A composition to be used as a preventive agent for people at risk of tuberculosis infection, or as a secondary agent for treating infected tuberculosis patients.
The MTBVAC vaccine, with targeted genetic modifications, addresses the limitations of existing TB vaccines by enhancing protection and immunogenicity, offering a potential solution for TB prevention and treatment.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- ウニベルシダッドデサラゴサ
- Filing Date
- 2026-02-06
- Publication Date
- 2026-05-26
AI Technical Summary
Current TB vaccines, such as BCG, provide limited protection against pulmonary TB, especially in developing regions, and there is an urgent need for more effective and accessible diagnostic tools and vaccines to combat the rising global TB burden, including multidrug-resistant strains.
A live attenuated M. tuberculosis vaccine composition, MTBVAC, with specific genetic deletions in the Rv0757 and Rv2930(fadD26) genes to inhibit PDIM production, is developed, offering a safer and more effective immunogenic response.
MTBVAC demonstrates improved protection and immunogenicity in animal models and human trials, particularly in neonates, providing a promising candidate for TB prevention and treatment.
Smart Images

Figure 2026086629000023 
Figure 2026086629000024 
Figure 2026086629000025
Abstract
Description
Technical Field
[0001] The present invention relates to pharmaceutical compositions such as vaccines, and methods for preparing and using such compositions.
Background Art
[0002] Bacillus Calmette-Guerin (BCG) vaccine is a live attenuated strain of Mycobacterium bovis, the causative agent of tuberculosis (TB) in cattle. BCG was first introduced into clinical use in 1921, approximately 100 years ago, when it was given orally to an infant whose mother had died of TB the day after giving birth. The infant showed no adverse events following BCG vaccination and, importantly, did not develop TB. At that time, oral administration of BCG was considered the natural (gastrointestinal tract) route by which infants and children acquired TB when given unpasteurized milk. TB is associated with poverty and represents a major burden in poor developing regions of the world. The incidence of TB is increasing globally due to poverty and inequality and is exacerbated by the HIV / AIDS pandemic, which greatly increases the risk of infection progressing to active disease. Diabetes, metabolic syndrome, smoking, and more recently, vitamin deficiencies resulting from malnutrition and poor socioeconomic conditions have emerged as important risk factors for TB. Importantly, particular care is needed when defining clinical trial programs, including studies or patient populations, to assess how these factors may affect the efficacy of new TB vaccines. With the increasing globalization and the emergence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) strains of TB, TB is becoming an ever more serious threat to the world.
[0003] As reported today by the latest World Health Organization (WHO) Global TB Report 2018, TB has reached alarming levels, with 10 million cases and 1.6 million deaths attributed to the disease. Globally, approximately 50 million people are already in latent infection with MDR M. tuberculosis (Mycobacterium tuberculosis) strains, and treatment options are insufficient. This is a noteworthy resource for future active TB cases. Nevertheless, the WHO's End TB Strategy aims to reduce TB incidence by 90% by 2035. With a pledge to reduce TB mortality by 95%, there is an urgent need to achieve this ambitious goal for rapid, reliable, and more accessible diagnostic tools, new, less toxic, and more effective antibiotics to shorten treatment time, and ultimately, a new vaccine to prevent pulmonary TB. [Overview of the Initiative] [Problems that the invention aims to solve]
[0004] This invention contributes to the objective of providing a novel vaccine for preventing TB. [Means for solving the problem]
[0005] The present invention relates to a live attenuated M. tuberculinoid vaccine composition, preferably a reconstituted composition after freeze-drying, comprising an isolated microorganism belonging to the MTBVAC strain having i) a PhoP-phenotype due to inactivation by genetic deletion of the Rv0757 gene, and ii) a PDIM-phenotype due to deletion of a second gene Rv2930 (fadD26) that inhibits PDIM production, wherein the composition contains the following components (in percentage) per 1 mL.
[0006] [Table 1]
[0007] Other objects, advantages, and novel features of the present invention will become apparent from the following detailed description of the invention when considered in conjunction with the accompanying drawings. [Brief explanation of the drawing]
[0008] [Figure 1] Growth of the SO2 strain in Middlebrook 7H9 medium and synthetic Sauton medium. The figures show the OD and Cfu / mL results for culture passage 1 and culture passage 2. [Figure 2] This figure shows the OD results of MTBVAC cultures in Sauton medium, SD medium, and SDG medium. [Figure 3] This figure shows the stability results for the lots or batches identified in Table 15 at 2°C to 8°C and -30°C. [Figure 4] This figure shows the protective effects in mice. The data in the figure represents a pool of data from two independent experiments (n = 12 mice / group). All data are mean ± SEM. The protective index is defined as the difference in bacterial load (expressed as a decimal logarithm) between the unvaccinated group and the vaccinated group. [Figure 5] This figure shows immunogenicity in mice. The data in the figure is from one experiment (n = 5 mice / group). All data are mean ± SEM. SFC: Spot-forming colony. [Figure 6] Vaccination of neonates in a TB endemic environment with progressively increasing doses of MTBVAC primarily resulted in a Th1 (IFN-γ, IL-2, or TNF-α) antigen-specific CD4 T cell response. The highest dose of MTBVAC, 2.5 × 10⁵ CFU, induced the greatest antigen-specific CD4 T cell cytokine response at day 70. The lowest dose of MTBVAC, 2.5 × 10³ CFU, was the least immunogenic. [Figure 7]Vaccination of neonates in a TB endemic environment with progressively increasing doses of MTBVAC yielded dose-response profiles of quantitative QFT assay values at 180 and 360 days post-vaccination. QFT values were stratified into three distinct domains according to the risk of developing active TB, as described in Andrews JR, Nemes E, Tameris M et al. Serial QuantiFERON testing and tuberculosis disease risk among young children: an observational cohort study. Lancet Respir Med, (2017). [Figure 8] This figure shows that pathogenic mycobacteria are not present in the guinea pig working seed lot. [Figure 9] This figure shows the stability study of the master seed lot and working seed lot. [Figure 10] This figure shows the long-term stability study of MTBVAC vaccines stored at (A) -15℃ to -30℃ and (B) +2℃ to +8℃, in doses of 3×10³cfu / 0.1mL to 17×10³cfu / 0.1mL, 3×10⁴cfu / 0.1mL to 17×10⁴cfu / 0.1mL, and 3×10⁶cfu / 0.1mL to 17×10⁶cfu / 0.1mL. [Figure 11] This diagram shows the stepwise construction from SO2 to MTBVAC. The final double deletion strain is phenotypically identical to the prototype SO2 (phoP-based PDIM deletion) but guarantees greater genetic stability. Light blue indicates the phoP gene, the fadD26 gene is shown in pale orange, the antibiotic resistance cassettes kmr and hygr are reddish-purple, and yellow triangles indicate res sites adjacent to Ωhygr in the deleted region or residual res sites, where the res sites do not contain any exogenous coding sequences. [Modes for carrying out the invention]
[0009] Definition and detailed explanation of MTBVAC strain The term "MTBVAC strain" is used to refer to an isolated microorganism of M. tubercurocysis that lacks the Rv0757 gene of the M. tubercurocysis MT103 clinical strain and also possesses a deletion of the Rv2930(fadD26) gene. Therefore, the above strain presents two independent mutations derived from M. tubercurocysis, and the independent phoP deletion does not affect the vaccine properties derived from the inactivation of the above gene. Thus, the "MTBVAC strain" is characterized by the inactivation of PDIM production due to the deletion of the Rv2930(fadD26) gene, and therefore this strain is characterized by possessing deletions of both the Rv2930 gene and the Rv0757 gene.
[0010] Therefore, it should be noted that the MTBVAC strain was constructed to contain two independent non-reverting deletion mutations without antibiotic markers, meeting the first Geneva consensus safety requirements for advancing the mycobacterial live vaccine to Phase I clinical evaluation. The MTBVAC strain was genetically engineered to be phenotypic and functionally similar to the prototype SO2. SO2 is an Mt103 phoP mutant (Mt103phoP::kmr) marked by insertion of a kanamycin-resistant cassette (kmr) (see Figure 11). In addition to the manipulated PhoP-deficient phenotype, SO2 spontaneously acquires PDIM biosynthesis, which is described as common in M. tuberculosis, as a result of repeated subculturing and manipulation in the laboratory (see Figure 2 in Dessislava Marinova, Jesus Gonzalo-Asensio, Nacho Aguilo & Carlos Martin (2017) MTBVAC from discovery to clinical trials in tuberculosis-endemic countries, Expert Review of Vaccines, 16:6, 565-576, DOI:10.1080 / 14760584.2017.1324303).
[0011] As shown in Figure 11, the MTBVAC strain was constructed following a stepwise approach. First, an unmarked deletion of fadD26 was introduced into SO2 to produce SO2ΔfadD26. As a result, the MTBVAC strain was constructed by an unmarked deletion of SO2ΔfadD26 in phoP. In the construction of MTBVAC, a suicide plasmid containing deleted fadD26 and phoP genes was used, and the deleted region was identified by a hygromycin resistance marker (hyg) flanked by res sites on both sides. r )(res::hyg rIt was interrupted at ::res). γδ-resolverase derived from E. coli catalyzes the excision of the antibiotic resistance cassette following recognition of the res site, then leaving a copy of the residual res "scar" at the deletion site (Malaga, et al. 2003), and no exogenous code is present at the res site. The Ding sequence is also not included. The final construct SO2ΔfadD26::ΔphoP was named the MTBVAC strain. In the MTBVAC strain, fadD26 is not marked. Introducing a deletion ensures the genetically stable elimination of PDIM biosynthesis. The deletion in the fadD26 gene is 1511 bp in size and results in the complete inactivation of this essential gene in PDIM biosynthesis. The wild-type gene is 1752 bp (583 amino acids). The remaining res scar is mediated by γδ-resolverase. r This deletion was left behind during the excision process. As a result of this deletion, the transcription levels of the following five genes at the PDIM locus (fadD26-ppsE) are reduced, and PDIM biosynthesis in MTBVAC is completely abolished (Ainhoa Arbues PhD Thesis). The PDIM locus of M. tubercurosis contains 13 genes clustered on a 50kb fragment of chromosome. This region is the largest operon in the genome of M. tubercurosis (Camacho, et al. 2001, Camacho, et al. 1999, Cox, et al. 1999, Trivedi, et al. 2005).
[0012] In M. tubercurosis, phoP (744 bp) maps upstream of phoR (1458 bp), and both genes are transcribed in the same direction. Replacement of the 94 bp deletion within the phoP gene by the residual res site requires the presence of multiple stop codons, while resulting in the lack of translation of the DNA-binding domain of PhoP (corresponding to 92 amino acids) in MTBVAC.
[0013] Deletions of the phoP and fadD26 genes in MTBVAC can be detected / located using an RT-PCR presence / absence approach. This method uses fluorescent PCR reagents (primers and probes) to indicate the presence of the res site in the ΔphoP and ΔfadD26 genes, as well as the absence of the wild-type phoP and fadD26 genes.
[0014] Hereinafter, the inventors provide the open reading frame (ORF) sequences of the fadD26 gene in Mt103a) and MTBVAC(ΔfadD26)b), and the ORF sequences of the phoP gene in Mt103c) and MTBVAC(ΔphoP)d). The nucleotide sequences corresponding to the deleted gene regions in fadD26(a) and phoP(c) are shown in lowercase, and the remaining res region is highlighted in gray. In the case of fluorescence PCR detection, the primers for each target are underlined, and the Taq-man probe is shown in bold.
[0015] a) Wild-type fadD26 gene in Mt103 Sequence ID 1 ATGCCGGTGACCGACCGTTCAGTGCCCTCTTTGCTGCAAGAGAGGGCCGACCAGCAGCCTGACAGCACTGCATATACGTACATCGACTACGGATCCgaccccaagggatttgctgacagcttgacttggtcgcaggtctacagtcgtgcatgcatcattgctgaagaactcaagttatgcgggttacccggagatcgagtggcggtttta gcgccacaaggactggaat atgtccttgcattcctgggcgcac ttcaggctggatttatcgcg gcaacgatccaggagatcaccggtggacgggccgcggcgatcgcagtgcccgacgacatcaccgaacaactggtggcgatcatcgaattcaagcgacgcggtagtaccgccgaagaggtcatgctcaagctccgctcggtgaagcgtgaggtcacctccgcGATATCGAAGTCACACAGCCTGCGGGTGGCCGATCTCGTTCTGGTGTCACCTGGTTCGATTCCCATCACCACCAGCGGCAAGATCCGGCGGTCAGCCTGCGTCGAACGCTATCGCAGCGACGGCTTCAAGCGGCTGGACGTAGCCGTATGA
[0016] b) ΔfadD26 in MTBVAC SEQ ID NO: 2 ATGCCGGTGACCGACCGTTCAGTGCCCTCTTTGCTGCAAGAGAGGGCCGACCAGCA GCCTGACAGCACTGCATATACG TACATCGACTACGGATCCACTA GTTCTAGAGCAACCGTCCGAA ATATTATAAATTATCGCACACATAAAAACAGTGCTGTTAATGTGTCTATTAAATCGATTTTTTGTTATAACAGACACTGCTTGTCCGATATTTGATTTAGGATACATTTTTATGAGATCCCCCGGGCTGCAGGAATTCGATATCGAAGTCACACAGCCTGCGGGTGGCCGATCTCGTTCTGGTGTCACCTGGTTCGATTCCCATCACCACCAGCGGCAAGATCCGGCGGTCAGCCTGCGTCGAACGCTATCGCAGCGACGGCTTCAAGCGGCTGGACGTAGCCGTATGA
[0017] c) Wild-type phoP gene in Mt103 SEQ ID NO: 3 ATGCGGAAAGGGGTTGATCTCGTGACGGCGGGAACCCCAGGCGAAAACACCACACCGGAGGCTCGTGTCCTCGTGGTCGATGATGAGGCCAACATCGTTGAACTGCTGTCGGTGAGCCTCAAGTTCCAGGGCTTTGAAGTCTACACCGCGACCAACGGGGCACAGGCGCTGGATCGGGCCCGGGAAACCCGGCCGGACGCGGTGATCCTCGATGTGATGATGCCCGGGATGGACGGCTTTGGGGTGCTGCGCCGGCTGCGCGCCGACGGCATCGATGCCCCGGCGTTGTTCCTGACGGCCCGTGACTCGCTACAGGACAAGATCGCGGGTCTGACCCTGGGTGGTGACGACTATGTGACAAAGCCCTTCAGTTTGGAGGAGGTCGTGGCCAGGCTGCGGGTCATCCTGCGACGCGCGGGCAAGGGCAACAAGGAACCACGTAATGTTCGACTGACGTTCGCCGATatcgagctcgacgaggagaccc acgaagtgtggaaggcgg gccaaccggtgtcgctgtcgcccaccgaattcac cctgctgcgctatttcgtG ATCAACGCGGGCACCGTGCTGAGCAAGCCTAAGATTCTCGACCACGTTTGGCGCTACGACTTCGGTGGTGATGTCAACGTCGTCGAGTCCTACGTGTCGTATCTGCGCCGCAAGATCGACACTGGGGAGAAGCGGCTGCTGCACACGCTGCGCGGGGTGGGCTACGTACTGCGGGAGCCTCGATGA
[0018] d) ΔphoP in MTBVAC SEQ ID NO: 4 ATGCGGAAAGGGGTTGATCTCGTGACGGCGGGAACCCCAGGCGAAAACACCACACCGGAGGCTCGTGTCCTCGTGGTCGATGATGAGGCCAACATCGTTGAACTGCTGTCGGTGAGCCTCAAGTTCCAGGGCTTTGAAGTCTACACCGCGACCAACGGGGCACAGGCGCTGGATCGGGCCCGGGAAACCCGGCCGGACGCGGTGATCCTCGATGTGATGATGCCCGGGATGGACGGCTTTGGGGTGCTGCGCCGGCTGCGCGCCGACGGCATCGATGCCCCGGCGTTGTTCCTGACGGCCCGTGACTCGCTACAGGACAAGATCGCGGGTCTGACCCTGGGTGGTGACGACTATGTGACAAAGCCCTTCAGTTTGGAGGAGGTCGTGGCCAGGCTGCGGGTCATCCTGCGACGCGCGGGCAAGGGCAA CAAGGAACCACGTAATGTTCGA CTGACGTTCGCCGATATCGA ATTCCTGCAGCCCGGG GGATCTCATAAAAATGTATCCTAAATCAAATATCGGACAAGCAGTGTCTGTTATAACAAAAAATCGATTTAATAGACACATTAACAGCACTGTTTTTATGTGTGCGATAATTTATAATATTTCGGACGGTTGCTCTAGAACTAGTGGATCAACGCGGGCACCGTGCTGAGCAAGCCTAAGATTCTCGACCACGTTTGGCGCTACGACTTCGGTGGTGATGTCAACGTCGTCGAGTCCTACGTGTCGTATCTGCGCCGCAAGATCGACACTGGGGAGAAGCGGCTGCTGCACACGCTGCGCGGGGTGGGCTACGTACTGCGGGAGCCTCGATGA
[0019] SO2 has a thorough and complete preclinical history demonstrating a robust safety and attenuation profile, as well as promising efficacy, compared to BCG in relevant animal models. Fortunately, most of these preclinical studies were replicated using MTBVAC to confirm the functional profile and biological activity of the dual attenuated PhoP-PDIM phenotype. Lipid profile analysis demonstrated that MTBVAC and its prototype SO2 are phenotypic equivalent and lack DAT, PAT, and PDIM.
[0020] On the other hand, in the context of this invention, BCG is used below to refer to the current vaccine that has been used against tuberculosis since 1921. This vaccine is obtained by subculturing in the laboratory. This is a live attenuated vaccine derived from the M. bovis strain, which has lost its pathogenicity and is currently known to have deleted more than 100 genes. (Behr, MA BCG-different strains, different vaccines, Lancet Infect Dis 2002, 2(2), 86-92.)
[0021] In the context of this invention, H37Rv is used hereafter to refer to a sequenced pathogenic M. tuberculosis strain, which Cole et al. refer to as Rv (see Cole et al 1998 Deciphering the biology of M. tuberculosis from the complete genome sequence. Nature 393:537-544).
[0022] In the context of this invention, MT103 is used below to refer to a clinical isolate of M. tuberclovis. (Camacho et al. 1999 Identification of a virulence gene cluster) of M. tuberculosis by signature-tagged transposon mutagenesis. Mol Microbiol 34:257-267.
[0023] In the context of the present invention, the term PDIM- strain is used below to refer to a strain of the M. tuberclovosis complex that is unable to synthesize futhiocerol dimycocerosate, an important lipid associated with the pathogenicity of M. tuberclovosis.
[0024] In the context of the present invention, SO2+pSO5 is used below to refer to the M. tuberclovis SO2 strain in which the mutation in Rv0757 is complemented by the Rv0757 gene through transformation with a replication plasmid containing the mycobacterial phoP gene, but PDIM synthesis cannot be complemented, and its phenotype is PhoP+PDIM-.
[0025] In the context of the present invention, phoP- of M. tuberclovsis is used below to refer to a strain of M. tuberclovsis inactivated by a deletion of the Rv0757 gene between the EcoRV-BspEI sites, and its phenotype is phoP-PDIM+.
[0026] In the context of the present invention, Rv2930(fadD26) is used below to refer to the gene at the beginning of the operon responsible for the synthesis of futhiocerol dimycocerosate (PDIM) (Camacho et al.), and exclusion of this gene in M. tubercrose confers a stable PDIM phenotype.
[0027] explanation The use of vaccines to prevent TB in humans has proven to be a major challenge for almost a century now. BCG, derived from M. bovis, is currently the only approved TB vaccine in use and the most widely used vaccine in the world. Since the early 1920s, the development and general administration of the BCG vaccine have progressed significantly with the prospect of eradicating TB worldwide. However, these initial prospects have not been achieved, and the results of numerous efficacy trials clearly show that the current form of the BCG vaccine has limited use for controlling respiratory forms of the disease in adults, particularly in developing world regions where the disease is prevalent. (Fine, PE Variation in protection by BCG: implications of and for heterologous immunity. Lancet 1995, 346(8986), 1339-1345. M. Zberg More knowledge about the pathogenicity of tuberculosis and the immune response models leading to the generation of protective immunity makes it possible to develop a better vaccine than BCG. The observation that a higher level of protection is achieved when the host is vaccinated with BCG suggests that viability and persistence are fundamental characteristics necessary for the success of a tuberculosis vaccine. In this sense, U.S. Patent No. 8287886 proposes the use of a prototype single-dose live vaccine strain of M. tubercurosis having an inactivated Rv0757(phoP) gene and a second independent mutation in phoP that inhibits PDIM synthesis, which is attenuated more effectively than BCG in immunodeficient SCID mice and comparable to that conferred by BCG in mice. It was shown that the level of protection is higher, and that it provides better protection than BCG in guinea pigs.
[0028] The phoP gene, along with phoR, forms part of a two-component system and shows high similarity to other two-component systems that regulate the transcription of major pathogenicity genes in intracellular pathogens. This two-component system also regulates the expression of many other genes not directly involved in pathogenicity. (Groisman, EA The pleiotropic two-component regulatory system PhoP-PhoQ. J Bacteriol 2001, 183(6), 1835-1842). Elimination of pathogenicity genes itself does not appear to be the only way to attenuate M. tubercrose. M. tubercrose, which cannot synthesize pantothenic acid de novo, may also be affected. A pantothenate auxotrophic mutant of tuberculosis was shown to persist in SCID mice without causing disease. Sambandamurthy, VK, Wang, X., Chen, B. et al. A pantothenate auxotroph of M. tuberculosis is highly attenuated and protects mice against tuberculosis. Nat Med 2002, 8(10), 1171-1174. In addition, individual leucine auxotrophic mutants were strongly attenuated and could not replicate in vivo in SCID mice. Hondalus, MK, Bardarov, S., Russell, R., Chan, J., Jacobs, WR, Jr. & Bloom, BR Attenuation of and protection induced by a leucine auxotroph of M. tuberculosis. Infect Immun 2000, 68(5), 2888-2898. Therefore, the principle that vaccine strains based on M. tubercurocysts can be properly attenuated while retaining genes suppressed by M. bovis BCG is now generally accepted.
[0029] Prior to U.S. Patent No. 8287886, research into vaccines more effective than BCG was based on the idea that the loss of pathogenicity due to BCG itself was a contributing factor to the lack of complete protection. (Behr, MA, Wilson, MA, Gill, WP et al. Comparative genomics of) BCG vaccines by whole-genome DNA microarray. Science 1999, 284(5419), 1520-1523. Therefore, it was inferred that a new attenuated mutant of M. tuberculosis may be less pathogenic and more effective as a vaccine. However, in this regard, it has been shown that there is no difference in the ability to provide protective immunity against tuberculosis between natural infection with M. tuberculosis and vaccination with BCG. Sampson, SL, Dascher, CC, Sambandamurthy, VK et al. Protection elicited by a double leucine and pantothenate auxotroph of M. tuberculosis in guinea pigs. Infect Immun 2004, 72(5), 3031-3037. Individuals infected with M. tuberculinus with latent tuberculosis had a 79% lower risk of progressive tuberculosis after reinfection compared to uninfected individuals (Andrews 2012. CID 54:784-790). Furthermore, considering the fact that most of these individuals may have been vaccinated with BCG, this actually suggests that there may be a difference in the protective immunity provided by BCG and M. tuberculinus. This raised the question of whether it is possible to improve BCG by rationally attenuating M. tuberculinus. In this context, the observation that the mutant M. tuberculinus strain described in U.S. Patent No. 8,287,886, which has a combination of two independent mutations in PhoP protein synthesis and PDIM synthesis, was attenuated more than BCG in SCID mouse models and provided a higher degree of protection than BCG in guinea pig models, even when applied at 10 times the dose of BCG, was considered particularly relevant.
[0030] The mutant M. tubercurosis strain described in U.S. Patent No. 8,287,886 is characterized by being an isolated microorganism belonging to the genus Mycobacterium that contains inactivation of the Rv0757(phoP) gene and inactivation of a second gene that inhibits PDIM (futhiocerol dimycocerosate) production. In particular, such mutant M. tubercurosis strain (SO2 strain) described in U.S. Patent No. 8,287,886 is characterized by inactivation of the Rv0757(phoP) gene and a second independent mutation in phoP that inhibits PDIM production.
[0031] Interestingly, as described in U.S. Patent No. 8287886, the SO2 strain is Six guinea pigs vaccinated with 50 times the normal dose of this type of vaccine were not found to be toxic. Furthermore, their survival and weight curves were studied. The survival rate was 100% after a 6-month experimental period. Figure 12 in U.S. Patent No. 8287886 shows the weight gain observed in all animals over 6 months, and the non-toxicity of the SO2 strain (Y = weight in grams and X = time to infection in weeks). Furthermore, the survival rate of guinea pigs vaccinated after infection with M. tuberculinus was also studied in U.S. Patent No. 8287886 (Figure 13). The defense study in guinea pigs tracked the survival rate of guinea pigs after 300 days. Survival curves were measured for unvaccinated guinea pigs (saline) and guinea pigs vaccinated with the current BCG vaccine, M. tuberculinus phoP- strain, or SO2 strain (phoP- and PDIM- mutations). After subcutaneous vaccination, animals were infected with a high dose of the pathogenic strain of M. tubercurochromis (H37Rv) to study survival rates. After 60 days, six unvaccinated guinea pigs (administered in saline) died, while the groups vaccinated with SO2 strain, phoP-, and BCG survived. At 300 days post-infection, three guinea pigs vaccinated with BCG and phoP- died, compared to only one in the SO2 strain-vaccinated group. This indicates that protection from the phoP variant is similar to protection from the current BCG vaccine, but vaccination with the SO2 strain, a double mutant of phoP- and PDIM-, provided better protection in the guinea pig model. Furthermore, Figure 14 of U.S. Patent No. 8287886 shows the 400-day survival of the guinea pigs tracked in Figure 13. Six unvaccinated guinea pigs died after 60 days. 400 days after infection, three guinea pigs in the group vaccinated with the SO2 strain survived (Figure 14a), compared to only one guinea pig in the group vaccinated with BCG (Figures 14a and 14b) and phoP- (Figure 14b). This again demonstrates that while the protection provided by the phoP mutant is similar to that of BCG, vaccination with the SO2 strain, a double mutant of phoP- and PDIM-, provided better protection after 400 days of the experiment.
[0032] In conclusion, the results described in U.S. Patent No. 8287886 indicate that microorganisms belonging to the genus Mycobacterium (particularly from M. tuberclovis complex) possessing the SO2 strain, and therefore the phoP-PDIM- phenotype, are a more effective vaccine than BCG according to many criteria. The SO2 strain is attenuated more than BCG in SCID mice, providing mice with at least as good protective immunity as BCG and resulting in a stronger cellular immune response. Furthermore, in protective experiments conducted on guinea pigs against high-dose H37Rv infection, strains with the PDIM-PhoP- phenotype achieved 100% survival in guinea pigs where BCG achieved only a 33% survival rate. This protection is associated with reduced disease severity and bacterial load.
[0033] Based on these results, the authors of this invention proceeded with the development of a live attenuated M. tuberculinosis vaccine containing the MTBVAC strain, presented as a lyophilized pellet in a 3 mL amber glass vial. As previously shown, the MTBVAC strain was constructed to contain two independent non-reverse deletion mutations without antibiotic markers, meeting the safety requirements of the First Geneva Consensus. In this sense, the MTBVAC strain was genetically engineered to be phenotypic and functionally similar to its prototype SO2. In the MTBVAC strain, the introduction of an unmarked deletion at fadD26 ensures the genetically stable elimination of PDIM biosynthesis. It should be noted that SO2 has a thorough and complete preclinical history demonstrating a robust safety and attenuation profile, as well as promising efficacy, compared to BCG in relevant animal models. As previously shown, most of these preclinical studies were replicated using MTBVAC to confirm the functional profile and biological activity of the dual attenuated PhoP- / PDIM-deficient phenotype.
[0034] Based on the above, the authors of the present invention prepared a vaccine containing the MTBVAC strain. A single dose of 0.05 mL of the above vaccine is administered to the neonatal infant via the intradermal route, similar to BCG. Therefore, it was given. Therefore, the first objective of the inventors of the present invention was to obtain a vaccine useful in neonates, preferably lyophilized, for the treatment or prevention of TB in this specific age group of population. With this in mind, the inventors of the present invention conducted the experiments described in Examples 2 and 3 of the present application in neonates, and as a result of these experiments, 2.5×10 4 CFU or 2.5×10 5 It was concluded that vaccination with MTBVAC at a recommended dose of CFU or more was immunogenic in neonates in a TB endemic environment.
[0035] It should be noted that in the present application, the term "neonates" is understood as a newly born child (or other mammal) or as an infant less than 4 weeks old after birth.
[0036] Based on the above results, the present inventors are currently conducting a Phase 2a randomized comparative dose-setting study on the safety and immunogenicity of MTBVAC in healthy BCG-naive, HIV-unexposed South African neonates. This study is conducted in a population of 99 HIV-unexposed BCG-naive neonates without known within-family exposure to M. tuberculosis. The estimated study period (the first participants will receive vaccination until the completion of data collection) is approximately 36 months. In this study, MTBVAC is administered to neonates at three dose levels: 1.5×10 4 CFU / 0.05 ml to 8.5×10 4 CFU / 0.05 ml, 1.5×10 5 CFU / 0.05 ml to 8.5×10 5 CFU / 0.05 ml, and 1.5×10 6 CFU / 0.05 ml to 8.5×10 6 CFU / 0.05 ml. The placebo control is the BCG vaccine. Participants receive a single dose of MTBVAC or BCG by intradermal administration on study Day 0. The objectives of this study are as follows.
[0037] Primary evaluation items: In healthy, BCG-naive, HIV-unexposed South African neonates, the safety and reactiongenicity of MTBVAC will be evaluated by gradually increasing dose levels compared to the BCG vaccine. We will evaluate the immunogenicity of MTBVAC by gradually increasing the dose level in healthy, BCG-naive, HIV-unexposed newborns in South Africa.
[0038] Secondary evaluation items: We evaluate the conversion rate of QuantiFERON-TB Gold Plus (QFT) in neonates receiving MTBVAC with gradually increasing dose levels.
[0039] Exploratory evaluation items: This study evaluates the differences in major histocompatibility (MHC)-restricted T cell responses induced by MTBVAC and BCG vaccination. We will evaluate the differences in donor-unrestricted T cell responses induced by MTBVAC and BCG vaccination.
[0040] Examples 2 and 3 are 2.5 × 10 4 CFU or 2.5 × 10 5 We have already shown that vaccination with MTBVAC at estimated doses above CFU was immunogenic in neonates in a TB endemic environment, and considering the fact that the reactivity of the MTBVAC vaccine was clearly lower than that of the BCG vaccine, we can estimate that MTBVAC should be 1.5 × 10⁻⁶ 4 CVU / 0.05ml~8.5×10 4 CVU / 0.05ml, 1.5 x 10 5 CFU / 0.05ml~8.5×10 5 CFU / 0.05ml, or 1.5×10 6 CFU / 0.05ml~8.5×10 6 It seems plausible that administering CFU / 0.05ml to neonates could be useful as a preventative agent for neonates at risk of M. tuberculinosis infection or developing tuberculosis. El.
[0041] Accordingly, in the first aspect, the present invention relates to a composition comprising an isolated microorganism belonging to the M. tuberclovosis complex, preferably a clinical isolate of M. tuberclovosis, more preferably a clinical isolate of M. tuberclovosis, comprising a PhoP-phenotype due to inactivation by genetic deletion of the Rv0757 gene and a PDIM-phenotype due to deletion of a second gene Rv2930(fadD26) that inhibits PDIM production, and more preferably the microorganism is an MTBVAC strain, and the composition comprises at least 1.5 × 10 4 Contains isolated microorganisms of cfu / 0.05 ml or more. The above composition is 1.5 × 10 4 CFU / 0.05ml~8.5×10 6 It is preferable that the composition contains isolated microorganisms at a concentration of cfu / 0.05 ml. 4 CFU / 0.05ml~8.5×10 4 cfu / 0.05ml, or 1.5 × 10 5 CFU / 0.05ml~8.5×10 5 cfu / 0.05ml, or 1.5 × 10 6 CFU / 0.05ml~8.5×10 6 It is more preferable to include isolated microorganisms at a concentration of cfu / 0.05 ml.
[0042] In a second aspect of the present invention, the composition of the first aspect is intended for use in neonates at risk of infection with M. tuberculinus or neonates at risk of developing tuberculosis disease to prevent infection caused by M. tuberculinus complex, preferably M. tuberculinus, or for use in human neonates at risk of developing tuberculosis disease and suffering from latent tuberculosis infection to prevent or inhibit the development of clinically significant symptoms associated with active disease caused by M. tuberculinus complex, preferably M. tuberculinus, or for use in neonates with latent and / or active TB tuberculinus The composition is intended for use as a secondary agent to treat patients infected with the nucleus, or for use in revaccination, booster vaccination, or booster administration in prophylactic or inhibitory treatment against infections caused by the M. tuberculosis complex, preferably M. tuberculosis, in human neonates at risk of infection with M. tuberculosis, or for use as a secondary agent for the prevention of any unrelated infections other than tuberculosis caused by M. tuberculosis, including infections caused by Mycobacterium other than tuberculosis, in neonates. The composition is more preferably administered to neonates via the intradermal route.
[0043] In addition to the above, it should be noted that the inventors are currently conducting a double-blind, randomized, BCG-comparative, dose-increasing safety and immunogenicity study in adults with latent tuberculosis infection (LTBI) as measured by the QuantiFERON-TB Gold Plus (QFT) assay and adults without LTBI. This is a Phase 1b / 2a, double-blind, randomized, BCG-comparative, dose-increasing safety and immunogenicity study in healthy adults with and without LTBI. All participants had previously received the BCG vaccine in infancy. The research product has four dose levels: 5 × 10⁶ 3 CFU, 5x10 4 CFU, 5x10 5 CFU, and 5x10 6This is an MTBVAC study for CFUs. The active control was BCG (5 × 10⁻¹⁰). 5 (CFU)
[0044] Participants meeting the inclusion / exclusion criteria will be randomized within the study cohort and will receive a single dose of MTBVAC or BCG revaccination via intradermal administration on study day 0. The study will be conducted at a single site in South Africa. Participants will be enrolled in one of eight cohorts and will follow safety and immunogenicity endpoints until study day 182. The estimated time to complete enrollment is approximately 9 months.
[0045] Cohorts 1-8 include participants who are QFT-negative (Cohorts 1-4) and QFT-positive (Cohorts 5-8). Participants are randomized within each cohort. Receive either MTBVAC or BCG.
[0046] Based on these, in a third aspect, the present invention relates to a composition comprising an isolated microorganism belonging to the M. tuberclovosis complex, preferably a clinical isolate of M. tuberclovosis, more preferably the M. tuberclovosis isolate MT103, characterized by having a PhoP-phenotype due to inactivation by genetic deletion of the Rv0757 gene and a PDIM-phenotype due to deletion of a second gene Rv2930(fadD26) that inhibits PDIM production. The composition comprises at least 3 × 10 3 Contains isolated microorganisms of cfu / 0.1 ml or more. The above composition contains 3 × 10 3 CFU / 0.1ml~17×10 6 It is preferable that the composition contains isolated microorganisms at a concentration of cfu / 0.1 ml. 3 cfu / 0.1ml~17×10 3 cfu / 0.1ml, or 3 × 10 4 cfu / 0.1ml~17×10 4 cfu / 0.1ml, or 3 × 10 5 cfu / 0.1ml~17×10 5 cfu / 0.1ml, or 3 × 10 6cfu / 0.1ml~17×10 6 It is more preferable to include isolated microorganisms at a cfu / 0.1ml concentration.
[0047] In a fourth aspect of the present invention, the composition of the third aspect is administered to non-neonatal humans, such as children, adolescents, and adults, who are at risk of infection by M. tuberculosis, for the prevention or cessation of infection caused by the M. tuberculosis complex, preferably M. tuberculosis (including booster vaccination). More preferably, the composition is administered via an intradermal route.
[0048] In a fifth aspect of the present invention, the composition of the third aspect is administered to non-neonatal humans, such as children, adolescents, and adults, who are at risk of developing tuberculosis and suffer from latent tuberculosis infection, for the prevention or denial of the development of overall clinical symptoms associated with active disease caused by M. tuberculosis complex, preferably M. tuberculosis. More preferably, the composition is administered via an intradermal route.
[0049] In a sixth aspect of the present invention, the composition of the third aspect is administered for use as a secondary agent for treating patients infected with latent and / or active TB in neonates, as well as in non-neonatal humans such as children, adolescents, and adults. More preferably, the composition is administered via an intradermal route.
[0050] In a seventh aspect of the present invention, the composition of the third aspect is administered for vaccine revaccination or booster administration in prophylactic or inhibitory treatment for infection caused by the M. tuberculinosis complex, preferably M. tuberculinosis, in non-neonatal humans such as children, adolescents, and adults who are at risk of infection by M. tuberculinosis. In this sense, it should be noted that a booster injection or booster administration after initial immunization is re-exposure to an immune antigen. Re-exposure is intended to increase immunity to the antigen to a protective level after memory of the antigen has decreased over time.
[0051] Meanwhile, the authors of the present invention have carried out any aspect of the present invention described above using the MTBVAC strain and have conducted numerous studies to establish the most appropriate production process for the MTBVAC vaccine in order to achieve a preferred method that minimizes the decline in viability after lyophilization in the development process, providing consistent results and a product having a shelf life of at least two years when stored at +2°C to 8°C. As an initial approximation, different stabilizer compositions were tested alongside different culture media.
[0052] The first challenge in producing the MTBVAC vaccine was culturing it in a medium with the specified composition and free of animal-derived components. Therefore, experiments were conducted using the SO2 strain. As stated, the MTBVAC strain was genetically engineered to be phenotypic and functionally similar to its prototype SO2, and therefore, the SO2 strain was considered a suitable starting point for establishing the most appropriate production process for the MTBVAC vaccine.
[0053] Using the SO2 strain, we developed and tested different culture media that do not contain any animal-derived components. Some of the validated culture media are as follows: Middlebrook 7H9 and modifications (Media for Tubercle Bacilli, Dubos, RJ and Middlebrook, G. American Review of Tuberculosis and Pulmonary Diseases, 1947 Vol. 56 No.4 pp. 334-45 ref.15). Sauton synthetic medium (Handbook of Microbiological Media, Fourth Edition, Ronald M. Atlas, CRC Press, 2010, Page 1540) and modified versions.
[0054] The compositions of Sauton medium and Middlebrook medium are detailed in the table below:
[0055] [Table 2]
[0056] [Table 3]
[0057] Growth in Sauton medium was similar to that of the reference medium (unmodified Middlebrook medium, Table 2). Figure 1 compares the growth curves in Middlebrook and Sauton medium. In parallel with the culture medium composition, these studies began to profile other variables such as culture time, number of culture passages and growth type, and standing or agitation at a laboratory scale (see Table 3).
[0058] [Table 4]
[0059] Finally, Sauton synthetic medium was selected under static growth conditions because it is effective for the growth of the SO2 strain. Although non-static growth conditions could also be selected, the culture must be under aerobic conditions.
[0060] The next stage of development was to study the freeze-drying process. Freeze-drying is a crucial step in the production of live vaccines. Achieving stability in freeze-dried vaccines is a complex process because microorganisms are susceptible to environmental factors after freeze-drying, such as temperature, and growth and formulation conditions can also affect the success of the process. The yield of viable bacteria after freeze-drying and subsequent storage stability can be affected by factors such as the freeze-drying cycle, stabilizer composition, residual moisture, and the presence of air.
[0061] In the development phase using SO2, up to 11 different stabilizer compositions were tested. The table below shows the compositions of the stabilizers tested.
[0062] [Table 5]
[0063] In the stabilizer studies, different formulations were tested, varying the composition, the ratio of stabilizer to culture medium, and the amount of lyophilization. In all tests, the decrease in viability of the lyophilized material and its stability after 30 days at 37°C were assessed. As a criterion for selecting stabilizers in future tests, a limit of viability reduction of 90% and / or a maximum of 80% was established after accelerated stability testing at 37°C (see results in Table 5).
[0064] [Table 6]
[0065] Following the preliminary tests mentioned above, the degradation in lyophilization without stabilizers exceeded 99%, leading to the conclusion that stabilizers need to be added to the culture medium for lyophilization. The best stabilizer that met the specifications for degradation during lyophilization at 37°C and for accelerated stabilization was GSA (monosodium glutamate and sucrose).
[0066] After reaching the above conclusions, the inventors received the MTBVAC strain in the form of a freeze-dried pre-master seed lot and immediately began cell culture of this particular strain. For the proliferation of the MTBVAC strain, a first Sauton medium (see Table 1) with the same composition as that used in the proliferation study of the parent strain SO2 was used. However, unexpectedly, in the case of MTBVAC, lower proliferation was observed in the Sauton synthetic medium than that observed for the SO2 strain. Furthermore, challenges in the amplification phase of the MTBVAC strain were also detected. To address these challenges, experiments were conducted to add components to the composition of the Sauton medium and to remove components from the composition of the medium. Such modifications consisted of adding or removing adjuvants such as glucose, zinc sulfate, biotin, glycerol, and polysorbate.
[0067] Enrichment of Sauton synthesis medium with zinc sulfate and biotin did not yield favorable results, and no growth of MTBVAC was observed. Enrichment with glucose, polysorbate, and glycerin yielded good results, and sufficient growth of MTBVAC was achieved.
[0068] As a result of these growth studies, SD medium and SDG medium were developed, and MTBVAC cultures were grown in these media. MTBVAC growth was good in both SD medium and SDG medium, but some cultures stopped growing after continuous passaging in SDG medium, so SD medium was selected for amplification passaging. Figure 2 shows the OD results of MTBVAC cultures in Sauton medium, SD medium, and SDG medium.
[0069] However, when culturing the MTBVAC strain was initiated from lyophilized or freeze-dried master seed lot vials, it was observed that growth could not be initiated in SD medium. Therefore, the composition was modified to develop a seed medium. As a conclusion of these studies, the seed medium was selected as a means of initiating culture for future pilot and industrial trials, SD medium was selected as a means of amplification and subculturing, and SDG medium was selected as a means of mass culture before lyophilization. Furthermore, since the composition of SD medium combined with stabilizers affected the lyophilization process and the appearance of the tablets, it is important to note that the lyophilization process should be carried out only in SDG medium.
[0070] The present inventors hereby provide compositions for seed medium, SD medium, and SDG medium.
[0071] [Table 7]
[0072] In this sense, the following three tables demonstrate the consistency of the results obtained using the methods developed in the study: MTBVAC2.5×10 5 This shows the results of industrial-scale production in five batches.
[0073] [Table 8]
[0074] [Table 9]
[0075] [Table 10]
[0076] [Table 11]
[0077] In a previous development study using the SO2 strain, the inventors concluded that stabilizers are necessary in the freeze-drying process to reduce the loss of viable bacteria and improve the stability of the freeze-dried product. The same stabilizers selected in the SO2 study were used in the development of MTBVAC. The objective was 3 × 10 3 cfu / 0.1ml~17×10 6 A range of cfu / 0.1 ml, preferably 3 × 10 3 cfu / 0.1ml~17×10 3 cfu / 0.1ml, or 3 × 10 4 cfu / 0.1ml~17×10 4 cfu / 0.1ml, or 3 × 10 5 cfu / 0.1ml~17×10 5 cfu / 0.1ml, or 3 × 10 6 cfu / 0.1ml~17×10 6 The objective was to obtain a lyophilized vaccine containing MTBVAC strains at concentrations in the range of cfu / 0.1 ml, and to minimize the decline in viability after lyophilization in a development process that provides a product with consistent results and a shelf life of at least two years when stored at 2°C to 8°C.
[0078] In the development phase using MTBVAC, up to seven different stabilizer compositions were tested. Table 11 below describes the compositions of the stabilizers tested.
[0079] [Table 12]
[0080] Tables 12 and 13 below show the results in terms of the percentage of viability loss in accelerated stability studies of MTBVAC in laboratory-scale lyophilization tests. The tables show the effect of the composition of the lyophilization medium combined with stabilizers in the lyophilization process. From these studies, we concluded that stabilizers are necessary for lyophilization of MTBVAC, and that GSA stabilizers yield the best results for the parameters tested.
[0081] [Table 13]
[0082] [Table 14]
[0083] Finally, the table below shows the freeze-drying results for the four batches of MTBVAC.
[0084] [Table 15]
[0085] Figure 3 shows the stability results for the lots or batches identified in Table 14 between 2°C and 8°C and -30°C. Furthermore, Table 15 below provides further results for parallel freeze-drying of cultures from Table 11 (SDG medium) in pilot and industrial plants.
[0086] [Table 16]
[0087] All of the above results were obtained by propagating the MTBVAC strain, preferably 1 × 10⁶. 8 cfu / mL ~ 5 × 10 8 It was obtained by freeze-drying SDG medium grown in the range of cfu / mL. Note that monosodium glutamate and sucrose (GSA) were added to perform the freeze-drying, preferably at concentrations of 10 g / L to 40 g / L and 100 g / L to 400 g / L, respectively.
[0088] Accordingly, specific formulations and methods that can be used for the preparation of pharmaceuticals based on the living MTBVAC strain are described herein, as will be further described below. The formulations of the present invention comprise or consist of any of the compositions detailed below, which can be used to culture the MTBVAC strain. The compositions are detailed below.
[0089] [Table 17]
[0090] Accordingly, an eighth aspect of the present invention relates to a composition comprising, or consisting solely of, a seed culture medium characterized as described above.
[0091] A ninth aspect of the present invention relates to a composition comprising, or consisting solely of, an SD medium characterized as described above.
[0092] A tenth aspect of the present invention relates to a composition comprising, or consisting solely of, an SDG culture medium characterized as described above.
[0093] An eleventh aspect of the present invention relates to any of the above-described seed medium, SD medium, or SDG medium, wherein the medium contains, preferably 1 × 10⁶ MTBVAC strains grown therein. 8 cfu / mL ~ 5 × 10 8 Further inclusions are included in the range of cfu / mL.
[0094] A twelfth aspect of the present invention relates to the use of any of the above-described seed medium, SD medium, or SDG medium for culturing or expanding the MTBVAC strain under aerobic conditions. In this sense, seed medium is preferably selected as a means for initiating the MTBVAC strain culture, SD medium is preferably selected as a means for amplification and subculturing, and SDG medium is preferably selected as a means for mass culture before lyophilization. In a particularly preferred embodiment of the twelfth aspect of the present invention, the present invention relates to a method for producing a ready-to-use (a) freeze-dried attenuated live M. tuberculinus vaccine composition, wherein the composition comprises an isolated microorganism belonging to a M. tuberculinus strain, more preferably the MTBVAC strain, having i) a PhoP-phenotype due to inactivation by genetic deletion of the Rv0757 gene, and ii) a PDIM-phenotype due to deletion of a second gene Rv2930 (fadD26) that inhibits PDIM production, and the method comprises initiating the culture of the M. tuberculinus strain and expanding or amplifying the bacteria using a suitable cell medium, wherein the method is characterized by using SDG medium for mass culture before lyophilization. The above method preferably includes initiating the culture of M. tubercurosis strain in seed medium, growing or amplifying the bacteria using SD medium, and using SDG medium for large-scale culture before freeze-drying. The above method more preferably further includes a freeze-drying step in which sucrose and monosodium glutamate are added as stabilizers to the SDG medium used for large-scale culture prior to the freeze-drying step.
[0095] Furthermore, certain components (e.g., specific stabilizers, extenders, and buffers) have been found to be advantageous in the preparation of lyophilized MTBVAC strain vaccines. The present invention also relates to reconstituted vaccines, as well as methods of prevention and treatment utilizing the compositions described herein. The compositions and methods of the present invention are further described below.
[0096] In particular, a thirteenth aspect of the present invention is a live attenuated M. tubercurocysis vaccine composition comprising an isolated microorganism belonging to the M. tubercurocysis strain, The aforementioned microorganism, i) PhoP-phenotype due to inactivation by genetic deletion of the Rv0757 gene, ii) Having a deletion of the second gene Rv2930(fadD26) that inhibits PDIM production (PDIM-phenotype), preferably the M. tuberclovis strain is the MTBVAC strain. The composition is a freeze-dried composition, The composition is obtained by freeze-drying a culture medium containing the microorganisms by adding sucrose and sodium glutamate as stabilizers. The present invention provides a vaccine composition wherein the culture medium is SDG medium. More preferably, in a thirteenth aspect, the present invention provides a vaccine composition comprising an isolated microorganism belonging to a strain of M. tuberculosis having i) a PhoP-phenotype due to inactivation by genetic deletion of the Rv0757 gene and ii) a PDIM-phenotype due to deletion of a second gene Rv2930(fadD26) that inhibits PDIM production, preferably the MTBVAC strain, and the vaccine composition being obtainable or acquired by the method of a twelfth aspect of the present invention.
[0097] More preferably, the present invention provides a vaccine composition comprising an isolated microorganism belonging to an M. tuberculinus strain having i) a PhoP-phenotype due to inactivation by genetic deletion of the Rv0757 gene, and ii) a PDIM-phenotype due to deletion of a second gene Rv2930(fadD26) that inhibits PDIM production, preferably the M. tuberculinus strain being the MTBVAC strain, and the composition comprising, or consisting solely of, the following components (in percentages) per 1 mL.
[0098] [Table 18]
[0099] More preferably, the attenuated live M. tuberculinosis vaccine composition mentioned in the above paragraph is freeze-dried or a reconstituted composition obtained by adding water, preferably sterile water for injection, to a freeze-dried composition.
[0100] In a preferred embodiment of the 13th aspect of the present invention, or in any of the preferred embodiments thereof, the composition contains at least 3 × 10 per 0.1 ml, preferably per 0.1 ml of water. 3 The composition is characterized by containing microbial strains of CFU or higher. Preferably, the composition contains 3 × 10⁶ per 0.1 ml. 4 CFU ~ 17 x 10 per 0.1 ml 6 The composition contains the isolated microbial strain of the cfu. More preferably, the composition contains 3 × 10 per 0.1 ml. 4 cfu~17×10 4 cfu, or 3 × 10 per 0.1 ml 5 cfu~17×10 5 cfu, or 3 × 10 per 0.1 ml 6 cfu~17×10 6 The cfu contains the isolated microbial strains. More preferably, 1.5 × 10 5 CFU / 0.05ml~8.5×10 5 The release specifications for the freeze-dried MTBVAC vaccine containing the MTBVAC strain at cfu / 0.05ml are detailed in the table below.
[0101] [Table 19]
[0102] Furthermore, as shown herein, stability data demonstrate that both master cell banks and working cell banks prepared from pre-master seeds are stable (see Figure 8), and that vaccine MTBVACs stored at -15°C to 30°C and +2°C to +8°C remain stable for more than 24 months (see Figures 3 and 10).
[0103] Furthermore, stability tests have shown that the MTBVAC vaccine remains stable at room temperature for at least 8 hours after reconstitution.
[0104] As will be discussed in more detail elsewhere in this specification, the compositions of the present invention are particularly advantageous in terms of the stability and viability of the active ingredients, which is largely due to the formulation and method of preparing the product, including lyophilization. Generally, this method includes the steps of freezing, primary drying, secondary drying, and stoppering. This method is described in more detail in the experimental examples below, but an example of the method is as follows: In the freezing step, the shelves of the lyophilizer are pre-cooled to -50°C. Once all trays are placed, the shelves are kept at -50°C for 120 minutes. In the primary drying process, a ramp process is performed where the vacuum is set to 25mT, the shelf temperature is raised to -40°C at +0.1°C / min and held for 500 minutes; the shelf temperature is raised to -35°C at +0.1°C / min and held for 500 minutes; the shelf temperature is raised to -30°C at +0.1°C / min and held for 500 minutes; and the shelf temperature is raised to -25°C at +0.1°C / min and held for 800 minutes. In the secondary drying process, the vacuum is kept at 25mT, and a ramp process is performed where the shelf temperature is raised to +20°C at +0.1°C / min and held for 800 minutes. If necessary, the product can be held at +20°C and 25mT for an additional 24 hours before stopper ringing. In the stoppering step, the chamber is degassed with dry nitrogen gas filtered through 0.22 μm, the vacuum is set to 800 mbar (slightly vacuum), and the stopper is pressed into the vial. Alternative freeze-drying cycles that may be used in the present invention are well known in the art. Therefore, the method of the present invention may include freezing at or to a temperature of, for example, -70°C to -30°C (e.g., -60°C to -40°C, or -50°C). Freezing can be carried out for about 30 minutes to 240 minutes (e.g., 60 minutes to 120 minutes or more). The material may then be subjected to one or more drying steps as described herein. In these processes, a vacuum can be applied (e.g., 25 mT), and the temperature can be gradually changed (e.g., 0.1°C / min to 1.0°C / min, or 0.5°C / min) over a period of time (e.g., 100 minutes to 1000 minutes, e.g., 200 minutes to 600 minutes or 300 minutes to 500 minutes). In primary drying, the temperature may be raised to, for example, -30°C to +10°C, e.g., -20°C to +5°C, or -15°C to 0°C, or to a similar degree, while in secondary drying, the temperature may be changed to, for example, +5°C to +35°C, e.g., 10°C to 30°C, or 15°C to 20°C. As is known to those skilled in the art, these parameters (e.g., temperature, holding time, ramp rate, and vacuum level) can be changed, for example, based on the results obtained.
[0105] A vaccine composition according to the thirteenth aspect of the present invention may be administered as a primary prophylactic agent to persons at risk of infection with M. tuberculinosis or at risk of developing tuberculosis, or as a secondary agent for treating infected patients, according to the fourteenth aspect of the present invention. Because the strains of these compositions are attenuated, they are particularly suitable for administration to "at-risk individuals" such as neonates, children, adolescents, adults, and the elderly. Such vaccines can also be used in veterinary settings.
[0106] A preferred embodiment of a fourteenth aspect of the present invention relates to an MTBVAC vaccine for immunizing an individual against symptoms caused by tuberculosis. It should be noted that the vaccine may be suitable not only for the treatment of bladder cancer, but also for the treatment or prevention of TB, or as a vector or adjuvant. It is preferable to immunize an individual against symptoms caused by TB.
[0107] In another preferred embodiment of the 14th aspect of the present invention, the composition of the 13th aspect is administered to neonates at risk of infection with M. tuberculinus or neonates at risk of developing TB disease for the prevention of infection caused by M. tuberculinus complex, preferably M. tuberculinus. The composition is more preferably administered to neonates via the intradermal route.
[0108] In another preferred embodiment of the 14th aspect of the present invention, the composition of the 13th aspect is administered to non-neonatal humans, such as children, adolescents, and adults, who are at risk of infection by M. tuberculinosis, for the prevention or cessation of infection caused by the M. tuberculinosis complex, preferably M. tuberculinosis (including booster vaccination). The composition is more preferably administered via an intradermal route.
[0109] In another preferred embodiment of the 14th aspect of the present invention, the composition of the 13th aspect is administered to non-neonatal human beings, such as children, adolescents, and adults, who are at risk of developing TB disease and have latent tuberculosis infection, for the prevention or denial of the development of the overall clinical symptoms associated with active disease caused by M. tuberculosis, preferably M. tuberculosis. The composition is more preferably administered via the intradermal route.
[0110] In another preferred embodiment of the 14th aspect of the present invention, the composition of the 13th aspect is used in neonates, as well as in non-neonatal humans such as children, adolescents and adults, to provide latent and / or active It is administered for use as a secondary drug to treat patients infected with TB. The above composition is more preferably administered via the intradermal route.
[0111] In another preferred embodiment of the 14th aspect of the present invention, the composition of the 13th aspect is administered for revaccination or booster administration in prophylactic or inhibitory treatment for infection caused by the M. tuberculinosis complex, preferably M. tuberculinosis, in non-neonatal humans such as children, adolescents, and adults who are at risk of infection by M. tuberculinosis. In this sense, it should be noted that a booster injection or booster administration after initial immunization is re-exposure to an immune antigen. The re-exposure is intended to increase and restore immunity to the antigen to a protective level after memory of the antigen has decreased over time.
[0112] Throughout this specification and the claims, the word “including” and its variations shall not imply the exclusion of other technical characteristics, additives, ingredients, or processes. Other purposes, advantages, and characteristics of the present invention will be to those skilled in the art, some arising from this specification and some arising from the practice of the invention. The following examples and drawings are provided by non-limiting examples of the present invention. [Examples]
[0113] Example 1. Immunogenicity and protection are independent of the dose of MTBVAC in neonatal mice. Newborn C3H mice (1 to 3 days old) were given 25 μl of BCG (approximately 2.5 × 10⁴) containing a single clinical dose. 5Intradermal vaccination was performed using MTBVAC at a specified CFU dose. For the BCG group, commercially available vials of the BCG Danish strain corresponding to lot 111053F and lot 113033C were used. For MTBVAC, animals were immunized with the MTBVAC vaccine produced by lyophilizing SDG medium in which the MTBVAC strain was grown. To perform the lyophilization described above, sodium glutamate (10 g / L to 40 g / L) and sucrose (100 g / L to 400 g / L) were added. The lyophilized preparations were resuspended.
[0114] Research on the effectiveness of defense Eight weeks after vaccination, mice were subjected to intranasal challenge with 150 CFU of M. tuberclovic strain H37Rv. Four weeks later, the mice were sacrificed, and the bacterial load in the lungs was identified by plating tissue homogenates on 7H11S solid medium. The results are shown in Figure 4.
[0115] Research on immunogenicity Eight weeks after vaccination, mice were sacrificed and spleen cells were isolated for immunogenicity evaluation. One million spleen cells were incubated for 24 hours in the presence of 10 μg / ml purified protein derivative (PPD), 2 μg / ml overlapping ESAT6 peptide or CFP10 peptide, or a non-antigen (negative control). Interferon-gamma (IFNγ) producing cells were analyzed by ELISPOT. The results are shown in Figure 5.
[0116] conclusion The specific protective efficacy and immunogenicity against PPD, ESAT6, or CFP10 induced by MTBVAC were shown to be dose-independent in neonatal mouse models.
[0117] Example 2. Phase 1B immunogenicity data in neonates (South Africa) Objective: The inventors conducted a search to determine the immunogenicity of neonates after vaccination with the MTBVAC vaccine described in the present invention and to characterize the induced immune response.
[0118] Methods: 36 HIV-unexposed, BCG-naive, healthy newborns were randomized in a 1:3 ratio, and 2.5 × 10⁶ tests were administered within 96 hours of birth. 3 CFU, 2.5 x 10 4 CFU or 2.5 × 10 5 CFUs were administered with either BCG (SSI strain) or MTBVAC. Whole blood MTBVAC-specific cytokine responses were measured on days 7, 28, and 70 by whole blood intracellular cytokine staining and BD LSRFortessa flow cytometry (18 colors, blue-red-purple-green).
[0119] Description of the whole blood ICS assay (Narrative): Heparinized fresh whole blood was immediately stimulated with BCG, MTBVAC, or phytohemagglutinin (PHA), or left unstimulated at 37°C for 12 hours (Nil). Stimulation conditions included half the blood volume [250 μL (0.25 ml)], Nil only, and MTBVAC and BCG. After 7 hours of stimulation, the supernatant (for soluble cytokine / chemokine analysis) was collected from all conditions, frozen with -BOC, and stored for further analysis to be sent to the Sponsor. After supernatant removal, brefeldin A was added to the remaining whole blood and tubular In addition to the bath, the cells were incubated for a further 5 hours in a programmable water bath. The water bath was switched off after a total of 12 hours of stimulation. The following morning, FACS lysate was added to lyse the red blood cells and to fix the white blood cells. The fixed white blood cells were then frozen for later intracellular cytokine staining and flow cytometry. Flow cytometry staining and acquisition were performed in batches at later time points. The frequency and pattern of specific type 1 cytokines and IL-17 by CD4 T cells were evaluated. The immunogenicity time points were selected based on recent studies conducted by SATVI, which indicate that the peak of the BCG-induced T cell response in infants is around 6–10 weeks of age.
[0120] Results: Vaccination with MTBVAC doses increasing in stages primarily resulted in a Th1 (IFN-γ, IL-2, or TNF-α) antigen-specific CD4 T cell response. The highest dose was 2.5 × 10⁶. 5 MTBVAC in CFUs induced the greatest antigen-specific CD4 T cell cytokine response on day 70. 3 MTBVAC from CFU showed the lowest immunogenicity. Figure 6 further illustrates these results.
[0121] Conclusion: These data are 2.5 × 10 4 CFU or 2.5 × 10 5 Vaccination with MTBVAC at CFU levels or higher has been shown to be immunogenic in neonates in TB endemic environments.
[0122] Example 3. Randomized, double-blind, dose-increasing clinical trial of MTBVAC compared to BCG vaccine SSI, in adults living in TB endemic areas with a safety arm in neonates.
[0123] Objective: To evaluate the safety and immunogenicity of three doses of MTBVAC versus BCG in neonates in TB endemic areas.
[0124] Methods: Eighteen HIV-, QuantiFERON (QFT)-, previously BCG-vaccinated healthy adults were randomized in a 1:1 ratio to MTBVAC (5 × 10⁻¹). 5 CFU (Cellular Fibre-forming Units) or BCG SSI was administered. Subsequently, 36 HIV-unexposed, BCG-naive healthy newborns were randomized in a 1:3 ratio and given 2.5 × 10⁶ doses within 96 hours of birth. 3 CFU, 2.5 x 10 4 CFU or 2.5 × 10 5 CFUs were administered BCG SSI or MTBVAC. QFT was performed at days 180 and 360, and QFT+ infants (≥0.35 IU / mL) were used as a reference for isoniazid prophylactic therapy.
[0125] Results: All adults experienced a local injection site reaction, with 18 (100%) experiencing swelling, 16 (88.9%) experiencing redness, and 10 (55.5%) developing ulcers. Nine cases of reaction were reported to be moderate. One case of swelling was reported, and it was severe (35 mm). No SAEs were reported on day 28.
[0126] Due to the unavailability of BCG vaccine SSI, the highest dose of MTBVAC was administered to six infants in an open-label manner. In all three cohorts, 16 infants (44.4%) experienced local reactions (2 [16.6%], 3 [25%], and 11 [91.6%]), with swelling in 14 infants (38.9%), erythema in 5 infants (13.9%), and scarring in 9 infants (25.0%), all of which were assessed as mild. No ulcers were observed. Systemic AEs were similar across the cohorts (n=32 / 42 / 40), with 9 infants (n=3 / 4 / 2) assessed as moderate and 8 infants (n=4 / 2 / 2) as severe. Six infants experienced 7 unrelated SAEs, including an unrelated death due to viral pneumonia confirmed by autopsy.
[0127] Dose-related QFT conversion was observed at day 180 in MTBVAC recipients in cohort 1 (n=3, 37.5%), cohort 2 (n=6, 75%), and cohort 3 (n=7, 77.8%), but not in the 7 BCG recipients. At day 360, as shown in Figure 7, positive QFT was observed in 0 (0.0%) MTBVAC recipients in cohort 1, 2 (25.0%) in cohort 2, and 4 (44.4%) in cohort 3.
[0128] In conclusion, MTBVAC appears safe at three dose levels in South African neonates and seems to produce transient dose-dependent QFT conversions, which could be promising indicators of immunogenicity in TB endemic areas. Furthermore, the reactivity of the MTBVAC vaccine is significantly lower than that produced by the BCG vaccine; scarring occurred in 5 out of 8 neonates (62%) treated with the BCG vaccine, while scarring occurred in only 2 out of 10 neonates (20%) treated with the highest dose of MTBVAC.
Claims
1. A method for producing a freeze-dried, attenuated live M. tuberculinoid vaccine composition ready for use, The composition is i) A PhoP- phenotype resulting from inactivation due to genetic deletion of the Rv0757 gene, wherein the open reading frame (ORF) sequence of PhoP consists of sequence number 4, ii) A deletion of the second gene Rv2930 (fadD26) that inhibits PDIM production (PDIM-phenotype), wherein the open reading frame (ORF) sequence of fadD26 consists of sequence number 2, It includes isolated microorganisms belonging to M. tuberclovis MTBVAC strain, which have the following characteristics: The method includes initiating the culture of the MTBVAC strain and expanding or amplifying the bacteria using one or more suitable cell media. The above method is for large-scale cultivation before freeze-drying, as follows: Table 1 This method is characterized by using SDG medium containing the quantitative and qualitative compositions shown below. A method wherein the above method is carried out under aerobic conditions.
2. The method according to claim 1, wherein the method comprises initiating the culture of the MTBVAC strain in a seed medium defined in the table below, and expanding or amplifying the bacteria using SD medium defined in the table below. Table 2
3. The above method further includes a freeze-drying step in which sucrose and sodium glutamate are added as stabilizers to the SDG medium used for mass culture prior to the freeze-drying step. The method according to claim 1 or 2.
4. A live attenuated M. tuberculinoid vaccine composition containing isolated microorganisms belonging to the MTBVAC strain, The aforementioned microorganism, i) PhoP- phenotype due to inactivation by genetic deletion of the Rv0757 gene, ii) Deletion of the second gene Rv2930 (fadD26) that inhibits PDIM production (PDIM-phenotype), It has, The composition is a freeze-dried composition, The composition is obtained by freeze-drying a culture medium containing the microorganisms by adding sucrose and sodium glutamate as stabilizers. A vaccine composition wherein the culture medium is SDG medium.
5. A vaccine composition comprising an isolated microorganism belonging to the MTBVAC strain having i) a PhoP-phenotype due to inactivation by a genetic deletion of the Rv0757 gene, and ii) a PDIM-phenotype due to a deletion of a second gene Rv2930 (fadD26) that inhibits PDIM production, wherein the vaccine composition is obtained or can be obtained by the method according to any one of claims 1 to 3.
6. A vaccine composition for attenuated live M. tuberclovosis, preferably a reconstituted composition after freeze-drying, comprising an isolated microorganism belonging to the MTBVAC strain having i) a PhoP-phenotype due to inactivation by a genetic deletion of the Rv0757 gene, and ii) a PDIM-phenotype due to a deletion of a second gene Rv2930 (fadD26) that inhibits PDIM production, wherein the composition contains the following components per 1 mL. Table 3
7. Freeze-dried, attenuated live M. tuberculinus vaccine composition.
8. A reconstituted composition obtained by adding water, preferably sterile water for injection, to the freeze-dried composition described in claim 4 or 7.
9. The composition contains at least 3 × 10 units per 0.1 ml, preferably per 0.1 ml of water. 3 A live attenuated M. tuberculinoid vaccine composition according to any one of claims 4 to 8, characterized by containing a microbial strain of CFU or higher.
10. The composition contains 3 × 10 per 0.1 ml. 4 cfu ~ 17 x 10 per 0.1 ml 6 A live attenuated M. tuberculinoid vaccine composition according to any one of claims 4 to 8, comprising the isolated microbial strain of cfu.
11. The composition contains 3×10 4 cfu to 17×10 4 cfu, or 3×10 5 cfu to 17×10 5 cfu, or 3×10 6 cfu to 17×10 6 cfu of the isolated microbial strain, and the live attenuated M. tuberculosis vaccine composition according to any one of claims 4 to 8.
12. The composition contains at least 3 × 10 per 0.1 ml. 3 The isolated microbial strains with a cfu or higher concentration, and 17 × 10⁶ per 0.1 ml. 6 A live attenuated M. tuberculinoid vaccine composition according to any one of claims 4 to 8, comprising the isolated microbial strain of cfu.
13. The composition contains 3 × 10 per 0.1 ml. 4 cfu~17×10 4 cfu, or 3 x 10 per 0.1 ml 5 cfu~17×10 5 cfu, or 3 x 10 per 0.1 ml 6 cfu~17×10 6 A live attenuated M. tuberculinoid vaccine composition according to any one of claims 4 to 8, comprising the isolated microbial strain of cfu.
14. A live attenuated M. tuberculinoid vaccine composition according to any one of claims 4 to 13, for use in preventing or inhibiting infection caused by M. tuberculinoid complex, preferably M. tuberculinoid, in neonates at risk of infection by M. tuberculinoid.
15. A live attenuated M. tuberculinoid vaccine composition according to any one of claims 4 to 13, for use in preventing or inhibiting infection caused by the M. tuberculinoid complex, preferably M. tuberculinoid, in non-neonatal humans such as children, adolescents, and adults who are at risk of infection by M. tuberculinoid.
16. A live attenuated M. tuberculinoid vaccine composition according to any one of claims 4 to 13, for use in preventing or inhibiting the development of clinically significant symptoms associated with active disease caused by M. tuberculinoid complex, preferably M. tuberculinoid, in human neonates, as well as non-neonatal humans such as children, adolescents, and adults, who are at risk of developing tuberculosis and suffer from latent tuberculosis infection.
17. A live attenuated M. tuberculinoid vaccine composition according to any one of claims 4 to 13, to be used as a secondary agent for treating patients infected with latent and / or active TB in neonates, as well as in non-neonatal humans such as children, adolescents, and adults.
18. A live attenuated M. tuberculinoid vaccine composition according to any one of claims 4 to 13, for use in vaccine revaccination, booster vaccination, or booster administration in prophylactic or inhibitory treatment for M. tuberculinoid complex, preferably infection caused by M. tuberculinoid, in human neonates at risk of infection by M. tuberculinoid, as well as in non-neonatal humans such as children, adolescents, and adults.
19. Non-tuberculous mycobacteria in newborns, as well as in non-newborn humans such as children, adolescents, and adults. A live attenuated M. tuberculinoid vaccine composition according to any one of claims 4 to 13, to be used as a secondary agent for the prevention of any unrelated infection other than tuberculosis caused by M. tuberculinoid, including infections caused by terriers.