SARS-CoV-2 mRNA domain vaccine

Abstract

Currently, there is no specific treatment for COVID-19 or a vaccine against SARS-CoV-2 infection. The ongoing health problems and mortality associated with coronavirus infections, particularly the SARS-CoV-2 pandemic, are a major international concern. The public health crisis caused by SARS-CoV-2 highlights the importance of rapidly developing effective and safe vaccine candidates against these viruses. [Solution] This disclosure relates to a coronavirus ribonucleic acid (RNA) vaccine, as well as methods for using the vaccine and compositions comprising the vaccine. The RNA vaccine encodes the domains and subunits of the coronavirus.

Description

[Technical Field]

[0001] Related applications This application claims the interests of U.S. Provisional Application No. 62 / 971,825 filed on 7 February 2020, U.S. Provisional Application No. 63 / 016,175 filed on 27 April 2020, U.S. Provisional Application No. 63 / 044,330 filed on 25 June 2020, and U.S. Provisional Application No. 63 / 063,137 filed on 7 August 2020, each of which is incorporated herein by reference in its entirety. [Background technology]

[0002] Human coronaviruses are highly transmissible enveloped positive-sense RNA viruses belonging to the family Coronaviridae. Two subfamilies of Coronaviridae are known to cause human disease. The most important is β-coronavirus (beta-coronavirus). β-coronaviruses are a common cause of mild to moderate upper respiratory tract infections. However, outbreaks of COVID-19, such as the coronavirus infection first identified in Wuhan, China in December 2019, are associated with a high mortality rate. This recently identified coronavirus is called Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) (formerly known as "2019 Novel Coronavirus" or "2019-nCoV") and has rapidly infected hundreds of thousands of people. The pandemic disease caused by the SARS-CoV-2 virus was named COVID-19 (Coronavirus Disease 2019) by the World Health Organization (WHO). The initial genome sequence of the SARS-CoV-2 isolate (Wuhan-Hu-1) was released on January 10, 2020, by researchers at the China CDC in Beijing, at Virological, a UK-based discussion forum for the evolution and epidemiological analysis and interpretation of viral molecules. Subsequently, this sequence was deposited in GenBank on January 12, 2020, under GenBank accession number MN908947.1. [Prior art documents] [Patent Documents]

[0003] [Patent Document 1] PCT / US2012 / 058519 [Patent Document 2] PCT / US2013 / 075177 [Patent Document 3] PCT / US2014 / 058897 [Patent Document 4] PCT / US2014 / 058891 [Patent Document 5] PCT / US2014 / 070413 [Patent Document 6] PCT / US2015 / 36773 [Patent Document 7] PCT / US2015 / 36759 [Patent Document 8] PCT / US2015 / 36771 [Patent Document 9] PCT / IB2017 / 051367 [Overview of the project] [Problems that the invention aims to solve]

[0004] Currently, there is no specific treatment for COVID-19 or a vaccine against SARS-CoV-2 infection. The ongoing health problems and mortality associated with coronavirus infections, particularly the SARS-CoV-2 pandemic, are a major international concern. The public health crisis caused by SARS-CoV-2 highlights the importance of rapidly developing effective and safe vaccine candidates against these viruses. [Means for solving the problem]

[0005] Provided herein are compositions (e.g., vaccines) comprising, in some embodiments, one or more messenger ribonucleic acid (mRNA) molecules encoding a highly immunogenic antigen(s) capable of inducing a potent neutralizing antibody response to the SARS-CoV-2 antigen. The mRNA molecules described herein express a key neutralizing domain of the SARS-CoV-2 coronavirus spike (S) protein, which is effective in inducing protective immunity when used individually or in combination as an immunogenic composition or vaccine to protect a person from infection with a natural virus and / or to mitigate symptoms if infection occurs. The envelope S protein of known betacoronaviruses is crucial for SARS-CoV-2 infection, as it determines the virus's host targeting and entry into host cells. The composition of the S protein is similar among betacoronaviruses such as SARS-CoV-2, SARS-CoV, MERS-CoV, HKU1-CoV, MHV-CoV, and NL63-CoV, each containing two subunits, S1 and S2, which mediate attachment and membrane fusion. The S1 subunit includes an N-terminal domain (NTD) and a receptor-binding domain (RBD).

[0006] Subunit antigen expression allows the immune response to focus on a specific subunit while minimizing the stimulation of memory B and T cells specific to other domains of the antigen shared with other related viruses. The data provided herein demonstrate that administration of mRNA encoding membrane-bound or soluble SARS-CoV-2 S1 subunit antigens generated antibody titers against SARS-CoV-2 RBD antigen, NTD antigen, wild-type full-length S protein, and S protein with a double proline mutation (stabilizing the higher-order structure before fusion). As shown herein, in all doses tested, two-dose regimens (i.e., including an additional immune dose) were effective in inducing antibodies capable of recognizing and binding to the SARS-CoV-2 WT S protein. Surprisingly, the highest inducing titer was measured against the double proline-stabilized version of the S protein, even in the absence of a double proline mutation in the S1 subunit (the double proline mutation occurred in S2, which was not present in the immunogen tested).

[0007] Furthermore, both NTDs and RBDs are known to be antibody binding sites that neutralize viral activity. In the case of SARS-CoV-2, the RBD is the receptor binding site of the spike protein that binds to angiotensin-converting enzyme 2 (ACE2). Although the function of the NTD is not fully understood, it appears to play a role in binding the sugar moiety and promoting the higher-order structural change of the spike protein from pre-fusion to post-fusion. In any case, both the NTD domain and the RBD domain induce high-binding antibody and neutralizing antibody titers, as shown herein.

[0008] For example, and quite surprisingly, data provided in some embodiments herein show that while serum derived from administration of mRNA encoding membrane-bound RBD antigen (RBD-TM) or membrane-bound NTD antigen (NTD-TM) exhibited immunogenicity against the SARS-CoV-2 S1 / S2 spike protein, a 50:50 combination of the two mRNAs (and therefore the two antigens) generated an unexpectedly high synergistic neutralizing antibody titer against the SARS-CoV-2 S1 / S2 spike protein.

[0009] Accordingly, some aspects of the present disclosure provide compositions comprising mRNA encoding a functional domain of the SARS-CoV-2 S protein that can induce an immune response, such as a neutralizing antibody response, against SARS-CoV-2. In some embodiments, the mRNA is formulated in lipid nanoparticles.

[0010] In some embodiments, mRNA containing an open reading frame (ORF) encoding at least two domains of the SARS-CoV-2 spike protein and a sub-full-length spike protein are provided. A sub-full-length spike protein is a spike protein that is at least one amino acid shorter than the full-length spike protein, or one or more domains and / or subunits of a fusion protein having one or more domains linked together in a non-natural order or sequence. In some embodiments, one of the two domains is the N-terminal domain (NTD) of the SARS-CoV-2 spike protein. In some embodiments, one of the two domains is the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein. In some embodiments, the ORF encodes a transmembrane domain (TD) linked to the NTD and / or RBD. In some embodiments, the TD is the influenza hemagglutinin transmembrane domain. In some embodiments, the ORF comprises NTD-RBD-TM. In some embodiments, at least two domains are linked via a cleavable or non-cleavable linker. In some embodiments, the non-cleavable linker is a glycine-serine (GS) linker. In some embodiments, the GS linker is 4-15 amino acids. In some embodiments, the linker is a pan-HLA DR-binding epitope (PADRE). In some embodiments, the ORF encodes a signal peptide. In some embodiments, the signal peptide is linked to an NTD. In some embodiments, the signal peptide is linked to an RBD. In some embodiments, the signal peptide is heterogeneous to SARS-CoV-2. In some embodiments, at least two domains are soluble. In some embodiments, the ORF encodes a transport signal domain. In some embodiments, the transport signal domain is a macrophage marker. In some embodiments, the macrophage marker is CD86 and / or CD11b. In some embodiments, the transport signal domain is a VSV-G cytoplasmic tail (VSVGct).In some embodiments, one of the two domains is the first repeating heptapeptide: HPPHCPC(HR1) of the SARS-CoV-2 spike protein. In some embodiments, one of the two domains is the second repeating heptapeptide: HPPHCPC(HR2) of the SARS-CoV-2 spike protein. In some embodiments, the ORF encodes a transmembrane domain (TD) linked to HR1 and / or HR2. In some embodiments, the TD is the influenza hemagglutinin transmembrane domain. In some embodiments, the ORF encodes a fusion peptide (FP). In some embodiments, the ORF encodes a CT tail.

[0011] In some embodiments, mRNA is provided that includes an open reading frame (ORF) encoding the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein. In some embodiments, the RBD is soluble. In some embodiments, the RBD is ligated to a transmembrane domain, optionally to an influenza hemagglutinin transmembrane domain.

[0012] Details of one or more embodiments of the present invention are described below. Other features and advantages of the present invention will also be apparent from the following drawings, the detailed descriptions of some embodiments, and the appended claims. [Brief explanation of the drawing]

[0013] [Figure 1] Schematic diagram of wild-type and 2P spike protein antigens encoded by the mRNA of the present invention; signal peptide (SP), unfilled; N-terminal domain (NTD), dotted line; receptor-binding domain (RBD), downward diagonal stripes; subdomain 1 (SD1), horizontal stripes; subdomain 2 (SD2), wave; fusion peptide (FP), upward diagonal stripes; heptad repeat 1 (HR1) weave; heptad repeat 2 (HR2) diagonal brick pattern; (TM), vertical stripes; and cytoplasmic tail (CT), brick pattern. [Figure 2]Examples 1-3 show exemplary linear designs of antigens encoded by mRNA. [Figure 3-1] Figure 2 shows the sequence alignment of the antigens. [Figure 3-2] Figure 2 shows the sequence alignment of the antigens. [Figure 4] Examples 4-6 show exemplary linear designs of antigens encoded by mRNA. [Figure 5-1] This specification shows sequence alignments of various S1 subunit antigens described herein. [Figure 5-2] This specification shows sequence alignments of various S1 subunit antigens described herein. [Figure 6] Examples 7 and 8 show exemplary linear designs of antigens encoded by mRNA. [Figure 7] This shows the correlation between neutralization and ELISA titer. [Figure 8A] This shows serum IgG1 and IgG2a titers on day 36, following the initial immunization on day 1 and the additional immunization on day 21, in mice with mRNA encoding NTD-RBD-TM in the LNP. [Figure 8B] This shows serum IgG1 and IgG2a titers on day 36, following the initial immunization on day 1 and the additional immunization on day 21, in mice with mRNA encoding NTD-RBD-TM in the LNP. [Figure 8C] This shows serum IgG1 and IgG2a titers on day 36, following the initial immunization on day 1 and the additional immunization on day 21, in mice with mRNA encoding NTD-RBD-TM in the LNP. [Modes for carrying out the invention]

[0014] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a newly emerged respiratory virus with high morbidity and mortality rates. Compared to SARS-CoV, which emerged in 2002, and Middle East respiratory syndrome coronavirus (MERS-CoV), which emerged in 2012, SARS-CoV-2 is spreading rapidly worldwide. According to the World Health Organization (WHO), as of July 6, 2020, the current COVID-19 outbreak has resulted in approximately 11.5 million confirmed cases and over 530,000 deaths worldwide. New cases of COVID-19 infection are increasing and continue to rise rapidly. Therefore, it is crucial to develop a variety of safe and effective vaccines and drugs to prevent and treat COVID-19 and mitigate its serious impact worldwide. Vaccines and drugs manufactured using various modalities, and vaccines with improved safety and efficacy, are essential. There remains a need to accelerate the advanced design and development of vaccines and treatments for coronavirus disease 2019 (COVID-19).

[0015] On January 7, 2020, Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) was identified as the causative agent of a new pneumonia outbreak that occurred in Wuhan, Hubei Province, China in December 2019 (Lu H. et al. (2020) J Med Virol. Apr;92(4):401-402.). Shortly thereafter, this virus caused an outbreak in China and spread worldwide. Analysis of the SARS-CoV-2 genome structure indicates that it belongs to the β-coronavirus (CoV) group (Chan et al. 2020 Emerg Microbes Infect.;9(1):221-236).

[0016] The key protein on the surface of the coronavirus is the spike protein. A wide variety of mRNA constructs have been designed and are disclosed herein. When mRNA encoding the spike antigen is formulated into a suitable delivery vehicle, its subunits and domains can induce a potent immune response against SARS-CoV-2, thus producing an effective and potent mRNA vaccine. Administration of mRNA encoding various spike protein antigens, particularly spike protein subunits and domain antigens, results in the delivery of mRNA to immune tissues and cells of the immune system, where the mRNA is rapidly translated into protein antigens. Other immune cells, such as B cells and T cells, can then recognize and mount the mRNA, triggering an immune response against the encoded protein, ultimately producing a long-term protective response against the coronavirus. The drawbacks of protein vaccine development, such as low immunogenicity, inadequate presentation to the immune system, or misfolding of the antigen, are circumvented by the use of highly effective mRNA vaccines encoding the spike protein, subunits, and their domains disclosed herein.

[0017] This disclosure provides compositions (e.g., mRNA vaccines) that induce potent neutralizing antibodies against coronavirus antigens. In some embodiments, the composition comprises mRNA encoding at least one (e.g., one, two, or more) coronavirus antigens, such as the SARS-CoV-2 antigen. In some embodiments, the mRNA encodes, for example, a spike protein domain, such as a receptor-binding domain (RBD), an N-terminal domain (NTD), or a combination of the RBD and NTD.

[0018] Some aspects of this disclosure provide messenger ribonucleic acid (mRNA) comprising a receptor-binding domain (RBD) and a transmembrane domain of the SARS-CoV-2 spike protein, for example, an open reading frame encoding a fusion protein that is naturally occurring or includes heterologous transmembrane domains.

[0019] In some embodiments, the protein transmembrane domain is an influenza hemagglutinin transmembrane domain.

[0020] In some embodiments, the fusion protein includes an amino acid sequence that has at least 80% identity with the amino acid sequence of SEQ ID NO: 77.

[0021] In some embodiments, the fusion protein includes an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 77.

[0022] In some embodiments, the fusion protein contains the amino acid sequence of SEQ ID NO: 77.

[0023] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 76.

[0024] In some embodiments, the open reading frame includes a nucleotide sequence having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 76.

[0025] In some embodiments, the open reading frame includes the nucleotide sequence of SEQ ID NO: 76.

[0026] Other aspects of the present disclosure provide messenger ribonucleic acid (mRNA) comprising an open reading frame encoding a fusion protein including the amino(N)-terminal domain and transmembrane domain of the SARS-CoV-2 spike protein.

[0027] In some embodiments, the transmembrane domain is an influenza hemagglutinin transmembrane domain.

[0028] In some embodiments, the fusion protein includes an amino acid sequence that has at least 80% identity with the amino acid sequence of SEQ ID NO: 47.

[0029] In some embodiments, the fusion protein includes an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 47.

[0030] In some embodiments, the fusion protein contains the amino acid sequence of SEQ ID NO: 47.

[0031] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 46.

[0032] In some embodiments, the open reading frame includes a nucleotide sequence having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 46.

[0033] In some embodiments, the open reading frame includes the nucleotide sequence of SEQ ID NO: 46.

[0034] Further aspects of the present disclosure provide a messenger ribonucleic acid (mRNA) comprising an open reading frame encoding a fusion protein containing a receptor-binding domain of the SARS-CoV-2 spike protein linked to the amino(N)-terminal domain of the SARS-CoV-2 spike protein via an optional linker.

[0035] In some embodiments, the fusion protein further includes a transmembrane domain.

[0036] In some embodiments, the fusion protein includes an amino acid sequence that has at least 80% identity with the amino acid sequence of SEQ ID NO: 92.

[0037] In some embodiments, the fusion protein includes an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 92.

[0038] In some embodiments, the fusion protein contains the amino acid sequence of SEQ ID NO: 92.

[0039] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 91.

[0040] In some embodiments, the open reading frame includes a nucleotide sequence having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 91.

[0041] In some embodiments, the open reading frame includes the nucleotide sequence of SEQ ID NO: 91.

[0042] In some embodiments, the mRNA further comprises a 5' untranslated region (UTR) which optionally contains the nucleotide sequence of sequence number 131 or 132.

[0043] In some embodiments, the mRNA further includes a 3' untranslated region (UTR) which optionally contains the nucleotide sequence of sequence number 132 or 4.

[0044] In some embodiments, the mRNA further comprises a 5' cap, optionally 7mG(5')ppp(5')NlmpNp.

[0045] In some embodiments, the mRNA further includes a poly-A tail, optionally about 100 nucleotides in length.

[0046] In some embodiments, the mRNA contains chemical modifications, optionally including 1-methylpseuduridine.

[0047] Some aspects of this disclosure provide compositions comprising any one of the mRNAs described in the preceding paragraphs.

[0048] Other aspects of this disclosure provide compositions comprising at least two of any one mRNA from the preceding paragraphs.

[0049] Other aspects of the present disclosure provide compositions comprising: (a) messenger ribonucleic acid (mRNA) comprising an open reading frame encoding a fusion protein comprising the receptor-binding domain (RBD) and transmembrane domain of the SARS-CoV-2 spike protein; and (b) mRNA comprising an open reading frame encoding a fusion protein comprising the amino(N)-terminal domain and transmembrane domain of the SARS-CoV-2 spike protein. In some embodiments, the ratio of mRNA of (a) to mRNA of (b) is about 1:1, for example, 1:2, 1:3, 2:1, or 3:1. In some embodiments, at least 50% of the mRNA in the composition is mRNA of (a). For example, at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the mRNA in the composition is mRNA of (a). In some embodiments, at least 50% of the mRNA in the composition is mRNA of (b). For example, at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the mRNA in the composition is (b) mRNA.

[0050] In some embodiments, the protein transmembrane domain is an influenza hemagglutinin transmembrane domain.

[0051] In some embodiments, the fusion protein of (a) includes an amino acid sequence having at least 80% identity with the amino acid sequence of SEQ ID NO: 77.

[0052] In some embodiments, the fusion protein of (a) comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 77.

[0053] In some embodiments, the fusion protein of (a) contains the amino acid sequence of SEQ ID NO: 77.

[0054] In some embodiments, the open reading frame of (a) includes a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 76.

[0055] In some embodiments, the open reading frame of (a) includes a nucleotide sequence having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 76.

[0056] In some embodiments, the open reading frame of (a) includes the nucleotide sequence of SEQ ID NO: 76.

[0057] In some embodiments, the fusion protein of (b) includes an amino acid sequence that has at least 80% identity with the amino acid sequence of SEQ ID NO: 47.

[0058] In some embodiments, the fusion protein of (b) comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 47.

[0059] In some embodiments, the fusion protein of (b) contains the amino acid sequence of SEQ ID NO: 47.

[0060] In some embodiments, the open reading frame of (b) includes a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 46.

[0061] In some embodiments, the open reading frame of (b) includes a nucleotide sequence having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 46.

[0062] In some embodiments, the open reading frame of (b) includes the nucleotide sequence of SEQ ID NO: 46.

[0063] In some embodiments, mRNA is formulated in lipid nanoparticles.

[0064] In some embodiments, the composition further comprises lipid nanoparticles.

[0065] In some embodiments, mRNA (a) is formulated in lipid nanoparticles, and mRNA (b) is formulated in lipid nanoparticles.

[0066] In some embodiments, the lipid nanoparticles include cationic lipids.

[0067] In some embodiments, the lipid nanoparticles further contain neutral lipids.

[0068] In some embodiments, the lipid nanoparticles further comprise sterols.

[0069] In some embodiments, the lipid nanoparticles further comprise polyethylene glycol (PEG)-modified lipids.

[0070] In some embodiments, the lipid nanoparticles include ionizable cationic lipids, neutral lipids, sterols, and PEG-modified lipids.

[0071] In some embodiments, the ionizable cationic lipid is heptadecan-9-yl 8((2-hydroxyethyl)(6-oxo6-(undecyloxy)hexyl)amino)octanoate (compound 1).

[0072] In some embodiments, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0073] In some embodiments, the sterol is cholesterol.

[0074] In some embodiments, the PEG-modified lipid is 1,2-dimiristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG).

[0075] In some embodiments, the lipid nanoparticles contain 20-60 mol% ionizable cationic lipids, 5-25 mol% neutral lipids, 25-55 mol% sterols, and 0.5-15 mol% PEG-modified lipids.

[0076] In some embodiments, the lipid nanoparticles include: 47 mol% ionizable cationic lipids; 11.5 mol% neutral lipids; 38.5 mol% sterols; and 3.0 mol% PEG-modified lipids; 48 mol% ionizable cationic lipids; 11 mol% neutral lipids; 38.5 mol% sterols; and 2.5 mol% PEG-modified lipids; 49 mol% ionizable cationic lipids; 10.5 mol% neutral lipids; 38.5 mol% sterols; and 2.0 mol% PEG-modified lipids; 50 mol% ionizable cationic lipids; 10 mol% neutral lipids; 38.5 mol% sterols; and 1.5 mol% PEG-modified lipids; or 51 mol% ionizable cationic lipids; 9.5 mol% neutral lipids; 38.5 mol% sterols; and 1.0 mol% PEG-modified lipids.

[0077] In some embodiments, the lipid nanoparticles include: 47 mol% of Compound 1; 11.5 mol% of DSPC; 38.5 mol% of cholesterol; and 3.0 mol% of PEG2000 DMG; 48 mol% of Compound 1; 11 mol% of DSPC; 38.5 mol% of cholesterol; and 2.5 mol% of PEG2000 DMG; 49 mol% of Compound 1; 10.5 mol% of DSPC; 38.5 mol% of cholesterol; and 2.0 mol% of PEG2000 DMG; 50 mol% of Compound 1; 10 mol% of DSPC; 38.5 mol% of cholesterol; and 1.5 mol% of PEG2000 DMG; or 51 mol% of Compound 1; 9.5 mol% of DSPC; 38.5 mol% of cholesterol; and 1.0 mol% of PEG2000 DMG.

[0078] Further aspects of the present disclosure provide a method comprising administering to a target amount of the mRNA or composition of any one of the foregoing claims that is effective in inducing a neutralizing antibody response to SARS-CoV-2.

[0079] Other aspects of the present disclosure provide a method comprising administering to a target amount of the mRNA or composition of any one of the foregoing claims that is effective in inducing a T cell immune response to SARS-CoV-2.

[0080] Some aspects of the present disclosure provide messenger ribonucleic acid (mRNA) comprising an open reading frame (ORF) encoding a coronavirus antigen capable of inducing an immune response, such as a neutralizing antibody response, against SARS-CoV-2, wherein the antigen comprises a protein fragment or a functional protein domain of SARS-CoV-2, and optionally, the RNA is formulated in lipid nanoparticles.

[0081] In some embodiments, the antigen is a functional protein domain.

[0082] In some embodiments, the protein domain is the N-terminal domain (NTD) of the SARS-CoV-2 spike protein.

[0083] In some embodiments, the NTD is linked to a transmembrane domain, and optionally to an influenza hemagglutinin transmembrane domain.

[0084] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 47, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 47.

[0085] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 46, and optionally, the open reading frame includes the nucleotide sequence of SEQ ID NO: 46.

[0086] In some embodiments, the protein domain is the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein.

[0087] In some embodiments, RBD is soluble.

[0088] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 62, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 62.

[0089] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 61, and optionally, the open reading frame includes the nucleotide sequence of SEQ ID NO: 61.

[0090] In some embodiments, the RBD is linked to a transmembrane domain, optionally to an influenza hemagglutinin transmembrane domain.

[0091] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 77, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 77.

[0092] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 76, and optionally, the open reading frame includes the nucleotide sequence of SEQ ID NO: 76.

[0093] In some embodiments, the NTD is linked to the RBD of the SARS-CoV-2 spike protein to form an NTD-RBD fusion protein.

[0094] In some embodiments, the NTD-RBD fusion is linked to a transmembrane domain (TM), optionally to an influenza hemagglutinin transmembrane domain, to form the NTD-RBD-TM protein.

[0095] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 92, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 92.

[0096] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 91, and optionally, the open reading frame includes the nucleotide sequence of SEQ ID NO: 91.

[0097] In some embodiments, the NTD-RBD fusion includes a C-terminal shortening.

[0098] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 107, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 107.

[0099] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 106, and optionally, the open reading frame includes the nucleotide sequence of SEQ ID NO: 106.

[0100] In some embodiments, the NTD and / or RBD include an extended region.

[0101] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the amino acid sequences of SEQ ID NOs. 59, 86, 89, 116, 119, or 122, and optionally, the antigen comprises any one of the amino acid sequences of SEQ ID NOs. 59, 86, 89, 116, 119, or 122.

[0102] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to any one nucleotide sequence of sequence numbers 58, 85, 88, 115, 118, or 121, and optionally, the open reading frame includes any one nucleotide sequence of sequence numbers 58, 85, 88, 115, 118, or 121.

[0103] In some embodiments, the protein domain is the S1 subunit domain of the SARS-CoV-2 spike protein.

[0104] In some embodiments, the S1 subunit is soluble.

[0105] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 5, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 5.

[0106] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 3, and optionally, the open reading frame includes the nucleotide sequence of SEQ ID NO: 3.

[0107] In some embodiments, the S1 subunit is linked to a transmembrane domain, and optionally to an influenza hemagglutinin transmembrane domain.

[0108] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 17, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 17.

[0109] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 16, and optionally, the open reading frame includes the nucleotide sequence of SEQ ID NO: 16.

[0110] In some embodiments, the S1 subunit is modified to remove the RBD or a portion of the RBD of the S protein.

[0111] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the amino acid sequences of SEQ ID NOs. 20, 23, 26, 29, 32, or 35, and optionally, the antigen comprises any one of the amino acid sequences of SEQ ID NOs. 20, 23, 26, 29, 32, or 35.

[0112] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to any one nucleotide sequence of sequence numbers 19, 22, 25, 28, 31, or 34, and optionally, the open reading frame includes any one nucleotide sequence of sequence numbers 19, 22, 25, 28, 31, or 34.

[0113] In some embodiments, the S1 subunit is linked to the S2 subunit of the S protein.

[0114] In some embodiments, the S2 subunit is derived from the SARS-CoV-2 S protein.

[0115] In some embodiments, the S1 subunit is derived from the HKU1 S protein.

[0116] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 38, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 38.

[0117] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 37, and optionally, the open reading frame includes the nucleotide sequence of SEQ ID NO: 37.

[0118] In some embodiments, the S1 subunit is derived from the OC43 S protein.

[0119] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 41, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 41.

[0120] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 40, and optionally, the open reading frame includes the nucleotide sequence of SEQ ID NO: 40.

[0121] In some embodiments, the antigen further comprises a scaffold domain optionally selected from ferritin, lumazine synthetase, and foldon.

[0122] In some embodiments, the scaffold domain is ferritin.

[0123] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 8 or 65, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 8 or 65.

[0124] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 7 or 64, and optionally, the open reading frame includes the nucleotide sequence of SEQ ID NO: 7 or 64.

[0125] In some embodiments, the scaffold domain is a lumazine synthetase.

[0126] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the amino acid sequences of SEQ ID NOs: 11, 14, 68, or 71, and optionally, the antigen comprises any one of the amino acid sequences of SEQ ID NOs: 11, 14, 68, or 71.

[0127] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to any one of the nucleotide sequences of SEQ ID NOs: 10, 13, 67, or 70, and optionally, the open reading frame includes any one of the nucleotide sequences of SEQ ID NOs: 10, 13, 67, or 70.

[0128] In some embodiments, the scaffold domain is Foldon.

[0129] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the amino acid sequences of SEQ ID NOs: 44, 50, 74, 80, 83, 101, 104, or 113, and optionally, the antigen comprises any one of the amino acid sequences of SEQ ID NOs: 44, 50, 74, 80, 83, 101, 104, or 113.

[0130] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any one nucleotide sequence of SEQ ID NOs: 43, 49, 73, 79, 82, 100, 103, or 112, and optionally, the open reading frame includes any one nucleotide sequence of SEQ ID NOs: 43, 49, 73, 79, 82, 100, 103, or 112.

[0131] In some embodiments, the antigen further includes a macrophage marker, and a transport signal optionally selected from CD86, CD11B, and / or VSVGct.

[0132] In some embodiments, the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the amino acid sequences of SEQ ID NO: 95, 98, or 110, and optionally, the antigen comprises any one of the amino acid sequences of SEQ ID NO: 95, 98, or 110.

[0133] In some embodiments, the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to any one of the nucleotide sequences of SEQ ID NOs: 94, 97, or 109, and optionally, the open reading frame includes any one of the nucleotide sequences of SEQ ID NOs: 94, 97, or 109.

[0134] In some embodiments, mRNA is formulated within lipid nanoparticles.

[0135] In some embodiments, the lipid nanoparticles include cationic lipids, optionally ionizable cationic lipids, neutral lipids, sterols, and / or polyethylene glycol (PEG)-modified lipids. Ionizable cationic lipids, as used herein interchangeably with ionizable lipids and cationic lipids, refer to ionizable lipids. In some embodiments, the lipid nanoparticles include 40–50 mol% of ionizable lipids, optionally 45–50 mol%, for example 45–46 mol%, 46–47 mol%, 47–48 mol%, 48–49 mol%, or 49–50 mol%, for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%. In some embodiments, the lipid nanoparticles contain 30–45 mol% sterols, optionally 35–40 mol%, for example 30–31 mol%, 31–32 mol%, 32–33 mol%, 33–34 mol%, 35–35 mol%, 35–36 mol%, 36–37 mol%, 38–38 mol%, 38–39 mol%, or 39–40 mol%. In some embodiments, the lipid nanoparticles contain 5–15 mol% helper lipids, optionally 10–12 mol%, for example 5–6 mol%, 6–7 mol%, 7–8 mol%, 8–9 mol%, 9–10 mol%, 10–11 mol%, 11–12 mol%, 12–13 mol%, 13–14 mol%, or 14–15 mol%. In some embodiments, the lipid nanoparticles contain 1–5% PEG lipids, optionally 1–3 mol%, for example, 1.5–2.5 mol%, 1–2 mol%, 2–3 mol%, 3–4 mol%, or 4–5 mol%.

[0136] In some embodiments, the ionizable cationic lipid is heptadecan-9-yl 8((2-hydroxyethyl)(6-oxo6-(undecyloxy)hexyl)amino)octanoate (compound 1), the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol is cholesterol, and / or the PEG-modified lipid is 1,2-dimiristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG).

[0137] In some embodiments, the lipid nanoparticles contain 20–60 mol% ionizable cationic lipids, 5–25% neutral lipids, 25–55 mol% sterols, and about 0.5–15 mol% PEG-modified lipids.

[0138] In some embodiments, the lipid nanoparticles include: 47 mol% ionizable cationic lipids; 11.5 mol% neutral lipids; 38.5 mol% sterols; and 3.0 mol% PEG-modified lipids; 48 mol% ionizable cationic lipids; 11 mol% neutral lipids; 38.5 mol% sterols; and 2.5 mol% PEG-modified lipids; 49 mol% ionizable cationic lipids; 10.5 mol% neutral lipids; 38.5 mol% sterols; and 2.0 mol% PEG-modified lipids; 50 mol% ionizable cationic lipids; 10 mol% neutral lipids; 38.5 mol% sterols; and 1.5 mol% PEG-modified lipids; or 51 mol% ionizable cationic lipids; 9.5 mol% neutral lipids; 38.5 mol% sterols; and 1.0 mol% PEG-modified lipids.

[0139] In some embodiments, the lipid nanoparticles include: 47 mol% of Compound 1; 11.5 mol% of DSPC; 38.5 mol% of cholesterol; and 3.0 mol% of PEG2000 DMG; 48 mol% of Compound 1; 11 mol% of DSPC; 38.5 mol% of cholesterol; and 2.5 mol% of PEG2000 DMG; 49 mol% of Compound 1; 10.5 mol% of DSPC; 38.5 mol% of cholesterol; and 2.0 mol% of PEG2000 DMG; 50 mol% of Compound 1; 10 mol% of DSPC; 38.5 mol% of cholesterol; and 1.5 mol% of PEG2000 DMG; or 51 mol% of Compound 1; 9.5 mol% of DSPC; 38.5 mol% of cholesterol; and 1.0 mol% of PEG2000 DMG.

[0140] The entire contents of International Application No. PCT / US2016 / 058327 (Publication No. WO2017 / 070626) and International Application No. PCT / US2018 / 022777 (Publication No. WO2018 / 170347) are incorporated herein by reference.

[0141] SARS-CoV-2 The SARS-CoV-2 genome is single-stranded positive-sense RNA (+ssRNA) with a size of 29.8-30kb, encoding approximately 9860 amino acids (Chan et al. 2000, cited above; Kim et al. 2020 Cell, May 14;181(4):914-921.e10.). SARS-CoV-2 is a polycistronic mRNA with a 5' cap and a 3' poly-A tail. The SARS-CoV-2 genome is organized into specific genes encoding structural and non-structural proteins (Nsp). The order of structural proteins within the genome is 5'-replicase (open reading frame (ORF) 1 / ab)-structural protein [spike (S)-envelope (E)-membrane (M)-nucleocapsid (N)]-3'. The coronavirus genome includes a number of open reading frames encoding accessory proteins, non-structural proteins, and structural proteins (Song et al. 2019 Viruses; 11(1): p. 59). Most antigenic peptides are located in structural proteins (Cui et al. 2019 Nat. Rev. Microbiol.; 17(3):181-192). The spike surface glycoprotein (S), small envelope protein (E), matrix protein (M), and nucleocapsid protein (N) are the four major structural proteins. The S protein can contribute to cell targeting and induce neutralizing antibodies (NAbs) and protective immunity, and therefore may be considered one of the most important targets in coronavirus vaccine development among all the other structural proteins. Furthermore, amino acid sequence analysis has shown that the S protein contains conserved regions within the coronavirus, which may provide a basis for universal vaccine development.

[0142] antigen The compositions of the present invention, for example, vaccine compositions, are characterized by nucleic acids, particularly mRNA, designed to encode an antigen of interest, for example, an antigen derived from the beta-coronavirus structural protein, in particular an antigen derived from the SARS-CoV-2 spike protein. The compositions of the present invention, for example, vaccine compositions, do not contain an antigen themselves, but rather contain nucleic acids, particularly mRNA(s), that encode an antigen or antigen sequence once delivered to a cell, tissue, or target. Delivery of nucleic acid molecules, particularly mRNA(s), is achieved by formulating the nucleic acid molecules in a suitable carrier or delivery vehicle (e.g., lipid nanoparticles) so that the nucleic acid is taken up by the cell upon administration to the cell, tissue, or target, and the cell then expresses the protein(s) encoded by the nucleic acid, for example, mRNA(s). As used herein, the term “antigen” refers to a substance, such as a protein (e.g., glycoprotein), polypeptide, or peptide, that elicits an immune response, for example, when present in a target (e.g., when present in a human or mammalian target). The present invention is based at least in part on the understanding that, when expressed from mRNA administered to a cell or subject, an antigen encoded by mRNA can produce an immune response in the immune system against the expressed antigen, for example, by inducing the production of antibodies against the expressed antigen, such as conjugating antibodies and / or neutralizing antibodies, which can trigger a B cell and / or T cell response specific to the expressed antigen, ultimately leading to a protective or preventive response against the antigen or the pathogen to which the antigen is associated. Preferred mRNA-encoded antigens are “viral antigens.” As used herein, the term “viral antigen” refers to an antigen derived from a virus, such as a pathogenic virus. As used herein, the term antigen may refer to a full-length protein, such as a full-length viral protein, or a protein fragment (e.g., a polypeptide or peptide fragment), a protein subunit or domain, such as a viral protein subunit or domain.

[0143] Many proteins have a quaternary or three-dimensional structure consisting of multiple polypeptides or polypeptide chains that associate with an oligomer molecule. As used herein, the term “subunit” refers to a polypeptide or polypeptide chain resulting from the processing of a single protein molecule, e.g., a developing protein molecule, which this subunit assembles (or “co-assembles”) with other protein molecules (e.g., subunits or chains) to form a protein complex. A protein may have a relatively small number of subunits and may therefore be described as an “oligomer,” or it may consist of many subunits and therefore be described as a “multimer.” Subunits of an oligomer or multimer protein may be identical, homologous, or completely different and dedicated to different tasks.

[0144] Proteins or protein subunits may further contain domains. As used herein, the term “domain” refers to a distinct functional and / or structural unit within a protein. Typically, a “domain” is involved in a specific function or interaction and contributes to the overall role of the protein. Domains can exist in a variety of biological contexts. Similar domains (i.e., domains that share structural, functional, and / or sequence homology) may exist within a single protein or within separate proteins having similar or different functions. Protein domains are often conserved portions of the tertiary structure or sequence of a particular protein and may function and exist independently of the rest of the protein or its subunits.

[0145] In structural and molecular biology, identical, homologous, or similar subunits or domains can be useful in classifying newly identified or novel proteins, as was done immediately after the release of the SARS-CoV-2 virus genome sequence.

[0146] As used herein, the term antigen is distinct from the term “epitope,” which refers to the underlying structure of an antigen, such as a polypeptide or carbohydrate structure that can be recognized by an antigen-binding site but is insufficient to induce an immune response. The art describes protein antigens, e.g., isolated proteins, polypeptides, or peptide antigens, that are delivered to target or immune cells in an isolated form. However, the design, testing, validation, and production of protein antigens can be costly and time-consuming, especially when producing proteins on a large scale. In contrast, mRNA technology is suitable for the rapid design and testing of mRNA constructs encoding various antigens. Furthermore, the rapid production of mRNA combined with formulation on a suitable delivery vehicle (e.g., lipid nanoparticles) can proceed rapidly, enabling the rapid production of mRNA vaccines on a large scale. Potential benefits also arise from the fact that the antigen encoded by the mRNA of the present invention is expressed by target cells, e.g., by the human body, and therefore the target, e.g., the human body, functions as a “factory” to produce the antigen, which then triggers a desired immune response.

[0147] In a preferred embodiment, an antigen is a protein capable of inducing an immune response (e.g., causing the immune system to produce antibodies against the antigen). In this specification, the use of the term “antigen” encompasses immunogenic proteins, as well as polypeptides or peptides derived from immunogenic proteins, such as immunogenic fragments (immunogenic fragments that induce (or can induce) an immune response to an antigen, unless otherwise specified). It should be understood that the term “protein” encompasses polypeptides and peptides, while the term “antigen” encompasses antigenic fragments. Other molecules may be antigenic, such as bacterial polysaccharides or combinations of proteins and polysaccharide structures, but in the case of viral vaccines included herein, viral proteins, fragments of viral proteins, and designed and / or mutant proteins derived from the beta-coronavirus SARS-CoV-2 are the antigens featured herein.

[0148] Nucleic acid / mRNA The vaccine technologies described herein are characterized by nucleic acids, particularly messenger RNA (mRNA) designed to encode an antigen of interest, e.g., beta-coronavirus spike protein antigen, or its subunits, domains, or fragments (e.g., antigenic fragments). The nucleic acids, e.g., mRNA of the present invention are preferably formulated on a suitable carrier or delivery vehicle (e.g., lipid nanoparticles) so that the nucleic acids, e.g., mRNA are suitable for in vivo use. When properly formulated, the nucleic acids, e.g., mRNA can be delivered to a target, e.g., cells and / or tissues of a human target, to achieve translation of the protein encoded by these nucleic acids.

[0149] Nucleic acid molecules are macromolecules composed of linked nucleotides that carry genetic information, directing most, if not all, cellular functions by directing the process of protein synthesis. Nucleic acids contain polymers of nucleotides (nucleotide monomers). Therefore, nucleic acids are also called polynucleotides (or polynucleotide chains). The two main classes of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA constitutes the genetic material of all free-living organisms and most viruses. RNA is the genetic material of certain viruses, but it is also found in all living cells and plays an important role in cellular processes, especially protein synthesis.

[0150] Nucleosides are structural subunits of nucleic acids, such as DNA and RNA. Nucleosides consist of a nitrogenous base (nucleic acid base), usually either a pyrimidine (cytosine, thymine, or uracil) or a purine (adenine or guanine), covalently bonded to a "sugar," which is a five-carbon carbohydrate, ribose, or ribose or deoxyribose. Nucleosides consist of a nitrogenous base, a sugar (ribose or deoxyribose), and one to three phosphate groups. Essentially, a nucleotide is simply a nucleoside with additional phosphate groups.

[0151] Nucleic acid molecules, DNA and RNA, are composed of nucleotides linked to each other in a chain by chemical bonds called ester bonds between the sugar base of one nucleotide and the phosphate group of an adjacent nucleotide. The sugar is at the 3' end, and the phosphate is at the 5' end of each nucleotide. The phosphate group attached to the 5' carbon of the sugar of one nucleotide forms an ester bond with the free hydroxyl group at the 3' carbon of the next nucleotide. These bonds are called phosphodiester bonds, and the sugar-phosphate backbone is described as extending or growing in the 5' to 3' direction when the molecule is synthesized.

[0152] The nucleic acid base portion of nucleic acids is characterized by purine bases, adenine (A) and guanine (G), and pyrimidine bases, cytosine (C), thymine (T) in DNA, and uracil (U) in RNA. The sugar portion of nucleic acids is characterized by deoxyribose in DNA and ribose in RNA. The five nucleosides are usually abbreviated as single-letter codes A, G, C, T, and U, respectively. However, thymidine is more commonly denoted as "dT" ("d" stands for "deoxy") because it contains a 2'-deoxyribofuranose moiety instead of the ribofuranose ring found in uridine. This is because thymidine is found in deoxyribonucleic acid (DNA) rather than ribonucleic acid (RNA). Conversely, uridine is found in RNA rather than DNA. The remaining three nucleosides can be found in both RNA and DNA. In RNA, they are represented as A, C, and G, but in DNA, they are represented as dA, dC, and dG.

[0153] Those skilled in the art will understand that, unless otherwise stated, the nucleic acid sequences described in this application may enumerate "T"s within representative DNA sequences, but when the sequence corresponds to mRNA, "T"s are replaced with "U". Therefore, any DNA disclosed herein and identified by a specific sequence identification number also discloses a corresponding mRNA sequence complementary to that DNA, in which case each "T" in the DNA sequence is replaced with a "U".

[0154] Nucleic acids may include, for example, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), such as mRNA, threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acids (LNAs, for example, LNA having a β-D-ribo structure, α-LNA having an α-L-ribo structure (a diastereomer of LNA), 2'-amino-LNA having 2'-amino functionalization, and 2'-amino-α-LNA having 2'-amino functionalization), ethylene nucleic acid (ENA), cyclohexenyl nucleic acid (CeNA), and / or chimeras and / or combinations thereof.

[0155] The present invention is characterized by messenger RNA (mRNA), particularly mRNA designed to encode a target antigen, such as the beta-coronavirus spike protein antigen, subunit, domain, or fragment thereof (e.g., antigenic fragment). Messenger RNA (mRNA), a subtype of RNA, is a single-stranded molecule of RNA corresponding to the gene sequence of a given gene. mRNA is produced during transcription, when a single strand of DNA is decoded by RNA polymerase, and mRNA is synthesized, i.e., transcribed. mRNA is read by ribosomes during the process of protein synthesis, i.e., translation. Therefore, messenger RNA (mRNA) is RNA that encodes (at least one) protein (natural, unnatural, or modified polymer of amino acids) and can be translated and produce the encoded protein in vitro, in vivo, in situ, or ex vivo.

[0156] The compositions of this disclosure comprise at least one mRNA having an open reading frame (ORF) encoding a coronavirus antigen. In some embodiments, the mRNA further comprises a 5' UTR, a 3' UTR, a poly(A) tail, and / or a 5' cap or cap analogue. An open reading frame (ORF) is a continuous stretch of DNA or RNA beginning with a start codon (e.g., methionine (ATG or AUG)) and ending with a stop codon (e.g., TAA, TAG, or TGA, or UAA, UAG, or UGA). ORFs typically encode proteins. The sequences disclosed herein may further comprise additional elements (e.g., 5' and 3' UTRs), but it will be understood that these elements, unlike the ORF, are not necessarily required to be present in the mRNA of this disclosure. It should also be understood that the mRNA characterized in the present invention, for example in the beta-coronavirus vaccine of this disclosure, may comprise any 5' untranslated region (UTR) and / or any 3' UTR. Exemplary UTR sequences are shown in the sequence listing (e.g., SEQ ID NOs: 2, 4, 131, and 132); however, other UTR sequences may be used or replaced with any UTR sequence described herein. Furthermore, UTRs may be omitted from the mRNA provided herein.

[0157] In some embodiments, the composition comprises mRNA containing a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with any one of the nucleotide sequences of SEQ ID NOs.

[0158] In some embodiments, the composition comprises mRNA containing an ORF having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with any one nucleotide sequence of sequence numbers 46, 76, or 91. In some embodiments, the composition comprises mRNA containing an ORF having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with any one nucleotide sequence of sequences in Tables 1 to 15.

[0159] Tables 1-15 show exemplary sequences of coronavirus antigens in the compositions of this disclosure and mRNA encoding coronavirus antigens.

[0160] Please understand that any of the mRNA-encoded antigens described herein may or may not contain a signal sequence.

[0161] Encoded coronavirus spike (S) protein antigen The envelope spike (S) protein of known betacoronaviruses determines the virus's host targeting and entry into host cells. Coronavirus spike (S) proteins are ideal antigens for vaccine design because they can induce neutralizing antibodies and protective immunity. The S protein is crucial for SARS-CoV-2 infection. The composition of the S protein is similar among betacoronaviruses such as SARS-CoV-2, SARS-CoV, MERS-CoV, HKU1-CoV, MHV-CoV, and NL63-CoV.

[0162] As used herein, the term “spike protein” refers to a glycoprotein that forms a homotrimer protruding from the envelope (viral surface) of viruses, including beta-coronaviruses. The trimerized spike protein facilitates the entry of virions into host cells by binding to receptors on the surface of host cells and subsequently fusing the viral membrane with the host cell membrane. The S protein is a large, highly glycosylated type I transmembrane fusion protein composed of 1,160 to 1,400 amino acids, depending on the type of virus. The beta-coronavirus spike protein contains approximately 1,100 to 1,500 amino acids and has a structure (i.e., domain composition and structure) as shown in Figure 1. The SARS-CoV-2 spike (S) protein is an ideal antigen for vaccine design because it can induce neutralizing antibodies and protective immunity. The mRNA of the present invention is designed to produce the SARS-CoV-2 spike protein (i.e., encode the spike protein so that it is expressed when the mRNA is delivered to a cell or tissue, e.g., a target cell or tissue), and also to produce its antigenic variants. Those skilled in the art will understand that while a virus, such as a beta-coronavirus, may require an essentially full-length or complete spike protein to perform its intended function of facilitating viral entry into host cells, certain variations in the structure and / or sequence of the spike protein may be permissible if the primary aim is to elicit an immune response to the spike protein. For example, a slight shortening of, for instance, one to a few amino acids, perhaps up to five or ten, from the N-terminus or C-terminus of an encoded spike protein, such as an encoded spike protein antigen, may be permissible without altering the antigenic properties of the protein. Similarly, variations of one to a few amino acids (perhaps up to five or ten or more) (e.g., conservative substitutions) of an encoded spike protein, such as an encoded spike protein antigen, may be permissible without altering the antigenic properties of the protein.In exemplary embodiments, the spike protein, for example, the encoded spike protein antigen, has an amino acid sequence shown in any one of the sequences in Tables 1 to 15 (for example, derived from the amino acid sequence shown as SEQ ID NO: 125). In other embodiments, the spike protein, for example, the encoded spike protein antigen, has 100 or fewer, 90 or fewer, 80 or fewer, 70 or fewer, 60 or fewer, 50 or fewer, 40 or fewer, 30 or fewer, 20 or fewer, 10 or fewer, or 5 or fewer amino acid substitutions and / or deletions when compared to (sequenced with) a spike protein having an amino acid sequence shown in any one of the sequences in Tables 1 to 15 (for example, derived from the amino acid sequence shown as SEQ ID NO: 125). If a slight change occurs in the encoded spike protein sequence, the variant preferably has the same activity as the reference spike protein sequence and / or the same immunospecificity as the reference spike protein, as determined, for example, by an immunoassay (e.g., an enzyme-linked immunosorbent assay (ELISA)).

[0163] The coronavirus S protein can be divided into two important functional subunits: the N-terminal S1 subunit, which forms the spherical head of the S protein, and the C-terminal S2 region, which forms the stem of the protein and is directly embedded in the viral envelope. When interacting with a potential host cell, the S1 subunit recognizes and binds to receptors on the host cell, particularly the angiotensin-converting enzyme 2 (ACE2) receptor, while the S2 subunit, the most conserved component of the S protein, is responsible for fusing the viral envelope to the host cell membrane. (See, for example, Shang et al., PLoS Pathog. 2020 Mar;16(3):e1008392). Each monomer of the trimer S protein contains two subunits, S1 and S2, which mediate adhesion and membrane fusion, respectively. See, for example, Figure 1. As part of the in vivo infection process, the two subunits are separated from each other by an enzymatic cleavage process. The S protein is initially cleaved in vivo at the S1 / S2 site of infected cells via furin-mediated cleavage, followed by a serine protease-mediated cleavage event at the S2' site within S1. In SARS-CoV-2, the S1 / S2 cleavage site is located at amino acid 676-TQTNSPRRAR / SVA-688 (see SEQ ID NO: 127). The S2' cleavage site is located at amino acid 811-KPSKR / SFI-818 (see SEQ ID NO: 126).

[0164] As used herein, for example, in the context of designing the nucleic acid of the present invention, e.g., a SARS-CoV-2 S protein antigen encoded by mRNA, the term “S1 subunit” (e.g., S1 subunit antigen) refers to the N-terminal subunit of the spike protein, beginning at the N-terminus of the S protein and ending at the S1 / S2 cleavage site, while the term “S2 subunit” (e.g., S2 subunit antigen) refers to the C-terminal subunit of the spike protein, beginning at the S1 / S2 cleavage site and ending at the C-terminus of the spike protein. As described above, those skilled in the art will understand that essentially full-length or complete spike protein S1 or S2 subunits are required for receptor binding or membrane fusion, respectively, but some variation in the structure and / or sequence of S1 or S2 is acceptable when the primary aim is to induce an immune response to the spike protein subunit. For example, slight shortenings of, for instance, one to a few amino acids, perhaps up to four, five, six, seven, eight, nine, or ten, from the N-terminus or C-terminus of an encoded subunit, e.g., an encoded S1 or S2 protein antigen, may be tolerated without altering the antigenic properties of the protein. Similarly, variations (e.g., conservative substitutions) of one to a few amino acids (perhaps up to four, five, six, seven, eight, nine, or ten) (or more) of an encoded spike protein subunit, e.g., an encoded S1 or S2 protein antigen, may be tolerated without altering the antigenic properties of the protein(s). In exemplary embodiments, the spike protein, e.g., an encoded spike protein antigen, has an amino acid sequence shown in any one of the sequences in Tables 1-15 (e.g., derived from the amino acid sequence shown as SEQ ID NO: 125).In other embodiments, the spike protein subunit, for example, the encoded S1 or S2 protein antigen, has 50 or fewer, 40 or fewer, 30 or fewer, 20 or fewer, 10 or fewer, or 5 or fewer amino acid substitutions and / or deletions when compared to (or aligned with) a spike protein S1 subunit containing or consisting of amino acids 1 to 685 of the spike protein, or a spike protein S2 subunit containing or consisting of amino acids 686 to 1273, having an amino acid sequence as shown in SEQ ID NO: 125. If a slight change occurs in the encoded spike protein subunit sequence, the variant preferably has the same activity as the reference spike protein subunit sequence and / or the same immunospecificity as the reference spike protein subunit, as determined, for example, by an immunoassay (e.g., an enzyme-linked immunosorbent assay (ELISA)).

[0165] The S1 and S2 subunits of the SARS-CoV-2 spike protein further comprise domains readily identifiable by structure and function, which can then be characterized when designing nucleic acid vaccines, particularly antigens encoded by the mRNA vaccine of the present invention. Within the S1 subunit, the domain comprises an N-terminal domain (NTD) and a receptor-binding domain (RBD), the RBD domain further comprising a receptor-binding motif (RBM). The wild-type S1 subunit also comprises a signal peptide (SD), the N-terminus of the NTD domain, and the first subdomain (SD1) and second subdomain (SD2). The domains within the S2 subunit include a fusion peptide (FP), heptad repeat 1 (HR1), heptad repeat 2 (HR2), a transmembrane domain (TM), and a cytoplasmic domain also known as the cytoplasmic tail (CT) (Lu R. et al., cited above; Wan et al., J. Virol. Mar 2020, 94(7)e00127-20). The HR1 and HR2 domains are sometimes referred to as the "fusion core region" of SARS-CoV-2 (Xia et al., 2020 Cell Mol Immunol. Jan; 17(1):1-12). Figure 1 shows the domain structure of the SARS-CoV-2 spike protein. The S1 subunit includes an N-terminal domain (NTD), a linker region, a receptor-binding domain (RBD), a first subdomain (SD1), and a second subdomain (SD2). The S1 subunit may be modified to include a C-terminal transmembrane domain (TM) and may be soluble. The S2 subunit includes, among other things, a first heptad repeat (HR1), a second heptad repeat (HR2), a transmembrane domain (TM), and a cytoplasmic tail. A soluble S2 subunit may be generated without the TM domain.

[0166] The S1 NTD and RBD are excellent antigens for the vaccine design approach of the present invention because these domains have been shown to be targets of neutralizing antibodies in betacoronavirus-infected individuals. As used herein, for example, in the context of antigen design (the antigen encoded by the mRNA of the present invention and expressed from, for example, the mRNA vaccine of the present invention), the term “N-terminal domain” or “NTD” refers to a domain within the SARS-CoV-2 S1 subunit containing approximately 290 amino acids, having identity with amino acids 1-290 of the S1 subunit of the spike protein having the amino acid sequence shown as SEQ ID NO: 125. As used herein, for example, in the context of antigen design (the antigen encoded by the mRNA of the present invention and expressed from, for example, the mRNA vaccine of the present invention), the term “receptor-binding domain” or “RBD” refers to a domain within the SARS-CoV-2 S1 subunit containing approximately 175-225 amino acids, having identity with amino acids 316-517 of the S1 subunit of the spike protein having the amino acid sequence shown as SEQ ID NO: 125. As used herein, the term “receptor-binding motif” refers to the portion of the RBD that directly contacts the ACE2 receptor. The expressed RBD is expected to specifically bind to angiotensin-converting enzyme 2 (ACE2) as its receptor, and / or specifically react with an RBD-binding and / or neutralizing antibody, such as CR3022.

[0167] The compositions provided herein include mRNA capable of encoding one or more full-length or partial (sequence shortened or otherwise deleted) S protein subunits (e.g., S1 or S2 subunits), one or more domains or combinations of domains of an S protein subunit (e.g., NTD, RBD, or NTD-RBD fusions, with or without SD1 and / or S2), or chimeras of a full-length or partial S protein subunit and an S2 protein subunit. Other S protein subunit and / or domain configurations are contemplated herein.

[0168] Figures 2 and 6 show exemplary domain and subunit antigens derived from the SARS-CoV-2 spike protein. Figures 2A and 2B show soluble and transmembrane RBD antigens, respectively. A transmembrane NTD antigen is shown in Figure 2C. The domain antigens shown in Figures 2D-2F and 2I represent exemplary fusion proteins of NTD and RBD having SP and TM domains, respectively. Two of the constructs also have terminal transport domains (CD86 and / or CD11b). The domains are linked via linkers, particularly GS linkers or PADRE linkers (Figure 2I). Domain constructs with an RBD domain at the N-terminus of the NTD domain are shown in Figures 2G and 2H. Each construct may also contain SP and / or TM domains.

[0169] Encoded subunit antigen Some aspects of this disclosure provide compositions comprising mRNA encoding (at least one) subunit of the SARS-CoV-2 S protein. In some embodiments, the mRNA encodes the S1 subunit (e.g., full-length or partial). In other embodiments, the mRNA encodes the S2 subunit (e.g., full-length or partial). In yet another embodiment, the mRNA encodes a chimeric S1-S2 protein, where one subunit is derived from the SARS-CoV-2 S protein and the other subunit is derived from another organism, such as a virus, such as the influenza virus. The SARS-CoV-2 subunits (S1 and / or S2) encoded by the mRNA of this disclosure may be soluble or membrane-bound (e.g., linked to a transmembrane domain). Exemplary antigen designs based on S2 are shown in Figure 6. Figure 6A shows full-length S2 including the FP, HR1, HR2, TM, and CT domains. A version of S2 consisting of linkers between subunits is shown in Figure 6B. Domain antigens without the CT domain are shown in Figures 6C and 6D.

[0170] Soluble subunit antigen Soluble proteins are present in the cytoplasm of cells or secreted from cells (e.g., not membrane-bound). Soluble antigens secreted by cells can be opsonized by complement, captured by follicular dendritic cells of lymph nodes, and recognized by B cells specific to the epitopes present in the expressed protein. Subunit antigen expression further allows for focusing the immune response against a specific subunit, while minimizing stimulation of memory B and T cells specific to other domains of antigens shared with other related viruses. While not bound by theory, presentation of SARS-CoV-2 S1 subunits in a soluble form, including NTDs, RBDs, and possibly SARS-CoV-2 S1 subunit-mediated polypeptides, is conceivable to generate an S1 subunit-specific immune response. Therefore, in some embodiments, the mRNAs provided herein encode soluble SARS-CoV-2 S1 subunit antigens and / or soluble SARS-CoV-2 S2 subunit antigens. Non-limiting examples of soluble SARS-CoV-2 S1 subunit antigens and the mRNA encoding them are shown in Tables 1A and 1B below. Other examples of soluble SARS-CoV-2 subunit antigens are shown herein. [Table 1] [Table 2-1] [Table 2-2] [Table 2-3]

[0171] Membrane-bound subunit antigens Membrane-bound proteins are fixed to the cell membrane (they are not soluble). Although not bound by theory, antigen-presenting cells are thought to deliver embedded antigens to the absorptive lymph nodes, generating a strong immune response. The germinal center reaction that occurs in the absorptive lymph nodes involves CD4 +T FH This involves prolonged contact between cells and B cells, enabling co-stimulatory and local cytokine signaling, such as IL-4 and IL-21, which promotes B cell replication and class switching to IgG1 production specific to the presented antigen, each potentially promoting the generation of long-lived plasma cells and memory B cells. Therefore, in some embodiments, the mRNA encodes a membrane-bound SARS-CoV-2 S1 subunit antigen and / or a membrane-bound SARS-CoV-2 S2 subunit antigen. In some embodiments, the membrane-bound antigen (e.g., S1 subunit, S2 subunit, NTD, RBD, or any combination thereof) is ligated to a transmembrane domain, e.g., a naturally occurring transmembrane domain or a heterologous transmembrane domain (derived from a heterologous protein), which plays a role in fixing the protein to the cell membrane. Non-limiting examples of membrane-bound SARS-CoV-2 S1 subunit antigens and SARS-CoV-2 S2 subunit antigens and the mRNAs encoding them are provided in Tables 2A and 2B below. Other membrane-bound SARS-CoV-2 S1 subunit antigens are contemplated herein. [Table 3] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6]

[0172] Subunit antigen shortening and RBD deletion In some embodiments, the composition includes mRNA encoding the RBD or a modified S1 subunit to remove part of the RBD. Shortening the S1 subunit reduces the number of epitopes recognized by the immune system, thereby biasing the immune response against the remaining epitopes, which may allow for the selection of antibodies against specific epitopes important for viral neutralization. Shortening or partial deletion of the RBD may prevent the expressed protein or the cells carrying it from interacting with the receptor ACE2, increasing the likelihood of reaching lymph nodes and stimulating the desired immune response. Furthermore, removing the RBD may prevent epitope masking by cross-reactive antibodies previously produced against the associated virus, thus allowing the induced immune response to be specifically focused on the antigen of interest. In addition, removing the RBD may alter the higher-order structure of the expressed subunit, allowing B cells specific to these alternative higher-order epitopes to take up linear peptides and present them to T cells, thereby CD4 + This indirectly enhances the T cell response to these epitopes that are still present in the natural composition.

[0173] In some embodiments, the composition includes mRNA encoding an RBD or a modified S1 subunit (where the S2 subunit contains a glycan) to remove part of the RBD. The glycan is bound to the protein by N-linked glycosylation via an asparagine residue, or by O-linked glycosylation via a serine or threonine residue. The presence of a glycan shield on some components of the protein can mask peptide epitopes, thereby allowing the antibody response to concentrate on other exposed peptide epitopes. Furthermore, glycosylated proteins also induce antibodies that recognize the coated glycan. B cells that recognize glycan epitopes take up linear peptide epitopes and CD4 + CD4 is presented to T cells, thereby affecting linear epitopes found throughout the protein. + It promotes the response of T cells.

[0174] Non-specific examples of shortened SARS-CoV-2 S1 subunit antigens and their encoding mRNAs are shown in Tables 3A and 3B below.

[0175] Non-exclusive examples of SARS-CoV-2 S1 subunits with RBD deletions and the mRNA encoding them are shown in Tables 4A and 4B below. [Table 5] [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11] [Table 7] [Table 8-1]

Table 8-2

Table 8-3

Table 8-4

Table 8-5

Table 8-6

Table 8-7

[0176] Chimeric S1-S2 subunit antigen In some embodiments, the composition comprises mRNA encoding a chimeric protein, e.g., a chimeric S1-S2 protein having an S1 subunit derived from the S protein of one virus and an S2 subunit derived from the S protein of a different virus. For example, the S2 subunit may be derived from SARS-CoV-2 and the S1 subunit may be derived from HKU1. As another example, the S2 subunit may be derived from SARS-CoV-2, while the S1 subunit may be derived from OC43. These chimeric proteins are likely to be opsonized by circulating antibodies specific for the S1 subunit of HKU1 or OC43 generated by previous exposure, promoting efficient uptake and cross-presentation of SARS-CoV-2 S2 subunit peptides by macrophages and dendritic cells. Opsonization by circulating antibodies also promotes capture by follicular dendritic cells for presentation to B cells having receptors specific for SARS-CoV-2 S2 subunit epitopes. Non-limiting examples of chimeric S1 / S2 subunit constructs and the mRNAs encoding them are shown in Tables 5A and 5B below. + T cells, and cross-presentation. Opsonization by circulating antibodies also promotes capture by follicular dendritic cells for presentation to B cells having receptors specific for SARS-CoV-2 S2 subunit epitopes. Non-limiting examples of chimeric S1 / S2 subunit constructs and the mRNAs encoding them are shown in Tables 5A and 5B below.

Table 9

[0177] Encoded domain antigen Other embodiments of the present disclosure provide compositions comprising mRNA encoding (at least one) subdomain of the SARS-CoV-2 S1 subunit of the S protein. The subdomain may be an N-terminal domain (NTD) or a receptor-binding domain (RBD) (with or without SD1 and / or SD2). In some embodiments, the mRNA encodes a combination of NTD and RBD (with or without SD1 and / or SD2) (e.g., a non-native combination). In some embodiments, the NTD and / or RBD are ligated to a transmembrane domain (with or without SD1 and / or SD2). In some embodiments, the mRNA encodes two subdomains (NTD and RBD) of the SARS-CoV-2 S1 subunit of the S protein mutated to contain a cysteine ​​residue. In some embodiments, such mutations result in the formation of a disulfide bond. As an example, the mRNA may encode an NTD containing an F43C mutation and an RBD containing a Q563C mutation, ultimately resulting in an NTD ligated to the RBD via a disulfide bond.

[0178] N-terminal domain (NTD) construct In some embodiments, the mRNA provided herein encodes an NTD of the S1 subunit of the SARS-CoV-2 S protein. NTDs of specific beta-coronaviruses induce protective levels of antibodies. Antibodies specific to NTDs of other beta-coronaviruses, such as MERS, act by preventing membrane fusion and viral entry (Zhou H et al. Nat Commun. 2019;3068), providing a second mechanism of neutralization distinct from preventing viral attachment to ACE2. The SARS-CoV-2 NTD encoded by the mRNA of this disclosure may be soluble or membrane-bound. Non-limiting examples of membrane-bound SARS-CoV-2 NTD antigens and the mRNAs encoding them are shown in Tables 6A and 6B below. [Table 11] [Table 12-1]

Table 12-2

[0179] Receptor-binding domain (RBD) construct In other embodiments, the mRNA provided herein encodes the RBD of the S1 subunit of the SARS-CoV-2 S protein. The RBD binds to the ACE2 receptor of the host cell and mediates the attachment of the virus to the cell. Attachment is necessary for the virus to enter and replicate in the cell. Thus, an RBD-targeted antibody response that blocks the attachment of the virus to the cell effectively neutralizes extracellular virus particles, prevents proliferation, and promotes further immune responses against other components of the neutralized virus particles. The SARS-CoV-2 RBD encoded by the mRNA of the present disclosure may be soluble or membrane-bound (e.g., linked to a transmembrane domain).

[0180] Soluble RBD antigen In some embodiments, the mRNA encodes a soluble SARS-CoV-2 RBD. Dendritic cells sample soluble proteins by endocytosis and, when migrating to draining regional lymph nodes, present the linear peptides that make up the sampled proteins to CD4 + T cells. These CD4 + T cells recognize, take up, and provide proliferative signals to the presenting B cells for epitopes derived from the RBD. Thus, specifically administering an RBD that does not contain other components of the SARS-CoV-2 spike protein is expected to focus the immune response on the epitopes present in the RBD. Non-limiting examples of soluble SARS-CoV-2 RBDs and the mRNAs encoding them are shown in Tables 7A and 7B below.

Table 13

Table 14

[0181] membrane-bound RBD antigen In some embodiments, the mRNA encodes membrane-bound SARS-CoV-2 RBD. Cells expressing membrane-bound RBD are expected to deliver these membrane-bound antigens to influx region lymph nodes, facilitating efficient recognition of epitopes by RBD-specific B cells. Since B cell surfaces contain many surface-bound antibodies and expressing cells contain numerous copies of membrane-bound RBD, it is expected that B cell receptors cross-link after initial recognition of the antigen by B cells, stimulating a potent response through affinity effects. Non-limiting examples of membrane-bound SARS-CoV-2 RBD and the encoding mRNA are shown in Tables 8A and 8B below. [Table 15] [Table 16]

[0182] Domain fusion antigen In further embodiments, the mRNA provided herein encodes a SARS-CoV-2 NTD-RBD fusion protein. For example, the NTD and RBD of the SARS-CoV-2 S1 subunit of the S protein may be linked to each other via a linker such as a short amino acid (e.g., glycine-serine) linker to allow for plasticity / hinging and spacing between domains. In another embodiment, a linker containing an antigenic epitope, such as a class II universal T cell epitope such as PADRE, may be used. In some embodiments, a transmembrane region is linked to the NTD-RBD fusion via another short amino acid (e.g., glycine-serine or PADRE) linker, for example, for plasticity and to allow for a reasonable distance between the membrane and the antigen. While not bound by theory, this membrane-bound tandem configuration is thought to present most, if not all, known neutralizing and protective epitopes in a single open reading frame. Next, administration of this fusion protein should concentrate the immune response toward known protective epitopes, reducing the unnecessary production of antibodies and T cells specific to non-protective epitopes. Furthermore, antibodies against different domains may neutralize viral particles through different mechanisms, such as blocking attachment to host cells or preventing the bound virus from entering host cells through membrane fusion. Thus, the broader responses induced by fusion proteins containing different domains are more evolutionarily robust and may require multiple distinct mutations to evade vaccine-induced immunity. Non-limiting examples of SARS-CoV-2 NTD-RBD fusion proteins and their encoding mRNAs are shown in Tables 9A and 9B below.

[0183] Linker Various linkers may be used in accordance with this disclosure. The linkers provided herein are simply amino acid sequences that artificially link two other amino acid sequences together. The linkers used herein may be cleavable or incleavable. Cleavable linkers allow mRNA to be translated into polypeptides, and then cleavage of the linker allows the individual components to be released independently. Incleavable linkers maintain the connection of one or more protein subunits, allowing the entire protein to perform a function that requires the proximity of component subunits. Non-limiting examples of such linkers include glycine-serine (GS) linkers (incleavable); and F2A linkers, P2A linkers, T2A linkers, and E2A linkers (cleavable). Other links may be used herein.

[0184] In some embodiments, the linker is a GS linker. A GS linker is a polypeptide linker comprising glycine and serine amino acid repeats. They contain plastic and hydrophilic residues and can be used to perform protein subunit fusion without interfering with the folding and function of the protein domain or forming secondary structures. In some embodiments, the mRNA encodes a fusion protein comprising a GS linker that is 3 to 20 amino acid long. For example, the GS linker may have a length of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids (or at least that length). In some embodiments, the GS linker is 15 amino acid long (e.g., GGSGGSGGSGGSGGG (SEQ ID NO: 133)) (or at least 15 amino acid long). In some embodiments, the GS linker is 8 amino acid long (e.g., GGGSGGGS (SEQ ID NO: 134)) (or at least 8 amino acid long). In some embodiments, the GS linker is 7 amino acid long (e.g., GGGGGG (SEQ ID NO: 135)) (or at least 7 amino acid long). In some embodiments, the GS linker is 4 amino acid long (e.g., GGGS (SEQ ID NO: 136)) (or at least 4 amino acid long). In some embodiments, the GS linker includes (GGGS)n (SEQ ID NO: 136), where n is any integer from 1 to 5. In some embodiments, the GS linker is 4 amino acid long (e.g., GSGG (SEQ ID NO: 152)) (or at least 4 amino acid long). In some embodiments, the GS linker includes (GSGG)n (SEQ ID NO: 152), where n is any integer from 1 to 5.

[0185] In some embodiments, the linker is a glycine linker having, for example, a length of 3 amino acids (e.g., GGG) (or at least a length of 3 amino acids).

[0186] In some embodiments, the protein encoded by the mRNA vaccine comprises two or more linkers, which may be the same or different from one another (e.g., GGGSGGG (SEQ ID NO: 135) and GGGS (SEQ ID NO: 136) in the same S protein construct).

[0187] In some embodiments, the linker contains mRNA encoding a pan-HLA DR-binding epitope (PADRE) (e.g., AKFVAAWTLKAAA (SEQ ID NO: 148)). PADRE is an immunodominant helper CD4 T cell epitope and a potent immunogen (see, for example, Alexander J. et al. J of Immuno. 164(3):1625-33, incorporated herein by reference). [Table 17] [Table 18-1] [Table 18-2] [Table 18-3] [Table 18-4] [Table 18-5] [Table 18-6] [Table 18-7]

[0188] Transport signals In some embodiments, the mRNA encodes a SARS-CoV-2 S protein domain (e.g., NTD, RBD, or NTD-RBD fusion) linked to a Golgi transport signal. Non-limiting examples of such signals include macrophage markers such as CD86 and / or CD11b, which are highly expressed and whose intracellular domains can control efficient transport from the Golgi apparatus to the cell surface. Other cellular transport signals (sequences), e.g., the VSV-G cytoplasmic tail (VSVGct), may also be used herein. More efficient transport of the encoded protein to the cell surface is expected to increase the availability of the antigen for B cell recognition and thus facilitate the production of antibodies against the encoded SARS-CoV-2 S protein domain. Non-limiting examples of SARS-CoV-2 antigens linked to transport signals and encoding mRNAs are shown in Tables 10A and 10B below. [Table 19] [Table 20-1] [Table 20-2] [Table 20-3] [Table 20-4] [Table 20-5] [Table 20-6] [Table 20-7]

[0189] Shortening of the domain fusion C-terminus In other embodiments, the mRNA provided herein encodes a SARS-CoV-2 NTD-RBD fusion protein in which a portion of the C-terminal domain is shortened / deleted. In one embodiment, 13 (or at least 13) amino acids are deleted from the C-terminal domain of the NTD-RBD fusion protein. The deletion of these amino acids is expected to increase the exposure of the epitope to the antibody, thereby stimulating a more robust immune response to protective epitopes present in the NTD and RBD domains.

[0190] Non-exclusive examples of SARS-CoV-2 domain fusion antigens with C-terminal shortening and the mRNA encoding them are shown in Tables 11A and 11B below. [Table 21] [Table 22-1] [Table 22-2] [Table 22-3]

[0191] Domain extension In some embodiments, the SARS-CoV-2 S protein domain antigen comprises an "extended" region that includes sequences adjacent to and / or contiguous with those understood in the art to be the NTD domain or the RBD domain. The RBD_EXT series includes SD1 (subdomain 1). The NTD_EXT series includes the C-terminal helix of the NTD. Some B cells and antibodies recognize conformational epitopes that are only seen in the properly folded but non-denatured form of the SARS-CoV-2 S protein NTD and RBD. Inclusion of sequences adjacent to and / or contiguous with the NTD and RBD domains can not only provide additional B cell epitopes to the antigen, but potentially result in more optimal folding of these domains, stimulating B cells with antibodies specific for epitopes found at the ends of either domain. Further, inclusion of these extended sequences increases the distance between the NTD or RBD and the expressing cell membrane, increasing the exposure of both domains to antibodies that may have reduced binding efficiency if the expressed protein is too close to the cell surface. Finally, inclusion of extended sequences increases the pool of peptides that may be presented by CD4 + T cells to B cells that have recognized an NTD or RBD epitope, and then the entire protein is processed for antigen presentation, thereby increasing the chance that NTD- or RBD-specific B cells receive sufficient T cell help. Non-limiting examples of SARS-CoV-2 domain extensions and the mRNAs encoding them are provided in Tables 12A and 12B below.

Table 23

Table 24-1

Table 24-2

Table 24-3

Table 24-4

[0192] Domain mixture This disclosure provides compositions comprising, in some embodiments, a mixture of mRNAs encoding SARS-CoV-2 S protein subdomains. In one example, the composition comprises a mixture of mRNAs encoding NTDs (SD1, SD2, and / or with or without a transmembrane domain) and mRNAs encoding RBDs (SD1, SD2, and / or with or without a transmembrane domain). In some embodiments, the composition comprises mRNA encoding NTDs (e.g., SEQ ID NO: 45 or 46) ligated to a transmembrane domain (e.g., SEQ ID NO: 47) and mRNA encoding RBDs (e.g., SEQ ID NO: 75 or 76) ligated to a transmembrane domain (e.g., SEQ ID NO: 77).

[0193] The ratio of concentrations of one mRNA to another in the composition may be 1:1 (50:50), 1:2, 1:3, 1:4, or 1:5. In some embodiments, this ratio is 1:1. For example, the composition may contain mRNA encoding an NTD ligated to a transmembrane domain (e.g., SEQ ID NO: 47) (e.g., SEQ ID NO: 45 or 46) in a 1:1 ratio to mRNA encoding an RBD ligated to a transmembrane domain (e.g., SEQ ID NO: 77) (e.g., SEQ ID NO: 75 or 76). In some embodiments, the ratio is 1:2. For example, the composition may contain mRNA encoding an NTD ligated to a transmembrane domain (e.g., SEQ ID NO: 47) (e.g., SEQ ID NO: 45 or 46) in a 1:2 ratio to mRNA encoding an RBD ligated to a transmembrane domain (e.g., SEQ ID NO: 77) (e.g., SEQ ID NO: 75 or 76). Another embodiment, composition may comprise mRNA encoding RBD (e.g., SEQ ID NO: 75 or 76) ligated to a transmembrane domain (e.g., SEQ ID NO: 77) in a 1:2 ratio with mRNA encoding NTD (e.g., SEQ ID NO: 45 or 46) ligated to a transmembrane domain (e.g., SEQ ID NO: 47). Different mRNAs encoding different antigens may stimulate immune responses of varying intensities (Magini Det al. PLoS ONE. 2016;11:e0161193), and administration of two mRNAs encoding two different antigens in equimolar ratios may elicit an immune response to one but not to the other (John S et al. Vaccine. 2018;36:1689-1699). Manipulating the ratio of co-delivered mRNAs may be useful for inducing a broad immune response targeting a desired antigen with equivalent potency.

[0194] Encoded nanoparticle antigen The mRNA vaccines provided herein, in some embodiments, encode a fusion protein containing a coronavirus antigen ligated to a scaffold domain. In some embodiments, the scaffold domain confers desired properties to the antigen encoded by the mRNA of this disclosure. For example, the scaffold domain can improve the immunogenicity of the antigen by, for example, altering the structure of the antigen, altering the uptake and processing of the antigen, and / or ligating the antigen to another molecule. In some embodiments, the scaffold domain ligated to the antigen facilitates the self-assembly of the antigen into viral nanoparticles or a larger protein-folding immunogen. Non-limiting examples of scaffold domains that may be used as provided herein include ferritin domains, lumazine synthetase domains, foldon domains, and encapsulin domains. Other scaffold domains may be used.

[0195] Ferritin In some embodiments, the ferritin domain is used as a scaffold domain. Ferritin is a protein whose primary function is the storage of iron within cells. Ferritin is composed of 24 subunits, each subunit consisting of four alpha-helix bundles that self-assemble into a quaternary structure with octahedral symmetry (Cho K et al. J Mol Biol. 2009;390:83-98; (Granier T. et al. J Biol Inorg Chem. 2003;8:105-111; and Lawson DM et al. Nature. 1991;349:541-544). Ferritin self-assembles into nanoparticles with robust thermal and chemical stability. Encapsulating antigens within these ferritin nanoparticles is expected to slow antigen degradation and aggregate individual antigens, with each nanoparticle containing 24 antigen subunits. Aggregation of multiple copies of the same antigen facilitates both antigen uptake and transport by dendritic cells, as well as more robust CD4 + and CD8 +It enhances the T cell response (Kastenmuller K et al. J Clin Invest. 2011;121(5):1782-96). Therefore, ferritin nanoparticles are an ideal platform for antigen presentation and vaccine development.

[0196] The mRNAs provided herein, in some embodiments, encode RBDs linked to the ferritin domain via, for example, a glycine (e.g., GGG) linker domain. Other linkers may be used.

[0197] In other embodiments, the mRNA provided herein encodes the S1 domain of an S protein linked to the ferritin domain, for example, via a glycine (e.g., GGG) linker. Other linkers may be used, as shown elsewhere in this specification.

[0198] Non-specific examples of SARS-CoV-2 antigens linked to ferritin domains and their encoding mRNAs are shown in Tables 13A and 13B below. [Table 25] [Table 26-1] [Table 26-2] [Table 26-3] [Table 26-4] [Table 26-5]

[0199] Lumazine synthetase In some embodiments, the lumazine synthetase domain is used as a scaffold domain. Lumazine synthetase is an enzyme responsible for the second-to-last catalytic step in riboflavin biosynthesis in various organisms, including archaea, bacteria, fungi, plants, and eubacteria. Lumazine synthetases are composed of homooligomers, which vary in size and number of subunits depending on their species of origin, such as pentamers, decamers, and icosahedral 60-mers. The lumazine synthetase monomer is 150 amino acids long and contains beta sheets of adjacent tandem alpha helices. Various quaternary structures have been reported for lumazine synthetases, demonstrating their morphological diversity (from homopentamers to symmetrical assemblies of 12 pentamers forming a 150 Å diameter capsid). When an antigen is presented on the surface of lumazine synthetase, locally high concentrations of the antigen are displayed in a regular sequence. Such repeating structures enable crosslinking of B cell receptors, resulting in a potent immune response through affinity effects.

[0200] The mRNAs provided herein, in some embodiments, encode RBDs linked to the rumazine synthetase domain via, for example, glycine-serine (e.g., GGS). Other linkers may be used.

[0201] In other embodiments, the mRNA provided herein encodes the S1 domain of an S protein linked to a lumazine synthetase domain, for example, via a glycine-serine (e.g., GGS) linker. Other linkers may be used, as shown elsewhere in this specification.

[0202] Non-restrictive examples of SARS-CoV-2 antigens and encoding mRNAs linked to the Foldon domain are shown in Tables 14A and 14B below. [Table 27] [Table 28-1] [Table 28-2] [Table 28-3] [Table 28-4] [Table 28-5] [Table 28-6] [Table 28-7] [Table 28-8] [Table 28-9]

[0203] Foldon In some embodiments, the Foldon domain is used as a scaffolding domain. The C-terminal domain of T4 fibrintin (Foldon) is essential for the formation of fibrintin trimer structures and can be used as an artificial trimerization domain (see, for example, Meier S. et al. Journal of Molecular Biology 2004 Dec 3;344(4):1051-1069; Tao Y et al. Structure 1997 Jun 15;5(6):789-98). When fused to the ectodomain of the S protein, the Foldon domain promotes the correct trimerization of the S protein and avoids incorrect protein folding. Such a process, resulting in the generation of the pre-fusion higher-order structure of the S protein, leads to increased expression, higher-order structure uniformity, and induction of a potent neutralizing antibody response.

[0204] While not bound by theory, this configuration is thought to result in a foldon that is primarily immunologically silent in the intracellular domain of the protein. Non-restrictive examples of SARS-CoV-2 antigens and encoding mRNAs linked to the foldon domain are shown in Tables 15A and 15B below. [Table 29] [Table 30-1] [Table 30-2] [Table 30-3] [Table 30-4] [Table 30-5] [Table 30-6] [Table 30-7] [Table 30-8] [Table 30-9] [Table 30-10] [Table 30-11] [Table 30-12] [Table 30-13] [Table 30-14]

[0205] Encapsulin In some embodiments, the encapsulin domain is used as a scaffold domain. Encapsulin is a protein cage nanoparticle isolated from the thermophilic bacterium Thermotoga maritima. Encapsulin is assembled from 60 copies of the same 31 kDa monomer having a thin icosahedral T=1 symmetric cage structure (with inner and outer diameters of 20 nm and 24 nm, respectively) (Sutter M. et al. Nat Struct Mol Biol. 2008;15:939-947). Although the exact function of encapsulin in T. maritima is not yet clearly understood, its crystal structure has recently been elucidated, and its function has been hypothesized as an intracellular compartment that encapsulates proteins such as DyP (dye dechromic peroxidase) and Flp (ferritin-like protein) (involved in the oxidative stress response) (Rahmanpour R. et al. FEBS J. 2013;280:2097-2104). Using encapsrin in nanoparticle constructs makes it possible to display protein antigens on the surface of the nanoparticles and to encapsulate cargo such as mRNA within the nanoparticles themselves. Previous encapsrin nanoparticle-based vaccines induced strong immune responses to both the surface-displayed antigens and the cargo proteins themselves (Lagoutte P. et al. Vaccine. 2018;36(25):3622-3628).

[0206] The mRNAs provided herein, in some embodiments, encode S protein domains (e.g., S1, S2, RBD, and / or NTD) ligated to the encapsulin domain.

[0207] Fusion protein In some embodiments, the compositions of the present disclosure include mRNA encoding an antigenic fusion protein. Thus, the encoded antigen(s) may include two or more proteins (e.g., a protein and / or protein fragments) bound together. Alternatively, the protein to which the protein antigen is fused may promote a robust immune response to the coronavirus antigen rather than to itself. In some embodiments, the antigen fusion protein retains functional properties from the proteins of their respective origins.

[0208] In some embodiments, the fusion protein includes a receptor-binding domain from the SARS-CoV-2 spike protein.

[0209] In some embodiments, the fusion protein includes the N-terminal domain from the SARS-CoV-2 spike protein.

[0210] In some embodiments, the fusion protein includes a transmembrane domain. In some embodiments, the transmembrane domain may be derived from a virus other than SARS-CoV-2. For example, the transmembrane domain may be derived from the influenza hemagglutinin transmembrane domain, which has been demonstrated to effectively fix the protein to the cell surface.

[0211] variant In some embodiments, the compositions of this disclosure include RNA encoding a coronavirus antigen variant. An antigen variant or other polypeptide variant refers to a molecule whose amino acid sequence differs from that of the wild-type, native, or reference sequence. An antigen / polypeptide variant may have substitutions, deletions, and / or insertions at specific positions within its amino acid sequence compared to the native or reference sequence. Typically, a variant has at least 50% identity with the wild-type, native, or reference sequence. In some embodiments, a variant shares at least 80% or at least 90% identity with the wild-type, native, or reference sequence.

[0212] The variant antigens / polypeptides encoded by the nucleic acids of this disclosure may include amino acid changes that confer any of several desirable properties, such as enhancing their immunogenicity, enhancing their expression, and / or improving their stability or PK / PD properties in a subject. The variant antigens / polypeptides may be prepared using conventional mutagenesis techniques and, as appropriate, assayed to evaluate whether they possess the desired properties. Assays for determining expression levels and immunogenicity are well known in the art, and exemplary such assays are described in the Examples section. Similarly, the PK / PD properties of protein variants may also be measured using techniques recognized in the art (e.g., by evaluating the expression of the antigen over time in a vaccinated subject and / or by confirming the persistence of the induced immune response). The stability of the protein(s) encoded by the variant nucleic acid may be measured by analyzing thermal stability or stability under urea denaturation, or by using in silico prediction. Methods for such experiments and in silico evaluations are well known in the art.

[0213] In some embodiments, the composition comprises mRNA or mRNA ORF comprising any one nucleotide sequence of any of the sequences provided herein (see, for example, the sequence listing), or comprises a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of the sequences provided herein.

[0214] The term "identity" refers to the relationship between two or more polypeptide (e.g., antigens) or polynucleotide (nucleic acid) sequences, determined by comparing these sequences. Identity also refers to the degree of sequence relevance between or within sequences, determined by the number of matches between chains of two or more amino acid residues or nucleic acid residues. Identity measures the percentage of perfect match between the smaller of two or more sequences with gap alignment (if any), which is addressed by a specific mathematical model or computer program (e.g., an "algorithm"). The identity of a given antigen or nucleic acid can be readily calculated by known methods. The "percent identity (%)" applied to polypeptide or polynucleotide sequences is defined as the percentage of residues (amino acid residues or nucleic acid residues) in a candidate amino acid or nucleic acid sequence that are identical to residues in the amino acid or nucleic acid sequence of a second sequence, after aligning the sequences and introducing gaps as necessary to achieve the maximum identity percentage. Methods and computer programs for alignment are well known in the art. Identity depends on the calculation of the identity percentage, but it is understood that the value may differ due to gaps and penalties introduced into this calculation. Generally, variants of a particular polynucleotide or polypeptide (e.g., antigen) have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% but less than 100% sequence identity with respect to that particular reference polynucleotide or polypeptide, in quantification by sequence alignment programs and parameters described herein and known to those skilled in the art.Tools for such alignment include the BLAST suite (Stephen F. Altschul, et al (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”, Nucleic Acids Res. 25:3389-3402). Another well-known local alignment technique is based on the Smith-Waterman algorithm (Smith, TF & Waterman, MS (1981), “Identification of common molecular subsequences.” J.Mol.Biol. 147:195-197). A common global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, SB & Wunsch, CD (1970), “A general method applicable to the search for similarities in the amino acid sequences of two proteins.” J.Mol.Biol. 48:443-453). More recently, the Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed, which is said to align nucleotide and protein sequences more comprehensively and faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm.

[0215] Therefore, polynucleotides encoding peptides or polypeptides, including substitutions, insertions, and / or additions, deletions, and covalent modifications to a reference sequence, particularly a polypeptide (e.g., antigen) sequence disclosed herein, are included within the scope of this disclosure. For example, a sequence tag or amino acids (e.g., one or more lysines) may be added to a peptide sequence (e.g., at its N-terminus or C-terminus). Sequence tags can be used for the detection, purification, or localization of peptides. Lysines may be used to increase peptide solubility or to enable biotinylation. Alternatively, amino acid residues located in the carboxyl and amino-terminal regions of the amino acid sequence of a peptide or protein may be optionally deleted to result in a truncated sequence. Certain amino acids (e.g., C-terminal or N-terminal residues) may be optionally deleted depending on the intended use of the sequence (e.g., soluble, as part of a larger sequence, or for expression of a sequence bound to a solid support). In some embodiments, sequences for (or encoding) signal sequences, stop sequences, transmembrane domains, linkers, multimerization domains (e.g., fold-on regions), etc., may be replaced with alternative sequences that achieve the same or similar functions. In some embodiments, cavities within the protein core may be filled to improve stability, for example, by introducing larger amino acids. In other embodiments, buried hydrogen bond networks may be replaced with hydrophobic residues to improve stability. In yet another embodiment, glycosylation sites may be removed and replaced with appropriate residues. Such sequences are readily recognizable to those skilled in the art. It should also be understood that some of the sequences provided herein contain sequence tags or terminal peptide sequences (e.g., at the N-terminus or C-terminus) that can be deleted before use, for example, in the preparation of mRNA vaccines.

[0216] As will be recognized by those skilled in the art, protein fragments, functional protein domains, and homologous proteins are also considered to be within the range of the coronavirus antigen of interest. For example, this specification provides protein fragments of any reference protein (meaning polypeptide sequences that are at least one amino acid residue shorter than the reference antigen sequence but otherwise identical), which are immunogenic and conditioned to confer a protective immune response against coronavirus. In addition to variants that are identical to the reference protein but shortened, in some embodiments the antigen may contain 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations in any of the sequences provided or referred to herein. The length of the antigen / antigen polypeptide may range from about 4, 6, or 8 amino acids to full-length proteins.

[0217] Stabilizing element Natural eukaryotic mRNA molecules may contain stabilizing elements (including, but not limited to, their 5' UTR and / or the untranslated region (UTR) of their 3' UTR) in addition to other structural features (e.g., a 5' cap or a 3' poly(A) tail). Both the 5' UTR and 3' UTR are typically transcribed from genomic DNA and are elements of immature mRNA. Structural features specific to mature mRNA, such as the 5' cap and 3' poly(A) tail, are usually added to the transcribed (immature) mRNA during mRNA processing.

[0218] In some embodiments, the composition comprises mRNA having an open reading frame encoding at least one antigen polypeptide having at least one modification, at least one 5' terminal cap, and is formulated within lipid nanoparticles. The 5' cap of the polynucleotide may be completed simultaneously during an in vitro transcription reaction using the following chemical RNA cap analogs: 3'-O-Me-m7G(5')ppp(5')G[ARCA cap]; G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A; m7G(5')ppp(5')G to generate a 5' guanosine cap structure according to the manufacturer's protocol (New England BioLabs, Ipswich, MA). 5' capping of the modified RNA may be completed post-transcriptionally using a vaccinia virus capping enzyme to generate a "cap 0" structure: m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). Cap 1 structure may be generated using both vaccinia virus capping enzyme and 2'-O methyltransferase to produce m7G(5')ppp(5')G-2'-O-methyl. Cap 2 structure can be generated from Cap 1 structure by then methylating the third nucleotide from the 5' end using 2'-O methyltransferase. Cap 3 structure can be generated from Cap 2 structure by then methylating the fourth nucleotide from the 5' end using 2'-O methyltransferase. The enzymes may be derived from recombinant sources.

[0219] The 3' poly(A) tail is typically a stretch of adenine nucleotides attached to the 3' end of transcribed mRNA. This can sometimes contain up to approximately 400 adenine nucleotides. In some embodiments, the length of the 3' poly(A) tail can be an essential element with respect to the stability of individual mRNAs.

[0220] In some embodiments, the composition includes a stabilizing element. The stabilizing element may include, for example, a histone stem-loop. A stem-loop binding protein (SLBP), a 32 kDa protein, has been identified. It is associated with the histone stem-loop at the 3' end of histone messages in both the nucleus and cytoplasm. Its expression level is regulated by the cell cycle, peaking in the S phase, at which time histone mRNA levels also increase. This protein has been shown to be essential for the efficient 3' end processing of histone premRNA by U7 snRNP. SLBP continues to associate with the stem-loop after processing, and then facilitates the translation of mature histone mRNA into histone proteins in the cytoplasm. The RNA-binding domain of SLBP is conserved throughout metazoans and protists, and histone stem-loop binding depends on the structure of the loop. The minimal binding site includes at least three nucleotides at the 5' and two nucleotides at the 3' to the stem-loop.

[0221] In some embodiments, the mRNA comprises a coding region, at least one histone stem-loop, and optionally a poly(A) sequence or polyadenylation signal. The poly(A) sequence or polyadenylation signal should generally enhance the expression level of the encoded protein. In some embodiments, the encoded protein is neither a histone protein, a reporter protein (e.g., luciferase, GFP, EGFP, β-galactosidase, EGFP), nor a marker or selection protein (e.g., alpha-globin, galactokinase, and xanthine:guanine phosphoribosyltransferase (GPT)).

[0222] In some embodiments, the mRNA includes combinations of a poly(A) sequence or polyadenylation signal and at least one histone stem-loop, each of which would normally correspond to an alternative mechanism, but which act synergistically to increase protein expression beyond the levels observed with any one of the individual elements. The synergistic effect of the poly(A) and at least one histone stem-loop combination is independent of the order of the elements and the length of the poly(A) sequence.

[0223] In some embodiments, the mRNA does not contain a histone downstream element (HDE). The "hitone downstream element (HDE)" is a naturally occurring stretch of approximately 15-20 nucleotides of purine-rich polynucleotide located at the 3' of the stem-loop, corresponding to the U7 snRNA binding site involved in the processing of histone premRNA to mature histone mRNA. In some embodiments, this nucleic acid does not contain introns.

[0224] mRNA may or may not contain enhancer and / or promoter sequences, which may or may not be modified, and may or may not be activated. In some embodiments, the histone stem-loop generally originates from a histone gene and contains intramolecular base pairs of two adjacent, partially or entirely opposite complementary sequences separated by a spacer consisting of a short sequence, which form the loop of this structure. The unpaired loop region typically cannot base-pair with any of the stem-loop elements. This is often present in RNA, as it is an important component of many RNA secondary structures, but it can also be present in single-stranded DNA. The stability of the stem-loop structure generally depends on its length, the number of mismatches or bulges, and the base composition of the paired regions. In some embodiments, fluctuating base pairs (non-Watson-Crick base pairs) may result. In some embodiments, at least one histone stem-loop sequence contains a length of 15 to 45 nucleotides.

[0225] In some embodiments, the mRNA has one or more AU-rich sequences removed. These sequences (sometimes referred to as AURES) are destabilizing sequences found in the 3'UTR. AURES may be removed from the RNA vaccine, or they may remain in the RNA vaccine.

[0226] Signal peptide In some embodiments, the composition includes mRNA having an ORF encoding a signal peptide fused with a coronavirus antigen. The signal peptide comprises 15–60 amino acids from the N-terminus of the protein and is typically required for transmembrane transposition on the secretory pathway, thus universally regulating the entry of most proteins into the secretory pathway in both eukaryotes and prokaryotes. In eukaryotes, the signal peptide of the nascent precursor protein (preprotein) guides the ribosome to the rough endoplasmic reticulum (ER) membrane and initiates transmembrane transport of the growing peptide chain for processing. ER processing produces the mature protein, and the signal peptide is typically cleaved from the precursor protein by the host cell's ER-resident signal peptidases, or retained and functioning as a membrane anchor. The signal peptide may also facilitate the targeting of the protein to the cell membrane.

[0227] The signal peptide may be 15 to 60 amino acids long. For example, the signal peptide may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 amino acids long. In the globe embodiment, the lengths of the signal peptides are 20-60, 25-60, 30-60, 35-60, 40-60, 45-60, 50-60, 55-60, 15-55, 20-55, 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50. The amino acid lengths are 40-50, 45-50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20-40, 25-40, 30-40, 35-40, 15-35, 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25, or 15-20 amino acid lengths.

[0228] Signal peptides derived from heterologous genes (effectively regulating the expression of genes other than coronavirus antigens) are known in the art, and these may be tested for desired properties and then incorporated into the nucleic acids of this disclosure.

[0229] Array optimization In some embodiments, the ORFs encoding the antigens of this disclosure are codon-optimized. Methods of codon optimization are known in the art. For example, one or more ORFs of any of the sequences provided herein may be codon-optimized. In some embodiments, codon optimization may be used to match codon frequencies in the target and host organisms to ensure proper folding; to bias the GC content to increase mRNA stability or reduce secondary structure; to minimize tandem repeat codons or sequences of bases that may impair gene composition or expression; to customize transcriptional and translational regulatory regions: inserting or removing protein transport sequences; removing / adding post-translational modification sites (e.g., glycosylation sites) within the encoded protein; adding, removing, or shuffling protein domains; inserting or deleting restriction enzyme recognition sites; modifying ribosome binding sites and mRNA degradation sites; regulating translation rates to ensure proper folding of various domains of the protein; or reducing or removing problematic secondary structures within polynucleotides. Codon optimization tools, algorithms, and services are publicly known in the art, and non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA), and / or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using an optimization algorithm.

[0230] In some embodiments, the codon-optimized sequence shares less than 95% sequence identity with a natural or wild-type sequence ORF (e.g., a natural or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 90% sequence identity with a naturally occurring or wild-type sequence (e.g., a natural or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 85% sequence identity with a natural or wild-type sequence (e.g., a natural or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 80% sequence identity with a natural or wild-type sequence (e.g., a natural or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 75% sequence identity with a natural or wild-type sequence (e.g., a natural or wild-type mRNA sequence encoding a coronavirus antigen).

[0231] In some embodiments, the codon-optimized sequence shares 65% to 85% (e.g., about 67% to about 85% or about 67% to about 80%) sequence identity with the natural or wild-type sequence (e.g., the natural or wild-type mRNA sequence encoding the coronavirus antigen). In some embodiments, the codon-optimized sequence shares 65% to 75% or about 80% sequence identity with the natural or wild-type sequence (e.g., the natural or wild-type mRNA sequence encoding the coronavirus antigen).

[0232] In some embodiments, the codon-optimized sequence encodes an antigen that is immunogenic to or more immunogenic than the coronavirus antigen encoded by the non-codon-optimized sequence (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% higher).

[0233] Modified mRNA, when transfected into mammalian host cells, exhibits stability for 12–18 hours, or more than 18 hours, for example, 24, 36, 48, 60, 72 hours, or more than 72 hours, and can be expressed by mammalian host cells.

[0234] In some embodiments, codon-optimized RNA may be RNA with enhanced G / C levels. The G / C content of a nucleic acid molecule (e.g., mRNA) can affect RNA stability. RNA with increased amounts of guanine (G) and / or cytosine (C) residues may be more functionally stable than mRNA containing large amounts of adenine (A) and thymine (T) or uracil (U) nucleotides. As an example, WO02 / 098443 discloses a pharmaceutical composition containing mRNA stabilized by sequence modification within the coding region. Due to genetic coding degeneracy, this modification works by replacing existing codons with codons that promote higher RNA stability without altering the resulting amino acids. This approach is limited to the coding region of RNA.

[0235] Unmodified nucleotides In some embodiments, the mRNA is chemically unmodified and contains a standard ribonucleotide consisting of adenosine, guanosine, cytosine, and uridine. In some embodiments, the nucleotides and nucleosides of this disclosure contain standard nucleoside residues, e.g., residues present in transcription RNA (e.g., A, G, C, or U). In some embodiments, the nucleotides and nucleosides of this disclosure contain standard deoxyribonucleosides, e.g., deoxyribonucleosides present in DNA (e.g., dA, dG, dC, or dT).

[0236] chemical modification In some embodiments, the compositions of the present disclosure include an mNA having an open reading frame encoding a coronavirus antigen, wherein the nucleic acid comprises a nucleotide and / or nucleoside that may be standard (unmodified) or modified as known in the art. In some embodiments, the nucleotides and nucleosides of the present disclosure include modified nucleotides or nucleosides. Such modified nucleotides and nucleosides may be naturally occurring modified nucleotides and nucleosides or modified nucleotides and nucleosides that do not exist in nature. Such modifications may include modifications of the sugar, backbone, or nucleic acid base portion of the nucleotide and / or nucleoside that are recognized in the art.

[0237] In some embodiments, the naturally occurring modified nucleotides or nucleotides described herein are those commonly known or recognized in the art. A non-limiting list of such naturally occurring modified nucleotides and nucleotides can, among other things, be found in the widely recognized MODOMICS database.

[0238] In some embodiments, the non-naturally occurring modified nucleotides or nucleosides of this disclosure are generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleosides can be found, among others, in published U.S. Patent Application Nos. PCT / US2012 / 058519, PCT / US2013 / 075177, PCT / US2014 / 058897, PCT / US2014 / 058891, PCT / US2014 / 070413, PCT / US2015 / 36773, PCT / US2015 / 36759, PCT / US2015 / 36771, or PCT / IB2017 / 051367 (all of which are incorporated herein by reference).

[0239] Therefore, the nucleic acids of this disclosure (e.g., DNA nucleic acids and RNA nucleic acids, e.g., mRNA nucleic acids) may include standard nucleotides and nucleosides, naturally occurring nucleotides and nucleosides, nucleotides and nucleosides that do not exist in nature, or any combination thereof.

[0240] The nucleic acids of this disclosure (e.g., DNA nucleic acids and RNA nucleic acids such as mRNA nucleic acids) include, in some embodiments, a variety of (two or more) different types of standard and / or modified nucleotides and nucleosides. In some embodiments, a particular region of the nucleic acid includes one, two, or more (optionally different) types of standard and / or modified nucleotides and nucleosides.

[0241] In some embodiments, modified RNA nucleic acids (e.g., modified mRNA nucleic acids) introduced into cells or organisms exhibit reduced degradation in the cells or organisms compared to unmodified nucleic acids, including standard nucleotides and nucleosides, respectively.

[0242] In some embodiments, modified RNA nucleic acids (e.g., modified mRNA nucleic acids) introduced into cells or organisms may exhibit reduced immunogenicity in cells or organisms compared to unmodified nucleic acids containing standard nucleotides and nucleosides (e.g., reduced innate response).

[0243] In some embodiments, nucleic acids (e.g., RNA nucleic acids such as mRNA nucleic acids) include unnaturally modified nucleotides introduced during or after nucleic acid synthesis to achieve a desired function or property. The modifications may be present in internucleotide bonds, purine or pyrimidine bases, or sugars. The modifications may be introduced by chemical synthesis or by polymerase enzymes located at the ends of the chain or elsewhere in the chain. Any region of the nucleic acid may be chemically modified.

[0244] This disclosure provides modified nucleosides and nucleotides of nucleic acids (e.g., RNA nucleic acids (e.g., mRNA nucleic acids)). “Nucleoside” means a compound comprising a sugar molecule (e.g., pentose or ribose) or a derivative thereof in combination with an organic base (e.g., purine or pyrimidine) or a derivative thereof (also referred herein as “nucleic acid base”). “Nucleotide” means a nucleoside containing a phosphate group. Modified nucleotides may be synthesized by any useful method (e.g., chemically, enzymatically, or recombinantly) to include one or more modified or unnatural nucleosides. Nucleic acids may contain a region(s) of linked nucleosides. Such regions may have variable skeletal links. These links may be standard phosphodiester links, in which case the nucleic acid contains a region of nucleotides.

[0245] Modified nucleotide base pairings include not only standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides containing non-standard or modified bases and / or modified nucleotides, where the arrangement of hydrogen bond donors and hydrogen bond acceptors enables, for example, hydrogen bonding between a non-standard base and a standard base, or between two complementary non-standard base structures, within a nucleic acid having at least one chemical modification. An example of such a non-standard base pairing is the base pairing of the modified nucleotide inosine with adenine, cytosine, or uracil. Any combination of base / sugar or linker may be incorporated into the nucleic acids of this disclosure.

[0246] In some embodiments, the modified nucleic acid bases in nucleic acids (e.g., RNA nucleic acids such as mRNA nucleic acid) include 1-methyl-pseudridine (m1ψ), 1-ethyl-pseudridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, the modified nucleic acid bases in nucleic acids (e.g., RNA nucleic acids such as mRNA nucleic acid) include 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudridine, 5-methylcytidine, and / or 5-methoxycytidine. In some embodiments, the polyribonucleotide includes a combination of at least two (e.g., two, three, four, or more) of the aforementioned modified nucleic acid bases (including, but not limited to, chemical modifications).

[0247] In some embodiments, the mRNA of the Disclosure comprises a 1-methylpseudridine (m1ψ) substitution at one or more or all uridine positions of the nucleic acid.

[0248] In some embodiments, the mRNA of the Disclosure comprises 1-methylpseudridine (m1ψ) substitutions at one or more uridine positions in the nucleic acid, and 5-methylcytidine substitutions at one or more cytidine positions in the nucleic acid.

[0249] In some embodiments, the mRNA of the Disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid.

[0250] In some embodiments, the mRNA of the Disclosure comprises pseudouridine (ψ) substitutions at one or more uridine positions in the nucleic acid, and 5-methylcytidine substitutions at one or more cytidine positions in the nucleic acid.

[0251] In some embodiments, the mRNA of this disclosure contains uridine at one or more or all of the uridine positions of the nucleic acid.

[0252] In some embodiments, mRNA is uniformly modified for a specific modification (e.g., completely modified, modified throughout the entire sequence). For example, nucleic acids may be uniformly modified with 1-methylpseudridine, meaning that all uridine residues in the mRNA sequence are replaced with 1-methylpseudridine. Similarly, nucleic acids may be uniformly modified for any type of nucleoside residue present in the sequence by replacement with modified residues (e.g., the residues mentioned above).

[0253] The nucleic acids of this disclosure may be partially modified along the entire length of the molecule or fully modified. For example, within the nucleic acids of this disclosure or within a given sequence region thereof (e.g., within mRNA with or without a poly(A) tail), one or more or all or a given type of nucleotide (e.g., purines or pyrimidines, or one or more or all of A, G, U, and C) may be uniformly modified. In some embodiments, all nucleotides X within the nucleic acids of this disclosure (or their sequence region) are modified nucleotides, where X may be one of the nucleotides A, G, U, and C, or one of the following combinations: A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.

[0254] Nucleic acids are modified nucleotides in a range of percentages (e.g., 1% to 100% modified nucleotides in terms of overall nucleotide content, or in terms of one or more types of nucleotides (i.e., one or more of A, G, U, or C)), or any range of percentages (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%). This may include 10%~95%, 10%~100%, 20%~25%, 20%~50%, 20%~60%, 20%~70%, 20%~80%, 20%~90%, 20%~95%, 20%~100%, 50%~60%, 50%~70%, 50%~80%, 50%~90%, 50%~95%, 50%~100%, 70%~80%, 70%~90%, 70%~95%, 70%~100%, 80%~90%, 80%~95%, 80%~100%, 90%~95%, 90%~100%, and 95%~100%). It will be understood that any remaining percentage can be explained by the presence of unmodified A, G, U, or C.

[0255] mRNA may contain modified nucleotides from 1% to 100%, or any percentage within that range (e.g., at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides). For example, nucleic acids may contain modified pyrimidines (e.g., modified uracil or cytosine). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracil in the nucleic acid is replaced with modified uracil (e.g., 5-substituted uracil). Modified uracil may be replaced with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosine in the nucleic acid is replaced with modified cytosine (e.g., 5-substituted cytosine). The modified cytosine may be replaced with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0256] Untranslated area (UTR) The mRNAs of this disclosure may contain one or more regions or portions that act or function as untranslated regions. If the mRNA is designed to encode at least one target antigen, the nucleic acid may contain one or more of these untranslated regions (UTRs). The wild-type untranslated regions of nucleic acids are transcribed but not translated. In mRNA, the 5'UTR begins at the transcription start site and continues to the start codon, but does not contain the start codon. The 3'UTR, on the other hand, begins immediately after the stop codon and continues to the transcription termination signal. There is growing evidence that UTRs play a regulatory role in the stability and translation of nucleic acid molecules. The regulatory function of UTRs can be incorporated into the polynucleotides of this disclosure, particularly to enhance molecular stability. Specific functions can also be incorporated to ensure control of downregulation of transcripts in case the transcript is misdirected to an undesirable organ site. A variety of 5'UTR and 3'UTR sequences are known and available in the art.

[0257] The 5'UTR is a region of mRNA located just upstream (5') of the start codon (the first codon of an mRNA transcript translated by ribosomes). The 5'UTR does not code for proteins (it is non-coding). Natural 5'UTRs have a function that plays a role in translation initiation. They have signatures like the Kozak sequence, which is commonly known to be involved in the process by which ribosomes initiate translation of many genes. The Kozak sequence has consensus CCR(A / G)CCAUGG (SEQ ID NO: 128), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another "G". The 5'UTR is also known to form secondary structures involved in the binding of elongation factors.

[0258] In some embodiments of this disclosure, the 5'UTR is a heterologous UTR, i.e., a naturally occurring UTR associated with a different ORF. In other embodiments, the 5'UTR is a synthetic UTR, i.e., one that does not exist in nature. Examples of synthetic UTRs include mutated UTRs to improve their properties (e.g., to increase gene expression) and fully synthetic UTRs. Examples of 5'UTRs include α-globin or β-globin of Xenopus or human origin (U.S. Patent No. 8,278,063, and No. 9,012,219), human cytochrome β-245α polypeptide, and hydroxysteroid (17b) dehydrogenase, and tobacco etch virus (U.S. Patent No. 8,278,063, and No. 9,012,219). The CMV Early 1 (IE1) gene (US Patent Application Publication No. 20140206753, WO2013 / 185069), sequence GGGAUCCUACC (SEQ ID NO: 129) (WO2014144196) may also be used. In another embodiment, the 5'UTR of the TOP gene is the 5'UTR of the TOP gene lacking the 5'TOP motif (oligopyrimidine tract) (e.g., WO / 2015101414, WO / 2015101415, WO / 2015 / 062738, WO2015024667, WO2015024667; the 5'UTR element derived from the ribosomal protein large 32 (L32) gene (WO / 2015101414, WO2 015101415, WO / 2015 / 062738), a 5'UTR element derived from the 5'UTR of the hydroxysteroid (17-β) dehydrogenase 4 gene (HSD17B4) (WO2015024667), or a 5'UTR element derived from the 5'UTR of ATP5A1 (WO2015024667) may be used. In some embodiments, an internal ribosome entry site (IRES) is used instead of the 5'UTR.

[0259] In some embodiments, the 5'UTR of the present disclosure includes sequences selected from SEQ ID NO: 131 and SEQ ID NO: 2.

[0260] The 3'UTR is a region of mRNA located immediately downstream (3') of the stop codon (the codon in the mRNA transcript that signals the end of translation). The 3'UTR does not code for proteins (it is non-coding). Natural or wild-type 3'UTRs are known to contain embedded adenosine and uridine stretches. These AU-rich signatures are particularly widespread in genes with high turnover rates. Based on sequence characteristics and functional properties, AU-rich elements (AREs) can be classified into three classes (Chen et al, 1995): Class I AREs contain several dispersed copies of the AUUUA motif within the AU-rich region. C-Myc and MyoD contain Class I AREs. Class II AREs have two or more overlapping UUAUUUA(U / A)(U / A)(SEQ ID NO: 130) denatures. Molecules containing this type of ARE include GM-CSF and TNF-α. Class III AREs are not as well defined. These U-rich regions do not contain the AUUUA motif. c-Jun and Myogenin are two well-studied examples in this class. Most proteins that bind to AREs are known to destabilize messengers, while members of the ELAV family, particularly HuR, have been demonstrated to increase mRNA stability. HuR binds to all three classes of AREs. Integrating a HuR-specific binding site into the 3'UTR of a nucleic acid molecule results in HuR binding, which stabilizes the message in vivo.

[0261] The stability of nucleic acids (e.g., RNA) of this disclosure may be modified by introducing, removing, or modifying 3'UTR AU-rich elements (AREs). When manipulating a particular nucleic acid, one or more copies of AREs may be introduced to reduce the stability of the nucleic acid of this disclosure, thereby suppressing translation and reducing the production of the resulting protein. Similarly, by identifying and removing or mutating AREs, intracellular stability may be increased, thereby increasing the translation and production of the resulting protein. Transfection experiments may be performed using the nucleic acids of this disclosure in relevant cell lines, and protein production may be assayed at various time points after transfection. For example, cells may be transfected with various ARE-engineered molecules, and the proteins produced may be assayed using an ELISA kit on the relevant protein at 6, 12, 24, 48, and 7 days after transfection.

[0262] 3'UTR may be heterologous or synthetic. Regarding 3'UTR, globin UTRs (including Xenopus β-globin UTR and human β-globin UTR) are known in the art (U.S. Patent Nos. 8,278,063, 9012,219, and U.S. Patent Application Publication No. 2011,008,6907). Modified β-globin constructs with enhanced stability in several cell types have been developed by cloning two consecutive human β-globin 3'UTRs head-to-tail and are well known in the art (U.S. Patent Application Publication No. 2012 / 0195936, WO2014 / 071963). In addition, α2-globin, α1-globin, UTRs, and their variants are also known in the art (WO2015, 1014,15, and WO2015, 24667). Other 3'UTRs described in non-patent literature with respect to mRNA constructs include CYBA (Ferizi et al., 2015) and albumin (Thess et al., 2015). Other exemplary 3'UTRs include bovine or human growth hormone (wild-type or modified) (WO2013 / 185069, U.S. Patent Application Publication No. 20140206753, WO2014152774), rabbit β-globin, and hepatitis B virus (HBV) UTRs, with α-globin 3'UTR and viral VEEV 3'UTR sequences also known in the art. In some embodiments, the sequence UUUGAAUU (WO2014144196) is used. In some embodiments, human and mouse ribosomal protein 3'UTRs are used. Other examples include rps9 3'UTR (WO2015101414), FIG4 (WO2015101415), and human albumin 7 (WO2015101415).

[0263] In some embodiments, the 3'UTR of the present disclosure includes sequences selected from SEQ ID NO: 132 and SEQ ID NO: 4.

[0264] Those skilled in the art will understand that heterogeneous or synthetic 5'UTRs can be used with any desired 3'UTR sequence. For example, a heterogeneous 5'UTR may be used with a synthetic 3'UTR and a heterogeneous 3''UTR.

[0265] Non-UTR sequences may also be used as regions or subregions within nucleic acids. For example, an intron or a portion of an intron sequence may be incorporated into a region of the nucleic acid of this disclosure. Incorporation of an intron sequence may increase protein production and nucleic acid expression levels.

[0266] The combination of features may be contained in adjacent regions or within other features. For example, the ORF may be flanked by a 3'UTR which may contain a 5'UTR that may contain a potent Kozak translation initiation signal and / or an oligo(dT) sequence for template addition of a poly(A) tail. The 5'UTR may contain a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different genes (e.g., the 5'UTR described in U.S. Patent Application Publication No. 20100293625 and PCT / US2014 / 069155, which are incorporated herein by reference in their entirety).

[0267] It should be understood that any UTR derived from any gene can be incorporated into a region of nucleic acid. Furthermore, multiple wild-type UTRs of any known gene may be utilized. Providing artificial UTRs that are not variants of the wild-type region is also within the scope of this disclosure. These UTRs or any part thereof may be oriented in the same direction as a selected transcript, or their orientation or position may be altered. Thus, a 5' or 3' UTR may be inverted, shortened, lengthened, or made up of one or more other 5' UTRs or 3' UTRs. As used herein, the term “modified” in relation to a UTR sequence means that the UTR has been modified in any way in relation to a reference sequence. For example, a 3' UTR or 5' UTR may be modified compared to a wild-type or native UTR by a change in orientation or position as described above, or by the inclusion of additional nucleotides, deletion of nucleotides, exchange or transposition of nucleotides. Any of these modifications that produce a “modified” UTR (3' or 5') includes a variant UTR.

[0268] In some embodiments, double, triple, or quadruple UTRs, such as 5'UTR or 3'UTR, may be used. As used herein, a “double” UTR is a UTR in which two copies of the same UTR are coded either in series or substantially in series. For example, a double beta-robin 3'UTR may be used as described in U.S. Patent Publication No. 20100129877, the contents of which are incorporated herein by reference in their entirety.

[0269] Having patterned UTRs is also within the scope of this disclosure. As used herein, “patterned UTR” means a UTR that reflects a repeating or alternating pattern such that ABABAB or AABBAAABBAABB or ABCABCABC or its variants are repeated one, two or three or more times. In these patterns, each letter A, B, or C represents a different UTR at the nucleotide level.

[0270] In some embodiments, adjacent regions are selected from a family of transcripts from which the protein shares a common function, structure, feature, or property. For example, the polypeptide of interest may belong to a family of proteins expressed in a particular cell, tissue, or at a certain point in development. Any UTR derived from these genes may be replaced with any other UTR from the same or different protein families to create a new polynucleotide. As used herein, “family of proteins” is used in its broadest sense to refer to a group comprising two or more polypeptides of interest that share at least one function, structure, feature, localization, origin, or expression pattern.

[0271] The untranslated region may also include translation enhancer elements (TEEs). In non-limiting examples, TEEs may include the TEE described in U.S. Patent Application No. 20090226470, which is incorporated herein in its entirety by reference, and TEEs known in the art.

[0272] RNA in vitro transcription The cDNAs encoding polynucleotides described herein can be transcribed using an in vitro transcription (IVT) system. In vitro transcription of RNA is known in the art and is described in International Publication No. WO 2014 / 152027, which is incorporated herein by reference in its entirety. In some embodiments, the RNAs of this disclosure are prepared according to one or more of the methods described in WO 2018 / 053209 and WO 2019 / 036682, each of which is incorporated herein by reference.

[0273] In some embodiments, the RNA transcript is produced using an unamplified linearized DNA template in an in vitro transcription reaction for generating the RNA transcript. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of mRNA, for example, coronavirus mRNA, but is not limited to this. In some embodiments, cells, for example, bacterial cells, for example, E. coli, for example, DH-1 cells, are transfected using the plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA, and then isolated and purified. In some embodiments, the DNA template includes an RNA polymerase promoter, for example, a T7 promoter located 5' to the target gene and ligated to act on the target gene.

[0274] In some embodiments, the in vitro transcription template encodes the 5' untranslated (UTR) region, includes an open reading frame, and encodes the 3' UTR and poly-A tail. The specific nucleic acid sequence composition and length of the in vitro transcription template depend on the mRNA encoded by the template.

[0275] The "5' untranslated region" (UTR) refers to the region of mRNA immediately upstream (i.e., 5') of the start codon that does not code for a polypeptide (i.e., the first codon of the mRNA transcript translated by the ribosome). If an RNA transcript is being produced, the 5' UTR may contain a promoter sequence. Such promoter sequences are known in the art. It should be understood that the vaccines of this disclosure do not contain such promoter sequences.

[0276] The "3' untranslated region" (UTR) refers to the region of mRNA immediately downstream (i.e., 3') of a stop codon that does not code for a polypeptide (i.e., the codon of the mRNA transcript that signals the end of translation).

[0277] An "open reading frame" (ORF) is a continuous stretch of DNA that begins with a start codon (e.g., methionine (ATG)) and ends with a stop codon (e.g., TAA, TAG, or TGA), and codes for a polypeptide.

[0278] A "poly(A)tail" is a region of mRNA located downstream of the 3'UTR, for example, immediately downstream (i.e., 3'), that contains multiple consecutive adenosine monophosphates. A poly(A)tail can contain 10 to 300 adenosine monophosphates. For example, a poly(A)tail may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, a poly(A)tail contains 50 to 250 adenosine monophosphates. In the relevant biological environments (e.g., intracellular, in vivo), poly(A)tails function to protect mRNA from enzymatic degradation (e.g., in the cytoplasm), and to assist in transcription termination and / or the transport and translation of mRNA from the nucleus.

[0279] In some embodiments, the nucleic acid contains 200 to 3,000 nucleotides. For example, the nucleic acid may contain 200 to 500, 200 to 1,000, 200 to 1,500, 200 to 3,000, 500 to 1,000, 500 to 1,500, 500 to 2,000, 500 to 3,000, 1,000 to 1,500, 1,000 to 2,000, 1,000 to 3,000, 1,500 to 3,000, or 2,000 to 3,000 nucleotides.

[0280] An in vitro transcription system typically includes a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor, and a polymerase.

[0281] NTPs may be manufactured in-house, selected from suppliers, or synthesized as described herein. NTPs may be selected from those described herein, including, but not limited to, natural and non-natural (modified) NTPs.

[0282] The methods of this disclosure may use any number of RNA polymerases or variants. The polymerase may be selected from phage RNA polymerases, e.g., T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase and / or mutant polymerases, e.g., but not limited to polymerases that can incorporate modified nucleic acids and / or modified nucleotides, including chemically modified nucleic acids and / or nucleotides. Some embodiments exclude the use of DNases.

[0283] In some embodiments, RNA transcripts are capped via enzymatic capping. In some embodiments, the RNA contains a 5' end cap, for example, 7mG(5')ppp(5')NlmpNp.

[0284] chemical synthesis Solid-phase chemical synthesis. The nucleic acids of this disclosure may be manufactured whole or partially using solid-phase techniques. Solid-phase chemical synthesis of nucleic acids is an automated method in which molecules are immobilized on a solid support and synthesized stepwise in a reactant solution. Solid-phase synthesis is useful for site-specific introduction of chemical modifications to nucleic acid sequences.

[0285] Liquid-phase chemical synthesis. The synthesis of nucleic acids according to this disclosure by sequential addition of monomer building blocks may be carried out in the liquid phase.

[0286] Combinations of synthesis methods. Each of the synthesis methods discussed above has its own advantages and limitations. Attempts have been made to overcome these limitations by combining these methods. Such combination methods are also within the scope of this disclosure. When solid-phase or liquid-phase chemical synthesis is used in combination with enzymatic ligation, long-chain nucleic acids that cannot be obtained by chemical synthesis alone can be efficiently produced.

[0287] Nucleic acid region or subregion ligation Nucleic acid assembly by ligases can also be used. DNA or RNA ligases facilitate intermolecular ligation of the 5' and 3' ends of polynucleotide chains through the formation of phosphodiester bonds. Nucleic acids, such as chimeric polynucleotides and / or cyclic nucleic acids, can be prepared by ligation of one or more regions or subregions. DNA fragments can be joined by ligase-catalyzed reactions to create recombinant DNA with various functions. Two oligodeoxynucleotides, one with a 5' phosphoryl group and the other with a free 3' hydroxyl group, serve as substrates for DNA ligases.

[0288] purification The nucleic acid purification described herein may include, but is not limited to, nucleic acid cleanup, quality assurance, and quality control. Cleanup may be carried out by methods known in the art, for example, but is not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes (EXIQON® Inc, Vedbaek, Denmark), or HPLC-based purification methods, for example, but is not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). When used with respect to nucleic acids, such as "purified nucleic acid," the term "purified" means that it has been separated from at least one contaminant. "Contaminant, impurity" is any substance that makes another substance unsuitable, impure, or inferior. Therefore, purified nucleic acids (e.g., DNA and RNA) exist in a form or configuration different from that found in nature, or in a form or configuration different from that which existed before being subjected to processing or purification.

[0289] Quality assurance and / or quality control checks may be performed using methods such as gel electrophoresis, UV absorbance, or analytical HPLC, but are not limited to these.

[0290] In some embodiments, nucleic acids may be sequenced by methods including, but not limited to, reverse transcriptase-PCR.

[0291] Quantification In some embodiments, the nucleic acids of this disclosure may be quantified in exosomes or when derived from one or more bodily fluids. Bodily fluids include peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, sputumous fluid, amniotic fluid, earwax, breast milk, bronchoalveolar lavage fluid, semen, prostatic fluid, Cowper's fluid or bulbourethral gland fluid, sweat, feces, hair, tears, cystic fluid, pleural and ascites fluid, pericardial fluid, lymph, atherosclerotic fluid, chyle, bile, interstitial fluid, menstrual fluid, pus, sebum, vomit, vaginal secretions, mucosal secretions, fecal water, pancreatic juice, sinus lavage fluid, bronchopulmonary aspirate, blastocyst fluid, and umbilical cord blood. Alternatively, exosomes may be recovered from organs selected from the group consisting of the lungs, heart, pancreas, stomach, intestines, bladder, kidneys, ovaries, testes, skin, colon, breasts, prostate, brain, esophagus, liver, and placenta.

[0292] The assay may be performed using construct-specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or a combination thereof, while exosomes can be isolated using immunohistochemical methods such as enzyme-linked immunosorbent assay (ELISA). Exosomes can also be isolated by size exclusion chromatography, density gradient centrifugation, fractional centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or a combination thereof.

[0293] These methods give researchers the ability to monitor the levels of residual or delivered nucleic acids in real time. This is possible because, in some embodiments, the nucleic acids of this disclosure differ from their endogenous forms due to structural or chemical modifications.

[0294] In some embodiments, nucleic acids may be quantified using methods such as ultraviolet-visible spectroscopy (UV / Vis), though not limited to these. An example of a UV / Vis spectrometer is the NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified nucleic acids may be analyzed to determine whether they are of appropriate size and to confirm that nucleic acid degradation has not occurred. Nucleic acid degradation may be confirmed by methods such as agarose gel electrophoresis, HPLC-based purification methods, including, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE), and capillary gel electrophoresis (CGE).

[0295] Lipid nanoparticles (LNPs) In some embodiments, the mRNA of the Disclosure is formulated in lipid nanoparticles (LNPs). The lipid nanoparticles typically comprise ionizable cationic lipids, non-cationic lipids, sterols, and PEG lipid components together with the nucleic acid cargo of interest. The lipid nanoparticles of the Disclosure are based on components, compositions, and methods commonly known in the Art (e.g., all of which are incorporated herein by reference in their entirety: PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016000129; PCT / US201 It can be generated using 6 / 014280;PCT / US2016 / 014280;PCT / US2017 / 038426;PCT / US2014 / 027077;PCT / US2014 / 055394;PCT / US2016 / 52117;PCT / US2012 / 069610;PCT / US2017 / 027492;PCT / US2016 / 059575 and PCT / US2016 / 069491.

[0296] The vaccines of this disclosure are typically formulated within lipid nanoparticles. In some embodiments, the lipid nanoparticles comprise at least one ionizable cationic lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid.

[0297] In some embodiments, the lipid nanoparticles contain 40-50 mol% of ionizable lipids, optionally comprising 45-50 mol%, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol%, for example, about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%.

[0298] In some embodiments, the lipid nanoparticles include 30–45 mol% sterols, optionally 35–40 mol%, for example, 30–31 mol%, 31–32 mol%, 32–33 mol%, 33–34 mol%, 35–35 mol%, 35–36 mol%, 36–37 mol%, 38–38 mol%, 38–39 mol%, or 39–40 mol%.

[0299] In some embodiments, the lipid nanoparticles contain 5–15 mol% of helper lipids, optionally 10–12 mol%, for example, 5–6 mol%, 6–7 mol%, 7–8 mol%, 8–9 mol%, 9–10 mol%, 10–11 mol%, 11–12 mol%, 12–13 mol%, 13–14 mol%, or 14–15 mol%.

[0300] In some embodiments, the lipid nanoparticles contain 1–5% PEG lipids, optionally 1–3 mol%, for example, 1.5–2.5 mol%, 1–2 mol%, 2–3 mol%, 3–4 mol%, or 4–5 mol%.

[0301] In some embodiments, the lipid nanoparticles contain 20-60 mol% of ionizable cationic lipids. For example, the lipid nanoparticles may contain 20-50 mol%, 20-40 mol%, 20-30 mol%, 30-60 mol%, 30-50 mol%, 30-40 mol%, 40-60 mol%, 40-50 mol%, or 50-60 mol% of ionizable cationic lipids. In some embodiments, the lipid nanoparticles contain 20 mol%, 30 mol%, 40 mol%, 50 mol%, or 60 mol% of ionizable cationic lipids. In some embodiments, the lipid nanoparticles contain 35 mol%, 36 mol%, 37 mol%, 38 mol%, 39 mol%, 40 mol%, 41 mol%, 42 mol%, 43 mol%, 44 mol%, 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, 50 mol%, 51 mol%, 52 mol%, 53 mol%, 54 mol%, or 55 mol% of ionizable cationic lipids.

[0302] In some embodiments, the lipid nanoparticles contain 5 to 25 mol% of non-cationic lipids. For example, the lipid nanoparticles may contain 5 to 20 mol%, 5 to 15 mol%, 5 to 10 mol%, 10 to 25 mol%, 10 to 20 mol%, 10 to 25 mol%, 15 to 25 mol%, 15 to 20 mol%, or 20 to 25 mol% of non-cationic lipids. In some embodiments, the lipid nanoparticles contain 5 mol%, 10 mol%, 15 mol%, 20 mol%, or 25 mol% of non-cationic lipids.

[0303] In some embodiments, the lipid nanoparticles contain 25-55 mol% sterols. For example, the lipid nanoparticles may contain 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% sterols. In some embodiments, the lipid nanoparticles contain 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% sterols.

[0304] In some embodiments, the lipid nanoparticles contain 0.5 to 15% PEG-modified lipids. For example, the lipid nanoparticles may contain 0.5 to 10 mol%, 0.5 to 5 mol%, 1 to 15 mol%, 1 to 10 mol%, 1 to 5 mol%, 2 to 15 mol%, 2 to 10 mol%, 2 to 5 mol%, 5 to 15 mol%, 5 to 10 mol%, or 10 to 15 mol%. In some embodiments, the lipid nanoparticles contain 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% PEG-modified lipids.

[0305] In some embodiments, the lipid nanoparticles contain 20-60 mol% ionizable cationic lipids, 5-25 mol% neutral lipids, 25-55 mol% sterols, and 0.5-15 mol% PEG-modified lipids.

[0306] In some embodiments, the ionizable cationic lipids of this disclosure are of formula (I): [ka] It has a compound or salt or isomer of the, in which, R1 is C 5-30 Alkyl, C 5-20 Selected from the group consisting of alkenyl, -R*YR'', -YR'', and -R''M'R', R2 and R3 are independently H, C 1-14 Alkyl, C 2-14 Selected from the group consisting of alkenyls, -R*YR'', -YR'', and -R*OR'', or R2 and R3 together with the atoms to which they are bonded to form a heterocycle or a carbon ring. R4 is C 3-6 Carbon ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 Selected from the group consisting of alkyl groups, where Q is a carbocyclic, heterocyclic, -OR, or -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N( R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8, -O(CH2) n The following are selected from OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(R)N(R)2C(O)OR, where each n is independently selected from 1, 2, 3, 4, and 5. Each R5 is independent of C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R6 is independent of C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, M and M' are independently -C(O)O-, -OC(O)-, -C(O)N(R')-, Selected from -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, aryl groups, and heteroaryl groups, R7 is C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, R8 is C 3-6 Selected from the group consisting of carbocyclic and heterocyclic rings, R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenil, C 3-6 Selected from the group consisting of carbocyclic and heterocyclic rings, Each R is independent of C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R' is independent of C 1-18 Alkyl, C 2-18 Selected from the group consisting of alkenyl, -R*YR'', -YR'', and H, Each R is independent of C 3-14 Alkyl and C 3-14 Selected from the group consisting of alkenils, Each R* is independent of C 1-12 Alkyl and C 2-12 Selected from the group consisting of alkenils, Each Y is independent of C 3-6 It is a carbon ring, Each X is independently selected from the group consisting of F, Cl, Br, and I. m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0307] In some embodiments, a subset of compounds of formula (I) has R4 -(CH2) n Q, -(CH2) nIf it is CHQR, -CHQR, or -CQ(R)2, then (i) if n is 1, 2, 3, 4, or 5, Q is not -N(R)2, or (ii) if n is 1 or 2, Q is not a 5, 6, or 7-membered heterocycloalkyl.

[0308] In some embodiments, another subset of compounds of formula (I) is: R1 is C 5-30 Alkyl, C 5-20 Selected from the group consisting of alkenyl, -R*YR'', -YR'', and -R''M'R', R2 and R3 independently determine H and C 1~14 Alkyl, C 2~14 Selected from the group consisting of alkenyls, -R*YR'', -YR'', and -R*OR'', or R2 and R3 together with the atom to which they are bonded to form a heterocycle or a carbon ring. R4 is C 3~6 Carbon ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 Selected from the group consisting of alkyl groups, where Q is C 3~6 5-14 member heteroaryl, -OR, -O(CH2) having one or more heteroatoms selected from a carbocyclic ring, N, O, and S. n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) nOR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and having one or more heteroatoms selected from N, O, and S, including oxo(=O), OH, amino, monoalkylamino or dialkylamino and C 1-3 Selected from 5- to 14-membered heterocycloalkyl groups substituted with one or more substituents selected from alkyl groups, where each n is independently selected from 1, 2, 3, 4, and 5. Each R5 independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R6 independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, aryl groups, and heteroaryl groups. R7 is C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, R8 is C 3-6 Selected from the group consisting of carbocyclic and heterocyclic rings, R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenil, C 3-6 Selected from the group consisting of carbocyclic and heterocyclic rings, Each R independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R' independently, C 1~18 Alkyl, C 2~18 Selected from the group consisting of alkenyl, -R*YR'', -YR'', and H, Each R is independent of C 3-14 Alkyl and C 3-14 Selected from the group consisting of alkenils, Each R* independently, C 1-12 Alkyl and C 2-12 Selected from the group consisting of alkenils, Each Y independently, C 3-6 It is a carbon ring, Each X is independently selected from the group consisting of F, Cl, Br, and I. m is a compound selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13. Or, salts or isomers thereof.

[0309] In some embodiments, another subset of compounds of formula (I) is: R1 is C 5-30 Alkyl, C 5-20 Selected from the group consisting of alkenyl, -R*YR'', -YR'', and -R''M'R', R2 and R3 independently determine H and C 1~14 Alkyl, C 2~14 Selected from the group consisting of alkenyls, -R*YR'', -YR'', and -R*OR'', or R2 and R3 together with the atom to which they are bonded to form a heterocycle or a carbon ring. R4 is C 3-6 Carbon ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 Selected from the group consisting of alkyl groups, where Q is C 3-6 5-14 member heteroaryl, -OR, -O(CH2) having one or more heteroatoms selected from a carbocyclic ring, N, O, and S. nN(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R)2, and each n is independently selected from 1, 2, 3, 4, and 5, and Q is a 5- to 14-member heterocyclic ring, (i) when R4 is -(CH2) n Q, and n is 1 or 2, or (ii) when R4 is -(CH2) n CHQR, and n is 1, or (iii) when R4 is -CHQR and -CQ(R)2, Q is a 5- to 14-member heteroaryl or an 8- to 14-member heterocyclic alkyl, each R5 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H, each R6 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H, M and M’ are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R’)-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, -S-S-, aryl groups, and heteroaryl groups, R7 is selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H, R8 is selected from the group consisting of C 3-6 carbocyclic rings and heterocyclic rings, R9 is selected from the group consisting of H, CN, NO2, C 1-6 alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 alkenyl, C 3-6 a carbocyclic ring and a heterocyclic ring, each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H, each R’ is independently selected from the group consisting of C 1~18 alkyl, C 2~18 alkenyl, -R*YR”, -YR”, and H, each R” is independently selected from the group consisting of C 3-14 alkyl and C 3-14 alkenyl, each R* is independently selected from the group consisting of C 1-12 alkyl, and C 2-12 alkenyl, each Y is independently C 3-6 a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I, m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13, a compound, or a salt or isomer thereof.

[0310] In some embodiments, another subset of the compounds of formula (I) includes R1 is selected from the group consisting of C 5-30 alkyl, C 5-20 alkenyl, -R*YR”, -YR”, and -R”M’R’, R2 and R3 are independently H, C 1~14 alkyl, C 2~14 alkenyl, -R*YR”, -YR”, and -R*OR”, or R2 and R3 together with the atom to which they are attached form a heterocyclic ring or a carbocyclic ring, R4 is C 3~6 a carbocyclic ring, -(CH2) n Q, -(CH2) nCHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 Selected from the group consisting of alkyl groups, where Q is C 3~6 5-14 member heteroaryl, -OR, -O(CH2) having one or more heteroatoms selected from a carbocyclic ring, N, O, and S. n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R)2 are selected, and each n is independently selected from 1, 2, 3, 4, and 5. Each R5 independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R6 independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, M and M' independently become -C(O)O-, -OC(O)-, -C(O)N(R')-, Selected from -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, aryl groups, and heteroaryl groups, R7 is C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, R8 is C 3-6 Selected from the group consisting of carbocyclic and heterocyclic rings, R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenil, C 3-6 Selected from the group consisting of carbocyclic and heterocyclic rings, Each R independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R' independently, C 1~18 Alkyl, C 2~18 Selected from the group consisting of alkenyl, -R*YR'', -YR'', and H, Each R is independent of C 3-14 Alkyl and C 3-14 Selected from Alkenil, Each R* independently, C 1-12 Alkyl and C 2-12 Selected from the group consisting of alkenils, Each Y independently, C 3-6 It is a carbon ring, Each X is independently selected from the group consisting of F, Cl, Br, and I. Examples include compounds, salts, or isomers thereof, where m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13. In some embodiments, another subset of compounds of formula (I) is: R1 is C 5-30 Alkyl, C 5-20 Selected from the group consisting of alkenyl, -R*YR'', -YR'', and -R''M'R', R2 and R3 independently determine H and C 2-14 Alkyl, C 2-14 Selected from the group consisting of alkenyls, -R*YR'', -YR'', and -R*OR'', or R2 and R3 together with the atoms to which they are bonded to form a heterocycle or a carbon ring. R4 is -(CH2) n Q or -(CH2) n CHQR, where Q is -N(R)² and n is selected from 3, 4, and 5. Each R5 independently, C1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R6 independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, aryl groups, and heteroaryl groups; R7 is C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R' independently, C 1~18 Alkyl, C 2~18 Selected from the group consisting of alkenyl, -R*YR'', -YR'', and H, Each R is independent of C 3-14 Alkyl and C 3-14 Selected from the group consisting of alkenils; Each R* independently, C 1~12 Alkyl and C 1~12 Selected from the group consisting of alkenils, Each Y independently, C 3-6 It is a carbon ring, Each X is independently selected from the group consisting of F, Cl, Br, and I, and m is a compound selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13. Or, salts or isomers thereof.

[0311] In some embodiments, another subset of compounds of formula (I) is: R1 is C 5-30 Alkyl, C 5-20 Selected from the group consisting of alkenyl, -R*YR'', -YR'', and -R''M'R', R2 and R3 independently, C 1-14 Alkyl, C 2-14 Selected from the group consisting of alkenyls, -R*YR'', -YR'', and -R*OR'', or R2 and R3 together with the atoms to which they are bonded to form a heterocycle or a carbon ring. R4 is -(CH2) n Q, -(CH2) n Selected from the group consisting of CHQR, -CHQR, and -CQ(R)2, where Q is -N(R)2 and n is selected from 1, 2, 3, 4, and 5. Each R5 independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R6 independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, aryl groups, and heteroaryl groups. R7 is C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R independently, C 1-3 Alkyl, C 2-3 Selected from the group consisting of alkenyls and H, Each R' independently, C 1~18 Alkyl, C 2~18 Selected from the group consisting of alkenyl, -R*YR'', -YR'', and H, Each R is independent of C 3-14 Alkyl and C 3-14 Selected from the group consisting of alkenils, Each R* independently, C 1-12 Alkyl and C 1-12 Selected from the group consisting of alkenils, Each Y independently, C 3-6It is a carbon ring, Each X is independently selected from the group consisting of F, Cl, Br, and I, and m is a compound selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13. Or, salts or isomers thereof.

[0312] In some embodiments, a subset of compounds of formula (X) is formula (IA): [ka] Examples include compounds or salts or isomers of the compound, where I is selected from 1, 2, 3, 4, and 5, m is selected from 5, 6, 7, 8, and 9, M1 is a bond or M', and R4 is an unsubstituted C 1-3 Alkyl, or -(CH2) n Q is a heteroaryl or heterocycloalkyl group, where Q is OH, -NHC(S)N(R)2, -NHC(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)R8, -NHC(=NR9)N(R)2, -NHC(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, heteroaryl or heterocycloalkyl, M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, aryl group, and heteroaryl group, and R2 and R3 are independently selected from H, C 1-14 Alkyl and C 2-14 Selected from the group consisting of alkenyls.

[0313] In some embodiments, a subset of compounds of formula (I) is formula (II): [ka] Examples include compounds or salts or isomers of C, where I is selected from 1, 2, 3, 4, and 5; M1 is a bond or M'; and R4 is an unsubstituted C. 1-3 Alkyl or -(CH2) nQ is a heteroaryl or heterocycloalkyl group, where n is 2, 3, or 4, and Q is OH, -NHC(S)N(R)2, -NHC(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)R8, -NHC(=NR9)N(R)2, -NHC(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, heteroaryl or heterocycloalkyl, and M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, aryl group, and heteroaryl group; and R2 and R3 are independently H, C 1-14 Alkyl and C 2-14 Selected from the group consisting of alkenyls.

[0314] In some embodiments, a subset of compounds of formula (I) may be formulas (IIa), (IIb), (IIc), or (IIe): [ka] Examples include salts or isomers thereof, where R4 is as described herein.

[0315] In some embodiments, a subset of compounds of formula (I) is formula (IId): [ka] Examples include compounds of , or salts or isomers thereof, where n is 2, 3, or 4, and m, R', R'', and R2-R6 are as described herein. For example, each of R2 and R3 is independently C 5-14 Alkyl and C 5-14 It can be selected from the group consisting of alkenyls.

[0316] In some embodiments, the ionizable cationic lipids of this disclosure are compounds having the following structure: [ka] Includes.

[0317] In some embodiments, the ionizable cationic lipids of this disclosure are compounds having the following structure: [ka] Includes.

[0318] In some embodiments, the noncationic lipids of this disclosure include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and 1,2-dipalmitoyl-sn-glycero Cero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 dietherPC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-difytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3 -Phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

[0319] In some embodiments, the PEG-modified lipids of this disclosure include PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipids are DMG-PEG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG, and / or PEG-DPG.

[0320] In some embodiments, the sterols of the present disclosure include cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and mixtures thereof.

[0321] In some embodiments, the LNP of the present disclosure comprises an ionizable cationic lipid of compound 1, where the non-cationic lipid is DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG.

[0322] In some embodiments, the lipid nanoparticles contain 45 to 55 mol percent (mol%) of ionizable cationic lipids. For example, the lipid nanoparticles may contain 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mol% of ionizable cationic lipids.

[0323] In some embodiments, the lipid nanoparticles contain 5-15 mol%, 5-10 mol%, or 10-15 mol% of DSPC. For example, the lipid nanoparticles may contain 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mol% of DSPC.

[0324] In some embodiments, the lipid nanoparticles contain 35–40 mol% cholesterol. For example, the lipid nanoparticles may contain 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, or 40 mol% cholesterol.

[0325] In some embodiments, the lipid nanoparticles contain 1-2 mol%, 1-3 mol%, 1-4 mol%, or 1-5 mol% of DMG-PEG. For example, the lipid nanoparticles may contain 1, 1.5, 2, 2.5, 3, or 3.5 mol% of DMG-PEG.

[0326] In some embodiments, the lipid nanoparticles contain 50 mol% ionizable cationic lipid, 10 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG.

[0327] In some embodiments, the lipid nanoparticles contain 49 mol% ionizable cationic lipid, 10 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% DMG-PEG.

[0328] In some embodiments, the lipid nanoparticles contain 49 mol% ionizable cationic lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG.

[0329] In some embodiments, the lipid nanoparticles contain 48 mol% ionizable cationic lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% DMG-PEG.

[0330] In some embodiments, the LNPs of this disclosure include N:P ratios ranging from about 2:1 to about 30:1.

[0331] In some embodiments, the LNPs of this disclosure include an N:P ratio of approximately 6:1.

[0332] In some embodiments, the LNPs of this disclosure include an N:P ratio of approximately 3:1.

[0333] In some embodiments, the wt / wt ratio of the ionizable cationic lipid components to RNA contained in the LNPs of this disclosure is approximately 10:1 to approximately 100:1.

[0334] In some embodiments, the wt / wt ratio of the ionizable cationic lipid components to RNA contained in the LNPs of this disclosure is approximately 20:1.

[0335] In some embodiments, the wt / wt ratio of the ionizable cationic lipid components to RNA contained in the LNPs of this disclosure is approximately 10:1.

[0336] In some embodiments, the average diameter of the LNPs in this disclosure is approximately 50 nm to approximately 150 nm.

[0337] In some embodiments, the average diameter of the LNPs in this disclosure is approximately 70 nm to approximately 120 nm.

[0338] Multivalent vaccine The compositions provided herein may contain RNA encoding two or more antigens of the same or different species, or may contain multiple RNAs. In some embodiments, the composition contains one or more mRNAs encoding two or more coronavirus antigens. In some embodiments, the RNA may encode 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more coronavirus antigens.

[0339] In some embodiments, two or more different mRNAs encoding antigens may be formulated within the same lipid nanoparticle. In other embodiments, two or more different RNAs encoding antigens may be formulated within separate lipid nanoparticles (each RNA is formulated within a single lipid nanoparticle). The lipid nanoparticles may then be administered together as a single vaccine composition (e.g., a vaccine composition containing multiple RNAs encoding multiple antigens) or separately.

[0340] Combination vaccines The compositions provided herein may contain one mRNA encoding two or more antigens of the same or different virus strains, or multiple RNAs. Combination vaccines containing RNA encoding one or more coronaviruses and one or more antigens of different organisms are also provided herein. Accordingly, the vaccines of this disclosure may be combination vaccines targeting one or more antigens of the same strain / species, or one or more antigens of different strains / species, for example, organisms found in the same geographical area at high risk of coronavirus infection, or organisms to which an individual is likely to be exposed when exposed to coronavirus.

[0341] Pharmaceutical preparations This specification provides compositions (e.g., pharmaceutical compositions), methods, kits, and reagents for, for example, the prevention and / or treatment of coronaviruses in humans and other mammals. The compositions provided herein may be used as therapeutic or prophylactic agents. They may be used in pharmaceuticals for the prevention and / or treatment of coronavirus infections.

[0342] In some embodiments, the coronavirus vaccine comprising the RNA described herein may be administered to a subject (e.g., a mammalian subject such as a human subject) to which the mRNA is translated in vivo to produce an antigen polypeptide (antigen).

[0343] The “effective amount” of a composition (e.g., containing RNA) is based at least in part on the target tissue, target cell type, means of administration, physical properties of the RNA (e.g., length, nucleotide composition, and / or degree of modified nucleosides), other components of the vaccine, and other determinants, such as the age, weight, height, sex, and overall health status of the subject. Typically, the effective amount of a composition provides an induced or promoted immune response as a function of antigen production within the target cells. In some embodiments, an effective amount of a composition containing mRNA having at least one chemical modification is more efficient than a composition containing a corresponding unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production may be demonstrated by increased cell transfection (percentage of cells transfected with the RNA vaccine), increased protein translation and / or expression from the polynucleotide, decreased nucleolysis (e.g., indicated by increased duration of protein translation from modified polynucleotides), or altered antigen-specific immune responses in host cells.

[0344] The term “pharmaceutical composition” refers to a combination of an active agent and an inactive or active carrier that makes the composition particularly suitable for in vivo or ex vivo diagnostic or therapeutic use. A “pharmaceutically acceptable carrier” does not cause undesirable physiological effects, either after or during administration to a subject. The carrier in the pharmaceutical composition must also be “acceptable” in the sense that it is compatible with the active ingredient and capable of stabilizing it. One or more solubilizers may be used as a pharmaceutical carrier for the delivery of the active agent. Examples of pharmaceutically acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents for achieving compositions usable as dosage forms. Other examples of carriers include colloidal silicon dioxide, magnesium stearate, cellulose, and sodium lauryl sulfate. Additional suitable pharmaceutical carriers and diluents, as well as pharmaceutical necessities for their use, are described in Remington's Pharmaceutical Sciences.

[0345] In some embodiments, compositions according to this disclosure (including polynucleotides and the polypeptides encoded therein) may be used for the treatment or prevention of coronavirus infection. Some compositions may be administered prophylactically as part of an aggressive immunization scheme or therapeutically to healthy individuals or during the early stages of infection in the incubation period or during active infection after the onset of symptoms. In some embodiments, the amount of RNA provided to cells, tissues, or subjects may be an amount effective for immunoprevention.

[0346] The composition may be administered together with other prophylactic or therapeutic compounds. In non-limiting examples, the prophylactic or therapeutic compound may be an adjuvant or a booster. As used herein, when referring to a prophylactic composition (e.g., a vaccine), the term “booster” refers to an additional dose of the prophylactic (vaccine) composition. The booster (or booster vaccine) may be administered after the prophylactic composition has been administered. The time between the initial dose of the prophylactic composition and the booster may be, but is not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 minutes. 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, The duration of immunization may be 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 18 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 25 years, 30 years, 35 years, 40 years, 45 years, 50 years, 55 years, 60 years, 65 years, 70 years, 75 years, 80 years, 85 years, 90 years, 95 years, or more than 99 years. In exemplary embodiments, the time between the first dose of the prophylactic composition and the booster immunization may be 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 6 months, or 1 year, but is not limited.

[0347] In some embodiments, the composition may be administered intramuscularly, intranasally, or intradermally, similar to the administration of inactivated vaccines known in the art.

[0348] The composition can be used in a variety of settings depending on the prevalence of infection or the degree or level of unmet medical needs. As a non-limiting example, RNA vaccines can be used to treat and / or prevent a variety of infectious diseases. RNA vaccines have superior properties in that they produce much higher antibody titers, better neutralizing immunity, a more sustained immune response, and / or an earlier response than commercially available vaccines.

[0349] Provided herein are pharmaceutical compositions comprising a complex of RNA and / or optionally, in combination with one or more pharmaceutically acceptable excipients.

[0350] RNA may be formulated or administered alone or in combination with one or more other components. For example, the composition may include other components, including adjuvants, but is not limited to these.

[0351] In some embodiments, the composition does not contain an adjuvant (is adjuvant-free).

[0352] RNA may be formulated or administered in combination with one or more pharmaceutically acceptable excipients. In some embodiments, the vaccine composition includes at least one additional active substance, such as a therapeutic active substance, a prophylactic active substance, or a combination of both. The vaccine composition may be sterile, pyrogen-free, or both sterile and pyrogen-free. General considerations for the formulation and / or manufacture of pharmaceutical agents, such as vaccine compositions, can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (which is incorporated herein by reference in its entirety).

[0353] In some embodiments, the composition is administered to humans, human patients, or subjects. For the purposes of this disclosure, the expression “active ingredient” generally refers to an RNA vaccine or a polynucleotide contained therein, such as mRNA encoding an antigen.

[0354] The formulations of the vaccine compositions described herein may be prepared by any method known or to be developed in the field of pharmacology. Generally, such preparation methods include the steps of associating an active ingredient (e.g., mRNA) with excipients and / or one or more auxiliary components, and then, if necessary and / or desired, dividing, shaping, and / or packaging the product into desired single or multi-dose units.

[0355] The relative amounts of the active ingredient, pharmaceutically acceptable excipients, and / or any further components in a pharmaceutical composition according to this disclosure will vary depending on the specificity, size, and / or condition of the target being treated, and further, on the route through which the composition is administered. For example, a composition may contain 0.1% to 100%, e.g., 0.5 to 50%, 1 to 30%, 5 to 80%, or at least 80% (w / w) of the active ingredient.

[0356] In some embodiments, mRNA is formulated with one or more excipients to (1) enhance stability, (2) increase cell transfection, (3) enable sustained or delayed release (e.g., from a depot), (4) alter in vivo distribution (e.g., target specific tissues or cell types), (5) increase in vivo translation of the encoded protein, and / or (6) alter the in vivo release profile of the encoded protein (antigen). In addition to conventional excipients such as any solvent, dispersion medium, diluent, or other liquid vehicle, excipients include, but are not limited to, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, RNA-transfected cells (e.g., for transplantation into a target), hyaluronidases, nanoparticle mimics, and combinations thereof.

[0357] Medication / Administration This specification provides compositions (e.g., RNA vaccines), methods, kits, and reagents for the prevention and / or treatment of coronavirus infections in humans and other mammals. The immunizing compositions may be used as therapeutic or prophylactic agents. In some embodiments, the compositions are used to provide prophylactic protection from coronavirus infection. In some embodiments, the compositions are used to treat coronavirus infection. In some embodiments, the compositions are used for priming immune effector cells, for example, to activate peripheral blood mononuclear cells (PBMCs) ex vivo and then inject (reinject) them into a target.

[0358] The subject may be any mammal (including non-human primates and humans). Typically, the subject is a human subject.

[0359] In some embodiments, a composition (e.g., an RNA vaccine) is administered to a subject (e.g., a mammalian subject such as a human subject) in an amount effective to induce an antigen-specific immune response. RNA encoding the coronavirus antigen is expressed and translated in vivo to produce the antigen, which then stimulates an immune response in the subject.

[0360] Prophylactic protection from coronavirus may be achieved after administration of the compositions of this disclosure. The immunizing composition may be administered once, twice, three times, four times, or more times, but a single dose of vaccine may be sufficient (optionally followed by one booster immunization). Although not desirable, it is also possible to achieve a therapeutic response by administering the composition to an infected individual. Dosage settings may need to be adjusted as appropriate.

[0361] Methods for inducing an immune response in a subject to a coronavirus antigen (or multiple antigens) are provided in aspects of this disclosure. In some embodiments, the method comprises administering to a subject a composition comprising one mRNA having an open reading frame encoding one coronavirus antigen, thereby inducing a coronavirus antigen-specific immune response in the subject, such that the anti-antigen antibody titer in the subject increases after vaccination to a level greater than that in a subject vaccinated with a prophylactic effective dose of a conventional vaccine against that antigen. "Anti-antigen antibody" is a serum antibody that specifically binds to an antigen.

[0362] The effective prophylactic dose is the dose that effectively prevents viral infection at a clinically acceptable level. In some embodiments, the effective dose is the dose listed in the vaccine's package insert. As used herein, conventional vaccines refer to vaccines other than the mRNA vaccines of this disclosure. Examples of conventional vaccines include, but are not limited to, live microbial vaccines, inactivated microbial vaccines, subunit vaccines, protein antigen vaccines, DNA vaccines, and virus-like particle (VLP) vaccines. In exemplary embodiments, a conventional vaccine is a vaccine that has achieved regulatory approval and / or is registered with a national drug regulatory agency (e.g., the U.S. Food and Drug Administration (FDA) or the European Medicines Agency (EMA)).

[0363] In some embodiments, the anti-antigen antibody titer in a subject is 1 log to 10 log higher after vaccination than the anti-antigen antibody titer in a subject vaccinated with a prophylactic effective dose of a conventional vaccine against coronavirus or in an unvaccinated subject. In some embodiments, the anti-antigen antibody titer in a subject is 1 log, 2 log, 3 log, 4 log, 5 log, or 10 log higher after vaccination than the anti-antigen antibody titer in a subject vaccinated with a prophylactic effective dose of a conventional vaccine against coronavirus or in an unvaccinated subject.

[0364] A method for inducing an immune response to coronavirus in a subject is provided in other aspects of this disclosure. The method comprises administering a subject a composition comprising mRNA containing an open reading frame encoding a coronavirus antigen, thereby inducing a coronavirus-specific immune response in the subject, the immune response in which the subject is equivalent to the immune response in a subject vaccinated with a conventional coronavirus vaccine at a drug dose level of 2 to 100 times that of the composition.

[0365] In some embodiments, the immune response in a subject is equivalent to the immune response in a subject administered with a conventional vaccine at twice the dosage level of the composition of the disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject administered with a conventional vaccine at three times the dosage level of the composition of the disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject administered with a conventional vaccine at four, five, ten, fifty, or 100 times the dosage level of the composition of the disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject administered with a conventional vaccine at 10 to 1000 times the dosage level of the composition of the disclosure. In some embodiments, the immune response in a subject is equivalent to the immune response in a subject administered with a conventional vaccine at 100 to 1000 times the dosage level of the composition of the disclosure.

[0366] In other embodiments, the immune response is assessed by determining the titer of [protein] antibodies in the subject. In other embodiments, the ability of serum or antibodies derived from an immunized subject is tested for its ability to neutralize viral uptake or reduce coronavirus transformation of human B lymphocytes. In other embodiments, the ability to promote a robust T cell response is measured using techniques recognized in the art.

[0367] Other aspects of the present disclosure provide a method for eliciting an immune response to coronavirus in a subject by administering a composition comprising mRNA having an open reading frame encoding a coronavirus antigen to the subject, thereby inducing a coronavirus antigen-specific immune response in the subject, which is induced 2 days to 10 weeks earlier than the immune response induced in a subject vaccinated with a prophylactic effective dose of a conventional vaccine against coronavirus. In some embodiments, the immune response in the subject is induced in a subject vaccinated with a prophylactic effective dose of a conventional vaccine at a drug dose level 2 to 100 times that of the composition of the present disclosure.

[0368] In some embodiments, the immune response in the subjects is induced 2, 3, 1, 2, 3, 5, or 10 weeks earlier than the immune response induced in subjects vaccinated with a prophylactic effective dose of a conventional vaccine.

[0369] Furthermore, this specification provides a method for inducing an immune response in a target to coronavirus by administering mRNA having an open reading frame encoding a first antigen, wherein the RNA does not contain stabilizing elements and the adjuvant is not formulated or administered concurrently with the vaccine.

[0370] The composition may be administered via any route that yields a therapeutically effective outcome. Such routes include, but are not limited to, intradermal, intramuscular, intranasal, and / or subcutaneous administration. This disclosure provides a method for administering an RNA vaccine to a subject in need. The exact amount required will vary from subject to subject depending on the subject's race, age, and general condition, the severity of the disease, the specific composition, its mode of administration, its mode of activity, etc. RNA is typically formulated in unit dosage forms for ease of administration and uniformity of drug dose. However, it will be understood that the total daily dose of RNA may be determined by the attending physician within reasonable medical judgment. The specific therapeutic effective dose level, prophylactic effective dose level, or appropriate imaging dose level for any particular patient will depend on a variety of factors, including the disorder being treated, the severity of the disorder, the activity of the specific compound used, the specific composition used, the patient's age, weight, overall health, sex, and diet, the timing of administration, route of administration, and excretion rate of the specific compound used, the duration of treatment, drugs used in combination with or concurrently with the specific compound used, and similar factors well known in the medical field.

[0371] As provided herein, the effective dose of RNA can be as low as about 20 μg, administered as a single dose or two 10 μg doses. In some embodiments, the effective dose is a total dose of 20 μg to 300 μg or 25 μg to 300 μg. For example, the effective dose may be a total dose of 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 250 μg, or 300 μg. In some embodiments, the effective dose is a total dose of 20 μg. In some embodiments, the effective dose is a total dose of 25 μg. In some embodiments, the effective dose is a total dose of 50 μg. In some embodiments, the effective dose is a total dose of 75 μg. In some embodiments, the effective dose is a total dose of 100 μg. In some embodiments, the effective dose is a total dose of 150 μg. In some embodiments, the effective dose is a total dose of 200 μg. In some embodiments, the effective dose is a total dose of 250 μg. In some embodiments, the effective dose is a total dose of 300 μg.

[0372] The RNAs described herein may be formulated in the dosage forms described herein, for example, intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreous, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous).

[0373] Vaccine effectiveness Some aspects of this disclosure provide formulations of compositions (e.g., RNA vaccines) in which RNA is formulated in an amount effective to induce an antigen-specific immune response (e.g., production of antibodies specific to coronavirus antigens) in a subject. “Effective amount” means the dose of RNA effective to induce an antigen-specific immune response. This specification also provides methods for inducing an antigen-specific immune response in a subject.

[0374] As used herein, an immune response to a vaccine or LNP in this disclosure refers to the occurrence of a humoral and / or cellular immune response in a subject to one or more coronavirus proteins present in the vaccine. For the purposes of this disclosure, a “humoral” immune response refers to an immune response mediated by antibody molecules (e.g., including secretory (IgA) or IgG molecules), while a “cellular” immune response refers to an immune response mediated by T lymphocytes (e.g., CD4+ helper and / or CD8+ T cells (e.g., CTLs) and / or other leukocytes). One important aspect of cellular immunity involves antigen-specific responses by cytolytic T cells (CTLs). CTLs are specific to peptide antigens expressed on the cell surface, presented with proteins encoded by major histocompatibility complexes (MHCs). CTLs help induce and promote the destruction of intracellular microorganisms or the lysis of cells infected with such microorganisms. Another aspect of cellular immunity involves antigen-specific responses by helper T cells. Helper T cells stimulate the function of nonspecific effector cells against cells that present peptide antigens along with MHC molecules on their surface, helping to focus their activity. The cellular immune response also triggers the production of cytokines, chemokines, and other such molecules produced by activated T cells and / or other leukocytes (including those derived from CD4+ and CD8+ T cells).

[0375] In some embodiments, antigen-specific immune responses are characterized by measuring the anti-coronavirus antigen antibody titer produced in subjects administered with the compositions provided herein. Antibody titer is a measure of the amount of antibodies present in a subject, e.g., antibodies specific to a particular antigen or the epitope of an antigen. Antibody titer is typically expressed as the reciprocal of the maximum dilution that yields a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for quantifying antibody titer.

[0376] Various serological tests can be used to measure antibodies against the encoded antigen of interest, e.g., SAR-CoV-2 virus or SAR-CoV-2 virus antigen, e.g., SAR-CoV-2 spike or S protein (of its domain). These tests include hemagglutination inhibition tests, complement fixation tests, immunofluorescence tests, enzyme-linked immunosorbent assays (ELISA), and plaque reduction neutralization tests (PRNTs). Each of these tests measures different antibody activities. In exemplary embodiments, a plaque reduction neutralization test, or PRNT (e.g., PRNT50 or PRNT90), is used as a serological correlate of protection. PRNTs measure the biological parameters of in vitro virus neutralization and are the most serologically virus-specific tests among a particular class of viruses, correlating well with sera levels of protection from viral infection.

[0377] The basic design of PRNT allows for virus-antibody interaction in a test tube or microtiter plate, thereby measuring the effect of antibodies on viral infectivity by plating the mixture onto virus-susceptible cells, preferably mammalian cells. The cells are covered with a semi-solid medium that restricts the transmission of progeny viruses. Each virus that initiates a productive infection generates localized infection areas (plaques) that can be detected in various ways. The plaques are counted and compared back to the initial viral concentration to determine the percentage decrease in the total viral infectivity. In PRNT, the serum sample to be tested is typically serially diluted before being mixed with a standardized amount of virus. Because the viral concentration is kept constant, individual plaques can be identified and counted when added to susceptible cells and covered with semi-solid medium. In this way, the PRNT endpoint titer can be calculated for each serum sample at any selected percentage decrease in viral activity.

[0378] In functional assays aimed at evaluating the immunogenicity of vaccines, the serum sample dilution series for antibody titration should ideally begin below the “serum protection” threshold titer. For SARS-CoV-2 neutralizing antibodies, the “serum protection” threshold titer remains unknown. However, a serologically positive threshold of 1:10 can be considered a serum protection threshold in certain embodiments.

[0379] The PRNT endpoint titer is expressed as the reciprocal of the last serum dilution that shows the desired percentage reduction in plaque number. The PRNT titer can be calculated based on a reduction of 50% or more in plaque number (PRNT50). The PRNT50 titer is preferred over titers that use a higher cutoff (e.g., PRNT90) for vaccine serum, as it provides more accurate results from the linear portion of the titration curve.

[0380] There are several methods for calculating PRNT titer. The simplest and most widely used method for calculating titer is to count the plaques and report the titer as the reciprocal of the last serum dilution, indicating a reduction of more than 50% in the number of input plaques based on back titration of the input plaques. Using curve fitting methods from several serum dilutions may yield more accurate results. There are various computer analysis programs available for this (e.g., SPSS or GraphPad Prism).

[0381] In some embodiments, antibody titers are used to assess whether a subject has contracted an infection or to determine whether immunization is necessary. In some embodiments, antibody titers are used to quantify the strength of an autoimmune response, to determine whether booster immunization is necessary, to determine whether a previous vaccine was effective, and to confirm a recent or past infection. According to this disclosure, antibody titers may be used to quantify the strength of an immune response induced in a subject by a composition (e.g., an RNA vaccine).

[0382] In some embodiments, the anti-coronavirus antigen antibody titer produced in the subject is increased by at least 1 log compared to the control. For example, the anti-coronavirus antigen antibody titer produced in the subject may be increased by at least 1.5, at least 2, at least 2.5, or at least 3 log compared to the control. In some embodiments, the anti-coronavirus antigen antibody titer produced in the subject is increased by 1, 1.5, 2, 2.5, or 3 log compared to the control. In some embodiments, the anti-coronavirus antigen antibody titer produced in the subject is increased by 1 to 3 log compared to the control. For example, the anti-coronavirus antigen antibody titer produced in the subject may be increased by 1 to 1.5, 1 to 2, 1 to 2.5, 1 to 3, 1.5 to 2, 1.5 to 2.5, 1.5 to 3, 2 to 2.5, 2 to 3, or 2.5 to 3 log compared to the control.

[0383] In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by at least twofold compared to a control. For example, the anti-coronavirus antigen antibody titer produced in a subject may be increased by at least threefold, at least fourfold, at least fivefold, at least sixfold, at least sevenfold, at least eightfold, at least ninefold, or at least tenfold compared to a control. In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by 2, 3, 4, 5, 6, 7, 8, 9, or tenfold compared to a control. In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by 2 to 10fold compared to a control. For example, the anti-coronavirus antigen antibody titer produced in a subject may be increased by 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9, or 9-10 times compared to a control.

[0384] In some embodiments, the antigen-specific immune response is measured as the ratio of geometric mean titers (GMTs) of serum neutralizing antibody titers against coronavirus (referred to as the geometric mean ratio (GMR)). The geometric mean titer (GMT) is the average antibody titer in a group of subjects, calculated by multiplying all values ​​and taking the nth root of that number (where n is the number of subjects for which data is available).

[0385] In some embodiments, the control is the anti-coronavirus antigen antibody titer produced in subjects not administered with the composition (e.g., an RNA vaccine). In some embodiments, the control is the anti-coronavirus antigen antibody titer produced in subjects administered with a recombinant or purified protein vaccine. Recombinant protein vaccines typically contain protein antigens produced in heterologous expression systems (e.g., bacteria or yeast) or purified from large quantities of pathogenic organisms.

[0386] In some embodiments, the efficacy of a composition (e.g., an RNA vaccine) is measured in a mouse model. For example, the composition may be administered to a mouse model, and the mouse model may be evaluated for induction of neutralizing antibody titers. Viral challenge studies may also be used to evaluate the efficacy of the vaccines of this disclosure. For example, the composition may be administered to a mouse model, the mouse model may be challenged with a virus, and the mouse model may be evaluated for survival and / or immune response (e.g., neutralizing antibody response, T cell response (e.g., cytokine response)).

[0387] In some embodiments, the effective dose of a composition (e.g., an RNA vaccine) is a reduced dose compared to the standard therapeutic dose of a recombinant protein vaccine. As used herein, “standard treatment” refers to medical or psychological treatment guidelines, which may be general or specific. “Standard treatment” defines evidence-based appropriate treatment and cooperation among healthcare professionals involved in the treatment of a given condition. It is a diagnostic and treatment process that a physician / clinician should follow for a particular type of patient, disease, and clinical situation. As used herein, “standard therapeutic dose” refers to the dose of a recombinant or purified protein vaccine, or an attenuated live or inactivated vaccine, or a VLP vaccine, administered to a subject to treat or prevent coronavirus infection or a related condition, in accordance with standard treatment guidelines for treating or preventing coronavirus infection or a related condition.

[0388] In some embodiments, the anti-coronavirus antigen antibody titer produced in subjects administered an effective amount of the composition is equivalent to the anti-coronavirus antigen antibody titer produced in control subjects administered a standard therapeutic dose of recombinant or purified protein vaccine, or attenuated live or inactivated vaccine, or VLP vaccine.

[0389] Vaccine efficacy can be evaluated using standard analyses (see, for example, Weinberg et al., J Infect Dis. 2010 Jun 1;201(11):1607-10). For example, vaccine efficacy can be measured in a double-blind, randomized, controlled clinical trial. Vaccine efficacy may also be expressed as a proportional reduction in disease incidence (AR) between the incidence rate (ARU) of the unvaccinated trial cohort and the incidence rate (ARV) of the vaccinated trial cohort, and can be calculated from the relative risk (RR) of the disease in the vaccinated group using the following formula. Effectiveness = (ARU - ARV) / ARU × 100; and Effectiveness = (1 - RR) × 100

[0390] Similarly, vaccine efficacy can be evaluated using standardized analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun 1;201(11):1607-10). Vaccine efficacy assesses how a vaccine (which may already be known to have high efficacy) reduces disease in a population. This measure can assess the essential balance of benefits and adverse effects of a vaccination program, not just the vaccine itself, under natural field conditions rather than controlled clinical trials. Vaccine efficacy is proportional to the effectiveness (potency) of the vaccine, but is also influenced by the degree of immunization of the target group within the population and by vaccine-independent factors that affect "real-world" outcomes (e.g., hospitalization, outpatient visits, or costs). For example, retrospective case-control analyses may be used to compare vaccination rates in a set of infection cases and appropriate controls. Vaccine efficacy can be expressed as a difference in proportions by using the odds ratio (OR) for developing an infection despite vaccination. Effectiveness = (1 - OR) × 100

[0391] In some embodiments, the efficacy of the composition (e.g., an RNA vaccine) is at least 60% compared to an unvaccinated control subject. For example, the efficacy of the composition may be at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 95%, at least 98%, or 100% compared to an unvaccinated control subject.

[0392] Bactericidal immunity. Bactericidal immunity refers to an intrinsic immune state that prevents effective pathogen infection of a host. In some embodiments, an effective amount of the composition of the Disclosure is sufficient to induce bactericidal immunity in a subject for at least one year. For example, an effective amount of the composition of the Disclosure is sufficient to induce bactericidal immunity in a subject for at least two years, at least three years, at least four years, or at least five years. In some embodiments, an effective amount of the composition of the Disclosure is sufficient to induce bactericidal immunity in a subject at a dose at least five times lower than that of a control. For example, an effective amount may be sufficient to induce bactericidal immunity in a subject at a dose at least 10 times, 15 times, or 20 times lower than that of a control.

[0393] Detectable antigen. In some embodiments, an effective amount of the composition of the present disclosure is sufficient to produce a detectable level of coronavirus antigen in a measurement in the serum of a subject 1 to 72 hours after administration.

[0394] Antibody titer. Antibody titer is a measure of the amount of antibodies in a subject, for example, antibodies specific to a particular antigen (e.g., anti-coronavirus antigen). Antibody titer is typically expressed as the reciprocal of the maximum dilution that yields a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for quantifying antibody titer.

[0395] In some embodiments, an effective amount of the composition of the present disclosure is sufficient to produce a neutralizing antibody titer of 1,000 to 10,000 produced by neutralizing antibodies against the coronavirus antigen, as measured in the serum of a subject 1 to 72 hours after administration. In some embodiments, an effective amount is sufficient to produce a neutralizing antibody titer of 1,000 to 5,000 produced by neutralizing antibodies against the coronavirus antigen, as measured in the serum of a subject 1 to 72 hours after administration. In some embodiments, an effective amount is sufficient to produce a neutralizing antibody titer of 5,000 to 10,000 produced by neutralizing antibodies against the coronavirus antigen, as measured in the serum of a subject 1 to 72 hours after administration.

[0396] In some embodiments, the neutralizing antibody titer is at least 100 NT. 50 For example, the neutralizing antibody titer should be at least 200, 300, 400, 500, 600, 700, 800, 900, or 1000 NT. 50 This may be the case. In some embodiments, the neutralizing antibody titer is at least 10,000 NT. 50 That is the case.

[0397] In some embodiments, the neutralizing antibody titer is at least 100 neutralizing units / milliliter (NU / mL). For example, the neutralizing antibody titer may be at least 200, 300, 400, 500, 600, 700, 800, 900, or 1000 NU / mL. In some embodiments, the neutralizing antibody titer is at least 10,000 NU / mL.

[0398] In some embodiments, the anti-coronavirus antigen antibody titer produced in a subject is increased by at least 1 log compared to a control. For example, the anti-coronavirus antigen antibody titer produced in a subject may be increased by at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 log compared to a control.

[0399] In some embodiments, the anti-coronavirus antigen antibody titer produced in the subject is increased by at least twofold compared to the control. For example, the anti-coronavirus antigen antibody titer produced in the subject is increased by at least three, four, five, six, seven, eight, nine, or tenfold compared to the control.

[0400] In some embodiments, the geometric mean, which is the nth root of the product of n numbers, is commonly used to describe proportional growth. In some embodiments, the geometric mean is used to characterize the antibody titer produced in a subject.

[0401] The control group may, for example, be an unvaccinated subject, or a subject that has been administered a live attenuated virus vaccine, an inactivated virus vaccine, or a protein subunit vaccine.

[0402] Further embodiments Further embodiments of the disclosure are included in the following numbered paragraphs:

[0403] 1. Messenger ribonucleic acid (mRNA) containing an open reading frame encoding a fusion protein that includes the receptor-binding domain (RBD) and transmembrane domain of the SARS-CoV-2 spike protein.

[0404] 2. The mRNA described in paragraph 1, wherein the protein transmembrane domain is the influenza hemagglutinin transmembrane domain.

[0405] 3. The mRNA described in paragraph 2, wherein the fusion protein comprises an amino acid sequence having at least 80% identity with the amino acid sequence of SEQ ID NO: 77.

[0406] 4. The mRNA according to paragraph 3, wherein the fusion protein comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 77.

[0407] 5. The mRNA described in paragraph 4, wherein the fusion protein contains the amino acid sequence of SEQ ID NO: 77.

[0408] 6. The mRNA described in any one of the preceding paragraphs, wherein the open reading frame contains a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 76.

[0409] 7. The mRNA according to paragraph 6, wherein the open reading frame contains a nucleotide sequence having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 76.

[0410] 8. The mRNA described in paragraph 7, wherein the open reading frame contains the nucleotide sequence of SEQ ID NO: 76.

[0411] 9. Messenger ribonucleic acid (mRNA) containing an open reading frame encoding a fusion protein including the amino(N)-terminal domain and transmembrane domain of the SARS-CoV-2 spike protein.

[0412] 10. The mRNA described in paragraph 9, wherein the transmembrane domain is an influenza hemagglutinin transmembrane domain.

[0413] 11. The mRNA described in paragraph 10, wherein the fusion protein comprises an amino acid sequence having at least 80% identity with the amino acid sequence of SEQ ID NO: 47.

[0414] 12. The mRNA according to paragraph 11, wherein the fusion protein comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 47.

[0415] 13. The mRNA described in paragraph 12, wherein the fusion protein contains the amino acid sequence of SEQ ID NO: 47.

[0416] 14. The mRNA described in any one of the preceding paragraphs, wherein the open reading frame contains a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 46.

[0417] 15. The mRNA according to paragraph 14, wherein the open reading frame contains a nucleotide sequence having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 46.

[0418] 16. The mRNA described in paragraph 15, wherein the open reading frame contains the nucleotide sequence of SEQ ID NO: 46.

[0419] 17. Messenger ribonucleic acid (mRNA) containing an open reading frame encoding a fusion protein that includes the amino(N)-terminal domain of the SARS-CoV-2 spike protein ligated to the receptor-binding domain of the SARS-CoV-2 spike protein.

[0420] 18. The mRNA described in paragraph 17, wherein the fusion protein further comprises a transmembrane domain.

[0421] 19. The mRNA described in paragraph 18, wherein the fusion protein comprises an amino acid sequence having at least 80% identity with the amino acid sequence of SEQ ID NO: 92.

[0422] 20. The mRNA according to paragraph 18, wherein the fusion protein comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 92.

[0423] 21. The mRNA described in paragraph 20, wherein the fusion protein contains the amino acid sequence of SEQ ID NO: 92.

[0424] 22. The mRNA described in any one of the preceding paragraphs, wherein the open reading frame contains a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 91.

[0425] 23. The mRNA according to paragraph 22, wherein the open reading frame contains a nucleotide sequence having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 91.

[0426] 24. The mRNA described in paragraph 23, wherein the open reading frame contains the nucleotide sequence of SEQ ID NO: 91.

[0427] The mRNA described in either of the preceding paragraphs, further including the 25.5' untranslated region (UTR) and optionally including the nucleotide sequence of SEQ ID NO: 131 or 132.

[0428] 26. mRNA as described in either of the preceding paragraphs, further comprising a 3' translation region (UTR) which optionally includes the nucleotide sequence described in SEQ ID NO: 132 or 4.

[0429] mRNA described in any one of the preceding paragraphs, with a 27.5' cap and optionally further containing 7mG(5')ppp(5')NlmpNp.

[0430] 28. mRNA as described in any one of the preceding paragraphs, further comprising, optionally, a poly-A tail having a length of approximately 100 nucleotides.

[0431] 29. The mRNA described in any one of the preceding paragraphs, wherein the mRNA is chemically modified and optionally contains 1-methylpseudolidine.

[0432] 30. A composition comprising the mRNA described in any one of paragraphs 1 to 29.

[0433] 31. A composition comprising the mRNA described in any one of paragraphs 1 to 8 and the mRNA described in any one of paragraphs 9 to 16.

[0434] 32. A composition comprising the mRNA described in any one of paragraphs 17 to 29.

[0435] 33. A composition, (a) Messenger ribonucleic acid (mRNA) containing an open reading frame encoding a fusion protein including the receptor-binding domain (RBD) and transmembrane domain of the SARS-CoV-2 spike protein, (b) The composition comprising an mRNA containing an open reading frame encoding a fusion protein including the amino(N) terminal domain and transmembrane domain of the SARS-CoV-2 spike protein.

[0436] 34. The composition according to paragraph 33, wherein the protein transmembrane domain is an influenza hemagglutinin transmembrane domain.

[0437] 35. The composition according to paragraph 34, wherein the fusion protein of (a) comprises an amino acid sequence having at least 80% identity with the amino acid sequence of SEQ ID NO: 77.

[0438] 36. The composition according to paragraph 35, wherein the fusion protein of (a) comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the amino acid sequence of Sequence ID No. 77.

[0439] 37. The composition according to paragraph 36, wherein the fusion protein of (a) comprises the amino acid sequence of SEQ ID NO: 77.

[0440] 38. The composition according to any one of claims 34 to 37, wherein the open reading frame of (a) comprises a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 76.

[0441] 39. The composition according to paragraph 38, wherein the open reading frame of (a) comprises a nucleotide sequence having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of Sequence ID No. 76.

[0442] 40. The composition according to paragraph 39, wherein the open reading frame of (a) comprises the nucleotide sequence of SEQ ID NO: 76.

[0443] 41. The composition according to any one of paragraphs 34 to 40, wherein the fusion protein of (b) comprises an amino acid sequence having at least 80% identity with the amino acid sequence of SEQ ID NO: 47.

[0444] 42. The composition according to paragraph 41, wherein the fusion protein of (b) comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 47.

[0445] 43. The composition according to paragraph 42, wherein the fusion protein of (b) comprises the amino acid sequence of SEQ ID NO: 47.

[0446] 44. The composition according to any one of claims 34 to 43, wherein the open reading frame of (b) comprises a nucleotide sequence having at least 70% identity with the nucleotide sequence of SEQ ID NO: 46.

[0447] 45. The composition according to paragraph 44, wherein the open reading frame of (b) comprises a nucleotide sequence having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 46.

[0448] 46. ​​The composition according to paragraph 45, wherein the open reading frame of (b) comprises the nucleotide sequence of SEQ ID NO: 46.

[0449] 47. The composition according to any one of paragraphs 33 to 46, wherein the ratio of mRNA (a) to mRNA (b) is approximately 1:1.

[0450] 48. mRNA described in any one of paragraphs 1 to 29, formulated in lipid nanoparticles.

[0451] 49. The composition according to any one of paragraphs 30 to 47, further comprising lipid nanoparticles.

[0452] 50. The composition according to paragraph 49, wherein the mRNA is formulated in lipid nanoparticles.

[0453] 51. The composition according to any one of paragraphs 33 to 47, wherein the mRNA of (a) is formulated in lipid nanoparticles and the mRNA of (b) is formulated in lipid nanoparticles.

[0454] 52. The composition according to paragraph 51, wherein the mRNAs of (a) and (b) are contained within the same lipid nanoparticle, or the mRNAs of (a) and (b) are formulated in separate nanoparticles.

[0455] 53. The composition according to paragraph 48 or any one of paragraphs 49 to 52, wherein the lipid nanoparticles include cationic lipids.

[0456] 54. The mRNA or composition according to paragraph 53, wherein the lipid nanoparticles further comprise neutral lipids.

[0457] 55. The mRNA or composition according to paragraph 53 or 54, wherein the lipid nanoparticles further comprise sterols.

[0458] 56. The mRNA or composition according to any one of paragraphs 53 to 55, wherein the lipid nanoparticles further comprise polyethylene glycol (PEG) modified lipids.

[0459] 57. The mRNA or composition according to any one of paragraphs 53 to 56, wherein the lipid nanoparticles comprise ionizable cationic lipids, neutral lipids, sterols, and PEG-modified lipids.

[0460] 58. The mRNA or composition according to paragraph 57, wherein the ionizable cationic lipid is heptadecan-9-yl 8((2-hydroxyethyl)(6-oxo6-(undecyloxy)hexyl)amino)octanoate (compound 1).

[0461] 59. The mRNA or composition according to paragraph 57 or 58, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0462] 60. mRNA or composition according to any one of paragraphs 57 to 59, wherein the sterol is cholesterol.

[0463] 61. The mRNA or composition according to any one of paragraphs 57 to 60, wherein the PEG-modified lipid is 1,2-dimiristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG).

[0464] 62. The mRNA or composition according to any one of paragraphs 57 to 61, wherein the lipid nanoparticles comprise 20 to 60 mol% of ionizable cationic lipids, 5 to 25 mol% of neutral lipids, 25 to 55 mol% of sterols, and 0.5 to 15 mol% of PEG-modified lipids.

[0465] 63. mRNA or composition as described in paragraph 62, wherein the lipid nanoparticles are as follows: 47 mol% ionizable cationic lipids; 11.5 mol% neutral lipids; 38.5 mol% sterols; and 3.0 mol% PEG-modified lipids; 48 mol% ionizable cationic lipids; 11 mol% neutral lipids; 38.5 mol% sterols; and 2.5 mol% PEG-modified lipids; 49 mol% ionizable cationic lipids; 10.5 mol% neutral lipids; 38.5 mol% sterols; and 2.0 mol% PEG-modified lipids; 50 mol% ionizable cationic lipids; 10 mol% neutral lipids; 38.5 mol% sterols; and 1.5 mol% PEG-modified lipids; or The mRNA or composition comprising 51 mol% ionizable cationic lipid; 9.5 mol% neutral lipid; 38.5 mol% sterol; and 1.0 mol% PEG-modified lipid.

[0466] 64. mRNA or composition as described in paragraph 63, wherein the lipid nanoparticles are as follows: 47 mol% of Compound 1; 11.5 mol% of DSPC; 38.5 mol% of cholesterol; and 3.0 mol% of PEG2000 DMG; 48 mol% of compound 1; 11 mol% of DSPC; 38.5 mol% of cholesterol; and 2.5 mol% of PEG2000 DMG; 49 mol% of compound 1; 10.5 mol% of DSPC; 38.5 mol% of cholesterol; and 2.0 mol% of PEG2000 DMG; 50 mol% compound 1; 10 mol% DSPC; 38.5 mol% cholesterol; and 1.5 mol% PEG2000 DMG; or The mRNA or composition comprising 51 mol% of compound 1; 9.5 mol% of DSPC; 38.5 mol% of cholesterol; and 1.0 mol% of PEG2000 DMG.

[0467] 65. A method comprising administering to a subject an amount of mRNA or composition described in any one of the preceding paragraphs that is effective in inducing a neutralizing antibody response to SARS-CoV-2 in the subject.

[0468] 66. A method comprising administering to a subject an amount of the mRNA or composition described in any one of the preceding paragraphs that is effective in inducing a T cell immune response to SARS-CoV-2 in the subject.

[0469] 67. Messenger ribonucleic acid (mRNA) comprising an open reading frame (ORF) encoding a coronavirus antigen capable of inducing an immune response, such as a neutralizing antibody response, against SARS-CoV-2, wherein the antigen comprises a protein fragment or a functional protein domain of SARS-CoV-2, and optionally, the RNA is formulated in lipid nanoparticles.

[0470] 68. The mRNA described in paragraph 67, wherein the antigen is a functional protein domain.

[0471] 69. The mRNA described in paragraph 68, wherein the protein domain is the N-terminal domain (NTD) of the SARS-CoV-2 spike protein.

[0472] 70. The mRNA described in paragraph 69, wherein the NTD is linked to a transmembrane domain, and optionally to an influenza hemagglutinin transmembrane domain.

[0473] 71. The mRNA described in paragraph 70, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 47, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 47.

[0474] 72. The mRNA according to paragraph 70 or 71, wherein the open reading frame includes a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 46, and optionally the open reading frame includes the nucleotide sequence of SEQ ID NO: 46.

[0475] 73. The mRNA described in paragraph 68, wherein the protein domain is the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein.

[0476] 74. The mRNA described in paragraph 73, wherein the RBD is soluble.

[0477] 75. The mRNA described in paragraph 74, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 62, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 62.

[0478] 76. The mRNA according to paragraph 74 or 75, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 61, and optionally the open reading frame contains the nucleotide sequence of SEQ ID NO: 61.

[0479] 77. The mRNA described in paragraph 73, wherein the RBD is linked to a transmembrane domain, and optionally to an influenza hemagglutinin transmembrane domain.

[0480] 78. The mRNA according to paragraph 77, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 77, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 77.

[0481] 79. The mRNA according to paragraph 77 or 78, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 76, and optionally the open reading frame contains the nucleotide sequence of SEQ ID NO: 76.

[0482] 80. The mRNA described in paragraph 69, wherein the NTD is linked to the RBD of the SARS-CoV-2 spike protein to form an NTD-RBD fusion protein.

[0483] 81. The mRNA described in paragraph 80, wherein the NTD-RBD fusion is linked to a transmembrane domain (TM), optionally to an influenza hemagglutinin transmembrane domain, to form an NTD-RBD-TM protein.

[0484] 82. The mRNA described in paragraph 81, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 92, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 92.

[0485] 83. The mRNA according to paragraph 81 or 82, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 91, and optionally the open reading frame contains the nucleotide sequence of SEQ ID NO: 91.

[0486] 84. The mRNA described in paragraph 80, wherein the NTD-RBD fusion includes a C-terminal shortening.

[0487] 85. The mRNA described in paragraph 84, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 107, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 107.

[0488] 86. The mRNA according to paragraph 84 or 85, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 106, and optionally the open reading frame contains the nucleotide sequence of SEQ ID NO: 106.

[0489] 87. The mRNA described in any one of the preceding paragraphs, wherein the NTD and / or RBD include an extended region.

[0490] 88. The mRNA according to paragraph 87, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any one of the amino acid sequences of SEQ ID NOs. 59, 86, 89, 116, 119, or 122, and optionally, the antigen comprises any one of the amino acid sequences of SEQ ID NOs. 59, 86, 89, 116, 119, or 122.

[0491] 89. The mRNA according to paragraph 87 or 88, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to any one nucleotide sequence of sequence numbers 58, 85, 88, 115, 118, or 121, and optionally, the open reading frame contains any one nucleotide sequence of sequence numbers 58, 85, 88, 115, 118, or 121.

[0492] 90. The mRNA described in paragraph 68, wherein the protein domain is the S1 subunit domain of the SARS-CoV-2 spike protein.

[0493] 91. The mRNA described in paragraph 90, wherein the S1 subunit is soluble.

[0494] 92. The mRNA described in paragraph 91, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 5, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 5.

[0495] 93. The mRNA according to paragraph 91 or 92, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 3, and optionally the open reading frame contains the nucleotide sequence of SEQ ID NO: 3.

[0496] 94. The mRNA described in paragraph 90, wherein the S1 subunit is linked to a transmembrane domain, or optionally to an influenza hemagglutinin transmembrane domain.

[0497] 95. The mRNA described in paragraph 94, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 17, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 17.

[0498] 96. The mRNA according to paragraph 94 or 95, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 16, and optionally the open reading frame contains the nucleotide sequence of SEQ ID NO: 16.

[0499] 97. The mRNA according to paragraph 90, wherein the S1 subunit is modified to remove the RBD or a portion of the RBD of the S protein.

[0500] 98. The mRNA according to paragraph 97, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any one of the amino acid sequences of SEQ ID NOs. 20, 23, 26, 29, 32, or 35, and optionally, the antigen comprises any one of the amino acid sequences of SEQ ID NOs. 20, 23, 26, 29, 32, or 35.

[0501] 99. The mRNA according to paragraph 97 or 98, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to any one nucleotide sequence of SEQ ID NOs: 19, 22, 25, 28, 31, or 34, and optionally, the open reading frame contains any one nucleotide sequence of SEQ ID NOs: 19, 22, 25, 28, 31, or 34.

[0502] 100. The mRNA described in paragraph 90, wherein the S1 subunit is ligated to the S2 subunit of the S protein.

[0503] 101. The mRNA according to paragraph 100, wherein the S2 subunit is derived from the SARS-CoV-2S protein, and in some embodiments, the S2 subunit comprises an open reading frame comprising a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence of SEQ ID NO: 145, and optionally, the open reading frame comprises the nucleotide sequence of SEQ ID NO: 145.

[0504] 102. The mRNA described in paragraph 101, wherein the S1 subunit is derived from the HKU1 S protein.

[0505] 103. The mRNA described in paragraph 102, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 38, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 38.

[0506] 104. The mRNA according to paragraph 102 or 103, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 37, and optionally the open reading frame contains the nucleotide sequence of SEQ ID NO: 37.

[0507] 105. The mRNA described in paragraph 101, wherein the S1 subunit is derived from the OC43 protein.

[0508] 106. The mRNA according to paragraph 105, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 41, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 41.

[0509] 107. The mRNA according to paragraph 105 or 106, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 40, and optionally the open reading frame contains the nucleotide sequence of SEQ ID NO: 40.

[0510] 108. The mRNA described in any one of the preceding paragraphs, wherein the antigen further comprises a scaffold domain optionally selected from ferritin, lumazine synthetase, and foldon.

[0511] 109. The mRNA described in paragraph 108, wherein the scaffold domain is ferritin.

[0512] 110. The mRNA according to paragraph 109, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequence of SEQ ID NO: 8 or 65, and optionally, the antigen comprises the amino acid sequence of SEQ ID NO: 8 or 65.

[0513] 111. The mRNA according to paragraph 109 or 110, wherein the open reading frame comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to the nucleotide sequence of SEQ ID NO: 7 or 64, and optionally, the open reading frame comprises the nucleotide sequence of SEQ ID NO: 7 or 64.

[0514] 112. The mRNA described in paragraph 108, wherein the scaffold domain is a lumazine synthetase.

[0515] 113. The mRNA according to paragraph 112, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any one of the amino acid sequences of SEQ ID NOs. 11, 14, 68, or 71, and optionally, the antigen comprises any one of the amino acid sequences of SEQ ID NOs. 11, 14, 68, or 71.

[0516] 114. The mRNA according to paragraph 112 or 113, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to any one nucleotide sequence of SEQ ID NO: 10, 13, 67, or 70, and optionally, the open reading frame contains any one nucleotide sequence of SEQ ID NO: 10, 13, 67, or 70.

[0517] 115. The mRNA described in paragraph 108, wherein the scaffold domain is foldon.

[0518] 116. The mRNA according to paragraph 115, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any one of the amino acid sequences of SEQ ID NOs: 44, 50, 74, 80, 83, 101, 104, or 113, and optionally, the antigen comprises the amino acid sequence described in any one of SEQ ID NOs: 44, 50, 74, 80, 83, 101, 104, or 113.

[0519] 117. The mRNA described in either paragraph 115 or 116, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to any one nucleotide sequence of SEQ ID NOs. 43, 49, 73, 79, 82, 100, 103, or 112, and optionally, the open reading frame contains any one nucleotide sequence of SEQ ID NOs. 43, 49, 73, 79, 82, 100, 103, or 112.

[0520] 118. mRNA as described in any one of the preceding paragraphs, further comprising a transport signal, wherein the antigen is optionally selected from macrophage markers, optionally from CD86, CD11B and / or VSVGct.

[0521] 119. The mRNA according to paragraph 118, wherein the antigen comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with any one of the amino acid sequences of SEQ ID NOs. 95, 98, or 110, and optionally, the antigen comprises any one of the amino acid sequences of SEQ ID NOs. 95, 98, or 110.

[0522] 120. The mRNA according to either paragraph 118 or 119, wherein the open reading frame contains a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to any one nucleotide sequence of sequence number 94, 97, or 109, and optionally, the open reading frame contains any one nucleotide sequence of sequence number 94, 97, or 109.

[0523] 121. mRNA described in any one of paragraphs 67-120, formulated in lipid nanoparticles.

[0524] 122. The mRNA according to paragraph 121, wherein the lipid nanoparticles include cationic lipids, optionally ionizable cationic lipids, neutral lipids, sterols, and / or polyethylene glycol (PEG) modified lipids.

[0525] 123. The mRNA or composition according to paragraph 108, wherein the ionizable cationic lipid is heptadecan-9-yl 8((2-hydroxyethyl)(6-oxo6-(undecyloxy)hexyl)amino)octanoate (compound 1), the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol is cholesterol, and / or the PEG-modified lipid is 1,2-dimiristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG).

[0526] 124. mRNA or composition according to any one of paragraphs 121 to 123, wherein the lipid nanoparticles comprise 20 to 60 mol% of ionizable cationic lipids, 5 to 25 mol% of neutral lipids, 25 to 55 mol% of sterols, and 0.5 to 15 mol% of PEG-modified lipids.

[0527] 125. mRNA or composition as described in paragraph 124, wherein the lipid nanoparticles are as follows: 47 mol% ionizable cationic lipids; 11.5 mol% neutral lipids; 38.5 mol% sterols; and 3.0 mol% PEG-modified lipids; 48 mol% ionizable cationic lipids; 11 mol% neutral lipids; 38.5 mol% sterols; and 2.5 mol% PEG-modified lipids; 49 mol% ionizable cationic lipids; 10.5 mol% neutral lipids; 38.5 mol% sterols; and 2.0 mol% PEG-modified lipids. 50 mol% ionizable cationic lipids; 10 mol% neutral lipids; 38.5 mol% sterols; and 1.5 mol% PEG-modified lipids; or The mRNA or composition comprising 51 mol% ionizable cationic lipid; 9.5 mol% neutral lipid; 38.5 mol% sterol; and 1.0 mol% PEG-modified lipid.

[0528] 126. mRNA or composition as described in paragraph 125, wherein the lipid nanoparticles are as follows: 47 mol% of Compound 1; 11.5 mol% of DSPC; 38.5 mol% of cholesterol; and 3.0 mol% of PEG2000 DMG; 48 mol% of compound 1; 11 mol% of DSPC; 38.5 mol% of cholesterol; and 2.5 mol% of PEG2000 DMG; 49 mol% of compound 1; 10.5 mol% of DSPC; 38.5 mol% of cholesterol; and 2.0 mol% of PEG2000 DMG; 50 mol% compound 1; 10 mol% DSPC; 38.5 mol% cholesterol; and 1.5 mol% PEG2000 DMG; or The mRNA or composition comprising 51 mol% of compound 1; 9.5 mol% of DSPC; 38.5 mol% of cholesterol; and 1.0 mol% of PEG2000 DMG.

[0529] 127. A method comprising administering to a subject an amount of mRNA described in any one of paragraphs 67 to 126 that is effective in inducing a neutralizing antibody response to SARS-CoV-2 in the subject.

[0530] 128. A method comprising administering to a subject an amount of mRNA described in any one of paragraphs 67 to 126 that is effective in inducing a T cell immune response to SARS-CoV-2 in the subject. [Examples]

[0531] Example 1. Expression Data The mRNA used in this study was used to express the major neutralizing domains of the SARS-CoV-2 coronavirus spike (S) protein and to evaluate whether these neutralizing protein domains are more efficient at inducing protective immunity when used individually or in combination as immunogenic compositions or vaccines to protect people from infection by live, spreading, naturally occurring viruses. The linear designs of the proteins encoded by the mRNA are shown in Figure 2. All proteins also contain a carboxyl (C)-terminal transmembrane domain (TM) derived from influenza hemagglutinin (HA).

[0532] Both NTDs and RBDs are known to be binding sites for antibodies exhibiting neutralizing virus activity. In the case of SARS-CoV-2, the RBD is the receptor binding site of the spike protein and binds to angiotensin-converting enzyme 2 (ACE2). The function of the amino(N) terminal domain NTD is not fully understood, but it appears to play a role in binding the sugar moiety and promoting the higher-order structural change from the pre-fusion to the post-fusion higher-order structure of the spike protein. See Zhou H, Chen Y, Zhang S, et al. Nat Commun. 2019;10(1):3068. In any case, both the NTD domain and the RBD domain induce high-binding antibody and neutralizing antibody titers, as discussed below.

[0533] Expression data for the mRNA RBD-TM vaccine ("SARS-CoV-2 RBD-TM"; SEQ ID NOs. 75-77), mRNA NTD-TM vaccine ("SARS-CoV-2 NTD-TM"; SEQ ID NOs. 45-47), and mRNA NTD-RBD-TM ("SARS-CoV-1 NTD-RBD-TM"; SEQ ID NOs. 90-92) vaccines are shown in Tables 16 and 17, using antibodies specific to the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein (mAb1) and the N-terminal domain (NTD) of the SARS-CoV-2 spike protein (Ab2). Table 16 shows the mean multiple difference (across dilution ranges) in MFI*Freq compared to WT SARS-CoV-2 spike protein mRNA (Table 16) at 24 hours (hr), 48 hours, and 72 hours. [Table 31]

[0534] Example 2. Immunogenicity data and neutralization data 21 days after single administration. mRNA NTD-TM and mRNA RBD-TM (described in Example 1) were administered to mice in the following doses: 0.001 μg, 0.01 μg, 0.1 μg, or 1 μg (N=8). mRNA NTD-RBD-TM (described in Example 1) was administered to mice in the following doses: 0.1 μg or 1 μg (N=8). A 50:50 mixture of mRNANTD-TM and mRNA RBD-TM was administered to mice, containing 0.1 μg of each mRNA per 0.2 μg of total mRNA, or 1 μg of each mRNA per 2 μg of total mRNA (N=8). Next, SARS-CoV-2 spike protein-specific IgG titers (Table 17), SARS-CoV-2 RBD-specific IgG titers (Table 18), and SARS-CoV-2 NTD-specific IgG titers (Table 19) were measured by ELISA 21 days after vaccination. The data are shown in Tables 17-19. A 0.1 μg dose of mRNA NTD-RBD-TM and a 0.2 μg dose of mRNA NTD-TM in a 50:50 mixture of mRNA RBD-TM compositions induced observable NTD-specific and RBD-specific IgG titers, while 0.1 μg doses of RBD-TM and NTD-TM induced measurable IgG titers for RBD and NTD antigens, respectively. [Table 32] [Table 33] [Table 34]

[0535] The neutralizing titer of serum in mice vaccinated with 1 μg doses of RBD-TM and NTD-RBD-TM compositions, as well as a 50:50 mixture of 2 μg doses of NTD-TM and RBD-TM compositions, was measured, and the correlation between ELISA titer and neutralizing titer was analyzed (Figure 7).

[0536] The titers induced by a 1 μg dose of the NTD-RBD-TM composition or a 2 μg dose of a 50:50 mixture of NTD-TM and RBD-TM composition were greater than those induced by a 1 μg dose of the RBD-TM composition (Table 20). A significant correlation exists between the neutralization titers of spike-specific IgG, RBD-specific IgG, and NTD-specific IgG and ELISA titers (Figure 7). [Table 35]

[0537] Recombinant VSVΔG-based SARS-CoV-2 pseudovirus neutralization assay Codon-optimized wild-type or D614G spike gene (Wuhan-Hu-1 strain; NC_045512.2) was cloned into a pCAGGS vector. To generate VSVΔG-based SARS-CoV-2 pseudovirus, BHK-21 / WI-2 cells were transfected with a spike expression plasmid and infected with VSVΔG-firefly-luciferase, as previously described (Whitt, 2010). A549-hACE2-TMPRSS2 cells were used as target cells for a VSVΔG-based SARS-CoV-2 pseudovirus neutralization assay. A549-hACE2-TMPRSS2 cells were generated by creating a lentivirus encoding hACE2-P2A-TMPRSS2 and maintained in DMEM supplemented with 10% fetal bovine serum and 1 μg / mL puromycin. A549-hACE2-TMPRSS2 cells were infected with pseudovirus at 37 degrees Celsius for 1 hour. The inoculated virus or virus-antibody mixture was removed after infection. After 18 hours, an equal volume of One-Glo reagent (Promega; E6120) was added to the culture medium and read using a BMG PHERastar-FS plate reader. The neutralization procedure and data analysis were the same as those described in the lentivirus-based pseudovirus neutralization assay. See Whitt, MA (2010). Journal of Virological Methods 169, 365-374.

[0538] Example 3. Immunogenicity data on day 36 after 2 doses The same dose of mRNA vaccine described in Example 2 was administered to mice again as an add-on immunization dose 22 days after the initial dose vaccination. The titers of antibodies produced after each of the add-on immunizations against RBD antigen, NTD antigen, wild-type (WT) spike (S) protein, and S2P protein (S protein with a double proline mutation to stabilize the higher-order structure before fusion) were measured by ELISA from serum at day 36 and are shown below. A 50:50 mixture of two immunogenic compositions, RBD-TM and NTD-TM encoded by mRNA in LNP, was administered to mice as an add-on immunization dose of 2 μg or 0.2 μg of total mRNA on day 22, and the titer was determined on day 36. See Table 21.

[0539] Based on WT S protein titers shown in Table 21, obtained by mice immunized with RBD-TM, NTD-TM, or NTD-RBD-TM encoded by mRNA in LNPs, the two doses were superior to all doses tested in inducing antibodies capable of recognizing and binding to the SARS-CoV-2 WT S protein. [Table 36]

[0540] Serum from mice immunized with two doses of RBD-TM, NTD-TM, or NTD-RBD-TM encoded by LNP mRNA was further analyzed for the ability of antibodies to recognize and bind to the SARS-CoV-2 S2P protein. Titers against the SARS-CoV-2 S2P protein were determined by ELISA using S2P as the antigen on the plate and are shown in Table 22 below. Each of these immunogens induced significantly higher antibody titers when S2P was the antigen compared to when WT S protein was the ELISA antigen. Compare Tables 21 and 22. [Table 37]

[0541] Table 23 shows that the immunogen was a 50:50 mixture of RBD-TM and NTD-TM encoded by mRNA in LNPs, and titers against WT S, RBD, NTD, and S2P were determined after the first dose (day 21) and the second dose (day 36). These results show that when the immunogen was a 50:50 mixture of RBD-TM and NTD-TM, the titer was dramatically increased compared to the antibody titers induced by the individual antigens at the same dose. This 50:50 mixture induced good titers against immune antigens, but surprisingly showed even better titers against the WT S protein and very high titers against the S2P protein. See Table 23.

[0542] [Table 38]

[0543] Table 24 shows the immunization results using RBD-TM and NTD-TM, respectively, as mRNA encoding these antigens. Geometric mean titers were measured for groups of eight mice using proteins encoded by mRNA immunogens as antigens on ELISA plates. In this case as well, both immunogenic compositions induced high titers against the immunized antigens when the antigens were administered as mRNA formulated for LNPs. In this case, a good antibody response was obtained at all concentrations with two doses. However, on a microgram (μg) basis, a 50:50 mixture of these antigens induced an antibody response approximately 10 times higher than when the antigens were administered alone. Compare Tables 23 and 24. [Table 39]

[0544] A fusion protein containing an NTD ligated to an RBD and encoded by mRNA in the LNP was administered as an immunogenic composition to groups of eight mice at doses of 0.1 and 1 μg on days 1 and 21. See Table 25 below. Even the mRNA encoding the fusion protein version of NTD-RBD-TM induced very good titers against individual domains, higher than when a single domain is an immune antigen. The titer against the S2P protein was approximately 8 times higher than the titer against the WTS protein. See Table 25. [Table 40]

[0545] The neutralization data is shown in Table 26. S1-666-TM, encoded by mRNA, is an antigen that uses residues 1-666 of the SARS-CoV-2 spike protein attached to the S1 subdomain, specifically the transmembrane domain. [Table 41]

[0546] Example 4. Immunogenicity of S1-666-TM S1-666-TM (or S1 residues 1-666 of spike protein S), encoded by LNP mRNA, was administered to mice as a primary immunization on day 1 and as an additional immunization on day 22 at doses of 0.01 μg and 0.1 μg (N=8) in the group. The titers of antibodies produced after additional immunizations against mRNA RBD, mRNA NTD, and mRNA wild-type (WT) spike (S) protein (Figure 1) were measured by ELISA from serum on day 21 (before additional immunization) and day 36 (after additional immunization), and are shown in Table 27 below.

[0547] The WT S protein titers shown in Table 27, obtained by mice immunized with S1-666-TM encoded by mRNA in the LNP, demonstrated superiority at all doses tested in inducing antibodies capable of recognizing and binding to the SARS-CoV-2 WT S protein, both at both doses. Surprisingly, the induced titer was highest when measured against the S2P version of the spike protein, even when the 2P mutation was not found in S1, as the 2P mutation occurs in S2 and S2 is not present in the immunogen. As with other constructs, NTD titers require a second dose to be determined. [Table 42]

[0548] Example 5. Immunogenicity of NTD-TM, NTD-TM, NTD-RBD-TM, and 50:50 mixture NTD-TM / RBD-TM compositions on day 36 after 2 doses. In this replicate experiment, mice were again administered an additional dose of the mRNA vaccine as described in the above examples, 22 days after the initial dose vaccination. SARS-CoV-2 spike protein-specific IgG titers, SARS-CoV-2 S2P protein-specific IgG titers, SARS-CoV-2 RBD-specific IgG titers, and SARS-CoV-2 NTD-specific IgG titers were measured (then by ELISA 36 days after the initial dose vaccination).

[0549] As a result, 1 μg and 0.1 μg doses of mRNA RBD-TM, mRNA NTD-TM, mRNA NTD-RBD-TM compositions, and 50:50 mixtures containing 1 μg or 0.1 μg of mRNA RBD-TM and mRNA NTD-TM compositions, respectively, were shown to induce high ELISA titers against SARS-CoV-2 spike or SARS-CoV-2 S2P protein.

[0550] Example 6. Immunogenicity study The immunogenicity of a 50:50 mixture of mRNA NTD-TM and mRNA RBD-TM was administered to mice at the following doses: 0.2 μg or 2 μg total mRNA (0.1 μg or 1 μg of each mRNA) (N=8). The initial dose was administered on day 1, and the additional dose was administered on day 22. On day 36, antibody binding to the SARS-CoV-2 stabilized pre-fusion spike protein (SARS-CoV-2 pre-S) was evaluated using ELISA. The following vaccine compositions containing mRNA NTD-RBD-TM, mRNA RBD-TM, and mRNA NTD-TM were administered to mice at the following doses: 0.1 μg and 0.01 μg (N=8). GMT data were determined and are shown in Table 28 below. [Table 43]

[0551] Example 7. Determination of the ratio of IgG2a and IgG1 in NTD-RBD-TM The NTD-RBD-TM mRNA composition was administered to mice at the following doses: 0.1 μg and 1 μg. The initial dose was administered on day 1, and the additional dose on day 22. S2P-specific IgG1 and IgG2a titers were evaluated on day 36. See Figures 8A–8C. By day 36, IgG2a titers were higher than IgG1 titers at both dose levels. See Figure 8A. The IgG2a / IgG1 ratio was plotted at day 36 to determine whether the T cell response was biased towards either a Th1 or Th2 type response. As shown in Figure 8B, the NTD-RBD-TM composition induces an antibody immune response that clearly falls within the Th1 type response. Th2 type responses are undesirable in vaccine development because they are associated with promoting disease enhancement.

[0552] Example 8. Immunogenicity study The mRNAs listed in Table 29 were administered to mice at the following doses: 0.1 μg and 1 μg (N=8). The initial dose was administered on day 1, and the booster immunization was administered on day 22. The serum IgG layer was assayed on S2P-coated plates on days 21 and 36. The results are shown in Table 29. [Table 44]

[0553] additional array It should be understood that any mRNA sequence described herein may include a 5'UTR and / or 3'UTR. The UTR sequence may be selected from the following sequences, but other known UTR sequences may also be used. It should also be understood that any mRNA construct described herein may further include a poly(A) tail and / or cap (e.g., 7mG(5')ppp(5')NlmpNp). Furthermore, while many mRNA and encoded antigen sequences described herein include a signal peptide and / or peptide tag (e.g., a C-terminal His tag), it should be understood that the indicated signal peptide and / or peptide tag may be substituted with a different signal peptide and / or peptide tag, or the signal peptide and / or peptide tag may be omitted. 5'UTR:GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC(Sequence ID 131) 5'UTR:GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC(Sequence ID 2) 3'UTR:UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 132) 3'UTR:UGAUAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 4) [Table 45-1] [Table 45-2] [Table 45-3] [Table 45-4] [Table 45-5]

[0554] It should also be understood that any one of the open reading frames and / or the corresponding amino acid sequences described herein may or may not include a signal sequence.

[0555] All references, patents, and patent applications disclosed herein are incorporated herein by reference with respect to the subject matter they refer to, and in some cases may constitute the entire document.

[0556] In this specification, the indefinite articles "a" and "an" in the specification and claims should be understood to mean "at least one" unless the opposite is explicitly stated. Furthermore, unless explicitly indicated otherwise, in any method comprising two or more steps or acts claimed herein, the order of the steps or acts of such method is not necessarily limited to the order in which the steps or acts of such method are described.

[0557] In the claims and the above specification, all transitional phrases, such as “comprising,” “including,” “possessing,” “have,” “contain,” “accompany,” “hold,” and “composed of,” should be understood to be open-ended, meaning they include but are not limited to what follows. Only the transitional phrases “consist of” and “essentially consist of” are closed or semi-closed transitional phrases, respectively, as described in Section 2111.03 of the U.S. Patent and Trademark Office Examination Guidelines.

[0558] The terms "approximately" and "effectively" preceding a number mean ±10% of the stated number.

[0559] Where a range of values ​​is given, each value between the upper and lower limits of the range is specifically intended and described herein.

[0560] The entire contents of International Application Numbers PCT / US2015 / 02740, PCT / US2016 / 043348, PCT / US2016 / 043332, PCT / US2016 / 058327, PCT / US2016 / 058324, PCT / US2016 / 058314, PCT / US2016 / 058310, PCT / US2016 / 058321, PCT / US2016 / 058297, PCT / US2016 / 058319, and PCT / US2016 / 058314 are incorporated herein by reference.

Claims

[Claim 1] Messenger ribonucleic acid (mRNA) containing at least two domains of the SARS-CoV-2 spike protein and an open reading frame (ORF) encoding a less than full-length spike protein.

Images