disease virus), E2A (type A virus), rhinitis virus), P2A (porcine teschovirus type 1A), and T2A (zosea Thosea asigna virus 2A), which generally contains the sequence GDVE at the C-terminus Includes XNPGP (SEQ ID NO: 1). See, e.g., Liu et al., Sci Rep. 2017; 7: 2193 The following table provides exemplary 2A sequences:

[0045] [Table 1]

[0046] In some embodiments, the method comprises expressing OCT4, KLF4, SOX2, and L-MYC. To express the 2A sequence of foot-and-mouth disease virus (OCT4-F2A), the cells were transfected with Human Oct4, KLF4, and porcine teschovirus 2A sequence (SOX2-P2A) are linked. Polycistronic epitopes containing the coding sequences of SOX2 and L-MYC The method includes transfecting the vector.

[0047] Reference numbers for exemplary sequences of OCT4, KLF4, SOX2, and L-MYC are , as presented in the table below.

[0048] [Table 2]

[0049] In some embodiments, the method also comprises activating one or more exogenous microRNAs in the cell. , e.g., miR-106a, miR-106b, miR-136s, miR-200c , miR-302s, miR-369s, and one or more of miR-371 / 373 The method may also or alternatively include expressing one or more miR-302s. and five miRNs, including 302a, 302b, 302c, 302d, and 367. A indicates the miR-302 cluster that includes A; any one of them or In a preferred embodiment, the method involves the step of detecting, in a cell, for example, a single epitope. The method includes expressing miR-302s and miR-200c from a recombinant vector. In some embodiments, the method includes delivering miR-302s and miR-200c to a cell. The method comprises introducing an episomal vector containing a sequence encoding

[0050] Exemplary sequences of miRNAs are presented in the table below. The sequences in bold are mature miRNAs. Represents.

[0051] [Table 3]

[0052] The sequences used should be at least 80, 85% identical to the exemplary (reference) sequences presented herein. , 90, 95, or 100% identical, but retain the desired activity of the exemplary (reference) sequence. Calculations of "identity" between two sequences can be performed as follows: The columns are aligned for optimal comparison purposes (e.g., for optimal alignment, Gaps are introduced into one or both of the first and second nucleic acid sequences to form identical (Sequences that do not match may be discarded for comparison purposes.) Sequences to be aligned for comparison purposes The length of the reference sequence is at least 60% (e.g., at least 70%, 80%, 90%, or 100%). The sequences are compared. A position in the first sequence has the same nucleotide as the corresponding position in the second sequence. If the position is occupied by a nucleotide, then the molecules are identical at this position. The percent identity between the two sequences must be determined for optimal alignment. When considering the number of gaps in a sequence and the length of each gap, , a function of the number of identical positions.

[0053] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In some embodiments, the identity pattern between two nucleotide sequences can be achieved using The census uses a gap penalty of 12, a gap extension penalty of 4, and The Blosum 62 rating matrix with a frame shift gap penalty of 5 is The ion concentration is determined using the GAP program in the GCG software package.

[0054] In some embodiments, the method comprises the step of: regulating, in a cell, OCT4, KLF4, SOX2, L-MYC The method includes expressing all of miR-302s, miR-302s, and miR-200c. In one embodiment, the method comprises administering to a cell a recombinant vector containing a 2A sequence of foot-and-mouth disease virus (OCT4-F2A) linked to the 2A sequence of foot-and-mouth disease virus (OCT4-F2A). Human Oct4, KLF4, and porcine teschovirus 2A sequence (SOX2-P2A) a lentiviral vector containing the coding sequences for SOX2 and L-MYC linked to or polycistronic episomal vectors, as well as miR-302s (e.g., (as shown above) and miR-200c (as shown above, or uacugccggguaaugaugga (SEQ ID NO: 21) A step of introducing a vector, for example, a lentiviral vector or an episomal vector Includes flops.

[0055] Primary somatic cells may also be directly transfected, and transfection is performed Before being cultured, the cells may first be cultured, removed from the culture plate, and resuspended. Cells can be transfected, e.g., stably, into their genome. As used herein, "integration" refers to the process by which an exogenous nucleic acid sequence is combined with and processed to integrate the exogenous nucleic acid sequence. The term "transfection" refers to various techniques for introducing exogenous nucleic acids into cells. calcium phosphate precipitates or calcium chloride, all of which are known in the art. Calcium precipitation, microinjection, and DEAE-dextrin-mediated transfection The vector may be a viral vector. In the case of a virus vector, transfection involves transducing viral particles into cells. and

[0056] After introducing these factors into cells, the cells are incubated under conditions that allow expression of the factors and iP S cells, e.g., alkaline phosphatase (AP) and more stringent pluripotency markers The cells were maintained for a time sufficient to induce reprogramming into cells expressing TRA-1-60. (Chan et al., 2009; Tanabe et al., 2013). Many methods are publicly available in the art. see, e.g., Malik and Rao, Methods Mol Biol. 2013;997:23-33 In some embodiments, the conditions include culturing the cells in a medium such as DMEM / F-12, L-glucan, or PEG-40. Glutamate (e.g., 2 mM), serum, e.g., fetal bovine serum (FBS) (e.g., 10%) , non-essential amino acids (NEAA, e.g., 1x concentration), nicotinamide (NAM, e.g., , 1 mM), sodium butyrate (NaB) (e.g., 25 mM), and ascorbic acid ( Alternatively, the cells may be maintained in a medium containing Knockout AA (e.g., 50 μg / ml); Quench DMEM medium with serum replacement, glutamine, and β-mercaptoethanol ( KSR, chemically defined, FBS-free media) may also be used. Those skilled in the art will recognize that other concentrations may also be used. For example, the cells may be incubated for 4-6, e.g., 5-6 days. It is incubated.

[0057] In a preferred embodiment, the cells are cultured on a biological matrix hydrogel support, e.g., MA Basement membrane extracts such as TRIGEL and PATHCLEAR Grade (Amsbio) Basement membrane extracts, or, for example, as described in Nguyen et al., Nat Biomed Eng. 2017;1. pii: 0096 Other synthetic alternatives, such as using about 10 μl of gel, Discrete regions, preferably substantially circular, having a diameter of 2 to 10 mm, e.g., about 5 mm. or into oval-shaped areas (also referred to herein as "spots"). The spots are arranged in a manner that maintains separation between the spots (the spots do not touch each other). For example, droplets of an appropriate volume are placed on a plate at intervals of about 1-3 cm, e.g. For example, this can be done by placing the cells on the intersections of a 2 x 2 cm grid (Figure 11C). For example, about 10 μl of gel is used to apply a spot having a diameter of about 2 to 10 mm, for example, about 5 mm. The tubes can be placed onto the grid intersections of a gridded culture plate. Incubation for 10 to 60 minutes, for example, 25 to 45 minutes, for example, about 30 minutes. After application, the gel is partially aspirated from the spot (stop before the gel is completely dry). The gel layer is left in the spot. Plates (e.g., with gel spots as described herein) are also presented. After the spots are prepared, the cells are then plated onto a plate containing, for example, about 5,000 cells per spot. At a density of about 20,000 cells, e.g., about 10,000 cells, e.g., about 10 μl of cell suspension The cells are seeded at a density of 10,000 cells per μl.

[0058] After reprogramming into iPSCs, the cells can be optionally divided into, for example, (1) three germ layer matrices; Markers (ectodermal marker, OTX2; endodermal marker, SOX17; and (2) staining with antibodies against mesodermal marker BRACHYURY; Specific markers (e.g., PAX6 and MAP2 for ectoderm, MAP2 for endoderm) FOXA2, SOX17, and CK8, and MSX1, MYL2A for mesoderm until the formation of ES-like colonies, which can be identified by gene expression of COL6A1, COL6B2, and COL6A2. For example, DMEM / F-12, L-glutamine (e.g., 2 mM), KSR (e.g., 2 0%), NEAA, NAM, NaB, and bFGF. In some embodiments, the iPSC cells may be cultured in ESSENTIAL 8 medium or Its equivalents, i.e., DMEM / F-12, L-ascorbic acid, selenium, trans containing spherin, NaHCO3, insulin, FGF2, and TGFβ1, or Maintain in an equivalent consisting essentially of these, e.g., Chen et al., Nat Methods 8(5): See 424-429.

[0059] Once iPS cells are generated, they can be maintained as iPS cell lines. In an embodiment, multiple iPSC cell lines are generated and characterized for each patient, and then Good cell lines (e.g., one, two, three, or more of the best cell lines) are selected. will be done.

[0060] Also referred to herein are cells produced by the methods described herein, e.g., iPS cells. Cell lines and compositions comprising the cells are also presented.

[0061] viral vectors Viral vectors for use in the methods and compositions include recombinant retroviruses. viruses, adenoviruses, adeno-associated viruses, and lentiviruses.

[0062] In this method, a preferred viral vector system useful for delivery of nucleic acids to the inner ear is , adeno-associated virus (AAV). AAV is a microorganism with a capsid of 25 nm. are non-enveloped viruses known to be related to wild-type viruses or There are no known diseases associated with AAV. AAV has a single-stranded DNA (ssDNA) genome. AAV has been shown to exhibit episomal, long-term transgene expression. AAV has been shown to provide excellent transgene expression in the brain, particularly in neurons. AAV vectors containing as few as 300 base pairs have been shown to be effective in The space for exogenous DNA is limited to approximately 4.7 kb. Described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985) AAV vectors, such as those described in A variety of nucleic acids have been introduced into different cell types using AAV vectors (e.g., Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); t al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51:611-619 (1984); and Flotte et al. (See, e.g., J. Biol. Chem. 268:3781-3790 (1993)). Numerous alternative AAV mutations AAV mutants (more than 100 AAV mutants have been cloned), and AAV mutants They have been identified based on desirable characteristics. For example, AAV9 efficiently crosses the blood-brain barrier. Furthermore, AAV capsids have been shown to be capable of expressing AAV vectors, for example, biotinylated AAV vectors. -, directed molecular evolution, self-complementary AAV genomes, etc., to increase transduction efficiency and selectivity In some embodiments, AAV1 is used.

[0063] Alternatively, retroviral vectors and adeno-associated viral vectors are also used in v Recombinant gene delivery system for the introduction of exogenous genes in vivo, particularly into humans - Patent Application 20070122997 These vectors provide efficient delivery of genes into cells, The introduced nucleic acid is stably integrated into the host chromosomal DNA. The development of specialized cell lines (called "packaging cells") that produce only the virus has Increasingly, the therapeutic utility of retroviruses has led to the development of defective retroviruses, which are genetically modified. It has been characterized for use in therapeutic gene transfer (see review (See Miller, Blood 76:271 (1990)). Replication-defective retroviruses are Techniques can be used to infect target cells through the use of helper viruses. Recombinant retroviruses can be produced and expressed in vitro. or in vivo, to infect cells with such viruses. Tocols are based on Ausubel, et al., eds., Current Protocols in Molecular Biology, Green e Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. Examples of suitable retroviruses are known to those skilled in the art, such as pL Ecotropic retroviral systems, including pJ, pZIP, pWE, and pEM. A packaging virus suitable for preparing both the avian and amphotropic retroviral systems is Examples include ΨCrip, ΨCre, Ψ2, and ΨAm. Retroviruses are In vitro and / or in vivo, various genes are expressed in various cells, including epithelial cells. It has been used to transduce many different cell types (e.g., Eglitis, et al. (1985) S science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:64 60-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; t al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Ge ne Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-1089 5; Hwu et al. (1993) J. Immunol. 150:4104-4115; U.S. Patent No. 4,868,116 Details; U.S. Patent No. 4,980,286; PCT Application WO 89 / 07136 No. brochure; PCT application WO 89 / 02468 brochure; PCT application country PCT Publication No. WO 89 / 05345; and PCT Application WO 92 / 0757 (See Brochure No. 3).

[0064] Another viral gene delivery system useful in the present method is an adenovirus-derived vector. The adenoviral genome encodes and expresses a gene product of interest. However, they are not capable of replicating in the normal lytic viral life cycle. See, e.g., Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al. , Science 252:431-434 (1991); and Rosenfeld et al., Cell 68:143-155 (1992). Those skilled in the art will appreciate that the adenovirus strain Ad type 5 dl324, or other adenoviruses Suitable adenoviruses derived from various strains (e.g., Ad2, Ad3, or Ad7) Recombinant adenoviruses can, under certain circumstances, be transformed into non-dividing cells. It is capable of infecting a wide variety of cell types, including epithelial cells. This may be advantageous in that it can be easily transferred to the virus particles (Rosenfeld et al., (1992) supra). is relatively stable, amenable to purification and concentration, and, as mentioned above, does not affect the infectivity spectrum. In addition, the introduced adenoviral DNA (and the The foreign DNA contained in the vector is not integrated into the genome of the host cell but remains episomal. Therefore, the introduced DNA is integrated into the host genome (e.g., retroviruses DNA), potential consequences of in situ insertional mutagenesis Furthermore, the capacity of the adenoviral genome to carry foreign DNA is comparable to that of other They are large (up to 8 kilobases) compared to gene delivery vectors (Berkner et al., supra; H aj-Ahmand and Graham, J. Virol. 57:267 (1986)).

[0065] Differentiation into mDAP / mDAN In some embodiments, the method comprises generating mDAPs or mDANs as follows: For bottom plate induction, after transfection, cells were incubated in 15% KSR, Culture the cells in DMEM medium supplemented with glutamine and β-mercaptoethanol for approximately 6 days (days 1-6). The neural progenitor cell induction stage was continued from day 6 to day 12 (D6 to D1). 2) Cells were cultured in 11.5% KSR, 0.25% N2 (days 6-8), 7.5 % KSR, 0.5% N2 (days 8-10), 3.75% KSR, L-glutamine, 0.75% N containing β-mercaptoethanol and non-essential amino acids (NEAA) Maintain in DMEM medium with 2 (days 10-12). For example, on days 1-1, respectively. On day 2 and days 1–8, 0.2 μM LDN19, a dual Smad inhibitor, was administered. 3189 and 10 μM SB431542 may be added. For example, on the second day On day 10, administer one or more SHH agonists (e.g., 2 μM purmorphamine and and 100ng / ml Shh) may be added together with 100ng / ml FGF8. A Wnt signaling activator, such as CHIR99021 (1 μM), was administered to, for example, For example, the cells may be incorporated between days 4 and 12. On day 9, the cells are treated with, for example, 40 μM Quercetin, for example, for 6-24 or 12-18 hours, e.g., for 16 hours This may be processed in a similar manner.

[0066] For the DA progenitor induction / maturation stage (day 12+), cells are N2, BDN F (e.g., 20 ng / ml), GDNF (e.g., 20 ng / ml), dbcAMP ( e.g., 500 μM), ascorbic acid (e.g., 200 μM), TGF-β3 (e.g., , 10 ng / ml) or gamma secretase inhibitors (e.g., DAPT, e.g., 10 μ M), and with a Wnt agonist (e.g., CHIR99021, e.g., 1 μM). They can be maintained in supplemented DMEM:F12 medium for approximately 12-15 days.

[0067] At about day 15, the cells in the spot are harvested and then lysed using, for example, EDTA. The cells may be chemically, enzymatically, or mechanically dissociated, and the single cell suspension may be For example, poly-L-ornithine / fibronectin / laminin coating (PLO / FN On day 15, the cells can be reseeded in a medium such as N2. BDNF (e.g., 20 ng / ml), GDNF (e.g., 20 ng / ml), d bcAMP (e.g., 500 μM), ascorbic acid (e.g., 200 μM), and T DMEM:F12 with growth factors including GF-β3 (e.g., 10 ng / ml) was applied. A ROCK inhibitor, for example, Y-27632 (for example, 10 μM), can be used to inhibit the dissociation of The cells can then be added and then removed. and / or until the induction of mDA neurons (mDANs), e.g., the mDAP marker ( expression of genes (e.g., OTX2, LMX1A, and EN1) and / or mDNA markers - at least 21-28 sufficient for expression of genes (e.g., TH, DAT, and PITX3) The cells can be maintained in culture for days.

[0068] Those skilled in the art will appreciate that other reagents and concentrations may also be used. For example, SH H agonists include purmorphamine, oxysterols, and Smoothened A number of Wnt agonists are presented in Table A, including agonist (SAG).

[0069] [Table 4-1]

[0070] [Table 4-2]

[0071] Other gamma secretase inhibitors include RO4929097; DAPT(N-[(3,5- Difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine-1,1-di Methyl ethyl ester; L-685458 ((5S)-(t-butoxycarbonylamine) (4R)-6-phenyl-(4R)hydroxy-(2R)benzylhexanoyl-L-le uL-phe-amide); BMS-708163 (avagacestat); BMS-29 9897 (2-[(1R)-1-[[(4-chlorophenyl)sulfonyl](2,5-di Fluorophenyl)amino]ethyl-5-fluorobenzenebutyrate);MK-0752;Y O-01027;MDL28170(Sigma);LY411575(N-2((2S )-2-(3,5-difluorophenyl)-2-hydroxyethanoyl)-N1-((7 S)-5-Methyl-6-oxo-6,7-dihydro-5H-dibenz[b,d]azepine -7-yl)-l-alaninamide, see US 6,541,466); ELN -46719 (the 2-hydroxy-valeric acid amide analog of LY411575 (wherein LY 411575 is 3,5-difluoro-mandelic acid amide) (U.S. Pat. No. 6,544,454 No. 1,466); PF-03084014 ((S)-2-((S)-5,7-di Fluoro-1,2,3,4-tetrahydronaphthalen-3-ylamino)-N-(1-( 2-methyl-1-(neopentylamino)propan-2-yl)-1H-imidazole- 4-yl)pentanamide, Samon et al., Mol Cancer Ther 2012;11:1565-1575); Compound E ((2S)-2-{[(3,5-difluorophenyl)acetyl]amino}-N- [(3S)-1-methyl-2-oxo-5-phenyl-2,3-dihydro-1H-1,4 -benzodiazepin-3-yl]propanamide; WO 98 / 28268 Lett.; and Samon et al., Mol Cancer Ther 2012;11:1565-1575); and semagacestat (LY450139; (2S)-2-hydroxy-3-methyl- N-((1S)-1-methyl-2-{[(1S)-3-methyl-2-oxo-2,3,4 ,5-tetrahydro-1H-3-benzazepin-1-yl]amino}-2-oxoethyl a ganic acid selected from the group consisting of: a ganic acid ester, ... Contains a secretase inhibitor.

[0072] Also provided herein are cells produced by the methods described herein, e.g., mDA P or mDAN cells, and compositions comprising the cells are also provided.

[0073] The method is exemplified for differentiation of iPSCs into dopaminergic neurons, but The potting method has been used in differentiation protocols for other cell types, including other neuronal types. Numerous neuronal differentiation protocols are known in the art. ;For example, Salimi et al., Mol Biol Rep. 2014 Mar;41(3):1713-21;Gunhnlar et al., Molecular Psychiatry 23:1336-1344 (2018);Trilck et al., Methods Mol Biol. 2016; 1353:233-59;Zhang et al., Stem Cell Res Ther. 2018 Mar 15;9(1):67;D'Aiuto et al. al., Organogenesis. 2014;10(4):365-77;Marton and Ioannidis, Stem Cells Translat ional Medicine 2019;8:366-374;Bell et al. Bio-protocol 9(5): e3188 (2019). DOI: 10.21769 / BioProtoc.3188;Bianchi et al., Stem Cell Research 32:126-134 (2018) Please refer to.

[0074] Treatment The mDAPs and mDANs produced using the methods described herein can be, for example, may be used as a cell model for Parkinson's disease (PD) (or PD Such subjects may be used to treat subjects (at risk of developing a disorder) who are at high risk of developing a disorder. These may be identified by those skilled in the art of medical care delivery using methods known in the art. The method includes the steps of obtaining primary somatic cells; generating a cell population containing mDAP; and Preferably, the primary somatic cells have PD (or P D), obtained from the subject to be treated, but in some embodiments, from cells The cells are preferably from a different subject, preferably from the same species as the subject being treated (i.e., autologous cells). Preferably, it is obtained from an immunologically matched subject. The method described herein allows for the identification of cells expressing one, two, or more mDAP markers ( For example, FOXA2, OTX2, LMX1A, and EN1, e.g., FOXA2 and LMX1A; optionally, TH co-expressing FOXA2, LMX1A, and NURR1 + cells), and optionally one, two, or more mDAN markers (e.g., These include cells that express genes that are specific for the TH, DAT, and PITX3, but not SOX1, PAX6, Sufficient mDAP was produced to generate a population free of cells expressing KI67 and KI67. do.

[0075] The cells are administered using methods known in the art. In some embodiments, the cells are to the affected region of the subject's brain using, for example, magnetic resonance imaging-guided stereotaxic surgery. Directly or in the vicinity, for example, on both sides, of one of the caudate nucleus, putamen, and substantia nigra For example, Garitaonandia et al., Stem Cells Dev. 2018 Jul 15;27(14):951-957;Kikuchi et al., Nature 548 : 592-596 (31 August 2017);MOrizane et al., Nature Communications 8:385 (2017);Sonntag See et al., Prog Neurobiol. 2018 Sep;168:1-20.

[0076] Culture dish Also provided herein are culture dishes for use in the methods described herein. The dish is presented with a grid at the bottom, with the distance between the lines being 1.5-2.5 cm. The grid may be, for example, about 2 cm, e.g., 2 x 2 cm. For example, it may be formed as part of the dish, printed or etched into the bottom. Culture dishes can be made using conventional injection molding or thermoforming techniques, for example, as known in the art. The method may be carried out in accordance with the known art, and any material acceptable for the culture dish, e.g., polystyrene. Polyethylene, Polypropylene, Polycarbonate, and Polyvinyl Thermoplastics It can be made using resin. Another suitable material is glass. In some embodiments, The dish may have a substantially flat bottom; alternatively, at the intersections of the grid lines, e.g. , a diameter of about 2 to 10 mm, for example, about 3 to 7 mm, for example, about 5 mm, a circular or There may also be oval depressions or depressions. The depressions may be, for example, 0.01 to 0.2 m. In some embodiments, the dish may be a biomatrix hydrogel. The matrix has a basement membrane extract or synthetic matrix.

[0077] In some embodiments, the culture dish with the grid is used for seeding cells. These are 10- or 6-cm round culture dishes with 12 or 6 intersections, respectively. The distance between cell placement areas (from the center of a spot to the center of an adjacent spot) was 2 cm. The diameter of the cell spot is 0.5 cm, the perimeter is about 1.57 cm, and the area is , about 0.2 cm 2 Therefore, at the intersection of the grid lines, For a 10cm dish, there are only 6 possible spots, and for a 10cm dish, there are 12 There are possible spots. [Example]

[0078] The following examples are not intended to limit the scope of the invention, as defined in the claims. The present invention will now be further described.

[0079] material and method In the examples below, the following materials and methods were used:

[0080] The antibodies and reagents used are shown in Table B.

[0081] [Table 5-1]

[0082] [Table 5-2]

[0083] [Table 5-3]

[0084] [Table 5-4]

[0085] biopsy Under an IRB-approved protocol (IRB partner number: 2010P001100), Skin biopsies (Table C) were taken from 10 healthy subjects and 1 sporadic PD patient.

[0086] [Table 6]

[0087] experimental animals The strain details and number of animals within each group are as follows: Athymic rats (NTac:NIH-F) were lesioned with 6-hydroxydopamine. oxn1 rnu , Taconic Biosciences), male, 12-14 weeks old. Thymic rat (Crl:NIH-Foxn1 rnu , Charles River stock code No. 316), male, 12-14 weeks old. NOD-SCID (NOD.CB17-Prkd c scid / NCrCrl, Charles River stock code number: 394), male Males and females, 8-10 weeks old. All animals were kept under 12-h light and dark with sterile food and water ad libitum. They were housed in ventilated cages under a dark cycle.

[0088] cell culture Human BJ dermal fibroblasts (hDF) and HEK293T cells were purchased from ATCC. The cells were grown according to a previously published protocol (19). To achieve this, infected cells were cultured in DMEM / F-12, 2 ml of PBS, for 5 days after transfection. M L-glutamine, 10% FBS, 1x NEAA, 1mM NAM, 25mM Maintain in induction medium containing 50 μg / ml NaB, and 50 μg / ml AA, then DME M / F-12, 2mM L-glutamine, 20% KSR, 1x NEAA, 1mM hiPSC culture medium containing 10 mM NAM, 25 mM NaB, and 10 ng / ml bFGF The H9 hESC cell line was obtained from the WiCell Institute. All hiPSC cell lines were cultured using Matrigel matrix. Maintain in Iial 8 medium and use 0.5 mM EDTA solution for gentle dissociation. All hESC cell lines were subcultured using Matrigel matrix. The cell lines used in this study were maintained in TeSR™1 medium. A database of commonly misidentified cell lines maintained by NCBI Biosample All cell lines were tested for interspecies determination (isoenzyme analysis and STR The product is certified by the supplier through the analysis and, by regulation, is inspected for mycoplasma detection. I was hit.

[0089] Generation of human iPSCs To generate lentivirus-based hiPSCs, incubate the cells overnight with Y4 factor (OCF) T4, SOX2, KLF4, and c-MYC; Gustavo Mostoslavs ky) and / or individual lentiviruses containing miRNAs vector, or polycistronic STEMCCA vector-derived lentivirus The next day, the medium was replaced with induction medium and the cells were incubated for 5 days. On day 6, the cells were fed with hiPSC medium and cultured in ES-like culture medium. The cells were maintained in this medium until the formation of ronnies. Any ESC-like colonies observed were manually picked. The cells were then cultured in Essential 8 medium on Matrigel-coated tissue culture plates. These cells were then introduced into the soil to generate hiPSC cell lines.

[0090] To generate hiPSCs based on the episome system, we used Neon transfection. Using the reprogramming system, cells were transfected with the pCXLE vector to express the reprogramming factors. and then electroporated at 10 μM on Matrigel-coated 6-well plates. The next day, the cells were incubated for an additional 5 days in hDF medium supplemented with Y-27632. The cells were fed with induction medium.

[0091] Plasmid construction and lentivirus production miR-17 / 92, miR-106a, miR-106b, miR-200c, mi For miR-302s, miR-369s, and miR-371 / 373, individual miRs were The coding sequence of the RNA was PCR amplified from H9 hESCs and inserted into the pGEM-T Easy vector. The sequences were confirmed by sequencing. The miRNA coding sequence was then introduced into the EcoRI site of the FUW-tetO vector. Polycistronic markers expressing OCT4, KLF4, SOX2, and L-MYC were introduced. Nick the foot-and-mouth disease virus 2A sequence (OCT4-F2A) for episomal vectors Human Oct4, KLF4, and porcine teschovirus 2A sequence (SOX2- P2A) and the coding sequence of L-MYC were extracted from H9 hESCs. PCR amplification and then transfection into a modified pCXLE episomal vector that does not contain the EGFP sequence. The miR-302s and / or miR-200c-expressing genes were introduced sequentially. For the p53 vector, coding for human miR-302s or human miR-200c The sequence was introduced into a modified pCXLE vector.

[0092] Lentivirus production was previously described with slight modifications ( Cha et al., 2017 Nat Cell Biol 19:445-456). Briefly, P Using PolyJet transfection reagent, lentiviral vectors were transfected into 293T cells. The vector was cotransfected with packaging plasmids containing pMD2.G and psPAX2. The lentivirus was transfected into the cells and maintained in DMEM supplemented with 10% FBS. The containing supernatant was collected 48 hours after transfection and purified by filtration using a 0.45 μm Millipore filter. Cell debris was removed by filtration through an ex-HV (Millipore) filter. .

[0093] hiPSC formation assay For staining with TRA-1-60, cells were incubated in 4% formaldehyde for 5 min. The cells were fixed in PBS, washed, and then incubated with anti-TRA-1-60 antibody (1:500). The cells were incubated overnight at 4°C. After washing three times with PBS, Cells were incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (1: The cells were incubated with 0.1% Triton X-10 in PBS for 1 hour. After three washes with n X-100, 3,3'-diazomethane was added according to the manufacturer's instructions. Cells were stained with dibenzobenzidine (DAB). For AP staining, fixed cells were Wash with PBS and then rinse with alkaline phosphatase substrate, NBT / BCIP solution. Following staining, the reaction was stopped by washing three times with PBS.

[0094] Live cell metabolic analysis Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured according to the manufacturer's instructions. The measurements were performed using an XFp analyzer (Agilent Technologies). Briefly, cells were seeded into the wells of an XF mini-plate and incubated under CO2. The assay was performed in a non-CO atmosphere. 2 incubator, 10 mM glucose, 5 mM sodium pyruvate, and Equilibrated for 1 hour in XF assay medium supplemented with 2 mM L-glutamine. The experiment was carried out after 1 μM oligomycin (Oligo), 2 μM FCCP, and 0 via sequential injection of 0.5 μM antimycin A / rotenone (Anti / Rot) Mitochondrial activity in DFs was monitored to determine basal respiration (= baseline OCR-An) ti / Rot OCR), ATP turnover (=basal respiration - Oligo OCR), maximum respiration Respiratory reserve (=FCCP OCR - Anti / Rot OCR), and oxidative reserve capacity (=maximal respiration) -basal respiration) was calculated using the Bradford protein assay. Values ​​were normalized to the total protein quantified.

[0095] Quantitative RT-PCR To extract total RNA, cells were lysed with Trizol according to the manufacturer's recommendations. RNA was isolated using a Nanodrop ND-1000 spectrophotometer (NanoDro RNA concentrations were measured using SuperScreen™ (Promega Technologies). RNA was reverse transcribed using ipt II with an oligo dT primer. For immunoquantitative RT-PCR, we used the SsoAdvanced Universal rsal SYBR Green Supermix and CFX Connect Reactions were carried out on a Real-Time System (Bio-Rad). PCR amplification was performed using specific primers (Table D). Expression of target genes was determined by normalization against chromatin actin.

[0096] [Table 7-1]

[0097] [Table 7-2]

[0098] [Table 7-3]

[0099] [Table 7-4]

[0100] Karyotype analysis To assess the number and structure of human iPS cell chromosomes, human iPS cells were cultured in a standard Cell Line Genetics, Inc. (M The document was sent to the company in Washington, D.C.

[0101] Detection of episomal plasmids Thermo Scientific Gene JET Plasmid Mini The prep kit isolates the cytosolic plasmid and the remaining vectors that were not integrated. 2 μl of each 20 μl extract was incubated with EBNA-1 specific proteins. with primer, 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds Genomic DNA was used for routine PCR amplification with 30 cycles of PCR. Plasma was prepared using the DNeasy Blood & Tissue kit manufactured by EN. To detect sequences derived from the EBNA-1 promoter, we used the same PCR conditions and EBNA-1 promoter. GAPDH primers were used as input controls. EBNA Primer sequences for -1 and GAPDH are presented in Table D.

[0102] DNA fingerprinting Genomic DNA was extracted using the QIAamp DNA FFPE Tissue Kit. Extracts from cells were prepared in a total volume of 20 μl using standard buffer conditions, 0.2 μg of DNA, and and GoTaq DNA polymerase, denatured at 95°C for 30 seconds, and then denatured at 55°C for 30 seconds. 35 cycles with annealing for 30 seconds and extension at 72°C for 1 minute PCR was performed using the primers listed in Table D.

[0103] Whole-exome sequencing As a result of fibroblast reprogramming and passaging of reprogrammed iPSCs To identify somatic mutations resulting from the mutations, we analyzed >1,400 cancer-associated genes. Provides extended coverage of >8,000 medically relevant genes, including Using the Personalis ACE WES service, fibroblasts and 4 We performed WES on two iPSC cell lines (Patwardhan et al. 2015. Genome Med 7:71). The average depth of coverage for the target region was 75x across all samples. For the four iPSC cell lines, we used MuTect2 to Paired analyses were performed on fibroblasts and each iPSC cell line to identify somatic cell proliferation. Mutations were detected (Cibulskis et al., 2013. Nat Biotechnol 31:213-219).

[0104] Sequencing reads were analyzed using the BWA-MEM program (version 0.7.15 ) against the GRCh38 reference genome, including alternative contigs and decoys. The sequences were aligned using the same sequence (Li and Durbin, 2010. Bioinformatics 26:589-595). The scanned reads were analyzed using the SAM tool (version 1.3.1) (Li et al., 2009). ioinformatics 25:2078-2079), Picard tools (broadinstitute.github.io / picar d, version 2.5.0), and Genome Analysis Tool Kit (GATK) software (version 3.6) (DePristo et al. 2011). Nat Genet 43:491-498), further processing the BAM files ready for analysis. In GATK, the MuTect2 module was used to generate the iPSC cell lines. were analyzed for somatic mutations in comparison with fibroblasts (Cibulskis et al., supra). a). Ensembl Variant Effect Predictor(vers) ion GRCh38.89) (McLaren et al., 2016. Genome Biol 17:122) We then annotated the identified somatic mutations and analyzed their effects on gene transcription and transcription. The consequences of this on protein production were investigated. In total, we obtained 20 or more high-quality effective alignments across all samples. Only mutations found within regions well covered by the primary read were included in the somatic mutation analysis. Among the candidate somatic mutations, the inventors identified Exome Agg regation Consortium (ExAC) database (Lek et al. 2016. Nature 536:285-291) with a maximum minor allele frequency >0.01% Potential germline variants were filtered out by excluding the remaining somatic mutations. For candidates, the inventors used the Catalogue of Somatic Mutations ions In Cancer(COSMIC)(cancer.sanger.ac.uk, version n 80) (Forbes et al. 2017. Nucleic Acids Res 45:D777-D783), and Canc er Gene Census (CGC) database (Futreal et al. 2004. Nat Rev Cancer 4:177-183) and identified frequently reported mutations and Genes were identified using ngCGH (github.com / seandavi / ngCGH, version 0.4 .4), and the Personalis ACE Cancer Exome Pipeline (Personalis, Inc., CA) for copy number variation (CNV) Using the results of the analysis, we will identify chromosomal aberrations and other interregional copy number variations. The present inventors investigated the genome using the Integrated Genome Viewer (ve All CNV candidates were identified for read alignment using the , and was examined visually.

[0105] Quercetin treatment To investigate the effect of quercetin on human iPSC collection, The cells were seeded in a 6-well plate. The cells were incubated with various concentrations of quercetin (5, 10, 20, 40 , and 100 μM) for 2, 6, 16, and 24 hours. After this time, the quercetin-containing medium was replaced with fresh medium, and the cells were incubated for 1 hour at 4°C for 1 hour. The cells were cultured for 48 hours. TrypLE was used to dissociate the cells, and trypan blue was used. Cell viability was measured using the -exclusion method and a hemocytometer.

[0106] Flow cytometry All were performed using the BD Accuri C6 system (BD Bioscience). FACS analysis was performed on TrypLE and data analysis was performed according to the manufacturer's instructions. Dissociate human iPS cells using either HCl or Accutase and place them on a 70 μm plate. The single cell suspension was first filtered through a cell strainer. The cells were fixed for 10 minutes in PBS and suspended in permeabilization buffer on ice for 15 minutes. After blocking for 30 minutes, the cells were incubated with labeled primary antibodies (PE-conjugated anti- SSEA-4, PE-conjugated anti-TRA-1-60) in the dark on ice for 1 hour. After washing with PBS containing 1% FBS, the cells were incubated for 1 h. Fluorescent dye-matched isotype controls were used and subtracted during analysis.

[0107] For cell loss / yield analysis, monolayer-based culture dishes or spotting The supernatant was collected from the culture dish and subjected to FACS. Particle numbers were calculated and total cell numbers were obtained based on the ratio of 100 μl to the total supernatant volume.

[0108] Detection of the presence of undifferentiated cells Using three different methods, a mixture of undifferentiated C4 cells was cultured at 100,000 total cells. , by 10 times (10 5 , 10 4 , 10 3 , 10 2 , 10 1 , and 10 0 fold) hDF For colony formation assays, each cell was serially diluted in The diluted solution was cultured in E8 medium for 6 days, and pluripotent colonies were identified by AP staining. To collect undifferentiated cells using quercetin, cells were incubated with 40 μM quercetin. The cells were treated for 16 hours and cultured in fresh E8 medium. ) Dissociate C4 cells using TrypLE and strain through a 70 μm cell strainer. First, the single cell suspension was diluted with 4% formaldehyde for 10 minutes. The cells were fixed for 15 minutes and suspended in permeabilization buffer on ice for 30 minutes. After blocking, the cells were incubated with labeled primary antibodies (PE-conjugated anti-SSEA-4, PE-conjugated anti-TRA-1-60) for 1 hour on ice in the dark. After washing with PBS containing 1% FBS, the cells were incubated in a BD Accuri C6 FACS analysis was performed using a system (BD Bioscience) and according to the manufacturer's instructions. Data analysis was performed according to the manufacturer's instructions. Fluorochrome-matched isotype controls were used for analysis. For qRT-PCR assay, total RNA was extracted from all dilutions. The cycle time (Ct) of OCT4 was determined by qRT-PCR. Copy number was calculated using a curve equation generated from qRT-PCR of purified OCT4 partial sequences. The OCT4 copy number was then plotted against the number of PSCs.

[0109] Preparation of spot-type dishes As shown in Figure 13B, it consists of two horizontal lines and three vertical lines. A grid of 10μm pixels is drawn on the bottom of a 6cm dish, resulting in six intersections. 1 ml of unheated Matrigel was loaded at each intersection to provide a defined spot coating. The spotted dish was incubated at 37°C for at least 30 minutes. The plates were incubated for 1 hour, and the Matrigel was aspirated immediately before seeding the cells. Uniformly suspended cells were placed in a cell culture dish at a density of 730 × 10 cells per dish. 3 In contrast to the normal seeding conditions, the spotted dish is seeded at a density of 1000 cells / cm². 40 x 10 per 10 μl 3 10 x 10 cells per 10 μl spot 3 Pieces, Spot 1 2.5 x 10 per 0 μl 3 The specimens were then spotted (spotting condition).

[0110] Differentiation of mDA progenitor cells The differentiation medium conditions and all morphogen factors are shown in Figure 5A. No antibiotics were used throughout the study. For the floor plate induction stage (days 1-6), we DMEM medium containing 15% KSR, glutamine, and β-mercaptoethanol was used. For the neural progenitor cell induction stage (days 6-12), we used 11.5% KS. R, 0.25% N2 (days 6–8), 7.5% KSR, 0.5% N2 (days 8–10) eyes), 3.75% KSR, L-glutamine, β-mercaptoethanol, and non-essential DMEM medium with 0.75% N2 (days 10-12) containing amino acids (NEAA) Dual Smad inhibition was used on days 1-12 and 1-8, respectively. The inhibitors, 0.2 μM LDN193189 and 10 μM SB431542, were added. From day 2 to day 10, the cells were cultured in a SHH agonist-inducible medium containing 100 ng / ml FGF8. The cells were treated with 2 μM purmorphamine and 100 ng / ml Shh. CHIR99021 (1 μM), a t signaling activator, was administered from day 4 to day 12. On day 9, cells were treated with 40 μM quercetin for 16 hours. For the DA progenitor induction / maturation stage (day 12+), DMEM:F12 medium was used. 2 supplements, 20ng / ml BDNF, 20ng / ml GDNF, 500 μM dbcAMP, 200 μM ascorbic acid, 10 ng / ml TGF-β3, Supplemented with 10 μM DAPT and 1 μM CHIR (days 12–15). On day 1, cells were dissociated with 0.5 mM EDTA and the single cell suspension was incubated with poly-L- In a lunitin / fibronectin / laminin coated dish, After the 15th day, the cells were reseeded at approximately 2.5 million cells per day. The compounds were 20ng / ml BDNF, 20ng / ml GDNF, 500μM db cAMP, 200 μM ascorbic acid, and 10 ng / ml TGF-β3 were applied. At the time of harvest, 10 μM Y-27632 was added to the medium.

[0111] immunocytochemistry hiPSC-derived dopaminergic neurons were cultured in phosphate-buffered saline (PBS) ( Ca 2+ and Mg 2+ ) and then rinsed with 4% formaldehyde in PBS (pH 7.4). The cells were fixed with blocking solution (0.3% Tr in PBS) for 10 minutes. Incubate in 1% ethanol (Iton X-100, and 1% horse serum) at room temperature for 1 hour. The cells were incubated in a 1% Triton X-100 buffer containing 0.3% Triton X-100 and 1% horse serum. The cells were then incubated overnight with primary antibodies in PBS containing 1000 ng / ml of nuclei. with the appropriate fluorescently conjugated secondary antibody, along with Hoechst 33342 for staining. The cells were incubated together at room temperature for 1 hour. Cell images were taken using a confocal microscope (Japan Data on specific cell populations were obtained from Imaging The apoptotic cells were determined from microscopic images using eJ software (11). To measure apoptosis, cells were incubated with cleaved caspase 3 and D. The cells were stained for Hoechst 33342, a NA-binding nuclear dye. After staining with t33342, the compacted chromatin is more condensed than normal cells. Condensed nuclei were counted by fluorescence microscopy. Data on cell populations were determined from microscopic images using ImageJ software. .

[0112] High-performance liquid chromatography (HPLC) analysis On day 47 of differentiation, the supernatant was collected and centrifuged at 300 x g for 5 minutes to separate the cells. Debris was removed. Samples were immediately stored at -80°C and analyzed for DA and DOPAC levels. For reversed-phase HPLC with electrochemical detection to determine the The samples were sent to the city's HPLC Bioanalytical Core. The supernatant was then transferred to a microcentrifuge tube equipped with a fresh 0.22 μM PVDF filter. Any remaining particulate matter was removed by spin filtering at 5000 rpm for 5 minutes at 4°C. The monoclonal antibody was detected by reversed-phase HPLC with electrochemical detection. Amine concentrations were determined using an ESA 584 pump and an ESA ESA 5600A CoulArra equipped with a 542-type refrigerated automatic sampler The detection system used was an MD-150 equipped with a C18 column guard cartridge. The separation was carried out using a 3.2 mm x 3.2 mm C18 column at 25°C. The mobile phase was pH 2. 0.95, 1.5mM sodium 1-octanesulfonate, 75mM NaH2PO4 , 0.025% triethylamine, and 8% acetonitrile. 25 μl was injected. The sample was eluted isocratically at 0.4 mL / min using a 5020 guard cell. Detection was performed using a 6210 electrochemical cell (ESA, Bedford, MA) equipped with The guard cell potential was set to 500 mV, while the analysis cell potential was set to -175, 200 , 350, and 425 mV. Retention time standards were set using known standards (Sigma). a Chemicals Co., St. Louis, MO) The analytes were identified by comparing the peak area with that of the standard on the dominant sensor. The compounds were quantified by comparison.

[0113] electrophysiology For electrophysiological recordings, place 70 day old dopaminergic cells into the recording chamber. , 95% O2 and 5% CO2, continuously bubbled, 130 mM Na Cl, 2.5 mM KCl, 2.5 mM CaCl2, 1 mM MgSO4, 1.25 mM The artificial brain was composed of 10 mM Na2HPO4, 26 mM NaHCO3, and 10 mM glucose. The brain was continuously perfused with cerebrospinal fluid at a rate of 1.2 ml / min. at room temperature using lse v8.80 software (HEKA Elektronik). Whole-cell patch clamp recordings were performed at 22 ± 1.0°C using a recording electrode (5–6 MΩ). Resistance), 150 mM K-gluconate, 5 mM NaCl, 1 mM MgCl2, 0.2 0.5 mM EGTA, 10 mM HEPES, 2 mM Mg-ATP, 0.5 mM Na-G Pipette solution containing TP (292 mOsm, adjusted to pH 7.3 with KOH) A potassium gluconate-based pipette solution was used to create a liquid junction potential of 15.1 mV. Action potential firing was recorded at the resting membrane potential in current clamp mode. Resistance was not compensated and was continuously monitored. Mini Analysis v6.0. 7 (Synaptosoft), and Clampfit 8.2 (Molecular Spontaneous synaptic events were analyzed offline using the program (Devices). 1 μM tetrodotoxin (TTX) blocked voltage-dependent sodium channels. Neurobiotin (0.2%) was incorporated into the pipette solution to allow recording of the cells. The sections were fixed in 4% formaldehyde at 4°C and co-stained with TH antibody.

[0114] Multi-electrode array (MEA) recording Axion Biosystems 24-well microelectrode array (MEA) plate The cells were incubated overnight at 37°C in a CO2 incubator with poly-L-ornithine (0.0015%), fibronectin (1 μg / ml), and laminin (1 μg / m The next day, C4-derived D28 cells were pre-coated with the pre-coated The cells were seeded at 20,000 cells per well on a pre-assembled MEA plate and then incubated as described above. D28 cells were cultured at 37°C in a 5% CO2 atmosphere according to the same schedule. The cells were maintained in a humidified incubator with PBS for 2 days to allow proper attachment. Electrophysiological recording was then initiated. A 60% medium exchange was performed every other day. Before and after the treatment with the Maestro MEA system, and the AxIS software ( Spontaneous activity was measured using a 100-kDa PBS (Axion Biosystems) at 37°C in culture medium. This MEA platform consists of 324 channels. If using a 24-well plate, place 16 electrodes per well in a 4x4 grid. Approximately 20,000 cells are placed on the electrode grid in each well. The AxIS Navigator 1.5.1 software was used. The raw data files (*.raw) at baseline and after treatment were then extracted using the spike file. These files were converted to a file format (*.spk) and an Excel file (*.csv). Conversion to a matrix allows further processing and analysis of the data. For neural spike measurements in the AxIS software, set High Pass = 200. The threshold for spike detection was set within the range of Hz to low pass = 3,000 Hz. Set to 6 times the rolling standard deviation of the filtered field potential on the electrode. 5 min Using the recordings over the time period, the average number of spikes in each well and the number of active electrodes ("active voltage"). The active electrodes were those with a spike rate of ≥ 5 spikes per minute. It was stipulated as follows.

[0115] To verify both the robustness of the activity and the quality and consistency of the well activity, To examine the raster plots of spike trains, we used the Axion BioSystems We used the Neural Metric Tool. Visualization was also used to aid in the interpretation of the processed data. The spike activity is sparse, or there is no bursting or network synchronization. Wells with little or no activity were excluded from the experiment. The rate was allowed to equilibrate on the system for at least 2 minutes. To isolate spontaneous neuronal activity, cells were cultured in 500 μl of medium per well. picrotoxin, a GABAergic antagonist, at a concentration of 10 μM in the soil; NBQX, an AMPA receptor antagonist; and NMDAR antagonist After the addition of the blockers, the mean spike count and mean electrode Both the number and frequency of serotonin-dependent changes were calculated. Recording and analysis were performed as described above. A t-test was used to compare the mean and mean values. Spike counts and mean active electrode counts were compared between control and treatment groups.

[0116] Cell preparation and cryopreservation for transplantation C4-derived D28 cells were rinsed twice with DPBS and then incubated at 37°C for 1 hour at 37°C. The cells were treated with 20 ng / ml N2 supplement for 5 minutes. BDNF, 20ng / ml GDNF, 500μM dbcAMP, 200μM As with corbic acid, 10 ng / ml TGF-β3, and 10 μM Y-27632; Cells were harvested using DMEM:F12 medium and centrifuged at 300 x g for 3 minutes. After isolation, the cell pellet was transferred to transplantation medium (DMEM / F-12 without phenol red) BDNF, 20ng / ml GDNF, 10μM Y-2763 The cell suspension was then suspended in 20 mM Boc-D-FMK. Large cell clumps were removed by passing the cells through a filter. Trypan blue exclusion method using a hemocytometer The final cell product was calculated as follows: 1000 cells / µl in transplant medium. For cryopreservation, the cell pellet consisted of 50,000 or 100,000 cells. , and suspended in CryoStor® CS10 cryopreservation medium. The cells in the tube were frozen in Mr. Frosty™ Freezer for controlled freezing at -80°C. The frozen cells were then placed in a freezing container (Nalgene). After one week, the frozen cells were thawed for transplantation.

[0117] Surgical procedure SomnoSuite Anesthesia System(Kent Scien isoforms were prepared using isoforms prepared by the isoform chemistries of the Isoform chemistries (Isoform chemistries, I ... The animals were anesthetized with flurane. Precision Instruments, Sarasota, FL) A stereotaxic apparatus (David KOPF Instruments, Tujunga, Stereotaxic surgery was performed on the CA.

[0118] Charles River athymic rats were administered 6-hydroxydopamine intravenously. A unilateral lesion of the nigrostriatal pathway was established by stereotaxic injection into the lateral forebrain bundle. Before the injection, desipramine (10 mg / kg) was administered to rats to induce noradrenergic responses. The ventricular projection was protected. (Panthelia, Reno, NV) with 2 microliters of 6-hydroxydopamine injection of acetaminophen (7.5 mg / ml in 0.2% ascorbic acid / 0.9% saline solution). The coordinates were: anterior-posterior axis (AP), -4.0; median-lateral axis (ML), -1.3; and Dorsoventral axis (DV) was calculated using -7.0 as the reference (Torres et al., 2011. J Neurosci Me Methods 200:29-35). For intrastriatal transplantation of H9-derived D28 cells or C4-derived D28 cells, To do this, one 2 μl deposit (50,000 cells per μl) was placed at the following coordinates: AP, +0.8; ML, -3.0; and DV, -5.5. 26G, 0.75 A 10 μl Hamilton syringe fitted with a blunt inch needle Cells were infused at a rate of 0.4 μl / min. For Taconic athymic rats, C4 D28 cells were suspended at a concentration of 100,000 cells per μl. For the 2,000 group, add 1 microliter of cells to the AP, +0.8; ML, -3 .0; and DV, -5.5. For the 300,000 cell group, 1. Two 5 μl deposits were made at the following coordinates: AP, +0.8; ML, −3.0; and D Control rats received only the transplant medium injection. For intrastriatal injections into NOD-SCID mice, bilateral ventral apex-illuminated , according to the following coordinates (in mm): AP: +0.5; ML: ±1.8; DV: -3.2 Deposit 2 μl of C4 D0 cells, C4 D14 cells, or C4 D28 cells ( One injection (50,000 cells per μl) was given intrastriatally.

[0119] After injection, the needle was kept in the brain for 5 minutes, and then the needle was removed for 5 minutes. After the surgery, the incised skin was closed with Autoclip (registered trademark). Mark)Surgical Suture(Fine science tool, Fost The incision was closed with a suture (Heinzburg, Germany) and the animal was monitored on a heating pad until recovery. All animals received ketoprofen (5 mg / kg; Ketofen, Santa Cruz, CA). z, SC-363115Rx) was injected subcutaneously to relieve pain, and 0.9% sodium chloride One ml of ethanol was injected intraperitoneally to prevent dehydration.

[0120] For intratesticular injection into NOD-SCID mice, longitudinally through the skin and peritoneum A 1 cm incision was made and the testes were placed on sterile gauze. 00 cells) of C4 iPSCs were slowly injected into the center of the seminal vesicle through any large blood vessel. The needle was slowly removed to avoid reflux of cells. , and returned to their original position in the abdomen.

[0121] D-amphetamine-induced rotational behavior test D-amphetamine, a presynaptic (indirect) DA agonist, was administered intraperitoneally (4 mg / kg) and successfully lesioned rats with 6-hydroxydopamine. Rotational behavior was induced in an automated system (SD Instruments, San Rotational behavior was recorded using a 90-minute (9 segments; segment 1) rat. Rats were recorded over a 10-minute period (10 minutes per rat). Only complete trunk rotations were counted. Then, rotations toward the lesion side were given a positive value and expressed as net rotations per minute. Only animals showing more than 6 ipsilateral rotations per minute were successfully lesioned. (Kirkeby et al. 2012.. Cell Rep 1:703-714).

[0122] Corridor Test To measure non-pharmacological behavioral improvement, we used the Corridor Test (Dowd et al. 2005. Brain Res Bull 68:24-30). First, we used a To achieve this, rats were exposed to sugar pellets scattered throughout the cortex for 10 minutes each over two days. The next day, ten pairs of cups filled with 5-10 sugar pellets were placed on the floor. The rats were placed at the end of the corridors, which were spaced apart along the road. The dogs were allowed to explore freely. The investigator, who was blinded to the groups, The behavior was counted directly. "Acquisition behavior" was defined as the number of times the rat placed its nose in the unique cup. The duration of the trial was defined as 20 acquisitions. All rats were examined until the time reached 5 min. The rats were then placed in an empty corridor for 5 minutes to allow them to adapt to the unfamiliar environment. Food was restricted the day before and throughout the 4-day study. (Right) Calculated as the number of acquisition actions and presented as the number of acquisition actions relative to the total number of acquisition actions. Testing was performed every 4 weeks up to 24 weeks after transplantation.

[0123] Cylinder Test To measure forelimb asymmetry in exploratory behavior, rats were placed in a glass cylinder. The animals were placed in a chamber (20 cm in diameter) and the contact of their front paws with the wall was recorded up to 30 times. Using the cylinder task (Bjorklund et al. 2010. Brain 133:496-511), rats The study director, blinded to the group, performed the assessment. is calculated as the average number of contacts using the right (opposite) front paw, relative to the average of all contacts. The results are presented as a percentage of the total number of patients treated with IFN-γ. The study was performed 24 weeks after implantation.

[0124] Stepping Test To measure forelimb akinesia, forelimb coordinated steps are quantified over a total length of 90 cm. Using the side-stepping test (Olsson et al. 1995. J Neurosci 15:3863-3875) The rats were evaluated. The investigator, blinded to the group, performed the steps. The results were calculated as the average number of right (contralateral) forelimb steps and the average number of left forelimb steps. The results are presented as a percentage of the mean number of steps. The study was performed 24 weeks after implantation. .

[0125] Biodistribution analysis To verify the presence of transplanted human cells, we performed amplification of human-specific genes. First, a specific RT-PCR method was used using QIAamp D according to the manufacturer's instructions. The NA FFPE Tissue Kit was used to prepare 15 mg of mouse tissue (olfactory bulb, cerebellum, and DNA was extracted from the Nan (a mixture of Nan, spinal cord, lung, heart, liver, kidney, and spleen). The concentration of extracted DNA was measured using a odrop ND-1000 spectrophotometer. ng of DNA was used in real-time RT-PCR reactions. Human-specific primer sequences The following are the sequences: forward 5'-ATTGCCCCAAAACTTTTTTG-3' (SEQ ID NO: No. 106), and reverse 5'-TTGAAGACCAGTCTGGGAAG-3' The endogenous mouse gene was amplified using the following primers: Forward: 5'-CCACA TCTCCCTCCAGAAAA-3' (SEQ ID NO: 107), and reverse 5'-AG GGTCTGGGCCATAGAACT-3' (SEQ ID NO: 108) was used for detection.

[0126] Brain sectioning and immunohistochemistry by intraperitoneal injection of ketamine (75 mg / kg) / xylazine (7.5 mg / kg). Following induction of deep anesthesia, the rats were placed in ice-cold phosphate-buffered saline (PBS; 0.01 M, pH 7. 4) for 8 minutes followed by 4% formaldehyde at a flow rate of 10 ml / min. The brain was then perfused with aldehyde for 20 minutes, and the brain was then removed and resuspended in 4% formaldehyde. After overnight fixation in aldehyde at 4°C, the cells were then fixed in 20% and 30% sucrose. The brains were cryopreserved by continuous incubation in OCT (optimal cutting). The striatum was embedded in a 2000-kJ / kg (2000-kJ / kg) compound and cut into coronal sections covering the entire striatum. The sections (30 μm) were collected sequentially (Leica CM1950, Buffalo Gro Brain slices were incubated with PBS containing 30% H2O2 for 30 min. Then, rabbit anti-TH antibody (1:5000), mouse anti-hNCA antibody (1:5000), and M antibody (1:1000), and mouse anti-hNuc (1:1000) overnight. After rinsing, the samples were incubated with a biotinylated secondary antibody (Vector The cells were stained for 1 hour using a vitrification kit (Vitamin E Labs). Finally, the cells were stained with Vitamin E according to the manufacturer's protocol. Ectastain Elite ABC Kit and DAB Peroxidase Substrate Kit The sections were visualized by a graft. + 5 for counting neurons The grid size was set to 200 × 200 μm with a 0 × 50 μm counting frame. Under a 63x oil immersion lens, the Stereo Investigator's optics al fractionator probe (MBF Bioscience, Willi The final counts were corrected for series (1:6) and the number of animals was 100. We obtained an estimate of the total number of TH-positive neurons per brain.

[0127] Vimentin immunohistochemistry was performed at the Rodent Histopathology Core at Harvard Medical School, Boston, MA was carried out.

[0128] Immunofluorescence on brain sections Free-floating coronal sections of the whole midbrain were prepared by centrifugation in PBS containing 5% normal donkey serum, 3% BSA, and and 0.3% Triton X-100 at room temperature for 1 hour. The primary antibody was pre-incubated for 10 min in 3% BSA and 0.5% HCl in PBS. Diluted in 3% Triton X-100 and applied overnight at 4°C. 0.3% After three washes with PBS containing 100 mg of Tween 20, the sections were incubated with the primary antibody. Alexa 488-conjugated secondary antibody, Alexa 488, diluted in the same buffer as 568-conjugated secondary antibody, or Alexa 647-conjugated secondary antibody All sections were incubated with Hoechst 3 After three further washes, the coverslips were covered with mounting medium were applied to the sections and visualized under a fluorescence microscope (Keyence Corporation, Osaka, Japan). Sections stained with secondary antibody alone were processed and photographed under the same conditions and used as negative controls. did.

[0129] Hematoxylin / eosin staining For pathological analysis of NOD-SCID mouse testes, ketamine / xylazine was used. Each mouse was anesthetized, and the testes were removed and temporarily stored in 4% formaldehyde. For pathological analysis of NOD-SCID mouse brain tissue, the sixth slice covering the entire striatum was used. Each coronal section was mounted on a glass slide for hematoxylin / eosin staining. To perform the analysis, slides of testis and brain tissue were prepared using a Rodent Histopathology hology Core at Harvard Medical School, Bo ston, and sent it to MA.

[0130] Quantitative and statistical analysis Unless otherwise indicated, all experiments were performed in biological triplicate. The "n" for each experiment is found in the figure caption and is used for all experiments. Statistical analysis was performed using GraphPad Prism v 7 software. A p value of <0.05 was considered statistically significant. Throughout the figures, asterisks indicate significance of p-values: * p<0.05; ** p<0.01; *** p<0.001 indicates the mutations present in the cell fraction within each iPSC cell line. For tests of difference, a two-sided binomial test was used to generate p-values, with Bonferroni correction. Mutation data were analyzed and visualized using R.

[0131] [Example 1] Identification of microRNAs (miRNAs) that regulate metabolic reprogramming Recently, the present inventors have reported that SIRT2, which is directly targeted by miR-200c, , which have been shown to be crucial for metabolic reprogramming and the generation of hiPSCs ( 19 To verify the functional relationship between miR-200c and reprogramming, we We investigated whether forced expression of miR-200c induces metabolic changes. miR-200c overexpression (OE) in human dermal fibroblasts (hDF) significantly increased oxygen consumption. Significant metabolic changes, including a decrease in the extracellular acidification rate (OCR) and an increase in the extracellular acidification rate (ECAR) This resulted in changes in the expression of β-glucan in the IL-14 expression vector (Figures 9A and 9B). miR-200c OE cells were treated with carbonyl cyanide-p-trifluoromethoxyphenyl Significant decrease in oxidative phosphorylation (OXPHOS) activity after injection of fluorouracil-containing benzodiazepine (FCCP) significant declines in basal respiration, ATP turnover, maximal respiration, and oxidative reserve capacity, as well as OC The inventors then compared hDF with miR-200c and miR-200c. Treatment with combined reprogramming factors (i.e., Y4F). miR-200c OE The addition of Y4F significantly reduced OXPHOS compared to Y4F alone (Figures 9F-9K). Therefore, pluripotency-associated miRNAs may facilitate metabolic reprogramming, thereby promoting reprogramming. This suggests that the programming process may be affected. We will investigate whether other miRNAs induce metabolic changes similar to miR-200c. Based on previous miRNA expression studies (20-23), we We identified eight candidate miRNA clusters (miRNAs) that were consistently enriched in hPSCs. R-17 / 92, miR-106a, miR-106b, miR-136s, miR-2 00c, miR-302s, miR-369s, and miR-371 / 373) were identified. The present inventors have investigated whether the OE of these miRNAs in hDF leads to metabolic changes. Interestingly, the present inventors found that these eight miRNA clusters Seven of the clusters (except miR-17 / 92) showed a decrease in OCR and ECAR. This results in significant metabolic reprogramming, including an increase in the OCR / ECAR ratio. , a robust reduction ranging from 1 / 3 to 1 / 20 compared to control cells transduced with an empty vector. We found that this resulted in a significant reduction (Figures 9L to 9N).

[0132] [Example 2] Combining metabolically regulated miRNAs with reprogramming factors effectively generates high-quality hiPSCs. Efficiently produce The present inventors have demonstrated that the expression of conventional reprogramming factors (Y4F or These metabolically regulated miRNs were expressed in Y3F (OCT4, SOX2, and KLF4). We investigated whether the addition of A facilitates the generation of hiPSCs. Among the seven miRNA clusters, miR-302s was found to be associated with Y3F or Y4F. When combined, they showed the highest efficacy in enhancing hiPSC generation (Fig. 1A and In addition, miR-106a, miR-106b, miR-200c, and miR- 369s, or the miR-371 / 373 cluster, also, to a lesser extent, in hiPS cells. Next, we investigated whether any additional miRNAs could significantly increase the production of Y. The combination of 3F and miR-302s (Y3F+3), or Y4F and miR-302s We are currently investigating whether this combination (Y4F+3) will further enhance hiPSC generation. In the presence of Y3F+3, the addition of any of the other miRNA clusters significantly enhanced the generation of hiPSCs (Fig. 1C). Only R-200c significantly enhanced hiPSC generation (Fig. 1D). The optimal combination of iR-302s and miR-200c (Y4F+3+2) The present inventors identified the following: Y4F, Y4F+3, and Y4F+3+2 induced We compared the kinetics of metabolic changes during reprogramming in the Y4F+3+ 2 induced the most significant metabolic changes (Figures 1E and 1F), suggesting that the metabolic changes and the efficiency This supports the link between the generation of hiPSCs and the development of hiPSCs. tase (AP), and a more stringent pluripotency marker, TRA-1-60 ( 24 , 25) showed that this combination also affected the overall quality of hiPSCs. We investigated whether AP produced by Y4F or Y4F+3 could have an effect. + Approximately 40% of the colonies were TRA-1-60 + In contrast, Y4F+3+ AP produced by 2 + Approximately 90% of the colonies were TRA-1- 60 + Furthermore, the T produced by Y4F+3+2 was RA-1-60 + hiPSC colonies exhibited a typical hESC-like condensed colony shape (Figure 10A). We also investigated adult hDF (GM03529, Coriell Institute) titute) were also reprogrammed and expressed by Y4F+3+2 on lentiviral vectors. Approximately 90% of the colonies produced by AP + / TRA-1-60 + We found that (Figure 10B).

[0133] Next, we used a non-viral vector to express this combination (Y4F+3+2) We investigated whether high-quality hiPSCs could be generated using one of the One vector carried Y4F (pY4F; Fig. 10C ), and the other vector carried miR-30 Two genes harboring the 2s and miR-200c clusters (p3+2; Figure 10D) Due to the known transforming activity of c-Myc (26), The inventors replaced this with L-MYC on pY4F. developed a novel epitopes using a single transfection of these two vectors. We established a reprogramming protocol (Figure 10E) that utilizes hDF Colonies were classified as having >90% AP. + / TRA-1-60 + It is effective for hiPSC colonies. The present inventors performed a rapid reprogramming study at Y4F, Y4F+3, and Y4F+4 cells (Fig. 1H). hiPSC cell lines with hESC-like morphology generated by F+3+2 were selected and were subcultured for >20 passages and their properties were characterized. As shown, their shape and expression levels of pluripotency markers are consistent with those of H9 hESCs. The expression levels of pluripotency markers were very similar. (2) staining with antibodies against germ layer markers, and (3) gene expression of cell lineage-specific markers. As evidenced by the present study, hiPSCs generated by H9 and Y4F+3+2 , differentiated well and evenly into all three germ layer cell lineages, whereas Y4F or Y The differentiation of hiPSCs generated by 4F+3 was biased toward the mesodermal cell lineage (Fig. 2C and These results indicate that the Y4F+3+2 combination induces new From both live-born and adult human fibroblasts, conventional methods (Y4F or Compared to Y4F+3, this allows for the production of high-quality hiPSCs with less bias in differentiation potential. This suggests that (Table 1).

[0134] [Table 8]

[0135] [Example 3] Genomic integrity and somatic mutations in hiPSCs Our reprogramming method reliably generates clinical-grade hiPSCs To investigate whether this is possible, the present inventors conducted a Nine fibroblast cell lines (three familial PD subjects, three sporadic PD subjects, and and 3 healthy subjects), and new skin biopsies (3 healthy subjects and 1 sporadic P Using adult hDF from multiple sources, including four samples from patients (D patients), In this study, we attempted to generate hiPSC cell lines. As shown, our method allows the production of pY4F and p3+2 in a single transfection. Using this method, multiple hiPSC cell lines were derived from all of these fibroblasts. (Fig. 10E). All hiPSC cell lines exhibited hESC-like morphology and OCT4, TRA- Presenting prominent expression of pluripotency markers, including 1-60, NANOG, and SSEA-4 did.

[0136] Focusing on personalized cell therapy, we developed a cell-based cellular matrix protein (C-C) derived from skin biopsies of sporadic PD patients. The hiPSC clone (MCL540 in Table B) was cultured in vitro using an IRB-approved protocol (I Further characterized under RB Partner Number: 2010P001100. Clinical grade The fundamental criteria for hiPSCs are the maintenance of genomic integrity and the prevention of deleterious (e.g., oncogenic) The absence of a mutation(s) that has been reported to be a contributing factor (7, 17). Specifically, the present inventors have identified MCL540 (N17, C4, N3, C11, and C5 Five independent hiPSCs from the original isolate were subcultured for approximately 20 passages. In addition to the clones, control cells (parental fibroblasts and H9) were used to transfect the vector DNA into the host genome. The potential integration of the plasmid into the genomic DNA was examined (Table 2). The inventors designed eight sets of EBNA-1 specific primers and cloned them into plasmid D Two sets (EB-01 and EB-02) were identified that specifically detect NA (Figure Plasmid DNA was undetectable in the cytoplasmic fraction (Fig. 12B), but One of the clones (N17) showed integration of the plasmid sequences (Fig. 12C). qRT-PCR analysis showed that N17 produced 1000 ng of plasmid sequence per 100 nanograms of genomic DNA. Column integration 1.3~1.7×10 4 The results showed that the diploid The amount of DNA in a cell is about 6 picograms (bionumbers.hms.harvard.edu / bionumber .aspx?id=111206), so 100 nanograms of genomic DNA was used in qRT-PCR. A gram is approximately 1.76 x 10 cells 4 Therefore, clone N17 represents 1 cell. It is believed to contain approximately one copy of the plasmid sequence per clone. The clone, and negative controls (original fibroblasts and H9) showed no integration of the plasmid DNA. Thus, we excluded N17 and used DNA fins. The remaining chromosomes were identified by chromosome printing, karyotyping, and in vivo pluripotent differentiation. Four hiPSC clones (C4, N3, C11, and C5) were further analyzed. (Figures 12E to 12G).

[0137] [Table 9]

[0138] We performed whole-exome sequencing on these four hiPSC clones. A total of 524 somatic mutations were identified by WES and compared with the parental fibroblast DNA sequence. There were 137 mutations in coding exons or ±2 bp of splicing acceptor Somatic mutations were found in each hiPS cell, including the target site and splicing donor site. C cell lines contain a median of 114.5 singleton mutations (range: 80–195) hiPSC cells harbored a median of 126 somatic mutations (range: 92–205). A small number of common mutations (n ​​= 1–4) were observed among the lines (Fig. 3A). C4 had the smallest number of somatic mutations (n=205), including 80 singletons. The patients had somatic mutations in the protein coding region (n=92). The hiPSC cell lines contained 27 (median, range: 14-35) nonsynonymous mutations. They carried a median of 36.5 (range: 17–50) nonsynonymous mutations. Again, C4 had the fewest mutations. We found that the most frequently mutated genes across multiple cancer types We investigated mutations in 127 genes reported to be involved in the pathogenesis of leukemia (27). These hiPSC cell lines harbored a maximum of one mutation (synonymous or non-synonymous) within these genes. No non-synonymous mutations were found in C4 or N3. Among the somatic mutations found in all four hiPSC cell lines, No mutations were involved. Finally, we investigated the effect of our hiPSC cells. The somatic mutation burden within the cell lineage was compared with published data sets (Fig. 3B). The authors obtained high-confidence somatic mutations (2 8) and Human Induced Pluripotent Stem Cells 299 hiPSC cell lines (Central) within the HipSci Initiative WGS data for the 1000-kDa virus (produced by the diviral method) revealed somatic coding mutations. Our hiPSC cell line was developed using the HipSci hiPSC cell line. The number of cells was similar to that of hESC cell lines (median: 25, range: 5–492), and significantly less than that of hESC cell lines. (median: 70, range: 34-223) (Wilcoxon rank sum test, p-value: 0. 00071) (Fig. 3B; left) shows the total mutation load. Furthermore, even within genes that are frequently mutated in cancer, they harbored a small number of mutations ( Figure 3B; right).

[0139] The present inventors also investigated somatic mutations that may be present in subpopulations of each hiPSC cell line. We also examined the allele frequencies within the observed somatic mutations. The distribution was estimated with a center of 45% for SNVs and a center of 35% for indels. A binomial test was performed using the null model (28, 30). The median value for a Bonferroni-corrected p-value of <0.01 is 16 (range 9–16). 18) were considered as potential candidates for somatic mutations originating from a certain cell fraction. Minor mutations for all somatic mutations found across all hiPSC cell lines The distribution of allele frequencies (Fig. 3C) showed that each hiPSC cell line contained clonal mutations and Both clonal and subclonal mutations are observed (identified as two peaks in the plot). Although subclonal mutations are known to be specific to individual hiPSC cell lines, The present inventors have demonstrated that the two hiPSC cell lines conserve We observed 0 mutations, but the short reads aligned by WES Visual inspection identified mutations in parental fibroblasts for 14 somatic mutation candidates. The identification of one or two short reads associated with variant alleles was This suggests that the subclonal mutation candidates of are potentially germline derived. In particular, our hiPSC cell line contains clones within cancer-driving genes such as TP53. No somatic mutations in the clones or subclones were observed (28). hiPSC cell lines, and had the lowest somatic mutation burden across the four lines. I was assigned.

[0140] [Example 4] The "spotting" culture method reliably produces high-yield, high-quality mDA cells R Numerous laboratories have demonstrated the ability to differentiate mouse and human PSCs in vitro. We are investigating the differentiation of mDNA into the A cell fate. Signaling and Sonic Hedgehog signaling play crucial roles. Based on these findings (31-33), recent mDA differentiation protocols have focused on the regulation of these signals. Embryoid body-derived neurosphere-based methods utilize activating factors (7, 34, 35). Because the results are highly variable between experiments (18, 35, 36), we used the "double SM" method. We sought to establish a more efficient and reproducible monolayer method based on "AD inhibition" ( 36 , 37 ) mDA cells used for transplantation studies generally grow in vitro for 1 The cells were differentiated for 6 to 32 days (7). According to the optimized conditions published in (37), 73 cells per 60 mm dish were cultured. 0,000 pieces (i.e., 1 cm 2 Starting at 34,000 per H9 cells (<36 passages) were used for the induction of mDA progenitor cells (mDAPs) based on the base plate. We sought to optimize the first 15 days, which are crucial in determining the outcome. In particular, we have demonstrated that the incidence of rheumatoid arthritis is significantly higher from days 8-10, resulting in highly variable outcomes. We observed severe cell death / loss beginning with the initial cell death. Multiple experiments (n=76 for hESCs and n=10 for hiPSCs) were performed by When we evaluated the results of the 48 hESC and hiP cell lines, we found that the hiP cells were significantly damaged due to severe cell loss. For any of the SCs >50% did not yield meaningful data (Figure 13A). Therefore, we used fluorescence-activated cell sorting (FACS) during the medium change. By determining the number of exfoliated cells, cell loss during the differentiation process can be carefully monitored. On day 15 (D15), we monitored the total number of harvested cells. These cells were then counted and further characterized. Two hESC cell lines (H9 and H7) and two hiPSC cell lines (C4 and N 3) When we investigated the total number of detached / lost cells from day 1 to day 14, The total number of cells was much greater than the total number of cells detected (Fig. 4B and Table 3). They cultured monolayers of small numbers of H9 and C4 cells (240,000 cells / cm). 2 Hit 11,000 cells per cm), and 60,000 cells per cm 2 3,500 cells per I tried starting with 1cm. 2 When 11,000 cells per cell were used, We found a similar pattern of significant cell loss (Table 3). 2 Hit At even lower densities of 3,500 cells, both H9 and C4 cells showed poor viability. The final cell yield was also unacceptable due to the loss and subsequent detachment. This pattern of severe cell loss was consistent regardless of the initial cell concentration. The monolayer condition in which cells are distributed in a uniform manner is a key factor in the in vitro growth of hiPSCs and hESCs. Thus, we suggest that the monolayer is not ideal for differentiation. Once divided into parts (herein referred to as "spotting"), We hypothesized that this might improve differentiation in the o. The authors used 10 μl of Matrigel at the intersections of a 2 × 2 cm grid. By pre-coating a circular area ("spot") of approximately 5 mm in diameter, Cell attachment was restricted to the designated areas (Figs. 13B and 13C).

[0141] To find the optimal cell density, we used H9 cells or C Using 4 cells, three different numbers of cells (40,000, 10,000, and 2,5 00 cells were seeded. Notably, this spotting method significantly reduced cell loss. The yield was improved at 15 days compared to the monolayer method. 10,000 cells per dish (60,000 total cells per 60mm dish) 0 cells) resulted in nearly 100% success of in vitro differentiation (Figure 13 A) Results in a final yield of 6-8 million mDA cells at day 15. On the other hand, we found that the total cell loss was less than 3 million cells (Figure 4B, Table 3). The authors found similar patterns for the H7 hESC and N3 hiPSC cell lines. The results confirmed that this spotting method is effective for detecting the mDA of hPSC cell lines. These results suggest that the method is widely applicable to the differentiation of various types of cells. The cells were sparsely populated with a small number of dead cells (Fig. 4C) and a significantly smaller number of cleaved caspase 3-positive cells. and decreased nuclear condensation, a well-known marker of programmed cell death (38, 39). (Fig. 4D). The present inventors investigated the difference in outcomes between the spotting method and the monolayer method. It is speculated that the difference is due to insufficient oxygen and nutrients in the cells under monolayer conditions. We attempted to correct this by changing the medium more frequently. However, this did not reduce cell loss or enhance cell yield. In the spotting method, daily medium changes significantly reduced cell loss (Fig. 14A). Neither mass loss nor cell yield was affected, again demonstrating a greater spot size than the monolayer method. It was confirmed that differentiation was more stable when the cells were treated with HCl. Regardless of the frequency of medium changes, the culture medium becomes significantly acidic only in monolayer cultures. The observed changes in cell health (Figure 14B) may explain, at least in part, the poor cell health. Overall, this novel spotting-based method reduces cell loss and increases final cell yield. Increasing the amount resulted in healthy mDA cells compared to conventional monolayer methods.

[0142] Table 3 shows the level of cell loss during in vitro differentiation of H9 and C4. Three different cell densities (1 cm 2 34,000 pieces per 1cm 2 11,000 pieces per , 1cm 2 a monolayer-based method with three different cell densities (3,500 cells per spore) and 40,000 per spot, 10,000 per spot, The results are compared with a spotting-based method using FACS (2,500 cells / ml). was used to count the detached cells present in the supernatant after medium change.

[0143] [Table 10-1]

[0144] [Table 10-2]

[0145] [Example 5] Quercetin treatment eliminates undifferentiated cells during in vitro differentiation The most important issue with hPSC-based cell therapy is the generation of residual undifferentiated cells with neoplastic potential. The aim is to establish safety by removing BIRC5 (Sulphuric Acid). Previous findings (encoding vivin) are highly expressed in blastocysts compared to somatic cells. 40), we have demonstrated that chemical inhibition of survivin can eliminate residual undifferentiated hiPSCs. However, survivin is known to be important for neural progenitor cells. (41, 42) Therefore, we investigated whether this strategy interferes with the production of mDAP. Among the survivin inhibitors (40), the present inventors have identified flavonoids We selected quercetin (3,3',4',5,7-pentahydroxyflavone). This natural compound is found in high concentrations in commonly consumed vegetables and fruits (43). First, the inventors of the present invention inoculated 100,000 undifferentiated C4 cells into the cells at 5, 10, 20, Treatment with 40 and 100 μM quercetin for 2, 6, 16, and 24 hours After washing with fresh medium, the cells were further cultured for a total of 48 hours. As shown in A, treatment with >20 μM quercetin for >16 hours resulted in a significant increase in viability. The fact that cells were undetectable indicates that undifferentiated hiPSCs were eliminated with >99.99% efficiency. Whether quercetin affects the survival of mDAP remains to be investigated. To investigate this, we transformed D9 C4 cells (mostly neural progenitor cells) into different The mice were treated with quercetin at different concentrations for 16 hours and the outcome was examined on the 11th day. On day 11, neither cell viability nor cell number was affected (Fig. 5B and 5C). C) This suggests that quercetin does not affect hiPSC-derived mDAP. do.

[0146] To establish a highly sensitive and specific assay, we used 100,000 total cells. A test mixture of undifferentiated C4 cells in hDF was created and subjected to three different assays. First, the inventors performed a model for SSEA-4 and TRA-1-60. FACS with monoclonal antibodies was used (Figure 15A), especially when the number of cells was less than 100. In this case, a significant discrepancy was found between the number of input cells and the number of detected cells (Fig. 15B). This indicates that this method was insensitive to the small number of undifferentiated cells. The authors cultured diluted cell samples for 6 days and + Colonies were then transferred to undifferentiated cells. A linear relationship was observed, but the A P + The number of colonies is approximately one-tenth of the number expected based on the input cell number. This discrepancy may be due to the limited survival and proliferation of individual hiPSCs. This may be due to their tendency to aggregate during colony formation and / or colony formation. Regardless, 10 5Even when hiPSCs were seeded, the To AP + Since no colonies were detected, this result indicates that the effectiveness of quercetin treatment was However, this method is not suitable for 100,000 pieces. Since it is not possible to detect undifferentiated cells less than 10 undifferentiated cells per 1000 cells, the inventors used qRT-PCR to measure OCT4 expression as a surrogate marker. Undifferentiated C4 cells 10 2 ~10 5 qRT-PCR for mRNA prepared from Using this analysis, a standard curve for OCT4 copy number was generated (Fig. 5F), demonstrating that the Using this assay, it was possible to predict the number of differentiated cells. Undifferentiated C4 cells calculated on days 14, 21, and 28 without treatment The numbers of β-glucan-1, β-glucan-2, and β-glucan-3 per 100,000 cells were 30, 2, and 0.17, respectively (Figure 5G). Therefore, on days 14, 21, or 28 of differentiation, 10 million cells If these were transplanted into a PD patient, the graft would contain approximately 3,000 undifferentiated cells and 2,000 undifferentiated cells, respectively. 00, and 17. Quercetin treatment was found to be >99.99% efficient. Since quercetin can eliminate undifferentiated cells, the predicted number of undifferentiated cells after treatment At most, 17 x 0.01% = 0.0017 cells per 10 million D28 cells. After quercetin treatment (40 μM for 16 hours on day 9), On days 21, 28, and 29, the untreated controls were calculated using qRT-PCR curves. The number of differentiated cells was much lower than 1 cell per 100,000 cells ( Figure 5 G) is consistent with this. At day 14 without quercetin treatment, a small number of NA NOG + Cells were observed but not detected with treatment (Fig. 15C). In summary, our results show that the high sensitivity method can be used to detect Lucetin treatment reduced the number of undifferentiated cells to undetectable levels, thereby preventing the proliferation of millions of undifferentiated cells. Even when differentiated cells are transplanted, the risk of tumor formation is significantly reduced. This indicates that...

[0147] [Example 6] Functional characterization of mDAPs and mDANs Based on the spotting method and quercetin treatment described above, the present inventors A modified in vitro protocol for differentiation of iPSCs into mDAP / mDAN. C4 cells differentiated using these methods showed a condensed morphology. Gradual growth, minimal detachment (Figure 14C), and bipolar extension of neurites from the tip ( On day 15, the cells were dissociated into a single cell suspension and replated. As shown in Figures 6B and 6C, neural progenitor markers (e.g., S OX2, SOX1, and NESTIN), and bottom plate / substrate markers (e.g., GLI 1, FOXA2, and CORIN) expression began at day 7 and remained high until day 28. The mDAP markers (e.g., OTX2, LM Expression of mDNA markers (X1A, and EN1) increased on days 21 and 28. Markers (e.g., TH, DAT, and PITX3) subsequently increased. The data show a stage-specific progression of NESTIN and mDAN markers. This was confirmed by immunocytochemical analysis (Fig. 16B). D28 cells showed a higher level of erythrocyte proliferation than D14 cells. Since D28 cells exhibited a more mature phenotype than primary cells (Fig. 16B), we concluded that D28 cells were more suitable than primary cells. Thus, typical mDAP and mDAN markers Immunocytochemistry was used to analyze D28 cells (Figures 6D-6H). Approximately 40% and 15% of the cells expressed MAP2 and TH, respectively, and 3 of the cells 8% expressed NURR1 (Figures 6D and 6E). The cells co-express FOXA2 and LMX1A, a characteristic feature of the mDA phenotype ( 6D and 6F), the majority of TH+ cells express FOXA2, LMX1A, and N The present inventors co-expressed URR1 in approximately 3 of the D28 cells (Figures 6D and 6G). 0% and 20% expressed the dorsal patterning marker PAX6 and the proliferation marker PAX7, respectively. We observed that the cells expressed the promoter KI67 (Fig. 6D and 6H). PAX6, SOX1, and ATPases known to form abnormal outgrowths during explantation ( 44 , 45 ). and KI67 co-expressing cells were undetectable (Figures 6D and 6H). . GABA + Cells or 5-HT + Cells are rarely detected at any stage of differentiation. No results were obtained (Figure 16B).

[0148] Co-expression of MAP2, dopamine transporter (DAT), and synaptophysin (SYP) Many TH + These cells, which contain neurons, are physiologically functional neurons. To determine whether the cells were pro-inflammatory, we analyzed the total cells at 70 days of culture. Patch clamp recordings were performed (Fig. 17A). + Neurons are P Additional mature mDA markers were co-expressed, including ITX3 and VMAT2 (Figure 17A ) Also, TH + ALDH1A1 + The neurons are A9-type mDANs and A1-type mDANs, respectively. Co-expression of GIRK2 or, in some cases, calbindin, characterizing type 0 mDAN In the current-clamp recording mode, we observed the endogenous Membrane properties (resting membrane potential: -55.93 ± 2.43 mV; input resistance: 1.52 ± 0.44 GΩ) ; n = 7 neurons), and action potentials (APs) observed in response to injection of depolarizing current (Fig. 18A; AP mean amplitude: 54.96 ± 4.66 mV; FWHM: 6.04 ± 0.82 mm seconds; amplitude of afterhyperpolarization (AHP): 3.55 ± 1.46 mV; n = 7 cells) In voltage-clamp recording mode, voltage pulses from -70 mV to +40 mV were applied to transiently Inward currents were induced by tetrodotoxin (TTX; voltage-dependent Na + Channel The complete blockade of voltage-dependent Na+ by the Na+ blocker + In addition to the expression of the channel, The results indicate a sustained outward current (Fig. 18B), which may represent a calcium current. During recording, we confirmed the presence of functional synapses (at a holding potential of -70 mV, the presence of sPSCs) Frequency: 0.11 ± 0.03 Hz; Peak Amplitude: 14.71 ± 3.05 pA; Rise Time , 0.73 ± 0.14 ms; decay time, 1.72 ± 0.19 ms; n = 5 cells) ( Spontaneous postsynaptic currents (sPSCs) were observed, indicating the absence of injected current (Fig. 18C). The spontaneous firing observed in the presence of ATP is consistent with pacemaker activity at the resting membrane potential (46). The recorded cells showed a 4.5-fold increase in activity, as typically observed in A9 mDANs. They fired spontaneously at a mean frequency of 4 ± 0.8 Hz (n = 4) (Fig. 18D). Individual neurons (loaded with neurobiotin via recording patch pipette; red ) colocalized with TH-positive cells, suggesting that these cells are dopaminergic neurons. In addition to single-cell patch clamp recording, we also measured population-level electrical activity using multi-electrode arrays (MEAs). The cells exhibit robust synchronous bursting patterns that indicate the maturation of neuronal networks. Cumulative activity maps showed that the activity of the mAb increased between days 30 and 44 in the mDA. The spike density and spike area of ​​mDNAs increased (Fig. 18F). To isolate the activity, cultures were treated with NBQX, a glutamate receptor antagonist. +AP5 and GABA A Treatment in combination with the receptor antagonist, picrotoxin Administration of this cocktail resulted in an increase in the total number of active electrode spikes and the number of active electrodes. However, the decrease in the number of serotonin-dependent genes was only slight (Fig. 18G and 18H). Finally, HPLC analysis of the culture medium indicated that mDNA was abundant in the culture medium. The analysis showed that D47 cells were stimulated with dopamine (3.1±0.1 ng / ml) and DOPAC (0 It was further shown that the α-glucan releases 0.2±0.0 ng / ml (Figure 6I).

[0149] [Example 7] In vivo safety testing after implantation In vitro characterization by the present inventors showed that the The majority of the cells expressed mDAP, which is suitable as a source of transplantable cells. To investigate the safety of these compounds, the present inventors used D14 C4 cells or D28 C 4 cells (without or with quercetin treatment; 100 cells per animal) ,000 cells were transplanted into the striatum of immunodeficient NOD SCID mice. The transplantation of undifferentiated C4 cells (day 0) resulted in the establishment of PSCs in all four test mice. The induced formation of teratomas containing the characteristic three germ layers, a characteristic feature of the phenotype (Fig. 7A, left panel). By comparison, D14 cells without quercetin treatment (n=8) or D1 with quercetin treatment (n=8) 4 cells (n = 19, Figure 7A, middle column), and D28 cells with quercetin treatment (n = 23 7A, right column) was transplanted, no teratoma formation was observed (Fig. 7B). Profoundly, the present inventors found that approximately 40% (Kercell) of the host brains transplanted with D14 cells 3 of 8 patients in the D14 group without quercetin; 8 of 19 patients in the D14 group with quercetin In contrast, rosette-like structures were observed in the D When 28 cells were transplanted, no rosette-like structures were observed (0 of 23 mice; Figure 7A and 7C). Immunohistochemistry showed that D14 grafts showed more fibroblast growth factor receptors than D28 grafts. In addition, D28 cells contained many vimentin-positive immature cells (Fig. 7D). Within the derived grafts, SOX1-positive cells, KI67-positive cells, and SOX1 / KI67 double-positive cells, SOX1 / PAX6 double-positive cells, and SOX1 / PAX6 / KI67 Triple-positive cells were also fewer in the grafts derived from D14 cells (33% vs. 4.5%; 5 0.9% vs. 1.2%; 2.1% vs. 0.15%; 1.2% vs. no detection; 0.75% vs. no detection 7E-7G), D28 grafts have fewer proliferative potential than D14 grafts. These results indicate that the complete undifferentiated cells are removed, Teratomas also did not form, but D14 grafts still formed rosette-like structures. These results suggest that D28 grafts contain immature progenitor cells capable of regulating the endothelial cell proliferation. , SOX1 / PAX6 / KI67 triple positive cells were also undetectable. We conclude that D28 cells represent a safer cell source for transplantation than D14 cells. The present inventors investigated the safety of D28 cells by evaluating their biodistribution. Six months after transplantation of D28 cells into the striatum, the present inventors found that the central nervous system system area (a mixture of the olfactory bulb and cerebellum, and the spinal cord), and five peripheral organs (lungs, heart, liver) , kidney, and spleen) were removed to examine the migration of human-derived cells from the striatal intracellular implants. Genomic qPCR revealed no significant differences in the human DNA sequence in any of these regions. The hiPSC positive control showed significant expression (Figure 7H). demonstrated that there was no detectable redistribution of transplanted cells within the brain or to peripheral organs. do.

[0150] [Example 8] In vivo efficacy studies and graft analysis in animal models for PD The 6-hydroxydopamine lesioned rat model was the first P D animal model (47) and remains a common model (48, 4 9) This rat model was used to quantitatively evaluate the effects of cell transplantation on locomotion. Its use in athymic rats is particularly useful because immunosuppression is not required. is becoming recognized as the preferred model. osciences (Hudson, NY), and Charles River (Wi Athymic rats (Illington, MA) were used. We first investigated the effects of C4 D2 8 cells, 100,000 and 300,000 cells per side, were administered 6-hydroxydopa The cells were transplanted into the striatum of athymic Taconic rats that had been lesioned with amine, and the cells were then transplanted monthly. They were monitored for amphetamine-induced rotational behavior. After 12 weeks, cells 10 Both the 300,000 cell group and the 300,000 cell group showed a significant decrease in ipsilateral rotation behavior. After 16 weeks, all implanted rats showed a significant decrease in rotational behavior (Fig. 19A). , were completely rescued, and some rats even showed contralateral rotation behavior. Vehicle-treated rats showed no recovery. The color indicated that the grafts contained neither teratomas nor rosettes (FIG. 19B). Immunohistochemistry for the cell adhesion molecule (hNCAM) was performed in the striatum (STR) (Figure 19C). , prefrontal cortex (PFC; Figure 19D), septal nucleus (Figure 19E), nucleus accumbens (NAc; Figure 19F) , and dense hNCAM in the corpus callosum (CC; Figure 19G). + showed innervation. Chemistry is the process of grafting with abundant TH + Neurons were revealed (Figure 19H). is survival TH + The average number of neurons was 5,621 ± 1 per 100,000 transplanted cells. 1029 (n = 4), and they had large, angular cell bodies typical of A9 neurons (Fig. 19I), and small, spherical neurons typical of A10 (Fig. 19J). It was shown to contain a mixture of tetrahedron forms.

[0151] These data suggest the safety and efficacy of D28 C4 cells. They found that D28 C4 cells were more robust and long-lasting than the Taconic strain. Further analysis was performed in athymic rats from Charles River, which facilitates comprehensive analysis. We have investigated the efficacy of a single dose (100,000 cells) of D2 for transplantation. 8 C4 cells were selected (Fig. 19K), and the efficacy and safety of the cryopreserved cells were verified using newly prepared cells. Cryopreserved D28 C4 cells (frozen D28) showed comparable viability to their freshly prepared counterparts. The viability level (approximately 90%) was maintained and the same m The amphetamine-induced rotational behavior was observed in the novel D28 Sixteen weeks after transplantation of C4 cells or frozen D28 C4 cells, the incidence of pulmonary embolism was significantly reduced, with 20 and After 24 weeks, complete rescue was achieved (Fig. 8A). ), some animals developed contralateral gyrus at 20 and 24 weeks. The inventors also conducted several studies without exogenous pharmacological stimulation. In this study, we assessed the functional effectiveness of these grafts, which may provide insight into motor deficits. This resulted in a larger scale of similarity to the motor deficits in human PD. The Corridor test (50), a highly sensitive test for the selection of Cryopreserved D28 C4 cells inhibited lesion-induced ipsilateral bias 24 weeks after transplantation. Notably, no significant reduction was observed after 16 or 20 weeks. What was not observed was that improvement in this task took more time than rotational behavior. The cylinder test and stepping test (51, 52) also showed that forelimb dysfunction caused by 6-hydroxydopamine lesions was Furthermore, transplantation of fresh or frozen D28 C4 cells resulted in a significant improvement in survival after 24 weeks of transplantation. In summary, all four behavioral tests showed significant improvements in the In this study, both fresh and frozen D28 C4 cells effectively induced ataxia. Furthermore, at later time points, additional transplanted animals also showed significant and comparable improvements in rotational behavior. The recovery was sustained up to the final study time point, 52 weeks later (Figure 19M). This suggests that the functional improvement resulting from transplantation was well maintained.

[0152] H9-derived mDA cells are functionally equivalent to human fetal ventral midbrain (VM) cells. Since the H9 h ESC-derived D28 cells and C4hiPSC-derived D28 cells were used to study the metastasis of these cells after transplantation. The results were compared directly. 5 and 4 × 10 5 Transplantation of any cell line was results in the same recovery in both magnitude and time course of rotational behavior. This was shown to be the case (Figure 20A).

[0153] Next, the present inventors analyzed the grafts 26 weeks after transplantation and found that hNCAM + Cells and TH + All of the cells were located in the dorsolateral STR (dl-STR), PFC, and N to the entire STR, with extensive extension to dopaminergic target regions such as Ac We found that the dl-ST exhibited extensive innervation (Figures 8E-8L and 20B). The widespread co-expression of hNCAM within dopaminergic fibers in R We further verified the robust innervation of the host brain by explant-derived mDANs (Figure 1). In addition, TH, human presynaptic protein (synaptophysin; hSyn), and Using antibodies against the striatal medium spiny neuron marker (DARPP32), We also performed heavy immunofluorescence staining. and host dendritic spines (DARPP32 + In neurons, TH + / hSyn + New This indicates that the transplanted DANs communicate with the host striatal neurons. This indicates that the apical junctions were formed (Fig. 8N). Explants contain hNCAM + / TH + Similar reinnervation and synaptogenesis patterns were observed in The results were shown in Figure 20C. The grafts also contained numerous DA neurons with A9- or A10-like morphology. (D28: 34,560 ± 3,200; frozen D28: 46,094 ± 8,967; Fig. 2 1A and 21B). Graft volume was also similar between D28 and frozen D28 (D28 :12.2±1.1mm 3 ;Freezing D28:13.0±1.7mm 3 ; Figure 21C). D28 and hNCAM in grafts frozen at D28, respectively. + The total number of cells is approximately 3.0 × 106 and 2.45 × 10 6 and TH + The average percentage of cells was 1.48 ± 0.55 % and 2.08±0.65%. + The majority of neurons (70-80 %) co-express FOXA2 and LMX1A and >90% of TH + Neurons, NURR1 was co-expressed (Figures 21D-21F). + Within neurons, mature DA molecules DAT, a marker for proliferation, was abundantly expressed (Fig. 21G), whereas The car is KI67 + was expressed in <1% of cells (D28: 0.86 ± 0. 0.09%; Frozen D28: 0.54±0.21%; Figures 21H and 21I). Teratomas were not observed, and proliferative cells co-expressing SOX1, PAX6, and KI67 were not observed. , rare or undetectable (SOX1 + PAX6 + :D28:0.37± 0.10%;Freezing D28:0.15±0.11%;SOX1 + PAX6 + KI67 + :D 28: 0.02±0.02%; Frozen D28: Not detected; Figures 21H and 21I). + In neurons, GIRK2 or calbindin was expressed (Figures 21J and 21K). , the majority co-expressed GIRK2 (D28: 79.29 ± 4.88%; frozen D28: 81.28±3.50% (Fig. 21L). + Neurons are Co-expresses additional A9 markers such as DH1A1. + ALDH1A1 + Neuro mDANs frequently co-express SOX6 and GIRK2, representing type A9 mDANs (Fig. 2 1M and 21N); some TH + ALDH1A1 + The neurons are A10 type m The cells co-expressed calbindin, which represents DAN (Figure 21O). In both fresh and frozen D28 C4 cell grafts, TH + The majority of neurons had characteristics of A9 mDANs and showed ataxia in behavioral tests. This coincides with a broad and prolonged recovery in the

[0154] These data were compared with those in a 6-hydroxydopamine-lesioned rat model. Recently published transplantation studies of hiPSC-derived DA cells (44, 45, 57 Compared with the DA yield in this study (surviving DA neurons, transplanted cells), The ratio of the number of cases to the number of cases was higher than in any of these other studies (Table 4).

[0155] [Table 11-1]

[0156] [Table 11-2]

[0157] [Example 9] GMP-compliant differentiated cell production Finally, we performed the experiments in a GMP facility within the Dana Farber Institute. Under this protocol, we have developed a method for producing differentiated C4 cells in vitro. Characterization will demonstrate the scalability and clinical applicability of our platform. Starting with approximately 1 million D0 C4 iPS cells, the present inventors investigated We successfully generated >160 million 28 cells (Figures 22A-22F). data (e.g., genomic footprinting, immunocytochemistry for marker proteins, q RT-PCR demonstrated that these clinically relevant quantities of FOXA2 + LMX1A + Cell High percentage (>85%), and inappropriate markers (e.g., 5-HT, DBH, OCT4 , and SSEA-4; serotonergic, noradrenergic, and Pathogen-free, high-quality, as evidenced by the absence of pluripotency markers It confirmed something.

[0158] [Example 10] In vivo human efficacy studies Human patients with PD were treated with autologous mDA progenitor cells generated by the methods described herein. The patient had a 10-year history of progressive idiopathic PD. The patient was a 69-year-old, right-handed, male physician. His PD medication was three capsules four times daily. Rytary (carbidopa / levodopa 23.75mg / 95mg sustained release) 4 mg rotigotine daily, and 1 mg rasagiline (904 mg levodopa) daily. Despite the best medical treatment, the patient continued to experience tremors, postural changes, and and an average of 3 hours off-time per day, characterized by a deterioration of fine motor control. The patient reported suboptimal symptom control with no movement disorder. The informed consent document outlined the risks associated with this first human use of the technology in PD. A thorough discussion of all currently available medical and surgical treatment options was provided. This included a review of treatment options, including deep brain stimulation. Fibroblasts were used to generate multiple iPSC cell lines, which were then cultured in vitro and in vitro. We have extensively investigated the pluripotent differentiation potential of the nucleus and nucleus in vivo, and performed whole-exome sequencing. Based on these data, A single clone (C4 The mDAP cells were selected for the generation of transplantable mDAP cells. Before shipping for use, it meets strict GMP and quality control standards and is A9 mD Gene expression of A-specific neuronal markers and other neuronal markers, as well as whole-genome sequencing Genomic integrity was tested by weighted sequencing (WGS).

[0159] Patients were assigned to the putamen, left hemisphere, and then right hemisphere in accordance with FDA regulatory guidelines. Each patient underwent two MRI-guided stereotactic surgical procedures, 6 months apart, for implantation of the MRI-guided stereotactic MRI scan. During surgery, each of the nuclei was located within the putamen posterior to the reference plane of the anterior commissure, spanning the superior and inferior extent of the nucleus. Three trajectories were performed (Schweitzer et al., Oper Neurosurg (Hagerstow) n) 2019;18:321-328). Each surgical procedure involved three injections of a total of 4 million cells. The dose was divided equally between the tracts. Intravenous cefazolin was administered during surgery. No immunosuppressants, glucocorticoids, or anticonvulsants were used at any time. After surgery, patients were monitored overnight and discharged one day later.

[0160] material and method In this example, the following materials and methods were used:

[0161] Overview The informed consent document is a guide to the currently available medical and surgical treatment options for deep The best use of this method in Parkinson's disease, with a review of treatment options including brain stimulation, is The study included an in-depth discussion of the first human use and associated risks. This work was conducted under regulatory guidelines from the US Food and Drug Administration (FDA). Approval was granted by Weill Cornell. ll Medical Center and at Massachusetts G All animal procedures were obtained from the review board at the General Hospital. McLean Hospital Animal Care and Use Co This was done with approval from mmittee.

[0162] iPSC generation, differentiation, and preclinical safety / efficacy testing As described above, the conventional Yamanaka factors were combined with two microRNA clusters. iPSCs were generated using a protocol that described the following: fibroblasts taken from skin biopsies. Using the method, multiple iPSC cell lines were generated and these were then analyzed in vitro and in vivo. In vivo, we investigated the pluripotent differentiation potential and used whole exome sequencing to The presence of protein-coding mutations was screened. The iPSC clone (called C4) was used in the manufacturing and quality control of pharmaceuticals and quasi-drugs. Further characterization and preparation of mDAP under Good Manufacturing Practice (GMP) conditions is planned. A "spotting" based method was selected for production under GMP conditions as described above. C4 iPSCs were cultured in vitro for 28 days using mDA This protocol allows the differentiation of PSC-specific anti-inflammatory cytokines encoding survivin. By inhibiting the apoptosis gene, BIRC5, the residual undifferentiated iPSCs (iPSCs) i.e., cells that express pluripotency markers such as OCT4, SSEA1, and NANOG The study included an overnight quercetin treatment on day 9, which eliminated the above-mentioned , and Lee et al., Proc Natl Acad Sci USA 2013;110:E3281-90.

[0163] Characterization of in vitro differentiated mDAPs In the two validation experiments described above, C4 iPSC-derived cells showed normal karyotypes. and mDAP with dopamine neuron-specific neural markers and other neural markers. The whole genome sequences for both C4 iPSCs and C4-derived progenitor cells were characterized. We performed genome sequencing and compared the progenitor cells to the original source fibroblasts; results confirmed the absence of known cancer-associated and neurodegeneration-associated mutations in the progenitor cells. I acknowledged it.

[0164] We found that 2% of C4 iPSCs and mDAPs express fibroblasts compared to parental fibroblasts. We identified three missense and splice site-disrupting variants, including three somatic mutations. However, known cancer-related genes (i.e., according to the CENSUS database), neurodegenerative disorders, Disease genes reported for harm (i.e., according to HGMD and ClinVar) ), and genes involved in tyrosine metabolism and dopaminergic synaptic pathways (i.e. (according to the KEGG database) were not affected by these mutations. In particular, a missense variant in FLG2 (ENSP00000373370.4:pV al672Gly) was present at a low ratio in the C4 iPSC samples, but this was due to the We therefore called this missense variant heterozygous in iPSCs. The mutants were subclonal somatic clones in both C4 iPSCs and mDAPs. We hypothesized that a mutation exists in the C4 iPSCs during differentiation into mDAP. No cell mutations were introduced. The majority of the mutations appeared as subclones in other samples (each boxed). Next, we performed ASCAT (allele-sp ecific copy number analysis of tumors)(Va n Loo et al. Proceedings of the National Academy of Sciences of the United State s of America 2010;107:16910-5) was used to perform read depth-based CNV analysis. The present inventors have introduced the PODXL gene into C4 iPSCs and mDAPs. We found heterozygous deletions spanning both the 2000 and 2001 exons, but compared with C4 iPSCs. Therefore, we did not find any additional CNVs introduced into mDAP. was not detected using WES. PODXL has been reported as a cancer driver gene. Not yet.

[0165] Prior to clinical use, neurons derived from these progenitor cells have been shown to be highly resistant to oxidative stress in vitro. The dopaminergic neurons in the substantia nigra pars compacta secrete dopamine and electrical activity. It exhibits physiological properties and, in animal models, functions of fetal midbrain-derived tissue as described above. The drug demonstrated functional efficacy similar to that of conventional drugs and passed FDA regulatory release standards. After treatment with chloramphenicol, the final cell product (at day 28) was immunostained and analyzed. Detectable residual undifferentiated iPS cells based on a real-time polymerase chain reaction-based assay C (the upper limit of the 95% confidence interval is defined as the number of differentiated cells per billion at day 28) (≤1 undifferentiated cell per 1000 cells). Potential causes of graft-induced motility disorders in the final product serotonergic neurons (Olanow et al. Ann Neurol 2003;54:403-14) , was not detected.

[0166] Graft survival under autologous versus allogeneic conditions in humanized mice Patient-derived iPSCs (C4) and allogeneic human embryonic stem cells (H9) were cultured at day 28 of mDAP. (C4-mDAP and H9-mDAP), and 1 × 10 cells of each cell line were differentiated. 5 individual Non-obese diabetic / severely immunodeficient mice (NOD SCID) and non-obese diabetic mice (NDCs) were used. Disease / severe immunodeficiency / interleukin-2 receptor gamma deficient mice (NOD SCID gamma mice) mouse), patient-humanized NOD SCID gamma mouse (C4-hu; 24 months after surgery [left using peripheral blood mononuclear cells obtained from the patient at 18 months [right hemisphere] and 18 months later [right hemisphere]. ) and the striatum of allogeneic humanized mice (K1-hu). by killing and labeling for human neural cell adhesion molecule (hNCAM+) cells. , graft survival, intragraft dopaminergic neurons (tyrosine hydroxylase The presence of neurons expressing markers for [TH+] neurons, and cellular The immune response (CD4+ cells) was examined histologically.

[0167] Surgical procedures in patients Patients were given cell implants six months apart, first in the left hemisphere and then in the right hemisphere. Underwent two surgical procedures (in compliance with FDA regulatory guidelines): MRI-based A Leksell stereotaxic technique was used. At each surgery, a single injection was performed in the superior parasagittal region of the frontal lobe. Starting from the point, three trajectories were created. Prepared in the Cell Manipulation Core and collected on the day of surgery A specially designed device was used to create a column spanning the sagittal extent of the putamen. Cells were injected into each injection tract using a CT scanner (Schweitzer et al. 2019). to image the cannula and fuse this image back into the pre-operative surgical plan. The accuracy of the localization was confirmed and bleeding was prevented (Figures 24A-24B). A total of 4 million viable cells were delivered, divided equally among the three injection channels. (cefazolin, 2 g every 8 hours for 3 doses during surgery) Each patient received 10 doses of 100 mg ... Postoperatively, patients were monitored overnight in the intensive care unit and discharged one day later. I did.

[0168] clinical scale A neurological examination was performed at baseline and at 1, 3, 6, 9, and 10 days after each implant. Parkinson's disease-specific measures were assessed at 12 months and at 6-month intervals thereafter. During the examination, the neurologist must determine whether the medications adequately control the motor symptoms reported by the patient. The pre-specified evaluation was the time during which the Move ment Disorder Society Unified Parkinson' Part III of the MDS-UPDRS Disease Rating Scale (MDS-UPDRS) Scores range from 0 to 132, with higher scores indicating worsening motor symptoms of Parkinson's disease. Cha et al., Nat Cell Biol 2017;19:445-56), and the 39-item Parkinson's Disease High scores on the PDQ-39 (Patient's Disease Questionnaire) The scale included a score ranging from 0 to 156, indicating a worsening quality of life (Lee et al., 2013). .

[0169] Brain imaging During surgery and at the implantation site or To screen for bleeding in this area, computed tomography (CT) was performed immediately after surgery. T) scans were performed. Serial magnetic resonance imaging (MRI) scans and magnetic resonance Spectroscopic findings were reviewed for any evidence of tumor, stroke, or hemorrhage. 18-L-dihydroxyphenylalanine ( 18 F-DOPA) positron emission tomography (PE T)-CT was performed to assess the presence of dopamine activity in presynaptic terminals within the engrafted putamen region. The changes in radioisotope uptake were evaluated. 18 F-DOPA normalized uptake value The ratio was used for semi-quantitative determination.

[0170] Safety Monitoring In parallel with the imaging workup, serial clinical neurological examinations to detect neurological adverse events were performed. The study was conducted by two study neurologists and a study radiologist. The patient continued to receive treatment from a neurologist.

[0171] result Immunogenicity of grafts in humanized mice after transplantation As shown in Figure 23A and above, in NOD SCID gamma mice, patient-derived m Both DAP (C4-mDAP) and homologous mDAP (H9-mDAP) survived. When transplanted into allogeneic humanized mice (K1-hu), both graft types were rejected. Patient-humanized mice (C4-hu) were able to express autologous C4-mDAP at 2 weeks after implantation. The grafts stained positive for hNCAM+ cells and expressed TH+ neurons. C4-hu mice rejected the allogeneic H9-mDAP and showed significant CD. There was a 4+ lymphocytic infiltrate (Figures 23B-23C).

[0172] Imaging in patients 0-24 months after implant Three months after the first implantation, 18 Imaging with F-DOPA PET-CT: In the putamen, 18 Following an initial decline from baseline in F-DOPA uptake, Up to 18 and 24 months after implantation on the left and right sides, respectively In the subsequent period, 18 The color intensity scale and As seen in quantitative comparisons of the left and selected subregions, the increase in activity is greater in the left than in the right. It was larger on the right side (second implant) and most prominent in the posterior putamen near the implant site. Semiquantitative changes from baseline in radioisotope uptake were observed (Figures 24A-24B). The change is shown in Figures 24A-24B, which varies from -4.0% to 13.5% on the right side and from -4.0% to 13.5% on the left side. On the other hand, it ranged from -4.8% to 9.8%.

[0173] MRI at 6 months after the first implant and at subsequent time points showed T2-weighted signal intensity The area of ​​enhancement resembled the implantation site within the putamen, as well as along the surgical injection tract within the white matter on the right side. The results were more pronounced in the six putaminal implantation sites (Fig. 24A-24B). No enhancement of the dark contrast was observed. Six months after the second surgery, a 4 mm enhancement area was observed in one Arterial spin-labeling magnetic resonance perfusion imaging observed 3 cm above the target within the injection tract CT and MRI, including imaging and magnetic resonance spectroscopy, revealed changes consistent with postoperative gliosis. showed transformation.

[0174] Clinical evaluation 24 months after the first (left) implant and 18 months after the second (right) implant, the patient No adverse events or declines in function were reported. Prior to the first implant, dopamine replacement therapy Part III of the MDS-UPDRS (Pa) was performed after an overnight rest ("off"). The score on the Motor Signs of Parkinson's Disease (SDS) is based on the patient's assessment of the motor signs of the disease caused by the worsening of symptoms. The patient declined to discontinue medication, so the score during the off period was 4 points after the first implantation. 43 at 12 weeks, 33-41 at subsequent follow-up, and 3 at 24 months. 3. MDS-UPD at peak dose ("on") of dopamine replacement therapy The RS Part III score was 38 at implantation and 19-35 during follow-up. and 29 at 24 months. The quality of life (QoL) was assessed at implantation (62%), with lower scores indicating improved quality of life. The mean ages were 2-34 during the follow-up period and 2 at 24 months (Figures 25A-25B and and Table 5).

[0175] [Table 12]

[0176] After 24 months, the patient's Parkinson's medication was carbidopa-levodopa sustained release (which Capsules containing 23.75 mg and 95 mg, respectively, 3, 3, 2, and 3 capsules at a dose of 4 times daily), rotigotine (4 mg daily), rasagiline (1 mg daily), and Droxidopa (100 mg daily) (levodopa equivalent for a total daily dose of 847 mg) This represented a 6% decrease in levodopa equivalents compared to before implantation. Patients reported less than one "non-control" hour per day. No motor disturbances were reported by the patient or observed during clinical examination (procedure as well as their absence preoperatively).

[0177] In addition to improvements in motor scores and motor ADLs, subjects also experienced improvements in sleep quality, including shortening of REM sleep. Improved quality of life, reduced behavioral symptoms, reduced drooling and swallowing disorders, and reduced anxiety and The study reported an alleviation of depression. There was no decline in subjective cognitive function, and the MoCA score remained between 27 and 30.

[0178] Generation of iPSC-derived autologous dopaminergic progenitor cells in patients with Parkinson's disease This study reports on the manufacture and implantation of the device, along with clinical and imaging results. Present evidence of therapeutic benefit. References

[0179] [Table 13-1]

[0180] [Table 13-2]

[0181] [Table 13-3]

[0182] [Table 13-4]

[0183] [Table 13-5]

[0184] [Table 13-6]

[0185] [Table 13-7]

[0186] Other embodiments The present invention has been described with reference to the detailed description thereof, the foregoing description being incorporated into the appended claims. The scope of the invention is defined by the range of It should be understood that these disclosures are not intended to be limiting. and modifications are within the scope of the following claims.

Claims

1. 1. A method for generating a population of midbrain dopaminergic progenitor cells (mDAP), comprising: Providing a population of induced pluripotent stem cells (iPSCs), preferably human iPSCs. ; a biomatrix hydrogel support having sufficient forcing to maintain separation between the regions. The cell population was then separated into separate regions with a distance between the regions, with approximately 5 cells per region. seeding the cells at a density of 1,000 to 20,000, preferably about 10,000; Call The iPSCs are maintained under conditions sufficient for the cells to differentiate into mDAPs. Top A method comprising:

2. The biological matrix hydrogel support is a basement membrane extract or a synthetic matrix. The method of claim 1, wherein

3. 3. The method of claim 1, wherein the cells are suspended in the gel prior to seeding. method.

4. The method of any one of claims 1 to 3, wherein the region is about 2 to 10 mm in diameter.

5. The method of any one of claims 1 to 4, wherein the distance between the regions is 1 to 3 cm.

6. The iPSCs express alkaline phosphatase (AP) and TRA-1-60.

6. The method according to claims 1 to 5.

7. The mDAP is FOXA2, OTX2, LMX1A, and / or EN1, preferably or one, two, or more genes, including at least FOXA2 and LMX1A. and optionally, the mDAP expresses markers associated with FOXA2, LMX1A, and N The method according to claims 1 to 6, wherein the cells are TH+ cells that co-express URR1.

8. The iPSCs Obtaining a population of primary cells from a subject, preferably wherein said primary cells are selected from the group consisting of fibroblasts, ... fibroblasts, hair keratinocytes, blood cells, or bone marrow mesenchymal stem cells (MSCs) Top; Induction of the expression of OCT4, KLF4, SOX2, and L-MYC in the cells and maintaining the primary cells under conditions sufficient for them to become iPSCs. The method of claims 1 to 7, wherein the method comprises:

9. Inducing expression of OCT4, KLF4, SOX2, and L-MYC Human Oct4 linked to the foot-and-mouth disease virus 2A sequence (OCT4-F2A) was transfected into primary cells. , KLF4, SO linked to the porcine teschovirus 2A sequence (SOX2-P2A) A polycistronic episomal vector containing the coding sequences of X2 and L-MYC was used. The method of claim 8, comprising transfecting.

10. The iPSC expresses miR-106a, miR-106b, and miR-13 in the cells. 6s, miR-200c, miR-302s, miR-369s, and miR-371 / 373, wherein one or more exogenous microRNAs (miRNAs) are selected from the group consisting of The method of claims 1 to 9, wherein the vector is produced by a method comprising the step of expressing A).

11. The miRNA includes one or both of miR-302s and miR-200c. The method according to claim 10.

12. An epitope containing sequences encoding miR-302s and miR-200c is introduced into the cells. The method of claim 11, comprising the step of introducing a chromosome vector.

13. The iPSCs express OCT4, KLF4, SOX2, miR-302 in the primary cells. The method of claim 1, wherein the method comprises expressing both miR-200s and miR-200c.

13. The method according to claims 1 to 12.

14. Into the cells: (i) human 2A sequence of foot-and-mouth disease virus (OCT4-F2A) linked to the 2A sequence of the virus (OCT4-F2A); Oct4, KLF4, and the porcine teschovirus 2A sequence (SOX2-P2A) linked A vector, preferably a viral vector, containing the coding sequences of SOX2 and L-MYC. vector or polycistronic episomal vector, or Oct4, KLF4, SOX2 and L-MYC mature RNA or corresponding protein, and (ii) ) miR-302s and miR-200c, or mature miR-302s and mature miR-200c A vector, preferably a viral vector, containing a sequence encoding iR-200c. The method of claim 13, comprising introducing an episomal vector.

15. 15. The method of any one of claims 1 to 14, wherein the cell is a human cell.

16. Preferably, the reduction of undifferentiated iPSCs by inhibiting the BIRC5 gene is further The method of claim 8, comprising:

17. A cell population containing mDAP, produced by the method of claims 1 to 16.

18. A composition comprising the cell population of claim 17.

19. Treating subjects with or at risk of developing Parkinson's disease (PD) A method of Preferably, primary cultures are obtained from said subjects having or at risk of developing PD. obtaining cells and generating iPSCs from said primary cells; Preferably, SOX1-positive cells, KI67-positive cells, and SOX1 / KI67 double-positive cells. , SOX1 / PAX6 double-positive cells, and SOX1 / PAX6 / KI67 triple-positive cells treating the iPSCs with quercetin for a time sufficient to reduce the number of P; generating a cell population comprising mDAP by the method of claims 1 to 16; and administering the cell population to the subject A method comprising:

20. The cells are optionally isolated from the target tissue using magnetic resonance imaging-guided stereotaxic surgery. The elephant's brain is placed in the caudate nucleus, the stenosis nucleus, and the stenosis nucleus, directly on or adjacent to the affected area, preferably on both sides. and the substantia nigra.

19. The method according to claim 19.

21. The cells are preferably injected into the superior parasagittal region of the cerebral cortex, with a single injection point. creates a column spanning the sagittal extent of the putamen with three injection channels, preferably 21. The method of claim 20, wherein the drug is administered via injection by a device.

22. Dose of approximately 1 million pieces, 2 million pieces, 3 million pieces, 4 million pieces, 5 million pieces, 6 million pieces, 7 million or 8 million cells are administered, preferably the cells are 22. The method of claim 21, wherein the injection passages are divided equally among the injection passages.

23. Both hemispheres are treated, with the cells administered to the first hemisphere in a first treatment and the second hemisphere in a second treatment.

23. The method of claim 19, wherein the method is administered to the other hemisphere in the treatment of method.

24. The time between the first treatment and the second treatment is about 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, 30 months, 36 months, 48 ​​months 24. The method of claim 23, wherein the period is 54 months, 54 months, or 60 months.

25. At least one antibiotic is administered before, during, and / or after surgery.

25. The method of any one of claims 19 to 24.

26. A grid was applied to the back of the dish with the distance between the grid lines being 1.5 to 2.5 cm. a culture dish for culturing cells, preferably provided with a 2 x 2 cm grid; 。

27. The portion of the dish on which the grid is printed or etched onto the back surface.

27. The culture dish of claim 26, formed as follows:

28. Polystyrene, polyethylene, polypropylene, polycarbonate, and polyvinyl 27. The culture dish of claim 26, comprising a thermoplastic resin.

29. A biomatrix hydrogel support, preferably a basement membrane extract, disposed therein.

27. The culture dish of claim 26, comprising a layer of a synthetic or synthetic matrix.