Adeno-associated virus vectors for the treatment of Best's disease
AAV vectors deliver a functional BEST1 gene and shRNA to suppress mutant BEST1 expression, addressing retinal detachment in Best disease by restoring the RPE-PR interface and improving vision.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- UNIV OF FLORIDA RESEARCH FOUNDATION INC
- Filing Date
- 2025-12-19
- Publication Date
- 2026-04-21
AI Technical Summary
Mutations in the BEST1 gene lead to retinal degeneration and detachment, causing progressive loss of central vision in conditions like Best disease, with the pathophysiology of the interaction between retinal pigment epithelial and photoreceptor cells being poorly understood.
Adeno-associated virus (AAV) vectors are used to deliver a functional BEST1 gene and small hairpin RNA (shRNA) to suppress mutant BEST1 expression, restoring photoreceptor function by encoding a wild-type BEST1 sequence resistant to shRNA degradation and enhancing cellular function.
The treatment reverses retinal detachment and restores the RPE-PR interface structure, improving visual function and preventing disease progression in Best disease and autosomal recessive bestrophinopathy.
Smart Images

Figure 2026067864000019 
Figure 2026067864000020 
Figure 2026067864000021
Abstract
Description
Technical Field
[0001] Cross - reference to Related Applications This application claims the benefit of the filing dates of U.S. Provisional Application No. 62 / 726,184, filed Aug. 31, 2018; U.S. Provisional Application No. 62 / 749,622, filed Oct. 23, 2018; and U.S. Provisional Application No. 62 / 754,530, filed Nov. 1, 2018, the entire contents of each of which are incorporated by reference. Government Support The invention was made with government support under grant number EY021721 awarded by the National Institutes of Health. The government has certain rights in the invention.
Background Art
[0002] Background Mutations in the BEST1 gene (also called VMD2) cause several forms of retinal degeneration, including Best vitelliform macular dystrophy, also known as Best disease. (Best disease is also called Best macular dystrophy, vitelliform dystrophy, and vitelliform macular dystrophy.) Bestrophinopathy is caused by over 200 various mutations in the human BEST1 gene that encodes a protein (bestrophin, or BEST1) that functions as a calcium - dependent chloride channel associated with the basolateral membrane of the retinal pigment epithelium. In bestrophinopathy, defects in fluid transport across the RPE impair the interaction between the RPE and photoreceptor cells. This damage leads to the retina detaching from its supporting layer and the accumulation of oxidized proteolipid (lipofuscin) in the RPE and subretinal space. Eventually, photoreceptors die, mainly in the macular region (which provides central vision). In humans, BEST1 mutations are usually autosomal dominant, meaning that one defective copy leads to the disease regardless of the presence of a normal (wild - type) gene inherited from the other parent. However, autosomal recessive bestrophinopathy (ARB) has also been reported.
[0003] Best disease, a rare disorder, is a slowly progressive macular degeneration that generally presents in childhood and sometimes in the late teens. Affected individuals initially have normal vision but subsequently experience a decline in central vision and metamorphopsia. They retain normal peripheral visual fields and dark adaptation. Affected individuals develop a yolk-like mass on the macula. This mass eventually disintegrates and spreads across the macula, leading to a loss of central vision. Best disease can be diagnosed based on family history or ophthalmic examination, such as the appearance of the fundus or electrooculogram (EOG). Inherited retinal degenerations (IRDs) encompass a large group of blinding conditions that are molecularly heterogeneous and pathophysiologically distinct. Genetic defects often act primarily on rod or cone photoreceptors (PRs) or both, and certain defects may involve phototransduction, ciliopathy, morphogenesis, neurotransmission, or others. Primary defects related to the retinal pigment epithelium (RPE) are less common but are attracting increased attention due to promising clinical trials.
[0004] The most common IRD due to primary RPE defects is caused by mutations in BEST1, which encodes a transmembrane protein associated with the basal lateral portion of the RPE. BEST1 (bestrophin) is a multifunctional channel protein that mediates trans-epithelial ion transport, intracellular calcium signaling and regulation of RPE cell volume, and regulation of the homeostatic environment of the subretinal space. In eukaryotic cells, BEST1 forms a stable homopentamer with four transmembrane helices, cytoplasmic N and C termini, and a continuous central pore that is sensitive to calcium-dependent regulation of chloride permeability.
[0005] In humans, BEST1 mutations result in a broad range of IRD collectively grouped as bestrofinopathy, often characterized by distinctive macular lesions. Retinal regions distant from the lesions tend to appear normal overall, despite the presence of a whole-retinal electrophysiological defect in the EOG, which reflects abnormalities in the eye's standing potential. Naturally occurring two-allele mutations in the canine BEST1 gene (cBEST1) cause canine IRD with clear phenotypic similarities to both dominant and recessive forms of human bestrofinopathy, including a marked bias of subretinal lesions towards the canine foveal-like region.
[0006] Proper anatomical juxtaposition and sustained interaction between the apical microvilli (MV) of the retinal pleura (RPE) and the lateral segment of the retina (PR) (OS) are considered crucial for normal vision. Both the ionic composition and volume regulation of the subretinal space are essential for maintaining the precise molecular proximity of this complex and homeostasis of the RPE-PR interface. In vitro and ex vivo studies have long shown that genetic variation, metabolic perturbations, and light stimulation alter the ionic composition of the subretinal space and the physiological responses of the RPE and / or PR. More recently, in vivo studies of the microanatomy of the lateral retina and its response to light in healthy and diseased retina are becoming increasingly beneficial in modern retinal imaging modalities.
[0007] Mutations in the BEST1 gene lead to retinal detachment and photoreceptor (PR) cell degeneration through primary channel disease of adjacent retinal pigment epithelial (RPE) cells. The pathophysiology of the interaction between RPE and PR cells preceding the formation of retinal detachment remains poorly understood. [Overview of the project]
[0008] Summary of the Invention Aspects of disclosure relate to compositions for treating bestrofinopathy (e.g., bestrofin vitiligo macular degeneration) in subjects (e.g., in humans). Aspects of disclosure are designed to repress the expression of endogenous BEST1 mRNA (e.g., both mutant and normal copies). In some embodiments, expression is repressed using RNA interference. In some embodiments, endogenous BEST1 mRNA is simultaneously replaced with normal BEST1 mRNA to produce only the normal protein. In some embodiments, adeno-associated virus (AAV) is used to deliver a gene for small hairpin RNA (shRNA) that results in the production of small interfering RNA (siRNA), in addition to an intron-free copy of the BEST1 gene.
[0009] In some embodiments, one or both alleles of the BEST1 gene in a subject (e.g., a human) are silenced by administering a small hairpin RNA (shRNA) molecule to the subject (e.g., a subject with Best's disease, e.g., a human with Best's disease). In some embodiments, the substituted BEST1 coding sequence is also administered to the subject to provide a functional bethroffin protein, for example, to restore photoreceptor function to the subject. In some embodiments, the substituted BEST1 coding sequence has one or more nucleotide substitutions to the endogenous gene allele(s) that make the substituted gene resistant to the effects of interfering RNA. In some embodiments, the substituted BEST1 coding sequence is a human BEST1 coding sequence (e.g., a wild-type human BEST1 coding sequence) containing one or more (e.g., 1, 2, 3, 4, or 5 or more) substitutions that make the gene resistant to shRNA-mediated degradation. In some embodiments, the substituted BEST1 coding sequence contains one or more silent mutations (base changes at the third position of the codon) at the target site, causing the gene to be "detargeted" from shRNA-mediated degradation.
[0010] In some aspects, the disclosure provides a small hairpin RNA (shRNA) comprising a sense strand containing the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO: 2), an antisense strand containing the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3), and a loop. In some embodiments, the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO: 7).
[0011] In some aspects, the disclosure provides a small hairpin RNA (shRNA) comprising a sense strand containing the nucleotide sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO: 6), an antisense strand containing the nucleotide sequence AAGAACUCGCCAUAUAGCAGC (SEQ ID NO: 5), and a loop. In some embodiments, the loop comprises the nucleotide sequence CUCGAG (SEQ ID NO: 8).
[0012] In some embodiments, the disclosure provides a small hairpin RNA (shRNA) comprising an antisense strand containing the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3). In some respects, the disclosure provides a vector containing a gene sequence encoding the shRNA described in the preceding paragraph. In some respects, the disclosure provides a vector further comprising a recombinant functional (e.g., wild-type) BEST1 coding sequence that does not contain the shRNA target sequence. In some respects, the vector further comprises a recombinant functional BEST1 coding sequence that is codon-optimized for expression in human cells.
[0013] In some respects, the disclosure provides a vector comprising a recombinant BEST1 coding sequence containing a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 9. In some respects, the disclosure provides a vector comprising a recombinant BEST1 coding sequence containing a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 10. In some respects, the disclosure provides a vector that is a plasmid or a viral vector. In some respects, the viral vector is a recombinant adeno-associated virus (rAAV) vector. In some respects, the rAAV vector is self-complementary. In several respects, the disclosure provides rAAV virus particles, which are AAV serotype 2 virus particles. In some respects, the disclosure provides compositions comprising a vector or rAAV particles and a pharmaceutically acceptable carrier.
[0014] In some respects, the disclosure provides a method for modulating BEST1 expression in a subject, which includes administering a composition comprising a vector or rAAV particles and a pharmaceutically acceptable carrier to a subject such as a human subject. In some respects, the disclosure provides a method for treating bestrofinopathy (e.g., Best's disease and ARBs) in a subject, which includes administering a composition. In some embodiments, vectors encoding functional BEST1 sequences are provided to supplement or modify (for example, at least partially) cellular BEST1 function without knocking down endogenous BEST1 gene expression. In some embodiments, the BEST1 sequences are codon-optimized.
[0015] In some embodiments, a vector encoding a functional BEST1 sequence is provided to supplement or modify (for example, at least partially) the BEST1 function of a cell, and an shRNA sequence is provided to knock down endogenous BEST1 gene expression. In some embodiments, endogenous BEST1 expression is knocked down using shRNA. In some embodiments, the BEST1 sequence is codon-optimized. In some embodiments, the BEST1 sequence is modified to be resistant to shRNA. In some embodiments, the BEST1 and shRNA sequences are encoded on the same AAV vector.
[0016] In some respects, the disclosure provides compositions for use in treating Best disease and compositions for use in the manufacture of pharmaceuticals for treating Best disease. In some respects, the disclosure provides compositions comprising a vector or rAAV particles, wherein the vector encodes a functional BEST1 sequence for use in treating ARBs, and compositions for use in the manufacture of pharmaceuticals for treating ARBs. These and other aspects are described in the following drawings, examples, and claims. [Brief explanation of the drawing]
[0017] Simple description of the drawing The following drawings form part of this specification and are included to further demonstrate certain aspects of this disclosure. They can be better understood by referring to one or more of these drawings in conjunction with the detailed descriptions of the particular embodiments presented herein. It should be understood that the data illustrated in the drawings are not intended to limit the scope of the disclosure.
[0018] [Figure 1A-D] Figures 1A–1D show the whole-retinal pathology of the RPE apical microvilli associated with the canine BEST1 mutation. Figures 1A and 1B show confocal images illustrating the molecular pathology of cBest (R25* / R25*; 89 weeks) (Figure 1B) compared with wild-type (Figure 1A) (42 weeks). Retinal frozen sections were immunolabeled with anti-EZRIN and human cone arrestin, combined with peanut agglutinin lectin and DAPI labeling. Figure 1C shows representative micrographs of 6-week-old canine wild-type and cBest mutation (R25* / P463fs) retinas immunolabeled with anti-BEST1 and anti-SLC16A1. White arrows point to subsets of cone-MVs. Figure 1D shows quantification of whole-retinal cone-MV numbers between the cBest mutant and a comparable-age control eye. The y-axis represents the mean number of cone-MVs per square millimeter for each color-coded retinal region examined. Abbreviations: H&E, hematoxylin & eosin staining; PRL, photoreceptor IS / OS layer; i, inferior; N, nasal; S, superior; T, temporal.
[0019] [Figure 2A-C] Figures 2A–2F show light-mediated changes in the lateral retinal structure in wild-type and cBest(R25* / P463fs) mutants. Figure 2A shows cross-sectional imaging along the horizontal meridian through the foveal area (foveal-like region) of 15-week-old normal (WT) dogs and 11-week-old cBest(R25* / P463fs) dogs with weaker and stronger light adaptation (LA). Thin white arrows indicate the supertemporal position of the OCT. Figure 2B shows longitudinal reflection profiles (LRP) at 3° nasal angle from the foveal-like region (T, temporal retina) and the nasal margin of the optic disc (N, nasal retina) (mean of 85 single LRPs) in WT dogs (12 eyes, 15–17 weeks old) compared with cBest-treated dogs (6 eyes, 11 weeks old) with weaker and stronger LA. Arrows indicate IS / OS and RPE / T peaks. Single and double arrows indicate the additional low-reflectance layer in cBest. Figure 2C shows the distance between the IS / OS peak and the RPE / T peak in the eyes of WT and cBest under two LA conditions. Symbols with error bars represent the mean (±2SD) distance for each group of eyes at both locations. Figure 2D shows schematic diagrams of the dark-adaptation protocol and the light-adaptation protocol. Animals were dark-adapted overnight (D / A) and OCT imaging was performed. Five increasing exposures (L1 to L5) were then used. [Figure 2D-F] Figure 2D also shows a magnified view of the OCT scan of a cBest with overlapping LRPs after nighttime dark adaptation (left) and after maximum exposure (right). Figure 2E shows results from different subsets of cBest eyes (n=3; colored traces) using a simplified protocol with only L4 and L5 exposure. Figure 2F shows the spatial tissue distribution of IS / OS to RPE / T distance at mean WT compared to two representative cBest eyes [panel; EM356-OS: 297 weeks old cmr1 / cmr3 (R25* / P463fs); LH30-OD: 12 weeks old cmr3 (P463fs / P463fs)].
[0020] [Figure 3A-B]Figures 3A–3D demonstrate that BEST1 gene enhancement therapy results in persistent inversion of foveomacular lesions and restoration of the RPE-PR interface structure in cBest mutants. Figure 3A shows the natural course of central subretinal detachment recorded by in vivo imaging in the right eye of a cBest dog (EM356-OD;R25* / P463fs) at three time points. Insets show autofluorescence and OCT images. Figure 3B shows fundus images taken before (52 weeks of age) and after subretinal injection of AAV2-cBEST1 (1.5 x 10¹⁰ vg / mL) in the eye shown in Figure 3A. Subretinal vesicle areas are indicated by dashed circles. Images taken at 43 and 245 weeks post-injection show persistent inversion of the central lesion and complete reattachment of the retina within the treated area. Center and right insets show autofluorescence and OCT images. [Figure 3C-D] Figures 3C and 3D show the recovery of RPE-photoreceptor interface structure after AAV-hBEST1 treatment in the cBest(R25* / R25*) model compared to a control. The boundaries of the vesicles are indicated by dashed circles. The locations of the corresponding OCT scans passing through the subretinal lesion before injection or through the mapped matching locations after injection are indicated by horizontal lines. The retinal incision sites are indicated by arrows.
[0021] [Figure 4A-B]Figures 4A–4F show the reversal of microdetachment throughout the retinal region after subretinal gene therapy in cBest mutant dogs [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), or cmr3(P463fs / P463fs)] injected subretinally with BSS or AAV-hBEST1. Figure 4A shows a map of the tissue distribution of IS / OS-RPE / T distance in cBest mutant dogs [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), or cmr3(P463fs / P463fs)] injected subretinally with BSS or AAV-hBEST1. Treatment boundaries are based on fundus photographs of vesicles taken at injection (dotted lines) and, where shown, evident boundaries at imaging (dashed lines). All eyes are shown as equivalent right eyes with the optic nerve and major blood vessels (black), tapetum junction (white), and foveal-like region (white oval) superimposed for ease of comparison. Figure 4B shows the difference in IS / OS-RPE / T distance of the WT in the superior and inferior retinal positions of the cBest eye within the treated vesicle (Tx; filled symbol) and untreated lateral vesicle (Ctrl; open symbol) regions. The dashed line divides the 95th percentile of normal variability. The tissue distribution of IS / OS-RPE / T distance is shown before (left) and after (right) treatment. [Figure 4C-F] Figures 4C and 4E show grayscale maps of the differences between each cBest eye and the mean WT control. White represents total retinal detachment. Figures 4D and 4F show the measured values of the coexisting difference in IS / OS-RPE / T distance between WT and pre-treatment (PreTx) and post-treatment (Tx) cBest eyes for the eyes shown in Figures 4C and 4E, respectively.
[0022] [Figure 5A-C]Figures 5A–5G show the phenotypes of retinal regions in two human subjects with ARB. Figure 5A shows the RPE health of the entire retinas of two ARB patients, P1 and P2, imaged with short-wavelength, low-light autofluorescence imaging (SW-RAFI) using natural RPE fluorophores lipofuscin. White arrows indicate the locations of the visual field profiles and OCT scans. Rectangles indicate regions of interest shown in other panels. Black arrows indicate the transition from disease to health in the retina around the center of the nose. Figure 5B shows the photosensitivity of the visual field of the eye, measured along a horizontal meridian, with dark-adapted (top) rods and light-adapted (bottom) cones. The gray area represents normal sensitivity except for the physiological blind spot corresponding to the optic nerve (ONH). Figure 5C shows a retinal cross-section with OCT along a horizontal meridian traversing the fovea. [Figure 5D-G] Figures 5D and 5E show details of the patient's lateral retinal stacking compared to normal in two regions of interest: the parapapillary retina (Figure 5D) and the central peripheral nasal retina (Figure 5E). Color indicates the interface near the tip of the COS and ROS, and the apical process of the RPE, while brick indicates the interface near the RPE and Bruch's membrane. Figures 5F and 5G show dark adaptation dynamics measured at P1 at the parapapillary locus (Figure 5F) and P2 at the central peripheral nasal locus (Figure 5G). Time 0 indicates the end of adaptation light.
[0023] [Figure 6A-D]Figures 6A–6D show the RPE-PR mating zone in a canine model of CNGB3-associated color blindness (ACHM3). Figures 6A and 6B show representative fluorescence microscopy images of 6-week-old CNGB3-D262N mutant (Figure 6A) and CNGB3 null (Figure 6B; CNGB3- / -) retinas, demonstrating normal expression of BEST1 limited to the basal plasma membrane of RPE cells and SLC16A1, a marker that labels the RPE apical process. Arrows point to a subset of cone-associated RPE apical microvilli (c-MVs). Figures 6A and 6B also show anti-CNGB3 and anti-EZRIN co-labeling, and a wild-type retina of the same age is shown for reference. Figures 6C and 6D show immunohistochemical evaluations of the RPE-PR interface in CNGB3 mutant retinas from affected dogs at 85 weeks of age (Figure 6C) and 57 weeks of age (Figure 6D). The apical lateral aspect of the RPE and its microvilli are immunolabeled with EZRIN, and a subset of c-MVs is indicated by arrows. Abbreviations: ACHM3, type 3 color blindness; cCNGB3, canine CNGB3 gene; cMV, cone-associated RPE apical microvilli; CNGB3, cyclic nucleotide gate channel beta-3 protein; hCAR, human cone arrestin; SLC16A1, solute carrier family 16 member 1.
[0024] [Figure 7] Figure 7 shows the recovery of light-mediated microdeposition. Two cBest-induced (R25* / P463fs) eyes [43 weeks old (right) and 52 weeks old (left)] were subjected to continuous dark adaptation and imaged in the same manner as the results shown in Figure 2A. [Figure 8A-B]Figures 8A–8B show hyperthick ONL in retinal regions with microdetachment and their correction by gene therapy in cBest eyes. Figure 8A shows uninjected cBest eyes (shown as IS / OS-RPE / T thickness maps in Figures 2A–2F and 4A–4F) demonstrating hyperthick ONL corresponding to broad areas of retinal microdetachment, and localized thinning of ONL over total lesions and near foveal-like regions in some eyes. Figure 8B shows treated cBest eyes (shown as IS / OS-RPE / T thickness maps in Figures 4A–4F) demonstrating normal ONL thickness in the AAV-treated region surrounded by hyperthick, normal, or thinned ONL in the untreated region. OD, right eye; OS, left eye.
[0025] [Figure 9A-F] Figures 9A–9F show the progression of focal macular lesions in a cBest-symptom dog (EM356-OS) (R25* / P463fs). Figure 9A shows the progression of discrete separation of the photoreceptor layer from the underlying RPE, forming a more apparent and larger subretinal macrodetachment (yolk rupture-like lesion) anteriorly, and Figure 9B shows the corresponding OCT scan at 23 weeks of age. Figure 9C shows the first signs of high autofluorescence accumulating within the subretinal lesion, observed at 8 weeks (31 weeks; early pseudohypopyometra lesion). Figure 9D shows the appearance of a typical pseudohypopyometra at 66 weeks of age, followed by yolk rupture-like lesions with dispersion of autofluorescence at 172 weeks and 297 weeks of age (inset, enlarged). Figures 9E and 9F show significant thinning of the ONL revealed by OCT scans. Dark lines indicate the location of the corresponding SD-OCT scans.
[0026] [Figure 10] Figure 10 shows retinal preservation after AAV-hBEST1 treatment in three cBest models [cmr1(R25* / R25*), cmr1 / cmr3(R25* / P463fs), and cmr3(P463fs / P463fs)] compared to wild-type control eyes and eyes not treated with cBest. [Figure 11A-D]Figures 11A–11D show the dose-response effect of BEST1 transgene expression on RPE cytoskeletal rescue in cBest(R25* / P463fs) retina. Figure 11A shows a cross-sectional overview from the surgical vesicle area (left), through the adjacent border area (center), to the continuous area outside the injection zone (right). Figure 11B shows significant dilation of the RPE apical process within the treated area with enhanced BEST1. Figure 11C shows the patchy distribution of BEST1 (weak signaling within individual RPE cells) and the presence of vestigial microvilli and rod MVs in the vesicle border area associated with RPE-PR microdetachment. Figure 11D shows the formation of subretinal lesions in the absence of both BEST1 expression and the RPE apical process outside the treatment zone.
[0027] [Figure 12A-B] Figures 12A–12B show the interocular symmetry of rod and cone function ARB patients P1 (Figure 12A) and P2 (Figure 12B). Rod (RSL) and cone sensitivity loss (CSL) maps of both eyes of two patients with ARB. [Figure 13] Figure 13 shows maps of the 6262bp plasmid, pTR-VMD2-hBest, and human bestrophin. [Figure 14] Figure 14 shows a map of the 6222bp plasmid, pTR-VMD2-cBest, and canine bestrofin.
[0028] [Figure 15] Figure 15 shows a map of the 6209 bp plasmid, pTR-SB-VMD2-HBest1-shRNA05, which contains resistance Best1. [Figure 16] Figure 16 shows a map of the 6145 bp plasmid, pTR-SB-VMD2-DTBest1-shRNA744, which contains detargeted Best1. [Figure 17]Figure 17 shows that the VMD2 promoter functions well in cell culture. HEK293T cells were transfected with plasmids expressing GFP or Best1 using either the chicken beta-actin promoter (CBA) or the VMD2 promoter. Protein lysates were isolated on polyacrylamide gel, and bestrofin (Best1) expression was detected by Western blotting, normalized to beta-tubulin expression, and showed a uniform loading on the gel.
[0029] [Figure 18A-B] Figures 18A–18B demonstrate the functionality of Best1-specific siRNA. The band intensities shown in the Western blot (Figure 18A) and quantified in the bar graph (Figure 18B) indicate that transfection of HEK293T, which stably expresses BEST1, resulted in a 75% reduction in bestrofin (Best1) protein. [Figure 19A-B] Figures 19A-19B show that Best1 shRNA is active: HEK293T-BEST1 cells were transfected with 4 μg of the plasmid shown. [Figure 20] Figure 20 shows the detargeting of Best1. The siRNA target site was removed from Best1 mRNA using a silent mutation (a base change at the third position of the codon). The disclosed example is for shRNA744. Sequence IDs 15-17 correspond to the following sequences from top to bottom: wild-type BEST1 target site; (complementary) shRNA744 target site; and detargeted DTBEST1 siRNA target site.
[0030] Detailed description Aspect of the application is to provide methods and compositions useful for treating Best's disease in subjects (for example, human subjects with Best's disease). In some embodiments, the disclosure provides methods and compositions for delivering a functional bethrophage protein to a subject having one or more mutant BEST1 genes. In some embodiments, the recombinant BEST1 gene (e.g., a coding sequence, e.g., cDNA or open reading frame) is delivered on a viral vector (e.g., an rAAV vector). In some embodiments, the expression of one or both alleles of the endogenous BEST1 gene is also knocked down. For example, in some embodiments, an siRNA (e.g., shRNA) is delivered to the subject along with the recombinant BEST1 gene. In some embodiments, the viral vector (e.g., an rAAV vector) encodes both the recombinant BEST1 gene and one or more siRNAs that target the endogenous BEST1 gene. In some embodiments, the recombinant BEST1 gene is modified to include one or more nucleotide substitutions that confer resistance to targeting by one or more siRNAs. In some embodiments, the recombinant BEST1 gene is codon-optimized (e.g., for expression in a subject, e.g., a human subject).
[0031] In some embodiments, the disclosure provides a small hairpin RNA (shRNA) comprising a sense strand containing the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO: 2), an antisense strand containing the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3), and a loop. In some embodiments, the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO: 7). In other embodiments, the disclosure provides a small hairpin RNA (shRNA) comprising a sense strand containing the nucleotide sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO: 6), an antisense strand containing the nucleotide sequence AAGAACUCGCCAUAUAGCAGC (SEQ ID NO: 5), and a loop. In some embodiments, the loop comprises the nucleotide sequence CUCGAG (SEQ ID NO: 8). In some embodiments, the disclosure provides a small hairpin RNA (shRNA) comprising an antisense strand containing the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3).
[0032] In some embodiments, shRNA can be delivered using a vector as shRNA driven by a promoter (e.g., a human H1 RNA promoter). In some embodiments, the vector is a plasmid. In some embodiments, the vector is a viral vector, such as an adeno-associated virus (AAV) vector. In some embodiments, the vector is a double-stranded or self-complementary AAV vector. In some embodiments, the vector sequence encoding the shRNA includes a BEST1 sequence. Therefore, in some aspects, shRNA is CCGTCAAAGCTTCACAGTGT TTCAAGAGA The nucleic acid having the sequence ACACTGTGAAGCTTTGACG (sequence number 18) (with the loop sequence underlined) can be encoded onto a DNA vector (for example, a viral vector). In some embodiments, various loop sequences are substituted for the loop sequence shown in sequence number 7.
[0033] Furthermore, in some embodiments, shRNA is GCTGCTATATGGCGAGTTCTT CTCGAG The sequence AAGAACTCGCCATATAGCAGC (Sequence ID 19) (with the loop sequence underlined) can be encoded onto a DNA vector (e.g., a viral vector) by a nucleic acid. In some embodiments, various loop sequences are substituted for the loop sequence shown in Sequence ID 8. In some embodiments, the same vector contains a coding sequence that encodes a normal (e.g., wild-type) Best1 protein but is resistant to the action of shRNA expressed by the vector.
[0034] In some embodiments, the BEST1 code sequence includes a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to sequence number 9. In some embodiments, the BEST1 code sequence includes a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to sequence number 10. In some embodiments, the BEST1 code sequence includes a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to sequence number 11.
[0035] In some embodiments, the BEST1 code sequence includes a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to sequence number 15. The 1757bp wild-type BEST1 sequence is defined as follows (SEQ ID NO: 9): [ka]
[0036] In some embodiments, the BEST1 coding sequence includes a short detargeting sequence corresponding to a region of the wild-type BEST1 gene. An exemplary detargeting sequence that may be used with a vector sequence encoding the shRNA744 sequence is defined as follows (SEQ ID NO: 10):CTACTGTACGGAGAATTTCT.
[0037] Other nucleotide substitutions may be made to detarget the BEST1 sequence. For example, in some embodiments, the detargeted sequence is located at various positions on the BEST1 coding sequence and corresponds to various regions of the wild-type BEST1 gene. An exemplary detargeted sequence that can be used with a vector sequence encoding the shRNA05 sequence is defined as follows (SEQ ID NO: 11): CCAGCAAGCTGCACAGCGT.
[0038] In some embodiments, an shRNA encoded by a nucleic acid containing the sequence of Sequence ID No. 1 (and / or its complement) (e.g., shRNA05) is transcribed in a vector-treated host cell (e.g., in a subject, e.g., a human subject). In some embodiments, two or more different shRNAs (e.g., having different start and / or stop sites, and different from shRNA05 by, for example, one or two additional or fewer nucleotides) are transcribed in a host cell.
[0039] In some embodiments, the BEST1 coding sequence is driven by a promoter (for example, a human opsin proximal promoter). In some embodiments, the promoter includes a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the following sequence number 12.
[0040] In some embodiments, the promoter driving shRNA expression includes a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 13 below. In some embodiments, the promoter driving shRNA expression includes a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 14 below.
[0041] The example promoter sequence is as follows: VMD2 promoter, 623bp fragment (SEQ ID NO: 12) [ka]
[0042] H1 promoter (SEQ ID NO: 13) [ka] U6 promoter (SEQ ID NO: 14) [ka]
[0043] In some embodiments, the BEST1 coding sequence is located in a vector such as an AAV vector or plasmid. In some embodiments, the vectors described herein include a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the detargeted BEST1 sequence, SEQ ID NO: 10.
[0044] In some embodiments, vectors encoding functional BEST1 sequences are provided to supplement or modify (for example, at least partially) cellular BEST1 function without knocking down endogenous BEST1 gene expression. In some embodiments, the BEST1 sequences are codon-optimized. In some embodiments, vectors encoding functional BEST1 sequences and shRNA sequences are provided to supplement or modify (for example, at least partially) cellular BEST1 function and to knock down endogenous BEST1 gene expression. In some embodiments, endogenous BEST1 expression is knocked down using shRNA. In some embodiments, the BEST1 sequence is codon-optimized. In some embodiments, the BEST1 sequence is modified to be resistant to shRNA. In some embodiments, the BEST1 and shRNA sequences are encoded on the same AAV vector.
[0045] In some aspects, the disclosure provides a method for modulating BEST1 expression in a subject, the method comprising administering a composition comprising a vector or rAAV particles and a pharmaceutically acceptable carrier to a subject such as a human subject. In some aspects, the disclosure provides a method for treating bestrofinopathy (e.g., Best's disease and ARBs) in a subject, the method comprising administering a composition.
[0046] In some aspects, the disclosure provides compositions for use in treating Best's disease and compositions for use in the manufacture of pharmaceuticals for treating Best's disease. In some aspects, the disclosure provides compositions comprising a vector or rAAV particles for use in treating ARBs, wherein the vector encodes a functional BEST1 sequence, and compositions for use in the manufacture of pharmaceuticals for treating ARBs.
[0047] Aspects of the disclosure relate to recombinant adeno-associated virus (rAAV) particles for delivery of rAAV vectors described herein (e.g., encoding shRNA and / or substituted BEST1) to various tissues, organs, and / or cells. In some embodiments, the rAAV particles comprise a capsid protein described herein, e.g., the AAV2 capsid protein. In some embodiments, the vector contained within the rAAV particle comprises the RNA of interest (e.g., shRNA containing the sequence of SEQ ID NO: 1) and a substituted BEST1 coding sequence (e.g., the sequence of SEQ ID NO: 10).
[0048] A recombinant AAV (rAAV) vector contained within an rAAV particle may contain at least (a) one or more heterogeneous nucleic acid regions (e.g., encoding shRNA and / or Best1 protein) and (b) one or more regions containing one or more reverse-ended repeat (ITR) sequences adjacent to the heterogeneous nucleic acid region (or transgene) (e.g., wild-type ITR sequences or engineered ITR sequences). In some embodiments, the heterogeneous nucleic acid region encodes the RNA of interest (e.g., shRNA containing the sequence of SEQ ID NO: 3) and contains a substituted BEST1 coding sequence (e.g., containing the sequence of SEQ ID NO: 10). In some embodiments, the rAAV vector is between 4kb and 5kb in size (e.g., 4.2–4.7kb). This rAAV vector can be capsidized with a viral capsid such as the AAV2 capsid. In some embodiments, the rAAV vector is single-stranded. In some embodiments, the rAAV vector is double-stranded. In some embodiments, a double-stranded rAAV vector may be a self-complementary vector that, for example, contains a region of the vector that is complementary to another region of the vector, and initiates the formation of the double-stranded vector.
[0049] As disclosed herein, analysis of Best1 structures with targeted mutations has shown that loss of apical microvilli of the retinal pigment epithelium and resulting retinal microdetachment represent the earliest features of canine bestrofinopathy. Retinal exposure is increased, dark adaptation is reduced, and microdetachment occurs. Subretinal adeno-associated virus-based gene therapy corrects both yolk-like lesions and light-modulated microdetachment.
[0050] Molecular pathogenesis studies in a canine BEST1 disease model revealed whole-retinal abnormalities at the RPE-PR interface associated with defects in the RPE microvilli sheath (ensheathment) and cone PR-associated insoluble photoreceptor matrix. In vivo imaging demonstrated whole-retinal RPE-PR microdetachment, which contracted in dark adaptation and expanded upon exposure to moderate light intensity. Subretinal BEST1 gene enhancement therapy using adeno-associated virus 2 reversed diffuse microdetachment as well as clinically detectable subretinal lesions. Immunohistochemical analysis showed modification of structural alterations at the RPE-PR interface in regions with BEST1 transgene expression. The successful treatment effect was 0.1 × 10⁶ per 1 mL area. 11 ~5×10 11 This was demonstrated in three different canine BEST1 genotypes with vector titers of the vector genome. Patients with two-allelic BEST1 mutations exhibited widespread retinal stacking defects, severe PR sensitivity loss, and delayed retinoid cycles. Human translation of the success of canine BEST1 gene therapy in reversing macro and microdetachment by restoring cellular architecture at the RPE-PR interface promises improved visual function and prevention of disease progression in patients developing bethrophinopathy.
[0051] As further disclosed herein, adeno-associated virus (AAV)2-mediated enhancement of the BEST1 gene has been found to correct this primary asymptomatic defect and disease.
[0052] rAAV particles may be of any AAV serotype, including any derivatives or pseudotypes (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2 / 1, 2 / 5, 2 / 8, or 2 / 9). As used herein, the serotype of rAAV particles refers to the serotype of the capsid protein. In some embodiments, the rAAV particles are AAV2. Non-limiting examples of derivatives and pseudotypes include rAAV2 / 1, rAAV2 / 5, rAAV2 / 8, rAAV2 / 9, AAV2-AAV3 hybrids, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32,33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, and AAV6. Includes AAV2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6 (Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV Clone 32 / 83, AAVShH10, AAV2 (Y→F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45. Such AAV serotypes and derivatives / pseudotypes, and methods for producing such derivatives / pseudotypes, are known in the art (see, for example, Mol Ther. 2012 Apr;20(4):699-708. doi: 10.1038 / mt.2011.287. Epub 2012 Jan 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan A1, Schaffer DV, Samulski RJ.). In some embodiments, the rAAV particle is a pseudotype rAAV particle comprising (a) a nucleic acid vector containing an ITR from one serotype (e.g., AAV2), and (b) a capsid composed of a capsid protein derived from another serotype (e.g., AAV5).Methods for producing and using pseudotyped rAAV vectors are known in the art (see, for example, Duan et al., J. Virol., 75:7662-7671, 2001; Halbert et al., J. Virol., 74:1524-1532, 2000; Zolotukhin et al., Methods, 28:158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001).
[0053] Methods for producing rAAV particles and rAAV vectors are also known and commercially available in the art (see, for example, Zolotukhin et al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167; and U.S. Patent Publication Nos. US 2007 / 0015238 and US 2012 / 0322861 (these are incorporated herein by reference), and plasmids and kits available from ATCC and Cell Biolabs, Inc.). For example, a plasmid containing an rAAV vector can be combined with one or more helper plasmids containing, for example, rep genes (e.g., encoding Rep78, Rep68, Rep52, and Rep40) and cap genes (e.g., encoding VP1, VP2, and VP3 (including the modified VP3 region described herein)) to transfect a producing cell line so that rAAV particles can be packaged and subsequently purified.
[0054] In some embodiments, one or more helper plasmids include a first helper plasmid containing a rep gene and a cap gene (for example, encoding the rAAV capsid protein described herein), and a second helper plasmid containing E1a, E1b, E4, E2a, and VA genes. In some embodiments, the rep gene is a rep gene derived from AAV2, and the cap gene is derived from AAV2 and may involve genetic modification to produce the modified capsid protein described herein. Helper plasmids and methods for producing such plasmids are known and commercially available in the art (see, for example, pDM, pDG, pDP1rs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E / R585E), and pDP8.ape plasmids from PlasmidFactory (Bielefeld, Germany); other products and services available from: Vector Biolabs (Philadelphia, PA); Cellbiolabs (San Diego, CA); Agilent Technologies (Santa Clara, Ca); and Addgene (Cambridge, MA); pxx6; Grimm et al. (1998), Novel Tools for Production and Purification of Recombinant Adenoassociated Virus Vectors, Human Gene Therapy, Vol. 9, 2745-2760; Kern, A. et al. (2003), Identification of a Heparin-Binding Motif on Adeno-Associated Virus Type 2 Capsids, Journal of Virology, Vol. 77, 11072-11081.;Grimm et al.(2003), Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1 to 6, Molecular Therapy,Vol. 7, 839-850;Kronenberg et al. (2005), A Conformational Change in the Adeno-Associated Virus Type 2 Capsid Leads to the Exposure of Hidden VP1 N Termini, Journal of Virology, Vol. 79, 5296-5303;およびMoullier, P. and Snyder, R.O. (2008), International efforts for recombinant adeno-associated viral vector reference standards, Molecular Therapy, Vol. 16, 1185-1188)。.
[0055] An exemplary, non-limiting method for producing rAAV particles is described below. One or more helper plasmids are produced or obtained, which contain rep and cap ORFs of the desired AAV serotype and adenovirus VA, E2A(DBP), and E4 genes under the transcriptional control of their native promoters. The cap ORF may also contain one or more modifications for producing the modified capsid proteins described herein. HEK293 cells (available from ATCC®) are transfected with one or more helper plasmids and plasmids containing the heterologous nucleic acid vectors described herein (for example, plasmids containing heterologous nucleic acids including wild-type or mutant cBEST1 or hBEST1 genes as shown in Figures 13, 14, 15, or 16) via CaPO4-mediated transfection, lipids, or polymer molecules such as polyethyleneimine (PEI). HEK293 cells are then incubated for at least 60 hours to enable the production of rAAV particles. Alternatively, in another example, an Sf9-based producer-stable cell line is infected with a single recombinant baculovirus containing a nucleic acid vector. As a further alternative, in another example, a HEK293 or BHK cell line is infected with an HSV containing a nucleic acid vector, and optionally with one or more helper HSVs containing adenovirus VA, E2A(DBP), and E4 genes under transcriptional control of the rep and cap ORFs described herein and their native promoters. The HEK293, BHK, or Sf9 cells are then incubated for at least 60 hours to enable the production of rAAV particles. The rAAV particles can then be purified using any method known in the art or described herein, for example, by iodixanol step gradient, CsCl gradient, chromatography, or polyethylene glycol (PEG) precipitation.
[0056] The disclosure also intends to describe host cells containing the shRNA, vector, or rAAV particles described herein. Such host cells include mammalian host cells, preferably human host cells, which may be isolated, for example, in cell or tissue culture. In some embodiments, the host cells are eye cells. In several respects, the disclosure provides formulations of one or more rAAV-based compositions disclosed herein in pharmaceutically acceptable solutions, either alone or in combination with one or more other modalities of treatment, for administration to cells or animals, and, in particular, for the treatment of human cells, tissues, and diseases occurring in humans.
[0057] Accordingly, in some embodiments, compositions are provided comprising the shRNA, vector, or rAAV particles described herein and optionally a pharmaceutically acceptable carrier. In some embodiments, the compositions described herein may be administered to a subject in need of treatment. In some embodiments, the subject has or is suspected of having one or more conditions, diseases, or disorders of the brain and / or eyes (e.g., Best's disease). In some embodiments, the subject has or is suspected of having one or more conditions, diseases, and disorders disclosed herein (e.g., Best's disease). In some embodiments, the subject has one or more endogenous variant BEST1 alleles (e.g., associated with or causing a disease or disorder of the eye or retina). In some embodiments, the subject has at least one autosomal dominant variant BEST1 allele (e.g., it causes Best's disease). In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate. Non-human examples of primates include macaques (e.g., crab-eating macaques or rhesus macaques), marmosets, tamarins, spider monkeys, night monkeys, savanna monkeys, squirrel monkeys, baboons, gorillas, chimpanzees, and orangutans. Other examples include domesticated animals such as dogs and cats, livestock such as horses, cattle, pigs, sheep, goats, and chickens, and other animals such as mice, rats, guinea pigs, and hamsters.
[0058] In some embodiments, the dose of rAAV particles administered to a cell or subject is 10 6 ~10 14 particles / mL or on the order of 10 3 ~10 15 particles / mL, or any value between those of any range (e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 particles / mL, etc.). In one embodiment, more than 10 13 particles / mL of rAAV particles are administered. In some embodiments, the dose of rAAV particles administered to a subject is 10 6 ~10 14 vector genomes (vg) / mL or on the order of 10 3 ~10 15 vg / mL, or any value between those of any range (e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 vg / mL, etc.). In one embodiment, more than 10 13 vg / mL of rAAV particles are administered. The rAAV particles can be administered as a single dose or divided into two or more doses as may be required to achieve treatment of the particular disease or disorder being treated. In some embodiments, 0.0001 mL to 10 mL (as examples, 0.0001 mL, 0.001 mL, 0.01 mL, 0.1 mL, 1 mL, 10 mL) are delivered to the subject in one dose.
[0059] In some embodiments, the rAAV particle titer is 1×10 10 ~5×10 13The range is vg / ml. In some embodiments, the rAAV particle titer is approximately 1 × 10⁻⁶. 10 , 2.5×10 10 , 5×10 10 , 1 x 10 11 , 2×10 11 , 2.5×10 11 , 5×10 11 , 1 x 10 12 , 2.5×10 12 , 5×10 12 , 1 x 10 13 , 2.5×10 13 , or 5×10 13 It can be vg / mL. In some embodiments, the particle titer is 1 × 10⁻⁶ 10 It is less than vg / mL. In some embodiments, the rAAV particle titer is 1 × 10⁻¹⁴ 15 It is greater than vg / mL. In some embodiments, the rAAV particle titer is 5 × 10⁻¹⁴. 13 It is greater than vg / mL. In a specific embodiment, the rAAV particle titer is approximately 2 × 10⁻⁶ 11 or 2.5 × 10 11 In some embodiments, rAAV particles are administered via methods further described herein (e.g., subretinal or intravitreous).
[0060] rAAV particles can be administered as a single dose or divided into two or more doses as may be required to achieve treatment for the specific disease or disorder being treated. In some embodiments, 1 to 500 microliters of the composition described herein (including, for example, rAAV particles) are administered to one or both eyes of the subject. For example, in some embodiments, about 1, about 10, about 50, about 100, about 200, about 300, about 400, or about 500 microliters may be administered to each eye. However, it should be understood that in some embodiments, smaller or larger amounts may be administered.
[0061] If necessary, rAAV particles or nucleic acid vectors may be administered in combination with other agents, such as proteins or polypeptides or various pharmaceutically active agents (including systemic or topical administration of one or more therapeutic polypeptides, biologically active fragments, or variants thereof). In fact, given that additional agents do not cause significant adverse effects upon contact with target cells or host tissues, there are virtually no limitations on the other components that may be included. Thus, rAAV particles may be delivered with a variety of other agents as required in particular cases. Such compositions may be purified from host cells or other biological sources, or alternatively, chemically synthesized as described herein.
[0062] In other aspects, the disclosure provides formulations of one or more plasmids encoding the shRNA disclosed herein in pharmaceutically acceptable solutions, either alone or in combination with one or more other modalities of treatment, for administration to cells or animals, and, in particular, for the treatment of human cells, tissues, and diseases occurring in humans. The disclosure also provides methods for administering the plasmids encoding the shRNA disclosed herein. Exemplary methods included methods for administering plasmids to mammals (e.g., humans).
[0063] In some embodiments, the disclosed plasmid formulations for administration to mammals (e.g., humans) comprise a DNA plasmid vector in phosphate-buffered saline (PBS). The vector concentration may be between 1 mg / ml and 3 mg / ml. In one embodiment, the concentration is approximately 2 mg / ml. In other embodiments, the concentrations are approximately 1.6 mg / ml, approximately 1.7 mg / ml, approximately 1.75 mg / ml, approximately 1.8 mg / ml, approximately 1.85 mg / ml, approximately 1.9 mg / ml, approximately 1.95 mg / ml, approximately 2.05 mg / ml, approximately 2.1 mg / ml, or approximately 2.15 mg / ml.
[0064] Pharmaceutically acceptable formulations of excipients and carrier solutions are well known to those skilled in the art, as is the development of suitable drug administration and treatment plans for using the specific compositions described herein in a variety of treatment plans, including, for example, oral, parenteral, intravenous, intranasal, intra-articular, and intramuscular administration and formulations.
[0065] Typically, these formulations may contain at least about 0.1% of the therapeutic agent (e.g., rAAV particles or plasmids) or more, although the percentage of the active ingredient(s) can naturally vary, and for convenience, may be between about 1 or 2% and about 70% or 80% or more of the total weight or volume of the formulation. Naturally, the amount of therapeutic agent(s) (e.g., rAAV particles) in each therapeutically useful composition can be prepared so that a suitable dosage is obtained at any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, shelf life of the product, and other pharmacological considerations are contemplated by those skilled in the art preparing such pharmaceutical formulations, and therefore, a variety of dosages and treatment plans may be desired.
[0066] In certain circumstances, it is desirable to deliver the shRNA, vector, or rAAV particles described herein by any of the following means: subcutaneously, intraocularly, intravitreously, parenterally, subcutaneously, intravenously, intraventricularly, intramuscularly, intrathecally, orally, intraperitoneally, orally or nasally inhaled, or by direct injection into one or more cells, tissues, or organs using a suitably formulated pharmaceutical composition disclosed herein.
[0067] The pharmaceutical forms of compositions suitable for injectable use (including, for example, shRNA, vectors, or rAAV particles as described herein) include sterile aqueous solutions or dispersions. In some embodiments, the form is sterile and fluid to the extent that easy syringability is present. In some embodiments, the form is stable under manufacturing and storage conditions and is preserved against microbial contamination such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, saline, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and / or vegetable oils. Adequate fluidity may be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of a dispersion, and by the use of a surfactant.
[0068] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle to which the shRNA, vector, or rAAV particles described herein are administered. Such pharmaceutical carriers may be sterile liquids, including water and oils, such as petroleum oils like mineral oil, vegetable oils like peanut oil, soybean oil, and sesame oil, animal oils, or synthetic oils. Saline solutions and aqueous dextrose and glycerol solutions may also be used as liquid carriers.
[0069] The compositions of this disclosure can be delivered to the eye via various routes. They can be delivered intraocularly by topical application to the eye, or intraocularly by, for example, intravitreal (intravitreal injection) or subretinal (subretinal injection) interphotoreceptor space. In some embodiments, they are delivered to rod photoreceptor cells. Alternatively, they can be delivered topically by insertion or injection into the tissues surrounding the eye. They can be delivered systemically via oral routes, or by subcutaneous, intravenous, or intramuscular injection. Alternatively, they can be delivered using catheters or grafts, such grafts being porous, nonporous, or gelatinous materials, and including membranes such as silastic membranes or fibers, biodegradable polymers, or proteinaceous materials. They can be administered, for example, during ocular surgery, or immediately after the onset of a disease, or during the onset of acute or prolonged symptoms, or before the onset of symptoms to prevent their onset.
[0070] For the administration of injectable aqueous solutions, for example, the solution may be suitably buffered as needed, and the liquid diluent may first be isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, intravitreous, subcutaneous, and intraperitoneal administration. In this regard, the sterile aqueous media that can be used will be known to those skilled in the art in light of this disclosure. For example, one dose can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection solution, or injected into the proposed injection site (see, e.g., Remington's Pharmaceutical Sciences, 15th edition, pp. 1035-1038 and 1570-1580). Depending on the condition of the subject being treated, some variation in the dose will inevitably occur. In any case, the person responsible for administration will determine the appropriate dose for each individual subject. Furthermore, for administration to humans, the preparation should meet sterility, pyrogenicity, and general safety and purity standards (as required, for example, by FDA Office of Biologics standards).
[0071] Sterile injectable solutions can be prepared by incorporating the shRNA, vector, or rAAV particles described herein, along with several other components listed above as needed, in the required amounts in a suitable solvent, followed by filtration sterilization. Generally, dispersions are prepared by incorporating various sterile active ingredients into a sterile vehicle containing a basic dispersion medium and other necessary components from those listed above. For sterile powders for the preparation of sterile injectable solutions, preferred preparation methods are vacuum drying and freeze-drying techniques, which produce powders of the active ingredients and any additional desired components from a pre-sterile filtered solution.
[0072] The amount of a composition (including, for example, the shRNA, vector, or rAAV particles described herein) and the duration of administration of such composition are within the scope of those skilled in the art who benefit from this teaching. However, the administration of a therapeutically effective amount of the disclosed composition may be achieved by a single dose, such as a single injection of a sufficient number of rAAV particles to provide therapeutic benefit to a patient receiving such treatment. Alternatively, depending on the circumstances, it may be desirable to provide multiple or consecutive doses of the composition over a relatively short or relatively long period, as may be determined by the physician supervising the administration of such composition.
[0073] In some embodiments, rod cells remain structurally intact and / or viable when BEST1 gene expression in the cell is silenced. In some embodiments, rod cells in which BEST1 gene expression is silenced may have a shortened outer segment that would normally contain BEST1. In some embodiments, the length of the outer segment may be maintained or restored (e.g., partially or completely) using an exogenously added (hardened) BEST1 gene, and its expression may be resistant to silencing using the compositions described herein.
[0074] As used herein, “to treat” a disease means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder (e.g., Best’s disease) experienced by the subject. The compositions described above are typically administered to the subject in an effective amount, i.e., an amount capable of producing the desired result. The desired result will depend on the activator administered. For example, an effective amount of rAAV particles may be the amount of particles capable of transferring heterologous nucleic acids to a host organ, tissue, or cell.
[0075] The toxicity and efficacy of the compositions used in the manner of disclosure may be determined by standard pharmaceutical procedures using either cultured cells or experimental animals to determine the LD50 (the dose that is lethal to 50% of the population). The dose ratio between the therapeutic index of toxicity and efficacy can be expressed as the LD50 / ED50 ratio. Compositions exhibiting a large therapeutic index are preferred. While those exhibiting toxic side effects may be used, care should be taken to design a delivery system that minimizes the potential damage of such side effects. The dosages of the compositions described herein generally fall within the range containing an ED50 that is little to no toxicity. Dosages may vary within this range depending on the dosage form used and the route of administration utilized.
[0076] Without further detail, those skilled in the art will be able to make the most of this disclosure based on the above description. Accordingly, the following specific embodiments should be construed as merely illustrative and not to limit the remainder of the disclosure in any way. All publications referenced herein are incorporated by reference for the purposes or subjects referenced herein.
[0077] example Example 1 Early retinal pathology at the RPE-PR interface. To understand the pathophysiology behind impaired RPE-PR interactions, we evaluated cBest retinas with clinically evident disease. Key features of the RPE apical membrane involved in direct interaction with the PR OS were investigated by immunohistochemistry (IHC) against EZRIN, a membrane-cytoskeletal linker protein essential for RPE apical MV formation, combined with human cone arrestin (hCAR) and peanut agglutinin lectin (PNA) labeling to distinguish cone-PR matrix-specific interfaces. Analysis of confocal microscopy and 3D reconstructed images of wild-type (WT) retinas revealed complex sheet-like structures of cone and rod-associated MVs, both intrinsic components of the RPE apical membrane. Cone-MVs (also known as RPE apical cone sheaths) were more prominent than rod-MVs, forming highly organized wrappings that connected individual cone lateral segments (COS) to the RPE apical surface (Figure 1A). In the subretinal space, this intercellular complex was further surrounded by a similarly complex cone-specific insoluble extracellular matrix sheath (cone-IPM), detected by selective binding of PNA lectin (Figure 1A). However, in affected cBest retinas, this complex extracellular compartmentalization of COS was lost, and the absence of the microvilli sheath led to hypertrophied RPE cells overloaded with lipofuscin granules and impaired insoluble cone-IPM (Figure 1B). These findings were examined in both the tapetum and non-tapetum portions of the retina of 22 eyes (ranging from 45 to 270 weeks of age) after the onset of the disease, using three different cBEST1 genotypes (R25). * / R25 * , P463fs / P463fs, and R25 * Confirmed in / P463fs)
[0078] To assess the potential for structural cone-MV abnormalities to secondary to cone dysfunction and disease, we investigated RPE-COS interactions in different canine IRD models (primary cone photoreceptor channel disease, CNGB3-associated color blindness). The RPE-COS complex was first examined at 6 weeks of age. CNGB3 mutant retinas containing either missense mutations or locus deletion mutations did not show apparent irregularities at the RPE-PR interface, and proper localization of RPE apical markers was associated with specific anti-BEST1 labeling (Figures 6A and 6B). Double immunostaining revealed a specific distribution of EZRIN along cone-MVs mating with hCAR-positive but CNGB3-negative COS. As a result of CNGB3 channel subunit dysfunction in older (57 and 85 weeks of age) mutant retinas undergoing gradual cone PR degeneration, the microvilli sheath at the RPE apex remained largely intact (Figures 6C and 6D).
[0079] Findings in CNGB3 mutant retinas suggested that the cone-MV sheath-related structural changes in cBest are specific to RPE channel disease caused by BEST1 mutations, rather than being secondary to cone defects. These experiments focused on 6 weeks of gestation, well before the onset of clinical disease in dogs and near the end of postnatal retinal differentiation (Figures 1C and 1D). In contrast to same-age WT controls, the absence of specific basal BEST1 immunolabeling in cBest RPEs was associated with a considerably smoother apical surface and clearly underdeveloped (vestigial) apical microvilli (Figure 1C, arrows). Quantification of cone-MV spatial density and cone-MV and rod MV lengths was performed using deconvoluted 3D Z-stack projection images at four retinal locations (Figure 1D). Significant differences in the mean number of cone-MVs (P<0.0001) were observed between cBest and WT in each retinal region examined (Figure 1D). While the number of cone photoreceptors was comparable to the control, cone-MVs in cBest were far fewer in number, more sparsely distributed, consistently shorter, and much finer than in the control, regardless of their tissue distribution. In control (WT) eyes, the average length of cone-MVs was 17.4 (±0.25) μm in the superior temporal quadrant of the tapetum and 12.3 (±0.23) μm in the inferior non-tapetum retina, while the length of rod-MVs was 6.7 (±0.11) μm and 5.3 (±0.27) μm in the tapetum and non-tapetum portions of the retina, respectively. However, in cBest, the average length of identified rare cone-MV extensions was significantly reduced (6.0±0.31 and 6.5±0.74 μm in the inferior portions of the central tapetum and non-tapetum, respectively). cBest's quantitative evaluation of minute rod-MVs exceeded the limits of optical resolution.
[0080] The cBEST1 mutant eye has microdetachments throughout the retina that expand with exposure. To determine the in vivo correlation of early RPE-PR interface abnormalities detected by IHC, we evaluated cBest eyes of young age well before ophthalmoscopic lesions were detected using non-invasive imaging by optical coherence tomography (OCT). Qualitatively, the central retina of all evaluated eyes showed an additional low-scattering layer in the lateral retina located distal to the outer granular layer (ONL), which was not detected in WT eyes (Figure 2A, arrows and double arrows). Unexpectedly, the low-scattering layer varied when repeatedly recorded in the same eye within a single experimental session. Further analysis revealed that the width of the low-scattering layer was wider in scans obtained towards the end of the imaging session when the retina was exposed to greater retinal irradiance due to intervening autofluorescence imaging performed with bright short-wavelength light (Figure 2A, double arrows, more LA). The width of the low-scattering layer was smaller in scans obtained early in the imaging session before autofluorescence imaging was performed (Figure 2A, arrows, less LA).
[0081] Quantitative studies were conducted by acquiring longitudinal reflection profiles and performing measurements at both nasal and temporal retinal locations. WT eyes (n=12, 15–17 weeks old) showed high scattering peaks in the outer retina at the outer plexiform layer (OPL) and outer limiting membrane (ELM), with an intervening low scattering layer defined as ONL (Figure 2B). Distal to the ELM, there was a high scattering peak corresponding to the junction between the medial and lateral segments of the photoreceptor (IS / OS), a major peak occurring near the RPE-tapetum interface (RPE / T), and a few intervening high scattering peaks corresponding to the photoreceptor OS tip (often difficult to resolve) (Figure 2B). An abnormal low scattering layer (Figure 2B, arrow) was detectable in cBest eyes (n=6, 11 weeks old) with less exposure. With greater exposure, the low scattering layer became deeper and more distinct (Figure 2B, double arrow). Both nasal and temporal retinal locations showed the same effect. The distance between the IS / OS peak and the RPE / T peak (Figures 2A and 2B, arrows) was measured. In WT eyes, the distance was 41.3 (±4.5) μm, but in cBest eyes, this distance was significantly larger for the nasal and temporal retinal regions at 46.8 (±6.7) μm and 45.2 (±6.8) μm (less exposure) and 55.8 (±10.5) μm and 53.5 (±6.3) μm (more exposure), respectively (P<0.001) (Figure 2C).
[0082] To better understand the function of exposure as a function of the low-scattering layer thickness, two types of experiments were conducted. In the main experiment (WT, n=12, 15-17 weeks old; cBest, n=3, 13 weeks old), the eyes were dark-adapted overnight, and then continuous imaging in the dark was performed for 2 hours with five intervening short exposures at 488 nm with gradually increasing intensity, ranging from extremely dim to moderate light generated by standard clinical ophthalmic equipment (Figure 2D). In a shorter experimental protocol, only the two highest exposures were used in different eyes (cBest, n=3, 13 weeks old). After dark adaptation overnight, the IS / OS-RPE / T distance was 40.0 (±4.5) μm in WT eyes and 47.1 (±4.8) μm in cBest eyes (Figure 2E). The difference was statistically significant (P<0.001). Increasingly brighter exposure resulted in a monotonic expansion of the IS / OS-RPE / T distance in cBest eyes, reaching an apparent plateau of 59.4 (±8.7) μm (Figure 2E). In WT eyes, the effect of exposure was either negligible or small, and the IS / OS-RPE / T distance reached a plateau of 40.9 (±4.3) μm. Thus, exposure to light appeared to induce acute retinal microdetachment of up to 18.4 (±8.7) μm in cBest eyes within minutes of age prior to any detectable ophthalmoscopic findings. The light-mediated microdetachment resolved over a period of less than 24 hours (Figure 7).
[0083] In preparation for local gene therapy, the retinal distribution of light-driven microdetachments was evaluated in fully light-adapted cBest and WT eyes (Figure 2F). The mean IS / OS-RPE / T distance across all WT eyes (n=4, 104 weeks old) was relatively uniform in the superior and inferior retinal regions, with a clear boundary corresponding to the transition between the tapetum retina and the pigmented (non-tapetum) retina. The greater distance to the tapetum retina in WT eyes may be due to differences in the major factors for high scattering peaks (tapetum vs. pigmented RPE in the tapetum retina). (R25) *In the mutant eye (P463fs), there was a remarkably clear retinal detachment in the foveal-like region, in addition to relatively diffuse microdetachments throughout the retina (Figure 2F, shown in darker colors). In the young cBest eye (P463fs / P463fs) at 12 weeks of age, ophthalmoscopic abnormalities were not apparent, but there was a distinct band of large microdetachments along the visual streak and surrounding the optic disc. A difference map between the mutant eye and the mean WT showed the spatial distribution of the degree of microdetachment (Figure 2F, right).
[0084] To assess potential adverse events for photoreceptors, ONL thickness was tissue-distributed across the retinal region with microdetachment (Figures 8A and 8B). Microdetachment did not result in the thinning of ONL expected from photoreceptor degeneration. Instead, cBest ONLs tended to be more uniformly thickened than WT ONLs. The super-thickened regions typically included the central-superior tapetum retina but sometimes extended into the inferior non-tapetum retina (Figure 8A). Importantly, microscopic examination of the super-thickened ONL regions revealed a number of PR nuclei comparable to those of the control. This suggests an expansion of internuclear spacing as a possible cause of the super-thickened ONLs observed by imaging.
[0085] The natural course of canine vestrofinopathy. As a prerequisite for evaluating the outcomes of gene therapy, the natural course of cBest was determined from a group of 18 dogs [12 males (M) and 6 females (F); ranging from 6 to 297 weeks of age] (Table 1). cBest dogs were continuously monitored by ophthalmoscopic examination and non-invasive imaging to detect the earliest onset of the disease and to understand the progression of the disease. Based on systematic in vivo imaging, the first signs of the disease were detected as early as 11 weeks of age (mean 15 weeks of age) as a slight localized retinal elevation in the canine foveal-like region (Figure 9A). This discrete separation of the photoreceptor layer from the underlying RPE progressed to form a larger subretinal macrodetachment (yolk-like lesion), evident in frontal and corresponding OCT scans at 23 weeks of age (Figure 9B). This discrete RPE-PR detachment, although not prominent in frontal imaging, was found to be consistent among the cBest eyes examined (n=34), regardless of genotype. From the asymptomatic stage, the disease progressed to form a macrodetachment (yolk-like stage) confined to the canine fovea and surrounded by microdetachments (Figure 3A, left panel). The primary lesion gradually evolved to manifest as a characteristic vesicular detachment within the foveal cortex of the retina, including a foveal-like region (Figure 3A, center and right panels, and Figures 9B-9D). The presence of characteristic hyperautofluorescence was evident in the lower part of the lesion (Figure 3A, center inset panel; pseudohypopyometra stage). The advanced disease stage was associated with significant thinning of the ONL, accompanied by partial absorption and dispersion of hyperautofluorescent material within the central lesion (Figures 9E and 9F).
[0086] In all cases, continuous imaging continued (Table 1), cBest appeared bilaterally, and while the rate of progression varied, it almost always showed remarkable symmetry (Figure 3A and Figures 9A-9F). Total retinal detachment visible bilaterally remained confined to the central retina, or extracentral lesions became more widespread and scattered throughout, still showing a strong bias towards areas rich in central cones and associated with super-thick ONL. [Table 1-1] [Table 1-2] [Table 1-3]
[0087] Key: BSS, equilibrium salt solution; cBEST1, canine transgene; hBEST1, human transgene; Inj., injected; OD, right eye; OS, left eye; OU, bilateral; pi, post-injection; UnTx, untreated; vg, vector genome; WT, wild type. cBEST1 mutation: R25 * / R25 * p.Arg25Ter-homozygote; P463fs / P463fs, p.Pro463fs-homozygote; R25 * / P463fs, p.Arg25Ter / p.Pro463fs-compound heterozygote
[0088] Subretinal BEST1 gene enhancement therapy stably corrects the disease. To evaluate the proof-of-concept of AAV2-mediated subretinal gene enhancement therapy, 22 cBest eyes were injected with canine (cBEST1) or human (hBEST1) transgenes driven by the human VMD2 promoter at 27–69 weeks [0.1–5 × 10⁻¹⁰]. 11 Vector titer in the vector genome (vg) / mL range or equilibrium salt solution (BSS) control (Table 1). Maps of exemplary AAV vectors containing the hBEST1 and cBEST1 heteronucleotides used to construct the disclosed rAAV particles are shown in Figures 13 and 14, respectively. In cBest dogs exhibiting localized or multiple retinal detachment at various stages, AAV was injected into one eye and not the other, or AAV was injected into one eye and a control (BSS) was injected into the opposite eye. In three cases exhibiting multiple disease, AAV targeting the superior temporal quadrant was injected bilaterally, while the retinal region outside the surgical vesicles served as the internal control (Table 1).
[0089] A representative result was a compound heterozygous (R25) case in the right eye that received a subretinal injection of cBEST1 at 52 weeks of age, showing advanced central retinal detachment (EM356-OD) (Figure 3A). *(P463fs) was shown in dogs (Figure 3B, left panel), but not injected in the other eye (EM356-OS) (Figures 9A-9F). Both eyes were monitored clinically and by in vivo imaging. Reversal of disease was first evident in the injected eye at 4 weeks post-injection (pi) and maintained a long-lasting effect, as shown at 43 and 245 weeks pi (Figure 3B). In this and other cases of progressive disease showing extensive accumulation of autofluorescent material within subretinal macrodetachment (n=13 eyes), the high autofluorescence signal remained detectable for several months after AAV injection but gradually weakened over time (Figure 3B, inset panel). Based on non-invasive imaging, both localized and extracentral lesions within the AAV-BEST1 treatment area resolved at 4-12 weeks pi, and localized retinal reattachment remained stable thereafter (Table 1). None of the eyes treated with AAV showed evidence of inflammatory response, and longitudinal in vivo evaluation revealed no adverse effects on RPE or neuroretina.
[0090] Treatment via AAV with hBEST1 also resulted in reversal of lesions and long-term disease correction (n=13 eyes). cBest dogs (R25 * / R25 * Representative in vivo imaging results and IHC evaluations (Figures 3C and 3D) from the study eye (EMC3-OS) showed that the initial bilateral lesions present before treatment were AAV-hBEST1 (2×10). 11The lesions disappeared after treatment with vg / mL (Figure 3D), but the lesions in the contralateral control eye (EMC3-OD) that received BSS continued to enlarge (Figure 3C). Based on fundus examination, in the described cases and all others, transient retinal detachment associated with vector or BSS delivery resolved within 24–48 hours pi. However, the retinal lesions injected with BSS recurred as early as 1 week pi and progressed in line with the natural disease course (Figure 3C). This was in stark contrast to the AAV-treated eye, where both the initial and more advanced lesions resolved within the first 6 weeks after hBEST1 gene therapy, and the treated area remained disease-free thereafter (Figure 3D). Ophthalmic examination and IHC evaluation using RPE and PR-specific markers showed no adverse effects on the retina up to 207 weeks pi (Figures 3, 10 and 11). Of particular importance was the evaluation of retinal preservation pi, which revealed a significant recovery of retinal structures at the RPE-PR interface, including expansion of cone-MV and actin cytoskeleton rescue, corresponding to vesicular areas treated with vectors containing either canine or human BEST1 transgenes (Figures 3C and 3D, lower panel and Figures 10 and 11). No differences were observed between sexes in clinical photographs or responses to AAV-BEST1 treatment.
[0091] The retina was compared to wild-type control and untreated cBest eyes in three cBest models [cmr1(R25 * / R25 * ), cmr1 / cmr3(R25 * Cholesterols were stored after AAV-hBEST1 treatment with (P463fs) and cmr3 (P463fs / P463fs). Cholesterols in the best eye were treated with AAV-hBEST1 (2×10) at 27 weeks of age (cmr1), 45 weeks of age (cmr1 / cmr3), or 63 weeks of age (cmr3). 11(vg / mL) was injected and evaluated by IHC at 103, 51, or 207 weeks pi, respectively (Figure 10). No obvious abnormalities were detected within the treated area until 207 weeks pi. Note the apical dilation of the RPE protruding into the subretinal space in all treated eyes (EZRIN). Untreated cBest controls (rightmost panel) show absence of apical microvilli of the RPE, RPE hypertrophy (EZRIN, RPE65), and accumulation of lipofuscin granules within the RPE monolayer, along with autofluorescent deposits in the subretinal space.
[0092] A typical confocal microscope image shows the AAV-hBEST1 injection (2.5 × 10 11 cBest(R25) at 79 weeks (vg / mL) * Figure 11A shows the retina (P463fs) double-labeled with BEST1 (RPE, darker color) and SLC16A1 (RPE, lighter color). Figures 11B–11D show an overview of the cross-section from the surgical vesicle area (Figure 11B) through the adjacent border area (Figure 11C) to the adjacent area outside the injection zone (Figure 11D). As highlighted in the magnified images, a direct correlation was observed between the degree of restoration of the RPE-PR interface structure and the expression of the BEST1 transgene. Significant dilation of the RPE apical process within the treatment area with enhanced BEST1 was observed (Figure 11B); patchy distribution of BEST1 (weak red signal within individual RPE cells) and the presence of vestigial microvilli [c-MV (bright arrow) and rod-MV (darker arrow)] in the vesicular boundary areas associated with RPE-PR microdetachment (Figure 11C); and subretinal lesion formation in the absence of both BEST1 expression and the RPE apical process outside the treatment zone (Figure 11D). Scalloped and indeterminate RPE apical surfaces and large amounts of intracellular deposits appeared as granular aggregates within cBest mutant RPEs (Figure 11A, upper panel, uninjected; Figure 11D, magnified). In the detachment zone, cellular debris (stars) penetrating into the subretinal space corresponds to Müller glia, reflecting stress-responsive retinal remodeling. [Scale bars, 100 μm (top) and 10 μm (Figures 11A-11D).]
[0093] Correction of photo-controlled microexfoliation using gene therapy. To understand the outcomes of BEST1 gene enhancement therapy in retinal areas without retinal detachment detectable by ophthalmoscopic examination, the IS / OS-RPE / T distance was measured tissue-distributed both inside and outside subretinal vesicles. 。 cBest(R25 * Representative results from control subretinal BSS injection in 69-week-old dogs (P463fs) showed uniform microdetachment covering the entire retina as imaged at 87 weeks of age (Figure 4A). The mean microdetachment area (IS / OS-RPE / T distance in BSS-injected mutant dogs, subtracted from co-administered measurements performed in WT eyes) was 11.6 μm in the upper retina and 16.7 μm in the lower retina (Figure 4B), consistent with uninjected cBest eyes. On the other hand, subretinal AAV gene therapy resulted in a significant reduction in the IS / OS-RPE / T distance of the treatment area. EMC3-OS, EML4-OS, and LH21-OS showed a reduction of approximately 2 × 10⁻⁶. 11 The results for three genotypes treated with gene therapy using a human BEST1 transgene with a titer of vg / mL are shown (Figure 4A and Table 1). In all cases, there was a significant reduction in the IS / OS-RPE / T distance of the treated vesicles. Notably, total retinal detachment (darker color) was only detectable outside the treated area (Figure 4A). Quantitative measurements showed complete improvement of microdetachment, with the IS / OS-RPE / T distance returning to WT levels in both the upper and lower retinal regions treated with subretinal gene therapy (Figure 4B, filled symbols), but not in retinal regions away from the treated vesicles (Figure 4B, unfilled symbols).
[0094] The effective area of subretinal gene therapy is often shown to extend beyond vesicles formed at the time of surgery, including borderline areas. In cBest dogs that successfully received gene therapy, borderline areas were present, but appeared qualitatively larger than those typically encountered to date (Figure 4A). In some of the most extreme cases, a pre-treatment map of whole-retinal microdetachment was found necessary to indicate the extent of borderline expansion. For example, EML9-OD, at 29 weeks of age, showed whole-retinal microdetachment, most extreme along the line of sight, including several areas with total retinal detachment (Figure 4C). Gene therapy was performed at 69 weeks. At 87 weeks, the microdetachment across the entire imaged retina, as well as most of the total retinal detachment, had disappeared (Figure 4C), and quantitative measurements showed normal or thinner IS / OS-RPE / T distances in superior and inferior retinal locations (Figure 4D). Importantly, the IS / OS-RPE / T distance showed significant improvement in retinal locations corresponding to vesicles formed at the time of injection, as well as in the nasal retinal control region of the same eye. This extreme example of borderline expansion may be explained by greater diffusion of the vector via microdetachment in the cBest eye, resulting in RPE transduction at a substantially more distant site than the initial vesicle. For comparison, a more typical example using delimited borderline expansion is shown. A 37-week-old EML13-OS showed microdetachment throughout the retina, particularly prominent in the temporal retina and along the line of sight; there were also several total retinal detachments along the line of sight (Figure 4E). Gene therapy was performed at 45 weeks. At 81 weeks, both the superior and inferior temporal retina lacked microdetachment and macrodetachment, while the untreated nasal retina retained microdetachment and formed numerous macrodetachments (Figure 4E). Quantitative results confirmed the treatment effect did not reach the nasal retina, unlike EML9-OD (Figure 4F).
[0095] To understand the potential outcomes of gene therapy for retinal degeneration, ONL thickness was mapped across the treated eye (Figure 8B). Treated retinal areas showing disappearance of microdetachment also tended to correspond to normal ONL thickness, while untreated areas retaining microdetachment tended to show hyperthick, normal, or, in some areas, thinned ONL (Figure 8B). In summary, gene-enhancing therapy via AAV in canine vestrophinopathy appears to promote persistent reversal of total retinal detachment, re-establishment of close contact between RPE and PR, and return of ONL thickness to normal values.
[0096] Human autosomal recessive bethroffinopathy: structure and function. To facilitate the clinical translation of successful gene therapy in BEST1 mutant dogs, we conducted studies to better understand the human pathophysiology of autosomal recessive bethrofinopathy (ARB) and to gain insights into the distribution of disease throughout the retina beyond the total lesions detectable by ophthalmoscopic examination as described above. Data from two patients are shown (Figures 5A-5G): P1 was a 39-year-old female with a two-allelic BEST1 mutation (c.341T>C / c.400C>G) and best corrected visual acuity of 20 / 100, while P2 was a 36-year-old male with a two-allelic mutation in BEST1 (c.95T>C / c.102C>T) and visual acuity of 20 / 60. In both patients, the mutant alleles isolated from clinically unaffected parents. Ultrawide imaging of RPE health status utilizing the innate autofluorescence of lipofuscin granules contained therein revealed widespread and abundant abnormalities consisting of regions of relative high or low autofluorescence and localized heterogeneity. Notably, a clear transition zone (Figure 5A, arrow) was observed in the central peripheral retina of the nose, which distinguished the healthier nasal peripheral retina.
[0097] Rod and cone function were sampled at high density along the horizontal meridian to better understand the tissue distribution of visual acuity loss and its correspondence to retinal structural abnormalities. Both patients showed deep (>3log) loss of rod-mediated sensitivity in the central part of the long-term dark-adapted eye; there was relative conservation of rod function in the temporal lobe (nasal retina) of both patients and in the periapillary region of one patient (Figure 5B, upper panel). Surprisingly, cone-mediated function in the light-adapted eye showed only moderate loss (<1log) or normal or near-normal results (Figure 5B, lower panel). Rod and cone function sampled across the entire visual field validated and extended these findings, showing strong interocular symmetry (Figures 12A and 12B). Binocular rod-response-loss (RSL) and cone-response-loss (CSL) maps of two patients with ARB. The large, symmetrical central region of severe RSL was surrounded by relatively preserved function in the temporal lobe. The impact on cone function is relatively small, and the central visual line (CSL) is relatively uniform across the entire visual field. The physiological blind spot is shown as a black square at 12° in the temporal lobe.
[0098] Cross-sectional imaging using OCT was performed to evaluate retinal stacking abnormalities along the horizontal meridian traversing the fovea (Figure 5C). There was no consistent exposure history at the time of OCT imaging. Both patients showed significant loss and abnormalities of ONL at the level of the lateral retinal photoreceptor IS / OS across a large portion of the central retina. Furthermore, P2 showed detachment of the central retina from the intraretinal cystic space and RPE, likely due to subretinal fluid accumulation. Retinal stacking showed relative normalization in the perioptic region (Figure 5C, dark rectangle) and beyond the transition around the center of the nose (Figure 5C, light rectangle). Analysis of the two regions of interest showed detectable but abnormally thinned ONL, and detectable IS / OS and lateral cone segment tips (COST), which were accompanied by low peak signals in both patients (Figures 5D and 5E). In P1, the distance from ELM to IS / OS and the distance from IS / OS to COST were comparable to normal. A low-scattering layer appeared distal to COST, and the RPE appeared extremely thick (Figure 5D, center panel). In P2, the distance from ELM to IS / OS appeared shorter than normal, but the distance from IS / OS to COST was comparable to normal. The distance from COST to ROST / RPE appeared longer than normal due to the presence of an indistinct low-scattering layer; the RPE appeared to be of comparable thickness to normal (Figure 5D, right panel). Analysis of the lateral retina in the central peripheral region of the nose in P1 showed that the distances from ELM to IS / OS, IS / OS to COST, and COST to ROST / RPE were greater than normal, and the RPE thickness was comparable to normal (Figure 5E, center panel). The features of P2 appeared intermediate between P1 and normal (Figure 5E, right panel).
[0099] To understand the impact of structural abnormalities at the lateral retina and RPE levels on the dynamics of retinoid migration between these cell layers, dark adaptation tests were performed. At the peripapillary location shown in Figure 5D, the P1 dark adaptation threshold was rod-mediated but elevated by 1.3 log units (Figure 5F). By 22.5 minutes post-exposure, the P1 result remained cone-mediated on a plateau, but normal results were already within 1 log unit of the final dark adaptation threshold. By 50 minutes, the P1 rod result was still elevated by 1 log, but normal recovery was complete (Figure 5F). At the central peripheral nasal retina location shown in Figure 5E, the P2 dark adaptation threshold was rod-mediated and elevated by approximately 0.5 log units compared to normal results (Figure 5G). By 14.5 minutes post-exposure, there was initial evidence of rod function, which gradually slowed compared to the 11-minute cone-rod breakdown in normal results. The rate of rod recovery was similar to that of normal results (Figure 5G). In summary, the dark adaptation dynamics of P1 rods at the periphallic locus showed a very slow time course, while the dark adaptation dynamics of P2 rod function at the central locus were close to normal (Figures 5F and 5G).
[0100] RPE plays a crucial role in maintaining the metabolically active environment of the subretinal space. Due to its dynamic relationship with adjacent retinal layers, mutations in RPE-specific genes often adversely affect adjacent sensory neurons, leading to loss of visual function and PR degeneration. Mutations in BEST1 are known to disrupt transepithelial ion and fluid transport in response to abnormal levels of intracellular calcium. Abnormal RPE calcium signaling leads to Ca 2+ It is also thought that this can lead to dysregulation of other pathways through changes in the expression and interaction of sensitive proteins. Based on cBest findings, one such protein is EZRIN, a membrane-cytoskeletal linker essential for the formation and proper maturation of RPE apical MVs. Activation of EZRIN's membrane-F-actin crosslinking function leads to Ca 2+Developing directly in response to transients, Ezrin-KO mice have been shown to exhibit a significant reduction in RPE MV generation. The apparent underdevelopment of the RPE apical MV observed in BEST1 mutant RPE is consistent with these findings. Furthermore, comparative IHC assessments with other IRD models have shown that these major structural changes related to the microvilli sheath are specific to primary RPE channel disease caused by BEST1 mutations and are not secondary to pyramidal dysfunction and degeneration.
[0101] The structural elements of the apical processes of the RPE differ significantly from those of the non-motile intestinal microvilli. The presence of contractile proteins (such as myosin) in the apical microvilli of the RPE, as well as molecules typically found at cell attachment sites, suggests that the RPE actively attaches to the neuroretina and exerts tension. The lack of a proper microvilli sheath at the RPE-PR interface in cBest, and therefore the absence of physical and electrostatic support from these processes to the PR OS, would be expected to weaken adhesion and lead to the separation of the RPE-PR complex throughout the retina. The microdetachment of the PR layer from the underlying RPE observed in cBest in the earliest stages of disease would be consistent with this process. Furthermore, the presence of contractile elements in the apical processes of the RPE, and the fact that they evolved from cells from which pigment migration occurred, indicates that active contraction is possible while the MVs are mating with the PR OS, and that they are destined to promote circadian ecliptic activity. A single RPE cell can accommodate approximately 30–50 PRs, depending on its retinal location and packing density; the intricate network of microvilli allows each RPE cell to routinely handle such a high metabolic load. Insights from proteomics profiling support this argument. Numerous channel proteins and transporters (e.g., Na) are central to the efficient transport of water, ions, and metabolites between RPEs and PRs. + / K +Along with ATPase, there is an enriched fraction of retinoid processing proteins expressed along the apical MV of the RPE. Considering the tissue distributional differences in RPE cell size and the density and length of the MVs quantified in this study, MV expansion increases the functional surface of a single RPE cell 20-30 times in the central retina, which is consistent with previous estimates. This number is even higher (approximately 50 times) in smaller RPE cells in the macular region, which are adapted to a higher turnover rate of depleted POS while facing the most densely populated PR. Such a dramatic reduction in the total apical surface area of the BEST1 mutant RPE leads to a chronic delay in metabolite processing, halting the RPE's ability to maintain adequate cell volume as well as both chemical composition and physiological pH levels in the subretinal space. Since these factors are essential for retinal adhesion, limitations in the RPE transport system alter the hydrostatic balance, reducing the osmoelastic properties of the RPE-PR complex and subsequently causing separation from the neuroretina. Indeed, primary serous detachment in human and canine bestrophinopathy first manifests in the fovea, the central region of highest metabolic activity. The absence of a high-extension apical process of the retinal pleocele, tightly enclosing the cosine ossicles (COS) up to the ellipsoid in structurally intact retina, would explain the bias of this cone-rich structure towards primary detachment in bestrophinopathy. There would likely be an almost exclusive dependence on frictional interaction with the luminal membrane (MV). This is consistent with findings in cBest, which also document the formation of localized previtiligo-like lesions within the canine foveal-like region of the retinal foveal area, as well as the susceptibility of other central cone-rich regions (such as the line of sight) to subretinal detachment.
[0102] The primary expansion of microdetachment in cBest upon exposure to dim, moderate light intensity was an unexpected result. In normal eyes, exposure is known to alter the molecular composition of the subretinal space. There is also evidence that exposure causes measurable structural changes in the normal outer retina, including changes in the length of the outer segment, hydration of the subretinal space, increased actin staining along the apical MV of the RPE, and light directivity of the outer segment. However, all normal changes are significantly smaller than those measured in cBest. For example, compared to an approximately 18 μm dilation of the subretinal space driven by light in cBest, a normal human eye showed a change of approximately 1 μm, and a normal mouse eye showed a change of approximately 4 μm in the outer retina. Human ARBs are only recently recognized, and the literature on the earliest disease stages is limited. Recessive cBest disease appears to have phenotypic similarities to both dominant and recessive bethrofinopathy in humans. In patients with Best's disease (BVMD), there has been some controversy regarding the structural features of the retina in the vitelloid or late lesions, or in the pre-vitelloid stage of the disease. Some studies have shown minor abnormalities at the RPE-PR interface level, while results from others have not supported detectable structural defects. The cause of this controversy may be genotype, resolution of the various methodological approaches used, or light history preceding imaging. Indeed, light-dependent lateral retinal changes have been described in BVMD using methods such as those disclosed herein; however, the magnitude of the changes in patients was smaller than in cBest (approximately 2 μm). Nevertheless, in general, an abnormal response of the affected retina to light stimulation may be associated with a significantly reduced light peak / dark valley ratio on electrooculography (a consistent finding in all Best's disease patients, even those with Best's disease pre-symptomatic).
[0103] Importantly, both microdetachments and macrodetachments in cBest negatively impacted photoreceptor health: areas of microdetachment tended to correspond to ultrathickened ONL, while larger lesions with total macrodetachment showed thinning of the ONL. The sampling method used herein could not assess smaller lesions with macrodetachment. The ONL contains all rod and cone nuclei, and classical studies in animal models and human eye donors have generally shown that the ONL thins with disease progression. Some of the earliest stages of retinal disease that show ONL thickening are less known and have only become measurable through advances in in vivo imaging methods. Human studies have previously shown ONL thickening that occurs in the early stages of retinal disease. There is also evidence in animal studies of ONL thickening associated with retinal stress. When examined under a microscope, ultrathickened regions of mapped ONL in cBest showed a number of PR nuclei comparable to controls, suggesting larger internuclear spacing within the ONL, which may correspond to levels of retinal stress below the apoptotic threshold. On the other hand, total retinal detachment can cause greater retinal stress and progressive degeneration.
[0104] To prevent photoreceptor and vision loss associated with BEST1 mutations, subretinal gene augmentation therapy was performed targeting retinal areas with macro and microdetachment. Results showed that AAV-mediated BEST1 gene augmentation was safe, reversed clinically apparent lesions, improved diffuse microdetachment, and normalized hyperthickened ONL. Furthermore, gene therapy was successful in three different BEST1 genotypes with both localized and polysymptoms, confirming the long-term persistence of the treatment effect. At the molecular level, the canine and human BEST1 transgenes demonstrated the ability to correct the juxtaposition of the RPE-PR complex and restore the cellular architecture of this critical interface. This study suggests that early and more advanced stages of autosomal recessive disorders are prudent approaches to this therapy. Further research using human induced pluripotent stem cell (hiPSC)-derived RPE models from patients with autosomal Best1 mutations will determine whether gene augmentation approaches are also beneficial for BVMD patients.
[0105] To facilitate the clinical translation of successful gene-enhancing therapies, we studied ARB patients to gain insights into their whole-retinal disease. Consistent with most, though not all, previous descriptions, retinal disease in ARB patients extended far beyond the macula to the midperiphery. Frontal and cross-sectional imaging and retinal region mapping of rod and cone function revealed the presence of a clear transition from disease to health in the central peripheral retina, a feature not previously highlighted. Within the diseased area, severe abnormalities in retinal structure were associated with severe loss of rod function; surprisingly, cone function was relatively preserved. Rod dysfunction in the central retina was also associated with extreme delays in the retinoid cycle, while the healthier peripheral areas showed nearly normal retinoid recirculation. There are at least two retinoid cycles that provide the photoreceptor dye with 11-cis-retinal chromophores. The standard retinoid cycle functions in the RPE and produces rod and cone PR chromophores. On the other hand, the retinal retinoid cycle is thought to regenerate chromophores within the retina for specific use of cones. The abnormal RPE-PR interface in Best's disease is most likely to affect the delivery of chromophores from the standard RPE-retinoid cycle; the retinal retinoid cycle may be relatively unaffected, thus explaining the greater retention of cone function.
[0106] In summary, as disclosed herein, we have remarkably revealed the contribution of a novel molecule to the pathophysiology of betotrophinopathy at the RPE-PR interface. We discovered the earliest manifestation of the disease—diffuse microdeposition enhanced by exposure—which was readily detectable by in vivo imaging. BEST1-enhancing gene therapy via AAV reversed both the overall apparent lesions and microdepositions and restored the cellular buildup at the RPE-PR interface. Assessment of ARB patients showed retinal morphological distribution and structural and functional defect characteristics exceeding those expected from PR degeneration. Such visual impairment may be mitigated by the successful application of BEST1 gene-enhancing therapy to patients developing betotrophinopathy.
[0107] Example 2 The vector technology in Example 2 was designed to suppress the expression of endogenous BEST1 mRNA (both mutant and normal copies) using RNA interference. These vectors simultaneously replace endogenous BEST1 mRNA with normal BEST1 mRNA, producing only normal protein. The technology uses adeno-associated virus to deliver a small hairpin RNA (shRNA) gene, in addition to an intron-free copy of the BEST1 gene, leading to the generation of small interfering RNA (siRNA). The BEST1 gene is resistant to siRNA because it has a silent mutation in its leading frame. Two shRNAs, and therefore two modified human BEST1 genes, were designed. Both BEST1 genes are driven by a 623bp fragment of the human VMD2 promoter. The BEST1 cDNA has a synthetic intron before it, followed by a polyadenylated sequence, both derived from the SV40 virus. In one case, shRNA05 is driven by the RNA polymerase III (pol III) H1 promoter, and in the other case, shRNA744 teeth Driven by the pol III U6 promoter, six thymidine sequences function as stop sequences for each shRNA. Nine potential siRNA or shRNA sequences were screened to identify these active shRNAs.
[0108] The gene sequence encoding shRNA is as follows: [ka] Figures 15 and 16 show maps of an exemplary AAV vector containing the hBEST1 gene, which includes heterologous nucleic acids encoding shRNA05 and shRNA744, as well as a detargeting sequence (e.g., one of sequence numbers 10 or 11) used to generate the disclosed rAAV particles. Both sequences are driven by the VMD2 promoter.
[0109] In some embodiments, the disclosure provides an shRNA05 sense strand comprising the nucleotide sequence of SEQ ID NO: 2, plus an additional nucleotide immediately preceding the first cytosine in that sequence. In some embodiments, this additional nucleotide comprises cytosine (C). In some embodiments, the disclosure provides shRNA05 comprising an antisense strand containing the nucleotide sequence of SEQ ID NO: 3.
[0110] The following are example gene sequences corresponding to the regions of the vector encoding the pol III H1 promoter, shRNA05, and the stop sequence: [ka] (Sequence ID 20). This sequence further includes a BamHI endonuclease site (ggatcc) to facilitate screening and ensure that the start site of shRNA05 is located 25 nucleotides downstream of the H1 promoter TATA box (TATAA). Thus, in some embodiments, shRNA encoded by nucleic acids containing this sequence (and / or its complements) (e.g., shRNA05) is transcribed in host cells (e.g., in subjects, e.g., human subjects, treated with a vector). In some embodiments, two or more different shRNAs (e.g., having different start and / or stop sites, e.g., different from shRNA05 by one or two additional or fewer nucleotides) are transcribed in host cells.
[0111] Figure 17 shows that the VMD2 promoter functions well in cell culture. HEK293T cells were transfected with plasmids expressing GFP or Best1 using either the chicken beta-actin promoter (CBA) or the VMD2 promoter. Protein lysates were isolated on polyacrylamide gel, and Best1 expression was detected by Western blotting, normalized to beta-tubulin expression to show uniform gel loading. Figures 18A and 18B show that Best1-specific siRNA is functional. Transfection of HEK293T cells stably expressing BEST1 resulted in a 75% reduction in Best1 protein. 20 nM siRNA was used. death,Cells were analyzed 48 hours after transfection. Western blot (Figure 18A) and BEST1 knockdown were compared by standardization of band intensity between Best1 and tubulin (Best1 / tubulin) (Figure 18B). Figures 19A and 19B show that Best1 shRNA is active: HEK293T-BEST1 cells were transfected with 4 μg of the indicated plasmid. Cells were harvested 48 hours after transfection. BEST1 expression was determined by Western blot (Figure 19A). BEST1 knockdown was compared by standardization of band intensity between Best1 and tubulin (Best1 / tubulin) (Figure 19B). Figure 20 shows detargeting of Best1. The siRNA target site was removed from Best1 mRNA using silent mutation (base change at the third position of the codon). The disclosed example is for shRNA744. Sequence IDs 15-17 correspond to the top-to-bottom sequence.
[0112] material and method Canine BEST1 model and in vivo retinal imaging. Homozygous (c.73C>T) (p.R25 * / R25 * ) or (c.1388delC)(p.P463fs / P463fs) or cBEST1(GB * Nearlelic (c.73C>T / 1388delC) of NM_001097545 (p.R25) *The study included 18 (n=18) bisexual (12M and 6F) cBest mutant dogs carrying one of the / P463fs) mutations. For ease of annotation in the multi-panel figures, the three genotypes are referred to as cmr1, cmr3, and cmr1 / cmr3, respectively. The study was performed in comparison with control hybrid dogs (n=12; 7M and 5F) (Table 1). All animals were housed and maintained at the Retinal Disease Research Facility (RDSF). The study was conducted in strict accordance with the recommendations of the NIH Guidelines for the Management and Use of Laboratory Animals and in accordance with the Statement of the Society for the Study of Vision and Ophthalmology on the Use of Animals in Ophthalmic and Vision Research. The protocol was approved by the Institutional Animal Management and Use Committee of the University of Pennsylvania (IACUC numbers 804956 and 803422). Frontal and retinal cross-sectional imaging was performed using dogs under general anesthesia as described above.
[0113] Human subjects. Light adaptation and dichromatic dark adaptation functions were measured at 2° intervals across the entire central visual field (central 60° along horizontal and vertical meridians) and at 12° intervals across the entire visual field. Photoreceptor mediation under dark adaptation conditions was determined by the difference in sensitivity between stimuli at 500 nm and 650 nm. Dark adaptation dynamics were evaluated using short-duration (30-second) moderate exposures from an LED-based dark acclimatometer (Roland Consult) and a clinical short-wavelength autofluorescence imaging device (25% laser power; Spectralis HRA; Heidelberg Engineering), similar to previously described techniques (92-94). Optical coherence tomography (OCT) was used to analyze the layered structure of the entire retina. Retinal cross-sections were recorded using a spectral domain (SD) OCT system (RTVue-100; Optovue). Post-acquisition data analysis was performed using a custom program (MATLAB 7.5; MathWorks). Recording and analysis techniques were previously described (30, 31, 94). Longitudinal reflection profiles (LRPs) were used to identify retinal features. Using a confocal scanning laser ophthalmoscope (Spectralis HRA; Heidelberg Engineering), frontal images were recorded as previously described (95), and RPE health was estimated using short-wavelength low-light autofluorescence imaging (SW-RAFI). All images were acquired in fast mode (30° × 30° square field or 50° circular field).
[0114] Canine BEST1 model and in vivo retinal imaging. To depict fundus features such as the optic nerve, retinal vessels, injection vesicle boundaries, retinal incision sites, and other localized changes, overlapping frontal images with near-infrared illumination (820 nm) reflectance were acquired using 30° and 55° diameter lenses (Spectralis HRA + OCT). Individual images were digitally stitched into a panoramic view of the entire retina using a custom program (MATLAB 7.5; MathWorks). Short-wavelength autofluorescence and reflectance imaging were used to contour the boundaries of the tapetum and pigmentary RPE. Spectral domain optical coherence tomography (SD-OCT) was performed using overlapping (30° × 25°) raster scans over a wide area of the retina. Post-processing of OCT data acquisition was performed using a custom program (MATLAB 7.5). For tissue distributional analysis of the entire retina, the combined backscatter intensity of each raster scan was used to pinpoint the precise location and orientation of retinal features displayed in the mosaic of the entire retina formed by near-infrared reflection (NIR) images. Each individual LRP forming all registered raster scans was assigned to regularly spaced bins (1°×1°) in a Cartesian coordinate system centered on the optic nerve; the LRPs in each bin were adjusted and averaged. Peaks and boundaries within the retina corresponding to the OPL, ELM, IS / OS, and RPE / T were segmented using both intensity and gradient information of the backscatter signal along each LRP. A tissue distribution map of ONL thickness was generated from the distance from OPL to ELM, and a thickness map from IS / OS to RPE / T was generated from the distance between these peaks. For all tissue distribution results, the locations of blood vessels, optic disc, vesicles, tapetum junction, and foveal-like regions (24) were superimposed for reference. First, the WT dog map was registered at the center of the optic disc and rotated to match the foveal-like region to derive the mean WT tissue distribution map. The foveal-like region in cBest mutant dogs was determined by superimposing a WT template onto the mutant eye based on the alignment of the optic disc, major superior vessels, and tapetum lucidum boundaries. Next, the cBEST1 mutant map was registered to the WT map with respect to the optic nerve center and the estimated foveal-like region, and a difference map was derived. The difference map was sampled both inside and outside the treatment vesicle in each eye.The relationship between light exposure and changes in the outer retinal structure was evaluated using two approaches. In a subset of eyes, cross-sectional OCT imaging was performed at the beginning of each experimental session, first with autofluorescence imaging using bright short-wavelength light, followed by further OCT imaging. While it was not possible to quantify the exact exposure from the OCT records acquired at the beginning of such sessions, they were thought to be from a retina exposed to less light compared to records acquired later. In another subset of eight eyes, OCT recordings were performed after overnight dark adaptation, sequentially in a dark room following short intervals of short-wavelength exposures from cSLO. Three eyes used five increasingly larger exposures: L1: laser, 20%; duration, 60 seconds; L2: laser, 25%; duration, 30 seconds; L3: laser, 50%; duration, 30 seconds; L4: laser, 100%; duration, 30 seconds; L5: laser, 100%; duration, 300 seconds. Three eyes used only L4 and L5. In two additional eyes, only L5 was used to track the recovery of microdetachments via light over 24 hours. The standard (100%) laser setting is estimated to correspond to a human retinal irradiance of 330 μW·cm⁻² at a wavelength of 488 nm (98). In both approaches, the areas selected for analysis were based on near-infrared imaging of the fundus by cSLO prior to the start of the study, excluding areas where clinically evident macrodetachments were located.
[0115] Subretinal injection and postoperative procedures. Recombinant AAV2 / 2 delivering either the cBEST1 or hBEST1 transgene under the control of the human VMD2 promoter (46) was administered under general anesthesia according to previously published procedures (46, 82, 97). Vector preparation and validation have been described in detail previously (46). The injection volume of the viral vector solution ranged from 50 to 180 μL (titer range 0.1 to 5 × 10⁶). 11(vg / mL) (Table 1) was delivered subretinally using a custom-modified RetinaJect subretinal syringe (SurModics) (97) under direct visualization by surgical microscope via a transvitreous approach without vitrectomy. Anterior chamber puncture was performed immediately after injection to prevent an increase in intraocular pressure. Subretinal vesicle formation was recorded immediately after injection by fundus photography (RetCam Shuttle; Clarity Medical Systems). In all cases, the surgical vesicles flattened and the retina reattached within 24–48 hours pi. Ophthalmic examinations, including biomicroscopy, indirect ophthalmoscopic examination, and fundus photography, were performed regularly throughout the time interval from injection to endpoint evaluation (24 hours, 48 hours, and 5-day pi, then weekly for the first two months, followed by monthly ophthalmic examinations thereafter). Postoperative management was performed as previously described (46).
[0116] Histological and immunohistochemical evaluation. Eye tissue for ex vivo analysis was collected as previously described (24, 99). Every effort was made to improve animal welfare and minimize discomfort. In all ex vivo evaluations, cBest and control (WT) eyes were fixed with 4% paraformaldehyde, embedded in a medium at the optimal cutting temperature, and processed as previously reported (99). Histological evaluation was performed using standard hematoxylin / eosin (H&E) staining, and all immunohistochemical experiments were performed on 10 μm thick frozen sections according to established protocols (46, 99). Briefly, retinal frozen sections were permeabilized with 1×PBS / 0.25% Triton X-100, blocked at room temperature for 1 hour, and incubated overnight with primary antibody (Table 2). For multicolor labeling, the primary antibody was combined with Alexa Fluor 488 phalloidin (Thermo Fisher Scientific) or PNA-AF647 (L32460; Molecular Probes), followed by incubation with the corresponding secondary antibody (Alexa Fluor) for 1 hour. Slides were examined using epifluorescence or transmission light microscopy (Axioplan; Carl Zeiss Meditec), and digital images were collected with a Spot 4.0 camera (Diagnostic Instruments). [Table 2]
[0117] Confocal microscopy and image analysis. Confocal images were acquired using a TCS-SP5 confocal microscope system (Leica Microsystems) or an A1R laser scanning confocal microscope (Nikon Instruments). To obtain cone-associated MV (cone-MV) counts, two adjacent fields with a length of 155 μm were used for each region of interest (ROI) in 6-week-old cBest(R25) microscopy. *Images were acquired at 4 mm from the optic nerve head in 10 retinal sections (n=80 ROI / eye) per retinal quadrant (temporal, superior, inferior, and nasal) of both eyes from WT controls of the same age (P463fs). Image stacks were acquired with 0.25 μm Z-steps and deconvolved using Huygens deconvolution software version 17.04 (Scientific Volume Imaging). All deconvolved images were rendered using the Leica LAS X 3D rendering module, and cone-MVs were manually counted. The lengths of both cone-MVs and rod-MVs were assessed within the Leica LAS X software from the maximum projection image. Data were analyzed in Microsoft Excel and quantified using Prism software version 7 (GraphPad).
[0118] References [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8]
[0119] Other embodiments All features disclosed herein can be combined in any combination. Each feature disclosed herein can be replaced by an alternative feature that serves the same, equivalent, or similar purpose. Thus, unless otherwise specified, each feature disclosed is merely an example of a general series of equivalent or similar features. From the above description, those skilled in the art will readily identify the essential features of this disclosure and may make various changes and modifications to the disclosure to suit various uses and conditions without departing from its spirit and scope. Therefore, other aspects are also included in the claims.
[0120] Equal portions While several embodiments of the invention are described and explained herein, those skilled in the art will readily grasp a variety of other means and / or structures for carrying out the functions and / or obtaining the results and / or one or more advantages described herein, and each of such variations and / or modifications will be considered to fall within the scope of the embodiments of the invention described herein. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials and stereochemistry described herein are illustrative, and that the actual parameters, dimensions, materials and / or stereochemistry will depend on the specific application (one or more) in which the teaching of the invention is used. Those skilled in the art will recognize many equivalents to the specific embodiments of the invention described herein, or can verify this simply by using routine experimental methods. Thus, it should be understood that the embodiments described above are presented only as examples, and that embodiments of the invention may be carried out in ways other than those specifically described and claimed, within the scope of the appended claims and equivalents thereof. The embodiments of the invention of this disclosure relate to each of the individual features, systems, articles, materials, kits and / or methods described herein. In addition, any two or more combinations of such features, systems, articles, materials, kits, and / or methods are included within the scope of the inventions of this disclosure, provided that such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent.
[0121] It should be understood that all definitions defined and used herein take precedence over dictionary definitions, definitions in literature incorporated by reference, and / or the ordinary meaning of the terms being defined. All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter they cite, and in some cases may encompass the entire document. When used herein and in claims, the indefinite articles "a" and "an" should be understood to mean "at least one" unless explicitly stated otherwise.
[0122] When used herein and in claims, the phrase “and / or” should be understood to mean “either or both” of the elements thus combined, i.e., elements that exist as a combination in some cases and separately in others. Multiple elements enumerated with “and / or” should be interpreted in the same manner (i.e., “one or more” of the elements thus combined). Other elements other than those specifically identified by the “and / or” clause may be present, whether related to or not to these specifically identified elements. Thus, as a non-limiting example, when used in conjunction with open-ended language such as “comprising,” a reference to “A and / or B” may, in one embodiment, refer to A only (optionally including elements other than B); in another embodiment, refer to B only (optionally including elements other than A); in yet another embodiment, refer to both A and B (optionally including other elements); and so on.
[0123] When used herein and in claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shall be interpreted as inclusive, that is, of the number or list of elements, including at least one but more than one, and optionally additional unlisted items. Only terms that are clearly indicated to be the opposite, such as “one of” or “exactly one of” or “consisting of” when used in claims, shall refer to the inclusion of exactly one element of the number or list of elements. In general, the term “or” when used herein shall be interpreted as indicating exclusive substitution (i.e., “one or the other” but not both) only when preceded by terms of exclusivity, such as “either,” “one of,” “one of” or “exactly one of.” “Consisting of” when used in claims shall have its usual meaning as used in the field of patent law.
[0124] When used herein and in claims, the phrase “at least one” should be understood to refer to a list of one or more elements and mean at least one element selected from any one or more elements in the list of elements, but not necessarily to include at least one of each and all elements specifically enumerated in the list of elements, and not to exclude any combination of elements in the list of elements. This definition also allows for the optional presence of elements other than those specifically identified in the list of elements referred to by the phrase “at least one,” whether or not they relate to the specifically identified elements. Therefore, as a non-limiting example, “at least one of A and B” (or equivalently “at least one of A or B” or equivalently “at least one of A and / or B”) may mean, in one embodiment, at least one A (including any more than one A), no B (and optionally including elements other than B); in another embodiment, at least one B (including any more than one B), no A (and optionally including elements other than A); in yet another embodiment, at least one A (including any more than one A) and at least one B (including any more than one B) (and optionally including other elements); and so on.
[0125] Unless otherwise explicitly stated, it should be understood that in any method claimed herein, which includes more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are described. In the claims and the above specification, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” and “composed of” should be understood to be open-ended, meaning they include but are not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” are closed or semi-closed transitional phrases, respectively, as shown in Section 2111.03 of the United States Patent and Trademark Examination Manual. It should be understood that embodiments described in this document using open-ended transitional phrases (e.g., “including”) are also intended to be, in alternative embodiments, as features “consisting of” and “essentially of” described by open-ended transitional phrases. For example, if the disclosure describes “a composition comprising A and B,” the disclosure also intends the alternative embodiments “a composition comprising A and B” and “a composition essentially of A and B.”
Claims
1. a) A sense strand containing the nucleotide sequence CGUCAAAAGCUUCACAGUGU (SEQ ID NO: 2) and an antisense strand containing the nucleotide sequence ACACUGUGAAAGCUUUGACG (SEQ ID NO: 3); and b) Loop This includes low-molecular-weight hairpin-type RNA (shRNA).
2. The shRNA according to claim 1, wherein the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO: 7).
3. The shRNA according to claim 1, comprising the nucleotide sequence CGUCAAAAGCUUCACAGUGUUUCAAAGAGAACACUGUGAAGCUUUGACG (Sequence ID 1).
4. A vector encoding the shRNA described in any one of claims 1 to 3.
5. The vector according to claim 4, further comprising a recombinant BEST1 coding sequence that does not contain the target sequence of the shRNA.
6. The vector according to claim 5, wherein the recombinant BEST1 coding sequence is codon-optimized for expression in human cells.
7. The vector according to claim 5 or 6, wherein the recombinant BEST1 coding sequence includes a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO:
9.
8. The vector according to claim 7, wherein the recombinant BEST1 coding sequence includes the nucleotide sequence of sequence number 9.
9. A vector encoding the shRNA and recombinant BEST1 sequence according to any one of claims 1 to 3, comprising a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO:
11.
10. The vector according to claim 9, comprising the nucleotide sequence of sequence number 11.
11. A plasmid, the vector according to any one of claims 4 to 10.
12. A viral vector, as described in any one of claims 4 to 10.
13. The vector according to claim 12, wherein the viral vector is a recombinant adeno-associated virus (rAAV) vector.
14. The vector according to claim 13, wherein the rAAV vector is self-complementary.
15. Recombinant adeno-associated virus (rAAV) particles comprising the rAAV vector according to claim 13 or 14.
16. The rAAV particle according to claim 15, which is an AAV serotype 2 (AAV2) virus particle.
17. A composition comprising a vector according to any one of claims 4 to 14 or rAAV particles according to claim 15 or 16 and a pharmaceutically acceptable carrier.
18. A method for regulating BEST1 expression in a subject, comprising administering the composition described in claim 17 to the subject.
19. A method for treating Best's disease in a subject, comprising administering the composition described in claim 17 to the subject.
20. The method according to claim 18 or 19, wherein the subject is a human subject.
21. The composition according to claim 17 for use in treating Best's disease.
22. The composition according to claim 17 for use in the manufacture of a pharmaceutical for treating Best's disease.
23. Use of the composition according to claim 17 in treating Best's disease.
24. Use of the composition according to claim 17 in the manufacture of a pharmaceutical for treating Best's disease.
25. A method for treating autosomal recessive bethrophinopathy (ARB) in a subject, comprising administering the composition according to claim 17 to the subject.
26. The method according to claim 25, wherein the subject is a human subject.
27. The composition according to claim 17 for use in treating ARBs.
28. The composition according to claim 17 for use in the manufacture of a pharmaceutical for treating ARBs.
29. Use of the composition according to claim 17 in treating ARBs.
30. Use of the composition according to claim 17 in the manufacture of a pharmaceutical for treating ARBs.
31. A small hairpin-type RNA (shRNA) containing an antisense strand with the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3).