Immunogenic composition and method for inducing an immune response against Clostridioides (Clostridium) difficile
The immunogenic composition with C. difficile toxoids and adjuvants like CpG or LiNA-2 effectively induces a rapid immune response against C. difficile, addressing the need for a CDI vaccine by potentially reducing the number of doses required and enhancing protection against CDI.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- PFIZER INC
- Filing Date
- 2026-02-05
- Publication Date
- 2026-05-19
AI Technical Summary
There is a critical unmet need for an effective vaccine to prevent Clostridioides difficile (C. difficile) infections, as current treatment options are suboptimal and no approved vaccines exist to prevent primary or recurrent CDI, which has led to a rising burden on patients and healthcare systems.
An immunogenic composition comprising Clostridioides difficile toxoids A and/or B, combined with adjuvants such as CpG or saponin-containing liposomal adjuvants, is administered in a two-dose regimen to induce a robust immune response, particularly against toxin B, potentially reducing the number of doses required compared to traditional three-dose regimens.
The two-dose regimen with adjuvants like CpG or LiNA-2 induces a rapid and robust immune response, neutralizing C. difficile toxins, offering protection against CDI and potentially improving vaccine adherence and reducing the number of doses needed.
Smart Images

Figure 2026082987000022 
Figure 2026082987000023 
Figure 2026082987000024
Abstract
Description
[Technical Field]
[0001] The present invention relates to compositions and methods relating to Clostridioides difficile toxoids, as well as to methods thereof. [Background technology]
[0002] Clostridioides difficile (C. difficile), formerly known as Clostridium difficile, is a Gram-positive anaerobic bacterium associated with gastrointestinal diseases in humans. Colonization of C. difficile typically occurs in the colon when the natural gut microbiota is reduced by antibiotic treatment. Infection can lead to antibiotic-related diarrhea and sometimes pseudomembranous colitis due to the secretion of glycated toxins A and B (approximately 308 and 270 kDa, respectively), which are the main toxic factors of C. difficile.
[0003] Over the past decade, the frequency and severity of C. difficile outbreaks in hospitals, nursing homes, and other long-term care facilities have increased dramatically. Key factors contributing to this rise include the emergence of highly virulent strains, increased antibiotic use, improved detection methods, and increased exposure to airborne spores in healthcare settings. [Overview of the project] [Problems that the invention aims to solve]
[0004] The increasing burden of C. difficile (CDI) infections on patients and healthcare systems demonstrates that preventing CDI is a critical unmet medical need. To date, there are no approved vaccines to prevent primary or recurrent CDI, and treatment options are suboptimal. Therefore, there is a need for an effective C. difficile vaccine to prevent CDI. [Means for solving the problem]
[0005] The present invention provides an immunogenic composition comprising Clostridioides difficile (C. difficile) toxoid A and / or toxoid B, and an adjuvant. In one embodiment, the adjuvant is a CpG adjuvant. In another embodiment, the adjuvant is a saponin-containing liposomal adjuvant. In one embodiment, C. difficile toxoid A comprises the amino acid sequence of SEQ ID NO: 4, which lacks the first methionine. For example, mutant C. difficile toxin A comprises the amino acid sequence specified in SEQ ID NO: 84. In one embodiment, C. difficile toxoid B comprises the amino acid sequence of SEQ ID NO: 6, which lacks the first methionine. For example, mutant C. difficile toxin B comprises the amino acid sequence specified in SEQ ID NO: 86.
[0006] In one embodiment, the CpG adjuvant comprises at least one type of CpG. In one embodiment, the immunogenic composition comprises about 0.1 to about 1.0 mg / mL of CpG. In one embodiment, the immunogenic composition comprises 0.5, 1.0, or 3.6 mg / mL of CpG. In a preferred embodiment, the immunogenic composition comprises 3.6 mg / mL of CpG. In another embodiment, the CpG adjuvant further comprises aluminum hydroxide (Al(OH)3). In one embodiment, the immunogenic composition comprises CpG and about 0.1 to 5 mg / mL or more of aluminum hydroxide. In one embodiment, the immunogenic composition comprises CpG and about 1.0 or 1.5 mg / mL of aluminum hydroxide. In a preferred embodiment, the immunogenic composition comprises 1.0 mg / mL of CpG combined with 1.5 mg / mL of aluminum hydroxide. In a preferred embodiment, the CpG is CpG24555.
[0007] In one embodiment, the CpG adjuvant comprises histidine or a phosphate buffer. In another embodiment, the CpG adjuvant comprises sodium chloride.
[0008] In another embodiment, the adjuvant comprises a saponin-containing liposome adjuvant. In one embodiment, the saponin-containing liposome adjuvant comprises a liposome composition containing a saponin and monophosphoryl lipid A (MPLA), the liposome composition comprising i) a lipid bilayer containing phospholipids and ii) cholesterol. In one embodiment, the saponin is QS-21. In one embodiment, the phospholipids are DMPC and DMPG. In a preferred embodiment, the saponin-containing liposome adjuvant comprises QS-21, monophosphoryl lipid A (MPLA), DMPC, DMPG, and cholesterol. In a preferred embodiment, MPLA is monophosphoryl 3-deacyl lipid A.
[0009] In one embodiment, the immunogenic composition contains about 0.05 to about 1.0 mg / mL or more of QS-21. In a preferred embodiment, the immunogenic composition contains 0.2 mg / mL of QS-21. In one embodiment, the immunogenic composition contains about 0.1 to about 1.0 mg / mL or more of MPLA. In a preferred embodiment, the immunogenic composition contains 0.4 mg / mL of MPLA. In one embodiment, the immunogenic composition contains about 0.5 to about 20 mg / mL or more of cholesterol. In a preferred embodiment, the immunogenic composition contains 11 mg / mL of cholesterol. In one embodiment, the immunogenic composition contains about 0.5 to about 20 mg / mL or more of DMPC. In a preferred embodiment, the immunogenic composition contains 14 mg / mL of DMPC. In one embodiment, the immunogenic composition contains about 0.5 to about 3.0 mg / mL or more of DMPG. In a preferred embodiment, the immunogenic composition contains 1.6 mg / mL of DMPG.
[0010] In a preferred embodiment, the saponin-containing liposomal adjuvant contains approximately 0.2 mg / mL QS-21, approximately 0.4 mg / mL monophosphoryl 3-deacyllipid A, approximately 14 mg / mL DMPC, approximately 1.6 mg / mL DMPG, and approximately 11 mg / mL cholesterol (LiNA-2).
[0011] In one embodiment, the saponin-containing liposome adjuvant comprises histidine or a phosphate buffer. In another embodiment, the saponin-containing liposome adjuvant comprises sodium chloride.
[0012] In one embodiment, the immunogenic composition contains C. difficile toxoid A and C. difficile toxoid B in a ratio of approximately 3:1 to approximately 1:1. In one embodiment, the immunogenic composition contains 50 to 200 μg of toxoid. In one embodiment, the immunogenic composition further comprises at least one of a buffer, a stabilizer, and a surfactant. In one embodiment, the immunogenic composition is lyophilized. In one embodiment, the lyophilized immunogenic composition is reconstituted before administration with a CpG adjuvant or a saponin-containing liposomal adjuvant.
[0013] The present invention provides a method for inducing an immune response in a human subject to Clostridioides difficile, the method further comprising administering a first and second dose of an immunogenic composition described herein, comprising C. difficile toxoid A and / or C. difficile toxoid B, and a CpG adjuvant or a saponin-containing liposomal adjuvant, to a human subject.
[0014] The present invention provides a method for preventing, treating, or improving a medically significant C. difficile infection in a human subject, the method further comprising administering a first and second dose of an immunogenic composition described herein, comprising C. difficile toxoid A and / or C. difficile toxoid B, and a CpG adjuvant or a saponin-containing liposomal adjuvant, to a human subject.
[0015] In one embodiment, the method comprises administering an immunogenic composition having C. difficile toxoid A, which contains the amino acid sequence of SEQ ID NO: 4, which lacks the first methionine, and / or C. difficile toxoid B, which has the amino acid sequence of SEQ ID NO: 6, which lacks the first methionine. For example, mutant C. difficile toxin A contains the amino acid sequence specified in SEQ ID NO: 84, and / or mutant C. difficile toxin B contains the amino acid sequence specified in SEQ ID NO: 86.
[0016] In one embodiment, the second dose is administered approximately two months after the first dose (M0, 2). In another embodiment, the second dose is administered approximately six months after the first dose (M0, 6).
[0017] In one embodiment, the method includes administering an immunogenic composition comprising a CpG adjuvant. In one embodiment, the CpG adjuvant is at a dosage of 0.5, 1.0, or 3.6 mg / mL. In a preferred embodiment, the CpG adjuvant is at a dosage of 3.6 mg / mL. In another embodiment, the method includes administering an immunogenic composition comprising a CpG adjuvant combined with aluminum hydroxide (Al(OH)3). In one embodiment, the aluminum hydroxide is at a dosage of 1.0 or 1.5 mg / mL. In a preferred embodiment, the adjuvant comprises 1.0 mg / mL of CpG combined with 1.5 mg / mL of aluminum hydroxide.
[0018] In a preferred embodiment, the method includes administering an immunogenic composition comprising CpG24555. In another preferred embodiment, the method includes administering an immunogenic composition comprising CpG24555 and aluminum hydroxide. In another preferred embodiment, the method includes administering an immunogenic composition comprising LiNA-2.
[0019] In a preferred embodiment, the composition is administered at a dosing volume of 0.5 mL.
[0020] In one embodiment, the induced immune response comprises neutralizing antibodies against Clostridium difficile toxin A and / or Clostridium difficile toxin B.
[0021] In a preferred embodiment, the neutralizing antibodies induced against Clostridium difficile toxin A and / or B are greater after administration of two doses of the immunogenic composition compared to administration of three doses of the immunogenic composition. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] [Figure 1]Figure showing the neutralizing titers of individual animals (NHP) immunized with C. difficile toxoid antigen formulated with LiNA-2 adjuvant (2-dose and 3-dose) compared to a formulation with aluminum hydroxide (Al(OH)3) (3-dose). The formulation of the toxoid antigen with LiNA-2 induces a robust and more rapid immune response that can neutralize the cytotoxicity of TcdB after 2 doses, compared to 3 doses formulated with Al(OH)3. [Figure 2] Figure showing the neutralizing titers of individual animals (NHP) immunized with C. difficile toxoid antigen formulated with LiNA-2 adjuvant (2-dose - M0, 2) or CpG adjuvant combined with Al(OH)3 (2-dose - M0, 2) compared to a formulation with aluminum hydroxide (Al(OH)3) (3-dose). The formulation of the toxoid antigen with either LiNA-2 or CpG / Al(OH)3 induces a robust and more rapid immune response that can neutralize the cytotoxicity of TcdB after 2 doses (0, 2 months), compared to 3 doses (0, 1, 6 months) formulated with Al(OH)3. [Figure 3] Figure showing the neutralizing titers of individual animals (NHP) immunized with C. difficile toxoid antigen formulated with LiNA-2 adjuvant (2-dose - M0, 6) or CpG adjuvant combined with Al(OH)3 (2-dose - M0, 6) compared to a formulation with aluminum hydroxide (Al(OH)3) (3-dose). The formulation of the toxoid antigen with either LiNA-2 or CpG / Al(OH)3 induces a robust and rapid immune response that can neutralize the cytotoxicity of TcdB after 2 doses (0, 6 months), compared to 3 doses (0, 1, 6 months) formulated with Al(OH)3. [Figure 4]This figure shows the neutralizing titer of individual animals (NHP) immunized with C. difficile toxoid antigen (2 doses - M0, 6) containing two levels of CpG adjuvant (0.5 or 1.0 mg / mL CpG) combined with Al(OH)3, compared to a formulation containing Al(OH)3 (3 doses). The toxoid antigen formulation containing CpG / Al(OH)3 induces a robust and rapid immune response capable of neutralizing TcdB cytotoxicity after 2 doses (0, 6 months) compared to 3 doses (0, 1, 6 months) formulated with Al(OH)3. [Figure 5] This figure shows the neutralizing titers of individual animals (NHP) immunized with C. difficile toxoid antigen (2 doses - M0, 2) containing CpG adjuvant alone (0.5 or 3.6 mg / mL CpG) or CpG adjuvant combined with Al(OH)3 at various levels of CpG (0.5, 1, or 3.6 mg / mL CpG), compared to formulations containing Al(OH)3 (3 doses). Formulations of toxoid antigens containing either CpG or CpG / Al(OH)3 induce a robust and rapid immune response capable of neutralizing TcdB cytotoxicity after 2 doses (0, 2 months) compared to 3 doses (0, 1, 6 months) formulated with Al(OH)3. [Figure 6] This figure shows the neutralizing titers of individual animals (rats) immunized with C. difficile toxoid antigen formulated with different LiNA-2 adjuvants (homogeneous and heterogeneous). [Figure 7] This figure shows the relationship between toxoid bond percentage and the Al(OH)3 / CpG mass ratio. [Modes for carrying out the invention]
[0023] The investigational C. difficile vaccine drug product (also referred to herein as "PF-06425090" or "Al(OH)3 formulation" when reconstituted with Al(OH)3) comprises a mixture of genetically modified C. difficile toxoid A (TxdA), i.e., a polypeptide containing SEQ ID NO: 4 (e.g., SEQ ID NO: 84) that is absent from the first methionine, and genetically modified C. difficile toxoid B (TxdB), i.e., a polypeptide containing SEQ ID NO: 6 (e.g., SEQ ID NO: 86) that is absent from the first methionine. The investigational C. difficile vaccine is presented as a sterile lyophilized powder with a 1:1 ratio of TxdA and TxdB at a dose intensity of 200 μg / dose (total dose for TxdA and TxdB), containing 10 mM Tris buffer at pH 7.4, 4.5% (w / w) trehalose dihydrate, and 0.01% (w / v) polysorbate 80. Prior to immunization, the lyophilized powder is reconstituted with 1 mg / mL aluminum, such as aluminum hydroxide (Al(OH)3), acting as an adsorbent / diluent, for 0.5 mL IM injection. The reconstituted investigational C. difficile vaccine contains tromethamine, Tris-HCl, trehalose dihydrate, polysorbate 80, sodium chloride, and aluminum in the form of aluminum hydroxide. See WIPO Patent Application WO / 2012 / 143902, U.S. Patent No. 9,187536, and WIPO Patent Application WO / 2014 / 060898, which are incorporated herein by reference as a whole.
[0024] The investigational C. difficile vaccine is designed to induce a protective and functional toxin-neutralizing antibody response against toxin A (TcdA) and toxin B (TcdB) from clinically relevant and highly virulent C. difficile strains. The vaccine is intended to prevent first-time / primary C. difficile infection (CDI) episodes in subjects aged 50 years and older. The vaccine has been shown to be safe and well-tolerated after a three-dose regimen. The investigational C. difficile vaccine has been evaluated in multiple clinical studies, including B5091001, B5091002, B5091003, B5091007, B5091008, B5091009, B5091010, and B5091019. See also WIPO patent applications WO / 2019 / 064115, WO / 2020 / 201985, and WO / 2021 / 255690, which are incorporated herein by reference as a whole.
[0025] The investigational C. difficile vaccine, reconstituted with Al(OH)3, is administered in a three-dose schedule (0, 1, and 6 months) to induce the functional immune response required to protect against CDI, particularly to achieve sufficient toxin neutralization titers in subjects with low pre-vaccination toxin B neutralization titers. Therefore, the present invention provides a C. difficile vaccine further comprising adjuvants to enhance the magnitude, kinetics, and persistence of the antitoxin immune response to the C. difficile toxoid antigen. The present invention further provides a C. difficile vaccine comprising adjuvants to enhance the immune response to the C. difficile toxoid antigen, particularly the immune response to toxin B, and potentially reduce the number of doses required to prevent CDI in humans (2 doses vs. 3 doses). Furthermore, a two-dose schedule may increase vaccine adherence and would benefit subjects at transient risk of CDI. As provided herein, the investigational C. difficile vaccine is formulated with various adjuvants at different doses and compared with the investigational C. difficile vaccine formulated with Al(OH)3 as an adsorbent.
[0026] The present invention provides investigational C. difficile vaccines, further comprising adjuvants as described herein. In particular, the present invention provides investigational C. difficile vaccines formulated with CpG adjuvants, CpG adjuvants in combination with Al(OH)3, and / or saponin-containing liposomal adjuvants.
[0027] In one embodiment, the immunogenic composition of the present invention comprises 200 μg / dose (total dose for TxdA and TxdB) having toxoid A (TxdA) and toxoid B (TxdB) in a 1:1 ratio, a polypeptide containing sequence number 4 (e.g., sequence number 84) having a 1:1 ratio of toxoid A (TxdA) and toxoid B (TxdB), a polypeptide containing sequence number 6 (e.g., sequence number 86) having a 1:1 ratio of toxoid A (TxdA) and toxoid B (TxdB), and an adjuvant.
[0028] In one embodiment, the adjuvant is a CpG adjuvant, which comprises at least one CpG oligonucleotide, preferably a CpG oligodeoxynucleotide (ODN). In one embodiment, the CpG is a class B CpG. In one embodiment, the CpG is CpG24555, which is a 21-mer oligodeoxynucleotide TLR9 agonist. In one embodiment, the adjuvant comprises only CpG. In one embodiment, the CpG is combined with aluminum hydroxide (Al(OH)3). In one embodiment, the CpG adjuvant, comprising only CpG24555 or combined with aluminum hydroxide (Al(OH)3), is designed to reconstitute a lyophilized investigational C. difficile vaccine drug product for administration.
[0029] In one embodiment, the immunogenic composition contains about 0.1 to about 5 mg / mL of CpG. In one embodiment, the immunogenic composition contains about 0.5, about 1.0, or about 3.6 mg / mL of CpG. In one embodiment, the immunogenic composition contains 0.5 mg / mL of CpG alone or in combination with aluminum hydroxide (AlOH3). In one embodiment, the immunogenic composition contains only 0.5 mg / mL of CpG. In one embodiment, the immunogenic composition contains 0.5 mg / mL of CpG in combination with 1.0 mg / mL of AlOH3. In one embodiment, the immunogenic composition contains 0.5 mg / mL of CpG in combination with 1.5 mg / mL of AlOH3.
[0030] In one embodiment, the immunogenic composition contains 1.0 mg / mL of CpG alone or in combination with aluminum hydroxide (AlOH3). In one embodiment, the immunogenic composition contains only 1.0 mg / mL of CpG. In one embodiment, the immunogenic composition contains 1.0 mg / mL of CpG in combination with 1.0 mg / mL of AlOH3. In one embodiment, the immunogenic composition contains 1.0 mg / mL of CpG in combination with 1.5 mg / mL of AlOH3.
[0031] In one embodiment, the immunogenic composition contains 3.6 mg / mL of CpG alone or in combination with aluminum hydroxide (AlOH3). In one embodiment, the immunogenic composition contains only 3.6 mg / mL of CpG. In one embodiment, the immunogenic composition contains 3.6 mg / mL of CpG in combination with 1.0 mg / mL of AlOH3. In one embodiment, the immunogenic composition contains 3.6 mg / mL of CpG in combination with 1.5 mg / mL of AlOH3. In one embodiment, the immunogenic composition contains 3.6 mg / mL of CpG in combination with 1.8 mg / mL of aluminum hydroxide (AlOH3).
[0032] In one embodiment, the immunogenic composition comprises CpG combined with about 1.0, about 1.5, about 1.7, about 1.8, about 2.0, or about 2.5 mg / mL of Al(OH)3.
[0033] In a preferred embodiment, the CpG adjuvant contains only CpG. In a preferred embodiment, the CpG adjuvant contains CpG in histidine buffer and sodium chloride (NaCl) at a pH of about 6.5. In a preferred embodiment, the CpG adjuvant contains CpG in 10 mM histidine buffer and 60 mM sodium chloride (NaCl) at a pH of about 6.5.
[0034] In a preferred embodiment, the CpG adjuvant contains 3.6 mg / mL of CpG24555 (i.e., high-dose CpG). In a preferred embodiment, the CpG adjuvant contains 3.6 mg / mL of CpG24555 in histidine buffer and sodium chloride (NaCl) at a pH of about 6.5. In a preferred embodiment, the CpG adjuvant contains 3.6 mg / mL of CpG24555 in 10 mM histidine buffer and 60 mM sodium chloride (NaCl) at a pH of about 6.5.
[0035] In another preferred embodiment, the CpG adjuvant comprises 1.0 mg / mL of CpG24555 (i.e., low-dose CpG) combined with 1.5 mg / mL of AlOH3. In another preferred embodiment, the CpG adjuvant comprises 1.0 mg / mL of CpG24555 combined with 1.5 mg / mL of AlOH3 in histidine buffer and sodium chloride (NaCl) at a pH of about 6.5. In another preferred embodiment, the CpG adjuvant comprises 1.0 mg / mL of CpG combined with 1.5 mg / mL of AlOH3 in 10 mM histidine buffer and 50 mM sodium chloride (NaCl) at a pH of about 6.5.
[0036] In another preferred embodiment, the CpG adjuvant comprises CpG combined with AlOH3 in histidine buffer and sodium chloride (NaCl) at a pH of about 6.5. In another preferred embodiment, the CpG adjuvant comprises CpG combined with AlOH3 in 10 mM histidine buffer and 50 mM sodium chloride (NaCl) at a pH of about 6.5.
[0037] The present invention provides an immunogenic composition comprising 200 μg / dose (total dose for toxoid A (TxdA) and toxoid B (TxdB)) of a genetically modified C. difficile (C. difficile) TxdA polypeptide, i.e., a polypeptide containing SEQ ID NO: 4 without the first methionine (e.g., SEQ ID NO: 84), and a genetically modified C. difficile (C. difficile) TxdB polypeptide, i.e., a polypeptide containing SEQ ID NO: 6 without the first methionine (e.g., SEQ ID NO: 86), and a CpG adjuvant containing CpG24555. In one embodiment, the immunogenic composition comprises 0.5, 1.0, or 3.6 mg / mL of CpG24555. In a preferred embodiment, the immunogenic composition comprises 3.6 mg / mL of CpG24555. In a preferred embodiment, the immunogenic composition contains 3.6 mg / mL of CpG24555 in histidine buffer and sodium chloride (NaCl). In a preferred embodiment, the immunogenic composition contains 3.6 mg / mL of CpG24555 in 10 mM histidine buffer and 60 mM sodium chloride (NaCl).
[0038] In a preferred embodiment, the immunogenic composition comprises the investigational C. difficile vaccine and 3.6 mg / mL of CpG24555. In a preferred embodiment, the lyophilized investigational C. difficile vaccine is reconstituted with 3.6 mg / mL of CpG24555 in histidine buffer and sodium chloride (NaCl). In a preferred embodiment, the lyophilized investigational C. difficile vaccine is reconstituted with 3.6 mg / mL of CpG24555 in 10 mM histidine buffer and 60 mM sodium chloride (NaCl).
[0039] The present invention further provides an immunogenic composition comprising 200 μg / dose (total dose for toxoid A (TxdA) and toxoid B (TxdB)) of genetically modified C. difficile (C. difficile) TxdA, i.e., a polypeptide containing SEQ ID NO: 4 without the first methionine (e.g., SEQ ID NO: 84), and genetically modified C. difficile (C. difficile) TxdB, i.e., a polypeptide containing SEQ ID NO: 6 without the first methionine (e.g., SEQ ID NO: 86), a CpG adjuvant containing CpG24555, and aluminum hydroxide Al(OH)3. In one embodiment, the immunogenic composition comprises 0.5, 1.0, or 3.6 mg / mL of CpG24555 and aluminum hydroxide Al(OH)3. In one embodiment, the immunogenic composition comprises CpG24555 and 1.0 or 1.5 mg / mL of aluminum hydroxide Al(OH)3. In a preferred embodiment, the immunogenic composition contains 1.0 mg / mL of CpG24555 and 1.5 mg / mL of aluminum hydroxide Al(OH)3. In a preferred embodiment, the immunogenic composition contains 1.0 mg / mL of CpG24555 and 1.5 mg / mL of AlOH3 in histidine buffer and sodium chloride (NaCl). In a preferred embodiment, the immunogenic composition contains 1.0 mg / mL of CpG24555 and 1.5 mg / mL of AlOH3 in 10 mM histidine buffer and 50 mM sodium chloride (NaCl).
[0040] In a preferred embodiment, the immunogenic composition comprises the C. difficile vaccine for clinical trials, 1.0 mg / mL of CpG24555, and 1.5 mg / mL of aluminum hydroxide Al(OH)3. In a preferred embodiment, the lyophilized C. difficile vaccine for clinical trials is reconstituted with 1.0 mg / mL of CpG24555 and 1.5 mg / mL of aluminum hydroxide Al(OH)3 in a histidine buffer containing sodium chloride (NaCl). In a preferred embodiment, the lyophilized C. difficile vaccine for clinical trials is reconstituted with 1.0 mg / mL of CpG24555 and 1.5 mg / mL of aluminum hydroxide Al(OH)3 in 10 mM histidine buffer and 50 mM sodium chloride (NaCl).
[0041] In one embodiment, the adjuvant-added immunogenic composition of the present invention comprises C. difficile toxoid A (TxdA) (e.g., SEQ ID NO: 84) containing SEQ ID NO: 4, which lacks the first methionine, and C. difficile toxoid B (TxdB) (e.g., SEQ ID NO: 86) containing SEQ ID NO: 6, which lacks the first methionine, as well as a CpG (e.g., CpG24555) adjuvant, either alone or in combination with aluminum (e.g., aluminum hydroxide Al(OH)3).
[0042] In another embodiment, the adjuvant is a saponin-containing liposomal adjuvant comprising monophosphoryl lipid A (MPLA) and triterpenoid glycoside saponin (QS-21). In one embodiment, the saponin-containing liposomal adjuvant further comprises 1,2-dimiristoyl-sn-glycero-3-phosphocholine (DMPC). In one embodiment, the saponin-containing liposomal adjuvant further comprises 1,2-dimiristoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DMPG). In one embodiment, the saponin-containing liposomal adjuvant further comprises cholesterol.
[0043] In a preferred embodiment, the saponin-containing liposome adjuvant comprises MPLA (e.g., 3D-PHAD®), QS-21, DMPC, DMPG, and cholesterol. In another preferred embodiment, the saponin-containing liposome adjuvant comprises 0.4 mg / mL MPLA (e.g., 3D-PHAD®), 0.2 mg / mL QS-21, 14 mg / mL DMPC, 1.6 mg / mL DMPG, and 11 mg / mL cholesterol (i.e., LiNA-2). In yet another preferred embodiment, the saponin-containing liposome adjuvant comprises MPLA (e.g., 3D-PHAD®), QS-21, DMPC, DMPG, and cholesterol in a phosphate buffer and sodium chloride (NaCl). In another preferred embodiment, the saponin-containing liposomal adjuvant comprises MPLA (e.g., 3D-PHAD®), QS-21, DMPC, DMPG, and cholesterol in 10 mM phosphate buffer and 150 mM sodium chloride (NaCl). In another preferred embodiment, the saponin-containing liposomal adjuvant comprises MPLA (e.g., 3D-PHAD®), QS-21, DMPC, DMPG, and cholesterol in phosphate buffer and sodium chloride (NaCl) at a pH of approximately 6.2. In a preferred embodiment, the saponin-containing liposomal adjuvant is designed to reconstitute a lyophilized investigational C. difficile vaccine drug product for administration.
[0044] The present invention further provides an immunogenic composition comprising 200 μg / dose (total dose for toxoid A (TxdA) and toxoid B (TxdB)) of a genetically modified C. difficile (C. difficile) TxdA, i.e., a polypeptide containing SEQ ID NO: 4 without the first methionine (e.g., SEQ ID NO: 84), and a genetically modified C. difficile (C. difficile) TxdB, i.e., a polypeptide containing SEQ ID NO: 6 without the first methionine (e.g., SEQ ID NO: 86), and a saponin-containing liposome adjuvant (e.g., LiNA-2). In one embodiment, the immunogenic composition comprises a saponin-containing liposome adjuvant containing MPLA (e.g., 3D-PHAD®) and QS-21. In a preferred embodiment, the immunogenic composition comprises a saponin-containing liposome adjuvant containing MPLA (e.g., 3D-PHAD®), QS-21, DMPC, DMPG, and cholesterol in a phosphate buffer and sodium chloride (NaCl). In a preferred embodiment, the immunogenic composition comprises a saponin-containing liposome adjuvant containing MPLA (e.g., 3D-PHAD®), QS-21, DMPC, DMPG, and cholesterol in a 10 mM phosphate buffer and 150 mM sodium chloride (NaCl). In a preferred embodiment, the immunogenic composition comprises 0.4 mg / mL MPLA (e.g., 3D-PHAD®), 0.2 mg / mL QS-21, 14 mg / mL DMPC, 1.6 mg / mL DMPG, and 11 mg / mL cholesterol. In a preferred embodiment, the immunogenic composition comprises 0.4 mg / mL MPLA (e.g., 3D-PHAD®), 0.2 mg / mL QS-21, 14 mg / mL DMPC, 1.6 mg / mL DMPG, and 11 mg / mL cholesterol in 10 mM phosphate buffer and 150 mM sodium chloride (NaCl).
[0045] In a preferred embodiment, the immunogenic composition comprises an investigational C. difficile vaccine, 0.4 mg / mL MPLA (e.g., 3D-PHAD®), 0.2 mg / mL QS-21, 14 mg / mL DMPC, 1.6 mg / mL DMPG, and 11 mg / mL cholesterol. In a preferred embodiment, the lyophilized investigational C. difficile vaccine is reconstituted in phosphate buffer and sodium chloride (NaCl) with 0.4 mg / mL MPLA (e.g., 3D-PHAD®), 0.2 mg / mL QS-21, 14 mg / mL DMPC, 1.6 mg / mL DMPG, and 11 mg / mL cholesterol. In a preferred embodiment, the lyophilized investigational C. difficile vaccine is reconstituted with 0.4 mg / mL MPLA (e.g., 3D-PHAD®), 0.2 mg / mL QS-21, 14 mg / mL DMPC, 1.6 mg / mL DMPG, and 11 mg / mL cholesterol in 10 mM phosphate buffer and 150 mM sodium chloride (NaCl). In a preferred embodiment, the immunogenic composition comprises the investigational C. difficile vaccine and LiNA-2. In a preferred embodiment, the lyophilized investigational C. difficile vaccine is reconstituted with LiNA-2 in a phosphate buffer containing sodium chloride (NaCl). In a preferred embodiment, the lyophilized investigational C. difficile vaccine is reconstituted with LiNA-2 in 10 mM phosphate buffer and 150 mM sodium chloride (NaCl).
[0046] In one embodiment, the adjuvant-added immunogenic composition of the present invention comprises C. difficile toxoid A (TxdA) (e.g., SEQ ID NO: 84) containing SEQ ID NO: 4, which lacks the first methionine, and C. difficile toxoid B (TxdB) (e.g., SEQ ID NO: 86) containing SEQ ID NO: 6, which lacks the first methionine, as well as a saponin-containing liposome adjuvant (e.g., LiNA-2).
[0047] In one embodiment, the immunogenic composition of the present invention is prepared by reconstituting a lyophilized investigational C. difficile vaccine for injection with either CpG (e.g., CpG24555), CpG combined with aluminum hydroxide (AlOH3) (e.g., CpG24555), or a saponin-containing liposomal adjuvant (e.g., LiNA-2). The reconstituted immunogenic composition is drawn into a syringe using a vial adapter to enable a 0.5 mL dose for IM administration.
[0048] In one embodiment, the immunogenic composition of the present invention is prepared by reconstituting a lyophilized investigational C. difficile vaccine for injection with an aluminum hydroxide (AlOH3) adsorbent (current formulation). The reconstituted immunogenic composition is presented as a sterile liquid suspension in the form of aluminum hydroxide containing sodium chloride (NaCl) at a dose strength of 1 mg / mL aluminum.
[0049] In one embodiment, the immunogenic compositions disclosed herein are administered in two doses, each dose separated by about 1 to about 4 months. In one embodiment, the immunogenic compositions disclosed herein are administered in two doses, each dose separated by about 1, 2, 3, or 4 months. In a preferred embodiment, the immunogenic compositions disclosed herein are administered in two doses, each dose separated by about 2 months. In one embodiment, the method of the present invention comprises the steps of administering a first dose and a second dose of the immunogenic composition described herein, preferably the second dose being administered about 2 months after the first dose (M0, 2).
[0050] In another embodiment, the immunogenic compositions disclosed herein are administered in two doses, each dose separated by about 1 to about 8 months from the other. In one embodiment, the immunogenic compositions disclosed herein are administered in two doses, each dose separated by about 1, 2, 3, 4, 5, 6, 7, or 8 months from the other. In a preferred embodiment, the immunogenic compositions disclosed herein are administered in two doses, each dose separated by about 6 months from the other. In one embodiment, the method of the present invention comprises the steps of administering a first dose and a second dose of the immunogenic composition described herein, preferably the second dose being administered about 6 months after the first dose (M0, 6).
[0051] In one embodiment, the method includes a further administration of a booster drug after the second dose, for example, 6 or 12 months after the second dose. Further boosters may be administered. In one embodiment, the method does not include a further administration of a booster drug after the second dose.
[0052] In one embodiment, the immunogenic composition disclosed herein is administered three times, with the first and second doses spaced about 1 to 4 months apart from each other, and the third dose spaced about 5 to 10 months apart from the first dose. In a preferred embodiment, the immunogenic composition disclosed herein is administered three times, with the first and second doses spaced about 1 month apart from each other, and the third dose spaced about 6 months apart from the first dose. In one embodiment, the method of the present invention comprises the steps of administering the first, second, and third doses of the immunogenic composition described herein, preferably with the second dose administered about 1 month after the first dose and the third dose administered about 6 months after the first dose (M0, 1, 6).
[0053] In one embodiment, the method includes a further administration of a booster drug after the third dose, for example, 6 or 12 months after the third dose. Further boosters may be administered. In one embodiment, the method does not include a further administration of a booster drug after the third dose.
[0054] Examples 1-4 of the present invention compare the relative immunogenicity of C. difficile toxoid antigens formulated with adjuvants in non-human primates (NHPs) compared with Al(OH)3 formulations. The formulations were assessed for enhancement of the immune response, particularly the immune response to toxin B, and the potential reduction in the number of doses required to prevent C. difficile infection (CDI) in humans (2 doses vs. 3 doses).
[0055] As provided in the examples herein, multiple immunogenicity studies were performed in NHP to compare the functional response of adjuvant-added formulations with that of Al(OH)3-formulated toxoid antigens. See Examples 1-4. Adjuvant-added formulations, with or without Al(OH)3, including CpG adjuvants (e.g., CpG24555) and saponin-containing liposomal adjuvants (e.g., LiNA-2), induced a robust and more rapid immune response in NHP after two doses (at 0, 2 months, or 0, 6 months) compared to three doses (at 0, 1, and 6 months) of Al(OH)3 formulations.
[0056] As further provided in the examples herein, dose-range immunogenicity studies were performed in NHP using C. difficile toxoid antigen with CpG adjuvant. When formulated with Al(OH)3, the functional immune response to two doses of the toxoid antigen (at months 0 and 2) increased in parallel with the amount of CpG included (0.5, 1.0, and 3.6 mg / mL of CpG24555). Inclusion of either 1.0 or 3.6 mg / mL of CpG induced a faster and more robust immune response than three doses of the Al(OH)3 formulation. See Examples 3 and 4. The functional immune response to two doses (at months 0 and 2) of toxoid antigen formulated with either 0.5 or 3.6 mg / mL of CpG alone (without Al(OH)3) was also evaluated in NHP. Both induced a faster response compared to three doses of the Al(OH)3 formulation. See Example 4.
[0057] Example 5 provides immunogenicity studies conducted in rats using homogeneous and heterogeneous LiNA-2 adjuvant-added C. difficile toxoid antigens. Toxoids formulated with homogeneous and heterogeneous saponin-containing liposomal adjuvants (e.g., LiNA-2) induced similar immune responses capable of neutralizing the cytotoxicity of toxin B.
[0058] Example 6 of the present invention provides a binding study using various CpG and Al(OH)3 concentrations and ratios to understand the binding properties of C. difficile toxoid and CpG adjuvants.
[0059] Example 7 of the present invention provides binding and resuspension studies for various CpG / Al(OH)3 formulations to assess the properties of C. difficile toxoid and CpG adjuvants.
[0060] Example 8 provides preferred immunogenic compositions and administration regimens of the present invention. For example, immunogenic compositions formulated with CpG adjuvant alone, CpG adjuvant + Al(OH)3, and / or saponin-containing liposomal adjuvant (LiNA-2) are administered in two doses (e.g., M0, 2 or M0, 6).
[0061] Compositions and vaccines In one embodiment, the composition is an immunogenic composition. In one embodiment, the composition is an immunogenic composition against humans. In another embodiment, the composition is a vaccine. “Vaccine” means a composition comprising an antigen containing at least one epitope, which induces an immune response specific to that antigen. Vaccines may be administered directly to a subject by routes of administration including subcutaneous, oral, oral-nasal, or intranasal administration. Preferably, vaccines are administered intramuscularly. In one embodiment, the composition is a human vaccine. In one embodiment, the composition is an immunogenic composition against C. difficile. In certain embodiments, the composition may further comprise one or more C. difficile antigens, one or more pharmaceutically acceptable carriers, and / or one or more adjuvants, as described herein.
[0062] As described above, the investigational C. difficile vaccine (also referred to herein as "PF-06425090" or "Al(OH)3 formulation" when reconstituted with Al(OH)3) comprises a mixture of genetically modified C. difficile toxoid A (TxdA), i.e., a polypeptide containing SEQ ID NO: 4 (e.g., SEQ ID NO: 84) that is further chemically inactivated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide) (EDC) and N-hydroxysuccinimide (NHS), and genetically modified C. difficile toxoid B (TxdB), i.e., a polypeptide containing SEQ ID NO: 6 (e.g., SEQ ID NO: 86) that is further chemically inactivated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS). The vaccine is presented as a lyophilized powder with a 1:1 ratio of TxdA and TxdB at a dose intensity of 200 μg / dose (total dose for TxdA and TxdB). Prior to immunization, the investigational C. difficile vaccine is reconstituted with Al(OH)3 as an adsorbent. The vaccine is administered in three doses (M0, 1, 6).
[0063] The present invention provides an investigational C. difficile vaccine formulated to enhance the immune response, particularly the immune response to toxin B, and thus provide a faster onset of protection and the use of a two-dose regimen (M0, 2, or 0, 6 months). This vaccine comprises an oligonucleotide CpG adjuvant (e.g., CpG24555), a CpG adjuvant combined with Al(OH)3 (e.g., CpG24555), and / or a saponin-containing liposomal adjuvant (e.g., LiNA-2). The adjuvant-containing vaccine compositions described herein are presented as lyophilized dosage forms (investigational C. difficile vaccine) and are prepared for injection by reconstitution with one of the following: an oligonucleotide CpG adjuvant (e.g., CpG24555), an oligonucleotide CpG adjuvant combined with aluminum hydroxide Al(OH)3 (e.g., CpG24555), or a saponin-containing liposome adjuvant (e.g., LiNA-2).
[0064] C. difficile toxoid The term "C. difficile toxoid" is used herein to refer to a partially or completely inactivated C. difficile toxin (toxin A or toxin B). A toxin is inactivated if, as measured, for example by an in vitro cytotoxicity assay or by animal toxicity, it has a lower toxicity than the untreated toxin (e.g., a toxicity of 100%, 99%, 98%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or any value in between). C. difficile toxoids can be produced by purifying the toxin from C. difficile cultures and inactivating the toxin with chemicals (e.g., formaldehyde, glutaraldehyde, peroxides, oxygen treatment). Alternatively, recombinant methods and / or alternative chemical crosslinking agents can be used to produce wild-type or mutant C. difficile (C. difficile) toxins with reduced or no toxicity. For example, gene mutations resulting in reduced toxicity can be created. Wild-type or mutant C. difficile (C. difficile) toxins lacking specific regions to reduce toxicity can also be produced.
[0065] A C. difficile toxoid or mutant C. difficile toxin refers to a molecule that exhibits a structure or sequence different from the corresponding wild-type structure or sequence, for example, by having crosslinks compared to the corresponding wild-type structure, and / or by having at least one mutation compared to the corresponding wild-type sequence when optimally aligned by a GAP or BESTFIT program using initial gap weighting. As used herein, the terms toxoid or mutant toxin further exhibit functional properties different from the corresponding wild-type molecule (e.g., discarded glucosyltransferase and / or discarded cysteine protease activity).
[0066] The toxoids used herein may be any of the toxoids or mutant C. difficile (C. difficile) toxins described in WIPO Patent Application WO / 2012 / 143902, U.S. Patent No. 9,187536, and WIPO Patent Application WO / 2014 / 060898, each incorporated herein by reference as a whole. In other words, the toxoids used herein may be any of the polypeptides described in WIPO Patent Application WO / 2012 / 143902, U.S. Patent No. 9,187536, and WIPO Patent Application WO / 2014 / 060898, each incorporated herein by reference as a whole. C. difficile (C. difficile) toxins derived from any of the wild-type strains described above may be used as a source from which toxoids or mutant C. difficile (C. difficile) toxins are produced. Preferably, C. difficile 630 is a source from which C. difficile toxoid is produced.
[0067] In one embodiment, toxoid refers to a polypeptide having any one sequence selected from the toxoid polypeptides of SEQ ID NOs: 1 to 861, wherein the first methionine is absent, and the polypeptide is in contact with a chemical crosslinking agent such as formaldehyde or EDC, as described herein, and / or is genetically mutated. More specifically, in one embodiment, toxoid is a polypeptide having an amino acid sequence specified in any one of SEQ ID NOs: 1 to 8, 15, 17, 19, 21, 23, 25, 28 to 35, 82 to 761, and 762 to 840. In another embodiment, the polypeptide has an amino acid sequence that is approximately 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 1-8, 15, 17, 19, 21, 23, 25, 28-35, 82-761, and 762-840. In another embodiment, the polypeptide has an amino acid sequence having at least 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, or 2200 consecutive amino acids for any one of SEQ ID NOs.
[0068] Mutations may involve substitution, deletion, excision, or modification of a wild-type amino acid residue that is normally located at that position. Therefore, the polypeptide may be any one of the following: fusion polypeptide, glycosylated polypeptide, non-glycosylated polypeptide, lipid-containing polypeptide, non-lipidized polypeptide, phosphorylated polypeptide, non-phosphorylated polypeptide, myristoylated polypeptide, non-myristoylated polypeptide, monomeric polypeptide, polymeric polypeptide, particulate polypeptide, denatured polypeptide, etc. Preferably, the mutation is a non-conservative amino acid substitution. The mutant toxin of the present invention can be prepared by techniques known in the art for preparing mutations, such as site-directed mutagenesis or mutagenesis using a mutagens (e.g., UV light). Preferably, site-directed mutagenesis is used. Alternatively, nucleic acid molecules having the target sequence can be synthesized directly. Such chemical synthesis methods are known in the art.
[0069] In the present invention, the mutant C. difficile toxin contains at least one mutation in the glucosyltransferase domain compared to the corresponding wild-type C. difficile toxin. In one embodiment, the glucosyltransferase domain contains at least two mutations. Preferably, the mutations reduce or eliminate the glucosyltransferase enzyme activity of the toxin compared to the glucosyltransferase enzyme activity of the corresponding wild-type C. difficile toxin.
[0070] Exemplary C. difficile toxoid A contains the amino acid sequence specified in SEQ ID NO: 4, which lacks the initial methionine. SEQ ID NO: 4 has the D285A, D287A, and C700A mutations compared to SEQ ID NO: 1 (wild-type toxin A). In another embodiment, mutant C. difficile toxin A contains the amino acid sequence specified in SEQ ID NO: 84. In another embodiment, C. difficile toxoid A contains a glucosyltransferase domain including SEQ ID NO: 29, which has amino acid substitutions at positions 285 and 287, and a cysteine protease domain including SEQ ID NO: 32, which has an amino acid substitution at position 158, compared to the corresponding wild-type C. difficile toxin A. In another embodiment, C. difficile toxoid A contains the amino acid sequence specified in Sequence ID No. 1, which lacks the initial methionine and has the D285A, D287A, and C700A mutations.
[0071] Further examples of C. difficile toxoid A include the amino acid sequence specified in SEQ ID NO: 7, which has the D269A, R272A, D285A, D287A, E460A, R462A, and C700A mutations compared to SEQ ID NO: 1, in which the first methionine is optionally absent. In another embodiment, mutant C. difficile toxin A includes the amino acid sequence specified in SEQ ID NO: 83.
[0072] Exemplary C. difficile toxoid B contains the amino acid sequence specified in SEQ ID NO: 6, which lacks the initial methionine. SEQ ID NO: 6 has the D286A, D288A, and C689A mutations compared to SEQ ID NO: 2 (wild-type toxin B). In another embodiment, mutant C. difficile toxin A contains the amino acid sequence specified in SEQ ID NO: 86.
[0073] Further examples of mutant C. difficile (C. difficile) TcdB include the amino acid sequence specified in SEQ ID NO: 8, with the D270A, R273A, D286A, D288A, D461A, K463A, and C698A mutations compared to SEQ ID NO: 2, and the initial methionine of SEQ ID NO: 8 being optionally absent. In another embodiment, mutant C. difficile (C. difficile) toxin B includes the amino acid sequence specified in SEQ ID NO: 85. In another embodiment, C. difficile (C. difficile) toxoid B includes the amino acid sequence specified in SEQ ID NO: 2, with the initial methionine being absent and having the D286A, D288A, and C689A mutations.
[0074] In addition to generating an immune response in mammals, the toxoids described herein also possess reduced cytotoxicity compared to the corresponding wild-type C. difficile toxin. Preferably, the immunogenic compositions are safe and, upon administration to mammals, exhibit minimal cytotoxicity (e.g., about 6-8 log) compared to the cytotoxicity of the respective wild-type toxins. 10 (Decreased toxicity) ~ No cytotoxicity
[0075] As used herein, the term cytotoxicity is a term understood in the art and refers to apoptotic cell death and / or a condition in which the normal biochemical or biological functions of one or more cells are abnormally impaired compared to identical cells under the same conditions but in the absence of a cytotoxic agent. Toxicity is defined, for example, in cells or mammals, by the amount of the active substance required to induce 50% cell death (i.e., EC, respectively). 50 or ED 50 It can be quantified as, or by other methods known in the art.
[0076] In one embodiment, a toxoid is a polypeptide having any one sequence selected from the toxoid polypeptides of SEQ ID NOs: 1 to 861, more specifically, a toxoid is a polypeptide having an amino acid sequence specified in any one of SEQ ID NOs: 1 to 8, 15, 17, 19, 21, 23, 25, 28 to 35, 82 to 761, and 762 to 840, wherein the polypeptide lacks the first methionine and is in contact with a chemical crosslinking agent such as formaldehyde or EDC, as described herein. Crosslinking (also referred to herein as "chemical inactivation" or "inactivation") is the process of chemically joining two or more molecules by covalent bonds. The terms "crosslinking agent," "crosslinking agent," and "crosslinker" refer to molecules that can react with and / or chemically attach to specific functional groups (primary amines, sulfhydryls, carboxyls, carbonyls, etc.) on peptides, polypeptides, and / or proteins. In one embodiment, the molecule may contain two or more reactive ends that can react with and / or chemically attach to specific functional groups (primary amines, sulfhydryls, carboxyls, carbonyls, etc.) on peptides, polypeptides, and / or proteins. Preferably, the chemical crosslinking agent is water-soluble. In another preferred embodiment, the chemical crosslinking agent is a heterobifunctional crosslinking agent. In yet another embodiment, the chemical crosslinking agent is not a bifunctional crosslinking agent. Chemical crosslinking agents are known in the art.
[0077] Exemplary suitable chemical crosslinking agents include formaldehyde; formalin; acetaldehyde; propionaldehyde; water-soluble carbodiimides (RN=C=NR'), which include 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride, 1-cyclohexyl-3-(2-morpholinyl-(4-ethyl)carbodiimide; meth-p-toluenesulfonate (CMC), N,N'-dicyclohexylcarbodiimide (DCC), and N,N'-diisopropylcarbodiimide (DIC), and their derivatives; as well as N-hydroxysuccinimide (NHS); phenylglyoxal; and / or UDP-dialdehydes.
[0078] In another embodiment, at least one amino acid can be chemically crosslinked by an active agent comprising EDC and NHS. For example, in one embodiment, the present invention relates to an isolated polypeptide having an amino acid sequence specified in SEQ ID NO: 4, wherein the methionine residue at position 1 is optionally absent, and the polypeptide comprises at least one amino acid side chain chemically modified by EDC and NHS. In another embodiment, the present invention relates to an isolated polypeptide having an amino acid sequence specified in SEQ ID NO: 6, wherein the methionine residue at position 1 is optionally absent, and the polypeptide comprises at least one amino acid side chain chemically modified by EDC and NHS. In yet another embodiment, the present invention relates to an isolated polypeptide having an amino acid sequence specified in SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 7, or SEQ ID NO: 8. The polypeptide is modified by contacting it with EDC and NHS.
[0079] As yet another example of a chemically crosslinked mutant C. difficile toxin, i.e., polypeptide, at least one amino acid can be chemically crosslinked by an active agent containing formaldehyde. Formaldehyde can react with the amino group of the N-terminal amino acid residue, as well as with the side chains of arginine, cysteine, histidine, and lysine. Formaldehyde and glycine can form Schiff base adducts, which can attach to the primary N-terminal amino group, arginine, and tyrosine residues, as well as to a lesser extent to asparagine, glutamine, histidine, and tryptophan residues.
[0080] Chemical crosslinking agents are said to reduce the cytotoxicity of a toxin if, under identical conditions, the treated toxin has lower toxicity (e.g., approximately 100%, 99%, 95%, 90%, 80%, 75%, 60%, 50%, 25%, or 10% lower toxicity) than the untreated toxin, as measured, for example, by in vitro cytotoxicity assays or by animal toxicity.
[0081] In one embodiment, the immunogenic composition of the present invention comprises a polypeptide (toxoid A) having amino acid sequence SEQ ID NO: 4 without methionine, for example, SEQ ID NO: 84, a second polypeptide (toxoid B) having amino acid sequence SEQ ID NO: 6 without methionine, for example, SEQ ID NO: 86, and an adjuvant such as a CpG adjuvant or a saponin-containing liposome adjuvant.
[0082] In one embodiment, the effective dose of C. difficile toxoid A and toxoid B (e.g., approximately 40 to approximately 500 μg / dose, e.g., approximately 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, One of the following doses is used: 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 μg / dose, for example, about 50 to about 100 μg / dose (w / w, total amount of toxoids A and B in the composition), with an effective toxoid A:B ratio (for example, about 10%, 20%, 30% by weight). An immunogenic composition is provided, comprising any of toxoid A versus toxoid B in a ratio of %, 40%, 50%, 60%, 70%, 3:1, 3:2, or 1:1, with sufficient purity (e.g., at least about 80–100%, e.g., any of about 80, 85, 90, 95, or 90–100% (w / w)), and each dose of a multi-dose administration regimen, using one or more doses (e.g., at least two, three doses or prescriptions) via any suitable route (e.g., intramuscular), is appropriately spaced apart from each other (e.g., at least about 1–10 days, e.g., any of about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days, e.g., about 7 days, or at least 1–7 months, e.g., any of about 1, 2, 3, 4, 5, 6, or 7 months). Those skilled in the art will understand that the length of time between drug administrations (time interval) varies depending on the individual, and that this interval should be long enough (e.g., measured in days or months) to allow time for the immune response to the preceding drug to develop (e.g., be primed) and not be inhibited by the subsequent drug administration (e.g., one or more booster doses).
[0083] In one embodiment, the immunogenic composition used in the vaccination regimen of the present invention comprises about 40 to about 500 μg / dose of C. difficile toxoid A. In one embodiment, the composition comprises about 50 to about 400 μg / dose of C. difficile toxoid A. In one embodiment, the composition comprises about 50 to about 200 μg / dose of C. difficile toxoid A. In one embodiment, the composition comprises about 50 to about 150 μg / dose. In one embodiment, the composition contains C. difficile toxoid A in any of the following amounts: approximately 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 μg / dose. In one embodiment, the composition contains approximately 50 μg / dose of C. difficile toxoid A. In another embodiment, the composition contains approximately 100 μg / dose of C. difficile toxoid A.
[0084] In one embodiment, the immunogenic composition used in the vaccination regimen of the present invention comprises about 40 to about 500 μg / dose of C. difficile toxoid B. In one embodiment, the composition comprises about 50 to about 400 μg / dose of C. difficile toxoid B. In one embodiment, the composition comprises about 50 to about 200 μg / dose of C. difficile toxoid B. In one embodiment, the composition comprises about 50 to about 150 μg / dose. In one embodiment, the composition contains C. difficile toxoid B in any of the following amounts: approximately 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 μg / dose. In one embodiment, the composition contains approximately 50 μg / dose of C. difficile toxoid B. In another embodiment, the composition contains approximately 100 μg / dose of C. difficile toxoid B.
[0085] In one embodiment, the immunogenic composition used in the vaccination regimen of the present invention comprises C. difficile toxoids A and B in doses disclosed herein. In one embodiment, the toxoid A to B ratio is 3:1, 3:2, or 1:1 by weight for toxoid A to toxoid B. In one embodiment, the toxoid A to B ratio is 1:3, 2:3, or 1:1 by weight for toxoid A to toxoid B. In one embodiment, the toxoid A to B ratio is 1:1 by weight for toxoid A to toxoid B. In one embodiment, the composition used in the vaccination regimen of the present invention comprises C. difficile toxoids A and B having a purity of at least about 80 to about 100%. In one embodiment, the composition used in the vaccination regimen of the present invention comprises C. difficile toxoids A and B having a purity of at least about 90 to about 100%. In one embodiment, the composition used in the vaccination regimen of the present invention comprises C. difficile toxoids A and B having a purity of about 80, 85, 90, 95, or 100% (w / w).
[0086] Pharmacologically acceptable carriers In one embodiment, the immunogenic compositions described herein may further comprise one or more pharmaceutically acceptable carriers and / or one or more adjuvants. In one embodiment, the compositions may be provided by combining C. difficile toxoid A and / or B described herein with one or more pharmaceutically acceptable carriers prior to administration. In one embodiment, a composition that may be a vaccine may be provided as a lyophilized formulation that can be reconstituted with a diluent and / or mixed with an adjuvant in clinical settings, if specified.
[0087] A pharmaceutically acceptable carrier is a material that is not biologically or otherwise undesirable, for example, that can be administered to a subject without causing any undesirable biological effects or interacting in a harmful manner with any other components of the pharmaceutical composition in which it is contained. The carrier will naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as will be well known to those skilled in the art. Suitable pharmaceutically acceptable carriers and their formulations are described, for example, in Remington's: The Science and Practice of Pharmacy, Vol. 27. 4 This may be relevant as described in David B. Troy (ed.), Lippicott Williams & Wilkins (2005). Typically, an appropriate amount of pharmaceutically acceptable salt is used in the formulation to make it isotonic.
[0088] Examples of pharmaceutically acceptable carriers include, but are not limited to, sterile water, physiological saline, buffer solutions such as Ringer's solution, and dextrose solutions. The pH of the solutions is generally about 5 to about 8 or about 7 to about 7.5. Other carriers include sustained-release preparations such as semipermeable matrices of solid hydrophobic polymers containing polypeptides or fragments thereof. The matrix may be in the form of a molded article, e.g., a film, liposomes, or microparticles. It will be apparent to those skilled in the art that certain carriers may be more preferred depending, for example, the route of administration and the concentration of the composition to be administered. The carriers are suitable for administration to humans or other subjects.
[0089] In one embodiment, the composition comprises a pharmaceutically acceptable carrier, which refers to any physiologically appropriate solvent, dispersion medium, stabilizer, diluent, and / or buffer. Exemplary stabilizers include carbohydrates such as sorbitol, mannitol, starch, dextran, sucrose, trehalose, lactose, and / or glucose; inactive proteins such as albumin and / or casein; and / or other large, slowly metabolized polymers, such as polysaccharides such as chitosan, polylactic acid, polyglycolic acid, and copolymers (latex-functionalized SEPHAROSE® agarose, agarose, cellulose, etc.), amino acids, polymeric amino acids, amino acid copolymers, and lipid aggregates (oil droplets or liposomes, etc.). Additionally, these carriers may function as immunostimulants (i.e., adjuvants).
[0090] Preferably, the C. difficile immunogenic composition contains trehalose. Preferred amounts (by weight) of trehalose range from a minimum of about 1%, 2%, 3%, or 4% to a maximum of about 10%, 9%, 8%, 7%, 6%, or 5%. Any minimum and maximum values can be combined to define an appropriate range. In one embodiment, the composition contains, for example, about 3% to about 6% trehalose, most preferably about 4.5% trehalose, per 0.5 mL dose.
[0091] Exemplary buffers include phosphate buffers (potassium phosphate, sodium phosphate, etc.); acetate buffers (sodium acetate, etc.); succinate buffers (sodium succinate, etc.); glycine buffers; histidine buffers; carbonate buffers, Tris buffers (tris(hydroxymethyl)aminomethane), and / or bicarbonate buffers (ammonium bicarbonate, etc.).
[0092] Preferably, the C. difficile immunogenic composition contains Tris buffer. Preferred amounts of Tris buffer include a minimum of about 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM to a maximum of about 100 mM, 50 mM, 20 mM, 19 mM, 18 mM, 17 mM, 16 mM, 15 mM, 14 mM, 13 mM, 12 mM, or 11 mM. Any minimum and maximum values can be combined to define an appropriate range. In one embodiment, the composition contains, for example, about 10 mM to about 15 mM of Tris buffer per 0.5 mL dose, more preferably about 8 mM to about 12 mM of Tris buffer, and most preferably about 10 mM of Tris buffer.
[0093] In another embodiment, the C. difficile immunogenic composition comprises a histidine buffer. Preferred amounts of histidine buffer include a minimum of about 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM to a maximum of about 100 mM, 50 mM, 20 mM, 19 mM, 18 mM, 17 mM, 16 mM, 15 mM, 14 mM, 13 mM, 12 mM, or 11 mM. Any minimum and maximum values can be combined to define an appropriate range. In one embodiment, the composition comprises, for example, about 10 mM to about 15 mM of histidine buffer per 0.5 mL dose, more preferably about 8 mM to about 12 mM of histidine buffer, and most preferably about 10 mM of histidine buffer.
[0094] In another embodiment, the C. difficile immunogenic composition comprises a phosphate buffer. Preferred amounts of phosphate buffer include a minimum of about 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM to a maximum of about 100 mM, 50 mM, 20 mM, 19 mM, 18 mM, 17 mM, 16 mM, 15 mM, 14 mM, 13 mM, 12 mM, or 11 mM. Any minimum and maximum values can be combined to define an appropriate range. In one embodiment, the composition comprises, for example, about 10 mM to about 15 mM of phosphate buffer per 0.5 mL dose, more preferably about 8 mM to about 12 mM of phosphate buffer, and most preferably about 10 mM of phosphate buffer.
[0095] In some embodiments, the composition contains a surfactant. Any surfactant is suitable, whether it is amphoteric, nonionic, cationic, or anionic. Exemplary surfactants include polyoxyethylene sorbitan ester surfactants such as polysorbate 20 and / or polysorbate 80 (e.g., TWEEN®); polyoxyethylene fatty ethers derived from lauryl, cetyl, stearyl, and oleyl alcohols, such as triethylene glycol monolauryl ether (BRIJ® 30) (known as BRIJ® surfactants); TRITON® X100, or t-octylphenoxypolyethoxyethanol; and sorbitan esters such as sorbitan trioleate (SPAN 85) and sorbitan monolaurate (commonly known as SPAN), and combinations thereof. Preferred surfactants include polysorbate 80 (polyoxyethylene sorbitan monooleate).
[0096] Polysorbate 80 (PS-80) is a nonionic surfactant. In one embodiment, the composition contains a PS-80 concentration ranging from 0.0005% to 1%. For example, the PS-80 concentration in the composition may be at least 0.0005%, 0.005%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, or 1.1% PS-80. In one embodiment, the PS-80 concentration in the composition may be at most 2.0%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1.0%, 0.9%, 0.8%, or 0.7% PS-80. Any minimum value can be combined with any maximum value described herein to define a range. Preferably, the composition contains about 0.01% PS-80.
[0097] In an exemplary embodiment, the immunogenic composition of the present invention comprises C. difficile toxoid A and toxoid B in trehalose, Tris buffer, and polysorbate 80. In another exemplary embodiment, the immunogenic composition of the present invention is a lyophilized composition comprising C. difficile toxoid A and toxoid B in trehalose, Tris buffer, and polysorbate 80, which is reconstituted with an adjuvant or adsorbent. For example, CpG alone, or a CpG adjuvant comprising CpG and aluminum hydroxide, or a saponin-containing liposome adjuvant.
[0098] In another exemplary embodiment, the immunogenic composition comprises trehalose, Tris buffer, histidine buffer, and polysorbate 80. In another exemplary embodiment, the immunogenic composition comprises trehalose, Tris buffer, sodium phosphate buffer, potassium phosphate buffer, and polysorbate 80. The pH of the buffer is generally considered to be selected to stabilize the selected active material and can be determined by those skilled in the art by known methods. Preferably, the pH of the buffer will be in the physiological pH range. Thus, the preferred pH range is about 3 to about 8; more preferably about 6.0 to about 8.0; even more preferably about 6.5 to about 7.5.
[0099] The adjuvant may include, for example, an adjuvant at an appropriate concentration (e.g., any of approximately 800 to 5000 μg / mL). The immunogenic composition may further include aluminum (e.g., aluminum hydroxide or aluminum phosphate), for example, aluminum hydroxide in sodium chloride can be used as a diluent for reconstituting the lyophilized formulation. The lyophilized vaccine may be diluted with WFI for the adjuvant-free formulation. The final dosing solution may include, for example, the composition / vaccine, diluent, and adjuvant.
[0100] In one embodiment, the pharmaceutical composition comprises one, two, or more different adjuvants. Alternatively, in one embodiment, the composition is administered to mammals in the absence of adjuvants; that is, the composition does not contain adjuvants.
[0101] In some embodiments, the pharmaceutical composition further comprises formaldehyde. For example, in a preferred embodiment, the pharmaceutical composition further comprising formaldehyde has an immunogenic composition in which a variant C. difficile toxin of the immunogenic composition is in contact with a chemical crosslinking agent containing formaldehyde. The amount of formaldehyde present in a pharmaceutical composition can vary from a minimum of approximately 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.010%, 0.013%, or 0.015%, to a maximum of approximately 0.020%, 0.019%, 0.018%, 0.017%, 0.016%, 0.015%, 0.014%, 0.013%, 0.012%, 0.011%, or 0.010%. An appropriate range can be defined by combining any minimum and maximum values. In one embodiment, the pharmaceutical composition contains approximately 0.010% formaldehyde.
[0102] In some alternative embodiments, the pharmaceutical compositions described herein are formaldehyde-free. For example, in a preferred embodiment, a formaldehyde-free pharmaceutical composition has an immunogenic composition in which at least one amino acid of the mutant C. difficile toxin is chemically crosslinked with an active agent containing EDC. More preferably, in such embodiments, the mutant C. difficile toxin is not in contact with a chemical crosslinking agent containing formaldehyde. In another exemplary embodiment, a pharmaceutical composition in lyophilized formaldehyde is formaldehyde-free.
[0103] Kits for administering C. difficile antigens are also provided herein. In one embodiment, one or more C. difficile antigens may form part of a kit for administration to a subject and / or be provided as a kit. Instructions for use for administering C. difficile antigens may also be provided with the kit. Compositions comprising the C. difficile antigens described herein may be included in a kit (e.g., a vaccine kit). For example, a kit may include a first container containing the composition described herein in a dry or lyophilized form, and a second container containing an aqueous solution for reconstituting the composition. The kit may optionally include a device for administering the composition in its reconstituted liquid form (e.g., a subcutaneous syringe, a microneedle array), and / or instructions for use. The device for administration may be supplied pre-filled with the aqueous solution for reconstituting the composition.
[0104] The volume of each delivery dose of the investigational agent (vaccine or placebo) may be about 0.5 mL. The volume of each delivery dose of the compositions disclosed herein may be about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 mL. The volume of each delivery dose of the compositions disclosed herein may be about 0.4, 0.5, or 0.6 mL. The volume of each delivery dose of the compositions disclosed herein may be about 0.5 mL. The volume of each delivery dose of the compositions disclosed herein may be about 1 mL. The formulations may be administered by any suitable route (e.g., subcutaneous, intravenous, intramuscular, intraperitoneal, intradermal, intranodal, intranasal, or oral).
[0105] As mentioned above, immunological compositions typically contain the C. difficile antigen and, when administered to a host / subject (e.g., a human), induce or enhance an immune response directed against the antigen (e.g., C. difficile). Such a response may include antibody production (e.g., by B cell stimulation) or a T cell-based response (e.g., a cytolytic response), which may be defensive and / or neutralizing. A defensive or neutralizing immune response may be harmful to the infectious organism corresponding to the antigen (e.g., from which the antigen originates) and beneficial to the host (e.g., by reducing or inhibiting infection). When used herein, defensive or neutralizing antibodies and / or cellular responses may be reactive with the C. difficile antigen described herein, especially when administered in effective amounts and / or according to a schedule. Such antibody and / or cellular responses, when tested in animals, may reduce or inhibit the severity, duration, and / or mortality of C. difficile infection. As shown in the examples, an immunogenic composition comprising the adjuvant described herein may induce an immune response to C. difficile. Immunological compositions that, when administered to a host, produce a therapeutic (e.g., typically administered during active infection) and / or protective (e.g., typically administered before or after active infection) and / or neutralizing immune response may be considered vaccines.
[0106] Adjuvant The present invention further provides immunogenic compositions comprising adjuvants. An adjuvant is a substance that enhances the immune response when administered together with an immunogen or antigen. Antigens may act primarily as a delivery system, primarily as an immune modulator, or possess strong characteristics of both. Suitable adjuvants include those suitable for use in mammals, including humans. Preferred adjuvants enhance the intrinsic immune response to an immunogen without causing conformational changes to the immunogen that could affect the qualitative morphology of the immune response. Suitable adjuvants include aluminum hydroxide gels such as MPL™ (3-O-deacylated monophosphoryl lipid A; Corixa, Hamilton, MT) and ALHYDROGEL™ (Brenntag Biosector, Denmark), as described in U.S. Patent No. 4,912,094, which are incorporated herein by reference as a whole; aluminum salts (aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc.), polymers or monomeric amino acids such as QS-21, polyglutamic acid, or polylysine, which may be used with or without immunostimulants such as MPL or 3-DMP.
[0107] Suitable adjuvants further comprise immunostimulatory oligonucleotides such as CpG oligonucleotides (see, for example, WO1998 / 040100, WO2010 / 067262, which are further described herein), saponin-containing liposomal adjuvants (as further described herein), or saponins and immunostimulatory oligonucleotides such as CpG oligonucleotides (see, for example, WO00 / 062800), which are incorporated herein by reference as a whole.
[0108] Other adjuvants include RC-529, GM-CSF, and complete Freund's adjuvants (CFA) and incomplete Freund's adjuvants (IFA). Yet another class of adjuvants includes glycolipid analogs, such as N-glycosylamides, N-glycosylureas, and N-glycosylcarbamates, each of which is substituted at sugar residues by amino acids.
[0109] The effective dose of an adjuvant, as described herein, refers to the amount necessary or sufficient to achieve the desired biological effect. For example, the effective dose of an adjuvant administered with an antigen to induce an antigen-specific immune response is the amount necessary to induce an immune response in response to the antigen upon exposure. By selecting from a variety of adjuvants in combination with the teachings provided herein, and considering factors such as efficacy, relative bioavailability, the subject's body weight, the severity of adverse side effects, and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and is nevertheless effective in treating a particular subject. The effective dose for any particular application may vary depending on factors such as the disease or condition being treated, the specific adjuvant administered, the size of the subject, or the severity of the disease or condition.
[0110] CpG Adjuvant In some embodiments, the immunogenic compositions described herein include C. difficile toxoids TxdA and TxdB, as well as immunostimulatory oligonucleotide adjuvants.
[0111] In a preferred embodiment, the immunostimulatory oligonucleotide adjuvant is a CpG oligonucleotide, most preferably a CpG oligodeoxynucleotide (CpG ODN), and therefore these terms are used interchangeably unless otherwise indicated. "CpG" refers to a cytosine-phosphoguanosine (CpG) motif-containing oligodeoxynucleotide (CpG ODN), which is a Toll-like receptor 9 (TLR9) agonist.
[0112] CpG oligonucleotides are short nucleic acid molecules containing cytosine linked by a phosphate bond, followed by guanine, where the pyrimidine ring of cytosine is unmethylated. A CpG motif is a base pattern containing an unmethylated central CpG surrounded by at least one base located on both sides (3' and 5' of the central CpG). CpG oligonucleotides include both D and K oligonucleotides. The entire CpG oligonucleotide may be unmethylated, or only a portion of it may be unmethylated. Examples of CpG oligonucleotides useful in the methods provided herein include those disclosed in U.S. Patents 6,194,388, 6,207,646, 6,214,806, 6,28,371, 6,239,116, and 6,339,068.
[0113] CpG oligonucleotides may encompass a wide range of chemical modifications and substitutions compared to native RNA and DNA, including phosphodiester nucleoside crosslinks, beta-D-ribose (deoxyribose) units, and / or native nucleoside bases (adenine, guanine, cytosine, thymine, uracil). Examples of chemical modifications are known to those skilled in the art, for example, Uhlmann E. et al. (1990), Chem. Rev. 90:543; "Protocols for Oligonucleotides and Analogs," Synthesis and Properties and Synthesis and Analytical Techniques, edited by S. Agrawal, Humana Press, Totowa, USA 1993; Crooke, ST. et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36:107~129; and Hunziker J. et al. (1995), Mod. Synth. Methods 7:331~417. Specifically, CpG oligonucleotides may contain modified cytosine. Modified cytosine is a naturally occurring or unnaturally occurring pyrimidine base analog of cytosine that can replace this base without impairing the immunostimulatory activity of the oligonucleotide. Modified cytosines include 5-substituted cytosines (e.g., 5-methylcytosine, 5-fluorocytosine, 5-chlorocytosine, 5-bromocytosine, 5-iodocytosine, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-difluoromethylcytosine, and unsubstituted or substituted 5-alkynylcytosine), 6-substituted cytosines, N4-substituted cytosines (e.g., N4-ethylcytosine), and 5-azacytosine. This includes, but is not limited to, 2-mercaptocytosine, isocytosine, pseudoisocytosine, cytosine analogs having a condensed ring system (e.g., N,N'-propylenecytosine or phenoxazine), and uracil and its derivatives (e.g., 5-fluorouracil, 5-bromouracil, 5-bromovinyluracil, 4-thiouracil, 5-hydroxyuracil, 5-propynyluracil).Preferred cytosines include 5-methylcytosine, 5-fluorocytosine, 5-hydroxycytosine, 5-hydroxymethylcytosine, and N4-ethylcytosine.
[0114] CpG oligonucleotides may also contain modified guanine. Modified guanine is a naturally occurring or unnaturally occurring purine base analog of guanine that can replace this base without impairing the immunostimulatory activity of the oligonucleotide. Modified guanines include, but are not limited to, 7-deeazaguanine, 7-deaza-7-substituted guanine, hypoxanthine, N2-substituted guanine (e.g., N2-methyl-guanine), 5-amino-3-methyl-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, adenine, substituted adenine (e.g., N6-methyl-adenine, 8-oxo-adenine), 8-substituted guanine (e.g., 8-hydroxyguanine and 8-bromoguanine), and 6-thioguanine. In some aspects of this disclosure, the guanine base is substituted with a universal base (e.g., 4-methyl-indole, 5-nitro-indole, and K-base), an aromatic ring system (e.g., benzimidazole or dichloro-benzimidazole, 1-methyl-1H-[1,2,4]triazole-3-carboxylic acid amide), or a hydrogen atom.
[0115] In certain embodiments, CpG oligonucleotides include a modified skeleton. Modification of the nucleic acid skeleton has been demonstrated to provide enhanced nucleic acid activity when administered in vivo. Secondary structures such as stem-loops can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be achieved by phosphate skeleton modification. Preferred stabilized nucleic acids have at least a partially phosphorothioate modified skeleton. Phosphothioates can be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistry. Aryl- and alkyl-phosphonates can be prepared, for example, as described in U.S. Patent No. 4,469,863; alkylphosphotriesters (where the charged oxygen moiety is alkylated, as described in U.S. Patent No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid-phase synthesis using commercially available reagents. Methods for other DNA skeletal modifications and substitutions are described (Uhlmann, E. and Peyman, A. (1990) Chem. Rev. 90:544; Goodchild, J. (1990) Bioconjugate Chem. 1:165). 2'-O-methyl nucleic acids with a CpG motif also induce immunoactivation, similar to ethoxy-modified CpG nucleic acids. In fact, no skeletal modification has been found that completely negates the CpG effect, although this is significantly reduced by replacing C with 5-methylC. Constructs with phosphorothioate linkages provide maximum activity and protect nucleic acids from degradation by intracellular exo- and endo-nucleases.
[0116] In one aspect of the present invention, the oligonucleotide comprises at least one phosphorothioate linkage. In another aspect, all internucleotide links in the oligonucleotide are phosphorothioate linkages. In another aspect, the oligonucleotide comprises at least one phosphodiester-like linkage. In another aspect, the phosphodiester-like linkage is a phosphodiester linkage. In another aspect, a lipophilic group is conjugated to the oligonucleotide. In one aspect, the lipophilic group is cholesterol.
[0117] In one embodiment, all internucleotide links of the CpG oligonucleotides disclosed herein are phosphodiester bonds ("soft" oligonucleotides as described in WO2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention are made resistant to degradation (e.g., stabilized). In one embodiment, all internucleotide links of the CpG oligonucleotides disclosed herein are phosphodiester bonds ("soft" oligonucleotides as described in WO2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention are made resistant to degradation (e.g., stabilized).
[0118] Immunostimulatory oligonucleotides may have a chimeric skeleton having a combination of phosphodiester and phosphorothioate linkages. For the purposes of the present invention, a chimeric skeleton refers to a partially stabilized skeleton in which at least one nucleotide linkage is a phosphodiester or phosphodiester-like linkage, at least one other nucleotide linkage is a stabilized nucleotide linkage, and at least one phosphodiester or phosphodiester-like linkage and at least one stabilized linkage are different. When the phosphodiester linkage is preferentially located within a CpG motif, such a molecule is referred to as “semi-soft” as described in WO2007 / 026190.
[0119] Other modified oligonucleotides include phosphodiester-modified oligonucleotides, combinations of phosphodiester and phosphorothioate oligonucleotides, methylphosphonates, methylphosphorothioates, phosphorordithioates, p-ethoxy, and combinations thereof. Each of these combinations and their specific effects on immune cells are discussed in more detail with respect to CpG nucleic acids in PCT Publications WO96 / 02555 and WO98 / 18810 and U.S. Patents 6,194,388 and 6,239,116.
[0120] Mixed skeletal modification ODNs can be synthesized as described in WO2007 / 026190. In one embodiment, the CpG oligonucleotides disclosed herein may include substitutions or modifications with bases and / or sugars, etc., as described in WO2007 / 026190.
[0121] In some aspects of the present invention, CpG-containing nucleic acids can be mixed with immunogenic carriers according to methods known to those skilled in the art (see, for example, WO03 / 024480).
[0122] CpG oligonucleotides may have one or two accessible 5' ends. For example, it is possible to create modified oligonucleotides having two such 5' ends by attaching two oligonucleotides via a 3'-3' linkage to produce oligonucleotides with one or two accessible 5' ends. The 3'-3' linkage may be a phosphodiester, phosphorothioate, or any other modified nucleoside crosslink. Methods for carrying out such linkages are known in the art. For example, such linkages are described in Seliger, H. et al., Oligonucleotide analogs with terminal 3'-3'- and 5'-5'-internucleotidic linkages as antisense inhibitors of viral gene expression, Nucleosides and Nucleotides (1991), 10(1-3), 469-477, and Jiang et al., Pseudo-cyclic oligonucleotides: in vitro and in vivo properties, Bioorganic and Medicinal Chemistry (1999), 7(12), 2727-2735.
[0123] Additionally, 3'-3' linked oligonucleotides where the linkage between 3'-terminal nucleosides is not a phosphodiester, phosphorothioate, or other modified bridge can be prepared using additional spacers such as tri- or tetra-ethylene glycol phosphate moieties (Durand, M. et al., Triple-helix formation by an oligonucleotide containing one (dA)12 and two (dT)12 sequences bridged by two hexaethylene glycol chains, Biochemistry (1992), 31(38), 9197-204, U.S. Pat. Nos. 5,658,738 and 5,668,265). Alternatively, non-nucleotide linkers can be derived from ethanediol, propanediol, or non-base deoxyribose (dSpacer) units using standard phosphoramidite chemistry (Fontanel, Marie Laurence et al., Nucleic Acids Research (1994), 22(11), 2022-7). Non-nucleotide linkers can be incorporated once or multiple times or combined with each other, allowing any desired distance between the 3'-termini of the two oligonucleotides to be ligated.
[0124] Phosphodiester internucleoside bridges located at the N3' and / or 5' termini of nucleosides can be replaced by modified internucleoside bridges, which can be, for example, phosphorothioate, phosphorodithioate, NR1R2-phosphoramidate, boranophosphate, α-hydroxybenzylphosphonate, phosphate-(C1-C 21 )-O-alkyl ester, phosphate-[(C6-C 21 )aryl-(C1-C 21 )-O-alkyl] ester, (C1-C8)alkylphosphonate and / or (C6-C 12 )arylphosphonate bridges, (C7-C- 12Selected from (C6~C)-α-hydroxymethylaryl (e.g., disclosed in PCT Publication WO95 / 01363), 12 )aryl, (C6~C 20 )aryl, and (C6~C 14 )aryl may be substituted with halogen, alkyl, alkoxy, nitro, or cyano, and R1 and R2 are independently of each other, hydrogen, (C1~C 18 )-alkyl, (C6~C 20 )-aryl, (C6~C 14 R1 and R2, together with the nitrogen atoms supporting them, form a 5-6 membered heterocycle which may further include additional heteroatoms selected from the O, S, and N groups.
[0125] Replacement of phosphodiester crosslinks located at the 3' and / or 5' ends of nucleosides by dephospho crosslinking (dephospho crosslinks are described, for example, in Uhlmann E. and Peyman A. in "Methods in Molecular Biology," Vol. 20, "Protocols for Oligonucleotides and Analogs," edited by S. Agrawal, Humana Press, Totowa 1993, Chapter 16, pp. 355 onwards), and the dephospho crosslinks are selected from, for example, formacetal, 3'-thioformacetal, methylhydroxylamine, oxime, methylenedimethylhydrazo, dimethylene sulfone, and / or silyl group dephospho crosslinks.
[0126] Various classes of CpG immunostimulatory oligonucleotides have been identified and are described in detail in WO2010 / 125480. The compositions and methods of the present invention involve the use of these various classes of CpG immunostimulatory oligonucleotides. In aspects of the present invention, the immunostimulatory oligonucleotides include, but are not limited to, oligonucleotides of any class having A, B, C, T, P, or E modifications.
[0127] In one aspect of the present invention, the immunogenic composition disclosed herein comprises a class A CpG oligonucleotide. In some aspects, the class A CpG oligonucleotide of the present invention comprises the nucleic acid sequence: 5'GGGGACGACGTCGTGGGGGGG3' (SEQ ID NO: 847).
[0128] In any of the Class A CpG oligonucleotide sequences, all linkages may be phosphorothioate links. In another embodiment, one or more linkages may preferably be phosphodiesters between the "C" and "G" of the CpG motif, forming a semi-soft CpG oligonucleotide. In any of these sequences, ethyluridine or a halogen may substitute for 5'T; examples of halogen substitutions include, but are not limited to, bromouridine or iodouridine substitutions.
[0129] In preferred embodiments of the present invention, the immunogenic compositions disclosed herein comprise B-class CpG ODNs that preferentially activate B cells. In one embodiment, the CpG oligonucleotide of the present invention is a B-class CpG oligonucleotide represented by at least the formula: 5'X1X2CGX3X43', where X1, X2, X3, and X4 are nucleotides. In one embodiment, X2 is adenine, guanine, or thymine. In another embodiment, X3 is cytosine, adenine, or thymine. The B-class CpG oligonucleotide sequences of the present invention may include those described in WO96 / 02555, WO98 / 18810, and U.S. Patents 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068.
[0130] In some embodiments, the B-class CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'TCGTCGTTTTTCGGTGCTTTT 3' (Sequence ID 48; CpG 24555), 5'TGACTGTGAACGTTCGAGATGA 3'(Sequence ID 841; CpG 1018); 5'TCGTCGTTTTGTCGTTTTGTCGTT 3'(Sequence ID 842; CpG 7909); 5'TCGTCGTTTTTCGGTCGTTTT 3'(Sequence ID 843; CpG 10103); 5'TCCATGACGTTCCTGACGTT 3'(Sequence ID 844; CpG 1826); 5'TCGTCGTTTCGTCGTTTTGTCGTT 3'(Sequence ID 845); and 5'TCGTCGTTTTGTCGTTTTTTTCGA 3'(Sequence ID 846) This may include, but is not limited to, those mentioned above.
[0131] In any of the B-class CpG oligonucleotide sequences, all linkages may be phosphorothioate links. In another embodiment, in any of these sequences, one or more linkages may preferably be phosphodiesters between the "C" and "G" of the CpG motif, forming a semi-soft CpG oligonucleotide. In any of these sequences, ethyluridine or a halogen may substitute for 5'T; examples of halogen substitutions include, but are not limited to, bromouridine or iodouridine substitutions.
[0132] In a preferred embodiment of the present invention, the CpG ODN comprises the nucleic acid sequence 5'T*C*G*T*C*G*T*T*T*T*C*G*G*T*G*C*T*T*T3' (SEQ ID NO: 48), where * indicates a phosphorothioate linkage. The CpG ODN of this sequence is known as CpG24555, described in WO2010 / 067262. CpG24555 is a TLR9 agonist with potent Th1 cell activity that stimulates strong B cell and NK cell activation.
[0133] In one aspect of the present invention, the immunogenic composition disclosed herein comprises a C-class CpG oligonucleotide. In some aspects, the C-class CpG oligonucleotide of the present invention comprises the following nucleic acid sequence: 5'TCGCGTCGTTCGGCGCGCGCCG 3'(Sequence ID 848); 5'TCGTCGACGTTCGGCGCGCGCCG 3'(Sequence ID 849); 5'TCGGACGTTCGGCGCGCGCCG 3'(Sequence ID 850); 5'TCGGACGTTCGGCGCGCCG 3'(Sequence ID 851); 5'TCGCGTCGTTCGGCGCGCCG 3'(Sequence ID 852); 5'TCGACGTTCGGCGCGCGCCG 3'(Sequence ID 853); 5'TCGACGTTCGGCGCGCCG 3'(Sequence ID 854); 5'TCGCGTCGTTCGGCGCCG 3'(Sequence ID 855); 5'TCGCGACGTTCGGCGCGCGCCG 3'(Sequence ID 856); 5'TCGTCGTTTTCGGCGCGCGCCG 3'(Sequence ID 857); 5'TCGTCGTTTTCGGCGGCCGCCG 3'(Sequence ID 858); 5'TCGTCGTTTTACGGCGCCGTGCCG 3'(Sequence ID 859); and 5'TCGTCGTTTTCGGCGCGCGCCGT 3'(Sequence ID 860) This may include, but is not limited to, those mentioned above.
[0134] In any of the C-class CpG oligonucleotide sequences, all linkages may be phosphorothioate links. In another embodiment, in any of these sequences, one or more linkages may preferably be phosphodiesters between the "C" and "G" of the CpG motif, forming a semi-soft CpG oligonucleotide. In any of these sequences, ethyluridine or a halogen may substitute for 5'T; examples of halogen substitutions include, but are not limited to, bromouridine or iodouridine substitutions.
[0135] In one aspect of the present invention, the immunogenic composition disclosed herein comprises a P-class CpG oligonucleotide. In some aspects, the CpG oligonucleotide of the present invention may comprise a P-class CpG oligonucleotide comprising a 5' TLR activation domain and at least two palindromic regions, one of which is a 5' palindromic region of at least 6 nucleotides in length and is directly or through a spacer attached to a 3' palindromic region of at least 8 nucleotides in length, and the oligonucleotide comprises at least one YpR dinucleotide. In one aspect, the P-class CpG oligonucleotide comprises at least one unmethylated CpG dinucleotide. In another aspect, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In yet another aspect, the TLR activation domain is located within the 5' palindromic region. In yet another aspect, the TLR activation domain is located immediately 5' of the 5' palindromic region. In some embodiments, the P-class CpG oligonucleotide of the present invention comprises the nucleic acid sequence: 5'TCGTCGACGATCGGCGCGCGCCG3' (SEQ ID NO: 861).
[0136] In any of the P-class CpG oligonucleotide sequences, all linkages may be phosphorothioate links. In another embodiment, one or more linkages may preferably be phosphodiesters between the "C" and "G" of the CpG motif, forming a semi-soft CpG oligonucleotide. In any of these sequences, ethyluridine or a halogen may substitute for 5'T; examples of halogen substitutions include, but are not limited to, bromouridine or iodouridine substitutions.
[0137] An immunogenic composition containing a CpG adjuvant may further comprise a buffer. Exemplary buffers include phosphate buffers (potassium phosphate, sodium phosphate, etc.); acetate buffers (sodium acetate, etc.); succinate buffers (sodium succinate, etc.); glycine buffer; histidine buffer; carbonate buffer, Tris buffer (tris(hydroxymethyl)aminomethane), and / or bicarbonate buffer (ammonium bicarbonate, etc.).
[0138] In a preferred embodiment, the CpG adjuvant may contain histidine buffer. Preferred amounts of histidine buffer include concentrations of about 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, 20 mM, 50 mM, or 100 mM. In one embodiment, the CpG adjuvant contains histidine buffer at a concentration of about 5 mM to about 15 mM. In another embodiment, the CpG adjuvant contains histidine buffer at a concentration of about 8 mM to about 12 mM. In a preferred embodiment, the CpG adjuvant contains histidine buffer at a concentration of about 10 mM.
[0139] In another embodiment, the CpG adjuvant may contain a phosphate buffer. Preferred amounts of the phosphate buffer include concentrations of about 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, 20 mM, 50 mM, or 100 mM. In one embodiment, the CpG adjuvant contains a phosphate buffer at a concentration of about 10 mM to about 25 mM. In a preferred embodiment, the CpG adjuvant contains a phosphate buffer at a concentration of about 20 mM phosphate.
[0140] CpG adjuvants may further contain salts. Exemplary salts include magnesium chloride, potassium chloride, sodium chloride, and combinations thereof.
[0141] In a preferred embodiment, the CpG adjuvant may contain sodium chloride (NaCl). Preferred amounts of sodium chloride include concentrations of at least about 10 mM, 20 mM, 25 mM, 30 mM, 40 mM, 50 mM, 60 mM, 75 mM, 80 mM, 90 mM, 100 mM, 125 mM, 150 mM, 175 mM, 200 mM, 225 mM, 250 mM, 270 mM, or 300 mM. In a preferred embodiment, the CpG adjuvant contains sodium chloride at a concentration of about 20 to about 100 mM. In a preferred embodiment, the CpG adjuvant contains sodium chloride at a concentration of about 40 to about 200 mM. In a preferred embodiment, the CpG adjuvant contains sodium chloride at a concentration of about 50 mM. In another preferred embodiment, the CpG adjuvant contains sodium chloride at a concentration of about 60 mM.
[0142] The doses of CpG oligonucleotides described herein may range from approximately 0.1 μg to 50 mg per dose, depending on the application. In some embodiments, the dose may range from approximately 10 μg to 10 mg per dose. In some embodiments, the immunogenic composition comprises CpG alone. In some embodiments, the immunogenic composition comprises CpG and an additional adjuvant.
[0143] In one embodiment, the immunogenic composition contains at least about 0.1 mg / mL, at least about 0.5 mg / mL, at least about 1.0 mg / mL, at least about 1.1 mg / mL, at least about 1.2 mg / mL, at least about 1.3 mg / mL, at least about 1.4 mg / mL, at least about 1.5 mg / mL, at least about 1.6 mg / mL, at least about 1.7 mg / mL, at least about 1.8 mg / mL, at least about 1.9 mg / mL, at least about 2.0 mg / mL, at least about 2.1 mg / mL, at least about 2.2 mg / mL, at least about 2.3 mg / mL, and at least Contains CpG of approximately 0.1 to 5 mg / mL or more, including CpG at concentrations of approximately 2.4 mg / mL, at least approximately 2.5 mg / mL, at least approximately 3.0 mg / mL, at least approximately 3.1 mg / mL, at least approximately 3.2 mg / mL, at least approximately 3.3 mg / mL, at least approximately 3.4 mg / mL, at least approximately 3.5 mg / mL, at least approximately 3.6 mg / mL, at least approximately 3.7 mg / mL, at least approximately 3.8 mg / mL, at least approximately 3.9 mg / mL, at least approximately 4.0 mg / mL, at least approximately 4.5 mg / mL, at least approximately 5.0 mg / mL, or higher.
[0144] In one embodiment, the immunogenic composition contains about 0.1 to about 1.0 mg / mL of CpG. In one preferred embodiment, the immunogenic composition contains about 0.5 mg / mL of CpG. In one embodiment, the immunogenic composition contains about 0.1 to about 1.0 mg / mL of CpG24555. In one preferred embodiment, the immunogenic composition contains about 0.5 mg / mL of CpG24555.
[0145] In one embodiment, the immunogenic composition contains about 0.5 to about 1.5 mg / mL of CpG. In one preferred embodiment, the immunogenic composition contains about 1.0 mg / mL of CpG. In one embodiment, the immunogenic composition contains about 0.5 to about 1.5 mg / mL of CpG24555. In one preferred embodiment, the immunogenic composition contains about 1.0 mg / mL of CpG24555.
[0146] In one embodiment, the immunogenic composition contains about 0.8 to about 1.8 mg / mL of CpG. In one preferred embodiment, the immunogenic composition contains about 1.2 mg / mL of CpG. In one embodiment, the immunogenic composition contains about 0.8 to about 1.8 mg / mL of CpG24555. In one preferred embodiment, the immunogenic composition contains about 1.2 mg / mL of CpG24555.
[0147] In one embodiment, the immunogenic composition contains about 3.0 to about 4.0 mg / mL of CpG. In one preferred embodiment, the immunogenic composition contains about 3.6 mg / mL of CpG. In one embodiment, the immunogenic composition contains about 3.0 to about 4.0 mg / mL of CpG24555. In one preferred embodiment, the immunogenic composition contains about 3.6 mg / mL of CpG24555.
[0148] In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoids A and B, reconstituted with a CpG adjuvant containing approximately 3.6 mg / mL of CpG24555 (high-dose CpG). In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoids A and B, reconstituted with a CpG adjuvant containing approximately 3.6 mg / mL of CpG24555 (high-dose CpG) in 10 mM histidine at pH 6.5 and 60 mM NaCl. In a preferred embodiment, the composition is administered in a dosing volume of 0.5 mL.
[0149] In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoids A and B totaling 0.4 mg / mL (200 μg / mL toxoid A and 200 μg / mL toxoid B), reconstituted with a CpG adjuvant containing approximately 3.6 mg / mL of CpG24555 (high-dose CpG). In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoids A and B totaling 0.4 mg / mL (200 μg / mL toxoid A and 200 μg / mL toxoid B), reconstituted with a CpG adjuvant containing approximately 3.6 mg / mL of CpG24555 (high-dose CpG) in 10 mM histidine and 60 mM NaCl at pH 6.5. In a preferred embodiment, the composition is administered in a dosage volume of 0.5 mL.
[0150] The immunogenic compositions containing CpG adjuvants disclosed herein may further contain additional adjuvants.
[0151] In one embodiment, the immunogenic composition comprising the CpG adjuvant disclosed herein may further comprise an aluminum salt (alum) (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide). In one embodiment, the immunogenic composition comprising the CpG adjuvant further comprises aluminum phosphate or aluminum hydroxide as the adjuvant. In a preferred embodiment, the immunogenic composition comprising the CpG adjuvant further comprises aluminum hydroxide (Al(OH)3).
[0152] In one embodiment, the immunogenic composition containing CpG is at least about 0.1 mg / mL, at least about 0.5 mg / mL, at least about 1.0 mg / mL, at least about 1.1 mg / mL, at least about 1.2 mg / mL, at least about 1.3 mg / mL, at least about 1.4 mg / mL, at least about 1.5 mg / mL, at least about 1.6 mg / mL, at least about 1.7 mg / mL, at least about 1.8 mg / mL, at least about 1.9 mg / mL, at least about 2.0 mg / mL, at least about 2.1 mg / mL, at least about 2.2 mg / mL, at least about 2.3 mg / mL, and at least about 2. It may further contain Al(OH)3 at concentrations of approximately 0.1 to 5 mg / mL or higher, including Al(OH)3 at concentrations of 4 mg / mL, at least about 2.5 mg / mL, at least about 3.0 mg / mL, at least about 3.1 mg / mL, at least about 3.2 mg / mL, at least about 3.3 mg / mL, at least about 3.4 mg / mL, at least about 3.5 mg / mL, at least about 3.6 mg / mL, at least about 3.7 mg / mL, at least about 3.8 mg / mL, at least about 3.9 mg / mL, at least about 4.0 mg / mL, at least about 4.5 mg / mL, at least about 5.0 mg / mL, or higher.
[0153] In one embodiment, the immunogenic composition containing CpG may further contain about 0.5 to about 2.5 mg / mL of Al(OH)3. In one embodiment, the immunogenic composition containing CpG may further contain about 1.0 to about 2.5 mg / mL of Al(OH)3. In one embodiment, the immunogenic composition containing CpG may further contain about 1.5 to about 2.5 mg / mL of Al(OH)3. In one preferred embodiment, the immunogenic composition containing CpG may further contain about 1.0 mg / mL of Al(OH)3. In one preferred embodiment, the immunogenic composition containing CpG may further contain about 1.5 mg / mL of Al(OH)3. In one preferred embodiment, the immunogenic composition containing CpG may further contain about 1.7 mg / mL of Al(OH)3. In one preferred embodiment, the immunogenic composition containing CpG may further contain about 1.8 mg / mL of Al(OH)3. In one preferred embodiment, the immunogenic composition containing CpG adjuvant may further contain about 2.0 mg / mL of Al(OH)3. In one preferred embodiment, the immunogenic composition containing CpG adjuvant may further contain about 2.5 mg / mL of Al(OH)3.
[0154] In one embodiment, the immunogenic composition contains approximately 0.5 mg / mL or more of CpG (e.g., CpG24555) and 1.0 mg / mL or more of Al(OH)3.
[0155] In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at concentrations of approximately 0.5 / 1.0, 0.5 / 1.5, 0.5 / 1.6, 0.5 / 1.7, 0.5 / 1.8, 0.5 / 1.9, 0.5 / 2.0, 0.5 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at concentrations of approximately 1.0 / 1.0, 1.0 / 1.5, 1.0 / 1.6, 1.0 / 1.7, 1.0 / 1.8, 1.0 / 1.9, 1.0 / 2.0, 1.0 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 1.1 / 1.0, 1.1 / 1.5, 1.1 / 1.6, 1.1 / 1.7, 1.1 / 1.8, 1.1 / 1.9, 1.1 / 2.0, 1.1 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 1.2 / 1.0, 1.2 / 1.5, 1.2 / 1.6, 1.2 / 1.7, 1.2 / 1.8, 1.2 / 1.9, 1.2 / 2.0, 1.2 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 1.3 / 1.0, 1.3 / 1.5, 1.3 / 1.6, 1.3 / 1.7, 1.3 / 1.8, 1.3 / 1.9, 1.3 / 2.0, 1.3 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 1.4 / 1.0, 1.4 / 1.5, 1.4 / 1.6, 1.4 / 1.7, 1.4 / 1.8, 1.4 / 1.9, 1.4 / 2.0, 1.4 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 1.5 / 1.0, 1.5 / 1.5, 1.5 / 1.6, 1.5 / 1.7, 1.5 / 1.8, 1.5 / 1.9, 1.5 / 2.0, 1.5 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 1.6 / 1.0, 1.6 / 1.5, 1.6 / 1.6, 1.6 / 1.7, 1.6 / 1.8, 1.6 / 1.9, 1.6 / 2.0, 1.6 / 2.5 mg / mL, or higher.In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at concentrations of approximately 1.7 / 1.0, 1.7 / 1.5, 1.7 / 1.6, 1.7 / 1.7, 1.7 / 1.8, 1.7 / 1.9, 1.7 / 2.0, 1.7 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at concentrations of approximately 1.8 / 1.0, 1.8 / 1.5, 1.8 / 1.6, 1.8 / 1.7, 1.8 / 1.8, 1.8 / 1.9, 1.8 / 2.0, 1.8 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 1.9 / 1.0, 1.9 / 1.5, 1.9 / 1.6, 1.9 / 1.7, 1.9 / 1.8, 1.9 / 1.9, 1.9 / 2.0, 1.9 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 2.0 / 1.0, 2.0 / 1.5, 2.0 / 1.6, 2.0 / 1.7, 2.0 / 1.8, 2.0 / 1.9, 2.0 / 2.0, 2.0 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 2.1 / 1.0, 2.1 / 1.5, 2.1 / 1.6, 2.1 / 1.7, 2.1 / 1.8, 2.1 / 1.9, 2.1 / 2.0, 2.1 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 2.2 / 1.0, 2.2 / 1.5, 2.2 / 1.6, 2.2 / 1.7, 2.2 / 1.8, 2.2 / 1.9, 2.2 / 2.0, 2.2 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 2.3 / 1.0, 2.3 / 1.5, 2.3 / 1.6, 2.3 / 1.7, 2.3 / 1.8, 2.3 / 1.9, 2.3 / 2.0, 2.3 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 2.4 / 1.0, 2.4 / 1.5, 2.4 / 1.6, 2.4 / 1.7, 2.4 / 1.8, 2.4 / 1.9, 2.4 / 2.0, 2.4 / 2.5 mg / mL, or higher.In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 2.5 / 1.0, 2.5 / 1.5, 2.5 / 1.6, 2.5 / 1.7, 2.5 / 1.8, 2.5 / 1.9, 2.5 / 2.0, 2.5 / 2.5 mg / mL, or higher.
[0156] In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoid A and toxoid B, reconstituted with a CpG adjuvant (low-dose CpG) containing approximately 1.0 mg / mL of CpG24555 and approximately 1.5 mg / mL of Al(OH)3. In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoid A and toxoid B, reconstituted with a CpG adjuvant (low-dose CpG) containing approximately 1.0 mg / mL of CpG24555 and approximately 1.5 mg / mL of Al(OH)3 in 10 mM histidine at pH 6.5 and 50 mM NaCl. In a preferred embodiment, the composition is administered in a dosage volume of 0.5 mL.
[0157] In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoids A and B totaling 0.4 mg / mL (200 μg / mL toxoid A and 200 μg / mL toxoid B), reconstituted with approximately 1.0 mg / mL of CpG24555 and approximately 1.5 mg / mL of Al(OH)3 (low-dose adjuvant). In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoids A and B in total (200 μg / mL toxoid A and 200 μg / mL toxoid B), reconstituted with 10 mM histidine at pH 6.5, approximately 1.0 mg / mL of CpG24555 and approximately 1.5 mg / mL of Al(OH)3 (low-dose adjuvant) in 50 mM NaCl. In a preferred embodiment, the composition is administered in a dosing volume of 0.5 mL.
[0158] In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at concentrations of approximately 3.0 / 1.0, 3.0 / 1.5, 3.0 / 1.6, 3.0 / 1.7, 3.0 / 1.8, 3.0 / 1.9, 3.0 / 2.0, 3.0 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at concentrations of approximately 3.1 / 1.0, 3.1 / 1.5, 3.1 / 1.6, 3.1 / 1.7, 3.1 / 1.8, 3.1 / 1.9, 3.1 / 2.0, 3.1 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 3.2 / 1.0, 3.2 / 1.5, 3.2 / 1.6, 3.2 / 1.7, 3.2 / 1.8, 3.2 / 1.9, 3.2 / 2.0, 3.2 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 3.3 / 1.0, 3.3 / 1.5, 3.3 / 1.6, 3.3 / 1.7, 3.3 / 1.8, 3.3 / 1.9, 3.3 / 2.0, 3.3 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 3.4 / 1.0, 3.4 / 1.5, 3.4 / 1.6, 3.4 / 1.7, 3.4 / 1.8, 3.4 / 1.9, 3.4 / 2.0, 3.4 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 3.5 / 1.0, 3.5 / 1.5, 3.5 / 1.6, 3.5 / 1.7, 3.5 / 1.8, 3.5 / 1.9, 3.5 / 2.0, 3.5 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at concentrations of approximately 3.6 / 1.0, 3.6 / 1.5, 3.6 / 1.6, 3.6 / 1.7, 3.6 / 1.8, 3.6 / 1.9, 3.6 / 2.0, 3.6 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at concentrations of approximately 3.7 / 1.0, 3.7 / 1.5, 3.7 / 1.6, 3.7 / 1.7, 3.7 / 1.8, 3.7 / 1.9, 3.7 / 2.0, 3.7 / 2.5 mg / mL, or higher.In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 3.8 / 1.0, 3.8 / 1.5, 3.8 / 1.6, 3.8 / 1.7, 3.8 / 1.8, 3.8 / 1.9, 3.8 / 2.0, 3.8 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 3.9 / 1.0, 3.9 / 1.5, 3.9 / 1.6, 3.9 / 1.7, 3.9 / 1.8, 3.9 / 1.9, 3.9 / 2.0, 3.9 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 4.0 / 1.0, 4.0 / 1.5, 4.0 / 1.6, 4.0 / 1.7, 4.0 / 1.8, 4.0 / 1.9, 4.0 / 2.0, 4.0 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 4.5 / 1.0, 4.5 / 1.5, 4.5 / 1.6, 4.5 / 1.7, 4.5 / 1.8, 4.5 / 1.9, 4.5 / 2.0, 4.5 / 2.5 mg / mL, or higher. In one embodiment, the immunogenic composition contains CpG / Al(OH)3 at a concentration of approximately 5.0 / 1.0, 5.0 / 1.5, 5.0 / 1.6, 5.0 / 1.7, 5.0 / 1.8, 5.0 / 1.9, 5.0 / 2.0, 5.0 / 2.5 mg / mL, or higher.
[0159] Saponin-containing liposomal adjuvant In some embodiments, the immunogenic compositions described herein include C. difficile toxoids TxdA and TxdB, as well as a saponin-containing liposome adjuvant.
[0160] Saponin-containing liposome adjuvants may include, but are not limited to, STIMULON® (QS-21 (Quillaja Saponaria)-21, Aquila, Framingham, Mass.), which is a triterpene glycoside or saponin, or ISCOM (Immunostimulatory Complex) and ISCOMATRIX® adjuvants, and particles generated therefrom. Accordingly, the compositions of the present invention may be delivered in the form of ISCOM, ISCOM containing CTB, liposomes, or encapsulated in compounds such as acrylates or poly(DL-lactide-co-glycoside) to form microspheres of an adsorption-appropriate size. Typically, the term "ISCOM" refers to an immunogenic complex formed between a glycoside such as a triterpenoid saponin (particularly Quil A) and an antigen containing a hydrophobic region. In a preferred embodiment, the adjuvant is ISCOMATRIX adjuvant.
[0161] In a further preferred embodiment, the saponin-containing liposome adjuvant comprises a liposome composition containing at least one saponin and monophosphoryl lipid A (MPLA). In one embodiment, the saponin-containing liposome adjuvant comprises a liposome composition containing at least one saponin and monophosphoryl lipid A (MPLA), wherein the liposome composition comprises i) a lipid bilayer containing phospholipids and ii) cholesterol.
[0162] In one embodiment, the saponin may be selected from QS-7, QS-18, QS-21, or a mixture thereof. Preferably, the saponin is QS-21.
[0163] In one embodiment, the phospholipid is selected from dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl phosphatidylglycerol (DPPG), and distearyl phosphatidylglycerol (DSPG). Preferably, the phospholipids are DMPC and DMPG.
[0164] In a preferred embodiment, the saponin-containing liposome adjuvant comprises QS-21, MPLA, DMPC, DMPG, and cholesterol. In a preferred embodiment, the saponin-containing liposome adjuvant comprises QS-21, MPLA, DMPC, DMPG, and cholesterol in a phosphate buffer. MPLA is preferably monophosphoryl 3-deacyllipid A (also known as 3D-PHAD®). 3D-PHAD® is a synthetic analog of MPLA derived from Salmonella Minnesota. In a preferred embodiment, the saponin-containing liposome adjuvant comprises QS-21, MPLA (3D-PHAD®), DMPC, DMPG, and cholesterol.
[0165] In one embodiment, the immunogenic composition contains QS-21 in concentrations of approximately 0.05 to approximately 1.0 mg / mL or higher, including QS-21 in concentrations of approximately 0.05 mg / mL, approximately 0.1 mg / mL, approximately 0.2 mg / mL, approximately 0.3 mg / mL, approximately 0.4 mg / mL, approximately 0.5 mg / mL, approximately 0.6 mg / mL, approximately 0.7 mg / mL, approximately 0.8 mg / mL, approximately 0.9 mg / mL, or approximately 1.0 mg / mL or higher.
[0166] In one embodiment, the immunogenic composition contains about 0.1 to about 0.4 mg / mL of QS-21. In one preferred embodiment, the immunogenic composition contains about 0.2 mg / mL of QS-21.
[0167] In one embodiment, the immunogenic composition contains MPLA (preferably monophosphoryl 3-deacyllipid A) in concentrations of approximately 0.1 mg / mL, approximately 0.2 mg / mL, approximately 0.3 mg / mL, approximately 0.4 mg / mL, approximately 0.5 mg / mL, approximately 0.6 mg / mL, approximately 0.7 mg / mL, approximately 0.8 mg / mL, approximately 0.9 mg / mL, or approximately 1.0 mg / mL, or higher, with a total MPLA concentration of approximately 0.1 to approximately 1.0 mg / mL or higher.
[0168] In one embodiment, the immunogenic composition contains about 0.2 to about 0.6 mg / mL of MPLA (preferably monophosphoryl 3-deacyl lipid A).
[0169] In one preferred embodiment, the immunogenic composition contains about 0.3 to about 0.5 mg / mL of MPLA (preferably monophosphoryl 3-deacyl lipid A).
[0170] In one preferred embodiment, the immunogenic composition contains about 0.4 mg / mL of MPLA (preferably monophosphoryl 3-deacyl lipid A).
[0171] In one embodiment, the immunogenic composition contains cholesterol ranging from approximately 0.5 to approximately 20 mg / mL or more, including cholesterol at concentrations of approximately 1.0 mg / mL, approximately 2.0 mg / mL, approximately 3.0 mg / mL, approximately 4.0 mg / mL, approximately 5.0 mg / mL, approximately 6.0 mg / mL, approximately 7.0 mg / mL, approximately 8.0 mg / mL, approximately 9.0 mg / mL, approximately 10.0 mg / mL, approximately 11.0 mg / mL, approximately 12.0 mg / mL, approximately 13.0 mg / mL, approximately 14.0 mg / mL, approximately 15.0 mg / mL, approximately 16.0 mg / mL, approximately 17.0 mg / mL, approximately 18.0 mg / mL, approximately 19.0 mg / mL, approximately 20.0 mg / mL, or higher.
[0172] In one embodiment, the immunogenic composition contains about 5 to about 15 mg / mL of cholesterol. In one preferred embodiment, the composition contains about 11 mg / mL of cholesterol.
[0173] In one embodiment, the immunogenic composition contains DMPC in concentrations of approximately 0.5 to approximately 20 mg / mL or higher, including approximately 0.5 mg / mL, approximately 1.0 mg / mL, approximately 2.0 mg / mL, approximately 3.0 mg / mL, approximately 4.0 mg / mL, approximately 5.0 mg / mL, approximately 6.0 mg / mL, approximately 7.0 mg / mL, approximately 8.0 mg / mL, approximately 9.0 mg / mL, approximately 10.0 mg / mL, approximately 11.0 mg / mL, approximately 12.0 mg / mL, approximately 13.0 mg / mL, approximately 14.0 mg / mL, approximately 15.0 mg / mL, approximately 16.0 mg / mL, approximately 17.0 mg / mL, approximately 18.0 mg / mL, approximately 19.0 mg / mL, approximately 20.0 mg / mL, or higher.
[0174] In one embodiment, the immunogenic composition contains about 5 to about 20 mg / mL of DMPC. In one embodiment, the immunogenic composition contains about 5 to about 15 mg / mL of DMPC. In one preferred embodiment, the immunogenic composition contains about 14 mg / mL of DMPC.
[0175] In one embodiment, the immunogenic composition contains DMPG in concentrations of approximately 0.5 to approximately 3.0 mg / mL or higher, including DMPG in concentrations of approximately 0.5 mg / mL, approximately 0.6 mg / mL, approximately 0.7 mg / mL, approximately 0.8 mg / mL, approximately 0.9 mg / mL, approximately 1.0 mg / mL, approximately 1.1 mg / mL, approximately 1.2 mg / mL, approximately 1.3 mg / mL, approximately 1.4 mg / mL, approximately 1.5 mg / mL, approximately 1.6 mg / mL, approximately 1.7 mg / mL, approximately 1.8 mg / mL, approximately 1.9 mg / mL, approximately 2.0 mg / mL, or higher, at least approximately 2.5 mg / mL, or at least approximately 3.0 mg / mL, or higher.
[0176] In one embodiment, the immunogenic composition contains about 1.0 to about 2.0 mg / mL of DMPG. In one preferred embodiment, the immunogenic composition contains about 1.6 mg / mL of DMPG.
[0177] In a preferred embodiment, the immunogenic composition comprising a saponin-containing liposomal adjuvant contains approximately 0.2 mg / mL of QS-21, approximately 0.4 mg / mL of monophosphoryl 3-deacyllipid A (also known as 3D-PHAD®), approximately 14 mg / mL of DMPC, approximately 1.6 mg / mL of DMPG, and approximately 11 mg / mL of cholesterol (LiNA-2).
[0178] In another embodiment, the immunogenic composition comprising a saponin-containing liposome adjuvant contains approximately 0.4 mg / mL of QS-21, approximately 0.8 mg / mL of monophosphoryl 3-deacyllipid A (also known as 3D-PHAD®), approximately 28 mg / mL of DMPC, approximately 3.2 mg / mL of DMPG, and approximately 22 mg / mL of cholesterol.
[0179] In another embodiment, the immunogenic composition comprising a saponin-containing liposomal adjuvant contains approximately 0.1 mg / mL of QS-21, approximately 0.2 mg / mL of monophosphoryl 3-deacyllipid A (also known as 3D-PHAD®), approximately 7 mg / mL of DMPC, approximately 0.8 mg / mL of DMPG, and approximately 5.5 mg / mL of cholesterol.
[0180] In another embodiment, the immunogenic composition comprising a saponin-containing liposome adjuvant may further comprise a buffer. Exemplary buffers include phosphate buffers (potassium phosphate, sodium phosphate, etc.); acetate buffers (sodium acetate, etc.); succinate buffers (sodium succinate, etc.); glycine buffers; histidine buffers; carbonate buffers, Tris buffers (tris(hydroxymethyl)aminomethane), and / or bicarbonate buffers (ammonium bicarbonate, etc.).
[0181] In a preferred embodiment, the composition comprising the saponin-containing liposome adjuvant may comprise a phosphate buffer. Preferred amounts of the phosphate buffer include concentrations of 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, 20 mM, 50 mM, or 100 mM. In one embodiment, the saponin-containing liposome adjuvant comprises a phosphate buffer at a concentration of about 5 mM to about 15 mM. In another embodiment, the saponin-containing liposome adjuvant comprises a phosphate buffer at a concentration of about 8 mM to 12 mM. In a preferred embodiment, the saponin-containing liposome adjuvant comprises a phosphate buffer at a concentration of about 10 mM.
[0182] Saponin-containing liposome adjuvants may further contain salts. Exemplary salts include magnesium chloride, potassium chloride, sodium chloride, and combinations thereof.
[0183] In a preferred embodiment, the saponin-containing liposome adjuvant contains sodium chloride (NaCl). Preferred amounts of sodium chloride include concentrations of at least about 10 mM, 20 mM, 25 mM, 30 mM, 40 mM, 50 mM, 60 mM, 75 mM, 80 mM, 90 mM, 100 mM, 125 mM, 150 mM, 175 mM, 200 mM, 225 mM, 250 mM, 270 mM, or 300 mM. In a preferred embodiment, the saponin-containing liposome adjuvant contains sodium chloride at a concentration of about 100 to about 200 mM. In a preferred embodiment, the saponin-containing liposome adjuvant contains sodium chloride at a concentration of about 150 mM.
[0184] In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoids A and B, reconstituted with a saponin-containing liposomal adjuvant (LiNA-2) containing approximately 0.2 mg / mL QS-21, approximately 0.4 mg / mL monophosphoryl 3-deacyllipid A (also known as 3D-PHAD®), approximately 14 mg / mL DMPC, approximately 1.6 mg / mL DMPG, and approximately 11 mg / mL cholesterol. In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoids A and B, reconstituted with a saponin-containing liposomal adjuvant (LiNA-2) containing approximately 0.2 mg / mL QS-21, approximately 0.4 mg / mL monophosphoryl 3-deacyllipid A (also known as 3D-PHAD®), approximately 14 mg / mL DMPC, approximately 1.6 mg / mL DMPG, and approximately 11 mg / mL cholesterol in 10 mM phosphate at pH 6.2. In a preferred embodiment, the composition is administered in a dosage volume of 0.5 mL.
[0185] In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoids A and B totaling 0.4 mg / mL (200 μg / mL toxoid A and 200 μg / mL toxoid B) reconstituted with a saponin-containing liposomal adjuvant (LiNA-2) containing approximately 0.2 mg / mL QS-21, approximately 0.4 mg / mL monophosphoryl 3-deacyllipid A (also known as 3D-PHAD®), approximately 14 mg / mL DMPC, approximately 1.6 mg / mL DMPG, and approximately 11 mg / mL cholesterol. In a preferred embodiment, the immunogenic composition comprises lyophilized C. difficile toxoids A and B, reconstituted with a saponin-containing liposomal adjuvant (LiNA-2) containing approximately 0.2 mg / mL QS-21, approximately 0.4 mg / mL monophosphoryl 3-deacyllipid A (also known as 3D-PHAD®), approximately 14 mg / mL DMPC, approximately 1.6 mg / mL DMPG, and approximately 11 mg / mL cholesterol in 10 mM phosphate at pH 6.2. In a preferred embodiment, the composition is administered in a dosage volume of 0.5 mL.
[0186] As used herein, “liposome” refers to a closed bilayer membrane containing an encapsulated aqueous volume. Liposomes can be monolayer vesicles possessing a single membrane bilayer, or multilayer vesicles possessing multiple membrane bilayers, each separated from its neighbor by an aqueous layer. The resulting membrane bilayer structure is such that the hydrophobic (nonpolar) tail of the lipid is directed toward the center of the bilayer, while the hydrophilic (polar) head is directed toward the aqueous phase. Liposomes consist of a smectic intermediate phase, as they are commonly used, and can consist of either a phospholipid or nonphospholipid smectic intermediate phase. The smectic intermediate phase is best described by Small, HANDBOOK OF LIPID RESEARCH, Vol. 4, Plenum, NY, 1986, pp. 49-50.
[0187] Saponin-containing liposome adjuvants may be homogeneous or heterogeneous. As used herein, the term “homogeneous” means a final adjuvant formulation containing liposomes having a size range of 30–400 nm, as determined by methods known in the art, including but not limited to dynamic light scattering (DLS), transmission electron cryomicroscopy (e.g., cryoTEM or cryoEM), and nanoparticle tracking analysis (NTA, e.g., ViewSizer). A “homogeneous” adjuvant formulation may also mean a final adjuvant formulation containing liposomes having a polydispersity index (PDI) of about 0.05–0.5 or about 0.05–0.3, preferably about 0.3.
[0188] As used herein, the term “heterogeneous” means a final adjuvant formulation containing liposomes having varying sizes ranging from 30 nm to over 10 micrometers, about 30 nm to 4 micrometers, about 30 nm to 1400 nm, preferably about 30 nm to 1000 nm, as determined by methods known in the art, including but not limited to dynamic light scattering (DLS), transmission electron microscopy (e.g., cryoTEM or cryoEM), and nanoparticle tracking analysis (NTA, e.g., ViewSizer). A “heterogeneous” adjuvant formulation may also mean a final adjuvant formulation containing liposomes having a polydispersity index (PDI) of >0.5. The calculations used to determine the size and PDI parameters can be found in ISO standard documents 13321:1996 E and ISO 22412:2008 (Worldwide MIDynamic Light Scattering, Common Terms Defined. Malvern Instruments Limited; Malvern, UK:2011, pp. 1-6, Inform White Paper). As used herein, “heterogeneous” adjuvant formulations also mean “polydispersible” adjuvant formulations. As used herein, the term “about” refers to ±5% of the reference value.
[0189] In one embodiment, the saponin-containing liposome adjuvant of the present invention is homogeneous. In another embodiment, the saponin-containing liposome adjuvant of the present invention is heterogeneous.
[0190] Unless otherwise noted, the saponin-containing liposome adjuvants used in the embodiments of this application are heterogeneous saponin-containing liposome adjuvants.
[0191] In one embodiment, saponin-containing liposomal adjuvants are produced according to the processes and methods described in U.S. Provisional Applications No. 63 / 319,418 and No. 63 / 485,964, and International Publication No. WO2023 / 175454, whose disclosures are incorporated herein by reference as a whole. Multiple processes are described for preparing heterogeneous and homogeneous liposomal adjuvant formulations expandable for manufacture.
[0192] In the present invention, the saponin-containing liposome adjuvant is a phospholipid selected from (a) monophosphoryl lipid A (MPLA), (b) saponin, and (c)(i) phosphatidylcholine (PC) and / or phosphatidylglycerol (PG), wherein the phospholipid is dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl A homogeneous adjuvant formulation comprising a liposome bilayer comprising a liposome composition comprising (ii) cholesterol, wherein the molar percentage concentration of cholesterol in the liposome composition is higher than 50% (mol / mol), or the molar ratio of cholesterol to phospholipid is greater than 1, and the method is as follows: (i) A step of dissolving phospholipids, cholesterol, and MPLA in an organic solvent to form an organic phase; (ii) A step of injecting the organic phase of step (i) into the aqueous phase at a specific flow rate and a specific ratio of organic relative aqueous phase to form liposomes; (iii) A step of stirring the liposomes from step (ii) to form intermediate liposomes; (iv) A step to remove the organic phase of the intermediate liposome from step (iii); (v) A step of concentrating the intermediate liposomes of step (iv); and (vi) A step of compounding the intermediate liposomes from step (v) with saponins to form a final adjuvant formulation having a polydispersity of 0.05 to 0.5 and a size range of approximately 30 to 400 nm. It contains, thereby producing a homogeneous adjuvant formulation.
[0193] In one embodiment of the first method for producing a homogeneous adjuvant composition, in step (i), the phospholipid, cholesterol, and MPLA are dissolved in an organic solvent by sonication, heating, or a combination thereof, preferably by heating. In one embodiment, the organic solvent is ethanol or isopropyl alcohol. In another embodiment, the organic phase is heated to a temperature of 45°C to 65°C.
[0194] In another embodiment of the first method for producing a homogeneous adjuvant composition, the aqueous phase comprises water and, optionally, a buffer. In a preferred embodiment, the buffer comprises a 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In another embodiment, the aqueous phase is at a temperature of 20°C to 60°C. In another embodiment, the flow rate of step (ii) is 0.5 mL / min to 400 mL / min, or rapid addition. In another embodiment, the flow rate of step (ii) is 0.5 mL / min to 400 mL / min. In another embodiment, the injection of step (ii) is carried out by rapid injection of the organic phase of step (i).
[0195] In another aspect of the first method for producing a homogeneous adjuvant composition, the intermediate liposomes in step (iii) are stirred at a speed of 700 rpm to 900 rpm.
[0196] In another embodiment of the first method for producing a homogeneous adjuvant composition, the ratio of the organic relative aqueous phases in step (ii) ranges from 1:4 to 1:16. In a preferred embodiment, the ratio is 1:8.
[0197] In another embodiment of the first method for producing a homogeneous adjuvant composition, the size of the intermediate liposomes in step (iv) is reduced by using a high-pressure extruder or a microfluidic homogenizer. In one embodiment, the size of the liposomes is reduced in step (iv) by using a membrane size ranging from 50 nm to 120 nm, or a homogenization pressure of 17,000 PSI to 24,000 PSI, or a combination of both.
[0198] In another aspect of the first method for producing a homogeneous adjuvant composition, the organic solvent is removed before or after the reduction in step (iv). In one aspect, the step of removing the organic phase of the intermediate liposomes in step (iv) is by tangential flow filtration (TFF). In another aspect, the TFF is TFF dialysis filtration. In another aspect, the TFF comprises a membrane having a molecular weight cutoff (MWCO) ranging from 100 to 500 kDa.
[0199] In another embodiment of the first method for producing a homogeneous adjuvant composition, the concentration step of step (v) is performed by ultrafiltration. In one embodiment, the ultrafiltration includes a bioburden reduction filter and a sterile filter.
[0200] In another embodiment of the first method for producing a homogeneous adjuvant composition, the compounding step (vi) is performed at a mixing rate of 300 rpm. In one embodiment, the compounding step (vi) lasts from 1 hour to 24 hours. In another embodiment, the compounding step (vi) occurs at room temperature or 2 to 8°C.
[0201] In another embodiment of the first method for producing a homogeneous adjuvant composition, the final adjuvant formulation has a size range of approximately 30 nm to 400 nm.
[0202] In another embodiment of the first method for producing a homogeneous adjuvant composition, the final adjuvant formulation has a polydispersity of 0.05 to 0.5.
[0203] In a further embodiment of the first method for producing a homogeneous adjuvant composition, the injection step of step (ii) is performed by pump or syringe injection. In a preferred embodiment, the injection step of step (ii) is performed by pump.
[0204] In one embodiment, the saponin-containing liposome adjuvant is (a) a monophosphoryl lipid A (MPLA), (b) a saponin, and (c)(i) at least one phospholipid selected from phosphatidylcholine (PC) and / or phosphatidylglycerol (PG), wherein the phospholipid is dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl A homogeneous adjuvant formulation comprising a liposome bilayer comprising a liposome composition comprising (ii) cholesterol, wherein the molar percentage concentration of cholesterol in the liposome composition is higher than 50% (mol / mol), or the molar ratio of cholesterol to phospholipid is greater than 1, and the method is as follows: (i) Dissolving phospholipids, cholesterol, and MPLA in an organic solvent or a mixture of organic solvents to form an organic phase; (ii) A step of injecting the organic phase of step (i) into the aqueous phase at a specific flow rate and a specific ratio of organic relative aqueous phase to form intermediate liposomes; (iii) A step of concentrating the intermediate liposomes from step (ii); (iv) A step to remove the organic phase of the intermediate liposome from step (iii); (v) A step of filtering the intermediate liposomes from step (iv); and (vi) A step of compounding the intermediate liposomes from step (v) with saponins to form a final adjuvant formulation having a polydispersity of 0.05 to 0.5 and a size range of approximately 30 to 400 nm. It contains, thereby producing a homogeneous adjuvant formulation.
[0205] In another embodiment of the second method for producing a homogeneous adjuvant composition, in step (i), the phospholipid, cholesterol, and MPLA are dissolved in an organic solvent by sonication, heating, stirring, or a combination thereof. In one embodiment, the organic solvent is ethanol or isopropyl alcohol or other organic solvents. In another embodiment, the organic phase is heated to a temperature of 45°C to 65°C, preferably 50°C to 65°C or 45°C to 55°C.
[0206] In another embodiment of the second method for producing a homogeneous adjuvant composition, the aqueous phase comprises water and, optionally, a buffer. In one embodiment, the buffer contains 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In a preferred embodiment, the aqueous phase is 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In another embodiment, the aqueous phase is at a temperature of 20°C to 65°C. In another embodiment, the flow rate of step (ii) is 5 mL / min to 15 mL / min. In another embodiment, the flow rate of step (ii) is 12 mL / min. In another embodiment, the intermediate liposomes in step (ii) are stirred at a speed of 100 rpm to 1000 rpm. In another embodiment, the ratio of the organic-to-aqueous aqueous phase in step (ii) ranges from 1:2 to 1:16. In a preferred embodiment, the ratio is 4:7.
[0207] In another aspect of the second method for producing a homogeneous adjuvant composition, the concentration step of step (iii) is performed by ultrafiltration.
[0208] In another aspect of the second method for producing a homogeneous adjuvant composition, the step of removing the organic phase of the intermediate liposomes in step (iv) is performed by tangential flow filtration (TFF). In one aspect, the TFF is TFF diafiltration. In another aspect, the TFF comprises a membrane having a molecular weight cutoff (MWCO) ranging from 100 to 500 kDa.
[0209] In another embodiment of the second method for producing a homogeneous adjuvant composition, the filtration step of step (v) includes a bioburden reduction filter and a sterile filter.
[0210] In another aspect of the second method for producing a homogeneous adjuvant composition, the compounding step (vi) is performed at a mixing rate of 350 rpm per hour at room temperature.
[0211] In another aspect of the second method for producing a homogeneous adjuvant composition, the final adjuvant formulation has a size range of approximately 50 nm to 200 nm. Preferably, the final adjuvant formulation has a size of approximately 100 nm.
[0212] In another aspect of the second method for producing a homogeneous adjuvant composition, the final adjuvant formulation has a polydispersity of 0.05 to 0.5. Preferably, the final adjuvant formulation has a PDI of <0.2.
[0213] In a further embodiment of the second method for producing a homogeneous adjuvant composition, the injection step of step (ii) is performed by pump or syringe injection. In a preferred embodiment, the injection step of step (ii) is performed by pump.
[0214] In another embodiment, the saponin-containing liposome adjuvant is (a) monophosphoryl lipid A (MPLA), (b) saponin, and (c)(i) phosphatidylcholine (PC) and / or phosphatidylglycerol (PG), wherein the phospholipid is dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl A heterogeneous adjuvant preparation comprising a liposome bilayer comprising a liposome composition comprising (ii) cholesterol, wherein the molar percentage concentration of cholesterol in the liposome composition is higher than 50% (mol / mol), or the molar ratio of cholesterol to phospholipid is greater than 1, and the method is (i) A step of dissolving phospholipids, cholesterol, and MPLA in an organic solvent to form a lipid solution as an organic phase; (ii) A step of simultaneously injecting the organic phase and aqueous phase from step (i) together at a specific flow rate and a specific ratio of the aqueous phase to the organic solvent to form liposomes; (iii) A step of concentrating the intermediate liposomes from step (ii); (iv) A step to remove the organic phase of the intermediate liposome from step (iii); (v) A step of processing the intermediate liposomes from step (iv) with a microfluidizer for 10 passes at approximately 17,500 psi; (vi) filtering the intermediate liposomes from step (v) using a 0.22 μm membrane; and (vii) A step of compounding the intermediate liposomes from step (vi) with saponins. It contains, thereby producing heterogeneous adjuvant formulations.
[0215] In another aspect of the first method for producing heterogeneous adjuvant formulations, in step (i), phospholipids, cholesterol, and MPLA are dissolved in an organic solvent by sonication, heating, stirring, or a combination thereof. In one aspect, the organic solvent is ethanol or isopropyl alcohol or a mixture thereof. In another aspect, the lipid formulation organic phase is heated to a temperature of 45–65°C.
[0216] In another embodiment of the first method for producing a heterogeneous adjuvant formulation, the aqueous phase comprises water and, optionally, a buffer. In one embodiment, the buffer contains 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In a preferred embodiment, the aqueous phase is 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In another embodiment, the aqueous phase is at a temperature of 45–60°C.
[0217] In another aspect of the first method for producing heterogeneous adjuvant formulations, in step (ii), the organic phase has a flow rate of 0.5 to 2 ml / min and the aqueous phase has a flow rate of 5 to 15 ml / min. In another aspect of the third method, in step (ii), the organic phase has a flow rate of 1.333 ml / min and the aqueous phase has a flow rate of 10.667 ml / min.
[0218] In another aspect of the first method for producing heterogeneous adjuvant formulations, the intermediate liposomes in step (iii) are stirred at a speed of 100 rpm to 900 rpm.
[0219] In another embodiment of the first method for producing heterogeneous adjuvant formulations, the ratio of the organic relative aqueous phases in step (ii) ranges from 1:4 to 1:8. In a preferred embodiment, the ratio is 1:8.
[0220] In another aspect of the first method for producing heterogeneous adjuvant formulations, the step of removing the organic phase of intermediate liposomes in steps (iii) and (iv) is performed by tangential flow filtration (TFF). In one aspect, the TFF is TFF ultrafiltration and dialysis filtration. In another aspect, the TFF comprises a membrane having a molecular weight cutoff (MWCO) ranging from 100 to 500 kDa.
[0221] In another aspect of the first method for producing heterogeneous adjuvant formulations, the concentration step of step (iii) is performed by ultrafiltration.
[0222] In another aspect of the first method for producing heterogeneous adjuvant formulations, the size of the intermediate liposomes in step (iv) is processed by using a microfluidizer.
[0223] In another aspect of the first method for producing heterogeneous adjuvant formulations, the organic solvent is removed before the microfluidizer treatment in step (v).
[0224] In another embodiment of the first method for producing heterogeneous adjuvant formulations, a buffer is added to the compounding step (vii). In one embodiment, the compounding step (vii) is performed at room temperature for 1 to 48 hours at a mixing rate of 350 rpm, or by stirring for 1 hour. In another embodiment, after the compounding step (vii), the intermediate liposomes are stored at room temperature for up to 48 hours without stirring.
[0225] In another aspect of the first method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a size of approximately 300 nm to 1000 nm.
[0226] In another aspect of the first method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a polydispersity of 0.4 to 1.0.
[0227] In a further embodiment of the first method for producing a heterogeneous adjuvant formulation, the injection step of step (ii) is performed by nanoassemblr, pump, or syringe injection.
[0228] In another embodiment, the saponin-containing liposome adjuvant is (a) monophosphoryl lipid A (MPLA), (b) saponin, and (c)(i) phosphatidylcholine (PC) and / or phosphatidylglycerol (PG), wherein the phospholipid is dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl A heterogeneous adjuvant formulation comprising a liposome bilayer comprising a liposome composition comprising (ii) cholesterol, wherein the molar percentage concentration of cholesterol in the liposome composition is higher than 50% (mol / mol), or the molar ratio of cholesterol to phospholipid is greater than 1, and the method is as follows: (i) A step of dissolving phospholipids, cholesterol, and MPLA in an organic solvent to form a lipid formulation as an organic phase; (ii) A step of injecting the organic phase of step (i) into the aqueous phase at a specific flow rate and a specific ratio of organic relative aqueous phase to form liposomes; (iii) A step of stirring the liposomes from step (ii) to form intermediate liposomes; (iv) A step to concentrate the intermediate liposomes from step (iii); (v) a step of removing the organic phase of the intermediate liposomes in step (iv); and (vi) A step of compounding the intermediate liposomes from step (v) with saponins. It contains, thereby producing heterogeneous adjuvant formulations.
[0229] In another embodiment of the second method for producing heterogeneous adjuvant formulations, in step (i), phospholipids, cholesterol, and MPLA are dissolved in an organic solvent by sonication, heating, stirring, or a combination thereof. In one embodiment, the organic solvent includes ethyl acetate and isopropyl alcohol. In another embodiment, the lipid formulation organic phase is heated to a temperature of 50°C to 65°C.
[0230] In another embodiment of the second method for producing heterogeneous adjuvant formulations, the aqueous phase comprises water and, optionally, a buffer. In one embodiment, the buffer contains 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In a preferred embodiment, the aqueous phase is 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In another embodiment, the aqueous phase is at a temperature of 20–25°C. In a further embodiment, the flow rate of step (ii) is 10–30 mL / min. In a further embodiment, the flow rate of step (ii) is 20 mL / min.
[0231] In another aspect of the second method for producing heterogeneous adjuvant formulations, the intermediate liposomes in step (iii) are stirred at a speed of 100 rpm to 900 rpm.
[0232] In another embodiment of the second method for producing heterogeneous adjuvant formulations, the ratio of the organic relative aqueous phases in step (ii) ranges from 1:4 to 1:8. In a preferred embodiment, the ratio is 1:8.
[0233] In another aspect of the second method for producing heterogeneous adjuvant formulations, the organic solvent is removed before the compounding step (vi).
[0234] In another aspect of the second method for producing heterogeneous adjuvant formulations, the step of removing the organic phase of intermediate liposomes in steps (iv) and (v) is performed by tangential flow filtration (TFF). In one aspect, the TFF is TFF ultrafiltration and dialysis filtration. In another aspect, the TFF comprises a membrane having a molecular weight cutoff (MWCO) ranging from 100 to 500 kDa.
[0235] In another aspect of the second method for producing heterogeneous adjuvant formulations, the concentration step of step (vi) is performed by ultrafiltration.
[0236] In another embodiment of the second method for producing heterogeneous adjuvant formulations, a buffer is added to the compounding step (vi).
[0237] In another embodiment of the second method for producing heterogeneous adjuvant formulations, the compounding step of step (vi) is performed at a mixing rate of 300 rpm per hour at room temperature. In one embodiment, after the compounding step of step (vii), the intermediate liposomes are stored at room temperature for 24 hours without stirring.
[0238] In another aspect of the second method for producing heterogeneous adjuvant formulations, the final adjuvant formulation has a size range of 300 nm to 1000 nm.
[0239] In another aspect of the second method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a polydispersity of 0.4 to 1.0.
[0240] In another aspect of the second method for producing heterogeneous adjuvant formulations, the injection step of step (ii) is performed by pipette, pump, or syringe injection.
[0241] In another embodiment, the saponin-containing liposome adjuvant is (a) monophosphoryl lipid A (MPLA), (b) saponin, and (c)(i) phosphatidylcholine (PC) and / or phosphatidylglycerol (PG), wherein the phospholipid is dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl A heterogeneous adjuvant formulation comprising a liposome bilayer comprising a liposome composition comprising (ii) cholesterol, wherein the molar percentage concentration of cholesterol in the liposome composition is higher than 50% (mol / mol), or the molar ratio of cholesterol to phospholipid is greater than 1, and the method is as follows: (i) A step of preparing a freeze-dried organic phase containing phospholipids, cholesterol, and MPLA; (ii) A step of rehydrating the freeze-dried organic phase from step (i) with the aqueous phase to form intermediate liposomes; (iii) A step of shrinking the intermediate liposomes from step (ii) using a microfluidizer; (iv) A step of compounding the intermediate liposomes from step (iii) with saponins. It contains, thereby producing heterogeneous adjuvant formulations.
[0242] In another aspect of the third method for producing heterogeneous adjuvant formulations, in step (i), phospholipids, cholesterol, and MPLA are dissolved in an organic solvent by sonication, heating, stirring, or a combination thereof. In one aspect, the organic solvent comprises tert-butyl alcohol (TBA) or a mixture thereof. In another aspect, the lipid organic phase is heated to a temperature of 25°C to 65°C. In another aspect, the organic phase solution is freeze-dried.
[0243] In another embodiment of the third method for producing heterogeneous adjuvant formulations, the aqueous phase comprises water or a buffer. In one embodiment, the buffer comprises a 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In a preferred embodiment, the aqueous phase is a 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In another embodiment, the aqueous phase is at a temperature of 20°C to 70°C.
[0244] In another aspect of the third method for producing heterogeneous adjuvant formulations, the intermediate liposomes in step (ii) are stirred at a speed of 100 to 1000 rpm.
[0245] In another aspect of the third method for producing heterogeneous adjuvant formulations, the size of the intermediate liposomes in step (iii) is reduced by a microfluidizer and a pressure at 18640 PSI or about 18640 PSI.
[0246] In another aspect of the third method for producing heterogeneous adjuvant formulations, the organic solvent is removed before rehydration in step (ii). In one aspect, the step of removing the organic solvent is by freeze-drying.
[0247] In another embodiment of the third method for producing heterogeneous adjuvant formulations, a buffer is added to the compounding step (iv).
[0248] In another aspect of the third method for producing a heterogeneous adjuvant formulation, the compounding step (iv) is performed at a mixing rate of 300 rpm or by stirring at room temperature for 1 hour.
[0249] In another aspect of the third method for producing heterogeneous adjuvant formulations, after the compounding step (iv), the intermediate liposomes are stored at room temperature for 24 hours without stirring.
[0250] In another aspect of the third method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a size of >300 nm.
[0251] In another aspect of the third method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a polydispersity of >0.4.
[0252] In one embodiment of a method for producing a homogeneous or heterogeneous adjuvant preparation, the saponin is selected from the group consisting of QS-7, QS-18, QS-21, or a mixture thereof. In a preferred embodiment, the saponin is QS-21.
[0253] In one embodiment of a method for producing a homogeneous or heterogeneous adjuvant preparation, the at least one phospholipid is a mixture of dimyristoylphosphatidylcholine (DMPC) and dimyristoylphosphatidylglycerol (DMPG).
[0254] In one embodiment, the liposome composition of the adjuvant formulation may contain cholesterol in a molar percentage concentration of more than 50% (mol / mol), about 55% to about 71% (mol / mol), or preferably about 55% (mol / mol).
[0255] In one embodiment, the saponin-containing liposome adjuvant is a monophosphoryl lipid A (MPLA)-containing liposome composition (e.g., ALFQ) containing at least one saponin (e.g., QS-21) as described in U.S. Patent No. 10,434,167, which is incorporated herein by reference as a whole.
[0256] Method and administration The C. difficile toxoids disclosed herein can be used as antigens. For example, they may be part of a vaccine. Therefore, in one embodiment, the immunogenic compositions of the present invention are for pharmaceutical use. In another embodiment, the immunogenic compositions of the present invention are for vaccine use.
[0257] Therefore, in one embodiment, the immunogenic compositions described herein, comprising C. difficile toxoid A and toxoid B, and an adjuvant, are intended for use in producing, inducing, or triggering an immune response in a subject. In one embodiment, the subject is a mammal such as a human, a non-human primate, a cat, a sheep, a pig, a horse, a cattle, or a dog. Preferably, the subject is a human.
[0258] The immunogenic compositions described herein, comprising C. difficile toxoid A and toxoid B, and adjuvants, may be used in therapeutic or prophylactic methods to prevent, treat, or improve bacterial infections, diseases, or conditions in human subjects.
[0259] The immunogenic compositions described herein, comprising C. difficile toxoid A and toxoid B, and adjuvants, may be used to prevent, treat, or improve C. difficile infections, diseases, or conditions in human subjects. The immunogenic compositions described herein, comprising C. difficile toxoid A and toxoid B, and adjuvants, may be used to prevent, treat, or improve C. difficile-related infections, diseases, or conditions in human subjects. The immunogenic compositions described herein may be used to induce or trigger an immune response to C. difficile in subjects.
[0260] The immunogenic compositions described herein, comprising C. difficile toxoid A and toxoid B, and an adjuvant, may be used to prevent, treat, or improve C. difficile infections, diseases, or conditions requiring medical attention in human subjects. The immunogenic compositions described herein may be used in subjects, by means of the toxoids contained in the compositions, to prevent, treat, or improve C. difficile infections, diseases, or conditions requiring medical attention.
[0261] The immunogenic compositions described herein, comprising C. difficile toxoid A and toxoid B, and adjuvants, may be used to induce, stimulate, or trigger an immune response to C. difficile in a subject in order to prevent, treat, or improve C. difficile infections requiring medical attention, and include the step of administering the immunogenic compositions of this disclosure to a subject.
[0262] In one aspect, the present invention relates to a method for preventing, treating, or improving a C. difficile-related infection, disease, or condition in a human subject, comprising the step of administering the immunogenic composition of the present disclosure to the subject.
[0263] In another aspect, the present invention relates to a method for preventing, treating, or improving a medically important C. difficile infection in a human subject, comprising the step of administering the immunogenic composition of the present disclosure to the subject.
[0264] In one aspect, the present invention relates to a method of inducing an immune response against C. difficile in a human. In another aspect, the present invention relates to a method of vaccinating a human. In one aspect, the method comprises administering at least one dosage of the immunogenic composition described herein to a human. In one aspect, the method comprises administering one dosage of the immunogenic composition described herein to a human. In one aspect, the method comprises administering two dosages of the immunogenic composition described herein to a human. In another aspect, the method comprises administering the first and second dosages of the immunogenic composition described herein to a human.
[0265] In one aspect, for example, in a 0, 6-month immunization schedule, etc., the second dosage is administered approximately 6 months after the first dosage. In one aspect, the second dosage is administered at least 20, 30, 50, 60, 100, 120, 160, 170, or 180 days after the first dosage and at most 250, 210, 200, or 190 days after the first dosage.
[0266] In one aspect, for example, in a 0, 2-month immunization schedule, etc., the second dosage is administered approximately 2 months after the first dosage. In one aspect, the second dosage is administered at least 5, 10, 20, 30, 50, or 60 days after the first dosage and at most 150, 90, 80, or 70 days after the first dosage. Any minimum value and any maximum value described herein can be combined to define a range.
[0267] In another embodiment, the second dose is administered approximately 30 days (about 1 month) after the first dose. In yet another embodiment, for example in a 0-2 month immunization schedule, the second dose is administered approximately 60 days (about 2 months) after the first dose. In yet another embodiment, for example in a 0-6 month immunization schedule, the second dose is administered approximately 180 days (about 6 months) after the first dose. In yet another embodiment, for example in a 0-4 month immunization schedule, the second dose is administered approximately 120 days (about 4 months) after the first dose.
[0268] In one embodiment, the method comprises administering a single, and at most two, doses of an immunogenic composition to a human. In another embodiment, the method comprises administering two, and at most two, doses of an immunogenic composition to a human. In one embodiment, the two doses are administered within approximately six months after the first dose. In another embodiment, the two doses are administered within approximately two months after the first dose. Administering at most two doses of the immunogenic composition to a human may be advantageous. Such advantages include, for example, encouraging human adherence to a complete dosing schedule and promoting cost-effectiveness of the schedule.
[0269] In one embodiment, the method includes a further administration of a booster drug to a human after a second dose. For example, the booster drug may be administered 6 or 12 months after the second dose. Further boosters may be administered. In one embodiment, the method does not include a further administration of a booster drug to a human after a second dose. As used herein, “booster” refers to an additional administration of an immunogenic composition to a human.
[0270] In one embodiment, the method comprises administering three doses of the immunogenic composition described herein to a human. In one embodiment, the method comprises administering at least three doses of the immunogenic composition. In one embodiment, the three doses are administered within a period of about six months after the first dose. In a further embodiment, at least three doses are administered to a human within a period of about six months.
[0271] In one embodiment, for example in an immunization schedule at 0, 1, and 6 months, the second dose is administered approximately 30 days (about 1 month) after the first dose, and the third dose is administered approximately 150 to 180 days after the second dose. In another embodiment, for example in an immunization schedule at 0, 2, and 6 months, the second dose is administered approximately 60 days (about 2 months) after the first dose, and the third dose is administered approximately 120 to 150 days after the second dose.
[0272] In one embodiment, the first, second, and third doses are administered to a human over a period of approximately 150, 160, 170, or 180 days, and at most 240, 210, 200, or 190 days. The range can be defined by combining any minimum value and any maximum value described herein. In another embodiment, the first, second, and third doses are administered to a human over a period of approximately 180 days or 6 months. For example, the second dose may be administered to a human about 30 days after the first dose, and the third dose may be administered to a human about 120 days after the second dose. Thus, the administration schedule includes steps of administering the drug to a human about 0, 1, and 6 months. For example, the second dose may be administered to a human about 60 days after the first dose, and the third dose may be administered to a human about 120 days after the second dose. Therefore, the administration schedule includes steps for administering the drug to humans at approximately 0, 2, and 6 months.
[0273] In one embodiment, the method includes administering a booster dose to a human after the third dose. For example, the booster dose may be administered 6 or 12 months after the third dose. Further boosters may be administered. In another embodiment, the method does not include administering a booster dose to a human after the third dose.
[0274] As described above, multiple doses of the immunogenic composition may be administered to a human, and the number of days between each dose may vary. The advantages of this method include, for example, the flexibility with which humans adhere to the administration schedule.
[0275] Upon administration of the compositions described herein to a host / subject using such a method, an immune response is typically observed, which typically includes a humoral immune response and may be accompanied by a cellular immune response.
[0276] In certain embodiments, the method may include the step of administering an immunogenic composition to a human subject who is at risk of infection. In some embodiments, the human subject may be at least about 40, 50, 55, 65, 75, 80, or 85 years of age or older. In some embodiments, the human subject may be about 40 to about 65 years of age or older. In some embodiments, the human subject may be about 65 to about 85 years of age or older. In some embodiments, the human subject may be about 18 years of age or older. In some embodiments, the human subject may be about 50 years of age or older. In some embodiments, the human subject may be about 55 years of age or older. In some embodiments, the human subject may be about 60 years of age or older. In some embodiments, the human subject may be about 65 years of age or older.
[0277] In one aspect, the present invention relates to a method for immunizing a subject (e.g., a human) to C. difficile by administering to it a composition comprising one or more C. difficile antigens and adjuvants. In one aspect, the present invention relates to compositions disclosed herein for use in a method for immunizing a subject to C. difficile. In one aspect, the present invention relates to compositions disclosed herein for use in a method for immunizing a human subject to C. difficile. In one aspect, the human subject is 40 to 90 years of age or older. In one aspect, the human subject is 50 to 85 years of age or older. In one aspect, the human subject is 60 to 85 years of age or older. In one aspect, the human subject is 65 to 85 years of age or older. In one aspect, the human subject is 65 to 69 years of age or older. In one aspect, the human subject is 70 to 79 years of age or older. In one embodiment, the human subjects are 75-79 years of age or older. In one embodiment, the human subjects are at least 50, 55, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 years of age or older. In one embodiment, the human subjects are at least 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85 years of age or older.
[0278] The immunogenic compositions described above may comprise one variant C. difficile (C. difficile) toxin (A or B), i.e., a polypeptide, and an adjuvant. Therefore, the immunogenic compositions may occupy separate vials in a preparation or kit (e.g., a separate vial for the composition containing variant C. difficile (C. difficile) toxin A, and a separate vial for the composition containing variant C. difficile (C. difficile) toxin B). The immunogenic compositions may be intended for simultaneous, sequential, or separate use.
[0279] In another embodiment, the immunogenic compositions described above may comprise both mutant C. difficile (C. difficile) toxins (A and B), i.e., polypeptides. Any combination of the described mutant C. difficile (C. difficile) toxin A and mutant C. difficile (C. difficile) toxin B may be combined for an immunogenic composition. Thus, the immunogenic compositions may be combined in a single vial (for example, a single vial containing both a composition comprising mutant C. difficile (C. difficile) TcdA and a composition comprising mutant C. difficile (C. difficile) TcdB). Preferably, the immunogenic compositions comprise mutant C. difficile (C. difficile) TcdA and mutant C. difficile (C. difficile) TcdB, i.e., polypeptides.
[0280] In certain embodiments, it is preferable that the compositions described herein exhibit immunogenic properties (e.g., induce a detectable and / or neutralizing and / or protective immune response) after appropriate administration to a subject. The presence of a neutralizing and / or protective immune response can be demonstrated, as described above, by showing that infection by a pathogen (e.g., C. difficile) is affected (e.g., reduced) in an individual (e.g., human or other animal) administered with the material described herein, compared to an individual not administered with the material. For example, one or more test subjects (e.g., human or non-human) may be administered with the compositions described herein by any appropriate route and schedule, and then antigen-loaded by a pathogenic organism after an appropriate amount for a suitable time (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks). After administration and / or antigen loading, the animal may be monitored for immune function (e.g., antibody production, T cell activity). For example, serum can be analyzed for total antibody response or expression of specific subtypes using antibody ELISA and / or pathogen neutralization assays. T cell activity can be measured, for example, by measuring IFN-γ production after antigen restimulation. Statistical analysis (e.g., Fisher's exact test, Wilcoxon test, Mann-Whitney test) can then be performed on the data to determine the effectiveness of the material in influencing the immune response.
[0281] Toxin neutralizing activity The immune response induced by administration of the immunogenic composition of the present invention may be determined using a toxin neutralization assay (TNA), ELISA, or more preferably, a cytotoxicity assay such as those described in WIPO Patent Application WO / 2012 / 143902, U.S. Patent No. 9,187536, and WIPO Patent Application WO / 2014 / 060898, which are each incorporated herein by reference as a whole.
[0282] In one embodiment, the immune response induced in humans is neutralizing against a C. difficile strain expressing toxin A having an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to toxoid A of the composition.
[0283] In another embodiment, the immune response induced in humans is neutralizing against a C. difficile strain expressing toxin B, which contains an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with toxoid B of the composition.
[0284] The usefulness (e.g., immunogenicity) of any of the materials (e.g., compositions) and / or methods described herein can be assayed by any of the various methods known to those skilled in the art. The suitability of any of the materials described herein for an intended purpose can be determined using one or more of the assays described herein, or any other suitable assay. These methods are illustrative and non-limiting; it should be understood that other assays may also be suitable. For example, the compositions described herein typically induce and / or enhance the production of antibodies against C. difficile when administered to a subject. Such antibodies can be detected in the subject using any method available to those skilled in the art. For example, as described in the Examples section, serum can be obtained from the subject and tested by ELISA to detect immunoglobulin type G (IgG) antibodies against C. difficile toxin A and / or toxin B (e.g., “Primary Immunogenicity Data”). Antibodies present in the test serum can react with toxin A or B antigens adsorbed to individual wells of a microtiter plate. The amount of antibody bound to antigen-coated wells can be determined using a colorimetric substrate reaction after the binding of a secondary anti-IgG (e.g., anti-human IgG) antibody-enzyme conjugate. Typically, a substrate is then added to the enzyme, which causes a colorimetric change that is directly proportional to the antibody bound to the antigen. The concentration of antibody in serum can be derived by extrapolation from a standard curve created by multiple dilutions of a reference standard serum having a defined IgG unit (ELISA unit (EU) / mL)). Neutralizing antibodies against C. difficile toxin can also be quantified using a toxin neutralization assay (TNA). In this assay, serially diluted serum can be incubated with a fixed amount of C. difficile toxin A or B. Test cells (e.g., Vero cells) can then be added, and the serum-toxin-cell mixture can be incubated under appropriate conditions (e.g., 6 days at 37°C).The ability of serum to neutralize the cytotoxic effects of C. difficile toxin can be determined by and correlated with cell viability. The assay utilizes the accumulation of acidic metabolites in sealed culture wells as an indicator of normal cellular respiration. In cells exposed to the toxin, metabolism and CO2 production decrease; consequently, the pH rises (e.g., above 7.4), as indicated by phenol red pH indicator in the cell culture medium. At this pH, the medium appears red. However, cell controls, i.e., cells exposed to the toxin neutralized by antibodies, metabolize and produce normal amounts of CO2; consequently, the pH is maintained (e.g., below 7.0), at which the medium appears yellow. Therefore, C. difficile toxin-neutralizing antibodies correlate with the serum's ability to neutralize the metabolic effects of C. difficile toxin on cells, as evidenced by their ability to maintain a specific pH (e.g., below 7.0). The color change of the culture medium can be measured using a plate reader (for example, at 562 nm to 630 nm) to further calculate the antitoxin-neutralizing antibody titer at 50% inhibition of C. difficile toxin-mediated cytotoxicity. In one embodiment, the composition induces a toxin-neutralizing antibody titer in a person after administration of the composition that is at least 1.01 times, 1.1 times, 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 32 times, or higher, compared to the toxin-neutralizing antibody titer in a person before administration of the composition, when measured under the same conditions in the toxin-neutralizing assay.
[0285] The toxin neutralization assay (TNA) used in the examples provided herein is described. Briefly, IMR-90 cells, which act as targets for toxin-mediated cytotoxicity, were seeded in 384-well microtiter plates. Each test serum sample was separately analyzed for its ability to neutralize toxin A or toxin B. Four sequential dilutions of the test serum were mixed with a constant concentration of toxin A (TcdA) or toxin B (TcdB) in a humidified incubator (37°C / 5%CO2) for 60 minutes to induce toxin neutralization. All plates included quality control consisting of a reference standard and antitoxin antibodies of known titers to monitor assay performance. After 60 minutes of incubation, the toxin-antiserum mixture was applied to an IMR-90 cell monolayer, and the plate was incubated for an additional 72 hours. Next, the viability of IMR-90 cell monolayers was tested using the luciferase-based CellTiter-Glo® reagent, which provides magnitude for ATP levels in metabolically active cells, and reported as relative luminescence units (RLU). High ATP levels indicate high cell viability and antibody-mediated neutralization of TcdA or TcdB. Neutralizing antibody concentrations were determined by comparing the RLU values of test samples to calibration curves from antitoxin A or B reference standards using a custom statistical analysis system (SAS®) program. Functional antibody concentrations were expressed as arbitrary units per serum mL (or neutralizing units / mL). The lower limit of quantification (LLOQ) for TcdA and TcdB TNA assays is 75.9 and 249.7 neutralizing units / serum mL, respectively.
[0286] Array identifier Sequence ID 1 specifies the amino acid sequence for wild-type C. difficile 630 toxin A (TcdA). Sequence ID 2 specifies the amino acid sequence for wild-type C. difficile 630 toxin B (TcdB). Sequence ID 3 specifies the amino acid sequence for mutant TcdA, which has mutations at positions 285 and 287 compared to Sequence ID 1. SEQ ID NO:4 specifies the amino acid sequence for mutant TcdA that has mutations at positions 285, 287, and 700 as compared to SEQ ID NO:1. Sequence ID 5 specifies the amino acid sequence for mutant TcdB, which has mutations at positions 286 and 288 compared to Sequence ID 2. Sequence ID 6 specifies the amino acid sequence for mutant TcdB, which has mutations at positions 286, 288, and 698 compared to Sequence ID 2. Sequence ID 7 specifies the amino acid sequence for mutant TcdA, which has mutations at positions 269, 272, 285, 287, 460, 462, and 700 compared to Sequence ID 1. Sequence ID 8 specifies the amino acid sequence for mutant TcdB, which has mutations at positions 270, 273, 286, 288, 461, 463, and 698 compared to Sequence ID 2. Sequence ID 9 specifies the DNA sequence encoding wild-type C. difficile 630 toxin A (TcdA). Sequence ID 10 specifies the DNA sequence encoding wild-type C. difficile 630 toxin B (TcdB). Sequence ID 11 specifies the DNA sequence that encodes Sequence ID 3. Sequence ID 12 specifies the DNA sequence that encodes Sequence ID 4. Sequence ID 13 specifies the DNA sequence that encodes Sequence ID 5. Sequence ID 14 specifies the DNA sequence that encodes Sequence ID 6. Sequence ID 15 specifies the amino acid sequence for wild-type C. difficile R20291 TcdA. Sequence ID 16 specifies the DNA sequence that encodes Sequence ID 15. Sequence ID 17 specifies the amino acid sequence for wild-type C. difficile CD196 TcdA. Sequence ID 18 specifies the DNA sequence that encodes Sequence ID 17. Sequence ID 19 specifies the amino acid sequence for wild-type C. difficile (VPI10463 TcdA). Sequence ID 20 specifies the DNA sequence that encodes Sequence ID 19. Sequence ID 21 specifies the amino acid sequence for wild-type C. difficile (R20291 TcdB). Sequence ID 22 specifies the DNA sequence that encodes Sequence ID 21. Sequence ID 23 specifies the amino acid sequence for wild-type C. difficile CD196 TcdB. Sequence ID 24 specifies the DNA sequence that encodes Sequence ID 23. Sequence ID 25 specifies the amino acid sequence for wild-type C. difficile (VPI10463 TcdB). Sequence ID 26 specifies the DNA sequence that encodes Sequence ID 25. Sequence ID 27 specifies the DNA sequence of the pathogenicity locus of wild-type C. difficile (VPI10463). Sequence ID 28 specifies the amino acid sequence corresponding to residues 101-293 of Sequence ID 1. Sequence ID 29 specifies the amino acid sequence for residues 1-542 of Sequence ID 1. Sequence ID 30 specifies the amino acid sequence corresponding to residues 101-293 of Sequence ID 2. Sequence ID 31 specifies the amino acid sequence for residues 1-543 of Sequence ID 2. Sequence ID 32 specifies the amino acid sequence corresponding to residues 543-809 of Sequence ID 1. Sequence ID 33 specifies the amino acid sequence corresponding to residues 544-767 of Sequence ID 2. Sequence ID 34 specifies the amino acid sequence for mutant TcdA, in which residues 101, 269, 272, 285, 287, 460, 462, 541, 542, 543, 589, 655, and 700 can be any amino acid. Sequence ID 35 specifies the amino acid sequence for mutant TcdB, where 102, 270, 273, 286, 288, 384, 461, 463, 520, 543, 544, 587, 600, 653, 698, and 751 can be any amino acid. Sequence ID 36 specifies the amino acid sequence for the variable light chain of the neutralizing antibody (A3-25 mAb) for C. difficile TcdA. Sequence ID 37 specifies the amino acid sequence for the variable heavy chain of the neutralizing antibody (A3-25 mAb) for C. difficile TcdA. Sequence ID 38 specifies the amino acid sequence for CDR1 of the variable light chain of the neutralizing antibody (A3-25 mAb) for C. difficile TcdA. Sequence ID 39 specifies the amino acid sequence for CDR2 of the variable light chain of the neutralizing antibody (A3-25 mAb) for C. difficile TcdA. Sequence ID 40 specifies the amino acid sequence for CDR3 of the variable light chain of the neutralizing antibody (A3-25 mAb) for C. difficile TcdA. Sequence ID 41 specifies the amino acid sequence for CDR1 of the variable heavy chain of the neutralizing antibody (A3-25 mAb) for C. difficile TcdA. Sequence ID 42 specifies the amino acid sequence for CDR2 of the variable heavy chain of the neutralizing antibody (A3-25 mAb) for C. difficile TcdA. Sequence ID 43 specifies the amino acid sequence for CDR3 of the variable heavy chain of the neutralizing antibody (A3-25 mAb) for C. difficile TcdA. Sequence ID 44 specifies the DNA sequence that encodes Sequence ID 3. Sequence ID 45 specifies the DNA sequence that encodes Sequence ID 4. Sequence ID 46 specifies the DNA sequence that encodes Sequence ID 5. Sequence ID 47 specifies the DNA sequence that encodes Sequence ID 6. Sequence ID 48 specifies the nucleotide sequence of the immunostimulatory oligonucleotide ODN CpG24555. Sequence ID 49 specifies the amino acid sequence for the variable heavy chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 50 specifies the amino acid sequence for the signal peptide of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 51 specifies the amino acid sequence for CDR1 of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 52 specifies the amino acid sequence for CDR2 of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 53 specifies the amino acid sequence for CDR3 of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 54 specifies the amino acid sequence for the constant region of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 55 specifies the amino acid sequence for the variable light chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 56 specifies the amino acid sequence for the signal peptide of the variable light chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 57 specifies the amino acid sequence for CDR1 of the variable light chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 58 specifies the amino acid sequence for CDR2 of the variable light chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 59 specifies the amino acid sequence for CDR3 of the variable light chain of the C. difficile TcdB neutralizing antibody (B8-26 mAb). Sequence ID 60 specifies the amino acid sequence for the variable heavy chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 61 specifies the amino acid sequence for the signal peptide of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 62 specifies the amino acid sequence for CDR1 of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 63 specifies the amino acid sequence for CDR2 of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 64 specifies the amino acid sequence for CDR3 of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 65 specifies the amino acid sequence for the constant region of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 66 specifies the amino acid sequence for the variable light chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 67 specifies the amino acid sequence for the signal peptide of the variable light chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 68 specifies the amino acid sequence for CDR1 of the variable light chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 69 specifies the amino acid sequence for CDR2 of the variable light chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 70 specifies the amino acid sequence for CDR3 of the variable light chain of the C. difficile TcdB neutralizing antibody (B59-3 mAb). Sequence ID 71 specifies the amino acid sequence for the variable heavy chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 72 specifies the amino acid sequence for the signal peptide of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 73 specifies the amino acid sequence for CDR1 of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 74 specifies the amino acid sequence for CDR2 of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 75 specifies the amino acid sequence for CDR3 of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 76 specifies the amino acid sequence for the constant region of the variable heavy chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 77 specifies the amino acid sequence for the variable light chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 78 specifies the amino acid sequence for the signal peptide of the variable light chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 79 specifies the amino acid sequence for CDR1 of the variable light chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 80 specifies the amino acid sequence for CDR2 of the variable light chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 81 specifies the amino acid sequence for CDR3 of the variable light chain of the C. difficile TcdB neutralizing antibody (B9-30 mAb). Sequence ID 82 specifies the amino acid sequence for mutant TcdB, in which the residues at positions 102, 270, 273, 286, 288, 384, 461, 463, 520, 543, 544, 587, 600, 653, 698, and 751 can be any amino acid. Sequence ID 83 lacks methionine at position 1 and specifies the amino acid sequence for mutant TcdA, which has mutations at positions 269, 272, 285, 287, 460, 462, and 700 compared to Sequence ID 1. Sequence ID 84 specifies the amino acid sequence for mutant C. difficile toxin A, which lacks methionine at position 1 and has mutations at positions 285, 287, and 700 compared to Sequence ID 1. Sequence ID 85 specifies the amino acid sequence for mutant C. difficile toxin B, which lacks methionine at position 1 and has mutations at positions 270, 273, 286, 288, 461, 463, and 698 compared to Sequence ID 2. Sequence ID 86 lacks methionine at position 1 and specifies the amino acid sequence for mutant C. difficile toxin B, which has mutations at positions 286, 288, and 698 compared to Sequence ID 2. Sequence ID 87 specifies the amino acid sequence for the wild-type C. difficile (2004013 TcdA). Sequence ID 88 specifies the amino acid sequence for the wild-type C. difficile (2004111 TcdA). Sequence ID 89 specifies the amino acid sequence for the wild-type C. difficile (2004118 TcdA). Sequence ID 90 specifies the amino acid sequence for the wild-type C. difficile (2004205 TcdA). Sequence ID 91 specifies the amino acid sequence for the wild-type C. difficile (2004206 TcdA). Sequence ID 92 specifies the amino acid sequence for the wild-type C. difficile (2005022 TcdA). Sequence ID 93 specifies the amino acid sequence for the wild-type C. difficile (2005088 TcdA). Sequence ID 94 specifies the amino acid sequence for the wild-type C. difficile (2005283 TcdA). Sequence ID 95 specifies the amino acid sequence for the wild-type C. difficile (2005325 TcdA). Sequence ID 96 specifies the amino acid sequence for the wild-type C. difficile (2005359 TcdA). Sequence ID 97 specifies the amino acid sequence for the wild-type C. difficile (2006017 TcdA). Sequence ID 98 specifies the amino acid sequence for the wild-type C. difficile (2007070 TcdA). Sequence ID 99 specifies the amino acid sequence for the wild-type C. difficile (2007217 TcdA). Sequence ID 100 specifies the amino acid sequence for the wild-type C. difficile (2007302 TcdA). Sequence ID 101 specifies the amino acid sequence for the wild-type C. difficile (2007816 TcdA). Sequence ID 102 specifies the amino acid sequence for the wild-type C. difficile (2007838 TcdA). Sequence ID 103 specifies the amino acid sequence for the wild-type C. difficile (2007858 TcdA). Sequence ID 104 specifies the amino acid sequence for the wild-type C. difficile (2007886 TcdA). Sequence ID 105 specifies the amino acid sequence for the wild-type C. difficile (2008222 TcdA). Sequence ID 106 specifies the amino acid sequence for the wild-type C. difficile (2009078 TcdA). Sequence ID 107 specifies the amino acid sequence for the wild-type C. difficile (2009087 TcdA). Sequence ID 108 specifies the amino acid sequence for the wild-type C. difficile (2009141 TcdA). Sequence ID 109 specifies the amino acid sequence for the wild-type C. difficile (2009292 TcdA). Sequence ID 110 specifies the amino acid sequence for wild-type C. difficile (2004013 TcdB). Sequence ID 111 specifies the amino acid sequence for wild-type C. difficile (2004111 TcdB). Sequence ID 112 specifies the amino acid sequence for wild-type C. difficile (2004118 TcdB). Sequence ID 113 specifies the amino acid sequence for wild-type C. difficile (2004205 TcdB). Sequence ID 114 specifies the amino acid sequence for wild-type C. difficile (2004206 TcdB). Sequence ID 115 specifies the amino acid sequence for the wild-type C. difficile (2005022 TcdB). Sequence ID 116 specifies the amino acid sequence for wild-type C. difficile (2005088 TcdB). Sequence ID 117 specifies the amino acid sequence for wild-type C. difficile (2005283 TcdB). Sequence ID 118 specifies the amino acid sequence for wild-type C. difficile (2005325 TcdB). Sequence ID 119 specifies the amino acid sequence for the wild-type C. difficile (2005359 TcdB). Sequence ID 120 specifies the amino acid sequence for wild-type C. difficile (2006017 TcdB). Sequence ID 121 specifies the amino acid sequence for wild-type C. difficile (2006376 TcdB). Sequence ID 122 specifies the amino acid sequence for wild-type C. difficile (2007070 TcdB). Sequence ID 123 specifies the amino acid sequence for the wild-type C. difficile (2007217 TcdB). Sequence ID 124 specifies the amino acid sequence for wild-type C. difficile (2007302 TcdB). Sequence ID 125 specifies the amino acid sequence for the wild-type C. difficile (2007816 TcdB). Sequence ID 126 specifies the amino acid sequence for wild-type C. difficile (2007838 TcdB). Sequence ID 127 specifies the amino acid sequence for the wild-type C. difficile (2007858 TcdB). Sequence ID 128 specifies the amino acid sequence for wild-type C. difficile (2007886 TcdB). Sequence ID 129 specifies the amino acid sequence for the wild-type C. difficile (2008222 TcdB). Sequence ID 130 specifies the amino acid sequence for the wild-type C. difficile (2009078 TcdB). Sequence ID 131 specifies the amino acid sequence for the wild-type C. difficile (2009087 TcdB). Sequence ID 132 specifies the amino acid sequence for wild-type C. difficile (2009141 TcdB). Sequence ID 133 specifies the amino acid sequence for the wild-type C. difficile (2009292 TcdB). Sequence ID 134 specifies the amino acid sequence for wild-type C. difficile 014 TcdA. Sequence ID 135 specifies the amino acid sequence for wild-type C. difficile 015 TcdA. Sequence ID 136 specifies the amino acid sequence for wild-type C. difficile 020 TcdA. Sequence ID 137 specifies the amino acid sequence for wild-type C. difficile 023 TcdA. Sequence ID 138 specifies the amino acid sequence for wild-type C. difficile 027 TcdA. Sequence ID 139 specifies the amino acid sequence for wild-type C. difficile 029 TcdA. Sequence ID 140 specifies the amino acid sequence for wild-type C. difficile 046 TcdA. Sequence ID 141 specifies the amino acid sequence for wild-type C. difficile 014 TcdB. Sequence ID 142 specifies the amino acid sequence for wild-type C. difficile 015 TcdB. Sequence ID 143 specifies the amino acid sequence for wild-type C. difficile 020 TcdB. Sequence ID 144 specifies the amino acid sequence for wild-type C. difficile 023 TcdB. Sequence ID 145 specifies the amino acid sequence for wild-type C. difficile 027 TcdB. Sequence ID 146 specifies the amino acid sequence for wild-type C. difficile 029 TcdB. Sequence ID 147 specifies the amino acid sequence for wild-type C. difficile 046 TcdB. Sequence ID 148 specifies the amino acid sequence for wild-type C. difficile 001 TcdA. Sequence ID 149 specifies the amino acid sequence for wild-type C. difficile 002 TcdA. Sequence ID 150 specifies the amino acid sequence for wild-type C. difficile 003 TcdA. Sequence ID 151 specifies the amino acid sequence for wild-type C. difficile 004 TcdA. Sequence ID 152 specifies the amino acid sequence for wild-type C. difficile 070 TcdA. Sequence ID 153 specifies the amino acid sequence for wild-type C. difficile 075 TcdA. Sequence ID 154 specifies the amino acid sequence for wild-type C. difficile 077 TcdA. Sequence ID 155 specifies the amino acid sequence for wild-type C. difficile 081 TcdA. Sequence ID 156 specifies the amino acid sequence for wild-type C. difficile 117 TcdA. Sequence ID 157 specifies the amino acid sequence for wild-type C. difficile 131 TcdA. Sequence ID 158 specifies the amino acid sequence for wild-type C. difficile 001 TcdB. Sequence ID 159 specifies the amino acid sequence for wild-type C. difficile 002 TcdB. Sequence ID 160 specifies the amino acid sequence for wild-type C. difficile 003 TcdB. Sequence ID 161 specifies the amino acid sequence for wild-type C. difficile 004 TcdB. Sequence ID 162 specifies the amino acid sequence for wild-type C. difficile 070 TcdB. Sequence ID 163 specifies the amino acid sequence for wild-type C. difficile 075 TcdB. Sequence ID 164 specifies the amino acid sequence for wild-type C. difficile 077 TcdB. Sequence ID 165 specifies the amino acid sequence for wild-type C. difficile 081 TcdB. Sequence ID 166 specifies the amino acid sequence for wild-type C. difficile 117 TcdB. Sequence ID 167 specifies the amino acid sequence for wild-type C. difficile 131 TcdB. Sequence ID 168 specifies the amino acid sequence for wild-type C. difficile 053 TcdA. Sequence ID 169 specifies the amino acid sequence for wild-type C. difficile 078 TcdA. Sequence ID 170 specifies the amino acid sequence for wild-type C. difficile 087 TcdA. Sequence ID 171 specifies the amino acid sequence for wild-type C. difficile 095 TcdA. Sequence ID 172 specifies the amino acid sequence for wild-type C. difficile 126 TcdA. Sequence ID 173 specifies the amino acid sequence for wild-type C. difficile 053 TcdB. Sequence ID 174 specifies the amino acid sequence for wild-type C. difficile 078 TcdB. Sequence ID 175 specifies the amino acid sequence for wild-type C. difficile 087 TcdB. Sequence ID 176 specifies the amino acid sequence for wild-type C. difficile 095 TcdB. Sequence ID 177 specifies the amino acid sequence for wild-type C. difficile 126 TcdB. Sequence ID 178 specifies the amino acid sequence for wild-type C. difficile 059 TcdA. Sequence ID 179 specifies the amino acid sequence for wild-type C. difficile 059 TcdB. Sequence ID 180 specifies the amino acid sequence for wild-type C. difficile 106 TcdA. Sequence ID 181 specifies the amino acid sequence for wild-type C. difficile 106 TcdB. Sequence ID 182 specifies the amino acid sequence for wild-type C. difficile 017 TcdB. Sequence ID 183 specifies the amino acid sequence for mutant TcdA, which has mutations at positions 285, 287, 700, 972, and 978 compared to Sequence ID 1. Sequence ID 184 specifies the amino acid sequence for mutant TcdB, which has mutations at positions 286, 288, 698, 970, and 976 compared to Sequence ID 2. Sequence IDs 185 through 195 specify the amino acid sequences for exemplary mutant toxins, respectively. Sequence IDs 196 through 212 specify the amino acid sequences for exemplary mutant toxin A, respectively. Sequence IDs 213 to 222 specify the amino acid sequences for exemplary mutant toxin B, respectively. Sequence IDs 223 to 236 specify the amino acid sequences for exemplary mutant toxin A, respectively. Sequence IDs 237 through 243 specify the amino acid sequences for exemplary mutant toxin B, respectively. Sequence IDs 244 to 245 specify the amino acid sequences for exemplary mutant toxin A, respectively. Sequence IDs 246 through 249 specify the amino acid sequences for exemplary mutant toxin B, respectively. Sequence IDs 250 to 253 specify the amino acid sequences for exemplary mutant toxin A, respectively. Sequence ID 254 specifies the amino acid sequence for an exemplary mutant toxin. Sequence IDs 255 through 263 specify the amino acid sequences for exemplary mutant toxin A, respectively. Sequence IDs 264 through 269 specify the amino acid sequences for exemplary mutant toxin B, respectively. Sequence IDs 270 through 275 specify the amino acid sequences for exemplary mutant toxins, respectively. Sequence IDs 276 through 323 specify the amino acid sequences for exemplary mutant toxin A, respectively. Sequence IDs 324 through 373 specify the amino acid sequences for exemplary mutant toxin B, respectively. Sequence IDs 374 through 421 specify the amino acid sequences for exemplary mutant toxin A, respectively. Sequence IDs 422 through 471 specify the amino acid sequences for exemplary mutant toxin B, respectively. Sequence IDs 472 through 519 specify the amino acid sequences for exemplary mutant toxin A, respectively. Sequence IDs 568 through 615 specify the amino acid sequences for exemplary mutant toxin B, respectively. Sequence IDs 520 to 567 specify the amino acid sequences for exemplary mutant toxin A, respectively. Sequence IDs 616 through 663 specify the amino acid sequences for exemplary mutant toxin B, respectively. Sequence IDs 664 through 711 each specify the amino acid sequence for an exemplary mutant toxin A. Sequence IDs 712 through 761 specify the amino acid sequences for exemplary mutant toxin B, respectively. Sequence IDs 762 through 800 specify the amino acid sequences for the toxin A variant, respectively. Sequence IDs 801 through 840 each specify the amino acid sequence for the toxin B variant. Sequence ID 841 specifies the nucleotide sequence of a class B oligonucleotide (CpG1018). Sequence ID 842 specifies the nucleotide sequence of a class B oligonucleotide (CpG7909). Sequence ID 843 specifies the nucleotide sequence of a class B oligonucleotide (CpG10103). Sequence ID 844 specifies the nucleotide sequence of a class B oligonucleotide (CpG1826). Sequence ID 845 specifies the nucleotide sequence of a Class B oligonucleotide. Sequence ID 846 specifies the nucleotide sequence of a Class B oligonucleotide. Sequence ID 847 specifies the nucleotide sequence of a Class A oligonucleotide. Sequence ID 848 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 849 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 850 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 851 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 852 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 853 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 854 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 855 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 856 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 857 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 858 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 859 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 860 specifies the nucleotide sequence of a C-class oligonucleotide. Sequence ID 861 specifies the nucleotide sequence of a P-class oligonucleotide.
[0287] Specific embodiments of the present invention are specified in the following numbered paragraphs: 1. An immunogenic composition comprising Clostridioides difficile (C. difficile) toxoid A and / or toxoid B, and a CpG adjuvant and / or a saponin-containing liposomal adjuvant. 2. The immunogenic composition described in paragraph 1, comprising a CpG adjuvant. 3. The immunogenic composition according to paragraph 2, wherein the CpG adjuvant comprises at least one CpG. 4. The CpG adjuvant is an immunogenic composition according to either paragraph 2 or 3, comprising a CpG oligonucleotide. 5. The CpG adjuvant is an immunogenic composition according to any one of paragraphs 2 to 4, comprising a CpG oligonucleotide TLR9 agonist. 6. The immunogenic composition according to any one of paragraphs 2 to 5, wherein the CpG adjuvant is a Class B CpG. 7. The CpG adjuvant is selected from SEQ ID NOs. 48 and 841-861, and is an immunogenic composition according to any one of paragraphs 2 to 6. 8. The CpG adjuvant is an immunogenic composition according to any one of paragraphs 2 to 7, comprising CpG24555 (SEQ ID NO: 48), CpG1018 (SEQ ID NO: 841), CpG7909 (SEQ ID NO: 842), CpG10103 (SEQ ID NO: 843), or CpG1826 (SEQ ID NO: 844). 9. The CpG adjuvant is the immunogenic composition described in paragraph 8, comprising CpG24555. 10. An immunogenic composition according to any one of paragraphs 2 to 9, comprising approximately 0.1 to 5 mg / mL or more of CpG. 11. An immunogenic composition according to any one of paragraphs 2 to 9, comprising approximately 0.1 to approximately 1.0 mg / mL of CpG. 12. An immunogenic composition according to any one of paragraphs 2 to 9, comprising approximately 0.5 mg / mL of CpG. 13. An immunogenic composition according to any one of paragraphs 2 to 9, comprising approximately 0.5 to approximately 1.5 mg / mL of CpG. 14. An immunogenic composition according to any one of paragraphs 2 to 9, comprising approximately 1.0 mg / mL of CpG. 15. An immunogenic composition according to any one of paragraphs 2 to 9, comprising approximately 0.8 to approximately 1.8 mg / mL of CpG. 16. An immunogenic composition according to any one of paragraphs 2 to 9, comprising approximately 1.2 mg / mL of CpG. 17. An immunogenic composition according to any one of paragraphs 2 to 9, comprising approximately 3.0 to approximately 4.0 mg / mL of CpG. 18. An immunogenic composition according to any one of paragraphs 2 to 9, comprising approximately 3.6 mg / mL of CpG. 19. The immunogenic composition according to any one of paragraphs 2 to 18, wherein the CpG adjuvant further comprises an additional adjuvant. 20. The immunogenic composition according to any one of paragraphs 2 to 19, wherein the CpG adjuvant further comprises an aluminum salt. 21. The immunogenic composition according to paragraph 20, wherein the aluminum salt is aluminum phosphate, aluminum sulfate, or aluminum hydroxide. 22. The immunogenic composition according to any one of paragraphs 1 to 21, wherein the CpG adjuvant further comprises aluminum hydroxide (Al(OH)3). 23. An immunogenic composition according to any one of paragraphs 2 to 22, comprising CpG and Al(OH)3 at a concentration of approximately 0.1 to 5 mg / mL or more. 24. An immunogenic composition according to any one of paragraphs 2 to 22, comprising CpG and approximately 0.5 to approximately 1.5 mg / mL of Al(OH)3. 25. An immunogenic composition according to any one of paragraphs 2 to 22, comprising CpG and approximately 1.0 mg / mL of Al(OH)3. 26. An immunogenic composition according to any one of paragraphs 2 to 22, comprising CpG and approximately 1.0 to approximately 2.5 mg / mL of Al(OH)3. 27. An immunogenic composition according to any one of paragraphs 2 to 22, comprising CpG and approximately 1.5 to approximately 2.5 mg / mL of Al(OH)3. 28. An immunogenic composition according to any one of paragraphs 2 to 22, comprising CpG and approximately 1.5 mg / mL of Al(OH)3. 29. An immunogenic composition according to any one of paragraphs 2 to 22, comprising CpG and approximately 1.7 mg / mL of Al(OH)3. 30. An immunogenic composition according to any one of paragraphs 2 to 22, comprising CpG and approximately 1.8 mg / mL of Al(OH)3. 31. An immunogenic composition according to any one of paragraphs 2 to 22, comprising CpG and approximately 2.0 mg / mL of Al(OH)3. 32. An immunogenic composition according to any one of paragraphs 2 to 22, comprising CpG and approximately 2.5 mg / mL of Al(OH)3. 33. An immunogenic composition according to any one of paragraphs 2 to 22, comprising approximately 0.5 mg / mL of CpG and approximately 0.1 to 5 mg / mL or more of Al(OH)3. 34. An immunogenic composition according to any one of paragraphs 2 to 22, comprising approximately 1.0 mg / mL of CpG and approximately 1.5 mg / mL of Al(OH)3. 35. An immunogenic composition according to any one of paragraphs 2 to 22, comprising approximately 1.2, 1.3, 1.4, 1.5, or 1.6 mg / mL of CpG and approximately 1.7 mg / mL of Al(OH)3. 36. An immunogenic composition according to any one of paragraphs 2 to 22, comprising approximately 1.5, 1.6, 1.7, 1.8, or 1.9 mg / mL of CpG and approximately 2.0 mg / mL of Al(OH)3. 37. An immunogenic composition according to any one of paragraphs 2 to 22, comprising approximately 1.8, 1.9, 2.0, 2.1, 2.2, or 2.4 mg / mL of CpG and approximately 2.5 mg / mL of Al(OH)3. 38. An immunogenic composition according to any one of paragraphs 2 to 22, comprising approximately 3.6 mg / mL of CpG and approximately 1.8 mg / mL of Al(OH)3. 39. An immunogenic composition according to any one of paragraphs 2 to 22, comprising approximately 1.4 mg / mL of CpG and approximately 1.7 mg / mL or more of Al(OH)3. 40. An immunogenic composition according to any one of paragraphs 2 to 22, comprising approximately 1.6 mg / mL of CpG and approximately 2.0 mg / mL or more of Al(OH)3. 41. An immunogenic composition according to any one of paragraphs 2 to 22, comprising approximately 2.0 mg / mL of CpG and approximately 2.5 mg / mL or more of Al(OH)3. 42. An immunogenic composition according to any one of paragraphs 2 to 22, comprising a CpG / Al(OH)3 mass ratio of approximately 1.21 or greater. 43. The CpG adjuvant is an immunogenic composition according to any one of paragraphs 2 to 42, comprising histidine or a phosphate buffer. 44. The immunogenic composition described in paragraph 43, wherein the histidine buffer is at a concentration of approximately 1 mM to 100 mM. 45. The immunogenic composition described in paragraph 43, wherein the histidine buffer is at a concentration of approximately 5 mM to 15 mM. 46. The immunogenic composition described in paragraph 43, wherein the histidine buffer is at a concentration of approximately 10 mM. 47. The immunogenic composition described in paragraph 43, wherein the phosphate buffer is at a concentration of approximately 1 mM to 100 mM. 48. The immunogenic composition described in paragraph 43, wherein the phosphate buffer is at a concentration of approximately 5 mM to 15 mM. 49. The immunogenic composition described in paragraph 43, wherein the phosphate buffer is at a concentration of approximately 10 mM. 50. An immunogenic composition according to any one of paragraphs 2 to 43, wherein the CpG adjuvant comprises sodium chloride. 51. The immunogenic composition described in paragraph 50, wherein sodium chloride is present in a concentration of approximately 10 mM to 300 mM. 52. The immunogenic composition described in paragraph 51, wherein sodium chloride is present at a concentration of approximately 20 mM to 100 mM. 53. The immunogenic composition described in paragraph 51, wherein sodium chloride is at a concentration of approximately 50 mM. 54. The immunogenic composition described in paragraph 51, wherein sodium chloride is at a concentration of approximately 60 mM. 55. An immunogenic composition according to any one of paragraphs 2 to 54, wherein the CpG adjuvant has a pH of approximately 6.0 to 7.0. 56. The immunogenic composition described in paragraph 55, wherein the pH is approximately 6.5. 57. The CpG adjuvant is an immunogenic composition as described in paragraph 2, comprising approximately 0.5, 1.0, 1.2, or 3.6 mg / mL of CpG24555. 58. The immunogenic composition described in paragraph 57, wherein the CpG adjuvant contains 3.6 mg / mL of CpG24555. 59. The CpG adjuvant is an immunogenic composition according to paragraph 57 or 58, comprising 3.6 mg / mL of CpG24555, histidine buffer, and sodium chloride. 60. The CpG adjuvant is an immunogenic composition according to any one of paragraphs 57 to 59, comprising approximately 3.6 mg / mL of CpG24555, 10 mM histidine buffer at a pH of approximately 6.5, and 60 mM sodium chloride. 61. The immunogenic composition according to paragraph 2, wherein the CpG adjuvant comprises approximately 0.5 mg / mL of CpG24555 and approximately 1.0 mg / mL of Al(OH)3, approximately 1.0 mg / mL of CpG24555 and approximately 1.0 mg / mL of Al(OH)3, approximately 3.6 mg / mL of CpG24555 and approximately 1.0 mg / mL of Al(OH)3, or approximately 1.0 mg / mL of CpG24555 and approximately 1.5 mg / mL of Al(OH)3. 62. The CpG adjuvant is an immunogenic composition as described in paragraph 61, comprising approximately 1.0 mg / mL of CpG24555 and approximately 1.5 mg / mL of Al(OH)3. 63. The immunogenic composition according to paragraph 61 or 62, wherein the CpG adjuvant comprises approximately 1.0 mg / mL of CpG24555, approximately 1.5 mg / mL of Al(OH)3, histidine buffer, and sodium chloride. 64. The immunogenic composition according to any one of paragraphs 61 to 63, wherein the CpG adjuvant comprises approximately 1.0 mg / mL of CpG24555 and approximately 1.5 mg / mL of Al(OH)3, 10 mM histidine buffer at a pH of approximately 6.5, and 50 mM sodium chloride. 65. The immunogenic composition according to paragraph 1, comprising a saponin-containing liposome adjuvant. 66. The saponin-containing liposome adjuvant is the immunogenic composition according to paragraph 65, comprising a saponin and a monophosphoryl lipid A (MPLA)-containing liposome composition. 67. The immunogenic composition according to paragraph 65 or 66, wherein the saponin-containing liposome adjuvant comprises a liposome composition containing saponin and monophosphoryl lipid A (MPLA), the liposome composition comprising i) a lipid bilayer containing phospholipids and ii) cholesterol. 68. The immunogenic composition according to any one of paragraphs 65 to 67, wherein the saponin is selected from QS-7, QS-18, QS-21, or a mixture thereof. 69. The immunogenic composition according to any one of paragraphs 65 to 68, wherein the saponin is QS-21. 70. An immunogenic composition according to any one of paragraphs 67 to 69, wherein the phospholipid is selected from dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), distearylphosphatidylcholine (DSPC), dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylglycerol (DPPG), and distearylphosphatidylglycerol (DSPG). 71. An immunogenic composition according to any one of paragraphs 67 to 70, wherein the phospholipids are DMPC and DMPG. 72. The saponin-containing liposome adjuvant is an immunogenic composition according to any one of paragraphs 65 to 71, comprising QS-21, monophosphoryl lipid A (MPLA), DMPC, DMPG, and cholesterol. 73. An immunogenic composition according to any one of paragraphs 66 to 72, wherein MPLA is monophosphoryl 3-deacyllipid A. 74. An immunogenic composition according to any one of paragraphs 65 to 73, comprising approximately 0.05 to approximately 1.0 mg / mL or more of QS-21. 75. An immunogenic composition according to any one of paragraphs 65 to 73, comprising approximately 0.1 to approximately 0.4 mg / mL of QS-21. 76. An immunogenic composition according to any one of paragraphs 65 to 73, comprising approximately 0.2 mg / mL of QS-21. 77. An immunogenic composition according to any one of paragraphs 65 to 76, comprising approximately 0.1 to approximately 1.0 mg / mL or more of MPLA. 78. An immunogenic composition according to any one of paragraphs 65 to 76, comprising approximately 0.2 to approximately 0.6 mg / mL of MPLA. 79. An immunogenic composition according to any one of paragraphs 65 to 76, comprising approximately 0.3 to approximately 0.5 mg / mL of MPLA. 80. An immunogenic composition according to any one of paragraphs 65 to 76, comprising approximately 0.4 mg / mL of MPLA. 81. An immunogenic composition according to any one of paragraphs 65 to 80, comprising approximately 0.5 to approximately 20 mg / mL or more of cholesterol. 82. An immunogenic composition according to any one of paragraphs 65 to 80, comprising approximately 5 to approximately 15 mg / mL of cholesterol. 83. An immunogenic composition according to any one of paragraphs 65 to 80, comprising approximately 11 mg / mL of cholesterol. 84. An immunogenic composition according to any one of paragraphs 65 to 83, comprising approximately 0.5 to approximately 20 mg / mL or more of DMPC. 85. An immunogenic composition according to any one of paragraphs 65 to 83, comprising approximately 5 to approximately 15 mg / mL of DMPC. 86. An immunogenic composition according to any one of paragraphs 65 to 83, comprising approximately 14 mg / mL of DMPC. 87. An immunogenic composition according to any one of paragraphs 65 to 86, comprising approximately 0.5 to approximately 3.0 mg / mL or more of DMPG. 88. An immunogenic composition according to any one of paragraphs 65 to 86, comprising approximately 1.0 to approximately 2.0 mg / mL of DMPG. 89. An immunogenic composition according to any one of paragraphs 65 to 86, comprising approximately 1.6 mg / mL of DMPG. 90. The saponin-containing liposome adjuvant is an immunogenic composition according to any one of paragraphs 65 to 89, comprising histidine or a phosphate buffer. 91. The immunogenic composition described in paragraph 90, wherein the phosphate buffer is at a concentration of approximately 1 mM to 100 mM. 92. The immunogenic composition described in paragraph 90, wherein the phosphate buffer is at a concentration of approximately 5 mM to 15 mM. 93. The immunogenic composition described in paragraph 90, wherein the phosphate buffer is at a concentration of approximately 10 mM. 94. The immunogenic composition according to any one of paragraphs 65 to 93, wherein the saponin-containing liposome adjuvant comprises sodium chloride. 95. The immunogenic composition described in paragraph 94, wherein sodium chloride is present in a concentration of approximately 10 mM to 300 mM. 96. The immunogenic composition described in paragraph 51, wherein sodium chloride is present at a concentration of approximately 100 mM to 200 mM. 97. The immunogenic composition described in paragraph 51, wherein sodium chloride is present at a concentration of approximately 150 mM. 98. The immunogenic composition according to any one of paragraphs 65 to 97, wherein the saponin-containing liposome adjuvant has a pH of approximately 5.5 to 7.0. 99. The immunogenic composition described in paragraph 55, having a pH of approximately 6.2. 100. The immunogenic composition described in paragraph 65, wherein the saponin-containing liposome adjuvant comprises approximately 0.2 mg / mL QS-21, approximately 0.4 mg / mL monophosphoryl 3-deacyl lipid A, approximately 14 mg / mL DMPC, approximately 1.6 mg / mL DMPG, and approximately 11 mg / mL cholesterol. 101. The immunogenic composition described in paragraph 65, comprising approximately 0.2 mg / mL QS-21, approximately 0.4 mg / mL monophosphoryl 3-deacyl lipid A, approximately 14 mg / mL DMPC, approximately 1.6 mg / mL DMPG, approximately 11 mg / mL cholesterol, 10 mM phosphate, and 150 mM sodium chloride. 102. The immunogenic composition described in paragraph 65, comprising approximately 0.2 mg / mL QS-21, approximately 0.4 mg / mL monophosphoryl 3-deacyl lipid A, approximately 14 mg / mL DMPC, approximately 1.6 mg / mL DMPG, approximately 11 mg / mL cholesterol, 10 mM phosphate and 150 mM sodium chloride at a pH of approximately 6.2. 103. The immunogenic composition described in paragraph 65, comprising approximately 0.4 mg / mL QS-21, approximately 0.8 mg / mL monophosphoryl 3-deacyllipid A, approximately 28 mg / mL DMPC, approximately 3.2 mg / mL DMPG, and approximately 22 mg / mL cholesterol. 104. The immunogenic composition described in paragraph 65, wherein the saponin-containing liposome adjuvant comprises approximately 0.1 mg / mL QS-21, approximately 0.2 mg / mL monophosphoryl 3-deacyl lipid A, approximately 7 mg / mL DMPC, approximately 0.8 mg / mL DMPG, and approximately 5.5 mg / mL cholesterol. 105. An immunogenic composition according to any one of paragraphs 1 to 104, wherein C. difficile toxoid A comprises the amino acid sequence of SEQ ID NO: 4, which lacks the first methionine, and C. difficile toxoid B comprises the amino acid sequence of SEQ ID NO: 6, which lacks the first methionine. 106. An immunogenic composition according to any one of paragraphs 1 to 105, wherein C. difficile toxoid A comprises the amino acid sequence of SEQ ID NO: 84, and C. difficile toxoid B comprises the amino acid sequence of SEQ ID NO: 86. 107. An immunogenic composition according to any one of paragraphs 1 to 106, comprising C. difficile toxoid A and C. difficile toxoid B in a ratio of approximately 3:1 to approximately 1:1. 108. An immunogenic composition according to any one of paragraphs 1 to 107, comprising 200 μg of toxoid per dose. 109. An immunogenic composition according to any one of paragraphs 1 to 108, further comprising at least one of a buffer, a stabilizer, and a surfactant. An immunogenic composition according to any one of paragraphs 1 to 73, further comprising 110.10 mM Tris, 4.5% ( / v) trehalose dihydrate, and polysorbate 80. 111. An immunogenic composition according to any one of paragraphs 1 to 110, wherein C. difficile toxoid A and toxoid B are lyophilized and reconstituted with a CpG adjuvant or a saponin-containing liposomal adjuvant. 112. The immunogenic composition described in paragraph 111, wherein lyophilized C. difficile toxoid A and toxoid B are reconstituted with a CpG adjuvant containing approximately 3.6 mg / mL of CpG24555. 113. The immunogenic composition described in paragraph 112, wherein lyophilized C. difficile toxoids A and B, totaling 0.4 mg / mL (200 μg / mL toxoid A and 200 μg / mL toxoid B), are reconstituted with a CpG adjuvant containing approximately 3.6 mg / mL of CpG24555. 114. The immunogenic composition described in paragraph 111, wherein lyophilized C. difficile toxoid A and toxoid B are reconstituted with a CpG adjuvant containing approximately 1.0 mg / mL of CpG24555 and approximately 1.5 mg / mL of Al(OH)3. 115. The immunogenic composition described in paragraph 114, in which lyophilized C. difficile toxoids A and B, totaling 0.4 mg / mL (200 μg / mL toxoid A and 200 μg / mL toxoid B), are reconstituted with a CpG adjuvant containing approximately 1.0 mg / mL of CpG24555 and approximately 1.5 mg / mL of Al(OH)3. 116. The immunogenic composition described in paragraph 111, wherein lyophilized C. difficile toxoid A and toxoid B are reconstituted with a saponin-containing liposome adjuvant containing approximately 0.2 mg / mL QS-21, approximately 0.4 mg / mL monophosphoryl 3-deacyllipid A, approximately 14 mg / mL DMPC, approximately 1.6 mg / mL DMPG, and approximately 11 mg / mL cholesterol. 117. The immunogenic composition described in paragraph 116, in which lyophilized C. difficile toxoids A and B, totaling 0.4 mg / mL (200 μg / mL toxoid A and 200 μg / mL toxoid B), are reconstituted with a saponin-containing liposomal adjuvant containing approximately 0.2 mg / mL QS-21, approximately 0.4 mg / mL monophosphoryl 3-deacyllipid A, approximately 14 mg / mL DMPC, approximately 1.6 mg / mL DMPG, and approximately 11 mg / mL cholesterol. An immunogenic composition according to any one of paragraphs 1 to 117, administered in a dosage volume of 118.0.5 mL. 119. An immunogenic composition according to any one of paragraphs 1 to 118, for use as a pharmaceutical. 120. An immunogenic composition according to any one of paragraphs 1 to 118 for use in a method for inducing an immune response in a human subject against C. difficile. 121. An immunogenic composition according to any one of paragraphs 1 to 118, for use as a vaccine. 122. The immunogenic composition described in any one of paragraphs 119 to 121, which is administered to human subjects in the first and second doses of the immunogenic composition. 123. An immunogenic composition according to any one of paragraphs 119 to 121, administered in the first and second doses. 124. The second dose is administered approximately two months after the first dose (e.g., M0, 2), according to the immunogenic composition described in paragraph 123. 125. The second dose is administered approximately 6 months after the first dose (M0, 6), the immunogenic composition as described in paragraph 123. 126. The immunogenic composition according to any one of paragraphs 119 to 121, wherein the human subject is 18 years of age or older, 50 years of age or older, 55 years of age or older, 60 years of age or older, 65 years of age or older, or 70 years of age or older. 127. A method for inducing an immune response in a human subject to C. difficile, comprising the step of administering to a human subject an immunogenic composition described in any one of paragraphs 1 to 118. 128. A method for preventing, treating, or improving an infection, disease, or condition associated with C. difficile in a human subject, comprising the step of administering an immunogenic composition described in any one of paragraphs 1 to 118 to the human subject. 129. A method for preventing, treating, or improving a C. difficile infection requiring medical attention in a human subject, comprising the step of administering an immunogenic composition described in any one of paragraphs 1 to 118 to a human subject. 130. The method according to any one of paragraphs 127 to 129, wherein the immunogenic composition is administered in a first and second dose. 131. The second dose is administered approximately two months after the first dose (e.g., M0, 2), as described in paragraph 130. 132. The second dose is administered approximately 6 months after the first dose (M0, 6), as described in paragraph 130. 133. The method according to any one of paragraphs 127 to 132, wherein the human subject is 18 years of age or older, 50 years of age or older, 55 years of age or older, 60 years of age or older, 65 years of age or older, or 70 years of age or older. 134. The method according to any one of paragraphs 127 to 133, wherein an immune response is induced, comprising a neutralizing antibody against C. difficile toxin A and / or a neutralizing antibody against C. difficile toxin B. 135. Neutralizing antibodies induced against C. difficile toxins A and / or B are greater after two doses of the immunogenic composition compared to three doses of the investigational C. difficile vaccine, according to any one of paragraphs 127 to 134.
[0288] As used herein, the term “approximately” means within a statistically meaningful range of a value such as a concentration range, time frame, molecular weight, temperature, or pH. Such a range may be within one order of magnitude of a given value or range, typically within 20%, more typically within 10%, and even more typically within 5% or 1%. Sometimes such a range may be within the range of typical experimental error of the standard method used to measure and / or determine a given value or range. The acceptable variation encompassed by the term “approximately” is considered to depend on the particular system under investigation and will be readily understood by those skilled in the art. Whenever a range is cited herein, any integer within that range is also contemplated as an embodiment of the present disclosure.
[0289] The inventors intend that, in all cases, the terms “comprising,” “comprise,” and “comprises” are optionally replaceable with the terms “consisting essentially of,” “consist essentially of,” “consists essentially of,” “consisting of,” “consist of,” and “consists of,” respectively.
[0290] All publications and patent applications referenced herein represent the level of skill of those skilled in the art in which the present invention relates. All references or patent applications cited herein are incorporated herein by reference.
[0291] The present invention is illustrated in the appended examples. The following examples are carried out using standard techniques that are well known and routine to those skilled in the art, unless otherwise described in detail. The examples are illustrative but do not limit the present invention. [Examples]
[0292] (Example 1) Immunogenicity of C. difficile vaccine antigen formulated with saponin-containing liposomal adjuvant. The relative immunogenicity of C. difficile toxoid antigens formulated with the saponin-containing liposomal adjuvant (LiNA-2) described herein was compared with formulations containing aluminum hydroxide (Al(OH)3) in non-human primates (NHPs). Functional antitoxin activity was determined by analyzing the collected serum using the toxin neutralization assay (TNA) described herein. TNA demonstrates the ability of antiserum to neutralize the cytotoxic effects mediated by wild-type C. difficile toxin A (TcdA) or toxin B (TcdB) in vitro. TNA provides a quantitative assessment of the functional activity of antibodies present in serum samples. Geometric mean concentrations (GMT) with a 95% confidence interval (CI) are provided for each C. difficile toxoid antigen.
[0293] Rhesus monkeys were immunized with IM with toxoid A (TxdA) and toxoid B (TxdB) according to the study design in Table 1. Group 1 received C. difficile vaccine antigen formulated with Al(OH)3. Groups 2, 3, and 4 received C. difficile vaccine antigen formulated with LiNA-2 adjuvant at 0, 1, and 6 months, 0 and 2 months, and 0 and 6 months, respectively.
[0294] [Table 1]
[0295] Serum was collected at multiple time points, and the ability to neutralize the cytotoxic activity of the toxins was measured in TNA. Individual animal neutralization titers for toxin B are shown in Figure 1, and GMTs are provided in Table 2. The toxoid formulated with LiNA-2 induces a robust and more rapid immune response capable of neutralizing the cytotoxicity of toxin B after two doses, compared to three doses formulated with Al(OH)3. GMTs for toxin A are provided in Table 3.
[0296] [Table 2]
[0297] [Table 3]
[0298] (Example 2) Immunogenicity of C. difficile vaccine antigens formulated with saponin-containing liposomal adjuvants or CpG adjuvants + Al(OH)3, administered at 0, 2, and 6 months of age. The relative immunogenicity of C. difficile toxoid antigens formulated with a saponin-containing liposomal adjuvant (LiNA-2) or a CpG adjuvant combined with Al(OH)3 (CpG24555) was compared with formulations containing Al(OH)3 in NHP. Serum functional cytotoxic activity at multiple postimmunotoxic time points was measured using the toxin neutralization assay described in Example 1. Geometric mean concentrations (GMT) with 95% confidence intervals (CI) are provided for each C. difficile toxoid antigen.
[0299] Rhesus monkeys were immunized with IM using TxdA and TxdB according to the study design in Table 4. Group 1 received C. difficile vaccine antigen formulated with Al(OH)3 at 0, 1, and 6 months. Groups 2 and 3 received C. difficile vaccine antigen formulated with LiNA-2 adjuvant at 0, 2, and 0 and 6 months, respectively. Groups 4 and 5 received C. difficile vaccine antigen formulated with 1 mg / mL CpG adjuvant + 1 mg / mL Al(OH)3 at 0, 2, and 0 and 6 months, respectively.
[0300] [Table 4]
[0301] Serum was collected at multiple time points, and the ability to neutralize the cytotoxic activity of the toxin was measured in TNA. Neutralizing titers for individual animals immunized at 0 and 2 months are shown in Figure 2, and GMTs are provided in Table 5. Toxoid antigens administered with either LiNA-2 or CpG+Al(OH)3 formulations on a 0 and 2-month schedule induced a robust and more rapid immune response capable of neutralizing the cytotoxicity of toxin B after two doses compared to three doses formulated with Al(OH)3. Both LiNA-2 and CpG+Al(OH)3 adjuvant-added formulations induced responses comparable to those determined after three doses of Al(OH)3-formulated toxoid antigens. The functional immune response measured in both adjuvant-added formulation groups vaccinated using the shortened 0 and 2-month schedule was persistent up to 12 months of study (10 months after the second dose). GMTs for toxin A are provided in Table 6.
[0302] [Table 5]
[0303] [Table 6]
[0304] The neutralizing titers of individual animals against toxin B immunized at 0 and 6 months are shown in Figure 3, and GMTs are provided in Table 7. Toxoid antigens administered with either LiNA-2 or CpG+Al(OH)3 formulations on a 0 and 6-month schedule also induced a robust and rapid functional immune response after two doses compared to three doses of Al(OH)3-formulated toxoid antigens. GMTs for toxin A are provided in Table 8.
[0305] [Table 7]
[0306] [Table 8]
[0307] (Example 3) Immunogenicity of C. difficile vaccine antigen formulated with CpG adjuvant + Al(OH)3 at various dose intensities, administered at 0 and 6 months of age. The relative immunogenicity of C. difficile toxoid antigens formulated with two levels of CpG adjuvant (CpG24555) combined with Al(OH)3 was compared with formulations containing Al(OH)3 in NHP. Serum functional cytotoxic activity at multiple postimmunotoxic time points was measured using the toxin neutralization assay described in Example 1. Geometric mean concentrations (GMT) with 95% confidence intervals (CI) are provided for each C. difficile toxoid antigen.
[0308] Rhesus monkeys were immunized with IM using TxdA and TxdB according to the study design in Table 9. Group 1 received three doses of C. difficile vaccine antigen formulated with Al(OH)3 (at months 0, 1, and 6). Groups 2 and 3 received two doses of C. difficile vaccine antigen formulated with either 0.5 mg / mL CpG + 1 mg / mL Al(OH)3 or 1 mg / mL CpG + 1 mg / mL Al(OH)3, respectively (at months 0 and 6).
[0309] [Table 9]
[0310] Serum was collected at multiple time points, and the ability to neutralize the cytotoxic activity of the toxins was measured in TNA. The neutralization titers of individual animals for toxin B are shown in Figure 4, and GMTs are provided in Table 10, showing that both CpG+Al(OH)3 formulations induced a robust and rapid immune response capable of neutralizing the cytotoxicity of toxin B after only two doses. GMTs for toxin A are provided in Table 11.
[0311] [Table 10]
[0312] [Table 11]
[0313] (Example 4) Immunogenicity of C. difficile vaccine antigens formulated with CpG adjuvant alone or with CpG adjuvant plus Al(OH)3 at various dose intensities, administered in months 0 and 2. The relative immunogenicity of C. difficile toxoid antigens formulated with CpG (CpG24555) alone or with CpG24555 combined with Al(OH)3 was compared in NHP with formulations containing Al(OH)3. Serum functional cytotoxic activity at multiple postimmunotoxic time points was measured using the toxin neutralization assay described in Example 1. Geometric mean concentrations (GMT) with 95% confidence intervals (CI) are provided for each C. difficile toxoid antigen.
[0314] Rhesus monkeys were immunized with IM with TxdA and TxdB according to the study design in Table 12. Group 1 received C. difficile vaccine antigen formulated with Al(OH)3 at 0, 1, and 6 months. Groups 2, 3, and 4 received two doses (at 0 and 2 months) of vaccine formulated with CpG+Al(OH)3, containing CpG adjuvant at 0.5, 1.0, or 3.6 mg / mL, respectively, and 1 mg / mL Al(OH)3. Groups 5 and 6 received two doses (at 0 and 2 months) of vaccine formulated with CpG alone, containing either 0.5 or 3.6 mg / mL of CpG, respectively.
[0315] [Table 12]
[0316] Serum was collected at multiple time points, and the ability to neutralize the cytotoxic activity of the toxins was measured in TNA. The neutralizing titers for individual animals against toxin B are shown in Figure 5, and GMTs are provided in Tables 13–14. The TNA response to toxoid antigens formulated with a combination of CpG + Al(OH)3 showed a CpG dose response (groups 2–4). The TNA response measured in serum collected from NHP immunized with toxoids formulated with 1.0 or 3.6 mg / mL CpG + Al(OH)3 (groups 3 and 4) was substantially higher than the response measured in serum from the 0.5 mg / mL CpG + 1 mg / mL Al(OH)3 group (group 2). Toxoid antigens formulated with either level of CpG alone (without Al(OH)3) (groups 5 and 6) also induced a strong TNA response in NHP. GMTs for toxin A are provided in Tables 15–16.
[0317] [Table 13]
[0318] [Table 14]
[0319] [Table 15]
[0320] [Table 16]
[0321] (Example 5) Immunogenicity of C. difficile vaccine antigens formulated with various saponin-containing liposomal adjuvants. The relative immunogenicity of C. difficile toxoid antigens formulated with aluminum hydroxide (Al(OH)3) and different saponin-containing liposomal adjuvants (LiNA-2) (e.g., homogeneous and heterogeneous) was compared in rats. Homogeneous and heterogeneous LiNA-2 adjuvants are described herein and in Table 17. Final rat LiNA-2 adjuvant doses were prepared by diluting 1× concentration LiNA-2 at a 1:5 dilution using PBS buffer at pH 6.2.
[0322] [Table 17]
[0323] The functional cytotoxic activity of serum at multiple time points after immunization was measured using the toxin neutralization assay described in Example 1.
[0324] Wistar Han rats (10 rats per group, 8-10 weeks old, Charles River Laboratories) were immunized with IM according to the study design in Table 18. Group 1 received C. difficile vaccine antigen formulated with Al(OH)3. Groups 2 and 3 received C. difficile vaccine antigen formulated with homogeneous and heterogeneous LiNA-2 adjuvants, respectively.
[0325] Serum was collected at multiple time points, and its ability to neutralize the cytotoxic activity of the toxin was measured in TNA. The neutralization titers for toxin B in serum from individual animals are shown in Figure 6, indicating that toxoids formulated with homogeneous and heterogeneous LiNA-2 induced similar immune responses capable of neutralizing the cytotoxicity of toxin B.
[0326] [Table 18]
[0327] (Example 6) Determination of the ratio and concentration of CpG / Al(OH)3 To understand the binding properties of C. difficile toxoid and CpG24555 (hereinafter referred to as "CpG"), binding studies were conducted using various CpG and Al(OH)3 concentrations and ratios. Formulation parameters affecting the binding of both CpG and the antigen to Al, such as CpG and Al(OH)3 concentrations, were investigated. C. difficile drug products for binding studies were formulated and lyophilized at a concentration of 0.4 mg / mL (200 μg / mL toxoid A and 200 μg / mL toxoid B) in 10 mM Tris, 4.5% (w / v) trehalose dihydrate, 0.01% (w / v) polysorbate 80, pH 7.4, and reconstituted with CpG / Al(OH)3 formulations. CpG / Al(OH)3 was formulated as a liquid in 10 mM histidine, 60 mM NaCl, and pH 6.5.
[0328] The total and bound CpG concentrations in CpG / Al(OH)3 suspension samples were determined using UV spectroscopy. The bound CpG concentration represents the amount of CpG bound to Al(OH)3. The standard optical density at 260 nm was measured to determine the theoretical absorbance constant of CpG (the absorbance constant of CpG at 260 nm is 38.19 mg / L). -1 The concentrations of oligonucleotides in the sample were calculated using the Baer-Lambert equation (where ≠ cm). After dissociating CpG from Al(OH)3, the total oligonucleotide concentration was measured. After centrifugation of the CpG / Al(OH)3 suspension to precipitate the particles, the unbound oligonucleotide concentration was measured by analyzing the supernatant. The bound CpG concentration was determined by subtracting the unbound CpG concentration from the total CpG concentration. The percentage of bound CpG to Al(OH)3 is the percentage of bound CpG concentration relative to the total CpG concentration.
[0329] To determine the percentage of bound toxoid, TxdA and TxdB were separated by anion exchange chromatography, detected by UV detection, and then quantified by comparing the peak response of the protein of interest to the response of a reference material of known concentration. After reconstituting the lyophilized C. difficile drug product vial with physiological saline, the total toxoid concentration was measured. After reconstituting the lyophilized C. difficile drug product vial with CpG / Al(OH)3, the unbound toxoid concentration was measured by centrifugation of the C. difficile drug product + CpG / Al(OH)3 suspension to precipitate particles, and analysis of the supernatant. The concentration of bound toxoid was determined by subtracting the unbound toxoid concentration from the total toxoid concentration. The percentage of bound toxoid to Al(OH)3 is the percentage of bound toxoid concentration relative to the total toxoid concentration.
[0330] Three aluminum levels were assessed: 0.85 mg, 1.0 mg, and 1.25 mg per 0.5 mL dose. As shown in Table 19, various concentrations of CpG were prepared with Al(OH)3 at each aluminum concentration. The prepared CpG / Al(OH)3 adjuvants were used to reconstitute lyophilized C. difficile toxoid, achieving a total toxoid of 400 μg / mL after reconstitution. Table 19 shows that total toxoid binding was achieved at CpG / Al(OH)3 concentrations above 1.4 / 1.7 mg / mL, 1.6 / 2.0 mg / mL, and 2.0 / 2.5 mg / mL, respectively.
[0331] [Table 19]
[0332] Based on the results in Table 19, the relationship between toxoid binding % and the Al(OH)3 / CpG mass ratio was summarized and plotted in Figure 7. The toxoid binding to aluminum increased with increasing Al(OH)3 / CpG mass ratio. When the Al(OH)3 / CpG mass ratio was ≥1.21, complete toxoid binding to aluminum was achieved, providing an estimate of the maximum acceptable CpG in formulations with a certain amount of Al(OH)3 for achieving complete binding of C. difficile toxoid.
[0333] (Example 7) Formulation development of CpG / Al(OH)3 Binding and resuspension studies were conducted on various CpG / Al(OH)3 formulations: low-dose formulations of 1.0 / 1.5 mg / mL CpG / Al(OH)3 and 1.2 / 1.8 mg / mL CpG / Al(OH)3, and high-dose formulations of 3.6 / 1.8 mg / mL CpG / Al(OH)3 (see Tables 20 and 21). For binding studies, C. difficile drug products were formulated and lyophilized in 10 mM Tris, 4.5% (w / v) trehalose dihydrate, 0.01% (w / v) polysorbate 80, pH 7.4, at concentrations of 200 μg / mL toxoid A and 200 μg / mL toxoid B. The CpG / Al(OH)3 adjuvants were formulated as liquids and assessed.
[0334] The binding investigation was conducted as described above. Each CpG / Al(OH)3 adjuvant was filled into a 1 mL syringe with a filling volume of 0.75 mL, and the resuspension characteristics of the formulation were investigated by stopping the syringe with a headspace of approximately 5 ± 1 mm. The filled syringes were kept horizontal at 5°C until complete sedimentation was achieved. Resuspension was monitored by counting the average number of shakes from the three syringes required to achieve a homogeneous suspension, based on visual observation.
[0335] For various low-dose formulations, complete CpG binding and C. difficile toxoid binding were observed after reconstitution. Furthermore, various formulations required fewer than five shakes after initial sedimentation in a filled syringe placed horizontally, indicating no concerns about resuspension. For high-dose formulations, various buffer components and NaCl amounts were assessed to improve resuspension and binding.
[0336] [Table 20]
[0337] [Table 21]
[0338] (Example 8) Phase 1 and Phase 2 randomized studies to evaluate the safety, tolerability, immunogenicity, and immunoopersistence of Clostridioides difficile vaccine administered in a two-dose regimen with a novel adjuvant in healthy adults. This Phase 1 / 2 study in adults ≥50 to <85 years of age will evaluate the safety and immunogenicity of various C. difficile vaccine formulations. It will assess whether adjuvant-added formulations exhibit a similar safety profile with improved immunogenicity (more rapid increase in protective antibodies, along with maintained persistence) in a two-dose regimen compared to the current Al(OH)3-containing vaccine formulation in a three-dose regimen.
[0339] Phase 1 Phase 1 will identify preferred adjuvants and dosing schedules. Using a parallel-group design, approximately 140 healthy adults ≥65–<85 years of age will be equally randomized to one of seven groups (20 participants per group) to receive either the C. difficile vaccine administered with one of three novel formulations in a 0 and 2-month or 0 and 6-month dosing schedule, or the C. difficile vaccine administered with the current Al(OH)3-containing formulation (control) in a 0, 1, and 6-month dosing schedule. Blood will be collected from all participants at screening and at visits 1–7 for safety clinical laboratory assessment. Additional blood will be collected from all participants at visits 1 and 3–8 for immunogenicity assessment. Participants will be followed up for safety for 6 months after the final investigational injection (visit 8). The group will receive one of the following C. difficile vaccines: investigational C. difficile vaccine + low-dose CpG + Al(OH)3 at 0–2 months or 0–6 months; investigational C. difficile vaccine + high-dose CpG only at 0–2 months or 0–6 months; investigational C. difficile vaccine + LiNA-2 at 0–2 months or 0–6 months; or investigational C. difficile vaccine + Al(OH)3 only at 0–1–6 months (current formulation: control).
[0340] Phase 2 Based on safety and immunogenicity data collected during Phase 1, one or two adjuvants and corresponding dosing schedules will be selected to proceed to Phase 2. If one adjuvant is selected, Phase 2 will enroll a total of approximately 215 healthy adults, with approximately 50 participants ≥50–<65 years old and approximately 165 participants ≥65–<85 years old. All participants will receive two doses of the adjuvant-added C. difficile vaccine in an open-label manner, using the same dosing schedule (at months 0 and 2 or 0 and 6). If two adjuvant formulations are selected after Phase 1, an additional vaccine group consisting of 215 participants (50 participants ≥50 to <65 years old and 165 participants ≥65 to <85 years old) will be added for the second adjuvant formulation, and participants will be equally randomized into one of two vaccine groups that will receive a C. difficile vaccine formulated with one of the two selected adjuvants.
[0341] Participants will be followed up for safety up to 6 months after their last vaccination and for antibody persistence for up to 4 years after their last vaccination. Blood samples will be collected from all participants at their first, second, and fourth through ninth visits for immunogenicity assessment.
[0342] Investigation arm and duration: The study will be conducted in two phases. Participants in Phase 1 will participate in the study for approximately 12 months. Participants in Phase 2 will participate in the study for up to approximately 4.5 years (2-6 months of vaccination, 6 months of safety follow-up, and up to 3.5 years of antibody persistence follow-up).
[0343] Phase 1 objective major • Describe the safety profile of the C. difficile vaccine when administered in a two-dose regimen using a novel adjuvant in healthy adults. - Evaluation items: Local reactions (pain, redness, and swelling at the injection site); systemic events (fever, vomiting, diarrhea, headache, malaise, new or worsening muscle pain, and new or worsening arthralgia); adverse events (AEs); serious adverse events (SAEs); adverse events requiring medical attention (MAAEs) Further description of the safety profile of C. difficile vaccine when administered in a two-dose regimen with a novel adjuvant in healthy adults. - Evaluation items: Hematological and chemical clinical laboratory parameters
[0344] secondary • Describe the immune response induced by C. difficile vaccine in healthy adults when administered in a two-dose regimen using a novel adjuvant. - Evaluation item: C. difficile TNA (specific neutralizing antibody for toxins A and B) concentration - Estimate: In evaluable participants: GMC (geometric mean concentration) at each planned time point after vaccination, and GMFR (geometric mean increase in genomic filtration rate) from pre-vaccination levels at each planned time point after vaccination. • Describe the safety profile of the C. difficile vaccine when administered in a two-dose regimen using a novel adjuvant in healthy adults. - Evaluation items: SAEs and adverse events requiring medical attention from 6 to 12 months after the last dose.
[0345] Phase 2 objective major • Describe the safety profile of the C. difficile vaccine when administered in a two-dose regimen using a selected novel adjuvant in healthy adults. - Evaluation items: Local reactions (pain, redness, and swelling at the injection site); systemic events (fever, vomiting, diarrhea, headache, malaise, new or worsening muscle pain, and new or worsening arthralgia); adverse events (AEs); serious adverse events (SAEs); adverse events requiring medical attention (MAAEs) • Describe the immune response to C. difficile vaccine in healthy adults when administered in a two-dose regimen using a novel adjuvant selected from among the available options. - Evaluation item: C. difficile TNA concentration - Estimand: In evaluable participants: GMC at one month after the last dose; GMFR from before vaccination to one month after the last dose.
[0346] secondary Further description of the immune response to C. difficile vaccine in healthy adults administered in a two-dose regimen using a novel adjuvant selected for that purpose. - Evaluation item: C. difficile TNA concentration - Estimates: Among evaluable participants: GMC at 1 month after the first dose and 6 months after the last dose; GMFR from before vaccination to 1 month after the first dose and 6 months after the last dose; Percentage of participants with a ≥4-fold increase in TNA concentration from before vaccination to 1 month after the last dose. • Describe the duration of the immune response to C. difficile vaccine when administered in a two-dose regimen using a novel adjuvant selected in healthy adults. - Evaluation item: C. difficile TNA concentration - Estimates: In evaluable participants: GMC at each planned duration time (1, 2, 3, and 4 years after the last dose); GMFR from before vaccination to each planned duration time (from before vaccination to 1, 2, 3, and 4 years after the last dose). • Describe the safety profile of the C. difficile vaccine when administered in a two-dose regimen using a novel adjuvant in healthy adults. - Evaluation items: SAEs and adverse events requiring medical attention from 6 to 12 months after the last dose.
Claims
[Claim 1] An immunogenic composition comprising Clostridioides difficile (C. difficile) toxoid A and / or toxoid B, and a CpG adjuvant or a saponin-containing liposomal adjuvant.