Modified virus
Recombinant MVs with modified H and F polypeptides address the neutralization susceptibility of measles virus, enabling effective cancer treatment and vaccination despite pre-existing immunity, thus improving therapeutic efficacy and vaccination success.
Patent Information
- Application Number
- JP2025265960
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2017-05-16
- Filing Date
- 2025-12-19
- Publication Date
- 2026-04-21
AI Technical Summary
Measles virus (MV) is susceptible to neutralization by human measles-immunized serum, rendering systemically administered oncolytic MV ineffective as a therapeutic agent in cancer patients and posing a risk to unvaccinated children due to high mortality rates.
Development of recombinant MVs with modified H and F polypeptides, such as those containing specific amino acid substitutions, to reduce susceptibility to antibody neutralization, allowing for effective cancer treatment and vaccination in the presence of pre-existing measles immunity.
The recombinant MVs exhibit reduced neutralization by human serum, enabling effective cancer therapy and vaccination, particularly in individuals with pre-existing measles antibodies, thereby overcoming the limitations of existing vaccines and therapies.
Smart Images

Figure 2026067861000004 
Figure 2026067861000005 
Figure 2026067861000006
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims priority to U.S. Application No. 62 / 506,892, filed on 16 May 2017. The disclosures of the prior application are deemed to be part of the disclosures of this application, and the entirety thereof is incorporated into this application.
[0002] 1. Technical field This specification relates to methods and materials for producing and using viruses (e.g., measles virus or adenovirus) that have reduced susceptibility to antibody neutralization (e.g., antibody neutralization with serum from measles virus vaccine). [Background technology]
[0003] 2. Background information Measles virus (MV) causes many deaths every year, primarily in children under the age of five. Unvaccinated children are at the highest risk of measles and measles-related death. In particular, children whose transmissible anti-measles antibody titers have fallen to non-protective levels but who are still too young to receive the current measles vaccine recommended for children aged 9-12 months may be at higher risk of measles and measles-related death.
[0004] Furthermore, Edmonston-derived MV has proven to be a potentially potent anticancer agent when administered to measles seronegative cancer patients. However, in most countries, more than 90% of cancer patients have protective titers of anti-measles antibodies in their blood (e.g., through natural measles infection or measles vaccination). Measles-immunized human serum neutralizes the virus before it can reach its target (tumor cells), thus rendering systemically administered oncolytic MV ineffective as a therapeutic agent in tumor-bearing mice. Therefore, the majority of cancer patients cannot benefit from systemically administered oncolytic MV therapy. [Overview of the project]
[0005] This specification provides methods and materials for producing and using viruses (e.g., MV) that have reduced susceptibility to antibody neutralization (e.g., antibody neutralization with monoclonal anti-MV antibodies and / or serum from MV vaccines). For example, this specification provides recombinant morbillivirus (e.g., recombinant MV) that has reduced ability to be recognized by anti-MV antibodies produced against wild-type MV or existing MV vaccines compared to wild-type MV H and F polypeptides or H and F polypeptides of existing MV vaccines.
[0006] As demonstrated herein, recombinant MVs having a substituted H gene (e.g., encoding a multi-mutant measles H protein with multiple immunodominant epitopes excluded) and a substituted F gene (e.g., a canine distemper virus F gene encoding a canine distemper virus F protein) are resistant to neutralization with human measles-immunized human serum. The recombinant MVs described herein can be used to address the main limitations of commercially available measles vaccines, MV-based platform vaccines, and oncolytic MVs, namely their susceptibility to neutralization with human measles-immunized human serum.
[0007] In one embodiment, this specification features a virus having a nucleic acid encoding a measles virus H polypeptide containing at least six amino acid substitutions, and a nucleic acid encoding a morbillivirus F polypeptide other than the measles virus F polypeptide. This virus may be a measles virus. This virus may be a viral vector (e.g., a vector derived from an adenovirus, adeno-associated virus, retrovirus, lentivirus, herpesvirus, vaccinia virus, or rhabdovirus). Measles virus H polypeptide may contain SEQ ID NO: 9 having six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19): S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V. In some cases, measles virus H polypeptide may contain SEQ ID NO: 9 having the E471K substitution. For example, measles virus H polypeptide may include SEQ ID NO: 9 having the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, E471K, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.In some cases, the measles virus H polypeptide may contain SEQ ID NO: 1 having six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36): H17S, D149N, S189P, G211S, E235G, N238 D, S240N, L249P, V280I, N282K, G302R, E303G, Q311R, Q334H, A359T, K364N, R377Q, M378K, P397L, T420A, V421A, L423P, F476L, N481Y, G491D, H495R, D505T, R533G, V562T, D574A, K576R, I594L, G603E, T609N, G613E, and T614A. For example, the measles virus H polypeptide may include SEQ ID NO: 3. In some cases, the measles virus H polypeptide may include SEQ ID NO: 1 with the E471K substitution. For example, the measles virus H polypeptide may contain SEQ ID NO: 1 having six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36): H17S, D149N, S189P, G211S, E235G, N238D, S2 40N, L249P, V280I, N282K, G302R, E303G, Q311R, Q334H, A359T, K364N, R377Q, M378K, P397L, T420A, V421A, L423P, E471K, F476L, N481Y, G491D, H495R, D505T, R533G, V562T, D574A, K576R, I594L, G603E, T609N, G613E, and T614A. Measles virus F polypeptide may be canine distemper virus F polypeptide. The virus may exhibit CD46-dependent cell entry. The virus may show (or not show) reduced Nectin-4-dependent cell entry compared to wild-type virus.The virus may be deficient in the measles virus F polypeptide, deficient in the nucleic acid encoding the measles virus F polypeptide, or deficient in both the measles virus F polypeptide and the nucleic acid encoding the measles virus F polypeptide. The virus may be deficient in the wild-type measles virus H polypeptide, deficient in the nucleic acid encoding the wild-type measles virus H polypeptide, or deficient in both the wild-type measles virus H polypeptide and the nucleic acid encoding the wild-type measles virus H polypeptide.
[0008] In another embodiment, this specification features a method for reducing the number of viable tumor cells in a mammal. This method comprises, or is essentially, administering to a mammal a virus having nucleic acid encoding a measles virus H polypeptide comprising at least 17 amino acid substitutions, and nucleic acid encoding a morbillivirus F polypeptide other than the measles virus F polypeptide. This virus may be a measles virus. This virus may be a viral vector (e.g., a vector derived from an adenovirus, adeno-associated virus, retrovirus, lentivirus, herpesvirus, vaccinia virus, or rhabdovirus). Measles virus H polypeptide may contain SEQ ID NO: 9 having six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19): S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V. In some cases, measles virus H polypeptide may contain SEQ ID NO: 9 having the E471K substitution. For example, measles virus H polypeptide may include SEQ ID NO: 9 having the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, E471K, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.In some cases, the measles virus H polypeptide may contain SEQ ID NO: 1 having six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36): H17S, D149N, S189P, G211S, E235G, N238 D, S240N, L249P, V280I, N282K, G302R, E303G, Q311R, Q334H, A359T, K364N, R377Q, M378K, P397L, T420A, V421A, L423P, F476L, N481Y, G491D, H495R, D505T, R533G, V562T, D574A, K576R, I594L, G603E, T609N, G613E, and T614A. For example, the measles virus H polypeptide may include SEQ ID NO: 3. In some cases, the measles virus H polypeptide may include SEQ ID NO: 1 having the E471K substitution. For example, the measles virus H polypeptide may contain SEQ ID NO: 1 having six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36): H17S, D149N, S189P, G211S, E235G, N238D, S2 40N, L249P, V280I, N282K, G302R, E303G, Q311R, Q334H, A359T, K364N, R377Q, M378K, P397L, T420A, V421A, L423P, E471K, F476L, N481Y, G491D, H495R, D505T, R533G, V562T, D574A, K576R, I594L, G603E, T609N, G613E, and T614A. Measles virus F polypeptide may be canine distemper virus F polypeptide. The virus may exhibit CD46-dependent cell entry. The virus may show (or not show) reduced Nectin-4-dependent cell entry compared to wild-type virus. Mammals can be humans.
[0009] In another embodiment, this specification features a method for stimulating an immune response to measles virus in a mammal. This method comprises, or is essentially, administering to a mammal a virus having nucleic acid encoding a measles virus H polypeptide comprising at least 17 amino acid substitutions, and nucleic acid encoding a morbillivirus F polypeptide other than the measles virus F polypeptide. This virus may be a measles virus. This virus may be a viral vector (e.g., a vector derived from an adenovirus, adeno-associated virus, retrovirus, lentivirus, herpesvirus, vaccinia virus, or rhabdovirus). Measles virus H polypeptide may contain SEQ ID NO: 9 having six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19): S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V. In some cases, measles virus H polypeptide may contain SEQ ID NO: 9 having the E471K substitution. For example, measles virus H polypeptide may include SEQ ID NO: 9 having the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, E471K, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.In some cases, the measles virus H polypeptide may contain SEQ ID NO: 1 having six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36): H17S, D149N, S189P, G211S, E235G, N238 D, S240N, L249P, V280I, N282K, G302R, E303G, Q311R, Q334H, A359T, K364N, R377Q, M378K, P397L, T420A, V421A, L423P, F476L, N481Y, G491D, H495R, D505T, R533G, V562T, D574A, K576R, I594L, G603E, T609N, G613E, and T614A. For example, the measles virus H polypeptide may include SEQ ID NO: 3. In some cases, the measles virus H polypeptide may include SEQ ID NO: 1 having the E471K substitution. For example, the measles virus H polypeptide may contain SEQ ID NO: 1 having six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36): H17S, D149N, S189P, G211S, E235G, N238D, S2 40N, L249P, V280I, N282K, G302R, E303G, Q311R, Q334H, A359T, K364N, R377Q, M378K, P397L, T420A, V421A, L423P, E471K, F476L, N481Y, G491D, H495R, D505T, R533G, V562T, D574A, K576R, I594L, G603E, T609N, G613E, and T614A. Measles virus F polypeptide may be canine distemper virus F polypeptide. The virus may exhibit CD46-dependent cell entry. The virus may show (or not show) reduced Nectin-4-dependent cell entry compared to wild-type virus. The mammal may be a child (e.g., a human child). The human child may have acquired anti-measles antibodies transplacentally.
[0010] In another embodiment, this specification features nucleic acid constructs comprising (or essentially thereof, or consisting thereof) nucleic acids encoding measles virus H polypeptides having at least six amino acid substitutions compared to wild-type measles virus H polypeptides, and nucleic acids encoding morbillivirus F polypeptides other than measles virus F polypeptides. Measles virus H polypeptides may include SEQ ID NO: 9 having six or more of the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V. Measles virus H polypeptides may include SEQ ID NO: 9 having the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V. Measles virus H polypeptides may contain at least one amino acid substitution at each of the antigen sites listed in Table 1. Wild-type measles virus H polypeptide may be the wild-type measles virus H polypeptide of the MVi / Madrid.SPA / 50.10 strain. Wild-type measles virus H polypeptide may contain the amino acid sequence described in SEQ ID NO: 9. Measles virus H polypeptide may include SEQ ID NO: 3. Morbillivirus F polypeptide may be canine distemper virus F polypeptide. Nucleic acid constructs may be viral vectors. Viral vectors may be derived from viruses selected from the group consisting of adenoviruses, adeno-associated viruses, retroviruses, lentiviruses, herpesviruses, vaccinia viruses, and rhabdoviruses. Measles virus H polypeptides may contain at least one amino acid substitution at each of the antigen sites listed in Table 2. Measles virus H polypeptides may contain a substitution at position E471 compared to wild-type measles virus H polypeptides. The substitution at position E471 may be an E471K substitution.The measles virus H polypeptide may include SEQ ID NO: 9 having the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, E471K, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V. The nucleic acid construct may be a construct that does not encode the measles virus F polypeptide. The nucleic acid construct may be a construct that does not encode the wild-type measles virus H polypeptide.
[0011] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to implement the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and not intended to be limiting.
[0012] Details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
Brief Description of the Drawings
[0013] [Figure 1] Figure 1 shows the mutations encoded by the MV-H polypeptide to avoid neutralization. [Figure 2] Figure 2 shows that the mutations in MV-H avoid neutralizing antibodies, but F-specific antibodies neutralize MV. [Figure 3] Figure 3 includes a schematic diagram of MV, CDV, and MV encoding CDV H, CDV F or both, and the corresponding neutralization susceptibilities by pooled whole human serum or specifically absorbed MV H / F. [Figure 4]Figure 4 shows the tropism and fusion ability of mutant MV H polypeptides in combination with CDV F polypeptides. [Figure 5] Figure 5 shows that multiple mutant MV H polypeptides can induce broad neutralizing antibodies against multiple MV strains. [Figure 6-1] Figure 6 shows the native MV H polypeptide (SEQ ID NO: 1), the nucleic acid encoding the native MV H polypeptide (SEQ ID NO: 2), the modified H polypeptide (SEQ ID NO: 3), the native MV F polypeptide (SEQ ID NO: 4), the nucleic acid encoding the native MV F polypeptide (SEQ ID NO: 5), the CDV F polypeptides (SEQ ID NOs: 6 and 7), the CDV H polypeptide (SEQ ID NO: 8), and the native MV H polypeptide of MVi / Madrid.SPA / 50.10[H1] (SEQ ID NO: 9). [Figure 6-2] Continuation of Figure 6-1. [Figure 6-3] Continuation of Figure 6-1. [Figure 6-4] Continuation of Figure 6-1. [Figure 6-5] Continuation of Figure 6-1. [Figure 7]Figures 7A-E. Reverse genetic system for stealth virus rescue: Optimization of antigenome expression plasmid. (A) Number of GFP-expressing cells determined by flow cytometry 3 days after transfection of BHK rescue cells. (B) Virus production 3 days post-transfection was determined by titration in freeze-thawed rescue cells (P0) and Vero cells. (C) Scatter plot showing the correlation between rescue efficiency and virus production (Pearson r=0.789, p<0.05). Dashed lines represent 95% confidence intervals. (D) Rescue of recombinant virus. Rescue cells were stacked 3 days after transfection to Vero cells, and syncytium formation was evaluated 3 days later. * indicates lack of representativeness of the micrograph. Arrows indicate single GPF-positive cells. After 5 hemiblind passages, the stealth virus began to spread similarly to the parent virus. (E) Plasmid constructs used in this study. Significant sequence variations are shown between constructs. Tmin is the smallest T7 promoter, and adding GGGAGA (SEQ ID NO: 10) promotes higher levels of gene expression (Topt). However, the optimal T7 promoter requires a self-cleaving hammerhead ribozyme (HHrbz) (Yun et al., J. Virol., 89(2):1242-53 (2015)). Constructors 1 (SEQ ID NO: 11) and 2 (SEQ ID NO: 12) are shown. Constructor 3 (SEQ ID NO: 13) has been described elsewhere (Beaty et al., mSphere, 2(2):ppi00376-16 (2017)). Constructor 4 (SEQ ID NO: 14) further contains a 5' elongation factor 1α core promoter (hEFL-HTLV), followed by a chimeric intron sequence. All constructors have hepatitis delta ribozyme (HDV) and a T7 terminator downstream of the MeV antigenome. [Figure 8]Figures 8A-B. Engraftment of CD46 footprint into MeV-H genotype H1. (A) Left panel. CHO cells expressing or not expressing cell receptors (SLAM, CD46, and nectin-4) were infected with GFP-expressing MeV encoding the indicated MeV-H at moi0.1. eGFP autofluorescence was recorded 72 hours after infection. (A) Right panel. Cell fusion induced by co-expression of vaccine MeV-F and indicated MeV-H. Cells were stained with Giemsa after 48 hours and micrographed. Magnification x40. (B) Dynamics of cell fusion determined by split luciferase assay. [Figure 9] Figures 9A-B. Antigenic variations of the Δ7 virus. (A) Model of the dimeric structure of MeV-HΔ7 with N-linked sugars. N-linked sugars are depicted as black (N168-, N200-, N215 linked) or orange spheres (N416 linked). Shows amino acid differences for the MeV-H vaccine Moraten strain. Blue: MeV-H genotype H1 specific changes; Red: Manipulated nAb escape mutation. (B) Antigenic map of viruses encoding different MeV-H proteins. Antigenicity was determined by viral plaque reduction microneutralization (PRMN) assay and color-coded according to differences in Log2 NT50. Individual neutralization curves are shown in Figure 19. [Figure 10]Figures 10A-D. BH030 defines a novel antigenic site on MeV-H. (A) PRMN assay of mAb BH030 against recombinant MeV encoding various genotype-specific MeV-H. Data points were fitted by nonlinear regression analysis using Graph Pad Prism. Inhibitory concentration of 50% (IC50) is shown by the dotted line. Notably, C2 viruses selectively evade (escape) neutralization. (B) Amino acid sequence alignment of the putative BH030 epitope, showing different amino acid substitutions in the C2 virus. Consensus is shown as SEQ ID NO: 15. (C) H1 viruses show resistance to BH030 neutralization compared to A viruses and A variants (416DLS→NLS), but are still neutralized, similar to Δ7 viruses. Adding E471E to Δ7 (here Δ8) results in BH030 escape. (D) Putative antigenic site defined by mnAb BH030. Glu471 is not masked by the N416-linked sugar covering site IIb, thus defining a new putative antigenic site V that extends from site IIb to site III. [Figure 11] Figures 11A-C. Immunogenicity of drifted MeV-H. (A) Schematic diagram of the experiment. C57BL / 6 mice were intravenously injected with GFP (negative control) or expression plasmids of various MeV-H variants within 5 seconds. One month later, the activity of neutralizing antibodies was evaluated by PRMN assay against vaccine virus (B) or Δ8 virus (C). Each data point represents a single individual. Missing points are due to animal death or lack of material. Data from two different immunizations are included. Gray shading indicates the level of neutralizing antibody considered unprotected against this disease. The dotted line below indicates the detection limit of the assay. [Figure 12]Figures 12A-D. The Δ8 virus avoids a broader anti-MeV-H polyclonal response. (A) Left panel, PRMN assay of rabbit anti-MeV-H polyclonal antibodies against vaccine and MeV-H variant viruses (Δ7 and Δ8). Curves were fitted with nonlinear regression to calculate NT50 values. Right panel, difference in neutralizing titer (ND) between viruses. The same rabbit anti-MeV-H polyclonal antibodies were further tested against a panel of recombinant viruses encoding genotype-specific MeV-H genes or Δ8 variants, with NT50 calculated as in the left panel and ND plotted as log2. Differences of 2 log2 or more are considered substantially antigenically different (dotted line). (B) Monitoring of MeV glycoprotein depletion conditions. IgG antibody levels after incubation of human serum with cells that do not express or express either MeV glycoproteins MeV-H and MeV-F, compared to levels of untreated human serum (condition 0) (Figure 20). Serum samples were diluted 1:10 with culture medium and subsequently cultured on a monolayer of Mel-JuSo cells for 4 days (Mel-JuSo / wt, condition 1; Mel-Ju-So-H, condition 2; Mel-JuSo-F, condition 3). The supernatant was collected and tested for the presence of MeV-F and MeV-H specific antibodies by FACS immunofluorescence assay. The dotted line surrounds values considered negative. (C) VCA IgG levels (U / mL) remaining after MeV-F specific depletion conditions. (D) Neutralizing capacity of polyclonal human serum against vaccine and Δ8 virus. Serum samples were collected from healthy, vaccinated young adults and left untreated or depleted of MeV-F specific antibodies. Neutralizing capacity between conditions was compared using Epstein-Barr virus (EBV) VCA IgG levels, taking into account the dilution factors between conditions. Data are shown as the mean of individual serum samples (N=6). The trend line of the neutralization curve between samples was determined by nonlinear regression fitting. *** P<0.0005, Wilcoxon signed-rank test. [Figure 13]Figures 13A-B. Roles of MeV-H and MeV-F glycoproteins in virus neutralization. (A) MeV glycoprotein specificity of pooled human serum. Conditions and IgG specificity levels were described and determined as shown in Figure 12. Data are shown as histogram plots. (B) PRNM of envelope-exchange viruses. Isogenic rMeV encoding MeV envelope glycoprotein (virus 1, shown in red) or CDV (virus 2, shown in blue), as well as viral chimeras between them (viruses 3 and 4), were used for neutralization sensitivity against human serum pre-incubated with control cells (unabsorbed) or cells expressing MeV-H or MeV-F glycoproteins. Representative syncytia are shown. [Figure 14]Figure 14A-D. Characterization of recombinant MeV. (A) Replication dynamics of recombinant virus. Viruses shown in Vero / hSLAM were infected at MOI 0.03. GFP autofluorescence and bright-field images were recorded and overlaid at the indicated time. Magnification x40. Cells were then harvested into culture medium and viral titer was measured as FFU / m using Vero / hSLAM. A, H1, and Δ8 represent MeV expressing equivalent MeV-H genes and vaccine MeV-F, while the stealth virus is a virus encoding MeV-HΔ8 together with CDV-F. (B) Protein incorporation into virions. 10⁴ virus particles were electrophoresed under reducing conditions and immunoblotted with the relevant antibodies. Note that anti-MeV-F antibodies do not cross-react with CDV-F. (C) Left panel. PRMN NT50 values of measles-immunized human serum against MeV A (vaccine) and stealth virus. Each line represents a single individual (N=14). The dotted line indicates the threshold antibody level for protection against clinical disease. Ferret serum anti-CDV was used as a control. ***, P<0.001 determined by Wilcoxon signed-rank test. Right panel, correlation of NT50 between vaccine virus and stealth virus. NT50 values are plotted on a log2 scale. P<0.001, both Pearson and Spearman correlation tests. The dotted line indicates the 95% confidence interval for regression analysis. R=0.51. (D) PRMN of guinea pig polyclonal MeV antiserum against A virus and stealth virus. Nonlinear regression was performed to calculate NT50 values and converted to mIU / mL (3584 for A virus and 563 for stealth). [Figure 15]Figures 15A-D. Comparison of receptor footprints in MeV-H. (A) Schematic diagram of the MeV-H primary sequence. From left to right: C, cytoplasmic tail; T, transmembrane domain; stalk domain; β1-6, beta-propeller blades 1-6. Amino acid positions depicting different domains are shown. (B-D) MeV-H is shown as an iridescent ribbon, consistent with panel A, while the receptor is shown as a translucent surface colored cyan (SLAM, panel A), magenta (nectin-4, panel B), and blue (CD46, panel C). The spheres represent residues less than 4.5 Å from the receptor entities SLAM (PDB: 3ALZ), nectin-4 (PDB: 4GJT), and CD46 (PDB: 3INB), respectively, colored cyan, magenta, and blue. In each MeV-H receptor complex structure, if residues are also associated with interactions with any of the other receptors, the spheres are colored differently from the receptor color and colored accordingly. The residue Y524, which is associated with interactions with all three receptors, is colored orange. For comparison, the orientation of MeV-H is kept constant throughout the panel. The bar representation indicates residues that are structurally involved but not functional (L464, L482, F483, L500, D530, Y543, S548) and vice versa, defined within 4.5 Å of the receptor (Mateo et al., J. Virol., 87(16):9208-16 (2013)). [Figure 16]Figures 16A-D. Use of receptors for stealth. (A) Stealth virus infection of a panel of CHO cells expressing or not expressing the MeV receptor. Infection was performed at MOI 0.03 and recorded after 3 days. Magnification x40. (B) Flow cytometry to determine surface expression of the MeV receptor in the CHO panel. Cells were stained with relevant antibodies and the number of molecules per cell was determined by Quantibrite BD. (C) Dynamic fusion assay after co-expression of either the MeV-F vaccine strain and the MeV-H vaccine strain or MeV-HΔ8. Mean ± standard deviation (n=3). (D) Binding of MeV receptor-Fc to plastic-bound MeV-H protein, monitored by OD (Figure 18). Data points are expressed as mean ± standard deviation (n=3) and fitted to total binding in single-site mode (R2≧0.99). *P<0.05, ***P<0.005, ***P<0.0001. Bonferroni's one-way ANOVA with multiple comparisons. [Figure 17] Figure 17. Vero cell dynamics fusion assay. MeV-H vaccine strain or Δ8 was co-transfected with MeV-F vaccine strain. Fusion was quantified by split luciferase assay. Transfection with MeV-F alone served as a negative control. Mean ± standard deviation of three representative experiments. [Figure 18] Figure 18. ELISA method for determining receptor binding to MeV-H. Microwells pre-coated with Strep-tactin XT were incubated with the supernatant containing MeV-H, and then incubated with anti-FLAG antibody (control) or single receptor-Fc. Binding was elucidated by HRP-binding anti-IgG and monitored by optical density. [Figure 19] Figure 19. PRMN assay of anti-MeV-H mAb. Results are expressed as % of the viral control in the absence of the mAb. Data are expressed as the mean ± standard deviation of two independent experiments performed four times. [Figure 20]Figure 20. Flow cytometry to characterize MeV glycoprotein expression in Mel-JuSo cell lines. Parental Mel-JuSO cells expressing either MeV-H or MeV-F, and Mel-JuSO cells, were stained with anti-MeV-H(C28-10-8) or anti-MeV-F(F3-5)mAb, and the results are shown as histograms. [Figure 21] Figure 21. Correlation analysis of IgG MeV-H and MeV-F specific antibody levels. Black dots represent individuals who received a single vaccine. Arrows indicate pooled human serum (Valley Biomedical). Statistical analysis was performed using two-sided Pearson correlation. [Modes for carrying out the invention]
[0014] Detailed explanation This specification provides nucleic acids, polypeptides, and viruses comprising nucleic acids and / or polypeptides. This specification also provides methods for using viruses to treat cancer patients or to vaccinate infants to protect them from MV infection. For example, this specification provides MV hemagglutinin (H) polypeptide, nucleic acids encoding MV H polypeptide, CDV F polypeptide, nucleic acid sequences encoding CDV F polypeptide, and viruses comprising such nucleic acids and / or polypeptides. For example, this specification provides recombinant viruses (e.g., MV or adenovirus (Ad)) comprising nucleic acids encoding modified H polypeptide and nucleic acids encoding modified F polypeptide. Such recombinant viruses may exhibit reduced susceptibility to antibody neutralization, reduced ability to induce membrane fusion, and / or reduced replicative fitness. Recombinant viruses described herein can proliferate efficiently in cells (e.g., human cells such as Vero cells and HeLa cells) like wild-type viruses. Viruses described herein can be used to treat cancer patients or to vaccinate infants so that the viruses exhibit reduced susceptibility to antibody neutralization. In some cases, recombinant viruses described herein can be used to treat cancer in patients with pre-existing measles immunity. In some cases, children who have neutralizing anti-measles antibodies (e.g., transplacentally acquired neutralizing anti-measles antibodies) may be vaccinated using the recombinant viruses described herein.
[0015] This specification provides H polypeptides, F polypeptides, and encoding nucleic acids that are heterogeneous to natural H and F polypeptides.
[0016] As used herein, the term "nucleic acid" encompasses both RNA and DNA, such as cDNA, genomic DNA, and synthetic (e.g., chemosynthetic) DNA. Nucleic acids may be double-stranded or single-stranded. Single-stranded nucleic acids may have either a sense strand or an antisense strand. Furthermore, nucleic acids may be circular or linear.
[0017] "Isolated nucleic acid" refers to nucleic acid isolated from other nucleic acids present in the viral genome, such as nucleic acids that are typically adjacent to one or both sides of the nucleic acid in the viral genome. The term "isolated" as used herein with respect to nucleic acids includes any non-natural nucleic acid sequence, because such non-natural sequences are not found in nature and do not have a directly continuous sequence in the natural genome.
[0018] The isolated nucleic acid may be, for example, a DNA molecule, provided that one of the nucleic acid sequences normally found directly adjacent to that DNA molecule in the natural genome is removed or absent. Therefore, isolated nucleic acids include, but are not limited to, DNA molecules existing as distinct molecules independently of other sequences (e.g., chemosynthetic nucleic acids, or cDNA or genomic DNA fragments produced by PCR or restriction endonuclease treatment), and DNA incorporated into nucleic acid constructs (e.g., vectors, such as expression vectors, self-replicating plasmids, or viruses (e.g., paramyxoviruses, retroviruses, lentiviruses, parvoviruses such as Ad, herpesviruses, adenoviruses, and Ad-associated viruses, rhabdoviruses such as varicella-stomatitis viruses, or vaccinia viruses)) or DNA incorporated into the genomic DNA of prokaryotes or eukaryotes. If the isolated nucleic acid is a virus, the virus may be, for example, an oncolytic virus or a viral vector (e.g., a viral gene transfer vector). For example, viral vectors may be derived from Ad, Ad-associated viruses, retroviruses, lentiviruses, herpesviruses, vaccinia viruses, or rhabdoviruses. Furthermore, isolated nucleic acids include manipulated nucleic acids, such as DNA molecules that are part of hybrid or fusion nucleic acids. DNA present in hundreds to millions of other nucleic acids, such as nucleic acids in cDNA libraries or genomic libraries, or nucleic acids in gel sections containing genomic DNA restriction digests, are not considered isolated nucleic acids.
[0019] As used herein, "polypeptide" refers to a chain of amino acid residues, regardless of post-translational modifications (e.g., phosphorylation or glycosylation).
[0020] The nucleic acids encoding modified H polypeptides provided herein may encode MV H polypeptides that are heterogeneous to natural MV H polypeptides or to H polypeptides having the amino acid sequence shown in GenBank accession number AAF85673 (Version AAF85673.1, GI No. 9181880; SEQ ID NO: 1). Other examples of natural MV H polypeptides (and the nucleic acid sequences that encode them) can be found in public databases. For example, GenBank accession number KP191044 (Version KP191044.1, GI No. 727347518; SEQ ID NO: 2) provides a nucleic acid sequence that encodes a wild-type H polypeptide. In some cases, MV H polypeptides designated as heterogeneous to natural MV H polypeptides and / or to H polypeptides having the amino acid sequence shown in SEQ ID NO: 1 may also be referred to as modified H polypeptides. As used herein, the term "H polypeptide amino acid sequence" refers to an amino acid sequence that is at least 85% (e.g., at least 85, 90, 95, 99, or 100%) identical to the sequence shown in Sequence ID No. 1. In some cases, a modified H polypeptide may have at least six (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more) amino acid residues associated with the immunodominant epitope of the modified (e.g., substituted) MV H glycoprotein. Amino acid substitutions in an H polypeptide are typically located at positions involved in the binding of the H polypeptide to its receptor.
[0021] In some cases, the modified H polypeptide may have one or more amino acid substitutions at each of the six antigen sites, for example, as listed in Table 1. [Table 1]
[0022] In some cases, the modified H polypeptide may have, for example, seven of the eight antigenic sites listed in Table 2, or one or more amino acid substitutions in each of the eight antigenic sites listed in Table 2. [Table 2]
[0023] In some cases, the modified H polypeptide is a full-length H polypeptide having the amino acid sequence described in SEQ ID NO: 1, for example, amino acids D149, A158, T174, T176, T177, F180, L181, S189, R195, N200, R211, R212, V220, E235, S240, G243, L246, L2 49, H252, V259, F276, V280, D283, S285, L296, G302, E303, S305, P308, Q311, S316, S31 8, M333, Q334, P338, L339, V345, I346, L351, V357, A359, K364, V367, R377, M378, F382, A392, C394, P397, V412, T420, V421, L423, K424, H448, V450, K460, E471, I473, F476, K 477, N481, G491, E / G492, H495, D505, L517, R533, I559, V562, I564, D574, Q575, K576, A The positions corresponding to 587, G603, V608, T609, E611, G613, T614, R616, and / or R617 may have six or more (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more) amino acid substitutions. For example, the modified H polypeptides provided herein may have the amino acid sequence described in SEQ ID NO: 1, however, MV H polypeptides have six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more): H17S, D149N, S189P, G211S, E235G, N238D, S240N, L249P, L276G, V280I, G30 2R, E303G, Q311R, Q334H, A359T, K364N, R377Q, M378K, P397L, T420A, V421A, L423P, E471K, F476L, N481Y, G491D, H495R, D505T, R533G, I594L, V562T, D574A, K576R, G603E, T609N, G613E, and T614A.
[0024] In some cases, the modified H polypeptide may have six or more (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) amino acid substitutions at positions corresponding to, for example, amino acids S189, E235, N238, L249, G302, Y310, Q311, R377, M378, D416, E471, N481, K488, G491, H495, D505, R533, S546, R547, and / or F552 of the full-length H polypeptide having the amino acid sequence described in SEQ ID NO: 9. For example, the modified H polypeptides provided herein may have the amino acid sequence described in SEQ ID NO: 9, provided that the MV H polypeptide has six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19): S189, E235, N238, L249, G302, Y310, Q311, R377, M378, D416, N481, K488, G491, H495, D505, R533, S546, R547, and F552. In some cases, the modified H polypeptides provided herein may have the amino acid sequence described in SEQ ID NO: 9, provided that the MV H polypeptide has six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20): S189, E235, N238, L249, G302, Y310, Q311, R377, M378, D416, E471, N481, K488, G491, H495, D505, R533, S546, R547, and F552.
[0025] In some cases, the modified H polypeptides provided herein may include one or more other amino acid modifications as described elsewhere (see, for example, WO 2014 / 015242; Hu et al. (Virology, 192(1):351-4 (1993)); Hummel and Bellini (J. Virol., 69(3):1913-16 (1995)); Rima et al. (J. Gen. Virol., 78:97-106 (1997)); Li and Qi (Arch. Virol., 147(4):775-86 (2002)); Santibanez et al. (J. Gen. Virol., 86:365-74 (2005)); and Tahara et al. (J. Virol., 82(9):4630-7 (2008))). For example, the modified H polypeptides provided herein may also contain one or more of the following amino acid substitutions: N238D, N282K, Y310C, N405S, D416N, K488E, S546G, R547G, and F552V. In some cases, the modified H polypeptides provided herein may also contain one or more of the following amino acid substitutions: N238D, N282K, Y310C, N405S, D416N, E471K, K488E, S546G, R547G, and F552V. As another example, the modified H polypeptides provided herein may include SEQ ID NO: 9 having six or more amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19) from the following positions: S189, E235, N238, L249, G302, Y310, Q311, R377, M378, D416, N481, K488, G491, H495, D505, R533, S546, R547, and F552.For example, the modified H polypeptides provided herein may include Sequence ID No. 9 having six or more of the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V (for example, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19). As another example, the modified H polypeptides provided herein may include SEQ ID NO: 9 having six or more amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) from the following positions: S189, E235, N238, L249, G302, Y310, Q311, R377, M378, D416, E471, N481, K488, G491, H495, D505, R533, S546, R547, and F552. For example, the modified H polypeptides provided herein may include Sequence ID No. 9 having six or more of the following amino acid substitutions (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) from among S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, E471K, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.
[0026] Amino acid substitutions may be conserved or non-conservative. Conservative amino acid substitutions replace an amino acid with an amino acid of the same class, while non-conservative amino acid substitutions replace an amino acid with an amino acid of a different class. Examples of conservative substitutions include those within the following groups: (1) glycine and alanine; (2) valine, isoleucine, and leucine; (3) aspartic acid and glutamic acid; (4) asparagine, glutamine, serine, and threonine; (5) lysine, histidine, and arginine; (6) phenylalanine and tyrosine. In some cases, the modified H polypeptides provided herein may have the amino acid sequence described in SEQ ID NO: 3. In some cases, the modified MV H polypeptide may be an H polypeptide derived from another member of the genus Morbillivirus (e.g., CDV, CeMV, FeMV, PPRV, PDV, and RPV). For example, a modified MV H polypeptide may be a CDV H polypeptide (e.g., a polypeptide having the sequence described in GenBank accession number AAC26995 (Version AAC26995.1; Sequence ID 8)).
[0027] Nucleic acids encoding modified F polypeptides provided herein may encode F polypeptides heterologous to natural MV F polypeptides or to F polypeptides having the amino acid sequence shown in GenBank accession number AAF85672 (Version AAF85672.1, GI No. 9181879; SEQ ID NO: 4). Examples of natural MV F polypeptides (and the nucleic acid sequences they encode) can be found in public databases. For example, GenBank accession number KP205324 (Version KP205324.1, GI No. 727347524; SEQ ID NO: 5) provides an example of a nucleic acid encoding a wild-type F polypeptide. In some cases, an MV F polypeptide designated as heterologous to a natural MV F polypeptide and / or heterologous to an F polypeptide having the amino acid sequence shown in SEQ ID NO: 4 may also be referred to as a modified F polypeptide. As used herein, the term "F polypeptide amino acid sequence" refers to an amino acid sequence that is at least 85% (e.g., at least 85, 90, 95, 99, or 100%) identical to the sequence shown in Sequence ID No. 4. In some cases, the modified MV F polypeptide may be an F polypeptide derived from another member of the Morbillivirus genus (e.g., CDV, CeMV, FeMV, PPRV, PDV, and RPV). For example, the modified MV F polypeptide may be a CDV F polypeptide (e.g., a polypeptide having the sequence described in GenBank accession number ABR08390 (Version ABR08390.1, GI No. 148724186; Sequence ID No. 6) or GenBank accession number ABR08390 (Version ABO31365.1, GI No. 129770954; Sequence ID No. 7)).
[0028] This specification also provides recombinant viruses (e.g., MV or Ad) comprising nucleic acids encoding the modified H polypeptide described herein and nucleic acids encoding the modified F polypeptide described herein. The recombinant viruses provided herein may be chimeric viruses. In some cases, the recombinant virus may comprise nucleic acids encoding the modified MV H polypeptide described herein and nucleic acids encoding the modified MV F polypeptide described herein. In some cases, the recombinant virus may comprise the modified MV H polypeptide described herein and modified MV F polypeptide described herein.
[0029] In some cases, the recombinant viruses provided herein may be morbilliviruses. Any suitable morbillivirus may include the nucleic acids described herein (e.g., nucleic acids encoding modified MV H polypeptides and / or modified MV F polypeptides). Species of the genus Morbillivirus include, but are not limited to, MV(MV), canine distemper virus (CDV), cetacean morbillivirus (CeMV), feline morbillivirus (FeMV), small ruminant plague virus (PPRV), seal distemper virus (PDV), and rinderpest virus (RPV). In some cases, the morbilliviruses provided herein are obtained from MV. Examples of MV strains include, but are not limited to, MVi / Madrid.SPA / 50.10[H1], Edmonston, and Moraten vaccine.
[0030] In some cases, the recombinant viruses provided herein may be Ad. Any suitable Ad may include nucleic acids described herein (e.g., nucleic acids encoding modified MV H polypeptides and / or modified MV F polypeptides). In humans, species of adenoviridae include, but are not limited to, species A (AdA), B (AdB), C (AdC), D (AdD), E (AdE), F (AdF), or G (AdG).
[0031] The nucleic acids provided herein can be obtained by any method, for example, common molecular cloning and chemical nucleic acid synthesis techniques, but not limited to these. For example, nucleic acids encoding modified H polypeptides or modified F polypeptides provided herein can be constructed using PCR. PCR refers to a procedure or technique for amplifying a target nucleic acid as described in U.S. Patent No. 4,683,195, and subsequent modifications of the procedure described therein.
[0032] The nucleic acids provided herein can be incorporated into viruses by standard techniques. For example, recombinant techniques can be used to insert nucleic acids encoding modified H polypeptides or modified F polypeptides provided herein into infectious viral cDNA. In some cases, the nucleic acid may be exogenous to the viral particle (e.g., an expression vector contained within a cell), and the polypeptide encoded by the nucleic acid may be expressed by the cell and subsequently incorporated into a new viral particle (e.g., the envelope of a new viral particle such as a recombinant virus).
[0033] Natural H polypeptides typically possess receptor-binding and hemagglutination activity and functionally cooperate with viral F polypeptides to induce fusion between target cells. Such fusions can be mediated by the interaction between the H polypeptide and the target cell receptor (e.g., CD46, SLAM, nectin-4, desmoglein-2, or sialic acid).
[0034] Recombinant viruses (e.g., MV or Ad) provided herein (including nucleic acids encoding modified H polypeptides and modified F polypeptides) may exhibit reduced Nectin-4-dependent cell entry (or no cell entry) compared to viruses having the natural H polypeptide and / or natural F polypeptide. For example, when modified H polypeptides and modified F polypeptides are incorporated into a virus, the level of Nectin-4-dependent cell entry exhibited by the virus is reduced (or eliminated) compared to the level of Nectin-4-dependent cell entry exhibited by a wild-type virus containing the corresponding natural H polypeptide. Morbilliviruses (e.g., MV) containing the modified H polypeptides and modified F polypeptides described herein exhibit reduced (or no) Nectin-4-dependent cell entry into cells (e.g., epithelial cells) compared to the amount of Nectin-4-dependent cell entry into cells (e.g., epithelial cells) of unmodified MV-H. Nectin-4-mediated cell entry can be evaluated by standard techniques such as those described herein (see Example 1). Recombinant morbilliviruses provided herein may retain their ability to bind to CD46 and / or SLAM. Therefore, viruses containing nucleic acids encoding modified H polypeptides and modified F polypeptides exhibit CD46- or SLAM-dependent cell entry, and cells containing such viruses may fuse in a CD46- or SLAM-dependent manner. Cell entry via CD46 and / or SLAM receptors can be evaluated by standard techniques such as those described in WO 03 / 093431. In some cases, recombinant morbilliviruses provided herein retain the ability to bind to CD46 but not to SLAM. Viruses containing nucleic acids encoding modified H polypeptides and modified F polypeptides exhibit CD46-dependent cell entry, and cells containing such viruses may fuse in a CD46-dependent manner.
[0035] The viruses provided herein can be attenuated. As used herein, “attenuated” refers to a virus that is immunologically related to the wild-type virus but is not pathogenic in itself. Attenuated MVs, for example, do not cause classic measles disease. Attenuated viruses are typically reproducible and can infect and replicate in host cells without additional viral functions provided, for example, by helper viruses or plasmid expression constructs encoding such additional functions.
[0036] Viruses containing the nucleic acids provided herein can be identified using appropriate methods. Such methods include, but are not limited to, PCR, and nucleic acid hybridization techniques such as Northern and Southern analysis. In some cases, immunohistochemical and biochemical techniques can be used to determine whether a virus contains a particular nucleic acid by detecting the expression of polypeptides encoded by that particular nucleic acid.
[0037] Recombinant viruses (e.g., MV or Ad) containing nucleic acids encoding modified H polypeptides and modified F polypeptides provided herein may be used to treat cancer patients. Certain viruses can be amplified in host cells to increase the number of available copies of the virus, typically by at least twofold (e.g., 5-10fold, 50-100fold, 500-1000fold, or even up to 5000-10000fold). Viruses can be expanded in standard cell culture media (e.g., DMEM or RPMI-1640 supplemented with 5-10% fetal bovine serum at 37°C with 5% CO2) until the desired concentration is obtained. Viral titers can usually be assayed by inoculating cells in culture (e.g., Vero cells). Viruses can be recovered from infected cells by scraping cells from a dish, freezing / thawing (e.g., about two rounds), and centrifugation. The clear supernatant represents "plaque-purified" virus.
[0038] Viral stocks can be prepared by infecting a cell monolayer (e.g., adsorption at 37°C for approximately 1.5 hours) followed by scraping of the infected cells into a suitable culture medium (e.g., Opti-MEM; Gibco / Invitrogen, Carlsbad, CA) and freeze / thaw lysis. Viral stocks can be aliquoted and frozen and stored at -70°C to -80°C at concentrations higher than the therapeutically effective dose. Viral stocks can be stored in stabilizing solutions. Stabilizing solutions are known in the art and are not limited to those containing sugars (e.g., trehalose, dextrose, glucose), amino acids, glycerol, gelatin, monosodium glutamate, Ca 2+ , and Mg 2+ This may include.
[0039] In some cases, cancer may be treated using recombinant viruses (e.g., MV or Ad) containing nucleic acids encoding modified H polypeptides and modified F polypeptides provided herein (e.g., to reduce tumor size, inhibit tumor growth, or reduce the number of surviving tumor cells). As used herein, “reducing the number of surviving tumor cells” means (1) slowing the growth rate of a population of tumor cells so that after a certain period, the tumor in the treated individual is smaller than it would be without treatment; (2) completely inhibiting the growth of a population of tumor cells so that tumor growth completely stops after treatment; and / or (3) reducing the population of tumor cells so that the tumor becomes smaller or even disappears after treatment.
[0040] Recombinant viruses (e.g., MV or Ad) containing nucleic acids encoding modified H polypeptides and modified F polypeptides provided herein can be administered to cancer patients, for example, by direct injection into a population of cancer cells (e.g., tumors) or by intravenous delivery to cancer cells. Types of cancer cells susceptible to viral treatment include nerve cells, glial cells, and bone marrow monocytes. The methods provided herein can be used to treat several types of cancer, for example, but not limited to, myeloma, melanoma, glioma, lymphoma, and cancers of the lung, brain, stomach, colon, rectum, kidney, prostate, ovarian, and breast. Attenuated MV containing modified H polypeptides and modified F polypeptides provided herein can be used to treat lymphoma (e.g., non-Hodgkin lymphoma), for example.
[0041] The viruses provided herein can be administered to patients in biocompatible solutions or pharmaceutically acceptable delivery vehicles, either by direct administration to cancer cells (e.g., intratumor) or systemically (e.g., intravenously). Appropriate pharmaceutical formulations depend in part on the route of use and entry, e.g., percutaneous or injection. Such forms should not prevent the composition or formulation from reaching target cells (i.e., cells to which the virus is desired to be delivered) or exerting its effect. For example, pharmaceutical compositions injected into the bloodstream need to be soluble.
[0042] The dosage varies from patient to patient (for example, depending on the size of the tumor), but the viral concentration that has been proven safe as a vaccine (for example, 10%) 3 The pfu limit was set as the lower limit, and while monitoring for the presence of harmful side effects and the reduction in cancer cell growth, 10 12The effective dose can be determined by increasing the dose up to pfu. A therapeutically effective dose typically provides a reduction of at least 10% in the number of cancer cells or tumor size. Dose-increasing studies can be used to obtain the desired effect for a given viral treatment (e.g., Nies and Spielberg, “Principles of Therapeutics,” Goodman & Gilman's The Pharmacological Basis of Therapeutics, eds. Hardman, et al, McGraw-Hill, NY, 1996, pp 43-62).
[0043] The viruses provided herein include, for example, about 10 3 pfu~about 10 12 pfu (usually >10 8 It can be delivered in doses within the range of pfu. A therapeutically effective dose may be provided in repeated doses. Repeated dosing is suitable when clinical symptoms or tumor size observation or monitoring assays indicate that the group of cancer cells or tumor has stopped shrinking, or that viral activity has decreased while the tumor is still present. Repeated doses (using the same or different modified viruses) may be administered via the same or a different route as the initial administration. A therapeutically effective dose may be delivered in several separate doses (e.g., at intervals of several days or weeks). In some cases, 1 to approximately 12 doses may be provided. In some cases, a therapeutically effective dose of attenuated MV can be delivered by a sustained-release formulation.
[0044] The viruses provided herein can be administered using a device that provides sustained release. Formulations for sustained release of the virus may include, for example, polymer excipients (e.g., swellable or non-swellable gels, or collagen). A therapeutically effective amount of virus can be delivered within the polymer excipient, and the excipient / virus composition is implanted at the site of cancer cells (e.g., near or within the tumor). The excipient gradually dissolves due to the action of body fluids, and an effective amount of virus is continuously released over a period of time. In some cases, the sustained-release device may include a series of alternating active and spacer layers. Each active layer of such a device typically contains a dose of the virus embedded in the excipient, and each spacer layer contains only the excipient or a low concentration of virus (i.e., lower than the effective dose). As each sequential layer of the device dissolves, pulsed doses of virus are delivered. The size / formulation of the spacer layers determines the time interval between administrations and is optimized according to the treatment plan used.
[0045] The viruses provided herein can be administered directly. For example, the virus can be injected directly into a tumor that can be palpated through the skin (e.g., lymphoma). Ultrasound guidance may also be used in such a method. In some cases, direct administration of the virus can be achieved via a catheter line or other medical access device and can be used in combination with an imaging system to locate a population of cancer cells. In this method, a guidewire, usually inserted into the medical access device, is used to position the implantable administration device near the population of cancer cells. An effective amount of the virus may be administered directly to a population of cancer cells visible in the exposed surgical field.
[0046] In some cases, the viruses provided herein may be delivered systemically. For example, systemic delivery may be achieved intravenously via injection or via intravenous delivery devices designed for the administration of multiple doses of pharmaceuticals. Such devices include, but are not limited to, winged injection needles, peripheral venous catheters, midline catheters, peripheral insertion central catheters, and surgically placed catheters or ports.
[0047] The course of viral therapy can be monitored by evaluating changes in clinical symptoms (known in the field for each specific type of cancer) or by directly monitoring the population of cancer cells or the size of the tumor. The method of treating cancer using the virus of the present invention is considered effective if, after administration of the virus, the number of cancer cells, tumor size, tumor-specific antigen levels, and / or other clinical symptoms decrease by at least 10%. In the case of solid tumors, for example, the effectiveness of viral therapy can be evaluated by measuring the size or weight of the tumor before and after treatment. Tumor size can be measured directly (e.g., using calipers), or using imaging techniques (e.g., X-ray, magnetic resonance imaging, computed tomography), or by evaluating non-imaging optical data (e.g., spectral data). In the case of a population of cancer cells (e.g., leukemia cells), the effectiveness of viral therapy can be determined by measuring the absolute number of leukemia cells in the patient's circulation before and after treatment. The effectiveness of viral therapy can also be evaluated by monitoring the level of cancer-specific antigens. Cancer-specific antigens include, for example, carcinoembryonic antigen (CEA), prostate-specific antigen (PSA), prostatic acid phosphatase (PAP), CA125, alpha-fetoprotein (AFP), carbohydrate antigens 15-3, and carbohydrate antigens 19-4.
[0048] In some cases, recombinant viruses (e.g., MV or Ad) containing nucleic acids encoding modified H polypeptides and modified F polypeptides provided herein may be used to vaccinate humans (e.g., children under 9 months of age or children under 15 months of age). When MV provided herein is used as a vaccine to vaccinate children under 9 months of age or under 15 months of age, the vaccine may efficiently induce a protective immune response against MV infection, even if the child has transmissible anti-MV antibodies. For example, a recombinant MV containing nucleic acids encoding modified H polypeptides and modified F polypeptides may be used to stimulate an immune response against MV in humans.
[0049] Any suitable patient can be treated using the materials and methods described herein. For example, cancer patients treated with recombinant MV described herein or children vaccinated may be mammals (e.g., humans, non-human primates, dogs, cats), birds, or reptiles.
[0050] The present invention will be further illustrated by the following examples, but this will not limit the scope of the invention as described in the claims. [Examples]
[0051] Example 1: Recombinant MV Measles virus (MV#1) has the following amino acid substitutions (for SEQ ID NO: 1): H17S, D149N, S189P, G211S, E235G, N238D, S240N, L249P, L276G, V280I, N282K, G302R, E303G, Y310C, Q311R, Q334H, A359T, K364N, R377Q, M378K, P397L, N405S A modified H protein (SEQ ID NO: 3) was created to contain D416N, T420A, V421A, L423P, F476L, N481Y, K488E, G491D, H495R, D505T, R533G, S546G, R547G, F552V, V562T, D574A, K576R, I594L, G603E, T609N, G613E, and T614A. This modified H protein (SEQ ID NO: 3) was created by introducing 19 point mutations into the measles virus hemagglutinin protein (SEQ ID NO: 9) of the wild-type MVi / Madrid.SPA / 50.10 (genotype H1) strain. The 19 point mutations are S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.
[0052] The MV vaccine strain (MV#2) and recombinant MV#1 were incubated with the mAb shown in Figure 1 at 37°C for 1 hour before infecting Vero / hSLAM cells seeded in 96-well plates. The number of infected eGFP-positive foci was counted four times with duplicates 48 hours after infection and expressed as the percentage of infected EGFP-positive foci in the absence of nAb. MV#1 evaded neutralizing antibodies targeting multiple antigen sites. Figure 1 shows the H protein modifications that contributed to MV#1's escaping neutralization.
[0053] To investigate the resistance of MV#1 to human anti-measles antiserum, MV glycoprotein-specific antibodies (e.g., H-reactive and F-reactive) were depleted from measles-immunized human serum. Serum samples were diluted 1:10 in culture medium (RPMI 1640 (CORNING, Manassas, VA, USA)) without fetal bovine serum (FBS), and subsequently cultured for 4 days on a monolayer of Mel-JuSo cells expressing or not expressing MV glycoprotein. The supernatant was collected and tested for the presence of H, F, or VCA-specific antibodies at a final dilution of 1:100 by FACS immunofluorescence assay using stably transfected human melanoma cells Mel-JuSo / MV-H or Mel-JuSO / MV-F as target cells. Epstein-Barr virus (EBV) VCA-specific antibodies were quantified by commercially available ELISA (IBL International, Hamburg, Germany). MV#1 was efficiently neutralized by F-reactive antibodies in measles-immunized human serum. We used a fluorescent plaque reduction microneutralization assay to determine the anti-MV-H immunization induced at vaccination. MV#1 was resistant to the H-reactive component of the human anti-measles antibody reaction.
[0054] In addition to MV H protein-specific antibodies, to confirm that MV F protein-specific antibodies are also important for MV neutralization, another wild-type Edmonton strain measles virus (MV#3) was prepared by replacing the MV F protein of wild-type Edmonton strain MV with the wild-type Ondersterpoort strain CDV F protein. Two other measles viruses (MV#4 and MV#5) were prepared. MV#4 was prepared by replacing the MV H protein of wild-type Edmonton strain MV with the wild-type CDV H protein. MV#5 was prepared by replacing the MV F protein of MV#4 with the wild-type (i.e., Ondersterpoort strain) CDV F protein. Schematic diagrams of MV#3, MV#4, and MV#5 viruses are shown in Figure 2. MV#2, MV#3, MV#4, and MV#5 viruses were tested as follows: Vero / cSLAM cells were infected with the various viruses, and micrographs were taken 48 hours after infection. A neutralization assay was performed, revealing that both MV H and MV F induce neutralizing antibodies.
[0055] Proliferative heteromorphic fusion of CDV Ondersterpoort and MVH#1. CHO cells expressing or not expressing the MV receptor were seeded in 24-well plates and co-transfected with plasmids encoding MVH#1 (1 μg) and F protein (1 μg; MV vaccine strain, MVF; Ondersterpoort vaccine strain, CDV F). Syncytial formation was evaluated after 24 hours. The results of syncytial formation activity demonstrate that when CDV F is co-expressed in a MVH#1-oriented manner, fusion can be induced without impairing syncytial formation. Viruses encoding both MVH#1 and CDV F were rescued, and monotropism of cells expressing CD46 was confirmed.
[0056] The surface expression pattern of the MV receptor was examined using flow cytometry. Proliferative infection was evaluated microscopically two days after infection. These results demonstrated that MVs encoding MV#1 and CDV F proliferate efficiently on cells expressing the CD46 receptor.
[0057] C57BL / 6 mice (Jackson Laboratories, Bar Harbor, ME, EEUU) were immunized by hydrodynamic delivery using a pCG plasmid (5 μg) encoding the MVH protein derived from MV#1. The neutralizing ability of the generated antibodies was evaluated 4 weeks after blood collection from the jugular vein. Mouse serum was inactivated by heat and serially diluted in Opti-MEM. Equal amounts of each virus encoding different MVH gene proteins were mixed with their respective polyclonal antibodies at 30 PFU / well in 2x serial dilutions in 96-well plates (Costar Corp., Cambridge, MA, USA), incubated at 37°C for 1 hour, and inoculated into 80–90% confluent Vero / hSLAM cells. After 2 days of culture, eGFP autofluorescence was visualized by fluorescence microscopy, and the neutralizing titer was determined as a high dilution that 100% blocked viral infectivity. These results demonstrate that MV#1 induced a neutralizing antibody response against the H glycoprotein that cross-neutralizes wild-type MV strains.
[0058] Example 2: Further recombinant MV In this Example 2, MV is referred to as MeV, MV#1 as MeVΔ7, Δ7, or Δ8, MV#2 as MeV#1, MV#3 as virus 3, MV#4 as MeV#4, and MV#5 as MeV#2. Some of these synthesis methods will be described again in Example 2, and some of the data presented in Example 1 will also be presented in Example 2. Furthermore, Δ8 virus was generated using MeVΔ7.
[0059] Cells and viruses Vero cells (CCL-81, ATCC), stably transfected Vero human (Vero / hSLAM) (Ono et al., J. Virol., 75(9):4399-401 (2001)), and canine (Vero / dogSLAM) (von Messling et al., J. Virol., 77(23):12579-91 (2003)) SLAMs were grown in Dulbecco's Modified Minimal Essential Medium (DMEM) (HyClone, GE Healthcare Life Science) supplemented with 5% (vol. / vol.) heat-inactivated fetal bovine serum (FBS) (Gibco) and 0.5 mg / mL of geneticin (G418; Corning) (Vero / hSLAM) or 1 mg / mL of zeosin (ThermoFisher, Walthman MA) (Vero / dSLAM). Chinese hamster ovary (CHO) cells, CHO-CD46 (Nakamura et al., Nat. Biotechnol., 22(3):331-6 (2004)), CHO-SLAM (Tatsuo et al., Nature, 406:893-6 (2000)), and CHO-N4 (Liu et al., J. Virol., 88(4):2195-204 (2014)) were cultured as described. Baby hamster kidney cells (BHK) were maintained in DMEM-10% FBS. Viruses were propagated as described elsewhere (Munoz-Alia et al., J. Virol., 91(11):e00209-17 (2017); Munoz-Alia et al., PLoS One, 13(2):e0192245 (2018)).
[0060] Recombinant MeV structures and rescue Recombinant MeV is p(+)MeV vac2(Based on the molecular cDNA clone of the Moraten / Schwartz vaccine strain contained in the (EGFP)N plasmid (del Valle et al., J. Virol., 81(19):10597-605 (2007)). In this plasmid, enhanced green fluorescent protein (EGFP) was inserted upstream of the N gene. To avoid plasmid instability during amplification in bacteria, the plasmid backbone was gradually replaced with the pSMART® LCkan vector (Lucigen, Middleton, WI) following two approaches. In the first approach, a multiple cloning site containing SacII and NotI restriction enzymes was added to the vector. Next, the optimal T7 promoter followed by a hammerhead ribozyme (HHrbz) (Figure 7) was inserted upstream of the viral genome by directly inserting the sequence into the forward primer, and the MeV genome was amplified up to the unique internal restriction site SacII located at the start of the P gene. Next, p(+)MV vac2 The SacII-NotI fragment of the (EGFP)N plasmid was inserted into the similarly digested pSMART® LCkan vector. In the second approach, a cassette containing the human elongation factor 1α core promoter, a chimeric intron, the T7 RNA polymerase promoter, HHrbz, and a cloning site was synthesized and ligated to the vector. All plasmid propagation was carried out in Escherichia coli Stbl2 TM cells (Invitrogen, 10268019).
[0061] To generate envelope-exchanged MeV, the CDV Ondersterpoort vaccine strains H (CDV-H) and F (CDV-F) genes, originally contained in the pCG plasmid (von Messling et al., J. Virol., 75(14):6418-27 (2001)), were used. To replace MeV-H with the MeV backbone, site-directed mutagenesis (QuikChange site-directed mutagenesis kit, Agilent) was first used to remove the SpeI site of CDV-H, and then the Y537D substitution was introduced to reduce binding by cross-reactive neutralizing antibodies in human serum (Zhang et al., Virology, 482:218-24 (2015)). The PacI and SpeI restriction sites (underlined) were modified by forward primer 5'- ttaattaa aacttagggtgcaagatcatcgataatgctcccctaccaagacaagg-3' and reverse primer 5'- actagt The gene was introduced into the start and end using polymerase chain reaction with gggtatgcctgatgtctgggtgacatcatgtgattggttcactagcagccttaatggtggtgatggtggtggctcccccttgcggccgcggccggctgggccgctctaccctcgatacggttacatgagaatcttatacggac-3', without altering the untranslated region (UTR). The PCR product was digested with PacI and SpeI and cloned into the MeV backbone. To replace MeV-F from the MeV antigenome plasmid, pCG-CDV-F was digested with HpaI / SpeI and inserted into similarly digested pCG-MeV-F. Next, the NarI / SpeI fragment of this plasmid was used to replace that of MeV.
[0062] Recombinant MeV (rMeV) was recovered using the Lipofectamine LTX / PLUS transfection reagent (Invitrogen) by simultaneous transfection of rMeV antigenomic plasmid constructs N, P, and L supporting a plasmid derived from MeV isolate genotype B3.1 (Munoz-Alia et al., Virus Res., 196:122-7 (2015)), and codon-optimized T7 RNA polymerase (Addgene plasmid 65974, obtained from Behur Lee). Transfected cells were co-cultured with Vero / hSLAM cells, and the virus was subsequently amplified. The identity of recombinant MeV was confirmed by Sanger sequencing after RNA extraction from infected cells.
[0063] Fusion assay Cells (5 x 10 in a 6-well plate) 5 Fugene HD (Promega) was used to co-transfect a (1 μg) pCG plasmid encoding the vaccine strain MeV-F with a pCG encoding the appropriate MeV-H. Fusion activity was evaluated 24 hours after Hema-Quik staining (Fisher Scientific 123-745).
[0064] To quantify cell fusion, we used a dual-split cyferase assay as described elsewhere (Saw et al., Methods, 90:68-75 (2015)). Briefly, this involved quantifying effector BHK cells (3 × 10⁶) in a black 96-well plate. 4 ) contains 33 ng each of MeV-H and MeV-F expression plasmids, and one of the split ciferase plasmids DSP 8-11 (Obtained from Z. Matsuda) was simultaneously transfected. MeV-F and DSP were used as controls. 8-11 Only plasmids were transfected. Target cells, CHO cells, and CHO cells expressing their respective measles virus receptors were transfected in a 6-well plate with 2 × 10⁶ cells per well. 5Each cell receives 1.5 μg of another dual-split reporter plasmid (DSP 1-7 The cells were transfected with the H plasmid. 24 hours after transfection, the target cells were detached with Versene (Life Technologies) and co-cultured with effector cells in Fusion medium (DMEM-F12 + 40 mM HEPES without phenol red) supplemented with a 1:1000 dilution of the cell-permeable luciferase substrate EnduREN (Promega). Luminescence resulting from cell fusion and mixing of cytoplasmic contents between target and effector cells was monitored at the indicated time using a Topcount NXT Luminometer (Packard Instrument Company, Meriden CT). The data represent the mean and standard deviation of three duplications of each H plasmid.
[0065] FACS analysis and quantification of cell surface molecules Cells were washed, detached using Versene (Gibco), and immediately incubated with phycoerythrin-conjugating antibodies anti-SLAM (FAB1642P; R&D Systems), anti-CD46 (FAB2005P; R&D Systems), and anti-nectin-4 (FAB2659P; R&D Systems), or a control isotype antibody (IC0041P; R&D Systems). After incubation at 4°C for 1 hour, cells were washed again and fluorescence was measured using a FACSCanto flow cytometry system (BD Bioscience). The number of receptors per cell was estimated by reference to calibration beads (BD QuantiBrite; BD Biosciences).
[0066] Recombinant proteins and binding assays The coding sequence of the CD46 ectodomain (residues 35-328) was amplified by PCR from a pGEM-CD46 vector (Sino Biologicals Inc., HG12239-G) and inserted in frame into a pFUSE vector (pfc1-hg1e3; Invivogen) using an In-Fusion Cloning Kit (Clontech) with the mouse Igκ chain leader sequence and the 3C protease cleavage sequence at the 5' end of the Fc region. Recombinant proteins of CD46-Fc, SLAM-Fc, and nectin-4-Fc (Munoz-Alia et al., PLoS One, 13(2):e0192245 (2018)) were expressed in Expi293 cells (Gibco) and purified from the culture supernatant as described elsewhere (Munoz-Alia et al., PLoS One, 13(2):e0192245 (2018)). Recombinant soluble MeV-H expression and purification were performed as described elsewhere (Munoz-Alia et al., J. Virol., 91(11):e00209-17 (2017)). Binding of receptor-Fc to MeV-H was determined by the enzyme-linked immunosorbent assay described elsewhere (Munoz-Alia et al., PLoS One, 13(2):e0192245 (2018)). Absorbance at 450 nm was measured using an Infinite M200Pro microplate reader (Tecan). Data were analyzed using Prism software (GraphPad), adjusted to single-site binding saturation mode, and the semi-saturated concentration (apparent Kd value [dissociation constant]) was determined. The reported values showed excellent fit (R 2 >0.99).
[0067] Viral protein content The viral preparations were heated in the presence of DTT, fractionated onto 4-12% bis-trispolyacrylamide gels, and transferred to PDVF membranes. Next, the blots were analyzed for anti-GFP, anti-MeV-Hcyt, anti-MeV-N, and anti-MeV-F using conjugate secondary rabbit antibody (ThermoFisher, #31642). The blots were eluted using SuperSignal Wester Pico chemiluminescent substrate (ThermoFisher) and analyzed using the ChemiDoc imaging system (BIO-RAD).
[0068] Serological assay The virus neutralization assays were performed based on the fluorescence-based plaque reduction microneutralization (PRMN) assays described elsewhere (Munoz-Alia et al., J. Virol., 91(11):e00209-17 (2017); Munoz-Alia et al., PLoS One, 13(2):e0192245 (2018); and Munoz-Alia et al., Virus Res., 236:30-43 (2017)). Each assay was repeated at least twice on different days, with four overlaps per assay. After fitting the data to an S-shaped dose-response (variable gradient) using GraphPad software (Prism 7), the 50% inhibitory concentration (IC) was determined. 50 ) was calculated.
[0069] Rabbit anti-MeV-H antiserum was generated by immunization with adenovirus expressing MeV-H from a vaccine strain (Lech et al., PLoS One, 8(1):e52306 (2013)).
[0070] The following reagents were obtained from BEI Resources, NIAID, and NIH: polyclonal anti-canine distemper virus, Lederle non-toxic (antiserum, ferret), NR-4025; and polyclonal anti-measles virus, Edmonston (antiserum, guinea pig), NR-4024.
[0071] Mouse monoclonal anti-hemagglutinin antibodies were prepared and characterized as described elsewhere (Munoz-Alia et al., Virus Research, e00209-17 (2017); Ziegler et al., J. Gen. Virol., 77(Pt 10):2479-89 (1996); Fournier et al., J. Gen. Virol., 78:1295-302 (1997); Ertl OT. Immunodominant regions and novel functional domains on the measles virus hemagglutinin protein. Germany: Eberhard Karls University; 2003; Hu et al., Virology, 192:351-4 (1993); and Masse et al., J. Virol., 78(17):9051-63 (2004)). Polyclonal antibodies were generated by gene-based hydrodynamic injection of 20 μg of plasmid DNA into C57BL / 6 mice (Liu et al., Gene Ther., 6(7):1258-66 (1999)).
[0072] Human serum was collected from the Erasmus MC serum bank of healthy individuals aged 17-18 years (de Swart et al., J. Virol., 79(17):11547-51 (2005)). They were likely never exposed to wild-type MeV, received monovalent measles vaccination at 14 months of age, and measles-mumps-rubella vaccination at 9 years of age. All polyclonal serum and ascites fluid containing mAbs were heat-inactivated (30 minutes, 56°C) before testing.
[0073] Epstein-Barr virus (BCA) IgG titers were determined using a commercially available assay (IBL International GMbH, catalog number 57351). Assays for determining MeV-specific IgG levels were performed as described elsewhere (de Swart et al., J. Virol., 79(17):11547-51 (2005); and de Swart et al., J. Virol. Methods., 71:35-44 (1998)).
[0074] Structural Modeling A model of MeV-H stealth was generated with over 90% confidence using the program Phyre2 (Kelley et al., Nat. Protoc., 10(6):845-58 (2015)). Next, the structure was submitted for in silico glycosylation using the GlyPro server (http: / / www.glycosciences.de). This generated a complex pentabularylated N-glycocan model with all predicted N-glycosylation sites, including N168 and N187, which are parts of the disordered region. The CD46 receptor of the MeV-H / CD46 crystallographic costructure (PDB 3INB) was superimposed and manipulated using PyMOL software (http: / / pymol.org).
[0075] statistical analysis Statistical significance was calculated using GraphPad Prism 7 according to appropriate statistical tests.
[0076] result Modeling of antigen drift to MeV-H MeV-H has seven major antigenic sites, and disruption of up to four of these sites does not negate the neutralization of polyclonal antibodies (Munoz-Alia et al., J. Virol., 91(11):e00209-17 (2017); Lech et al., PLoS One, 8(1):e52306 (2013); and Munoz-Alia et al., PLoS One, 13(2):e0192245 (2018)). Due to the lack of B cell immune superiority, removal of all antigenic sites may generate non-neutralizable mutants. To investigate this, all epitopes described for MeV-H were systematically disrupted. The experimental design is based on incorporating spontaneous neutralizing mAb escape mutant selection into a MeV-H background of genotype H1. This particular strain was selected based on previous observations that it is one of the most antigenically advanced MeV-H strains (Munoz-Alia et al., PLoS One, 13(2):e0192245 (2018)), which could minimize alterations to otherwise rigid MeV-H proteins (Fulton et al., Cell Rep., 11(9):1331-8 (2015)). A list of nAb-binding regions was created and disruption of those regions was matched with a single MeV-H strain named Δ7 (also known as MV#1 in Example 1) (Table 3).
[0077] [Table 3]
[0078] Manipulation of tropism towards MeV-H Since mutations in antigen site III (receptor binding site, RBS) are incompatible with wild-type tropism (SLAM and nectin-4), we planned to switch receptor specificity to CD46 via several amino acid substitutions: N481Y (Lecouturier et al., J. Virol., 70(7):4200-4 (1996)), H495R (Okada et al., J. Virol., 83(17):8713-21 (2009)), and S546G (Shibahara et al., J. Gen. Virol., 75:3511-6 (1994)). To evaluate the effect of amino acid substitutions on receptor-dependent fusion activity, transient expression of MeV-H mutants was performed in combination with vaccine-derived MeV-F. Because intercellular transmission can occur even without apparent syncytial formation, the corresponding recombinant MeV was also rescued by reverse genetics (Langedijk et al., J. Virol., 85(21):11242-54 (2011)). The results are shown in Figure 8. When using the MeV-H vaccine strain (A), both viral entry and cell fusion were observed in CHO cells expressing either SLAM, CD46, or nectin-4. Similarly, MeV-H H1 enabled viral entry and syncytial formation in SLAM and nectin-4 expressing cells. Introducing N481Y, H495R, or H495R / S546G into the latter background did not significantly increase CD46-dependent fusion activity, as seen in transient transfection assays. However, viral entry was observed in the absence of syncytial formation in the N481Y and H495R / S546G mutants. Adding H495R to the N481Y mutant restored the level of CD46-dependent fusion to the level observed in MeV-H A. Adding S546G to this mutant nearly doubled the CD46-dependent fusion, and a similar increase was observed in the N481Y / S546G mutant. Nevertheless, CD46-dependent enhanced infection was observed only when the triple mutant (N481Y / H495R / S546G) was used, so this combination was selected as the background for nAb escape mutations.
[0079] MeV-H can be systemically resistant to neutralization by 30 known mouse monoclonal antibodies. Table 3 was initially used as the basis for generating MeV-H globular domain escape viruses. Using this information together with triple CD46 tropic substitution, the Δ7 virus was directly manipulated to destroy all seven previously described non-overlapping antigenic sites on the manipulation side (Φ, Ia, Ib, IIa, IIb, III, and IV) (Figure 9A). To determine whether the number of introduced mutations was sufficient to neutralize other nAbs specific to each site, the neutralization susceptibility of viruses with MeV-HA, H1, and Δ7 was determined against a panel of 30 mAbs. The results are summarized in Figure 9B, which shows that the A virus was neutralized by all 30 nAbs tested, but this number decreased to 18 for the H1 virus. Conversely, the Δ7 virus was neutralized only by the nAb BH030.
[0080] The fact that both Δ7 and H1 viruses were similarly neutralized by BH030 indicates that the mutation introduced into Δ7 did not eliminate this nAb epitope. However, both viruses showed an 18-fold decrease in susceptibility to neutralization compared to the A virus (IC). 50 (1312 ng / mL vs. 71.6 ng / mL).
[0081] To determine whether this phenotype is applicable to other wild-type-specific MeV-H proteins or is a characteristic of the H1 genotype background used, the following was performed. Neutralization analysis showed that H1 viruses actually retain some degree of resistance to neutralization by BH030 compared to A, B3.1, C1, D4, D6, D7, D8, D9, F, and G viruses. However, C2 viruses showed a complete lack of neutralization susceptibility (Figure 10A). Based on sequence analysis of the amino acid sequence and molecular structure of MeV-H, the E471K mutation was identified as a candidate for nAb resistance (Figure 10B). To confirm these predictions, the E417K mutation was inserted into the Δ7 virus (this new virus is referred to as the "Δ8 virus"), and the neutralization susceptibility of the Δ8 virus to nAb BH030 was evaluated. Unlike the Δ7 virus, the Δ8 virus showed complete evasion (escape) from neutralization via BH030 (Figure 10C). Interestingly, E471 is located within the region assigned to antigen site IIb (referred to as II in Tahara et al., J. Virol., 87(1):666-75 (2013), and as a "sugar-shielded epitope" in Tahara et al., Viruses, 8(8): pii:E216 (2016)), which is described as being masked by an N416-linked sugar present in several genotypes (Figure 10D). To confirm that the N416-linked sugar is not protected from BH030 neutralization, the neutralization susceptibility of the D416N mutant A virus (Munoz-Alia et al., PLoS One, 13(2):e0192245 (2018)) was tested. Since the Δ7 virus also possessed the N416 sugar, no resistance to neutralization was observed, suggesting that BH030 may be able to target a novel antigenic site that does not overlap operationally (designed here as V, possibly extending between antigenic sites IIb and III) (Figure 10D). These results demonstrate that combining mutations in key residues of major antigenic sites can result in neutralization evasion of a large panel of 30 neutralizing antibodies.
[0082] Epitope elimination to MeV-H eliminates cross-neutralization. To determine whether the disruption of the B cell epitope by MeV-H affects its antigenicity, the following was performed: Mice were hydrodynamically injected with a plasmid encoding MeV-H, and antibody responses were evaluated after one month (Figure 11A). Neutralization assays showed that mice immunized with MeV-HΔ7 had lower titers of neutralizing antibodies than MeV-HA, but this was not statistically significant, likely due to variability (Figure 11B). Nevertheless, MeV-HΔ8 failed to produce detectable levels (Figure 11C). To assess whether MeV-HΔ8 generates non-cross-reactive antibodies against novel epitopes by examining the neutralizing activity of the Δ8 virus itself, the following was performed: The results shown in Figure 11C indicate that the Δ8 virus, having a different but common epitope from MeV-H A, was neutralized by isotyped antibodies, i.e., antibodies induced by immunization with MeV-HΔ8, similar to those induced by anti-MeV-H H1 and Δ7. Neutralizing antibodies induced by MeV-HA immunization did not exhibit neutralizing activity against the Δ8 virus. Subsequently, removal of multiple antigenic sites rendered cross-neutralization ineffective, allowing the virus to evade the anti-MeV-H polyclonal reaction.
[0083] Δ7 virus may evade polyclonal measles vaccine-induced neutralizing antibodies if it lacks MeV-F specific antibodies. Different animal models may exhibit different antibody repertoires (Nachbagauer et al., Nat. Immunol., 18(4):464-73 (2017)). Antibodies produced in exhaled rabbits after MeV-H A immunization were evaluated by neutralization analysis. While the virus Δ8 showed a tendency towards neutralization (Figure 12A), it was not neutralized compared to the vaccine virus. 50The titer showed an eightfold decrease (3 log2). If the difference is four times greater (2 log2 or antigenic unit (Smith et al., Science, 305(5682):371-6 (2004)) or greater, virus Δ8 was considered antigenically significantly different from the vaccine virus to ensure the updating of the human seasonal influenza vaccine (Russell et al., Vaccine, 26(Suppl 4):D31-4 (2008); and Garten et al., Science, 325(5937):197-201 (2009)). On the other hand, because the parental precursor was (H1), the immediate precursor virus (Δ7) was antigenically indistinguishable. Since the K471E mutation distinguished Δ7 from the Δ8 virus and resulted in antigenic variation, there was a desire to confirm that the antigenic difference was the result of a combination of all mAb escape variant selections and not the presence of a dominant variant. Therefore, a previous panel of recombinant MeV with other genotype-specific MeV-H gene proteins was tested (Munoz-Alia et al., J. Virol., 91(11):e00209-17 (2017); and Munoz-Alia et al., PLoS One, 13(2):e0192245 (2018). Of particular interest is the fact that MeV C2 had the K471E mutation. However, the difference in PRMN titers was less than twofold overall and was therefore considered insignificant. Overall, these results suggest that measles virus antigenic mutations have both incremental and pulse components; that is, amino acid substitutions may have a cumulative effect when the antigen threshold is exceeded.
[0084] Because the Δ7 virus, rather than the Δ8 virus, may be usable as a pre-vaccine in children with maternal antibodies, we conducted tests to investigate whether antigenic variations in Δ7 lead to reduced recognition in the serum of patients who have received the measles vaccine. This initially involved selecting six serum samples to test from Dutch individuals aged 17 to 23 years at the time of serum collection. Based on neutralizing titers and records of measles outbreaks in the Netherlands, the human samples were likely to correspond to recipients of two doses of the measles vaccine. The Δ7 virus and vaccine strain viruses were tested by PRMN using human serums #126, #128, #129, #134, #136, and #137. The mean ND for Δ8 virus 50 The titer was 1.41 times (0.50 antigen units) lower than the homologous titer of the vaccine strain, indicating a lack of antigenic variation between the two viruses. A correlation was found between MeV-H specific antibodies and MeV-F specific antibodies (Pearson R=0.54, p<0.05). To test whether MeV-F specificity masks potential antigenic variation, MeV-F specific antibodies were depleted and the assay was repeated. As shown in Figure 12B, incubation of human serum with simulated transfect cells (Condition 1) did not result in a decrease in MeV-F specific IgG antibodies compared to the untreated sample (Condition 0). Conversely, incubation with MeV-F expressing cells resulted in depletion of MeV-F specific antibodies, but MeV-H specific antibody levels remained unchanged. To account for small dilution factors introduced under different depletion conditions, Epstein-Barr VCA IgG antibodies, which are widely present in the human population, were further tested and used as controls for the antibody levels used (Figure 12C). Next, the neutralizing capacity of both non-depleted and MeV-F depleted human serum was retested. MeV-F depleted human serum lost only a slight neutralizing power against the vaccine virus (1 antigen unit), but the reduction was significant (7-fold) when comparing Δ7 virus to the vaccine virus (Figure 12D).
[0085] These results suggest that vaccination in humans elicits a narrower neutralizing antibody response than in rabbits, and that the Δ7 virus can potentially narrow the vaccination gap in infants if they lack anti-MeV-F antibodies.
[0086] MeV-H and MeV-F induce neutralizing antibodies. Neutralizing antibodies against MeV-F in measles-immunized human serum may buffer the cumulative antigenic substitution effect of MeV-H. To gain further insight into the contribution of the two MeV glycoproteins to viral neutralization, two approaches were used: 1) depletion of MeV-H and MeV-F specific antibodies (Figure 13A), and 2) study of the neutralization susceptibility of isogenic sets of viral chimeras with three different glycoprotein exchanges. This envelope-exchanged virus possessed all MeV-derived genes except H and F, which were exchanged either single or double with related but non-cross-reactive canine distemper virus (CDV) H and F (Miest et al., Mol. Ther., 19(10):1813-20 (2011); and Zhang et al., Virology, 482:218-24 (2015)). Therefore, dual switching of the MeV-H and MeV-F protein genes with the CDV-derived gene generated MeV#2, and single switching of either MeV-H or MeV-F generated MeV#3 and MeV#4, respectively (Figure 13B). The CDV-H protein gene used had the Y537D substitution intentionally intended for the Ondersterpoort vaccine strain because it had been shown to reduce the potential cross-neutralization of CDV by human serum (Munoz-Alia et al., J. Virol., 91(11):e00209-17 (2017); Zhang et al., Virology, 482:218-24 (2015)). All three chimeras (MeV#2, MeV#3, MeV#4) with the parent MeV (MeV#1) formed syncytia that were indistinguishable in Vero cells, demonstrating the complementarity of heteromorphism (Figure 13B).
[0087] For MeV H or MeV-F specific antibodies, a commercially available human serum pool consisting of approximately 60-80 American donors was used. The high antibody titers in this pool suggest they were likely induced primarily by exposure to wild-type virus (Itoh et al., J. Clin. Microbiol., 40(5):1733-8 (2002)). Figure 13A illustrates the depletion process. Serum absorption by MeV-H expressing cells (Condition 2) completely removed all human serum binding activity to the MeV-H protein, but MeV-F specific antibody levels remained unaffected. In contrast, absorption by MeV-F (Condition 3) specifically removed human serum binding to MeV-F, while MeV-H specific antibodies remained unaffected. Serum absorption by parental cell lines did not result in a decrease in human serum binding to both MeV-H and MeV-F compared to the original human serum material (Conditions 1 and 0, respectively).
[0088] Next, the neutralizing efficacy of MeV-H and MeV-F reactive antibodies was measured in measles-immunized humans. The PRMN assay showed that absorption of either the MeV-F or MeV-H component had virtually no effect on the neutralizing activity of human serum against MeV (MeV#1). On the other hand, serum absorption by both MeV-F and MeV-H resulted in a complete loss of neutralizing activity from human serum. Therefore, both MeV-H-specific and MeV-F-specific antibodies were equally important for MeV neutralization. As expected, measles-immunized human serum did not show neutralizing activity against MeV#2, regardless of serum treatment. MeV#1, MeV#3, and MeV#4, however, were efficiently neutralized without distinction from unabsorbed serum. Regarding viral chimeras with simple exchange (MeV#3 and MeV#4), resistance to neutralization was observed only when the MeV-specific antibody component consistent with that present in the virus was depleted. These results indicate that both MeV-F and MeV-H are immunogenic and that they work together to buffer antigenic mutations.
[0089] Antigen novelty does not come at the expense of fit. Next, we hypothesized that the range of antibody responses to both MeV envelope glycoproteins indicated antigenic staticity of MeV. To address this hypothesis, we proceeded with the rescue of the Δ8 virus in combination with atypical CDV-F (hereinafter referred to as Stealth) as a surrogate for a completely antigenically different virus. MeV Stealth was not obtained until the robustness of the MeV rescue system was improved. Unlike the rescue of the parental recombinant MeV Moraten vaccine, MeV Stealth was isolated and expanded from a single GFP-positive cell observed after multiple independent rescue attempts. After five semi-blind passages, the virus transmitted through a cell monolayer (Figure 7). The virus was further grown to generate a viral stock, which was tested for Sanger sequencing and Western blot analysis. Immunoblotting of purified virions demonstrated that Stealth lacked the isomorphic MeV-F protein and otherwise exhibited protein content similar to the vaccine strain (Figure 14B). Furthermore, sequencing results showed no compensatory mutations in any of the glycoprotein-coding sequences, which further confirmed the survival rate of the stealth virus encoding MeV-HΔ8 when combined with CDV-F.
[0090] To determine whether MeV stealth is associated with a fitness trade-off, the growth kinetics of MeV stealth were examined in cultured cells. These kinetics were compared to those of recombinant MeV containing MeV-H A, MeV-H H1, and MeV-HΔ8. MeV A replicated to higher titers at 12 and 48 hpi than the stealth and Δ8 viruses (Figure 14A). These two viruses showed titer peaks with a 24-hour delay. MeV H1 replicated to lower titers than any of the other viruses over time. Since MeVΔ8 contained MeV-H derived from MeV-H H1, these results suggest that the mutation introduced into MeV-H contributes to better complementation with heterologous F proteins.
[0091] Next, 15 human serum samples were used to determine whether the stealth virus is indeed resistant to neutralization by human antibodies induced by the measles vaccine (virus A). Previously used pooled human serum was avoided because high titers indicate a diverse history of exposure to measles virus, which may have induced a different repertoire of genotype-specific neutralizing antibodies (de Swart et al., J. Gen. Virol., 90:2982-9 (2009); Tamin et al., J. Infec. Dis., 170:795-801 (1994); and Munoz-Alia et al., Virus Research, 236: 30-43 (2017)). This may complicate future interpretations, as the antigenic drift of the stealth virus was modeled by monoclonal antibodies induced by the vaccine virus. CDV-vaccinated ferrets were used as negative and positive controls for neutralization of the vaccine and the stealth virus, respectively. Serum samples #126, #128, #129, #134, #136, and #137 used in Figure 12 could not be tested due to a lack of material. NT of the tested samples 50 The values showed a neutralizing efficacy against stealth viruses ranging from 3.12 to 10.9 times, with an overall geometric mean of 5.39 times (2.43 antigen units) lower (Figure 14C). Serum 152 was ND against stealth viruses. 50 The titer was less than 4x (1.64 antigen units), and serum 131 and 157 were ND (Not Detected). 50 The titer was at the threshold (4x). Of all the serums tested, serum 152 was the only one showing a level of protection against stealth virus (430 mIU / mL) and had the highest NT among all human serums tested against the vaccine strain. 50 The titer was 1344 mIU / mL. It is therefore reasonable to assume that the magnitude of the antibody response to the homogeneous vaccine determined whether a level of protection against stealth virus infection was achieved. Correlation analysis supports this hypothesis (Pearson r = 0.9112; p < 0.0001), which indicates that the minimum NT of 926 mIU / mL was the level of protection against stealth infection. 50The current 210 mIU / mL is suggested by the titer level and predictors of seroconversion to the vaccine virus (Haralambieva et al., Vaccine, 29:4485-91 (2011)).
[0092] To determine the extent to which the range and magnitude of the antibody response influenced the antigenic variations observed in stealth viruses, the following was performed. Antigenic variation was measured in a guinea pig model, which showed that cross-reactive antibodies against influenza virus at higher titers were induced than in mice or ferrets (Nachbagauer et al., Nat. Immunol., 18(4):464-73 (2017)). Under MeV conditions, guinea pigs showed an NT titer of 3584 mIU / mL. 50 The antibody response showed a highly neutralizing effect against homologous vaccine viruses (mounted) (Figure 14D). Conversely, it showed no neutrality against heterologous stealth viruses. 50 The titer is about 6 times lower (NT 50 =563), and therefore antigenically significant. These results indicate that immunodominance is largely conserved across species and that antigenic mutations can occur to circumvent the level of protection induced at vaccination.
[0093] Stealth is only possible with CD46 tropic. In influenza A virus, receptor-binding avidity and antigenic mutations are closely related (Hensley et al., Science, 326:734-6 (2009); and Li et al., J. Virol., 87(17):9904-10 (2013)), and can compensate for loss of viral fitness (Kosik et al., PLoS Pathog., 14(1):e1006796 (2018)). To address whether receptor specificity is affected in the presence of nAb escape mutations, CHO cells expressing the MeV receptor alone were infected. Unexpectedly, given the close structural and functional interactions of CD46 and nectin-4 (Figure 15), stealth viruses proved to produce highly efficient CD46-dependent fusions, but showed nothing in CHO cells expressing nectin-4 (Figure 16A). Because the number of molecules on the cell surface was comparable to those two and 10 times greater than the number of molecules in SLAM-expressing CHO cells (approximately 20,000), differences in receptor density were ruled out as a potential explanation for CD46 recognition for the use of nectin-4 (Figure 16B). Similar results were obtained when a panel of CHO cells was infected with the Δ8 virus encoding the same MeV-HΔ8 as stealth, which opposes allosteric interaction between MeV-HΔ8 and CDV-F as the cause. However, further interaction with the MeV matrix protein (MeV-M) may still affect receptor binding interaction. Next, we investigated whether a transient transfection-based fusion assay would parallel the results observed in the viral context. This approach involved using MeV-F in combination with MeV-H A or MeV-HΔ8. MeV-HΔ8 was shown to recognize nectin-4 without significantly affecting CD46-dependent fusion (Figure 16C). Similar CD46-dependent fusion activity was observed in both human and African green monkey cells (Figure 17). Receptor binding and dissociation constants of various recombinant MeV-H proteins (A, H1, and Δ8) were investigated by ELISA (Figure 18).Unlike the anti-FLAG antibody used as a control, the recombinant cell receptor showed different binding affinity to the MeV-H protein (Figure 16D). MeV-HΔ8 bound to CD46 approximately 4000 times better than MeV-H A and H1, and appeared to be K. d The concentration was 190 pM, and the concentration of MeV-H A was 819 μM (K d (This was unknown). The binding value of nectin-4 was the worst at all three receptors and did not reach saturation at the highest concentration used. The apparent K of nectin-4 to recombinant MeV-H protein d No significant difference was observed, but MeV-HΔ8 B max The values were approximately half of those for MeV-H A and H1 (1.56, 1.14, and 0.74, respectively). As expected, MeV-HΔ8 showed negligible binding to SLAM-Fc. MeV-H H1 showed lower binding to SLAM-Fc than MeV-H A, and K d The concentrations were 10.43 μM and 2.68 μM, but B max The values were also low (2.09 and 1.19, respectively). In summary, these results indicate that MeV-HΔ8 decreases for nectin-4 but distinguishes the use of CD46 from that of nectin-4 through increased avidity interaction with CD46.
[0094] As described herein, 30 known antibody epitopes were systematically eliminated from the measles H glycoprotein. Viruses possessing the measles H glycoprotein demonstrated resistance to neutralization by anti-H antibodies present in measles-immunized human, mouse, and rabbit serum. Furthermore, by substituting the measles F glycoprotein with the homologous F protein of the associated morbillivirus, we generated MeV Stealth, a recombinant MeV resistant to neutralization with measles-immunized human serum. The virus was shown to maintain complete fusionability and proliferate only in CD46-positive cells without incurring viral fitness costs. These results suggest that the MeV Stealth platform may be used for oncolytic virus therapy in measles-immunized cancer patients.
[0095] Other Embodiments Although the present invention has been described in conjunction with its detailed description, it should be understood that the foregoing description is illustrative of, and not limiting, the scope of the invention as defined by the appended claims. Other embodiments, advantages, and modifications are within the scope of the appended claims.
[0096] [Sequence List] SEQUENCE LISTING <110> Mayo Foundation for Medical Education and Research <120> Modified Viruses <130> PA25-569 <150> US62 / 506,892 <151> 2017-05-16 <160> 15 <170> PatentIn version 3.5 <210> 1 <211> 617 <212> PRT <213> measles virus <400> 1 Met Ser Pro Gln Arg Asp Arg Ile Asn Ala Phe Tyr Lys Asp Asn Pro 1 5 10 15 His Pro Lys Gly Ser Arg Ile Val Ile Asn Arg Glu His Leu Met Ile 20 25 30 Asp Arg Pro Tyr Val Leu Leu Ala Val Leu Phe Val Met Phe Leu Ser 35 40 45 Leu Ile Gly Leu Leu Ala Ile Ala Gly Ile Arg Leu His Arg Ala Ala 50 55 60 Ile Tyr Thr Ala Glu Ile His Lys Ser Leu Ser Thr Asn Leu Asp Val 65 70 75 80 Thr Asn Ser Ile Glu His Gln Val Lys Asp Val Leu Thr Pro Leu Phe 85 90 95 Lys Ile Ile Gly Asp Glu Val Gly Leu Arg Thr Pro Gln Arg Phe Thr 100 105 110 Asp Leu Val Lys Leu Ile Ser Asp Lys Ile Lys Phe Leu Asn Pro Asp 115 120 125 Arg Glu Tyr Asp Phe Arg Asp Leu Thr Trp Cys Ile Asn Pro Pro Glu 130 135 140 Arg Ile Lys Leu Asp Tyr Asp Gln Tyr Cys Ala Asp Val Ala Ala Glu 145 150 155 160 Glu Leu Met Asn Ala Leu Val Asn Ser Thr Leu Leu Glu Thr Arg Thr 165 170 175 Thr Asn Gln Phe Leu Ala Val Ser Lys Gly Asn Cys Ser Gly Pro Thr 180 185 190 Thr Ile Arg Gly Gln Phe Ser Asn Met Ser Leu Ser Leu Leu Asp Leu 195 200 205 Tyr Leu Gly Arg Gly Tyr Asn Val Ser Ser Ile Val Thr Met Thr Ser 210 215 220 Gln Gly Met Tyr Gly Gly Thr Tyr Leu Val Glu Lys Pro Asn Leu Ser 225 230 235 240 Ser Lys Arg Ser Glu Leu Ser Gln Leu Ser Met Tyr Arg Val Phe Glu 245 250 255 Val Gly Val Ile Arg Asn Pro Gly Leu Gly Ala Pro Val Phe His Met 260 265 270 Thr Asn Tyr Leu Glu Gln Pro Val Ser Asn Asp Leu Ser Asn Cys Met 275 280 285 Val Ala Leu Gly Glu Leu Lys Leu Ala Ala Leu Cys His Gly Glu Asp 290 295 300 Ser Ile Thr Ile Pro Tyr Gln Gly Ser Gly Lys Gly Val Ser Phe Gln 305 310 315 320 Leu Val Lys Leu Gly Val Trp Lys Ser Pro Thr Asp Met Gln Ser Trp 325 330 335 Val Pro Leu Ser Thr Asp Asp Pro Val Ile Asp Arg Leu Tyr Leu Ser 340 345 350 Ser His Arg Gly Val Ile Ala Asp Asn Gln Ala Lys Trp Ala Val Pro 355 360 365 Thr Thr Arg Thr Asp Asp Lys Leu Arg Met Glu Thr Cys Phe Gln Gln 370 375 380 Ala Cys Lys Gly Lys Ile Gln Ala Leu Cys Glu Asn Pro Glu Trp Ala 385 390 395 400 Pro Leu Lys Asp Asn Arg Ile Pro Ser Tyr Gly Val Leu Ser Val Asp 405 410 415 Leu Ser Leu Thr Val Glu Leu Lys Ile Lys Ile Ala Ser Gly Phe Gly 420 425 430 Pro Leu Ile Thr His Gly Ser Gly Met Asp Leu Tyr Lys Ser Asn His 435 440 445 Asn Asn Val Tyr Trp Leu Thr Ile Pro Pro Met Lys Asn Leu Ala Leu 450 455 460 Gly Val Ile Asn Thr Leu Glu Trp Ile Pro Arg Phe Lys Val Ser Pro 465 470 475 480 Tyr Leu Phe Thr Val Pro Ile Lys Glu Ala Gly Glu Asp Cys His Ala 485 490 495 Pro Thr Tyr Leu Pro Ala Glu Val Asp Gly Asp Val Lys Leu Ser Ser 500 505 510 Asn Leu Val Ile Leu Pro Gly Gln Asp Leu Gln Tyr Val Leu Ala Thr 515 520 525 Tyr Asp Thr Ser Arg Val Glu His Ala Val Val Tyr Tyr Val Tyr Ser 530 535 540 Pro Ser Arg Ser Phe Ser Tyr Phe Tyr Pro Phe Arg Leu Pro Ile Lys 545 550 555 560 Gly Val Pro Ile Glu Leu Gln Val Glu Cys Phe Thr Asp Gln Lys 565,570,575 Leu Trp Cys Arg His Phe Cys Val Leu Ala Asp Ser Glu Ser Gly Gly 580,585,590 His Ile Thr His Ser Gly Met Val Gly Met Gly Val Ser Cys Thr Val 595,600,605 Thr Arg Glu Asp Gly Thr Asn Arg Arg 610,615 <210> 2 <211> 1854 <212> DNA <213> measles virus <400> 2 atgtcaccgc aaagagaccg gataaatgcc ttctacaag ataaccctta tcccaaggga 60 agtaggatag ttattacag agaacatctt atgattgaca gacctatat tctgctggct 120 gttctgttcg tcatgtttct gagcttgatc ggattgctgg caattgcagg cattagactt 180 catcgggcag ccatctacac cgcggagatc cataaaagcc tcagtaccaa tctagatgtg 240 actaactcaa tcgagcatca ggtcaaggac gtgctgacac cactctttaa aatcatcggg 300 gatgaagtgg gcctgagaac acctcagaga ttcactgacc tagtgaaatt catctctgac 360 aagattaaat tccttaatcc ggatagggag tacgacttca gagatctcac ttggtgcatc 420 aacccgccag agaggatcaa actagattat gatcaatact gtgcagatgt ggctgctgaa 480 gagctcatga atgcattggt gaactcaact ctactggaga ccagaacaac caatcagttc 540 ctagctgtct caaagggaaa ctgctcaggg cccactacaa tcagaggtca attctcaaac 600 atgtcgctgt ccttgttgga cttgtactta ggtcgaggtt acaatgtgtc atctatagtc 660 actatgacat cccagggaat gtatggggga acctacctag tggaaaagcc taatctgaac 720 agcaaagggt cagagttgtc acaactgagc atgtaccgag tgtttgaagt aggtgttatc 780 agaaacccgg gtttgggggc tccggtgttc catatgacaa actattttga gcaaccagtc 840 agtaatggtc tcggcaactg tatggtggct ttgggggagc tcaaactcgc agccctttgt 900 cacggggacg attctatcac aattccctat cagggatcag ggaaaggtgt cagcttccag 960 ctcgtcaagc tgggtgtctg gaaatcccca accgacatgc aatcctgggt ccccttatca 1020 acggatgatc cagtggtaga caggctttac ctctcatctc acagaggtgt catcgctgac 1080 aatcaagcaa aatgggctgt cccgacaaca cgaacagatg acaagttgcg aatggagaca 1140 tgcttccagc aggcgtgtaa aggtaaaatc caagcactct gcgagaatcc cgagtgggtg 1200 ccattgaagg ataacaggat tccttcatac ggggtcctgt ctgttgatct gagtctgaca 1260 gttgagctta aaatcaaaat tgcttcggga ttcgggccat tgatcacaca cggctcaggg 1320 atggacctat acaaatccaa ccgcaacaat gtgtattggc tgactattcc gccaatgaga 1380 aatctagcct taggcgtaat caacacattg gagtggatac cgagattcaa ggttagtccc 1440 aacctcttca ctgtcccaat taaggaagca ggcgaggact gccatgcccc aacataccta 1500 cctgcggagg tggacggtga tgtcaaactc agttccaacc tggtgattct acctggtcaa 1560 gatctccaat atgttttggc aacctacgat acctccaggg ttgagcatgc tgtggtttat 1620 tacgtttaca gcccaagccg ctcattttct tacttttatc cttttaggtt gcctataaag 1680 ggggtcccaa tcgaactaca agtggaatgc ttcacatggg accaaaaact ctggtgccgt 1740 cacttctgtg tgcttgcgga ctcagaatcc ggcggacata tcactcactc tgggatggtg 1800 ggcatgggag tcagctgcac agctacccgg gaagatggaa ccaatcgcag ataa 1854 <210> 3 <211> 617 <212> PRT <213> Artificial Sequence <220> <223> construct sequence <400> 3 Met Ser Pro Gln Arg Asp Arg Ile Asn Ala Phe Tyr Lys Asp Asn Pro 1 5 10 15 His Ser Lys Gly Ser Arg Ile Val Ile Asn Arg Glu His Leu Met Ile 20 25 30 Asp Arg Pro Tyr Val Leu Leu Ala Val Leu Phe Val Met Phe Leu Ser 35 40 45 Leu Ile Gly Leu Leu Ala Ile Ala Gly Ile Arg Leu His Arg Ala Ala 50 55 60 Ile Tyr Thr Ala Glu Ile His Lys Ser Leu Ser Thr Asn Leu Asp Val 65 70 75 80 Thr Asn Ser Ile Glu His Gln Val Lys Asp Val Leu Thr Pro Leu Phe 85 90 95 Lys Ile Ile Gly Asp Glu Val Gly Leu Arg Thr Pro Gln Arg Phe Thr 100 105 110 Asp Leu Val Lys Phe Ile Ser Asp Lys Ile Lys Phe Leu Asn Pro Asp 115 120 125 Arg Glu Tyr Asp Phe Arg Asp Leu Thr Trp Cys Ile Asn Pro Pro Glu 130 135 140 Arg Ile Lys Leu Asn Tyr Asp Gln Tyr Cys Ala Asp Val Ala Ala Glu 145 150 155 160 Glu Leu Met Asn Ala Leu Val Asn Ser Thr Leu Leu Glu Thr Arg Thr 165 170 175 Thr Asn Gln Phe Leu Ala Val Ser Lys Gly Asn Cys Pro Gly Pro Thr 180 185 190 Thr Ile Arg Gly Gln Phe Ser Asn Met Ser Leu Ser Leu Leu Asp Leu 195 200 205 Tyr Leu Ser Arg Gly Tyr Asn Val Ser Ser Ile Val Thr Met Thr Ser 210 215 220 Gln Gly Met Tyr Gly Gly Thr Tyr Leu Val Gly Lys Pro Asp Leu Asn 225 230 235 240 Ser Lys Gly Ser Glu Leu Ser Gln Pro Ser Met Tyr Arg Val Phe Glu 245 250 255 Val Gly Val Ile Arg Asn Pro Gly Leu Gly Ala Pro Val Phe His Met 260 265 270 Thr Asn Tyr Phe Glu Gln Pro Ile Ser Lys Asp Leu Ser Asn Cys Met 275 280 285 Val Ala Leu Gly Glu Leu Lys Leu Ala Ala Leu Cys His Arg Gly Asp 290 295 300 Ser Ile Thr Ile Pro Cys Arg Gly Ser Gly Lys Gly Val Ser Phe Gln 305 310 315 320 Leu Val Lys Leu Gly Val Trp Lys Ser Pro Thr Asp Met His Ser Trp 325 330 335 Val Pro Leu Ser Thr Asp Asp Pro Val Ile Asp Arg Leu Tyr Leu Ser 340 345 350 Ser His Arg Gly Val Ile Thr Asp Asn Gln Ala Asn Trp Ala Val Pro 355 360 365 Thr Thr Arg Thr Asp Asp Lys Leu Gln Lys Glu Thr Cys Phe Gln Gln 370 375 380 Ala Cys Lys Gly Lys Ile Gln Ala Leu Cys Glu Asn Leu Glu Trp Ala 385 390 395 400 Pro Leu Lys Asp Ser Arg Ile Pro Ser Tyr Gly Val Leu Ser Val Asn 405 410 415 Leu Ser Leu Ala Ala Glu Pro Lys Ile Lys Ile Ala Ser Gly Phe Gly 420 425 430 Pro Leu Ile Thr His Gly Ser Gly Met Asp Leu Tyr Lys Ser Asn His 435 440 445 Asn Asn Val Tyr Trp Leu Thr Ile Pro Pro Met Lys Asn Leu Ala Leu 450 455 460 Gly Val Ile Asn Thr Leu Glu Trp Ile Pro Arg Leu Lys Val Ser Pro 465 470 475 480 Tyr Leu Phe Thr Val Pro Ile Glu Glu Ala Asp Glu Asp Cys Arg Ala 485 490 495 Pro Thr Tyr Leu Pro Ala Glu Val Thr Gly Asp Val Lys Leu Ser Ser 500 505 510 Asn Leu Val Ile Leu Pro Gly Gln Asp Leu Gln Tyr Val Leu Ala Thr 515 520 525 Tyr Asp Thr Ser Gly Val Glu His Ala Val Val Tyr Tyr Val Tyr Ser 530 535 540 Pro Gly Gly Ser Phe Ser Tyr Val Tyr Pro Phe Arg Leu Pro Ile Lys 545 550 555 560 Gly Thr Pro Ile Glu Leu Gln Val Glu Cys Phe Thr Trp Ala Gln Arg 565 570 575 Leu Trp Cys Arg His Phe Cys Val Leu Ala Asp Ser Glu Ser Gly Gly 580 585 590 His Leu Thr His Ser Gly Met Val Gly Met Glu Val Ser Cys Thr Val 595 600 605 Asn Arg Glu Asp Glu Ala Asn Arg Arg 610 615 <210> 4 <211> 553 <212> PRT <213> measles virus <400> 4 Met Ser Ile Met Gly Leu Lys Val Asn Val Ser Ala Ile Phe Met Ala 1 5 10 15 Val Leu Leu Thr Leu Gln Thr Pro Thr Gly Gln Ile His Trp Gly Asn 20 25 30 Leu Ser Lys Ile Gly Val Val Gly Ile Gly Ser Ala Ser Tyr Lys Val 35 40 45 Met Thr Arg Ser Ser His Gln Ser Leu Val Ile Lys Leu Met Pro Asn 50 55 60 Ile Thr Leu Leu Asn Asn Cys Thr Arg Val Glu Ile Ala Glu Tyr Arg 65 70 75 80 Arg Leu Leu Arg Thr Val Leu Glu Pro Ile Arg Asp Ala Leu Asn Ala 85 90 95 Met Thr Gln Asn Ile Arg Pro Val Gln Ser Val Ala Ser Ser Arg Arg 100 105 110 His Lys Arg Phe Ala Gly Val Val Leu Ala Gly Ala Ala Leu Gly Val 115 120 125 Ala Thr Ala Ala Gln Ile Thr Ala Gly Ile Ala Leu His Gln Ser Met 130 135 140 Leu Asn Ser Gln Ala Ile Asp Asn Leu Arg Ala Ser Leu Glu Thr Thr 145 150 155 160 Asn Gln Ala Ile Glu Thr Ile Arg Gln Ala Gly Gln Glu Met Ile Leu 165 170 175 Ala Val Gln Gly Val Gln Asp Tyr Ile Asn Asn Glu Leu Ile Pro Ser 180 185 190 Met Asn Gln Leu Ser Cys Asp Leu Ile Gly Gln Lys Leu Gly Leu Lys 195 200 205 Leu Leu Arg Tyr Tyr Thr Glu Ile Leu Ser Leu Phe Gly Pro Ser Leu 210 215 220 Arg Asp Pro Ile Ser Ala Glu Ile Ser Ile Gln Ala Leu Ser Tyr Ala 225 230 235 240 Leu Gly Gly Asp Ile Asn Lys Val Leu Glu Lys Leu Gly Tyr Ser Gly 245 250 255 Gly Asp Leu Leu Gly Ile Leu Glu Ser Gly Gly Ile Lys Ala Arg Ile 260 265 270 Thr His Val Asp Thr Glu Ser Tyr Phe Ile Val Leu Ser Ile Ala Tyr 275 280 285 Pro Thr Leu Ser Glu Ile Lys Gly Val Ile Val His Arg Leu Glu Gly 290 295 300 Val Ser Tyr Asn Ile Gly Ser Gln Glu Trp Tyr Thr Thr Val Pro Lys 305 310 315 320 Tyr Val Ala Thr Gln Gly Tyr Leu Ile Ser Asn Phe Asp Glu Ser Ser 325 330 335 Cys Thr Phe Met Pro Glu Gly Thr Val Cys Ser Gln Asn Ala Leu Tyr 340 345 350 Pro Met Ser Pro Leu Leu Gln Glu Cys Leu Arg Gly Tyr Thr Lys Ser 355 360 365 Cys Ala Arg Thr Leu Val Ser Gly Ser Phe Gly Asn Arg Phe Ile Leu 370 375 380 Ser Gln Gly Asn Leu Ile Ala Asn Cys Ala Ser Ile Leu Cys Lys Cys 385 390 395 400 Tyr Thr Thr Gly Thr Ile Ile Asn Gln Asp Pro Asp Lys Ile Leu Thr 405 410 415 Tyr Ile Ala Ala Asp His Cys Pro Val Val Glu Val Asn Gly Val Thr 420 425 430 Ile Gln Val Gly Ser Arg Arg Tyr Pro Asp Ala Val Tyr Leu His Arg 435 440 445 Ile Asp Leu Gly Pro Pro Ile Ser Leu Glu Arg Leu Asp Val Gly Thr 450 455 460 Asn Leu Gly Asn Ala Ile Ala Lys Leu Glu Asp Ala Lys Glu Leu Leu 465 470 475 480 Glu Ser Ser Asp Gln Ile Leu Arg Ser Met Lys Gly Leu Ser Ser Thr 485 490 495 Ser Ile Val Tyr Ile Leu Ile Ala Val Cys Leu Gly Gly Leu Ile Gly 500 505 510 Ile Pro Ala Leu Ile Cys Cys Cys Arg Gly Arg Cys Asn Lys Lys Gly 515 520 525 Glu Gln Val Gly Met Ser Arg Pro Gly Leu Lys Pro Asp Leu Thr Gly 530 535 540 Thr Ser Lys Ser Tyr Val Arg Ser Leu 545 550 <210> 5 <211> 1653 <212> PRT <213> measles virus <400> 5 Ala Thr Gly Gly Gly Thr Cys Thr Cys Ala Ala Gly Gly Thr Gly Ala 1 5 10 15 Ala Cys Gly Thr Cys Thr Cys Thr Gly Cys Cys Gly Thr Ala Thr Thr 20 25 30 Cys Ala Thr Gly Gly Cys Ala Gly Thr Ala Cys Thr Gly Thr Thr Ala 35 40 45 Ala Cys Thr Cys Thr Cys Cys Ala Ala Ala Cys Ala Cys Cys Cys Gly 50 55 60 Cys Cys Gly Gly Thr Cys Ala Ala Ala Thr Thr Cys Ala Thr Thr Gly 65 70 75 80 Gly Gly Gly Cys Ala Ala Thr Cys Thr Cys Thr Cys Thr Ala Ala Gly 85 90 95 Ala Thr Ala Gly Gly Gly Gly Thr Ala Gly Thr Ala Gly Gly Ala Ala 100 105 110 Thr Ala Gly Gly Ala Ala Gly Thr Gly Cys Ala Ala Gly Cys Thr Ala 115 120 125 Cys Ala Ala Ala Gly Thr Thr Ala Thr Gly Ala Cys Thr Cys Gly Thr 130 135 140 Thr Cys Cys Ala Gly Cys Cys Ala Thr Cys Ala Ala Thr Cys Ala Thr 145 150 155 160 Thr Ala Gly Thr Cys Ala Thr Ala Ala Ala Ala Thr Thr Ala Ala Thr 165 170 175 Gly Cys Cys Cys Ala Ala Thr Ala Thr Ala Ala Cys Thr Cys Thr Cys 180 185 190 Cys Thr Cys Ala Ala Thr Ala Ala Cys Thr Gly Cys Ala Cys Gly Ala 195 200 205 Gly Gly Gly Thr Ala Gly Ala Gly Ala Thr Thr Gly Cys Ala Gly Ala 210 215 220 Ala Thr Ala Cys Ala Gly Gly Ala Gly Ala Cys Thr Ala Cys Thr Ala 225 230 235 240 Ala Gly Ala Ala Cys Ala Gly Thr Thr Thr Thr Gly Gly Ala Ala Cys 245 250 255 Cys Ala Ala Thr Thr Ala Gly Gly Gly Ala Thr Gly Cys Ala Cys Thr 260 265 270 Thr Ala Ala Thr Gly Cys Ala Ala Thr Gly Ala Cys Cys Cys Ala Gly 275 280 285 Ala Ala Cys Ala Thr Ala Ala Gly Gly Cys Cys Gly Gly Thr Thr Cys 290 295 300 Ala Gly Ala Gly Cys Gly Thr Ala Gly Cys Thr Thr Cys Ala Ala Gly 305 310 315 320 Thr Ala Gly Gly Ala Gly Ala Cys Ala Cys Ala Ala Gly Ala Gly Ala 325 330 335 Thr Thr Thr Gly Cys Gly Gly Gly Ala Gly Thr Ala Gly Thr Cys Cys 340 345 350 Thr Gly Gly Cys Ala Gly Gly Thr Gly Cys Gly Gly Cys Cys Cys Thr 355 360 365 Ala Gly Gly Thr Gly Thr Thr Gly Cys Cys Ala Cys Ala Gly Cys Thr 370 375 380 Gly Cys Thr Cys Ala Gly Ala Thr Ala Ala Cys Ala Gly Cys Cys Gly 385 390 395 400 Gly Cys Ala Thr Thr Gly Cys Ala Cys Thr Thr Cys Ala Cys Cys Gly 405 410 415 Gly Thr Cys Cys Ala Thr Gly Cys Thr Gly Ala Ala Cys Thr Cys Thr 420 425 430 Cys Ala Gly Gly Cys Cys Ala Thr Cys Gly Ala Cys Ala Ala Thr Cys 435 440 445 Thr Gly Ala Gly Ala Gly Cys Gly Ala Gly Cys Cys Thr Gly Gly Ala 450 455 460 Ala Ala Cys Thr Ala Cys Thr Ala Ala Thr Cys Ala Gly Gly Cys Ala 465 470 475 480 Ala Thr Thr Gly Ala Gly Gly Cys Ala Ala Thr Cys Ala Gly Ala Cys 485 490 495 Ala Ala Gly Cys Ala Gly Gly Gly Cys Ala Gly Gly Ala Gly Ala Thr 500 505 510 Gly Ala Thr Ala Thr Thr Gly Gly Cys Thr Gly Thr Thr Cys Ala Gly 515 520 525 Gly Gly Thr Gly Thr Cys Cys Ala Ala Gly Ala Cys Thr Ala Cys Ala 530 535 540 Thr Cys Ala Ala Thr Ala Ala Thr Gly Ala Gly Cys Thr Gly Ala Thr 545 550 555 560 Ala Cys Cys Gly Thr Cys Thr Ala Thr Gly Ala Ala Cys Cys Ala Gly 565 570 575 Cys Thr Ala Thr Cys Thr Thr Gly Thr Gly Ala Thr Cys Thr Ala Ala 580 585 590 Thr Cys Gly Gly Thr Cys Ala Gly Ala Ala Gly Cys Thr Cys Gly Gly 595 600 605 Gly Cys Thr Cys Ala Ala Ala Thr Thr Gly Cys Thr Thr Ala Gly Ala 610 615 620 Thr Ala Cys Thr Ala Thr Ala Cys Ala Gly Ala Ala Ala Thr Cys Cys 625 630 635 640 Thr Gly Thr Cys Ala Thr Thr Ala Thr Thr Thr Gly Gly Cys Cys Cys 645 650 655 Cys Ala Gly Cys Cys Thr Ala Cys Gly Gly Gly Ala Cys Cys Cys Cys 660 665 670 Ala Thr Ala Thr Cys Thr Gly Cys Gly Gly Ala Gly Ala Thr Ala Thr 675 680 685 Cys Thr Ala Thr Cys Cys Ala Gly Gly Cys Thr Thr Thr Gly Ala Gly 690 695 700 Thr Thr Ala Thr Gly Cys Ala Cys Thr Thr Gly Gly Ala Gly Gly Ala 705 710 715 720 Gly Ala Thr Ala Thr Cys Ala Ala Thr Ala Ala Gly Gly Thr Gly Thr 725 730 735 Thr Ala Gly Ala Ala Ala Ala Gly Cys Thr Cys Gly Gly Ala Thr Ala 740 745 750 Cys Ala Gly Thr Gly Gly Ala Gly Gly Cys Gly Ala Thr Thr Thr Ala 755 760 765 Cys Thr Ala Gly Gly Cys Ala Thr Cys Thr Thr Ala Gly Ala Gly Ala 770 775 780 Gly Cys Ala Gly Ala Gly Gly Ala Ala Thr Ala Ala Ala Gly Gly Cys 785 790 795 800 Thr Cys Gly Gly Ala Thr Ala Ala Cys Thr Cys Ala Cys Gly Thr Cys 805 810 815 Gly Ala Cys Ala Cys Ala Gly Ala Gly Thr Cys Cys Thr Ala Cys Thr 820 825 830 Thr Cys Ala Thr Ala Gly Thr Cys Cys Thr Cys Ala Gly Thr Ala Thr 835 840 845 Ala Gly Cys Cys Thr Ala Thr Cys Cys Gly Ala Cys Gly Cys Thr Gly 850 855 860 Thr Cys Cys Gly Ala Gly Ala Thr Thr Ala Ala Gly Gly Gly Gly Gly 865 870 875 880 Thr Gly Ala Thr Thr Gly Thr Cys Cys Ala Cys Cys Gly Gly Cys Thr 885 890 895 Ala Gly Ala Gly Gly Gly Gly Gly Thr Cys Thr Cys Gly Thr Ala Cys 900 905 910 Ala Ala Cys Ala Thr Ala Gly Gly Cys Thr Cys Thr Cys Ala Ala Gly 915 920 925 Ala Gly Thr Gly Gly Thr Ala Thr Ala Cys Cys Ala Cys Thr Gly Thr 930 935 940 Gly Cys Cys Cys Ala Ala Gly Thr Ala Thr Gly Thr Thr Gly Cys Ala 945 950 955 960 Ala Cys Cys Cys Ala Ala Gly Gly Gly Thr Ala Cys Cys Thr Thr Ala 965 970 975 Thr Cys Thr Cys Gly Ala Ala Thr Thr Thr Thr Gly Ala Thr Gly Ala 980 985 990 Gly Thr Cys Ala Thr Cys Ala Thr Gly Thr Ala Cys Thr Thr Thr Cys 995 1000 1005 Ala Thr Gly Cys Cys Ala Gly Ala Gly Gly Gly Gly Ala Cys Thr 1010 1015 1020 Gly Thr Gly Thr Gly Cys Ala Gly Cys Cys Ala Ala Ala Ala Thr 1025 1030 1035 Gly Cys Cys Thr Thr Gly Thr Ala Cys Cys Cys Gly Ala Thr Gly 1040 1045 1050 Ala Gly Thr Cys Cys Thr Cys Thr Gly Cys Thr Cys Cys Ala Ala 1055 1060 1065 Gly Ala Ala Thr Gly Cys Cys Thr Cys Cys Gly Gly Gly Gly Gly 1070 1075 1080 Thr Cys Cys Ala Cys Cys Ala Ala Gly Thr Cys Cys Thr Gly Thr 1085 1090 1095 Gly Cys Thr Cys Gly Thr Ala Cys Ala Cys Thr Cys Gly Thr Ala 1100 1105 1110 Thr Cys Cys Gly Gly Gly Thr Cys Thr Thr Thr Thr Gly Gly Gly 1115 1120 1125 Ala Ala Cys Cys Gly Gly Thr Thr Cys Ala Thr Thr Thr Thr Ala 1130 1135 1140 Thr Cys Ala Cys Ala Ala Gly Gly Gly Ala Ala Cys Cys Thr Ala 1145 1150 1155 Ala Thr Ala Gly Cys Cys Ala Ala Thr Thr Gly Thr Gly Cys Ala 1160 1165 1170 Thr Cys Ala Ala Thr Thr Cys Thr Thr Thr Gly Thr Ala Ala Gly 1175 1180 1185 Thr Gly Thr Thr Ala Cys Ala Cys Ala Ala Cys Ala Gly Gly Thr 1190 1195 1200 Ala Cys Gly Ala Thr Thr Ala Thr Thr Ala Ala Thr Cys Ala Ala 1205 1210 1215 Gly Ala Cys Cys Cys Thr Gly Ala Cys Ala Ala Gly Ala Thr Cys 1220 1225 1230 Cys Thr Ala Ala Cys Ala Thr Ala Cys Ala Thr Thr Gly Cys Thr 1235 1240 1245 Gly Cys Cys Gly Ala Thr Cys Gly Cys Thr Gly Cys Cys Cys Gly 1250 1255 1260 Gly Thr Ala Gly Thr Cys Gly Ala Gly Gly Thr Gly Ala Ala Cys 1265 1270 1275 Gly Gly Cys Gly Thr Gly Ala Cys Cys Ala Thr Cys Cys Ala Ala 1280 1285 1290 Gly Thr Cys Gly Gly Gly Ala Gly Cys Ala Gly Gly Ala Gly Gly 1295 1300 1305 Thr Ala Thr Cys Cys Ala Gly Ala Cys Gly Cys Thr Gly Thr Gly 1310 1315 1320 Thr Ala Cys Thr Thr Gly Cys Ala Cys Ala Gly Ala Ala Thr Thr 1325 1330 1335 Gly Ala Cys Cys Thr Cys Gly Gly Thr Cys Cys Thr Cys Cys Cys 1340 1345 1350 Ala Thr Ala Thr Cys Ala Thr Thr Gly Gly Ala Gly Ala Gly Gly 1355 1360 1365 Thr Thr Gly Gly Ala Cys Gly Thr Ala Gly Gly Gly Ala Cys Ala 1370 1375 1380 Ala Ala Thr Cys Thr Gly Gly Gly Gly Ala Ala Thr Gly Cys Ala 1385 1390 1395 Ala Thr Thr Gly Cys Cys Ala Ala Ala Thr Thr Gly Gly Ala Gly 1400 1405 1410 Gly Ala Thr Gly Cys Cys Ala Ala Gly Gly Ala Ala Thr Thr Gly 1415 1420 1425 Thr Thr Gly Gly Ala Ala Thr Cys Ala Thr Cys Gly Gly Ala Cys 1430 1435 1440 Cys Ala Gly Ala Thr Ala Thr Thr Gly Ala Gly Ala Ala Gly Thr 1445 1450 1455 Ala Thr Gly Ala Ala Ala Gly Gly Thr Thr Thr Ala Thr Cys Gly 1460 1465 1470 Ala Gly Cys Ala Cys Thr Ala Gly Cys Ala Thr Ala Gly Thr Cys 1475 1480 1485 Thr Ala Cys Ala Thr Cys Cys Thr Gly Ala Thr Thr Gly Cys Ala 1490 1495 1500 Gly Thr Gly Thr Gly Thr Cys Thr Thr Gly Gly Ala Gly Gly Gly 1505 1510 1515 Thr Thr Gly Ala Thr Ala Gly Gly Gly Ala Thr Cys Cys Cys Cys 1520 1525 1530 Ala Cys Thr Thr Thr Ala Ala Thr Ala Thr Gly Thr Thr Gly Cys 1535 1540 1545 Thr Gly Cys Ala Gly Gly Gly Gly Gly Cys Gly Thr Thr Gly Thr 1550 1555 1560 Ala Ala Cys Ala Ala Ala Ala Ala Gly Gly Gly Ala Gly Ala Ala 1565 1570 1575 Cys Ala Ala Gly Thr Thr Gly Gly Thr Ala Thr Gly Thr Cys Ala 1580 1585 1590 Ala Gly Ala Cys Cys Ala Gly Gly Cys Cys Thr Ala Ala Ala Gly 1595 1600 1605 Cys Cys Thr Gly Ala Cys Cys Thr Thr Ala Cys Ala Gly Gly Ala 1610 1615 1620 Ala Cys Ala Thr Cys Ala Ala Ala Ala Thr Cys Cys Thr Ala Thr 1625 1630 1635 Gly Thr Ala Ala Gly Ala Thr Cys Gly Cys Thr Thr Thr Gly Ala 1640 1645 1650 <210> 6 <211> 662 <212> PRT <213> canine distemper virus <400> 6 Met His Asn Lys Asn Pro Lys Lys Ser Lys Pro Leu Pro His Thr Arg 1 5 10 15 Gln Asp Pro Leu Gln Gln His Ser Thr Arg Ser Ala Glu Thr Lys Thr 20 25 30 Ser Gln Gly Gln His Ser Thr Thr Ser Ala Gln Arg Ser Thr Tyr His 35 40 45 Gly Pro Arg Thr Ser Asp Arg Ser Val His Tyr Ile Met Asn Arg Thr 50 55 60 Arg Ser Cys Lys Gln Thr Ser His Arg Ser Asp Asn Ile Pro Pro His 65 70 75 80 Arg Asp His Glu Gly Ile Ile His His Thr Pro Glu Ser Val Thr Gln 85 90 95 Gly Ala Ser Ser Trp Phe Lys Arg Arg Gln Ser Asn Ala Thr Asn Ala 100 105 110 Gly Ser Gln Tyr Thr Trp Leu Val Leu Trp Cys Ile Gly Ile Ala Ser 115 120 125 Leu Leu Leu Cys Ser Lys Ala Gln Ile His Trp Asn Asn Leu Ser Thr 130 135 140 Ile Gly Ile Ile Gly Thr Asp Ser Val His Tyr Lys Ile Met Thr Arg 145 150 155 160 Pro Ser His Gln Tyr Leu Val Ile Lys Leu Met Pro Asn Val Ser Leu 165 170 175 Ile Asp Asn Cys Thr Lys Ala Glu Leu Gly Glu Tyr Glu Lys Leu Leu 180 185 190 Asn Ser Val Leu Glu Pro Ile Asn Gln Ala Leu Thr Leu Met Thr Asn 195 200 205 Asn Val Lys Pro Leu Gln Ser Val Gly Ser Gly Arg Arg Gln Arg Arg 210 215 220 Phe Ala Gly Val Val Leu Ala Gly Ala Ala Leu Gly Val Ala Thr Ala 225 230 235 240 Ala Gln Ile Thr Ala Gly Ile Ala Leu His Gln Ser Asn Leu Asn Ala 245 250 255 Gln Ala Ile Gln Ser Leu Arg Thr Ser Leu Glu Gln Ser Asn Lys Ala 260 265 270 Ile Glu Glu Ile Arg Glu Ala Thr Gln Glu Thr Val Ile Ala Val Gln 275 280 285 Gly Val Gln Asp Tyr Val Asn Asn Glu Leu Val Pro Ala Met Gln His 290 295 300 Met Ser Cys Glu Leu Val Gly Gln Arg Leu Gly Leu Lys Leu Leu Arg 305 310 315 320 Tyr Tyr Thr Glu Leu Leu Ser Ile Phe Gly Pro Ser Leu Arg Asp Pro 325 330 335 Ile Ser Ala Glu Ile Ser Ile Gln Ala Leu Ser Tyr Ala Leu Gly Gly 340 345 350 Glu Ile His Lys Ile Leu Glu Lys Leu Gly Tyr Ser Gly Asn Asp Met 355 360 365 Ile Ala Ile Leu Glu Ser Arg Gly Ile Lys Thr Lys Ile Thr His Val 370 375 380 Asp Leu Pro Gly Lys Leu Ile Ile Leu Ser Ile Ser Tyr Pro Thr Leu 385 390 395 400 Ser Glu Val Lys Gly Val Ile Val His Arg Leu Glu Ala Val Ser Tyr 405 410 415 Asn Ile Gly Ser Gln Glu Trp Tyr Thr Thr Val Pro Lys Tyr Val Ala 420 425 430 Thr Asn Gly Tyr Leu Ile Ser Asn Phe Asp Glu Ser Ser Cys Val Phe 435 440 445 Val Ser Glu Ser Ala Ile Cys Ser Gln Asn Ser Leu Tyr Pro Met Ser 450 455 460 Pro Ile Leu Gln Gln Cys Ile Arg Gly Asp Thr Ser Ser Cys Ala Arg 465 470 475 480 Thr Leu Val Ser Gly Thr Met Gly Asn Lys Phe Ile Leu Ser Lys Gly 485 490 495 Asn Ile Val Ala Asn Cys Ala Ser Ile Leu Cys Lys Cys Tyr Ser Thr 500 505 510 Ser Thr Ile Ile Asn Gln Ser Pro Asp Lys Leu Leu Thr Phe Ile Ala 515 520 525 Ser Asp Thr Cys Pro Leu Val Glu Ile Asp Gly Val Thr Ile Gln Val 530 535 540 Gly Gly Arg Gln Tyr Pro Asp Met Val Tyr Glu Ser Lys Val Ala Leu 545 550 555 560 Gly Pro Ala Ile Ser Leu Glu Arg Leu Asp Val Gly Thr Asn Leu Gly 565 570 575 Asn Ala Leu Lys Lys Leu Asp Asp Ala Lys Val Leu Ile Asp Ser Ser 580 585 590 Asn Gln Ile Leu Glu Thr Val Lys Arg Ser Ser Phe Asn Phe Gly Ser 595 600 605 Leu Leu Ser Val Pro Ile Leu Ile Cys Thr Ala Leu Ala Leu Leu Leu 610 615 620 Leu Ile Tyr Cys Cys Lys Arg Arg Tyr Arg Gln Thr Phe Lys His Asn 625 630 635 640 Thr Lys Val Asp Pro Thr Phe Lys Pro Asp Leu Thr Gly Thr Ser Lys 645 650 655 Ser Tyr Val Arg Ser Leu 660 <210> 7 <211> 662 <212> PRT <213> canine distemper virus <400> 7 Met His Asn Lys Ile Pro Lys Arg Ser Lys Pro Leu Pro His Thr Arg 1 5 10 15 Gln Asp Pro Leu Gln Gln His Ser Thr Arg Phe Gly Glu Thr Thr Thr 20 25 30 Ser Gln Gly Arg His Ser Thr Thr Ser Ala Gln Arg Ser Thr His His 35 40 45 Gly Pro Arg Thr Ser Asp Arg Pro Val His His Thr Met Asn Arg Thr 50 55 60 Arg Ser Cys Lys Gln Thr Ser His Arg Ser Asp Asn Ile Leu Pro His 65 70 75 80 Arg Asp His Lys Gly Ile Ile His His Thr Pro Glu Ser Val Thr Gln 85 90 95 Gly Ala Ser Ser Trp Phe Lys Arg Arg Gln Phe Asn Ala Thr Asn Ala 100 105 110 Gly Ser Gln Cys Thr Trp Leu Val Leu Trp Cys Ile Gly Ile Ala Ser 115 120 125 Leu Phe Leu Cys Ser Lys Ala Gln Ile His Trp Asn Asn Leu Ser Thr 130 135 140 Ile Gly Ile Ile Gly Thr Asp Ser Val His Tyr Lys Ile Met Thr Arg 145 150 155 160 Pro Ser His Gln Tyr Leu Val Ile Lys Leu Met Pro Asn Val Ser Leu 165 170 175 Ile Asp Asn Cys Thr Lys Ala Glu Leu Gly Glu Tyr Glu Lys Leu Leu 180 185 190 Asn Ser Val Leu Glu Pro Ile Asn Gln Ala Leu Thr Leu Met Thr Asn 195 200 205 Asn Val Lys Pro Leu Gln Ser Val Gly Ser Gly Arg Arg Gln Arg Arg 210 215 220 Phe Ala Gly Val Val Leu Ala Gly Ala Ala Leu Gly Val Ala Thr Ala 225 230 235 240 Ala Gln Ile Thr Ala Gly Ile Ala Leu His Gln Ser Asn Leu Asn Ala 245 250 255 Gln Ala Ile Gln Ser Leu Arg Thr Ser Leu Glu Gln Ser Asn Lys Ala 260 265 270 Ile Glu Glu Ile Arg Glu Ala Thr Gln Glu Thr Val Ile Ala Val Gln 275 280 285 Gly Val Gln Asp Tyr Val Asn Asn Glu Leu Val Pro Ala Met Gln His 290 295 300 Met Ser Cys Glu Leu Val Gly Gln Arg Leu Gly Leu Lys Leu Leu Arg 305 310 315 320 Tyr Tyr Thr Glu Leu Leu Ser Ile Phe Gly Pro Ser Leu Arg Asp Pro 325 330 335 Ile Ser Ala Glu Ile Ser Ile Gln Ala Leu Ser Tyr Ala Leu Gly Gly 340 345 350 Glu Ile His Lys Ile Leu Glu Lys Leu Gly Tyr Ser Gly Asn Asp Met 355 360 365 Ile Ala Ile Leu Glu Ser Arg Gly Ile Lys Thr Lys Ile Thr His Val 370 375 380 Asp Leu Pro Gly Lys Leu Ile Ile Leu Ser Ile Ser Tyr Pro Thr Leu 385 390 395 400 Ser Glu Val Lys Gly Val Ile Val His Arg Leu Glu Thr Val Ser Tyr 405 410 415 Asn Ile Gly Ser Gln Glu Trp Tyr Thr Thr Val Pro Lys Tyr Val Ala 420 425 430 Thr Asn Gly Tyr Leu Ile Ser Asn Phe Asp Glu Ser Ser Cys Val Phe 435 440 445 Phe Ser Glu Ser Ala Ile Cys Ser Gln Asn Ser Leu Tyr Pro Met Ser 450 455 460 Pro Ile Leu Gln Gln Cys Ile Arg Gly Asp Thr Ser Ser Cys Ala Arg 465 470 475 480 Thr Leu Val Ser Gly Thr Met Gly Asn Lys Phe Ile Leu Ser Lys Gly 485 490 495 Asn Ile Val Ala Asn Cys Ala Ser Ile Leu Cys Lys Cys Tyr Ser Thr 500 505 510 Ser Thr Ile Ile Asn Gln Ser Pro Asp Lys Leu Leu Thr Phe Ile Ala 515 520 525 Ser Asp Thr Cys Pro Leu Val Glu Ile Asp Gly Val Thr Ile Gln Val 530 535 540 Gly Gly Arg Gln Tyr Pro Asp Met Val Tyr Glu Ser Lys Val Ala Leu 545 550 555 560 Gly Pro Ala Ile Ser Leu Glu Arg Leu Asp Val Gly Thr Asn Leu Gly 565 570 575 Asn Ala Leu Lys Lys Leu Asp Asp Ala Lys Val Leu Ile Asp Ser Ser 580 585 590 Asn Gln Ile Leu Glu Thr Val Lys Arg Ser Ser Phe Asn Phe Gly Ser 595 600 605 Leu Leu Ser Ile Pro Ile Leu Ile Cys Thr Ala Leu Val Leu Leu Leu 610 615 620 Leu Ile Tyr Cys Cys Asn Arg Arg Tyr Arg Gln Thr Phe Lys His Asn 625 630 635 640 Thr Lys Val Asp Pro Thr Phe Lys Pro Asp Leu Thr Gly Thr Ser Lys 645 650 655 Ser Tyr Val Arg Ser Leu 660 <210> 8 <211> 604 <212> PRT <213> canine distemper virus <400> 8 Met Leu Pro Tyr Gln Asp Lys Val Gly Ala Phe Tyr Lys Asp Asn Ala 1 5 10 15 Arg Ala Asn Ser Thr Lys Leu Ser Leu Val Thr Glu Gly His Gly Gly 20 25 30 Arg Arg Pro Pro Tyr Leu Leu Phe Val Leu Leu Ile Leu Leu Val Gly 35 40 45 Ile Leu Ala Leu Leu Ala Ile Thr Gly Val Arg Phe His Gln Val Ser 50 55 60 Thr Ser Asn Met Glu Phe Ser Arg Leu Leu Lys Glu Asp Met Glu Lys 65 70 75 80 Ser Glu Ala Val His His Gln Val Ile Asp Val Leu Thr Pro Leu Phe 85 90 95 Lys Ile Ile Gly Asp Glu Ile Gly Leu Arg Leu Pro Gln Lys Leu Asn 100 105 110 Glu Ile Lys Gln Phe Ile Leu Gln Lys Thr Asn Phe Phe Asn Pro Asn 115 120 125 Arg Glu Phe Asp Phe Arg Asp Leu His Trp Cys Ile Asn Pro Pro Ser 130 135 140 Thr Val Lys Val Asn Phe Thr Asn Tyr Cys Glu Ser Ile Gly Ile Arg 145 150 155 160 Lys Ala Ile Ala Ser Ala Ala Asn Pro Ile Leu Leu Ser Ala Leu Ser 165 170 175 Gly Gly Arg Gly Asp Ile Phe Pro Pro His Arg Cys Ser Gly Ala Thr 180 185 190 Thr Ser Val Gly Lys Val Phe Pro Leu Ser Val Ser Leu Ser Met Ser 195 200 205 Leu Ile Ser Arg Thr Ser Glu Val Ile Asn Met Leu Thr Ala Ile Ser 210 215 220 Asp Gly Val Tyr Gly Lys Thr Tyr Leu Leu Val Pro Asp Asp Ile Glu 225 230 235 240 Arg Glu Phe Asp Thr Arg Glu Ile Arg Val Phe Glu Ile Gly Phe Ile 245 250 255 Lys Arg Trp Leu Asn Asp Met Pro Leu Leu Gln Thr Thr Asn Tyr Met 260 265 270 Val Leu Pro Lys Asn Ser Lys Ala Lys Val Cys Thr Ile Ala Val Gly 275 280 285 Glu Leu Thr Leu Ala Ser Leu Cys Val Glu Glu Ser Thr Val Leu Leu 290 295 300 Tyr His Asp Ser Ser Gly Ser Gln Asp Gly Ile Leu Val Val Thr Leu 305 310 315 320 Gly Ile Phe Trp Ala Thr Pro Met Asp His Ile Glu Glu Val Ile Pro 325 330 335 Val Ala His Pro Ser Met Lys Lys Ile His Ile Thr Asn His Arg Gly 340 345 350 Phe Ile Lys Asp Ser Ile Ala Thr Trp Met Val Pro Ala Leu Ala Ser 355 360 365 Glu Lys Gln Glu Glu Gln Lys Gly Cys Leu Glu Ser Ala Cys Gln Arg 370 375 380 Lys Thr Tyr Pro Met Cys Asn Gln Ala Ser Trp Glu Pro Phe Gly Gly 385 390 395 400 Arg Gln Leu Pro Ser Tyr Gly Arg Leu Thr Leu Pro Leu Asp Ala Ser 405 410 415 Val Asp Leu Gln Leu Asn Ile Ser Phe Thr Tyr Gly Pro Val Ile Leu 420 425 430 Asn Gly Asp Gly Met Asp Tyr Tyr Glu Ser Pro Leu Leu Asn Ser Gly 435 440 445 Trp Leu Thr Ile Pro Pro Lys Asp Gly Thr Ile Ser Gly Leu Ile Asn 450 455 460 Lys Ala Gly Arg Gly Asp Gln Phe Thr Val Leu Pro His Val Leu Thr 465 470 475 480 Phe Ala Pro Arg Glu Ser Ser Gly Asn Cys Tyr Leu Pro Ile Gln Thr 485 490 495 Ser Gln Ile Arg Asp Arg Asp Val Leu Ile Glu Ser Asn Ile Val Val 500 505 510 Leu Pro Thr Gln Ser Ile Arg Tyr Val Ile Ala Thr Tyr Asp Ile Ser 515 520 525 Arg Ser Asp His Ala Ile Val Tyr Tyr Val Tyr Asp Pro Ile Arg Thr 530 535 540 Ile Ser Tyr Thr His Pro Phe Arg Leu Thr Thr Lys Gly Arg Pro Asp 545 550 555 560 Phe Leu Arg Ile Glu Cys Phe Val Trp Asp Asp Asn Leu Trp Cys His 565 570 575 Gln Phe Tyr Arg Phe Glu Ala Asp Ile Ala Asn Ser Thr Thr Ser Val 580 585 590 Glu Asn Leu Val Arg Ile Arg Phe Ser Cys Asn Arg 595 600 <210> 9 <211> 617 <212> PRT <213> measles virus <400> 9 Met Ser Pro Gln Arg Asp Arg Ile Asn Ala Phe Tyr Lys Asp Asn Pro 1 5 10 15 His Ser Lys Gly Ser Arg Ile Val Ile Asn Arg Glu His Leu Met Ile 20 25 30 Asp Arg Pro Tyr Val Leu Leu Ala Val Leu Phe Val Met Phe Leu Ser 35 40 45 Leu Ile Gly Leu Leu Ala Ile Ala Gly Ile Arg Leu His Arg Ala Ala 50 55 60 Ile Tyr Thr Ala Glu Ile His Lys Ser Leu Ser Thr Asn Leu Asp Val 65 70 75 80 Thr Asn Ser Ile Glu His Gln Val Lys Asp Val Leu Thr Pro Leu Phe 85 90 95 Lys Ile Ile Gly Asp Glu Val Gly Leu Arg Thr Pro Gln Arg Phe Thr 100 105 110 Asp Leu Val Lys Phe Ile Ser Asp Lys Ile Lys Phe Leu Asn Pro Asp 115 120 125 Arg Glu Tyr Asp Phe Arg Asp Leu Thr Trp Cys Ile Asn Pro Pro Glu 130 135 140 Arg Ile Lys Leu Asn Tyr Asp Gln Tyr Cys Ala Asp Val Ala Ala Glu 145 150 155 160 Glu Leu Met Asn Ala Leu Val Asn Ser Thr Leu Leu Glu Thr Arg Thr 165 170 175 Thr Asn Gln Phe Leu Ala Val Ser Lys Gly Asn Cys Ser Gly Pro Thr 180 185 190 Thr Ile Arg Gly Gln Phe Ser Asn Met Ser Leu Ser Leu Leu Asp Leu 195 200 205 Tyr Leu Ser Arg Gly Tyr Asn Val Ser Ser Ile Val Thr Met Thr Ser 210 215 220 Gln Gly Met Tyr Gly Gly Thr Tyr Leu Val Glu Lys Pro Asn Leu Asn 225 230 235 240 Ser Lys Gly Ser Glu Leu Ser Gln Leu Ser Met Tyr Arg Val Phe Glu 245 250 255 Val Gly Val Ile Arg Asn Pro Gly Leu Gly Ala Pro Val Phe His Met 260 265 270 Thr Asn Tyr Phe Glu Gln Pro Ile Ser Lys Asp Leu Ser Asn Cys Met 275 280 285 Val Ala Leu Gly Glu Leu Lys Leu Ala Ala Leu Cys His Gly Gly Asp 290 295 300 Ser Ile Thr Ile Pro Tyr Gln Gly Ser Gly Lys Gly Val Ser Phe Gln 305 310 315 320 Leu Val Lys Leu Gly Val Trp Lys Ser Pro Thr Asp Met His Ser Trp 325 330 335 Val Pro Leu Ser Thr Asp Asp Pro Val Ile Asp Arg Leu Tyr Leu Ser 340 345 350 Ser His Arg Gly Val Ile Thr Asp Asn Gln Ala Asn Trp Ala Val Pro 355 360 365 Thr Thr Arg Thr Asp Asp Lys Leu Arg Met Glu Thr Cys Phe Gln Gln 370 375 380 Ala Cys Lys Gly Lys Ile Gln Ala Leu Cys Glu Asn Leu Glu Trp Ala 385 390 395 400 Pro Leu Lys Asp Ser Arg Ile Pro Ser Tyr Gly Val Leu Ser Val Asp 405 410 415 Leu Ser Leu Ala Ala Glu Pro Lys Ile Lys Ile Ala Ser Gly Phe Gly 420 425 430 Pro Leu Ile Thr His Gly Ser Gly Met Asp Leu Tyr Lys Ser Asn His 435 440 445 Asn Asn Val Tyr Trp Leu Thr Ile Pro Pro Met Lys Asn Leu Ala Leu 450 455 460 Gly Val Ile Asn Thr Leu Glu Trp Ile Pro Arg Leu Lys Val Ser Pro 465 470 475 480 Asn Leu Phe Thr Val Pro Ile Lys Glu Ala Gly Glu Asp Cys His Ala 485 490 495 Pro Thr Tyr Leu Pro Ala Glu Val Asp Gly Asp Val Lys Leu Ser Ser 500 505 510 Asn Leu Val Ile Leu Pro Gly Gln Asp Leu Gln Tyr Val Leu Ala Thr 515 520 525 Tyr Asp Thr Ser Arg Val Glu His Ala Val Val Tyr Tyr Val Tyr Ser 530 535 540 Pro Ser Arg Ser Phe Ser Tyr Phe Tyr Pro Phe Arg Leu Pro Ile Lys 545 550 555 560 Gly Thr Pro Ile Glu Leu Gln Val Glu Cys Phe Thr Trp Ala Gln Arg 565 570 575 Leu Trp Cys Arg His Phe Cys Val Leu Ala Asp Ser Glu Ser Gly Gly 580 585 590 His Leu Thr His Ser Gly Met Val Gly Met Glu Val Ser Cys Thr Val 595 600 605 Asn Arg Glu Asp Glu Ala Asn Arg Arg 610 615 <210> 10 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> construct sequence <400> 10 gggaga 6 <210> 11 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> construct sequence <400> 11 taatacgact cactata 17 <210> 12 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> construct sequence <400> 12 taatacgact cactataggg agatgtttgg tctgatgagg ccgaaaggcc gaaactccgt 60 aaggagtc 68 <210> 13 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> construct sequence <400> 13 taatacgact cactataggg agatttggtc tgatgagtcc gtgaggacga aacggagtct 60 agactccgtc 70 <210> 14 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> construct sequence <400> 14 taatacgact cactataggg agatttggtc tgatgagtcc gtgaggacga aacggagtct 60 agactccgtc 70 <210> 15 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> construct sequence <400> 15 Lys Asn Leu Ala Leu Gly Val Ile Asn Thr Leu Glu Trp Ile Pro Arg 1 5 10 15 Phe Lys Val Ser Pro 20
Claims
1. A nucleic acid encoding a measles virus H polypeptide containing at least six amino acid substitutions compared to the wild-type measles virus H polypeptide, and Nucleic acids that encode morbillivirus F polypeptides other than measles virus F polypeptide. Recombinant viruses, including those mentioned above.
2. The virus according to claim 1, wherein the virus is a measles virus.
3. The virus according to any one of claims 1 to 2, wherein the virus is an adenovirus.
4. The virus according to any one of claims 1 to 3, wherein the encoded measles virus H polypeptide and the morbillivirus F polypeptide are incorporated into the envelope of the recombinant virus.
5. The virus according to any one of claims 1 to 4, wherein the measles virus H polypeptide includes Sequence ID No. 9 having six or more of the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.
6. The virus according to any one of claims 1 to 5, wherein the measles virus H polypeptide comprises Sequence ID No. 9 having the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.
7. The virus according to any one of claims 1 to 6, wherein the measles virus H polypeptide comprises at least one amino acid substitution in each of the antigenic sites listed in Table 1.
8. The virus according to any one of claims 1 to 7, wherein the wild-type measles virus H polypeptide is the wild-type measles virus H polypeptide of strain MVi / Madrid.SPA / 50.
10.
9. The virus according to any one of claims 1 to 7, wherein the wild-type measles virus H polypeptide comprises the amino acid sequence described in Sequence ID No.
9.
10. The virus according to any one of claims 1 to 7, wherein the measles virus H polypeptide comprises SEQ ID NO:
3.
11. The virus according to any one of claims 1 to 10, wherein the morbillivirus F polypeptide is canine distempervirus F polypeptide.
12. The virus according to any one of claims 1 to 11, wherein the virus exhibits CD46-dependent cell entry.
13. The virus according to claim 12, wherein the virus exhibits reduced Nectin-4-dependent cell entry compared to the wild-type virus.
14. The virus according to any one of claims 1 to 13, wherein the measles virus H polypeptide comprises at least one amino acid substitution in each of the antigenic sites listed in Table 2.
15. The virus according to any one of claims 1 to 14, wherein the measles virus H polypeptide comprises a substitution at position E471 compared to the wild-type measles virus H polypeptide.
16. The virus according to claim 15, wherein the substitution at position E471 is an E471K substitution.
17. The virus according to any one of claims 1 to 16, wherein the measles virus H polypeptide comprises Sequence ID No. 9 having the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, E471K, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.
18. The virus according to any one of claims 1 to 17, wherein the virus lacks the measles virus F polypeptide, lacks the nucleic acid encoding the measles virus F polypeptide, or lacks both the measles virus F polypeptide and the nucleic acid encoding the measles virus F polypeptide.
19. The virus according to any one of claims 1 to 18, wherein the virus lacks the wild-type measles virus H polypeptide, lacks the nucleic acid encoding the wild-type measles virus H polypeptide, or lacks both the wild-type measles virus H polypeptide and the nucleic acid encoding the wild-type measles virus H polypeptide.
20. A method for reducing the number of viable tumor cells in a mammal, comprising administering a virus according to any one of claims 1 to 13 to the mammal.
21. The method according to claim 20, wherein the mammal is a human.
22. A method for reducing the number of viable tumor cells in a mammal, comprising administering a virus according to any one of claims 14 to 19 to the mammal.
23. The method according to claim 22, wherein the mammal is a human.
24. A method for stimulating an immune response to a measles virus in a mammal, comprising administering the measles virus described in any one of claims 1 to 13 to the mammal.
25. The method according to claim 24, wherein the mammal is a child.
26. The method according to claim 25, wherein the child is a human child.
27. The method according to claim 26, wherein the human child acquires anti-measles antibodies transplacentally.
28. A method for stimulating an immune response to a measles virus in a mammal, comprising administering the measles virus described in any one of claims 14 to 19 to the mammal.
29. The method according to claim 28, wherein the mammal is a child.
30. The method according to claim 29, wherein the child is a human child.
31. The method according to claim 30, wherein the human child acquires anti-measles antibodies transplacentally.
32. A nucleic acid encoding a measles virus H polypeptide containing at least six amino acid substitutions compared to the wild-type measles virus H polypeptide, and Nucleic acids that encode morbillivirus F polypeptides other than measles virus F polypeptide. Nucleic acid constructs containing these components.
33. The nucleic acid construct according to claim 32, wherein the measles virus H polypeptide comprises Sequence ID No. 9 having six or more of the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.
34. The nucleic acid construct according to claim 32, wherein the measles virus H polypeptide comprises Sequence ID No. 9 having the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.
35. The nucleic acid construct according to any one of claims 32 to 34, wherein the measles virus H polypeptide comprises at least one amino acid substitution in each of the antigenic sites listed in Table 1.
36. The nucleic acid construct according to any one of claims 32 to 35, wherein the wild-type measles virus H polypeptide is the wild-type measles virus H polypeptide of strain MVi / Madrid.SPA / 50.
10.
37. The nucleic acid construct according to any one of claims 32 to 34, wherein the wild-type measles virus H polypeptide comprises the amino acid sequence described in SEQ ID NO:
9.
38. The nucleic acid construct according to any one of claims 32 to 37, wherein the measles virus H polypeptide comprises SEQ ID NO:
3.
39. The nucleic acid construct according to any one of claims 32 to 38, wherein the morbillivirus F polypeptide is canine distempervirus F polypeptide.
40. The nucleic acid construct according to any one of claims 32 to 39, wherein the nucleic acid construct is a viral vector.
41. The nucleic acid construct according to any one of claims 32 to 40, wherein the viral vector is derived from a virus selected from the group consisting of adenovirus, adeno-associated virus, retrovirus, lentivirus, herpesvirus, vaccinia virus, and rhabdovirus.
42. The nucleic acid construct according to any one of claims 32 to 41, wherein the measles virus H polypeptide comprises at least one amino acid substitution in each of the antigenic sites listed in Table 2.
43. The nucleic acid construct according to any one of claims 32 to 42, wherein the measles virus H polypeptide comprises a substitution at position E471 compared to the wild-type measles virus H polypeptide.
44. The nucleic acid construct according to claim 43, wherein the substitution at position E471 is an E471K substitution.
45. A nucleic acid construct according to any one of claims 32 to 44, wherein the measles virus H polypeptide comprises Sequence ID No. 9 having the following amino acid substitutions: S189P, E235G, N238D, L249P, G302R, Y310C, Q311R, R377Q, M378K, D416N, E471K, N481Y, K488E, G491E, H495R, D505T, R533G, S546G, R547G, and F552V.
46. The nucleic acid construct according to any one of claims 32 to 45, wherein the nucleic acid construct does not encode the measles virus F polypeptide.
47. The nucleic acid construct according to any one of claims 32 to 46, wherein the nucleic acid construct does not encode the wild-type measles virus H polypeptide.