Hepatitis b virus vaccine
An mRNA vaccine encoding the L-HBsAg region of HBV, optimized and encapsulated in lipid nanoparticles, addresses the limitations of current HBV vaccines by providing therapeutic efficacy against hepatitis B through enhanced immune response.
Patent Information
- Application Number
- JP2024124555
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-07-31
- Publication Date
- 2026-02-13
AI Technical Summary
Current HBV vaccines are ineffective in treating hepatitis B, posing a risk of reactivation in genotype Ae strains and lacking therapeutic efficacy.
Development of an mRNA vaccine containing mRNA encoding the L-HBsAg region of HBV, optimized for immune response, encapsulated in lipid nanoparticles, and optionally including a 5' cap structure and 3' poly(A) tail, to induce both preventive and therapeutic immunity against hepatitis B.
The mRNA vaccine effectively treats hepatitis B while preventing infection by inducing robust anti-HBV antibody production and cellular immunity, offering a safer and more efficient alternative to conventional treatments.
Smart Images

Figure 2026022933000006 
Figure 2026022933000007 
Figure 2026022933000008
Abstract
Description
[Technical Field]
[0001] The present invention relates to vaccines for the treatment and / or prevention of Hepatitis B virus (HBV) infection. [Background technology]
[0002] Hepatitis B virus (HBV), the causative virus of hepatitis B, was discovered as the Australia antigen by Blumberg et al. in 1964. Subsequently, the Dane particle, which is the main body of HBV, was identified in 1970, and the viral genome contained in the virus particle was cloned in 1979 (Non-Patent Document 1).
[0003] HBV treatment mainly involves administering interferon (IFN) preparations and nucleic acid analog preparations to suppress the proliferation of hepatitis B virus and prevent the progression of liver disease (Non-Patent Document 2). However, for example, in cases of genotype Ae strains, which are common in Europe and the United States, these drugs pose a risk of reactivating hepatitis B, and the development of alternative treatment methods is desired.
[0004] The recombinant adsorbed hepatitis B vaccine, a widely used HBV vaccine, was approved in Japan over 30 years ago and is known for its high efficacy and safety in preventing HBV infection. The recombinant adsorbed hepatitis B vaccine is an inactivated adsorbed vaccine in which HBs antigen produced using genetically modified yeast is adsorbed onto an adjuvant (aluminum salt). All HBV vaccines currently approved in Japan are recombinant adsorbed hepatitis B vaccines, and are used for the prevention of hepatitis B, prevention of mother-to-child transmission of hepatitis B virus (in combination with anti-HBs human immunoglobulin), and prevention of hepatitis B after accidental contamination with HBs antigen-positive and HBe antigen-positive blood (in combination with anti-HBs human immunoglobulin). [Prior art documents] [Non-patent literature]
[0005] [Non-Patent Document 1] National Institute of Infectious Diseases website, infectious disease information "Hepatitis B" (revised June 19, 2013) URL: https: / / www.niid.go.jp / niid / ja / kansennohanashi / 321-hepatitis-b-intro.html [Non-patent document 2] Japan Society of Hepatology "Hepatitis B Guidelines" (4th edition) June 2022 Summary of the Invention [Problem to be solved by the invention]
[0006] As mentioned above, the HBV vaccines currently on the market are used to prevent HBV infection or the onset of hepatitis B, but none are applicable to the treatment of hepatitis B.
[0007] An object of the present invention is to provide an HBV vaccine that is effective in treating hepatitis B in addition to preventing HBV infection or the onset of hepatitis B. [Means for solving the problem]
[0008] The present inventors have discovered that an mRNA vaccine having mRNA encoding the L-HBsAg region of HBV is useful for both the treatment and prevention of hepatitis B, leading to the completion of the present invention.
[0009] That is, according to the present specification, the following inventions are provided. (1) An HBV vaccine containing, as an active ingredient, a messenger ribonucleic acid (mRNA) having any of the following base sequences (a) to (d) and having immune-inducing activity against hepatitis B virus (HBV): (a) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1; (b) a nucleotide sequence encoding an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; (c) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 3; and (d) A nucleotide sequence encoding an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 3. (2) The HBV vaccine according to (1), wherein any one of the base sequences (a) to (d) is codon-optimized. (3) An HBV vaccine described in (1) or (2), wherein the mRNA has a 5' cap structure and / or a 3' poly(A) tail. (4) The HBV vaccine described in any one of (1) to (3), wherein the mRNA contains a chemical modification in the open reading frame (ORF) portion. (5) The HBV vaccine according to any one of (1) to (4), wherein one or more uridines in the ORF portion of the mRNA are substituted with 1-methylpseudouridine. (6) The HBV vaccine according to any one of (1) to (5), wherein the mRNA is encapsulated in lipid nanoparticles. [Effects of the Invention]
[0010] According to the present invention, it is possible to provide an HBV vaccine that is effective in treating hepatitis B in addition to preventing HBV infection or the onset of hepatitis B. [Brief explanation of the drawings]
[0011] [Figure 1] Photographs showing the results of Western blot of 293FT cells transfected with the pcDNA3.1 L-HBsAg-FLAG vector. The left photograph shows the results of Western blot of WCL, and the right photograph shows the results of Western blot detecting the FLAG tag. [Figure 2] 10 is a photograph showing the results of Western blotting of NIH3T3 cells into which the pcDNA3.1 L-HBsAg-V5 vector was introduced. [Figure 3] Photographs showing the results of immunoblotting to detect preS1 and preS2 in 293FT cells transfected with the pcDNA3.1 L-HBsAg-FLAG vector. (A) Results for preS1 are shown. (B) Results for preS2 are shown. [Figure 4]1 shows photographs depicting the results of immunoblotting to detect expression of preS1 and actin, a housekeeping gene, in NIH3T3 cells transfected with L-HBsAg mRNA. [Figure 5] FIG. 1 is a schematic diagram showing the schedule for administration of mRNA vaccine to chronically HBV-infected mice and various tests. [Figure 6] Photographs showing the results of immunoblotting to detect anti-preS1 antibodies in mRNA-vaccinated chronically HBV-infected mice. GAPDH was detected as a loading control. [Figure 7] This graph compares the amount of anti-preS1 antibody in the serum of HBV chronically infected mice administered with an mRNA vaccine on days 0 (pre) and 42 (post) after administration. The graph on the right is an enlarged view of the absorbance range of 0 to 0.5 in the graph on the left. [Figure 8] FIG. 1 is a schematic diagram showing the schedule for producing a mouse model of chronic HBV infection and for testing to confirm the therapeutic efficacy of mRNA vaccines. [Figure 9] 1 is a graph showing serum AST and ALT measurements 42 days after administration of mRNA vaccine to a mouse model of chronic HBV infection. Error bars indicate standard error. * indicates p<0.05 in the Mann-Whitney U test. [Figure 10] Graphs showing the results of quantitative PCR analysis of gene expression in liver tissue collected from chronically HBV-infected mice administered with mRNA vaccine and from chronically HBV-infected mice not administered with mRNA vaccine. (A) Serum HBV-DNA level; (B) Liver tissue HBV-DNA level; (C) cccDNA level; and (D) Liver tissue HBV-RNA level. Error bars in the figure indicate standard error. * indicates p<0.05 in the Mann-Whitney U test. [Figure 11] Graphs showing the results of measuring serum HBs antibody levels in mice that received two doses of mRNA vaccine after the first and second doses: (A) after the first dose; (B) after the second dose. [Figure 12]This is a schematic diagram showing the schedule for investigating the HBV infection-preventing effect of HBs neutralizing antibodies using PXB cells. [Figure 13] This graph shows the results of measuring HBV-RNA expression levels compared to controls when PXB cells were exposed to diluted serum from various mice administered the mRNA vaccine. Error bars indicate standard error. *, **, and *** indicate p<0.05, p<0.01, and p<0.001, respectively, in a one-way ANOVA test compared to the control (n=3). DETAILED DESCRIPTION OF THE INVENTION
[0012] [1] Definition As used herein, "messenger ribonucleic acid (mRNA)" refers to RNA produced during the process of protein synthesis from genomic information stored in living organisms. It is used to express a target protein by replicating (transcriptionally) the base sequence from the genome and translating it into an amino acid sequence on ribosomes. Eukaryotic mRNA typically contains a 7-methylguanosine cap structure at the 5' end due to post-transcriptional or enzymatic reactions, which is useful for controlling mRNA stability and protein translation efficiency. Furthermore, mRNA may contain untranslated regions (UTRs) on the 5' and 3' sides of the protein-encoding region. The actual coding region within an mRNA molecule is located between the 5'-UTR and 3'-UTR and contains an initiation codon (AUG) and a termination codon (e.g., UGA). Furthermore, mRNA may contain a poly(A) tail at the 3' end.
[0013] As used herein, the term "vaccine" refers to a pharmaceutical composition administered to a subject to induce immunity (humoral immunity and cellular immunity) against pathogens, such as bacteria, viruses, or allergens, for the purpose of treating or preventing disease or poor health caused by the invasion of the pathogen in the subject.
[0014] As used herein, the state of "having immunity-inducing activity against HBV" refers to a state in which it has been confirmed that a subject has produced significantly higher levels of anti-HBV antibodies (especially anti-HBs antibodies) in the blood compared to HBV-uninfected controls, or that the immune response of lymphocytes to HBs antigen is significantly higher compared to HBV-uninfected controls. The confirmation method is not particularly limited, but the former can be confirmed using ELISA or the like, and the latter can be confirmed using ELISpot or the like.
[0015] As used herein, the term "mRNA vaccine" refers to a vaccine containing mRNA that is a partially altered or modified version of natural mRNA or an artificially synthesized mRNA, which, when administered to a subject, induces the desired immune response by introducing the mRNA into the subject's cells and expressing the target protein. Because mRNA is a highly unstable substance, in mRNA vaccines, the mRNA is usually protected by chemical modification or by encapsulation within particles.
[0016] In mRNA vaccines, mRNA is usually encapsulated in lipid nanoparticles and administered to a subject by intramuscular, subcutaneous, or intradermal injection. After administration, mRNA encapsulated in lipid nanoparticles is introduced into cells via membrane fusion between the lipid nanoparticles and the cells. The introduced mRNA is translated in the ribosomes of the cells to produce proteins. After being released outside the cells, some of these proteins are taken up again by other cells (endocytosis), and then taken into endosomes, where they form complexes with MHC class II molecules and are delivered to the cells via the cell surface to bind to CD4 + The antigen peptide is presented to T cells (helper T cells). Helper T cells promote antibody production by B cells through cytokine production (humoral immunity). Meanwhile, some of the proteins produced from mRNA are degraded by the proteasome to form antigen peptides, which form complexes with MHC class I molecules in the endoplasmic reticulum. The antigen peptide is then delivered to CD8 cells via the cell surface by MHC class I molecules. + It is presented to T cells (cytotoxic T cells), which then damage cells infected with viruses, etc. (cellular immunity).
[0017] As used herein, the term "subject" refers to an animal, preferably a mammal. Mammals refer to animals belonging to the phylum Chordata, subphylum Vertebrates, class Mammalia, including both humans and non-humans, and include, for example, primates including humans and chimpanzees, pet animals such as dogs and cats, livestock animals such as cows, pigs, horses, sheep, and goats, rodents such as mice and rats, and mammals kept in zoos. The subject as used herein is preferably a human.
[0018] As used herein, the "sequence identity" of an amino acid sequence or a nucleotide sequence refers to a value that can be determined using a protein search system or a gene search system such as BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), with or without introducing gaps.
[0019] As used herein, the term "adjuvant" refers to a substance that can enhance the antibody-inducing effect of a vaccine when administered to a subject together with the antibody-inducing substance in the vaccine.
[0020] In this specification, "compound ratios" are all expressed as weight ratios unless otherwise specified. Furthermore, concentrations expressed as "%" are all expressed as % by weight unless otherwise specified.
[0021] [2] Hepatitis B virus vaccine [2-1] Configuration The HBV vaccine of the present invention is characterized by comprising, as an active ingredient, messenger ribonucleic acid (mRNA) having any of the following base sequences (a) to (d), and having immune-inducing activity against hepatitis B virus (HBV). (a) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1; (b) a sequence identical to the amino acid sequence set forth in SEQ ID NO: 1 by 80% or more, 85% or more, 86% or more, or 87% a nucleotide sequence encoding an amino acid sequence having at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity; (c) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 3; and (d) a sequence identical to the amino acid sequence set forth in SEQ ID NO: 3 by 80% or more, 85% or more, 86% or more, or 87% a nucleotide sequence encoding an amino acid sequence having 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity. The HBV vaccine of the present invention has the advantage of being effective in both preventing HBV infection and treating existing hepatitis B in a subject.
[0022] [2-2] Nucleotide sequence As a result of extensive research, the present inventors have found that, rather than the HBV middle HBs antigen that has been used in antigen vaccines, large HBs antigen (L-HBsAg) expressed on the surface of the HBV large envelope, particularly mRNA encoding the preS1 region, is effective in preventing and treating HBV infection. SEQ ID NO: 1 above represents the N-terminal amino acid sequence of preS1, and SEQ ID NO: 3 represents the entire amino acid sequence of L-HBsAg. The amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 3 are shown in Table 1.
[0023] [Table 1]
[0024] The base sequence encoding the amino acid sequence represented by SEQ ID NO: 1 is not particularly limited, but can be, for example, the base sequence represented by SEQ ID NO: 2. The base sequence encoding the amino acid sequence represented by SEQ ID NO: 3 is not particularly limited, but can be, for example, the base sequence represented by SEQ ID NO: 4. Both base sequences are preferably codon-optimized according to the subject to which the vaccine is to be administered. The sequences of SEQ ID NOs: 2 and 4 are shown in Table 2.
[0025] [Table 2]
[0026] [2-3] Codon optimization Any known codon optimization technique may be used. Codon optimization can be performed for purposes such as adjusting the GC content to enhance mRNA stability or reduce secondary structure; reducing tandem repeat codons or stretches of identical bases; adjusting transcriptional and translational control regions; inserting or removing protein transport sequences; removing or adding post-translational modification sites (e.g., glycosylation sites) within the encoded protein; adding, removing, or shuffling protein domains; inserting or deleting restriction enzyme recognition sites; modifying ribosome binding sites and mRNA degradation sites; and adjusting the translation rate to ensure proper folding of various protein domains. Codon optimization tools, algorithms, and services are known in the art, including, but not limited to, services from GeneArt (Life Technologies), DNA2.0 (Menlo Park), and / or proprietary methods. In particular, the open reading frame (ORF) sequence encoding L-HBsAg is preferably optimized using an optimization algorithm.
[0027] Codon optimization may result in an mRNA nucleotide sequence that has less than 95%, 90%, 85%, 80%, 75%, 70%, or 65% sequence identity to the nucleotide sequence of the wild-type HBV ORF, but is not particularly limited as long as the amino acid sequence of the encoded protein satisfies the above requirements. Codon optimization has the advantage of increasing the expression efficiency of the HBV vaccine of the present invention in recipients.
[0028] [2-4] Stabilizing elements and chemical modifications In the HBV vaccine of the present invention, the mRNA preferably has a 5' cap structure and / or a 3' poly(A) tail. Having a 5' cap structure is particularly preferred. Having a 5' cap structure allows the protein to be produced without immediate degradation after being taken up by the cells of a subject (e.g., a human). Any known chemical RNA cap analog can be used as the 5' cap of the mRNA. For example, TriLink's CleanCap® service can be used. Alternatively, known cap analogs such as 3'-O-Me-m7G(5')ppp(5')G (ARCA cap), G(5')ppp(5')A;G(5')ppp(5')G;m7G(5')ppp(5')A;m7G(5')ppp(5')G can be used.
[0029] The 3' poly(A) tail is a stretch of adenine nucleotides added to the 3' end of transcribed mRNA. The length of the poly(A) tail is not particularly limited and can be varied appropriately depending on the structure and target of the mRNA. For example, the poly(A) tail can contain 20 to 500 adenines, particularly 100 to 200 adenines.
[0030] The mRNA may have a 5'-UTR and a 3'-UTR. The 5'-UTR sequence may be, for example, the 5'-UTR sequence of human alpha-globin mRNA, along with an optimized "Kozak sequence" for increased translation efficiency. The 3'-UTR sequence may be a combination of two sequence elements (FI elements) derived from the "amino terminal enhancer of split gene" (AES) mRNA (referred to as F) and the mitochondrial-encoded 12S ribosomal RNA (referred to as I) located between the coding sequence and the poly(A) tail to increase protein production and ensure long-term maintenance of the mRNA (see WO2017 / 060314). Alternatively, the 3'-UTR may be two repeated 3'-UTRs of human beta-globin mRNA.
[0031] In the HBV vaccine of the present invention, the ORF region of mRNA may be unmodified or chemically modified. The nucleosides constituting the mRNA include modified nucleotides or nucleosides. Such modified nucleotides and nucleosides may be naturally occurring modified nucleotides and nucleosides or may not be naturally occurring modified nucleotides and nucleosides. Such modifications include known modifications in the sugar, backbone, or nucleic acid base moieties of nucleotides and / or nucleosides.
[0032] In the HBV vaccine of the present invention, modified nucleobases in the mRNA include 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudouridine, 5-methylcytidine, and / or 5-methoxycytidine. The polyribonucleotide may contain a combination of at least two of the modified bases.
[0033] Preferably, mRNAs having these stabilizing elements and / or modifications have a stability of 12 to 18 hours or more than 18 hours, e.g., 12, 18, 24, 36, 48, 60, 72 hours, or more than 72 hours, when transfected into mammalian host cells, and are capable of expression by mammalian host cells.
[0034] [2-5] Lipid nanoparticles (LNPs) In the HBV vaccine of the present invention, mRNA is preferably encapsulated in LNPs to increase the stability of the molecule and the efficiency of its uptake into cells. In particular, it is preferable to encapsulate one mRNA molecule in one LNP.
[0035] Any LNP known to be used in mRNA vaccines can be used. For example, LNPs with the same composition as those used in commercially available vaccines (e.g., "BNT162b2; Comirnaty (Pfizer-BioNTech mRNA vaccine)") listed in Table 1 of Schoenmaker L., et al., Int. J. Pharm. 601 (2021) 120586 can be used. Such LNPs can include, for example, 20 to 60 mol% ionizable cationic lipids, 5 to 25 mol% non-cationic lipids (e.g., neutral lipids), 25 to 55 mol% sterols or steroids, and 0.5 to 15 mol% polymer-conjugated lipids (e.g., PEG-modified lipids). The ionizable cationic lipid may be selected from the group consisting of, for example, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate. The sterol or steroid may be, for example, cholesterol. The neutral lipid may be, for example, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). The polymer-conjugated lipid may be, for example, PEG2000 DMG.
[0036] LNPs can be prepared by referring to the descriptions in, for example, International Publication Nos. 2017 / 070626, 2018 / 170347, 2021 / 159040, and 2021 / 213945.
[0037] [2-6] Composition components In addition to mRNA or mRNA encapsulated in lipid nanoparticles, the vaccine of the present invention may contain an adjuvant. Any adjuvant known in the art may be used.
[0038] In addition to mRNA or mRNA encapsulated in lipid nanoparticles, the vaccine of the present invention may contain a pharmaceutically acceptable carrier as needed. The term "pharmaceutically acceptable carrier" as used herein refers to additives commonly used in the pharmaceutical technology field. Examples include excipients, binders, disintegrants, fillers, emulsifiers, flow regulators, lubricants, etc.
[0039] Examples of excipients include sugars such as monosaccharides, disaccharides, cyclodextrins, and polysaccharides (more specifically, but not limited to, glucose, sucrose, lactose, raffinose, mannitol, sorbitol, inositol, dextrin, maltodextrin, starch, and cellulose), metal salts (e.g., sodium chloride, sodium or calcium phosphate, calcium sulfate, magnesium sulfate, calcium carbonate), citric acid, tartaric acid, glycine, low-, medium-, and high-molecular-weight polyethylene glycols (PEGs), phospholipids, lysophospholipids, cholesterol, fatty acids, pluronics, kaolin, silicic acid, or combinations thereof.
[0040] Examples of binders include starch paste using corn, wheat, rice, or potato starch, simple syrup, glucose solution, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, shellac, and / or polyvinylpyrrolidone.
[0041] Examples of disintegrants include the above-mentioned starches, lactose, carboxymethyl starch, cross-linked polyvinylpyrrolidone, agar, laminaran powder, sodium hydrogen carbonate, calcium carbonate, alginic acid or sodium alginate, polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, stearic acid monoglyceride, or salts thereof.
[0042] Examples of fillers include the above-mentioned sugars and / or calcium phosphate (for example, tricalcium phosphate or calcium hydrogen phosphate).
[0043] Examples of emulsifiers include sorbitan fatty acid esters, glycerin fatty acid esters, sucrose fatty acid esters, and propylene glycol fatty acid esters.
[0044] Examples of flow regulators and lubricants include silicates, talc, stearates or polyethylene glycol.
[0045] Such carriers are primarily used to facilitate the formation of the dosage form and to maintain the dosage form and pharmacological effect, and may be used appropriately as needed. In addition to the above-mentioned additives, flavoring agents, solubilizing agents, suspending agents, diluents, surfactants, stabilizers, absorption promoters, bulking agents, wetting agents, humectants, adsorbents, disintegration inhibitors, coating agents, coloring agents, preservatives, antioxidants, fragrances, flavoring agents, sweeteners, pH adjusters, etc. may also be included as needed.
[0046] The vaccine of the present invention may also contain other drugs to the extent that the pharmacological effects of the drugs are not lost.
[0047] The dosage form of the vaccine of the present invention is not particularly limited as long as it can maintain the effects of the mRNA or mRNA encapsulated in lipid nanoparticles and other additional components. Examples of dosage forms for intramuscular administration include injections. As injections, any of the existing forms, such as sterilized liquid injections and lyophilized injections that are dissolved or suspended in sterile water or the like immediately before use, may be used. Examples of dosage forms for oral administration include tablets, orally disintegrating tablets, pills, capsules, granules, fine granules, powders, syrups, emulsions, suspensions, sublingual preparations, and inhalants. Examples of dosage forms for subcutaneous and intradermal administration include injections, poultices, and transdermal absorption preparations. Intramuscular, subcutaneous, and intradermal injections are preferred, with intramuscular injections being particularly preferred.
[0048] The amount of mRNA contained in the vaccine (composition) can be, for example, 1 ng to 1 μg / μL, 10 to 700 ng / μL, 100 to 500 ng / μL, or 150 to 400 ng / μL.
[0049] [2-7] Administration method The HBV vaccine of the present invention provides an RNA vaccine (pharmaceutical composition) and method for preventing HBV infection and treating hepatitis B in a subject. The RNA vaccine can be used as a therapeutic or prophylactic agent. In one embodiment, the RNA vaccine is used to provide prophylactic protection from HBV infection. In another embodiment, the RNA vaccine is used to treat hepatitis B. In yet another embodiment, the RNA vaccine is used to prime immune effector cells, for example, to activate peripheral blood mononuclear cells (PBMCs) ex vivo, which are then infused (reinfused) into a subject.
[0050] As described in the Examples below, it has been confirmed that the HBV vaccine of the present invention has high preventive and therapeutic effects in mice when administered once or twice. Therefore, when used for the purpose of preventing HBV infection, the HBV vaccine may be administered once, twice, three times, four times, or more, but is particularly preferably administered once or twice. When used for the purpose of treating hepatitis B, the HBV vaccine may be administered once, twice, three times, four times, or more. The frequency of administration is not limited, but may be, for example, about one month between the first and second administrations, and, if subsequent administrations are required, about once every six months to one year.
[0051] The route of administration of the HBV vaccine of the present invention is not particularly limited, and examples include intradermal, intramuscular, intranasal, oral, sublingual, intratracheal, pulmonary, colonic, and / or subcutaneous administration. The amount required for administration can be varied depending on the subject's age, weight, and living environment, severity of disease, concomitant medications, medical history, administration method, lifestyle, etc.
[0052] The HBV vaccine of the present invention is administered to a subject in an amount effective to induce an antigen-specific immune response. RNA encoding HBs antigen is translated in vivo to produce the antigen, which then stimulates an immune response in the subject. The RNA is preferably administered at an amount that provides a preventive or therapeutic effect without causing serious side effects. For example, a single dose may be 150 ng to 1 mg, 200 ng to 1 mg, 500 ng to 1 mg, 1 μg to 1 mg, 10 μg to 1 mg, 100 μg to 1 mg, 200 μg to 1 mg, 150 ng to 900 μg, 150 ng to 800 μg, 150 ng to 500 μg, or 150 ng to 100 μg per kg of body weight.
[0053] The RNA vaccines of the present invention can be formulated in dosage forms described herein, for example, intranasal, buccal, sublingual, intratracheal, pulmonary, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous) dosage forms.
[0054] Currently, pharmaceuticals used to treat hepatitis B include interferon preparations, pegylated interferon nucleic acid, and analog preparations. However, interferon preparations require intramuscular injection once to seven times per week, while pegylated interferon preparations require oral administration approximately once per week. Analog preparations require oral administration once per day. Both of these methods impose a burden on patients in terms of cost and compliance. Furthermore, some cases are ineffective with these pharmaceuticals, necessitating the development of other approaches. The HBV vaccine of the present invention has the advantage that it can be sufficiently effective with only one or two administrations (e.g., intramuscular injection). Even in cases where long-term treatment is required, it is expected to be effective with administration approximately once to twice per year, making it still advantageous over conventional treatment methods.
[0055] The HBV vaccine of the present invention has a different mechanism of action from conventional drugs, and is therefore expected to be effective as a new approach for cases in which conventional drugs have not been effective. Furthermore, because it is capable of inducing cellular immunity, it may also be useful in the treatment of hepatitis B, which has been difficult with conventional drugs.
[0056] The disclosures of all patent and non-patent literature cited herein are hereby incorporated by reference in their entirety. [Example]
[0057] EXAMPLES Hereinafter, examples will be shown to explain the present invention in more detail, but it is not intended that the scope of the present invention be limited to the scope of the examples.
[0058] [Example 1] Preparation of codon-optimized L-HBsAg expression vector Artificially synthesized DNA with a codon-optimized sequence of L-HBsAg DNA (SEQ ID NO: 5) (GenBank Accession No. KF170746.1) was obtained from an artificial gene synthesis service (Eurofins Genomics, Inc.). Nucleic acid amplification was performed by PCR using the synthesized cDNA as a template to obtain an amplified product. The sequences of the forward and reverse primers used in PCR are as follows: The four bases at the 5' end of the forward primer are the sequence required for TOPO cloning. The reverse primer sequence omits the stop codon for a C-terminal tag. Forward primer: 5'- CACCATGGGGCAGAATCTCAGCAC -3' (SEQ ID NO: 6) Reverse primer: 5'- GATGTAGACCCACAAACAGAAGAA -3' (SEQ ID NO: 7) The resulting amplification product (nucleic acid fragment) was cloned into the pENTR / D-TOPO vector (ThermoFisher).Furthermore, it was recombined into the pcDNA3.1 cV5 vector (ThermoFisher) or the pcDNA3.1 cFLAG (in-house) vector using the GATEWAY system to prepare a codon-optimized L-HBsAg expression vector.
[0059] [Example 2] Confirmation of expression of codon-optimized L-HBsAg expression vector in cultured cells (1) Immunoprecipitation and Western Blot 1 × 10 human 293FT cells (ThermoFisher) 5Cells were seeded at 1000 cells / mL in a 10-cm dish and transfected with 5 μg of pcDNA3.1 L-HBsAg-FLAG vector (two clones: #1 and #2) or 5 μg of pcDNA3.1 vector (mock vector) using Lipofectamine® 3000 (ThermoFisher). 24 hours after transfection, cells were washed with PBS and lysed with 1 mL of lysis buffer (1% NP-40, 150 mM NaCl, 50 mM Tris (pH 8.0)). The lysate was centrifuged at 15,000 rpm for 15 minutes at 4°C to collect whole cell lysate (WCL). A 950 μL aliquot of WCL was added to 10 μL of anti-FLAG M2 beads (Sigma-Aldrich). The mixture was mixed by inversion overnight at 4°C, and then centrifuged at 11,000 rpm for 1 minute at 4°C to remove the supernatant. The precipitate was washed five times with 1 mL of lysis buffer and then eluted with lysis buffer containing 150 μg / mL of 3×FLAG peptide (Sigma-Aldrich) to obtain immunoprecipitated products (FLAG IP). The WCL and FLAG IP were subjected to Western blotting, and FLAG-tagged proteins were detected using rabbit anti-FLAG polyclonal antibody (Sigma-Aldrich) and HRP-conjugated anti-rabbit IgG antibody (Cell Signaling Technology).
[0060] The results of Western blot analysis of WCL and FLAG IP of 293FT cells are shown in Figure 1. Bands were observed in both WCL and FLAG IP, confirming the expression of HBsAg in 293FT cells.
[0061] Mouse NIH3T3 cells (ATCC) were cultured at 5 × 10 4Cells were seeded at 1000 cells / mL in a 6-well plate and transfected with 1 μg of pcDNA3.1 L-HBsAg-V5 vector or mock vector using Lipofectamine 3000 (ThermoFisher). 24 hours after transfection, the cells were washed with PBS and lysed with 200 μL of lysis buffer. The lysate was centrifuged at 15,000 rpm at 4°C for 15 minutes to recover WCL. WCL were subjected to Western blotting, and V5-tagged proteins were detected using mouse anti-V5 antibody (ThermoFisher) and HRP-conjugated anti-mouse IgG antibody (Cell Signaling Technology).
[0062] The results of Western blot of WCL from NIH3T3 cells are shown in Figure 2. It was confirmed that HBsAg was also expressed in NIH3T3 cells.
[0063] (2) Immunofluorescence staining Mouse NIH3T3 cells or mouse L929 cells (RIKEN BRC) were cultured at 5 × 10 4 Cells were seeded at 1000 cells / mL in 4-well chamber slides and transfected with 0.25 μg of pcDNA3.1 L-HBsAg-FLAG vector or mock vector using Lipofectamine 3000 (ThermoFisher). 24 hours after transfection, cells were washed with PBS, fixed with 4% PFA / PBS for 5 minutes, and permeabilized with 0.01% Triton X-100 / PBS for 5 minutes. After blocking with 5% goat serum / PBS for 30 minutes, FLAG-tagged proteins were stained using rabbit anti-FLAG polyclonal antibody (Sigma-Aldrich) and Alexa488-conjugated anti-rabbit IgG antibody (ThermoFisher). Nuclei were stained with Hoechst 33342 and observed under a fluorescence microscope. In L-HBsAg-transfected NIH3T3 and L929 cells, a green FLAG-related staining was detected around the blue nucleus. This confirmed that HBsAg was expressed in the cells.
[0064] (3) Confirmation of preS1 and preS2 expression in L-HBsAg-transfected cells by immunoblotting WCLs from 293FT cells transfected with the pcDNA3.1 L-HBsAg-FLAG vector or mock vector prepared in (1) were subjected to Western blotting, and V5-tagged proteins were detected using mouse anti-preS1 antibody (Santa Cruz Biotechnology), mouse anti-preS2 antibody (Santa Cruz Biotechnology), and HRP-conjugated anti-mouse IgG antibody (Cell Signaling Technology).
[0065] The results of immunoblotting are shown in Figure 3. Figure 3A shows the results of immunoblotting using an anti-preS1 antibody, and Figure 3B shows the results of immunoblotting using an anti-preS2 antibody. Expression of both preS1 and preS2 was confirmed in 293FT cells transfected with L-HBsAg.
[0066] These results confirmed that L-HBsAg can be expressed intracellularly.
[0067] [Example 3] Synthesis of L-HBsAg mRNA and confirmation of expression The sequence of SEQ ID NO: 4 was codon-optimized, and L-HBsAg mRNA was synthesized using TriLink's custom synthesis service (CleanCap®), with a 5' cap structure (Cap1), all uridines replaced with N1-methylpseudouridine, and a 120-bp 3' poly(A) tail.
[0068] 5 × 10 mouse NIH3T3 cells 4Cells were seeded at 1000 cells / mL in a 24-well plate and transfected with 500 ng of synthesized L-HBsAg mRNA using Lipofectamine MessengerMAX (ThermoFisher). 24 hours after transfection, the cells were washed with PBS and lysed with 200 μL of lysis buffer. The lysate was centrifuged at 15,000 rpm at 4°C for 15 minutes to collect WCL. WCL was subjected to Western blotting to detect preS1 using a mouse anti-preS1 antibody (Santa Cruz Biotechnology) and an HRP-conjugated anti-mouse IgG antibody (Cell Signaling Technology). As a control, a similar experiment was performed on cells without mRNA transfection.
[0069] The results of immunoblotting are shown in Figure 4. It was confirmed that preS1 could be expressed in NIH3T3 cells transfected with L-HBsAg mRNA.
[0070] [Example 4] Preparation of mRNA vaccine Lipid nanoparticles (LNPs) with a similar composition to the SARS-CoV2 mRNA vaccine BNT162b2 (Schoenmaker L., et al., Int. J. Pharm. 601(2021) 120586) were prepared and encapsulated with synthesized L-HBsAg mRNA to produce an L-HBsAg mRNA vaccine.
[0071] [Example 5] Immunity induction by mRNA vaccine administration in HBV chronic infection model mice (1) Generation of AAV8-HBV1.3mer chronically infected mice AAV8-HBV1.3mer viral particles were obtained from SignaGen Laboratories (Rockville). Ten-week-old male C57BL6J mice (Jackson Laboratory) were inoculated with 1 × 10 10AAV8-HBV1.3mer virus particles were injected intravenously into the tail at a dose of vg / 100 μL / mouse. Mice 28 days after AAV8-HBV1.3mer injection were designated as chronically infected with HBV.
[0072] (2) Administration of mRNA vaccine to chronically infected HBV mice and confirmation of preS1 expression Figure 5 shows an outline of the schedule for mRNA vaccine administration and various tests in chronically HBV-infected mice. The L-HBsAg mRNA vaccine prepared in Example 4 was intramuscularly administered to the thigh muscles of chronically HBV-infected mice at 0, 1, 4, 10, or 20 μg mRNA / site, and thigh muscle tissue was collected 24 hours later. The collected tissue was lysed in RIPA buffer (FUJIFILM Wako), and the lysate was subjected to Western blotting. L-HBsAg and GAPDH protein (loading control) were detected using mouse anti-preS1 antibody (Beacle), rabbit anti-GAPDH antibody (Cell Signaling Technology), HRP-labeled anti-mouse IgG antibody (Cell Signaling Technology), and HRP-labeled anti-rabbit IgG antibody (Cell Signaling Technology).
[0073] The results of immunoblotting are shown in Figure 6. It was confirmed that the preS1 expression level in the thigh muscle increased in a manner dependent on the amount of mRNA administered.
[0074] (3) Measurement of anti-HBsAg IgG levels in HBV chronically infected mice administered mRNA vaccine On days 1 and 22, mice were intramuscularly administered L-HBsAg mRNA vaccine into the thigh muscle at 0, 1, 4, 10, or 20 μg mRNA / site (a total of two immunizations). Peripheral blood was collected by retroorbital bleed on days 0, 21, and 42 after the first mRNA vaccine administration, and serum was collected by centrifugation. Anti-L-HBsAg IgG production was analyzed by ELISA using serum collected on days 0 (pre) and 42 (post) after the first mRNA vaccine administration. L-HBsAg genotype D (obtained from Beacle) was diluted with PBS to a concentration of 1 μg / mL, dispensed into a 96-well plate at 100 μL per well, and left overnight at 4°C to allow adsorption to the plate. After removing the solution from each well and washing with PBS-T (0.05% Tween-20), 200 μL of 1% BSA / PBS-T was added per well and allowed to stand for 1 hour for blocking. After blocking, 1 μL of serum and 49 μL of 1% BSA / PBS-T were added to each well and allowed to stand for 1 hour. After washing three times with PBS-T, 50 μL of HRP-labeled anti-rabbit IgG antibody (Proteintech) / 1% BSA / PBS-T was added to each well and allowed to stand for 1 hour. After washing three times with PBS-T, 50 μL of TMB solution (FUJIFILM Wako) was added to each well and allowed to stand for 20 minutes. 50 μL of 1N HCl was added to each well to stop the color reaction. The absorbance at 450 nm / 630 nm was measured using a plate reader. Tests were performed in triplicate.
[0075] The amount of anti-HBsAg IgG in the serum of each mouse before and after the administration is shown in Figure 7. It was confirmed that the amount of anti-HBsAg IgG increased depending on the amount of mRNA administered.
[0076] (4) ELISpot assay of lymphocytes from mRNA-vaccinated chronically HBV-infected mice (4-1) Collection of lymphocytes Mice were euthanized by cervical dislocation 51 days after mRNA vaccination, and their spleens and livers were removed. The spleens and livers were separated into single cells using a 70 μm cell strainer. Spleen cells were lysed using red blood cell lysis buffer, and lymphocytes were collected. Lymphocytes not used on the day were suspended in CELLBANKER (Takara Bio) and stored at -80°C. The lymphocyte fraction of liver cells was collected by density centrifugation. Specifically, Percoll plus (Cytiva) was mixed with RPMI 1640 medium (Gibco) containing 2% fetal bovine serum (FBS) and 10 mM HEPES to prepare 30% and 65% Percoll solutions. Single cells were suspended in 30% Percoll, then layered with 65% Percoll, and centrifuged at 1,000 × g for 20 minutes at room temperature. After centrifugation, lymphocytes in the intermediate layer were collected by aspiration. Next, red blood cells were lysed with red blood cell lysis buffer, and liver-infiltrating lymphocytes were collected. Of the collected liver-infiltrating lymphocytes, those not to be used on the day were suspended in STEM-CELLBANKER (Takara Bio) and stored at -80°C.
[0077] (4-2) Peptide synthesis (1) Mouse MHC H-2-restricted epitopes derived from the amino acid sequence of known HBs antigens (Sette, AD et al. J. Immunol., 166, 1389-1397 (2001); Schirmbeck, R., et al., Eur. J. Immunol., 33, 2429-2438 (2003); Kuhroeber, A. et al., J. Immunol., 156, 3687-3695 (1996); Kuhroeber, A., et al., Int Immunol. 9, 1203-1212 (1997); Roh, S., et al., Virus Res., 73, 17-26 (2001)) were used as antigen peptides. The amino acid sequences of the 10 peptides used are shown in Table 3. The antigen peptides were synthesized by Eurofins Genomics. The purity of all synthesized antigen peptides was confirmed to be 90% or higher by reversed-phase high-performance liquid chromatography.
[0078] [Table 3]
[0079] (4-3) Synthesis of antigen peptide (2) The amino acid sequence from positions 1 to 108 of the L-HBsAg PreS1 sequence was divided into 24 overlapping fragments of 15 amino acids each, and peptide synthesis was performed in the same manner as in (4-2) (peptides 11 to 34). Peptides 11 to 34 were combined in equal amounts to prepare peptide mixes C1 to C5 and R1 to R5. Table 4 shows the amino acid sequences of peptides 11 to 34, and Table 5 shows the types of peptides contained in each peptide mix.
[0080] [Table 4]
[0081] [Table 5]
[0082] (4-4) Interferon (IFN)-γ ELISpot assay Anti-mouse IFN-γ antibody (Mabtech) solution was dispensed into a 96-well microplate (MultiScreen; Merck Millipore) and left to stand overnight at 4°C for antibody coating. The coated plate was washed several times with PBS and then blocked by leaving it to stand at room temperature for 2 hours using RPMI1640 containing 5% FBS. Each peptide prepared in (4-2) and (4-3) was added to the wells at a final concentration of 10 μg / mL (n=2). The lymphocytes prepared and frozen in (4-1) were thawed, and the cell number was counted and 3 × 10 5Lymphocytes were added to the wells at 100 μL / well. RPMI medium containing 5% FBS was used. Lymphocytes and peptides were incubated at 37°C and 5% CO2 for 24 hours. After washing the plate eight times with PBS and PBS-T, 100 μL of biotin-labeled anti-mouse INF-γ antibody was added to each well and incubated overnight at 4°C. After washing the plate, streptavidin-alkaline phosphatase conjugate (Mabtech) was added to each well and incubated at room temperature for 2 hours. After washing with PBS, NBT / BCIP solution (BioRad) was added. The reaction was stopped by washing with distilled water, and the wells were dried. The number of specific spots was calculated by subtracting the number of spots in blank wells from the number of specific spots. A positive ELISpot was determined when the number of specific spots was 10 or more and the number of counted spots was at least twice the number of spots in blank wells.
[0083] Of peptides 1 to 10 in Table 3, four peptides were judged to be positive: peptides 1, 2, 5, and 8. All of these peptides correspond to peptide fragments of L-HBsAg. Furthermore, of the peptide mix in Table 5, C1, C5, R1, and R2 were judged to be positive. This confirmed that peptides 11, 15, 16, and 20 are involved in immune induction. These results confirmed that the mRNA vaccine induced cellular immunity against L-HBsAg in mice and that multiple lymphocyte epitopes are present in preS1 of L-HBsAg.
[0084] [Example 6] Therapeutic effect of mRNA vaccine on HBV chronic infection model mice (1) Generation of chronically HBV-infected mice and control mice The mRNA vaccine was administered to mice chronically infected with HBV and its therapeutic effect was confirmed. (Figure 8) The schedule for generating model mice and confirming the therapeutic effect is shown in Figure 1. Chronically HBV-infected mice were generated in the same manner as in Example 5(1). As a negative control, AAV8-Empty Capside (66V080) from PROGEN Biotechnik GmbH was used, and AAV8-Empty was administered to mice in the same manner instead of AAV8-HBV1.3mer to generate control mice.
[0085] (2) Administration of mRNA vaccine As in Example 5(2), mRNA was administered to HBV chronic infection model and control mice.
[0086] (3) Measurement of AST / ALT Twenty-one days after the second mRNA vaccine administration, blood was collected from each mouse, and AST / SLT in 5 μL of serum was measured according to the Transaminase CII-Test Wako (Fujifilm Wako Pure Chemical Industries) protocol. Figure 9 shows the results of measuring ALT and AST concentrations in various mice. There was no significant difference in ALT and AST values between mice with and without mRNA vaccine administration, confirming that vaccination did not induce significant liver damage.
[0087] (4) Measurement of HBV-DNA in serum and liver tissue DNA extraction was performed according to the protocol for Sumitest EX-R&D (GS-J0201, MBL). NucleoSpin Tissue (U0952B, Takara Bio) was used to extract DNA from mouse liver tissue. A total of 20 μL of test solution was prepared: 1 μL of 20 ng template DNA, 10 μL of 2× qPCR MasterMix Plus Low ROX (Nippon Gene), 0.4 μL of 10 μM HBV-DNA forward primer, 0.4 μL of 10 μM HBV-DNA reverse primer, 0.2 μL of HBV-DNA Taqman® probe, and 8 μL of nuclease-free water. HBV DNA was quantified using a QuantStudio 12K Flex real-time PCR system (Thermo Fisher Scientific). Forward primer for HBV-DNA: 5'-ACTCACCAACCTCCTGTCCT-3' (SEQ ID NO: 42) Reverse primer for HBV-DNA: 5'-GACAAACGGGCAACATACCT-3' (SEQ ID NO: 43) HBV-DNA probe: 5'-FAM-TATCGCTGG / ZEN / ATGTGTCTGCGGCGT-TAMRA-3' (SEQ ID NO: 44)
[0088] (5) Measurement of cccDNA in liver tissue Circular DNA was extracted from 250 ng of liver tissue collected from HBV-infected mice receiving the mRNA vaccine and from mice not receiving the mRNA vaccine. Circular DNA was extracted from 250 ng of liver tissue in 2.5 μL of 10× NEB buffer and 0.5 μL of T5 exonuclease (New England BioLabs) at 37°C for 30 minutes and 95°C for 5 minutes. cccDNA expression was measured using a QuantStudio 12K Flex real-time PCR system (Thermo Fisher Scientific) containing 1 μL of template circular DNA, 10 μL of 2× qPCR MasterMix Plus Low ROX (Nippon Gene), 0.4 μL of 10 μM cccDNA forward primer, 0.4 μL of 10 μM cccDNA reverse primer, 0.2 μL of cccDNA TaqMan probe, and 8 μL of nuclease-free water. cccDNA was quantified using a QuantStudio 12K Flex real-time PCR system (Thermo Fisher Scientific). Forward primer for cccDNA: 5'-CGTCTGTGCCTTCTCATCTGC-3' (SEQ ID NO: 45) Reverse primer for cccDNA: 5'-GCACAGCTTGGAGGCTTGAA-3' (SEQ ID NO: 46) Probe for cccDNA: 5'-FAM-CTGTAGGCATAAATTGGT-MGB-3' (SEQ ID NO: 47)
[0089] (6) Measurement of liver HBV-RNA Liver RNA was extracted from liver tissue collected from chronically HBV-infected mice administered the mRNA vaccine and from mice not administered the mRNA vaccine, according to the RNeasy Mini Kit (Qiagen) protocol. cDNA was prepared by reverse transcription using the extracted RNA as a template with the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Expression of HBV-RNA 3.5 kb and the housekeeping gene GAPDH was measured using a QuantStudio 12K Flex real-time PCR system (Thermo Fisher Scientific) in a total volume of 10 μL. The following reagents were prepared: 1 μL of 5 ng cDNA, 5 μL of 2x SYBR Select Master Mix (Thermo Fisher Scientific), 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, and 3 μL of nuclease-free water. Expression of HBV-RNA 3.5 kb and the housekeeping gene GAPDH was measured using a QuantStudio 12K Flex real-time PCR system (Thermo Fisher Scientific). Forward primer for HBV-RNA 3.5 kb: 5'-GAGTGTGGATTCGCACTCC-3' (SEQ ID NO: 48) Reverse primer for HBV-RNA 3.5 kb: 5'-GAGGCGAGGGAGTTCTTCT-3' (SEQ ID NO: 49) Forward primer for GAPDH: 5'-TCTGGAAAGCTGTGGCGTG-3' (SEQ ID NO: 50) Reverse primer for GAPDH: 5'-CCAGTGAGCTTCCCGTTCAG-3' (SEQ ID NO: 51)
[0090] Figure 10 shows the results of various quantitative PCRs. Figure 10A shows the amount of HBV-DNA in serum, Figure 10B shows the amount of HBV-DNA in liver tissue, Figure 10C shows the amount of cccDNA in liver tissue, and Figure 10D shows the amount of HBV-RNA in liver tissue (relative values, with the mean value of the unvaccinated group taken as 1.0). In mice administered the HBV vaccine, both the HBV-DNA and HBV-RNA amounts were significantly reduced, demonstrating that administration of the HBV vaccine is useful for treating hepatitis B.
[0091] (7) Immunohistochemistry staining For immunohistochemical staining, liver tissues isolated from chronically HBV-infected mice receiving the mRNA vaccine and those not receiving the mRNA vaccine were formalin-fixed, paraffin-blocked, and thin-sectioned to prepare histological slides. The tissue slides were deparaffinized, antigen-inactivated, and protein-blocked (Dako). Primary antibodies used were mouse anti-HBV core antigen monoclonal antibody (ab8637, Abcam) and mouse anti-HBsAg monoclonal antibody (BioLegend), and the secondary antibody was HRP-conjugated anti-mouse IgG antibody (#7076, CST). After incubation with the primary antibody overnight at 4°C, the slides were washed three times with PBS-T for 5 minutes each, followed by incubation with the secondary antibody for 30 minutes at room temperature. After washing three times with PBS-T for 5 minutes each, the slides were developed with DAB according to the EnVision+Kits (Dako) protocol. As a result, it was confirmed that the expression of HBs antigen and HBV core antigen in tissues was suppressed in vaccinated mice compared to unvaccinated mice.
[0092] [Example 7] Preventive effect of mRNA vaccine on HBV infection (1) Measurement of mouse HBs neutralizing antibodies Blood samples were collected from various mice vaccinated with mRNA vaccine in Example 6 on day 14 after the first vaccination and day 42 after the second vaccination. Serum was prepared from each blood sample, and anti-Hbs antibodies in the serum were measured using a Mouse hepatitis B virus surface antibody (HBsAb) ELISA Kit (CSB-E12143, CUSABIO) to measure neutralizing antibodies to mouse HBsAg.
[0093] Figure 11 shows the levels of HBs antibodies after the first and second administrations of the mRNA vaccine. Compared to unvaccinated chronically HBV-infected mice, higher levels of HBs antibodies were observed in vaccinated mice. These results confirmed that the production of HBs antibodies was due to administration of the mRNA vaccine, not to infection with AAV-HBV1.3.
[0094] (2) Evaluation of HBs neutralizing antibodies Using PXB cells, which are cells capable of infecting HBV, we investigated in vitro whether mouse HBs antibody-positive serum could prevent HBV infection. The experimental scheme is shown in Figure 12. PXB cells (Phoenix Bio) were cultured at 5 × 10 5 Cells were seeded onto a ready-to-use plate containing PXB-cell medium (PPC-M200) at 100 cells / well and incubated at 37°C. Serum containing HBs antibody was added at 20-, 200-, and 2000-fold dilutions in medium and incubated for 5 days. Serum from the mice indicated by the circled numbers a to g in Figure 11 was used. Genotype C cell culture-derived HBV (HBVcc) (Phoenix Bio Inc.) was added and incubated for 16 hours, after which the medium was replaced with fresh medium and incubated for 14 days. Cells under each condition were collected, and HBV-RNA was quantified by RT-PCR. RT-PCR was performed according to the method described in Example 6(2). As a control, a similar study was performed using fresh medium instead of the serum diluent.
[0095] Figure 13 shows the amount of HBV-RNA in PXB cells after adding serum a to g at various dilutions. It was confirmed that serum b, c, f, and g produced by administering the mRNA vaccine could prevent HBVcc when added at high concentrations. These results demonstrate that the L-HBsAg mRNA vaccine is useful for preventing HBV infection.
Claims
1. An HBV vaccine comprising, as an active ingredient, a messenger ribonucleic acid (mRNA) having any of the following base sequences (a) to (d), and having immunity-inducing activity against hepatitis B virus (HBV): (a) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1; (b) a nucleotide sequence encoding an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; (c) a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 3; and (d) A base sequence encoding an amino acid sequence having 80% or more sequence identity with the amino acid sequence set forth in SEQ ID NO:
3.
2. The HBV vaccine according to claim 1, wherein any one of the base sequences (a) to (d) is codon-optimized.
3. The HBV vaccine of claim 1, wherein the mRNA has a 5' cap structure and / or a 3' poly(A) tail.
4. The HBV vaccine of claim 1, wherein the mRNA comprises a chemical modification in the open reading frame (ORF) portion.
5. The HBV vaccine according to claim 1, wherein one or more uridines in the ORF portion of the mRNA are substituted with 1-methylpseudouridine.
6. The HBV vaccine of claim 1 , wherein the mRNA is encapsulated in a lipid nanoparticle.