Lighting devices to promote circadian health

Abstract

This invention provides an artificial lighting system and method for promoting circadian health. [Solution] Methods, systems, and computer-readable media utilizing artificial lighting regulate the human circadian clock. By utilizing light-emitting diodes (LEDs) that emit wavelengths associated with the human opsin absorption spectrum, the device can stimulate human opsins. For example, the device replicates normal sunlight (for example, based on the season or time of day) by emitting light that changes in rhythmic intensity or spectral modulation.

Description

[Technical Field]

[0001] (Cross-reference of related applications) This application claims priority to U.S. Provisional Patent Application No. 63 / 085,234, filed on 30 September 2020, the entire disclosure of which (including color illustrations) is incorporated herein by reference. This application also claims priority to U.S. Provisional Patent Application No. 62 / 975,357, filed on 12 February 2020, the entire disclosure of which (including color illustrations) is incorporated herein by reference.

[0002] (Sequence Listing) This application includes an electronically submitted sequence listing in ASCII format, the entire listing of which is incorporated herein by reference. The ASCII copy, created on March 19, 2021, is named 027324_023021_SL.txt and has a size of 11,901 bytes.

[0003] (Rights of the U.S. government) This invention was made with the support of the U.S. Government under grant number EY027077, awarded by the National Institutes of Health. The U.S. Government has certain rights in this invention.

[0004] This disclosure relates, in general, to artificial lighting systems and methods for promoting circadian health, and more specifically, to systems and methods for using artificial lighting to stimulate human encephalopsin (OPN3), melanopsin (OPN4), and neuropsin (OPN5). [Background technology]

[0005] Human physiological functions are regulated by the light-dark cycle. Living on a rotating planet orbiting a yellow dwarf star creates a rhythmic cycle of light and dark. In response, humans have evolved systems to detect and utilize light for adaptive advantages. For example, the human visual system deciphers patterns of photons reflected from objects. Equally important is the synchronization of the circadian clock by light. The circadian clock, or circadian oscillator, is a biochemical oscillator that cycles in a stable phase and is synchronized by the light-dark cycle.

[0006] One photodetector protein crucial for circadian function is an opsin called melanopsin, which responds to blue light in the 490 nm range. More recent studies have revealed that other wavelengths (380 nm, violet light) and other opsins (encephalopsin and neuropsin) are also involved in regulating the circadian clock and acute photoresponse physiological functions.

[0007] Over the past 100 years, studies investigating the function of the circadian clock have shown that it plays a crucial role in almost every aspect of human physiological function. More recently, acute photoresponse pathways have also been shown to regulate physiological function. Acute photoresponses and circadian clock oscillations, triggered by light stimulation, combine to produce rhythmic systemic physiological functions, which means that humans are well adapted to time-dependent activities. For example, these photoresponse pathways increase daytime alertness and promote nighttime sleep. They also regulate metabolic systems to produce high energy levels during the day and low energy levels at night. Disruption of this rhythmic physiological function can have serious consequences. Jet lag sleepiness and foggy mind are just one example, but chronic... Shift workers, who are more susceptible to circadian dysfunction, are also known to be more prone to metabolic diseases and certain types of cancer. All of these findings provide sufficient reason to maintain rhythmic physiological functions through acute and circadian clock-dependent photoresponses.

[0008] Artificial lighting systems within buildings typically do not provide the spectral composition, intensity, or rhythm of light that matches natural sunlight. This means that typical building lighting systems do not meet the needs of human circadian physiological functions. Therefore, there is a need for special lighting systems that correct this deficiency by meeting the requirements of circadian health. Furthermore, because hospitals have many different members (e.g., patients, care teams, and shift workers), there is a need for lighting systems that are flexible enough to serve the diverse patient and worker populations within the hospital. [Overview of the project]

[0009] This disclosure discloses devices, methods, and computer program products for promoting human circadian health (e.g., treating a patient or preventing a disease) by emitting light that stimulates one or more human opsins.

[0010] In some embodiments, light is emitted by a device (e.g., in a commercial medical facility). The device may include a plurality of light-emitting diodes (LEDs) (e.g., arranged around the inner perimeter of a room) or a display (e.g., associated with an electronic device). In some embodiments, the device may include a controller that can control each of the LEDs or the display. For example, the controller may control the rhythmic intensity or spectral modulation of the light emitted from the indoor lighting device or the display of the electronic device.

[0011] In some embodiments, one or more of the LEDs may have wavelengths selected to target human opsin absorption spectra. For example, the LEDs may have wavelengths of 380 nm, 430 nm, 480 nm, 530 nm, 580 nm, or 630 nm, and may target the stimulation of human opsins such as opsins 3, 4, or 5. In some embodiments, the device can modulate a human (e.g., a patient or hospital worker) acute photoresponse and circadian clock based on opsin stimulation. For example, the device may simulate normal sunlight by reproducing twilight and dawn, or by reproducing spectral composition changes that occur in different seasons.

[0012] In some embodiments, the device may include a light source, for example, a light-emitting diode (LED) emitting violet light in the range of 360–420 nm (e.g., 380–410 nm); a memory for storing computer instructions; and one or more processors coupled to the memory and configured to execute the computer instructions stored in the memory. In some embodiments, the computer instructions may include a step of controlling the selective operation of the light source to stimulate human neuropsin (OPN5) based at least in part on the human circadian clock. For example, the selective operation of the light source (e.g., LED) may include controlling the rhythmic intensity of the violet light emitted by the light source (e.g., based on a first transition associated with dawn and a second transition associated with dusk). In another example, the selective operation of the light source (e.g., LED) may be based on one or more spectral compositional changes associated with one or more seasons.

[0013] According to some embodiments, the device may include a light source (e.g., an LED) that emits blue light in the range of 400–525 nm (e.g., 450–500 nm). In some embodiments, a computer instruction may include a step of controlling the selective operation of the light source (e.g., an LED) at least in part on the human circadian clock to stimulate human melanopsin (OPN4). In some embodiments, the computer instruction may include a step of controlling the selective operation of the light source (e.g., an LED) at least in part on the human circadian clock Based at least in part on this, the method may include a step of controlling the selective operation of a light source (e.g., an LED) to stimulate human melanopsin (OPN3).

[0014] According to some embodiments, the computer instructions may include a step of controlling the selective operation of a light source (e.g., an LED) to stimulate a human OPN5 / OPN4 ratio. For example, the computer instructions may include a step of controlling the selective operation of a light source (e.g., an LED) to stimulate a human OPN5 / OPN4 ratio of less than 0.4 at the midpoint of the daytime schedule and to stimulate an OPN5 / OPN4 ratio greater than 0.4 at the beginning and end of the daytime schedule. According to some embodiments, the computer instructions may include a step of controlling the selective operation of an LED to stimulate a human OPN5 / OPN3 ratio.

[0015] According to some embodiments, the device may include a display, and the illumination source (e.g., LEDs) may be incorporated as micro-LEDs within the display. According to some embodiments, the device may include an optical element (e.g., a lens, window, housing, or cover for the device) associated with an ultraviolet-transmitting illumination source (e.g., LEDs).

[0016] According to some embodiments, the device may include an interface (e.g., a graphical user interface) configured to receive information about geographical location. For example, selective operation of a lighting source (e.g., an LED) may be based on geographical location and associated transitions. According to some embodiments, selective operation of a lighting source (e.g., an LED) may be further based on one or more additional conditions, including time of year, atmospheric conditions, weather conditions, genetic factors, age, and health status.

[0017] According to some embodiments, the interface may be configured to receive information on two or more factors associated with the child (e.g., genetic structure, place of conception, place of birth, time of birth, gestational age, and sex), and the selective operation of a lighting source (e.g., an LED) may be based on transitions associated with the received factors associated with the child. For example, the device may include one or more indoor lighting devices installed in a childcare facility.

[0018] According to some embodiments, a method for treating myopia in children may include: providing a first illuminator that emits violet light in the range of 360–420 nm (e.g., 380–410 nm) to an area occupied by the child; providing a second illuminator that emits blue light in the range of 400–525 nm (e.g., 450–500 nm) to the area; selectively activating the first illuminator to stimulate the child's neuropsin (OPN5) based at least partially on the child's circadian clock; and selectively activating the second illuminator to stimulate the child's neuropsin (OPN4) based at least partially on the child's circadian clock (e.g., based on one or more spectral compositional changes associated with one or more seasons). According to some embodiments, the method may control the rhythmic intensity of the violet light emitted by the first illuminator based, for example, on a first transition associated with dawn and a second transition associated with dusk. For example, the selective activation step may selectively activate the first and second illumination sources to stimulate an OPN5 / OPN4 ratio of less than 0.4 in the child at the midpoint of the daytime schedule, and to stimulate an OPN5 / OPN4 ratio greater than 0.4 at the start or end of the daytime schedule.

[0019] According to some embodiments, selective activation of the first illumination source may be based on transitions related to information about the geographical location of the area. According to some embodiments, selective activation of the first illumination source may be based on one or more additional conditions, including time of year, atmospheric conditions, weather conditions, genetic factors, age, and health status. According to some embodiments, selective activation of the first illumination source may be based on transitions related to one or more received factors associated with the child (e.g., genetic structure, place of conception, place of birth, time of birth, gestational age, and sex). .

[0020] In some examples, a computer-readable storage medium stores computer-executable instructions to perform or cause to perform any of the methods described herein. In some examples, a device includes one or more processors, memory, and one or more programs, the one or more programs being stored in memory and configured to be executed by the one or more processors, and the one or more programs containing instructions to perform or cause to perform any of the methods described herein.

[0021] This summary is provided to introduce, in a simplified form, a selection of concepts that will be further described in the detailed description below. This summary is not intended to identify any major or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter. Furthermore, the claimed subject matter is not limited to any limitation that resolves any or all of the defects described in any part of this disclosure. [Brief explanation of the drawing]

[0022] Please refer to the attached drawings below, but these drawings are not necessarily drawn to scale.

[0023] [Figure 1] Figure 1 shows an exemplary light-engine LED emission spectrum. [Figure 2] Figure 2 shows exemplary spectral composition during summer and winter. [Figure 3] Figure 3 shows the exemplary absorption spectrum of human opsin and the exemplary distribution of emission spectra from LEDs constituting the lighting system. [Figure 4] Figure 4 shows exemplary OPN5 expression in a population of hypothalamic pOA neurons that receive input from the thermoregulatory nucleus. [Figure 5] Figure 5 shows that, in some embodiments, OPN5 poa neurons regulate BAT thermogenesis. [Figure 6] Figure 6 shows that, in some embodiments, violet light rapidly suppresses BAT heat production. [Figure 7] Figure 7 shows that, in some embodiments, OPN5 poa neurons respond to violet light ex vivo. [Figure 8] Figure 8 shows the expression of OPN3 in iAT and inWAT according to some embodiments. [Figure 9] Figure 9 shows the measurement of photon flux in iBAT and iscWAT according to some embodiments. [Figure 10] Figure 10 shows the inwat phenotypes of OPN3 null and minus blue-fed mice according to some embodiments. [Figure 11] Figure 11 shows that OPN3 is required for the photodependent enhancement of the heat production response in some embodiments. [Figure 12] Figure 12 shows that, in some embodiments, white adipocyte OPN3 is required for a normal thermogenesis response. [Figure 13] Figure 13 shows that, in some embodiments, the loss of OPN3 alters energy metabolism. [Figure 14] Figure 14 shows in vivo OPN3-dependent utilization of fat mass, as well as in vivo and in vitro photo- and OPN3-dependent lipolysis activation, according to some embodiments. [Figure 15] Figure 15 shows that OPN5 is expressed in lef1-positive hair follicle stem cells in some embodiments. [Figure 16]Figure 16 shows that cultures of the outer ear and tactile pad exhibit OPN5-mediated photosynchronization in some embodiments. [Figure 17] Figure 17 shows the induction and phase shift of per genes from acute light exposure in some embodiments. [Figure 18] Figure 18 shows the expression of clock genes in wild-type and OPN5- / - outer ears in some embodiments. [Figure 19] Figure 19 shows that, in some embodiments, circadian transcripts in the skin are synchronized to the LD cycle in vivo. [Figure 20] Figure 20 shows that OPN5 is expressed in different subsets of RGCs in some embodiments. [Figure 21] Figure 21 shows premature vitreous vascular regression and the absence of 380 nm photons in OPN5 null mice according to some embodiments. [Figure 22] Figure 22 shows that, in some embodiments, OPN5-dependent and light-dependent pathways regulate dopamine levels in the eyes of neonatal mice. [Figure 23] Figure 23 shows that, in some embodiments, the photodependent activation of phospho-T53-DAT in IPL requires OPN5. [Figure 24] Figure 24 shows that, in some embodiments, OPN5 RGC uses VGAT in the vitreous regression pathway (a model of OPN4-VEGFA and OPN5 dopamine pathway integration). [Figure 25] Figure 25 shows that, in some embodiments, retinal dopamine promotes vitreous vascular regression via DRD2-dependent inhibition of VEGFR2 activity. [Figure 26] Figure 26 shows that vitreous retraction can be regulated by light in some embodiments. [Figure 27] Figure 27 shows that in some embodiments, vitreous regression and retinal neovascularization are regulated by melanopsin. [Figure 28]Figure 28 shows the photo- and melanopsin-dependent regulation of VEGFA expression and hypoxia in the retina according to some embodiments. [Figure 29] Figure 29 shows that, in some embodiments, gestational light controls vascular development in the eye. [Figure 30] Figure 30 shows an exemplary system architecture for using artificial lighting to promote, among other things, the circadian health of patients. [Figure 31] Figure 31, in particular, illustrates an exemplary method of using artificial lighting to promote circadian health in patients. [Figure 32] Figure 32 shows a schematic diagram of an exemplary network device. [Figure 33] Figure 33 shows a schematic diagram illustrating a machine in the form of a computer system. [Figure 34] Figure 34 shows graphs of the spectral power distribution (SPD(λ)) of standard LED light compared to melanopsin (OPN4(λ)) and neuropsin (OPN5(λ)) in some embodiments. [Figure 35] Figure 35 shows graphs of the spectral power distribution (SPD(λ)) of daylight during the daytime compared with melanopsin (OPN4(λ)) and neuropsin (OPN5(λ)) in some embodiments. [Figure 36] Figure 36 shows graphs of the spectral power distribution (SPD(λ)) of daylight at twilight compared to melanopsin (OPN4(λ)) and neuropsin (OPN5(λ)) in some embodiments. [Figure 37] Figure 37 shows a graph of the OPN5 / OPN4 ratio of sunset to solar altitude in some embodiments, where, for example, 0 degrees represents the actual sunset. [Figure 38] Figure 38 shows a graph of the OPN5 / OPN4 ratio of sunrise to solar altitude in some embodiments, where, for example, 0 degrees represents the actual sunrise. [Figure 39]Figure 39 shows a graph of the OPN5 / OPN4 ratio of the second sunset to the solar altitude in some embodiments, where, for example, 0 degrees represents the actual sunset. [Figure 40] Figure 40 shows a graph of the spectral power distribution in which the OPN5 / OPN4 ratio transitions in a manner similar to sunrise or sunset, according to some embodiments. [Figure 41] Figure 41 shows a graph of the OPN5 / OPN4 ratio of the spectral transitions shown in Figure 40, according to some embodiments. [Figure 42] Figure 42 shows graphs of the OP5 / OPN4 ratio and lumens of the spectral transition shown in Figure 40 for some embodiments, where, for example, the OPN5 / OPN4 ratio is inversely proportional to the lumens. [Figure 43] Figure 43 shows a graph of the spectral power distribution in a second embodiment, which, according to some embodiments, transitions its OPN5 / OPN4 ratio in a manner similar to sunrise or sunset. [Figure 44] Figure 44 shows a graph of the OPN5 / OPN4 ratio of the spectral transitions shown in Figure 43, according to some embodiments. [Figure 45] Figure 45 shows graphs of the OPN5 / OPN4 ratio and lumens of the spectral transition shown in Figure 43 for some embodiments, where, for example, the OPN5 / OPN4 ratio is modulated, but the intensity is only slightly modulated. [Figure 46] Figure 46 shows a graph of the obtained system spectral effectiveness of a device, taking into account the spectral sensitivity of OPN5, the spectral transmittance of the UV polycarbonate optical material, the spectral reflectance of titanium dioxide (TiO2), and the light traveling through the polycarbonate optical device, as well as a single bounce from the TiO2-based coating, according to some embodiments. [Figure 47] Figure 47 shows a graph of the obtained system spectral efficacy of a device, considering the spectral sensitivity of OPN5, the spectral transmittance of a typical polycarbonate optical material, the spectral reflectance of titanium dioxide (TiO2), and the light traveling through the polycarbonate optical device, taking into account a single bounce from a TiO2-based coating, according to some embodiments. [Figure 48] Figure 48 shows a block diagram of a device consisting of a user interface, control means, and multiple LED types according to one embodiment. [Figure 49] Figure 49, in particular, illustrates an exemplary method of using artificial lighting to treat a patient's illness.

[0024] By convention, various features shown in the drawings may not be depicted to a fixed scale. Therefore, the dimensions of various features may be arbitrarily enlarged or reduced for clarity. In addition, some parts of the drawings may not depict all components of a given system, method, or device. Finally, similar reference numerals may be used throughout the specification and drawings to indicate similar features. [Modes for carrying out the invention]

[0025] The disclosed subject matter provides methods and lighting systems for illuminating indoor spaces and satisfying the need to activate OPN3, 4, and 5. In some examples, the lighting system may also take into account other possible light decoding mechanisms and may be aesthetically pleasing, physiologically beneficial, for example, commercial and residential installations.

[0026] The circadian clock is necessary to regulate certain aspects of rhythmic physiological functions, such as the sleep-wake cycle. In addition to physiological functions based on the circadian clock, newly discovered photoresponsive pathways (the subject of this application) are necessary for the acute regulation of physiological functions. For example, these newly discovered pathways regulate eye development and metabolism.

[0027] The photodetector G protein-coupled receptor (GPCR) opsin 5 (OPN5) plays a crucial role in regulating eye development in mice. OPN5 is a visible violet light (380 nm λmax)-responsive opsin that modulates dopamine levels in the eye. Since both violet light and dopamine suppress myopia, it has been shown that OPN5 may play a role in refractive development (1).

[0028] Myopia is the most common cause of vision impairment, affecting 1.5 billion people worldwide and costing $268 billion annually. There are no known causes or methods to prevent the onset of myopia. Myopia is a visual impairment in which near objects can be seen clearly, but distant objects appear blurry. Myopia occurs when the eyeball is too long or the cornea is too curved. This structural change causes incident light to focus on the front of the retina, rather than on the retina as seen in patients with normal vision (emmetropia). Myopia often appears in school-aged children and progresses into the late teens and early twenties as the eye continues to grow. High levels of myopia can lead to very serious conditions such as choroidal neovascularization, cataracts, glaucoma, retinal detachment, myopic retinopathy, and myopic macular degeneration. It can lead to serious eye complications.

[0029] The prevalence of myopia varies with age, race, ethnicity, urbanization, education level, and occupation. However, prevalence differs across geographical locations and environments. For example, in a recent clinical trial in Taiwan, 693 schoolchildren were randomly assigned to either an intervention group receiving additional outdoor time (up to 11 hours / week) or a control group with no change in outdoor time. The intervention group compared with the control group after one year. These findings indicate significantly less myopia shift and axial elongation, along with a 54% lower risk of rapid myopia progression. These findings suggest that children who spend time outdoors are far less likely to develop myopia. This is consistent with the hypothesis that the violet light-OPN5 pathway promotes normal refractive development, as natural sunlight contains violet light while indoor artificial light does not. Recent studies showing that mice with germline or retinal conditional deletions of the OPN5 gene exhibit alterations in refractive development and morphological deprivation-induced refractive changes are also consistent with this hypothesis.

[0030] For example, one reason children may develop myopia is that they spend too much time using indoor electronic devices and are no longer exposed to the natural light cycle. Furthermore, this has created a unique opportunity, as any electronic device with a display, whether it is a phone, tablet, computer, or television, can be used to deliver the 380nm light necessary to stimulate normal refractive development, reduce myopic shift, and lower the risk of rapid myopia progression.

[0031] Electronic devices designed to promote the normal development of refraction possess several important characteristics.

[0032] 1. Display lighting technology or indoor lighting sources must be able to generate not only the currently generated 480nm (blue) light, but also 380nm light.

[0033] 2. The generation of 380nm and 480nm light by the device must mimic the timing of the natural light cycle. This requires an application that operates in the background of the electronic device to deliver the natural light cycle. This includes the relative intensity of 380 / 480nm light to mimic the transition between dawn and dusk, but does not include 380 / 480nm light at night. This application needs to be synchronized with local time, but may include the option of extending daylight hours to better suit user behavior. The latter feature may be particularly important during the short winter days when user behavior is not synchronized with the solar cycle.

[0034] In some embodiments, indoor lighting may be provided that activates the neural, visual, and metabolic developmental pathways of opsins 3, 4, and 5. For example, the blue light (480 nm) cycle is important for normal physiological functions, such as circadian rhythm synchronization, as OPN4 (melanopsin) plays a central role in regulating the circadian clock and is important for many aspects of human physiological function. Furthermore, two additional opsins, OPN3 (encephalopsin) and OPNS (neuropsin), also have important functions. For example, OPN3, a blue light-sensitive opsin, plays an important role in the development of neural structures. Furthermore, OPN5, a violet light-sensitive opsin, is required for the normal development of the refractive and vascular systems of the eye. Both OPNS are also necessary for the normal development and homeostasis of the metabolic system.

[0035] Current indoor lighting technologies (including smartphone, tablet, and computer screens) do not generate the violet light wavelength (380 nm) that stimulates the OPNS. This means that in developed countries, where electronic devices are used extensively indoors, there is a lack of stimulation in this pathway. Consequently, this deficiency may contribute to the prevalence of diseases such as myopia and metabolic syndrome. OPN3 is activated by the same blue photons that activate OPN4. Therefore, embodiments that generate both blue and violet light can satisfy all three pathways.

[0036] In some cases, lighting systems may have the following characteristics:

[0037] A light engine consisting of six single-peak LEDs that can be combined to mimic full-spectrum illumination.

[0038] LEDs can generate light peaks at 380nm, 430nm, 480nm, 530nm, 580nm, and 630nm. These wavelengths target the human opsin absorption spectrum (see schematic diagram).

[0039] The output of each LED can be adjusted by software that allows for independent control of its intensity over time. Therefore, the lighting system can generate the transitions of dawn and dusk that mimic normal sunlight. It can also mimic the spectral composition changes that occur in different seasons.

[0040] The lighting system can be configured as a strip of horizontally mounted luminaires of discrete dimensions, which can be installed around the entire perimeter of the room's walls. The LED light is directed towards both the walls above and below the luminaire strip to produce indirect lighting for the room.

[0041] LEDs can be configured within a lighting strip to reproduce the typical color separation of dawn and dusk.

[0042] The lighting strip is calibrated to the north, south, east, and west, and in the Northern Hemisphere, it can be operated in sections so that the eastern side provides dawn lighting, the entire strip provides daytime lighting, and the western side provides twilight lighting.

[0043] In some embodiments, lighting systems can be designed to provide health benefits arising from the stimulation of opsins 3, 4, and 5 at all stages of development and adulthood, as well as aesthetic features that make them attractive lighting options. For example, lighting systems are very well suited to commercial medical facilities and general commercial buildings, and when manufactured in an inexpensive form, are very well suited to residential installations.

[0044] In some embodiments, the lighting system can utilize a light engine. For example, the light engine may employ at least four LEDs, each of which may emit photons having lambda axes at 400 nm, 480 nm, 550 nm, and 630 nm. In some embodiments, this distribution may target circadian opsins OPN5 (at 400 nm), OPN3, and OPN4 (both at 480 nm), but can also satisfy low-light vision and color rendering requirements, taking into account overlap with the absorption spectra of rod and cone photoreceptors. According to some embodiments, Figure 1 shows how the LED emission spectra may be distributed with respect to the absorption spectra of both circadian opsins and standard opsins.

[0045] In some embodiments, the controller provides the ability to control the intensity of each individual LED within the light engine, for example, with complete temporal flexibility. For example, the controller may be configured to produce indoor lighting with rhythmic intensity and spectral modulation that mimics a normal day. As an example of the flexibility provided by the controller (e.g., flexibility required of the light engine), Figure 2 shows the daytime spectral composition in winter and summer at 53 degrees latitude in Loughborough, England. As shown in Figure 2, in contrast to winter days, summer dawns and dusks are accompanied by peaks in violet and blue light. Therefore, in some embodiments, the light engine provides the flexibility to reproduce this type of spectral modulation.

[0046] In some embodiments, the controller may provide coordinated control of a set of optical engines within a functional domain. For example, in a hospital room, normal sunlight (e.g., bright during the day and dim at night) may be simulated. In some embodiments, the controller may also incorporate seasonal transitions in wavelength composition (e.g., Figure 2). However, in some embodiments, the number of indoor winter days may be extended to facilitate normal hospital functioning. For example, the number of daylight hours during winter in Cincinnati, Ohio is 9.5 hours, which may not be sufficient for a hospital to function efficiently. Therefore, the controller may extend the indoor winter days to adapt to shorter winter days by making any changes relatively subtle so that patients and staff can adapt as easily as well.

[0047] In some embodiments, the controller can provide a hospital care team station and access corridor with the same daytime lighting as the patient rooms. However, nighttime lighting programming may include deviations from the patient rooms to accommodate hospital shift work (e.g., night shift).

[0048] According to some embodiments, Figure 3 shows the absorption spectrum of human opsin and the ideal distribution of the emission spectrum from LEDs constituting the lighting system.

[0049] (UV light suppression of heat production by opsin 5 hypothalamic neurons) The opsin family of G protein-coupled receptors is used as photodetectors in animals. Opsin 5 (neuropsin, OPN5) is a highly conserved violet light (380 nm λmax) sensitive opsin. In mice, OPN5 is a photoreceptor in the retina and skin, but is also expressed in the preoptic area (POA) of the hypothalamus, for example, in the photosensing pathway in which OPN5-expressing POA neurons regulate brown adipose tissue (BAT) thermogenesis. For example, OPN5 expression may include glutamatergic thermosensitive POA neurons that receive synaptic input from multiple thermoregulatory nuclei. Furthermore, OPN5 POA neurons project to BAT and their activity decreases under chemogenetic stimulation. OPN5 null mice exhibit hyperactive BAT, elevated body temperature, and excessive thermogenesis upon cold exposure. Moreover, violet light stimulation during cold exposure rapidly suppresses BAT temperature in wild-type mice, but not in OPN5 null mice. Direct ex vivo measurement of intracellular cAMP reveals that OPN5 POA neurons increase cAMP when stimulated with violet light. Therefore, embodiments may include the identification of violet-sensitive deep brain photoreceptors that normally suppress BAT thermogenesis.

[0050] The availability of photons emitted from the sun is utilized by almost all living systems for adaptive advantages. For example, animal vision relies on the detection of synchrotron photons for object identification. Plants and animals also use non-visual pathways to predict the daily light-dark cycle in order to synchronize their circadian clocks. In animals, the eye is used for light input in both visual and non-visual pathways, but in non-mammalian species, extraocular light detection is well-explained. For example, in fruit flies and zebrafish, light synchronizes the circadian clock within organs without requiring input from the eye. It is possible to synchronize them. It was previously thought that mammals do not employ extraocular light detection, but this view has recently been changing.

[0051] In animals, most photoresponse pathways utilize members of the opsin family of G protein-coupled receptors as photodetectors. Among non-visual opsins, melanopsin (OPN4) is blue light sensitive (480 nmλ). max Opsins have been most extensively studied in mice, and ocular melanopsins are involved in circadian synchronization, pupillary light reflex, eye development, as well as mood and learning. Visual violet light sensitivity (380 nmλ) max ) 1,2 Evidence exists that neuropsin (OPN5) and blue light-sensitive encephalopsin (OPN3) are involved in extraocular light response pathways. In birds, OPN5 expression in the brain is involved in regulating seasonal breeding behavior, and in mice, its expression has been confirmed to be necessary and sufficient for the direct photosynchronization of the circadian clock in the retina, cornea, and skin. OPN3 may also be expressed in adipocytes and promotes lipolysis in a blue light-dependent manner.

[0052] In the hypothalamus of mice and primates, OPN5 is expressed in the preoptic area (POA), suggesting that, as in birds, OPN5 likely functions as a deep brain light sensor. The POA is a thermoregulatory region in mice that regulates the heat-generating capacity of brown adipose tissue (BAT) via sympathetic nervous system activity (SNS). Homeothermic animals rely on this system to protect their core body temperature against constantly changing environments. According to some embodiments, the mouse thermoregulatory system is OPN5-dependently violet light-responsive. Furthermore, according to some embodiments, the key photosensitive cells are neurons located in the preoptic area of ​​the hypothalamus.

[0053] (Opsin 5 in POA thermoregulatory neurons) According to some embodiments, tdTomato Reporter Ai14(OPN5 cre / + Using the OPN5 knock-in allele to activate Ai14 mice, OPN5 expression is identified in the preoptic area (POA) of the hypothalamus of mice at post-emergence day (P) 21 (Figure 4a, b). According to some embodiments, this region is P10 OPN5l acZ / +OPN5 was actively transcribed using Xgal labeling in mouse-derived brain tissues (Figures 4c, d). Ai14+ neurons were also found in the raphe pallidus, but P12 OPN5l acZ / + was Xgal-negative in frozen sections, suggesting OPN5 from earlier developmental stages cre / + ;Ai14 lineage marking. Comprehensive lineage surveys outside the CNS revealed no OPN5 expression in brown and white adipose tissues, thyroid, liver, heart, adrenal glands, and pancreas.

[0054] The POA contains multiple distinct neuron subtypes associated with homeostasis control. Using multiplex fluorescence in situ hybridization (M-FISH), distinct subpopulations in the POA of P21 OPN5 cre / + ;Ai14 mice (Figure 4e) were labeled. Most of the OPN5 POA neurons expressed Slc17a6 (vesicular glutamate transporter 2, VGLUT2) and were thus glutamatergic, but were only faintly co-labeled with Slc32a1 (vesicular GABA transporter, VGAT) (Figures 4f - h). The POA also contains temperature-sensitive neurons that co-express the neuropeptides PACAP (Adcyap1) and BDNF (Bdnf) 18 and use TRPM2 as thermosensor 19. Using M-FISH, almost all OPN5 POA neurons were co-labeled for Adcyap1 and Bdnf (Figures 4i - k), and it was found that approximately half co-express Trpm2. Thus, OPN5 POA neurons are BDNF+ / PACAP+ warm-sensitive glutamatergic neurons.

[0055] To map presynaptic inputs to OPN5 POA neurons, a tracing rabies virus was injected into the POA of P21 OPN5 cre / + ;Ai6;RΦGT20 mice (Figures 4l, m). Six days after injection, tdTomato-positive neurons were found adjacent These neurons were identified in the ventricular nucleus (PVN, Figures 4n-p), supraoptic nucleus (SON, Figures 4n, o, q), dorsomedial hypothalamus (DMH, Figures 4r, s), lateral paracerebellar peduncle (LPB, Figures 4t, u), and pallid raphe (RPa, Figures 4v, w). All of these regions play a role in thermoregulation (Figure 4x), and the DMH, LPB, and RPa are directly involved in the cutaneous thermal sensation circuit that controls brown adipose tissue (BAT) activity. In summary, these results indicate that OPN5 POA neurons are an excitatory thermosensitive population synaptically connected to the thermoregulatory nuclei.

[0056] (OPN5 POA neurons regulate BAT activity) According to some embodiments, OPN5 POA neurons communicate with BAT. Transneuronal retrograde pseudorabies virus (PRV) expressing mRFP1 is transmitted to P60 OPN5. cre / + The mRFP1 was injected into the BAT of Ai6 mice (Figure 5a). Five days after injection, mRFP1-positive neurons were identified in the intermediate lateral nucleus (IML), RPa, DMH, PVN, nucleus tractus solitary (NTS), and lateral hypothalamic area (LHA) of the spinal cord (Figures 5b-g), and all regions were involved in BAT thermogenesis. Importantly, we identified mRFP1-positive neurons in POA co-labeled with Ai6 (Figures 5h, i), demonstrating the existence of a direct polysynaptic pathway between OPN5 POA neurons and BAT.

[0057] To determine whether OPN5 POA neurons can control BAT activity, these neurons were activated or inhibited using chemical genetic material while monitoring BAT and core temperature. A cre-dependent AAV5 (adeno-associated virus) vector was used with OPN5. cre / + Mouse (OPN5 + / +Stimulating hM3Dq or inhibitory hM4Di DREADD (designer receptors exclusively activated by designer drugs) were targeted to OPN5 POA neurons by injection (using mice as controls) (Figures 5j-m). Telemetry sensors were implanted in the animals to monitor BAT and core temperature, and each was injected with the DREADD ligand clozapine N-oxide (CNO) for experimental and control studies (Figure 5m). The animals were then sacrificed and BAT was collected for molecular profiling of thermogenesis gene expression. Chemogenetic activation of OPN5 POA neurons significantly suppressed BAT and core temperature (Figures 5n, o). Cre-negative OPN5 treated with either vehicle or CNO. + / + Animals were unable to exhibit similar effects (Figure 5p, q). In contrast, chemogenetic inhibition of OPN5 POA neurons increased BAT and core temperature (Figure 5r, s), an effect not present in cre-negative controls (Figure 5t, u). OPN5 cre / - Subsequent studies in animals with (OPN5 function loss) and animals exposed to 4°C cold temperatures showed that heterozygous OPN5 function loss does not alter baseline BAT or core temperature, and that neither OPN5 loss nor temperature sensing alters the chemogenetic effect of OPN5 POA neurons on BAT activity. Overall, these results demonstrate that OPN5 POA neurons can reliably and bidirectionally regulate BAT activity.

[0058] (Increased heat production in OPN5 null mice) To study the function of OPN5 in heat production, germline OPN5 null mice (OPN5 - / - ) was used. OPN5 - / - Immunosensory detection in BAT showed elevated levels of uncoupling protein UCP1 and tyrosine hydroxylase (TH) (marker of SNS innervation). Cold exposure led to elevated levels of OPN5 - / -It was revealed that the animals better defended their body temperature and showed an increase in heat-producing pathway genes. Telemetry sensor recordings further showed that core and BAT temperatures increased in OPN5 null mice even at an ambient temperature of 24°C, and that these differences were not due to dysregulated circadian rhythms. Infrared thermography revealed that P8 and P90 OPN5 mice exposed to cold. - / - It was warmer than the control. P90 OPN5 - / - The surface temperature in the interscapular adipose tissue (iAT) region of the animals was quantitatively warmer, while the tail temperature could not be distinguished. In summary, these data suggest that mice lacking OPN5 exhibit increased BAT thermogenesis.

[0059] OPN5 - / - Abnormal heat production in mice does not result in changes in body weight, composition, or exercise activity, but it does lead to increased energy expenditure. The absence of body composition differences is OPN5 - / - This can be explained by increased food and water consumption in mice. Serum lipids are lower in the OPN5 null, but serum thyroxine (T4) and thyroid-stimulating hormone-releasing hormone (TRH) remain unchanged, suggesting that facultative rather than essential thermogenesis is primarily affected. Major white fat accumulation is observed in the OPN5 null. - / - In mice, the tumor is smaller and shows a decrease in adipocyte size and an increase in UCP1. Systolic and diastolic blood pressure, mean arterial pressure (MAP), and pulse rate are all related to OPN5. - / - Mouse and OPN5 + / + It is no different from the mouse. However, OPN5 - / - Mice show an enhanced response to the β3-adrenergic agonist CL-316,243. These results are from OPN5. - / - This study demonstrates that abnormal BAT thermogenesis in animals may not be attributable to differences in thyroid hormones or cardiovascular activity, but rather to adaptive changes in adrenaline BAT sensitivity and lipid mobilization. POA-specific OPN5 deletions were generated using Leprcre. Previous analyses were used as controls (OPN5). fl / fl ) and conditional mutant mice (Lepr cre / + ;OPN5fl / fl Repeated studies showed that the mutant mice closely mimicked the overall OPN5 loss-of-function model. These data strongly support the role of preoptic OPN5 in suppressing BAT thermogenesis.

[0060] (Purple light suppresses BAT activity.) OPN5 - / - Observations of abnormal heat production responses in mice suggested that OPN5 normally inhibits heat production. To evaluate whether this inhibitory role depends on the photosensing function of OPN5, we subjected mice to acute 380nm violet light stimulation while simultaneously exposing them to cold P90-120 OPN5. + / + and OPN5 - / - In animals, BAT and core temperature were monitored. OPN5 + / + In mice, violet light stimulation reduced BAT and core temperature, but OPN5 - / - The mouse did not respond (Figure 6a, b). OPN5+ / + mouse and OPN5 when purple light was not applied. - / - No differences in BAT or core temperature were observed between mice and mice (Figure 6c, d). The addition of purple light was observed in OPN5. + / + and OPN5 - / - To assess the potential for different behavioral responses in animals, spontaneous movement was recorded, but no differences were found in average speed or distance traveled.

[0061] OPN5 is expressed in retinal ganglion cells and can photosynchronize the retinal circadian clock. Two approaches were used to evaluate the potential contribution of retinal OPN5 to changes in BAT thermogenesis. First, OPN5 fl Rx cre When conditionally deleted from retinal progenitor cells using this method, the cold-exposed wild-type (OPN5) was identified. fl / fl ) Animals and retina OPN5 conditional (Rx cre ;OPN5 fl / fl No difference in core temperature was observed between the animals (Figure 6e). Secondly, P90~120 OPN5 + / + and OPN5 - / -The mice were enucleated and subjected to the same cold exposure light stimulation assay as the sighted mice. Nuclear transfer OPN5 + / + The mice decreased their core temperature in response to violet light, but enucleated OPN5 - / - did not show such a response (Figs. 6f, g). Enucleated OPN5 + / + and OPN5 - / - Molecular profiling of BAT excised from the animals showed differences in the induction of thermogenic genes similar to those observed in sighted mice (Fig. 6h). These data indicate that the inhibitory role of OPN5 on BAT thermogenesis does not require retinal OPN5.

[0062] (Absence of violet light enhances BAT activity) As an extension of the acute response analysis, it was determined whether chronic exclusion of violet photons mimics loss of OPN5 function in wild-type mice. Male and female wild-type mice on a C57BL6 / J background were raised under a standard 12L:12D light cycle from embryonic day (E) 16.5 to P70 under either "full spectrum" (380 nm + 480 nm + 660 nm) or "minus violet" (480 nm + 660 nm) illumination. Analysis at P70 revealed that minus violet mice exhibited a milder version of the abnormal thermogenic phenotype characteristic of OPN5 nulls.

[0063] As a result of data aggregation, since it was suggested that OPN5 POA neurons could be directly light-responsive, it was evaluated whether the POA received a photon flux sufficient for opsin activation. Using a custom-designed optical fiber probe, in-tissue radiometry was performed at various depths within the brains of anesthetized mice. At the λ max of the OPN5 action spectrum, an intensity attenuation of approximately 2.5 log-fold was measured at the depth of the POA relative to the skull surface. Extrapolating for normal sunlight intensity, a maximum violet light beam of 9.0×10 12 photons cm -2 s -1 can reach the POA. This exceeds the activation threshold of non-visual opsins in other mammals.

[0064] (The OPN5 POA neurons respond to violet light) Therefore, a major question is raised as to how the OPN5 POA neurons signal in response to violet light. To gain insights into these mechanisms, real-time intracellular cyclic AMP (cAMP) was monitored using a genetically encoded TEpacVV cAMP sensor that is transcriptionally activated by OPN5 cre TEpacVV reports cAMP binding by changes in fluorescence resonance energy transfer (FRET) between an mTurquoise donor (CFP) and a Venus acceptor (cp173Venus-Venus, YFP), which can be imaged using two-photon microscopy (Figs. 7a, b). Neurons that have experienced an increase in intracellular cAMP (e.g., in response to forskolin (FK) and 3-isobutyl-1-methylxanthine (IBMX)) have an increase in the ratio of CFP to YFP (ΔF), but depletion of cAMP by permeabilizing the cells with digitonin results in a decrease in ΔF (Figs. 7c–e). A 1-hour experimental protocol was designed, with 30 minutes of 50% duty cycle violet light stimulation after 15 minutes of FRET measurement in the dark, during which measurements were taken, and ending with 15 minutes of dark measurement after the application of FK + IBMX (Fig. 7f). POA slices from P21 OPN5 23 animals showed a dramatic increase in relative ΔF in response to violet light stimulation, but slices from P21 OPN5 cre / + animals had little or no increase in ΔF and were indistinguishable from the dark condition (Figs. 7g–k). These data argue that OPN5 POA neurons are directly sensitive to violet light stimulation ex vivo and increase intracellular cAMP in response to it.

[0065] (Discussion) ​​Thus, evidence is presented in mice for a violet-sensitive thermocentrifugal pathway from POA to BAT, utilizing OPN5 (neuropsin) as a light sensor. OPN5 acts as a deep brain photoreceptor with a peak sensitivity of 380 nm, inhibiting BAT thermogenesis via a direct light response that increases intracellular cAMP.

[0066] Deep brain photoreceptors have been extensively demonstrated in bony and avian species, where non-visual opsins modulate behavioral and reproductive responses in the host. In contrast, the evidence for extraocular light sensing and the precise signaling mechanisms in mammals are still not fully understood. According to some embodiments, adipocyte OPN3 (blue light-sensitive opsin) has been demonstrated to increase lipolysis by promoting cAMP-dependent phosphorylation of hormone-sensitive lipase, and thus enhance adaptive thermogenesis in mice. According to some embodiments, using neuroanatomical and loss-of-function studies, it has been established that preoptic area OPN5 functions inhibitory on BAT thermogenesis. Chemogenetic stimulation of OPN5 POA neurons immediately reduces BAT temperature, while mice lacking OPN5 show a significant increase in adaptive thermogenesis and BAT activity. These opposing activities of OPN3 and OPN5 on thermogenesis raise the intriguing hypothesis that non-visual photoreceptive pathways decode light information to aid in the time calibration of appropriate BAT activity. This is the case. Further research may be needed to understand the precise mechanism by which OPN3 and OPN5 activity are integrated in the thermogenic pathway.

[0067] By studying POA neurons expressing BDNF+ / PACAP+, leptin receptors, TRPM2, and prostaglandin EP3 receptors, evidence can be revealed that glutamatergic (non-GABAergic) populations directly regulate body temperature. Such data contradict previous models suggesting that thermoregulatory POA neurons projecting BAT are GABAergic. In some embodiments, this analysis identified glutamatergic BDNF / PACAP double-positive OPN5 POA neurons, which showed a strong decrease in BAT and core temperature under chemogenetic stimulation. It may be suggested that an excitable subpopulation of thermosensitive POA neurons may integrate signaling from leptin, prostaglandin E2, and violet light. The most compelling evidence for this comes from the tandem scRNA-seq:MERFISH (single cell RNA-seq Multiplexed Error-Robust FISH) cell atlas of POA, where the excitatory subcluster e13 is enriched for co-expression of Adcyap1 (encoding PACAP), Bdnf, Slc17a6 (encoding VGLUT2), Ptger3 (encoding prostaglandin E2 receptor), Lepr, and OPN527. It is important to investigate whether this population represents a true nexus for signal integration across all these pathways.

[0068] In some embodiments, an unexpected photoresponsive POA-BAT brainstem is revealed in mice that require OPN5 as a deep brain light sensor. Therefore, normal human thermogenesis may require light input via an extraocular pathway. This possibility is supported by OPN3 expression in human adipocytes, OPN5 expression in primate POA, and the conservation of many metabolic diseases exhibiting birth-time-dependent risk, suggesting the involvement of a photoresponsive pathway. It is hypothesized that insufficient stimulation of OPN3 and OPN5 in these tissues may contribute to the spread of metabolic disease epidemics in developed countries where artificial lighting is standard.

[0069] Figure 4 shows, for example, that OPN5 is expressed in a population of hypothalamic POA neurons that receive input from the thermoregulatory nucleus. a, b: Coronary brain section showing OPN5 (tdTomato, red) limited to the preoptic area (POA) (P21 OPN5 cre / + ;Ai14). Nissl markers are blue. Red markers in the optic tract (OT) are axons from OPN5 retinal ganglion cells. c, d: (c) whole brain, ventral view and (d) Xgal markers in coronal section by POA (P10 OPN5l acZ / + e: Schematic diagram and low-magnification image of the M-FISH (see Methods) region with nucleus (DAPI, grayscale) and three-color probe labeling. f, g: Representative images of POA neurons (f) probed for tdTomato (OPN5cre; Ai14, red), Slc32a1 (Vgat, green), and Slc17a6 (Vglut2, blue), and (g) shows the quantification of overlap (n=3, 109 cells). h: Representative tdTomato+ cells from (f). i, j: Similar to (f, g), but with tdTomato (OPN5 cre ; For Ai14 (red), Bdnf (green), and Adcyap1 (encoding PACAP, blue), with (j) quantification (n=3; 92 cells). k: Representative tdTomato+ cells from (i). l: Schematic diagram of mouse genetics used for rabies virus tracking. m: Experimental timeline of POA tracking, and primary infected neurons (yellow). n~w: Tracking neurons located in the paraventricular nucleus (red); PVN (o, p), supraoptic nucleus; SON (o, q), dorsomedial hypothalamus; DMH (r, s), parabrachial nucleus; LBP (t, u), and pallid raphe; RPa (v, w). The green area of ​​(o, q) is the optic tract with axons from OPN5 retinal ganglion cells. x: Schematic diagram of the presynaptic nucleus of OPN5 POA neurons. Scale bars: 5 μm (h, k), 20 μm (f, i), 75 μm (e, m), 100 μm(b, p, q, s, w), 200 μm(o, u), 1 mm(a). 2Cb: Lobule 2 of the cerebellar vermis. Data for g and i are mean ± standard error.

[0070] Figure 5 shows, for example, that OPN5 POA neurons regulate BAT thermogenesis. a:P60 OPN5 cre / + ;Injection of pseudorabies virus (PRV-mRFP1) into the BAT of Ai6 mice. b-i:Representative images of the spinal cord's intermediate lateral nucleus (IML) (b), RPa (c), DMH (d), PVN (e), nucleus tractus solitarius (NST) (f), lateral hypothalamic area (LHA) (g), and OPN5;Ai6 (green) PRV-infected (red) region including POA neurons (h, i). j:OPN5 cre / + or OPN 5+ / + Schematic diagram of DREADD virus delivery to POA in animals. k, l: OPN5 cre / + (k) AAV-infected POA neurons and OPN5 + / + (l) shows its absence. m: Experimental timeline. n~u: Chemogenetic manipulation of OPN5 POA neurons. CNO or vehicle (saline) was injected at 2 hours (white arrow). CNO-mediated activation of OPN5 POA neurons by Gq DREADD is shown to be OPN5 cre / + In animals (n, o), BAT and core temperature are reduced, but OPN5 + / + No reduction was observed in the control group (p, q). CNO-mediated inhibition of OPN5 POA neurons by Gi DREADD was observed in OPN5 cre / + The study increased BAT and core temperature in animals (r, s), but not in controls (t, u). Scale bar: 100 μm. Data from n to u are mean ± standard error. All p-values ​​represent one-way repeated measures ANOVA.

[0071] Figure 6 shows, for example, that violet light acutely suppresses BAT thermogenesis. a-d: BAT and core telemetry records during 5 hours of exposure at 4°C with illumination wavelength modulation. All mice were subjected to light exposure at 480 nm and 660 nm (see Methods). At 3 hours (dotted line), OPN5 + / + or OPN5 - / -The animals were either exposed to 380 nm light (a, b) or left with 480 nm + 660 nm light (c, d). The BAT and core temperature trajectories during light modulation (3-5 hours) were calculated by linear regression, and the temperature change rate was reported as °C / hour. e:OPN5 fl / fl and Rx cre Core temperature evaluation (rectum) of OPN5fl / fl mice during a 3-hour cold load under 380nm+480nm+660nm illumination. f, g: under 480nm+660nm illumination (f) or with added 380nm violet light, (g) enucleated OPN5 + / + (n=4) and OPN5 - / - (n=5) Core temperature assessment at 3 hours (dotted line) in mice. The dotted line trace in (g) represents the wild-type mean trace from (f). h: iBAT QPCR of thermogenesis genes (Ucp1, Pgc1α, Prdm16, Cidea) after 5 hours of cold exposure in mice from (g). Data are mean ± standard error. p-values ​​are from (a-d) one-way ANOVA with time as covariate, (e-g) one-way repeated measures ANOVA, and (h) ANOVA with Tukey post-hoc analysis.

[0072] Figure 7 shows, for example, that OPN5 POA neurons respond to violet light ex vivo. a:OPN5 cre ;Schematic diagram showing two-photon evaluation of cAMP biosensor FRET activity in POA slices derived from CAMPER mice. b: △F, CFP, YFP, and FRET images (△F = CFP / YFP ratio). c: Time-course △F images after response to forskolin (FK, 20 μM) and IBMX (200 μM) (top row) or digitonin (10 μg / mL) (bottom row). d, e: Individual traces from FK + IBMX (d, n=15 cells) or digitonin (e, n=6 cells) treated sections. f: Experimental timeline for testing the violet response of OPN5 neurons in POA slices as described in the methods. g: OPN5 cre / +Relative ΔF plots of animals (gray traces, n=4) and OPN5cre / - (blue traces, n=4). h: Percentage of cells responding to violet light for both groups (mean relative ΔF > 1.1 between t=15 and t=45). i, j Individual traces from each biological replica (n=6-8 cells / animal, 4 animals / genotype) from experiment (g). k:OPN5 cre / + Animals and OPN5 cre / - Peak ΔF from the dark, purple stimulus, and drug phases between animals. Data for g, h, and k are presented as mean ± standard error. p-values ​​are from (g) one-way repeated measures ANOVA and (h, k) two-tailed Student's t-test. Scale bars: 10 μm (c), 100 μm (b).

[0073] (method) Where appropriate, sample sizes were pre-determined using statistical methods. Except for image analysis, researchers were not blinded to assignments during the experiment and evaluation of results.

[0074] mouse The animals were housed in a pathogen-free animal facility maintained at an ambient temperature of 22°C and a relative humidity of 30–70%. All pharmacological and surgical procedures were performed according to protocols (protocol number 2018-0046) approved by the Institutional Animal Care and Use Committee of Cincinnati Children's Hospital Medical Center. This study complies with all relevant ethical guidelines for animal research. The genetically modified mice used in this study included: Rx-cre, Ai14 (Jax stock 007914), Ai6 (Jax stock 007906), RΦGT (Jax stock 024708), CAMPER (Rapgef3 Jax stock 032205), Lepr-cre (ObRb-cre, Jax stock 008320), and OPN5. tm1a(KOMP)WtsiThese were generated from C57BL / 6N embryonic stem cells obtained from KOMP (embryonic stem cell clone ID: KOMP-HTGRS6008_A_B 12-OPN5-ampicillin), as described above. Briefly, the embryonic stem cells have a genetic modification in which the LacZ-neomycin cassette is adjacent to the FRT site between exons 3 and 4, and the loxP site separates LacZ from the neomycin coding region. The loxP site is also adjacent to exon 4 of OPN5, enabling multiple mouse strains that can function as reporter nulls, conditionally floxed mice, and null mice. OPN5 fl The allele is OPN5 tm1a(KOMP)Wtsi This was created by crossbreeding mice with FLPeR (Jax stock 003946) and removing the LacZ cassette. OPN5 - / - The strain was created by crossing OPN5fl mice with E2a-cre (Jax stock 003724). OPN5 - / - The strains were grown under a mixed background (C57 / 129 / CD1 / FVB). All experiments used littermates as control animals, with the exception of C57BL / 6J mice housed under different lighting conditions. OPN5cre mice were generated in-house using CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 (CRISPR-associated protein 9) technology, as previously described.

[0075] Mice were given free respite to a standard diet (29% protein, 13% fat, and 58% carbohydrates kcal; LAB Diet 5010) and free access to water. Lactate controls were used for genetic crossbreeding, and unless otherwise specified, both male and female mice were included in the studies. The ages of the mice used included P8, P16, P21, P35, P60, P70, P90, and P120 days postnatally, as indicated in the relevant experiments.

[0076] (Lighting conditions) Animals were housed in a standard animal facility under fluorescent lighting (photon flux 1.62×10 15 photons cm -2 s -1 ) on a 12L:12D cycle, except when noted. For generation of “minus violet” animals, animals were housed in a lighting chamber adjusted to deliver full-spectrum lighting or violet-restricted lighting. For full-spectrum lighting (as above), light-emitting diodes (LEDs) were used to obtain a comparable total photon flux of 1.642×10 15 photons cm -2 s -1 . Spectral and photon flux information for full-spectrum LED lighting was as follows: near ultraviolet (λ max = 395 nm, 4.904×10 14 photons cm -2 s -1 ) in the range 375 - 435 nm, blue (λ max = 470 nm, 4.035×1014 photons cm -2 s -1 ) in the range 435 - 540 nm, and red (λ max = 660 nm, 7.411×1014 photons cm -2 s -1 ) in the range 600 - 700 nm. Spectral and photon flux information for minus violet LED lighting was as follows: blue (λ max = 470 nm, 7.509×10 14 photons cm -2 s -1 ) in the range 435 - 540 nm, and red (λ max = 630 nm, 9.705×10 14 photons cm -2 s -1 ), for a total of 1.736×1015 photons cm -2 s -1The photon beam was measured at approximately 24 inches from the light source, through an empty standard mouse cage. For the wavelength-limited experiment, C57BL / 6J animals were housed in either full-spectrum or minus-violet environments in a 12L:12D cycle starting in late pregnancy (embryonic stage E16.5). These mice were referred to as "full-spectrum" and "minus-violet" in the experiment.

[0077] (Virus vector) All viruses used in these studies were obtained from the Center for Neuroanatomy with Neurotropic Viruses (CNNV) through partner institutions at Princeton University, the University of Pittsburgh, and Thomas Jefferson University. For monosynaptic tracking of OPN5 POA neurons, CVS-N2c△G / EnvA-tdTomato rabies virus derived from a deletion mutant CVS-N2c rabies strain produced in Neuro2A neuroblastoma cells was used. For BAT projection mapping, PRV614-mRFP1, an attenuated laboratory pseudorabies strain expressing the red fluorescent protein mRFP1 under CMV promoter control, was used. For chemogenetic studies, AAV5-hSyn-DIO-hM3D(Gq)-mCherry and AAV5-hSyn-DIO-hM4D(Gi)-mCherry viruses were used. The CVS-N2c△G rabies virus was kindly provided by MJSchnell of Thomas Jefferson University. The PRV614-mRFP1 virus was kindly provided by LWEnquist of Princeton University. The AAV5-hSyn-DIO-hM3D(Gq)-mCherry and AAV5-hSyn-DIO-hM4D(Gi)-mCherry viruses were obtained via Addgene (plasmid numbers 44361 and 44362, respectively).

[0078] (Stereotaxic surgery) Mice were anesthetized with ventilated isoflurane (induction: 4%, maintenance: 1%-2%) and fixed to a stereotactic frame (Stoelting Co.). To track preoptic area OPN5 neurons, P21 OPN5cre;R26 RΦGT / Ai6 In a mouse, 0.5 μL of CVS-N2c rabies virus (titer: 1.0 × 10⁻¹⁴) was administered. 9 PFU / mL was injected into POA (coordinates relative to bregma: +0.40 mm AP, +0.20 mm ML, -4.00 mm DV). Six days after injection, mice (P27) were sacrificed and perfused with PBS and 4% paraformaldehyde. For BAT projection mapping, see P60 OPN5cre;R26 Ai6 / Ai6 The mice were dissected to expose the interscapular adipose region. Six 50nL nanoinjections of PRV614-mRFP1 virus (potency: 4.9 × 10⁶) were administered. 9 PFU / mL was administered bilaterally to the interscapular brown adipose tissue. The mice were then sacrificed and perfused with PBS and 4% paraformaldehyde 5 days after injection. For chemogenetic studies, 4-week-old male OPN5 mice were used. cre / + , OPN5 cre / - (OPN5 reporter null), and OPN5 + / + (cre-negative control) mice were given 1.0 μL of AAV5-hSyn-DIO-hM3D(Gq)-mCherry or AAV5-hSyn-DIO-hM4D(Gi)- mCherry virus (Titer: 7 × 10) 12 AAV (vg / mL) was injected into the POA (coordinates relative to bregma: +0.40 mm AP, +0.20 mm ML, -4.00 mm DV). All AAV-injected mice were given a recovery period of at least two weeks before further experiments.

[0079] (Chemogenetic manipulation experiment) The transplanted mice were transferred to a lighting chamber placed either at low temperature (4°C) or room temperature (22°C) for chemogenetic inhibitory hM4D(Gi) experiments, or only at room temperature (22°C) for chemogenetic excitatory hM3D(Gq) experiments. Recordings of BAT and core temperature were collected every 5 minutes for a total of 5 hours from 10:00 am to 3:00 pm. The lighting conditions were maintained at red (660 nm), blue (480 nm), and violet (380 nm) for all 5 hours. At the 2-hour mark, either CNO (1.0 mg / kg Gq DREADD, 2.0 mg / kg Gi DREADD) or vehicle (saline) was intraperitoneally administered to the animals. Both CNO and vehicle were given to all animals in separate experiments. Once the telemetry recordings were completed, the animals were administered CNO and sacrificed 6 hours later, and the relevant tissues were collected and the telemetry sensors were explanted.

[0080] (Thermoregulation and cold exposure assay) OPN5 null (OPN5 - / - ) and littermate controls (OPN5 + / + ) were subjected to deep body temperature assessment during acute cold exposure as described above in 7. Mice with conditionally deleted OPN5 from retinal progenitor cells (OPN5 fl / fl and Rx-cre;OPN5 fl / fl ), and conditionally deleted OPN5 from Lepr-expressing neurons in the POA (OPN5 fl / fl and Lepr-cre;OPN5 fl / fl ) were also subjected to this assay. Additionally, enucleated OPN5 + / + and OPN5 - / - mice, as well as "full spectrum" and "minus violet" housed C57BL / 6J animals were cold exposed.

[0081] Adult male and female P60 littermates were isolated from their home cages and individually housed in a custom-made illuminated chamber located in an electronically monitored 4°C cryogenic room for 3 or 5 hours, depending on the assay. Core body temperature was measured every 20 minutes during the assay using a RET-3 microprobe rectal thermometer (Kent Scientific Corporation, Torrington, CT) while the mice were conscious. Food and water were provided free of charge. The thermometer probe operator was not informed of the mouse genotype or previous temperature measurements throughout the experiment. At the end of the cold exposure, the mice were euthanized, and relevant tissues (BAT, inWAT, pgWAT) were dissected, weighed, and rapidly frozen for downstream molecular profiling.

[0082] For all 3-hour cold exposure assays, animals were exposed to a combination of red (660nm), blue (480nm), and violet (380nm) LEDs (RBV). For the 5-hour cold exposure assays, animals were exposed to red (660nm) and blue (480nm) illumination (RB) only for the first 3 hours. After the first 3 hours, violet light (380nm) was added between the 4th and 5th hours. All 3-hour cold exposure assays were performed during the animals' subjective daytime, from 11:00 AM to 2:00 PM. All 5-hour assays were performed from 10:00 AM to 3:00 PM.

[0083] (Remote temperature monitoring) P60 Adult Male OPN5 Null Mouse (OPN5) - / - ) and wild-type littermates (OPN 5+ / + Mice injected with either OPN5cre;AAV5-hM3D(Gq) or AAV5-hM4D(Gi) were implanted with indwelling telemetry sensors and subjected to a 5-hour cold (4°C) or ambient temperature (22°C) exposure assay. OPN5cre;AAV5-hM3D(Gq) animals were not subjected to the cold exposure assay. Briefly, the animals were placed in individual housings. The mice were transferred and adapted to a soft diet (DietGel® 76A and DietGel® Recovery+ 1 mg / 2 oz carprofen) three days prior to the transplant surgery. On the day of surgery, the animals were anesthetized, maintained with ventilated isoflurane, and a telemetry sensor (TTA-XS, Stellar Telemetry, TSE Systems) was subcutaneously implanted into the dorsal cavity. The sensor communicates wirelessly with an external antenna and features two external thermistor leads, one advanced beneath the iAT (BAT temperature) and the other advanced through the peritoneum and stationary within the mouse's visceral cavity (core temperature). Telemetry data were acquired using BIOPAC AcqKnowledge 5.0 software. The transplanted mice were returned to individual housings and monitored for at least two weeks prior to the experiment.

[0084] (Acute violet light stimulation experiment) The transplanted mice were transferred to a homemade illumination chamber placed at either low temperature (4°C) or room temperature (22°C). BAT and core temperature readings were collected every 5 minutes for a total of 5 hours, from 10:00 AM to 3:00 PM. Illumination conditions were maintained at red (660 nm) and blue (480 nm) throughout the 5 hours, or violet (380 nm) light was added at the 4th and 5th hours. After the experiment, the mice were returned to the light-controlled housing or sacrificed and perfused with 4% paraformaldehyde, and relevant tissues were collected and explanted with telemetry sensors.

[0085] (Imaging of intracellular cAMP dynamics) Ex vivo two-photon imaging of intracellular cAMP dynamics in acute brain slices was performed as follows.

[0086] (Preparation of acute brain slices) P30-P60 OPN5 cre / + ;CAMPER or OPN5 cre / -CAMPER male and female mice were darkened for 4 hours before tissue sampling. Ice-cooled modified artificial cerebrospinal fluid (mACSF, 92 mM NaCl, 2.5 mM KCl, 1.25 mM NaH2PO4, 30 mM NaHCO3, 25 mM glucose, 20 mM HEPES, 5 mM sodium ascorbate, 3 mM sodium pyruvate, 2 mM thiourea, 10 mM MgSO4·7H2O, 0.5 mM CaCl2·2H2O, titrated to pH=7.22 with NaOH) was equilibrated with 95% oxygen and 5% carbon dioxide. Under dim red light, the mice were anesthetized with isoflurane, their thoracic cavity was opened, and they were perfused transcardially with oxygenated ice-cooled mACSF. The brains were rapidly dissected and placed in oxygenated ice-cooled mACSF. 300 μm coronal sections were cut with a vibratome (Leica® VT1000 S), and the N-methyl-D-glucamine was recovered in a foil-covered, frothy, room-temperature N-methyl-D-glucamine recovery solution (NMDG, 92 mM N-methyl-D-glucamine, 2.5 mM KCl, 1.25 mM NaH2PO4, 30 mM NaHCO3, 25 mM glucose, 20 mM HEPES, 5 mM sodium ascorbate, 3 mM sodium pyruvate, 2 mM thiourea, 10 mM MgSO4·7H2O, 0.5 mM CaCl2·2H2O, 92 mM The cells were placed in N-methyl-D-glucamine (titrated to pH=7.25 with HCl) for 30 minutes. To record intracellular cAMP dynamics, slices were transferred to a recording chamber (RC-26G, Werner Instruments) and continuously perfused with oxygenated mACSF at 30-34°C at a rate of 2.1 mL / min. To isolate responses specific to hypothalamic neurons, 1 μM tetrodotoxin citrate (HB1035, Hello Bio) was added to the perfused cultured mACSF during imaging.

[0087] (Brain slice imaging) Two-photon imaging of FRET was performed using a Nikon A1R upright confocal microscope with the NIS Elements confocal software package v5.20.02. Images were acquired through a 16x immersion objective lens (CFI75 LWD 16X W, Nikon). mTurquoise (FRET donor) was imaged at 470-500nm (mTurquoise Rapgef3-expressing cells were excited by tuning a TiSapphire IR laser to 850 nm for two-photon imaging using FRET donor (CFP channel) and 525-575 nm (cp173Venus-Venus; FRET acceptor, YFP channel) bandpass emission filtration. To visually locate Rapgef3-expressing cells, POA was briefly exposed to 488 nm blue epifluorescence for less than 1 minute. Images were taken every minute for dark-treated and drug-treated cells. For cells irradiated with a 405 nm laser, images were taken every minute, with continuous 405 nm light stimulation for 1 minute in between. The drug was applied in a bath at 45 minutes into the experiment. 20 μM forskolin NKH477 (344281, EMD) Millipore), 200 μM IBMX (02195262-CF, MP Biomedicals), and 10 μg / mL digitonine (D141, Sigma Aldrich) were applied according to the experimental time point. △F (change in FRET) is expressed as the ratio of donor emission to acceptor emission (CFP / YFP). Images were processed and quantified using NIS Elements AR v5.20.00, ImageJ Ratio Plus plugin, and MATLAB® 2018a.

[0088] (Indirect calorimetry) Male and female OPN5 at ages P90-P120 + / + and OPN5 - / -Mice were acclimatized in a metabolic chamber (PhenoMaster®, TSE Systems GmbH, Germany) for three days prior to the start of the study. Mice were continuously recorded for a total of 16 days, with gas exchange (O2 and CO2), food intake, water intake, and spontaneous movement (in the XY plane) measured every 15 minutes. Ambient temperature was controlled via a climate-controlled chamber housing the metabolic chamber. VO2, VCO2, and energy consumption (EE) were calculated according to the manufacturer's guidelines (PhenoMaster® Software, TSE Systems GmbH, Germany), and EE was estimated via a shortened Weir equation. Respiratory exchange ratio (RER) was calculated using the ratio VCO2 / VO2. Mass-dependent variables (VO2, VCO2, EE) were not normalized to body weight. Food and water intake was measured by a top-mounted load cell sensor, from which food and water containers were suspended in a sealed cage environment. For food consumption, mice exhibiting excessive food-grabbing behavior were excluded from statistical analysis. After eight days of continuous recording, the cages were replaced with clean cages and sealed, and gas exchange re-equilibrium was completed within four hours. Body mass composition (fat and lean body mass) was measured using nuclear magnetic resonance and expressed as grams of fat and lean tissue, and as a percentage of total body weight.

[0089] For the CL-316,243 experiments, mice aged P90–P120 were acclimatized in a metabolic chamber (Promethion, Sable Systems International) for 3 days prior to the start of the study. Male and female OPN5+ / +, OPN5- / -, full-spectrum, and negative violet mice were included in these studies. Oxygen consumption (VO2), carbon dioxide production (CO2), energy expenditure (EE), respiratory exchange rate (RER), and kinetic activity (cm / s) were recorded every 5 minutes using Sable Systems International Metascreen software v2.3.15.11. Food and water were freely available. 1.0 mg / kg of CL316,243 or vehicle (saline) was administered intraperitoneally at the first hour of a 6-hour measurement window between 11:00 AM and 5:00 PM. All animals were subjected to both CL316,243 injection and vehicle injection in a randomized order. The data was exported using Sable Systems International ExpeData software v1.9.27.

[0090] (Infrared thermography (FLIR)) For whole-body infrared thermography imaging, adult (P90) and newborn (P8) OPN5 + / + and OPN5 - / - Mice were individually housed and placed in a homemade illuminated chamber at 4°C for 30 minutes. IR thermographic images were captured using a FLIR T530 infrared camera (L Using IR(registered trademark) Systems (Wilsonville, OR), a total of 30 images per minute were captured for each pair of adult P90 or P8 offspring. To quantify the interscapular region temperature, the pixel average from the region of interest drawn on the iAT was taken per image per mouse using FLIR Tools Desktop software v5.13.18031.2002. The size of the selected region of interest did not change. For comparative IR images, adult P90 mice were briefly anesthetized after 30 minutes of cold exposure and placed side by side. Adult OPN5 + / + and OPN5 - / -To quantify surface tail temperature in mice, animals were placed in tubular mouse restraints (Kent Scientific Corporation, Torrington, CT). These restraints allowed breathing through a slotted nose cone while immobilizing the animals with their tails exposed through a posterior port. Tail temperature was quantified per mouse, per minute, by describing a consistent size and pixel-averaged circular region of interest at a rostral-caudal distance from the base of the tail.

[0091] (Video tracking) P60 male OPN5 + / + and OPN5 - / - Mice were placed in a custom-made cylindrical open-top acrylic enclosure with paper bedding and concentrate, located in an electronically monitored 4°C low-temperature chamber. A recording camera (Fujifilm XT-10, with Samyang 12mm f / 2.0 lens) was mounted approximately 24 inches above the cage, recording video at 24 frames per second for a total of 140 minutes. Ambient 480nm and 660nm LEDs provided red and blue illumination, and at 80 minutes, a 380nm purple LED was switched on. The video was re-encoded at 2.4 frames per second and analyzed by center-of-gravity-based motion tracking using NIS Elements Ar v5.20.00.

[0092] (Non-invasive blood pressure measurement) The animals were placed on a heated stage for 2-3 days prior to the study using a tubular mouse restraint (Kent). The animals were adapted to the CODA (Kent Scientific Corporation) High Throughput Noninvasive Blood Pressure System (Kent). On the day of the experiment, the animals were placed inside a restraint on a heating stage. The animals were connected to a tail occlusion cuff and a volumetric pressure recording (VPR) cuff communicating with a Scientific Corporation (CODA) system. Thirty tail occlusion and VPR recording trials were automatically and continuously collected for each animal, and systolic / diastolic blood pressure, mean arterial pressure, and pulse rate were calculated using CODA® Data Acquisition Software v4.1.

[0093] (Intrafat tissue radiation measurement) The Holt-Sweeney microprobe was fabricated as described in 30 above. One end of a 100 μm silica core optical fiber patch cable (Ocean Optics, Dunedin, FL, USA) was terminated. The fiber branch tube and jacket were stripped off, and the polyimide buffer of the fiber was removed from the end of the fiber using a butane torch for 5 cm. A 10 g weight was attached to the end of the fiber and then heated and pulled with a butane torch to narrow the diameter. The narrowed area of ​​the fiber was then cut using carborundum paper to obtain a flat fiber end with a diameter of 30-50 μm. The sides of the narrowed fiber were painted with a film opaque pen to prevent stray light from entering, leaving a small transparent opening at the tip of the fiber. For structural support, this bare tapered fiber was then fixed to the tip of a stretched glass Pasteur pipette using a drop of cyanoacrylate adhesive, with only 6-9 mm of the bare optical fiber protruding. For spectral scalar irradiance measurements, a small light-scattering ball was added to the end of a tapered optical fiber. To do this, titanium dioxide was bonded to a high-viscosity UV-curable resin, DELO-PHOTOBOND, GB68 (DELO Industrie Klebstoffe, Windach, Germany). The mixture was then completely combined. The tip of the stretched fiber was quickly inserted and removed from the droplet of resin-titanium dioxide mixture, yielding a sphere with a diameter approximately twice that of the tapered fiber. Since all measurements from a particular probe are normalized to the signal from the same probe in a gelatin blank, small variations in probe diameter do not affect the results. The sphere was cured for 12 hours using a Thorlabs fiber-coupled LED light source (M375F2, Thorlabs Inc, Newton, NJ, USA).

[0094] For intratissue radiometry in mice, animals were anesthetized under ventilated isoflurane and placed on a mouse stereotactic frame (Stoelting Co, Wood Dale, IL, USA). Hair on the scalp was shaved, and the skin was incised rostrally and caudally to expose the cranial surface. The skull was destroyed with a 0.5 mm diameter micromotor drill 0.4 mm anterior and 0.2 mm lateral to the bregma. Subsequently, a Holt-Sweeney microprobe was fixed to the stereotactic frame, positioned at AP+0.40 mm, ML+0.20 mm, and lowered to DL-4.00 mm in 0.50 mm increments. While the probe was in the appropriate position, the scalp skin was repositioned to cover as much of the incision site as possible without obstructing the probe's descent. For broadband light irradiation, a Thorlabs plasma light source (HPLS345, Thorlabs Inc, Newton, NJ, USA) was placed above and in front of the mouse stereotactic frame. Light was delivered to the animal via a 5mm liquid light guide connected to a 2-inch collimating lens fixed in a vise. The distance from the collimating lens to the animal was approximately 2 feet.

[0095] Scalar irradiance measurements as a function of wavelength were obtained at the cortical surface and at probe depth increments from 0.50 mm to 4.00 mm. Spectral irradiance data were collected using an Ocean Optics 200–850 nm spectrometer (JAZ Series, Ocean Optics, Dunedin, FL, USA) and recorded using Ocean Optics OceanView v1.6.5 software.

[0096] (Tissue processing, sectioning, and immunohistochemistry) Animals were anesthetized under isoflurane and perfused intracardiacly with 4% paraformaldehyde solution. For immunofluorescence, the brain was dissected and post-fixed overnight in cold 4% paraformaldehyde at 4°C. After washing in PBS, the brain was cryoprotected in sucrose solution and embedded in a cryostat (Leica® CM3050 S) for sectioning. 30 μm sections were obtained and subsequently treated for immunofluorescence (IF). For immunohistochemistry, iAT and inWAT tissues were dissected and post-fixed overnight in 4% paraformaldehyde at room temperature. After washing in PBS, the tissues were processed (Leica® ASP300 S) and embedded (Tissue-Tek® TEC® 6). The embedded tissue blocks were cut to a thickness of 4.5 μm using a microtome (Leica® RM2255). The slides were incubated overnight in primary medium at 4°C, rinsed, and then incubated in secondary medium at room temperature for 1 hour. The slides were then rinsed and mounted with VectaShield® HardSet® anti-fade mounting medium containing DAPI.

[0097] Antibodies used for IF include NeuroTrace® 435 / 455 blue fluorescent Nissl stain (ThermoFisher Scientific, N21479, 1:100 dilution), anti-isolectin IB4 antibody (ThermoFisher Scientific, I21411, 1:300 dilution), anti-tyrosine hydroxylase antibody (Abcam, ab113, 1:500 dilution), and anti-insulin antibody (Dako, A0564, 1500 dilution). Antibodies used for IHC include anti-UCP1 antibody (Abcam, ab10983, 1:500 dilution).

[0098] (Xgal staining) For Xgal labeling, P10 OPN5lacZ and P16 Lepr-cre;Ai14;OPN5 lacZThe animals were anesthetized and perfused transcardially with Xgal fixative (1% formaldehyde, 0.2% glutaraldehyde, 2 mM MgCl2, 5 mM EGTA, and 0.01% Nonidet P-40). The brains were dissected and post-fixed overnight at 4°C in cold Xgal fixative. The brains were then washed, cryoprotected as described above, and labeled with Xgal enzyme. The reaction was closely monitored and stopped when background began to appear in the control (lacZ-negative) tissue. After four washes in PBS, 30 μm frozen sections from OPN5 lacZ animals were briefly post-fixed in 4% paraformaldehyde, counterstained with Nuclear Fast Red, dehydrated, and then imaged under standard transmission brightfield using Zeiss AxioVision v4.9.1 SP2 software. Lepr-cre;Ai14;OPN5 lac Nuclear Fast Red counterstaining was not applied to the Z-frozen sections.

[0099] (Cell size quantification (inWAT)) Hematoxylin-stained paraffin-sectioned inWAT samples were imaged under 594 nm excitation via a rhodamine filter. Monochrome images were thresholded, and adipocyte boundaries were automatically detected using NIS Elements Advanced Research v5.20.00 software (Nikon Instruments Inc.). Individual cells were defined as distinct objects in a binary layer, filtered for roundness and size, and their areas were measured in μm². Approximately 500–1000 cells were measured, and at least 20 fields of view were analyzed per animal to obtain a total of 10,000–20,000 cells per animal. Cell areas were binned at 100 μm² intervals, and the frequency (%) of all cells was recorded for each interval.

[0100] Multiple fluorescence in situ hybridization (M-FISH) M-FISH experiments were performed using fresh frozen brain tissue. In short, P21 males and females OPN5 cre / +Ai14 mice were sacrificed, and their brains were rapidly dissected and placed in freeze-embedding medium. The embedded brains were rapidly frozen in liquid nitrogen to obtain 14 μm frozen sections of POA, which were processed for M-FISH using RNAscope® Fluorescence Multiplex Reagent Kit V1 (ACDBio). Probes for Slc32a1 (Vgat), Slc17a6 (Vglut2), Adcyap1 (PACAP), Bdnf (BDNF), and tdTomato mRNA were used. In-situ hybridization was performed on fresh frozen tissue according to the manufacturer's protocol. Briefly, POA sections were pre-treated by sequentially immersing slides in 1×PBS, nuclease-free water, and 100% EtOH at room temperature for 2 minutes each. Probe hybridization was achieved by incubating sections in 40 μL of mRNA-targeted probe at 40°C for 2 hours, followed by signal amplification at 40°C for 30, 15, 30, and 15 minutes, respectively, using the manufacturer-provided Amp1, Amp2, Amp3, and Amp4 reagents. After each incubation step, two 2-minute washes were performed with the manufacturer-provided wash buffer. Slides were mounted using Tris-buffered fluorogel mounting medium (Electron Microscopy Sciences).

[0101] (M-FISH quantification) 60x field of view, n=3 animal-derived OPN5 cre / + ;Obtained from the Ai14 POA region. Before cell counting, a negative control region of interest (ROI) was acquired. Single-cell images (715 μm² ROI) of ependymal cells or dura mater cells were acquired, and background labeling was calculated for all three channels, which varied across experiments and probes. Multiple 715 μm² ROIs representing the target cells were acquired using the nuclear marker channel (DAPI) and the tdTomato (C2) probe. Then, for each ROI, spots from C1 (Slc32a1 or Bdnf) and C3 (Slc17a6 or Adcyap1) were calculated to marker cells. Cells were evaluated as positive or negative for each of the following criteria. A cell was considered positive if the number of spots was 1.5 times the background of the section. A total of 109 cells from n=3 animals were used for Slc32a1 and Slc17a6 evaluation, and a total of 97 cells from n=3 animals were used for Bdnf and Adcyap1 evaluation.

[0102] (Serum lipids and thyroid hormones) Serum was collected from P90-P120 OPN5+ / + and OPN5- / - male and female mice and rapidly frozen. Lipid profiles (TG, PL, CHOL, NEFA) were obtained using a standard colorimetric method (NIH 2U2C-DK059630-16) performed at the University of Cincinnati Mouse Metabolic Phenotyping Center. Briefly, triglycerides were quantified using the GPO-PAP method (Randox), phospholipids using the choline oxidase-DAOS method (Wako Diagnostics), cholesterol using the Infinity® cholesterol liquid stabilization reagent method (Thermo Scientific), and NEFA using the ACS-ACOD method (Wako Diagnostics). Colorimetric measurements were obtained using HT (BioTek). Serum levels of free thyroxine (T4) and thyroid-stimulating hormone-releasing hormone (TRH) were measured using competitive ELISA at the University of Massachusetts MMPC (NIH 5U2C-DK093000-07).

[0103] (Western blotting) Western blotting was performed using a standard protocol. Animal-derived BAT was dissected in 400 μL of modified RIPA lysis buffer and homogenized using zirconium oxide beads (2.0 mm) (Tissue Lyser II, Qiagen). After centrifugation and protein quantification (Pierce® BCA Protein Assay Kit), 10 μg of protein was loaded onto a 16% Novex Tris-glycine protein gel and transferred to a PVDF (polyvinylidene difluoride) membrane, where the bands were visualized by chemiluminescence. Antibodies used for Western blotting included anti-UCP 1 (Abcam, ab10983, 1:5000 dilution) and anti-α-tubulin (Abcam, ab4074, 1:5000 dilution).

[0104] (Quantitative RT-PCR) Fat deposits within the scapula were collected immediately after the cold exposure assay. Rapidly frozen tissue was homogenized in TRI reagent (Invitrogen) using RNase-free zirconium oxide beads (2.0 mm) in a TissueLyser II sample disruptor (Qiagen). Phase separation was achieved with chloroform, and RNA in the aqueous phase was precipitated with ethanol and purified by column using the GeneJET RNA purification kit (ThermoFisher Scientific no. K0732). Subsequently, the purified RNA was treated with RNase-free DNase I (ThermoFisher Scientific no. EN0521), and cDNA was synthesized using the Verso cDNA synthesis kit (ThermoFisher Scientific AB1453 / B). Quantitative RT-PCR was performed using the ThermoFisher QuantStudio 6&7 Flex Real-Time PCR system with Radiant® SYBR Green Lo-ROX qPCR mix (Alkali Scientific Inc.). Relative expression was calculated using the △△CT method with Tbp (TATA-binding protein) as the normalized gene. Statistical significance was calculated using two-way ANOVA followed by Tukey post-hoc analysis, with a p-value cutoff of 0.05.

[0105] (Statistics and Reproducibility) Statistical and image analyses were performed using MATLAB 2018a, NIS Elements Ar v.5.20.00, and ImageJ. The sample size for each experiment is reported in the manuscript or figure. The number of experimental repetitions was as follows: Figures 4a and 4b were repeated 12 times; Figures 4c and 4d were repeated 3 times; Figures 4e through 4k were repeated 3 times; Figures 4l through 4x were repeated 7 times; Figures 5a through 5i were repeated 5 times; Figures 5j through 5u were repeated 4 times; Figures 6a through 6d were repeated 5 times; Figure 6e was repeated 2 times; Figures 6f through 6h were repeated 2 times; and Figures 7a through 7k were repeated 4 times.

[0106] (Adaptive thermogenesis in mice is enhanced by opsin 3-dependent adipocyte photosensing. According to some embodiments, white adipocytes activate the lipolysis pathway to produce free fatty acids that are used as heating fuel by brown adipose tissue. Opsin 3 is required for blue light-enhanced activation of the lipolysis pathway, which explains the lower body temperature of OPN3 mutant mice, for example. Considering in more detail, adipocytes express encephalopsin (OPN3), an opsin sensitive to 480 nm blue light, and mice lacking OPN3 or blue light have reduced thermogenesis during cold exposure. Loss of OPN3 reduces oxygen and energy consumption, and white adipocytes with OPN3 promote lipolysis during cold exposure.)

[0107] Almost all living organisms can detect and decode light information for adaptive advantages. Examples include the visual system, where photoreceptor signals are processed into virtual images, and the circadian system, where light synchronizes the physiological clock. According to some embodiments, the photoresponsive pathway in mice modulates adipocyte function using encephalopsin (OPN3, 480 nm, blue light-responsive opsin). Germline null mice and adipocyte-specific condition null mice exhibit light- and OPN3-dependent deficiencies in thermogenesis and become hypothermic upon cold exposure. Stimulation of mouse adipocytes with blue light enhances the lipolytic response, particularly the phosphorylation of hormone-sensitive lipases. This response is OPN3-dependent. These data establish a key mechanism by which light-dependent local regulation of the lipolytic response in white adipocytes modulates energy metabolism.

[0108] The detection of photons by animals is utilized in many ways for adaptive advantages. Vision (detection of irradiance by retinal photoreceptors and formation of virtual images in the brain) is the most obvious example, as it is a component of conscious existence. However, in many types of animals, various non-visual ocular photoreceptors function in parallel. In mammals, the most well-characterized are the retinal ganglion cells expressing melanopsin (opsin 4 [OPN4]) and neuropsin (OPN5), which function in negative phototaxis, circadian clock synchronization, pupillary light reflex, and eye development.

[0109] Photoreceptors that function outside the eye are present throughout the animal kingdom. They exist as chromatophores in the skin of frogs, in the pineal gland that produces melatonin, and as deep brain photoreceptors that regulate seasonal reproductive responses in bird species. Until the extraocular expression domains of OPN3, OPN4, and OPN5 were defined, it was assumed that mammals did not possess extraocular photoreceptors. However, according to some embodiments, OPN5 can photosynchronize the circadian clock in the skin, and OPN4 can acutely regulate vasodilation. Adipocyte function may be regulated by photostimulation of OPN4. Attempts to express mammalian OPN3 have proven difficult, but studies of its vertebral orthologue derived from pufferfish suggest that it may function as a photosensitive opsin. Evidence for OPN3-mediated extraocular photoreception is accumulating in both mice and humans.

[0110] Mammals use three types of adipocytes. White adipose tissue (WAT) consists mainly of white adipocytes and is the primary energy storage site. Brown adipose tissue (BAT) consists only of brown adipocytes that generate heat through non-shivering thermogenesis (NST). Under cold exposure conditions, WAT is divided into "brite" adipocytes that possess functional UCP1. While it can be converted into fat, its capacity is at most one-third that of BAT. The lipolysis process releases free fatty acids (FFAs) and glycerol from WAT for systemic use. BAT then uses FFAs for heat generation through oxidative uncoupling via UCP1. Therefore, both WAT and BAT play important roles in regulating energy balance. Originally, it was thought that only human neonates had significant accumulations of brown fat, but it is now understood that brown fat is also present in adults. There is growing evidence suggesting that BAT activation may be beneficial in protecting against metabolic syndrome.

[0111] According to the embodiments, the extraocular function of OPN3 in the light-dependent regulation of adipocyte function is described. Upon cold exposure, mice with adipocyte-specific deletion of OPN3 are unable to properly defend their body temperature, exhibit attenuated induction of cold-induced genes in BAT, and utilize less fat during fasting. Many of these phenotypes are reproduced in mice raised without blue light wavelengths that normally stimulate OPN3. Furthermore, according to some embodiments, blue light has an adipocyte-specific acute stimulating effect on heat production. These metabolic perturbations appear to be explained by the OPN3 and blue light dependence of the lipolytic response, a pathway that normally provides fatty acid fuel for heat production. These data identify an unexpected mechanism of photo-information decoding for energy homeostasis.

[0112] (OPN3 is expressed in adipocytes.) Since reliable antibodies against mouse OPN3 are not currently available, OPN3 expression is determined by the expression of three alleles, namely OPN3 lacz , OPN3 cre Evaluation was performed using the tdTomato reporter Ai14 (in combination with OPN3-eGFP) and an expression reporter transgene (GENSAT030727-UCD) based on bacterial artificial chromosomes. The interscapular adipocyte (iAT) depot contains interscapular subcutaneous white adipocytes (iscWAT) and interscapular brown adipocytes (iBAT). X-gal labeling of control frozen sections from postnatal (P)16 iAT did not show background labeling in wild-type mice (Figure 8A), but OPN3 lacz / lacz Labeled adipocytes showed strong labeling in iscWAT (Figure 8B). Labeled adipocytes were not detected in control iBAT (Figure 8C). OPN3 lacz / lacz In the derived iBAT, X-gal labeled cells were not readily apparent, but a subset expressing brown adipocytes was detected under higher magnification and brighter transmitted illumination (Figure 8D).

[0113] Neonatal inguinal white adipocytes (inWAT) have a high concentration of Bright adipocytes (Figures 8E and 8F, BrAd). In control P16 inWAT, neither large unilocular white adipocytes nor smaller Bright adipocytes were X-gal labeled (Figures 8E and 8G). In contrast, OPN3 lacz / lacz Large, unilocular white adipocytes derived from mice were X-gal positive (Figures 8F and 8H). OPN3 cre When the tdTomato reporter Ai14 was converted using the allele (Figures 8I and 8K), frozen sections showed positivity in almost all adipocytes within iscWAT (Figures 8I and 8K). In iBAT, a subset of brown adipocytes were positivity (Figures 8J and 8K). The OPN3-eGFP reporter confirmed OPN3 expression in most white and brown adipocytes. Finally, Genotype-Tissue Expression (GTEx; accession phs000424.v7.p2, accessed February 21, 2018) data reported low to moderate expression of OPN3 in human subcutaneous and omental adipose tissue (2.9 and 3.1 tags / million, respectively). These data indicate that both mouse and human adipose tissue express OPN3, enhancing its potential for direct photoresponsiveness.

[0114] (The photon flux within iscWAT and iBAT is sufficient for opsin activation.) To measure the photon flux within the iAT of pigmented mice (Figure 9A), Holt-Sweeney A microprobe (HSM) (Figure 9B) was fabricated from a light-shielding optical fiber, and a transparent spherical focusing tip was attached to enable omnidirectional measurement of scalar irradiance under constant angular sensitivity. The microprobe was mounted inside an extended Pasteur pipette and lowered into the iAT using a positional fixing frame. Photon flux measurements were performed every 0.5 mm up to a total depth of 2.5 mm over the spectral range of 350-800 nm (Figure 9C). At λmax of 480 nm for OPN3 (Figure 9D), the measured photon flux was 5 × 10⁻¹⁶ at 0.5 mm (the deepest point in the iscWAT). 14 photon cm -2 s -1(Figure 9C) and 2.5 mm (deepest point in iBAT) for 2 × 10 13 photon cm -2 s -1 (Figure 9C) Surface illumination was controlled to 1% of the intensity of sunny daylight (direct sunlight intensity was 2 × 10⁻⁶). 17 photon cm -2 s -1 (This was measured as follows). Total light attenuation ranged from less than 1 log quantum at 0.5 mm to slightly more than 2 log quantum at 2.5 mm. Extrapolating to total sunlight, the iscWAT photon flux was approximately 5 × 10⁻¹⁶. 16 photon cm -2 s -1 It is likely that the signaling threshold for atypical opsins is 10 10 photon cm -2 s -1 The level is low (Wong, 2012). Therefore, these data indicate that iscWAT and iBAT photon fluxes are sufficient for opsin stimulation.

[0115] (Transcriptome analysis suggests that OPN3 regulates metabolism.) To address OPN3 function, microarray-based transcriptome analysis was performed on P16 control and OPN3 germline null mice. iAT and inWAT were collected together with liver (low-expression control). Using the AltAnalyze suite, Z-score significant clustering of differentially regulated transcripts (red, upregulated; blue, downregulated) was identified in a selected WikiPathway model with a more detailed schematic diagram. As expected, OPN3 transcripts showed a 3.0-fold decrease in iAT compared to OPN3 null mice (p=1.5×10⁻¹⁶). -4 ) and inWAT (5.6 times decrease, p = 7.6 × 10) - 3) showed the highest negative magnification change, but there was no significant change in the liver. Overall, transcriptome analysis demonstrated that OPN3 activity is necessary for normal metabolic regulation, as evidenced by the disregard of adipocyte extracellular matrix, lipids, glucose, and energy production pathways.

[0116] Figure 8 shows, for example, the expression of OPN3 in iAT and inWAT. (A-D): Xgal-labeled wild-type (A and C) and OPN3 of iAT, including iscWAT (A and B) and iBAT (C and D) of P16. lacz / lacz (B and D) Frozen sections. (E~H): X-gal labeled wild-type (E and G) and OPN3 inWAT, including white adipocytes (WAd) and Bright adipocytes (BrAd). lacz / lacz (F and H) Frozen sections. (G and H): Wild type (G) and OPN3 lacz / lacz (H) Higher magnification of inWAT in frozen sections. (I~K): OPN3 for iAT showing positive cells in iscWAT (enlarged region in I and K) and iBAT (enlarged region in J and K) cre Detection of tdTomato (red, grayscale) in Ai14 mice. iscWAT and iBAT are separated by muscle (m) lobules. Nuclei labeled with Hoechst33258 are shown in green. Scale bars: (A, B, E, F, and K) 100 μm, and (C, D, and G~J) 50 μm.

[0117] In inWAT, OPN3-dependent differentially regulated transcripts are found in the peroxisome proliferator-activated receptor (PPAR) pathway and the mitochondrial electron transport chain (ETC). Star formation occurs (Figure 10A). The PPAR pathway regulates adipocyte size, as well as lipid metabolism and energy production. Several components of the lipolytic pathway, including HSL (hormone-sensitive lipase), ATGL (lipid triglyceride lipase), and perilipin (PLIN), are involved. Since its expression is directly or indirectly dependent on the transcriptional coactivator PGC1α, this pathway partially regulates energy production. Furthermore, UCP1 is downregulated, possibly in response to the deregulation of its transcription factors PGC1a and RXRa / b. Notably, the transcript of lipoprotein lipase (Lpl), an enzyme that plays a role in extracellular lipolysis, is deregulated in the liver of OPN3 null mice. Finally, inWAT from OPN3 null mice showed a significant cluster of 17 downregulated ETC transcripts (Figure 10A). Taken together, these data suggest deregulated energy metabolism in OPN3 null mice.

[0118] Detection of UCP1 in inWAT by either immunofluorescence (Figure 10B) or immunoblotting (Figure 10C) confirmed relatively low levels in OPN3 null mice. Evaluation of inWAT size showed that OPN3 null mice had larger adipocytes on average (Figure 10D). Hematoxylin inWAT staining also showed a lower proportion of smaller Bright adipocytes, consistent with the adipocyte size evaluation (Figure 10E).

[0119] Next, total NAD content was measured in OPN3 null mice to evaluate mitochondrial function. Quantification showed no change in liver NAD in OPN3 null mice, but a decrease in inWAT (Figure 10F), which was consistent with a decrease in mitochondrial content. Transcriptome analysis of OPN3 null iBAT did not show ETC clustering, but the mitochondrial state of iBAT was evaluated based on the effect of OPN3 deficiency on inWAT. Immunoblotting of ETC components ATP5A (complex V), COX1 (complex IV), SDHB (complex II), NDUFB8 (complex I), and UCP1 revealed some variation in the presence of SDHB in OPN3 null mice, but the levels of both NDUFB8 and UCP1 were consistently low (Figure 10G). Correspondingly, iBAT transmission electron microscopy (TEM) in P28 revealed disordered organelle folds, similar to those in Ucp1 null mice (Figure 10H), partially suggesting OPN3-dependent changes in mitochondrial maintenance and / or organization.

[0120] Figure 9 shows, for example, the measurement of photon flux in iBAT and iscWAT. (A): Schematic diagram illustrating the setup for measuring intra-tissue photon flux. Collimated photons from a plasma source are directed into an anesthetized mouse and guided into it via a fiber probe stereotactic frame. The spectrum is measured by an OceanOptics spectrometer. (B): The Holt-Sweeney microprobe (scale bar: 100 μm) is an optical fiber with a transparent spherical tip that accepts photons over approximately 4π steradians. (C): Measurement depth according to iAT. (D): Absolute photon flux within interscapular fat color coded for depth. The top blue trace is surface flux, and λ for OPN3. max In this case, approximately 2 × 10 15 photon cm -2 s -1 Therefore, at a maximum depth of 2.5 mm (brown trace), the flux at OPN3λmax is approximately 1 × 10⁻⁶.13 photon cm -2 s -1 Each trace represents the average data from n=3 mice. The intensity of the color is ± standard error.

[0121] To evaluate the function of OPN3 as a photoreceptor opsin, C57BL / 6J mice were reared under "minus blue" lighting conditions from embryonic stage (E) 16.5 (see STAR method) and compared to mice reared under full-spectrum conditions. Subtracting the 480 nm wavelength reduces the total photon flux, but since opsins are sensitive to specific wavelengths, this lighting paradigm ensures that opsins other than blue are stimulated without change. Minus blue lighting yielded inWAT with larger quantifiable adipocytes (Figure 10I), lower bright adipocyte content (Figure 10J), and lower total NAD (Figure 10K). Furthermore, the minus-blue iBAT mice showed lower levels of NDUFB8 and UCP1 (Figure 10L). Compared to OPN3 null mice, the minus-blue phenotype was milder. This can be explained by residual activation of OPN3 due to the low efficiency absorption of purple and red photons. Overall, these data support the hypothesis that OPN3 functions as a photosensor that regulates adipose tissue development.

[0122] (Adaptive thermogenesis in mice is promoted by blue light in an OPN3-dependent manner.) In mice, body temperature is partially maintained by skeletal muscle shivering or by heat generated in the BAT via the NST pathway utilizing UCP1, creatine metabolism, and calcium circulation. Energy for heat production is partially provided by the oxidative metabolism of FFA stored in adipocytes. Therefore, the lipolysis process that releases FFA is crucial for a normal NST. Furthermore, lipolysis in white adipocytes has been shown to be directly necessary to fuel the NST. In some embodiments, several features of OPN3 null and minus blue mice suggested a deficiency with NST.

[0123] Figure 10 shows, for example, the inWAT phenotypes of OPN3 null and minus blue reared mice. (A): Schematic diagram of clustered OPN3-dependent transcript changes in the PPAR (WP2316), lipid uptake, and mitochondrial ETC (WP295) pathways (red: upregulation; blue: downregulation). (B): P16 control and OPN3 lacz / lacz UCP1 (green) markers for inWAT in animals. (C): OPN3+ / + and OPN3 lacz / lacz Immunoblot for detecting UCP1 and β-tubulin (TUBB) in mouse-derived P16 inWAT. (D~L)P16 control and OPN3 lacz / lacz Adipocyte size distribution in WAT (D and I) comparing (D) and full-spectrum vs. minus blue producing (I) mice. Data are presented as mean ± standard error for each genotype, n=3. Direct comparisons between genotypes at each interval were performed using Student's t-test (*p<0.05, **p<0.01, ***p<0.001). (E and J): OPN3 + / + , OPN3 lacz / lacz (E) Hematoxylin staining of P16 inWAT tissue sections from mice housed in full spectrum (380, 480, and 630 nm) versus mice housed in minus blue (380 and 630 nm) (J). (F and K): P16 OPN3 + / + and OPN3 lacz / lacz InWAT and total NAD levels in the liver of mice (F, n=4) or mice housed under either full-spectrum or negative-blue lighting (K, n=3). p-values ​​were calculated using Student's t-test. (G and L): OPN3 + / + , OPN3 lacz / lacz Immunoblotting to detect multiple components of ETC (ATP5A, COX1, SDHB, NDUFB8, and UCP1) in P16 iAT of mice housed in negative blue. (H): TEM showing abnormal mitochondrial morphology in OPN3 null iBAT at P28. Scale bars: (B) 500 μm, (E and J) 100 μm, (H) 2 μm.

[0124] Figure 11 shows, for example, that OPN3 is required for light-dependent enhancement of the thermogenic response: CBT evaluation over time after 4°C cold exposure for P21-P24 (neonatal) or adult mice of the indicated genotypes. Illumination conditions during cold exposure are indicated by colored lines on the horizontal axis of the chart. (A): OPN3 under full-spectrum (380+480+630nm) illumination lacz / lacz and the control OPN3 + / + CBT during cold exposure in [location]. (B): OPN3 in full-spectrum illumination △Ex2 / △Ex2 and the control OPN3 + / + CBT during cold exposure in C57BL / 6J background mice. (C): CBT levels in C57BL / 6J mice during cold exposure were elevated under either full-spectrum (gray trace) or negative blue (380+630 nm, blue trace) illumination. (D): CBT during cold exposure in the same cohort of mice shown in (A), except with negative blue lighting. (E): Same as (D), except for adult mice (2 months old). (F):OPN3 lacz / lacz and the control OPN3 + / + CBT during cold exposure under 180 minutes of full-spectrum (380+480+630nm) illumination and an additional 120 minutes of negative blue (480nm retreat) illumination. Data are presented as mean ± standard error.

[0125] According to some embodiments, OPN3 + / + and OPN3 lacz / lacz When neonatal mice were exposed to full-spectrum illumination at 4°C for 3 hours, the core body temperature (CBT) of OPN3 null mice was lower than that of wild-type mice (Figure 11A). lacz / laczTo explain the potential thermogenic effects caused by a mixed genetic background in mice, CRISPR(OPN3) △Ex2 Novel OPN3 loss-of-function alleles were generated on a pure C57BL / 6J background using ) and the analysis was repeated. △Ex2 / △Ex2 The mice also exhibited lower protective CBT (Figure 11B), confirming that the decrease in NST was OPN3-dependent. According to some embodiments, the claim that OPN3 functions as a photosensor could be tested again by assessing NST in minus blue mice. After 3 hours of cold exposure, minus blue mice similarly exhibited lower protective CBT than mice housed under full-spectrum illumination (Figure 11C). These data suggest that the absence of 480 nm light, which normally stimulates OPN3 during development, mimics a genetic loss of function.

[0126] Simultaneously, OPN3 was found to be capable of mediating acute photoresponses. In some embodiments, this was tested by exposing the same cohort of OPN3 wild-type and null mice (Figure 11A) to cold under negative blue illumination. Interestingly, CBT in control mice and OPN3 null mice was not statistically distinguishable (Figure 11D). This suggests that blue light can rapidly promote adaptive NST via OPN3, and that OPN3 activity is required for this effect.

[0127] Neonatal mice have a higher beige adipocyte content than adult mice, which may reflect specific NST requirements given their lower mass-to-surface area ratio. Therefore, we also attempted to establish whether adult mice exhibit a blue light-enhanced OPN3-dependent NST response. For analysis, two types of experiments were performed. First, CBT was evaluated in cohorts of adult controls and OPN3 null mice under negative blue conditions, showing that they were indistinguishable (Figure 11E). Next, using the same cohort of mice, the evaluation was repeated under full-spectrum illumination, showing that wild-type mouse CBT was higher than that of OPN3 null mice over 3 hours of cold exposure (Figure 11F, up to 180 minutes). This indicates that, as with neonatal mice, adult NST is enhanced by light and OPN3 activity. At 180 minutes, the 480 nm light was turned off, and a decrease was observed in wild-type mouse CBT, making it indistinguishable from that of OPN3 null mice. This provides further evidence that blue light can acutely regulate adaptive thermogenesis in an OPN3-dependent manner, and that this can occur in both neonatal and adult mice.

[0128] (White adipocyte OPN3 is required for a normal thermogenesis response.) To determine whether the germline null phenotype may be attributable to adipocyte OPN3, the inventors conditionally deleted OPN3 using panadipocytes Adipoq-cre. . Newborn Adipoq-cre;OPN3 fl / fl The mouse's inWAT is OPN3 lacz / lacz And, similar to the minus blue mice, they exhibit a low beige content (Figures 12A and 12B) and a larger adipocyte size distribution (Figure 12C). This is consistent with the hypothesis that OPN3 functions as a photosensor within adipocytes to regulate adipose tissue development.

[0129] Since both brown and white adipocytes express OPN3, the decrease in NST in OPN3 null mice could be explained by either BAT deficiency or WAT deficiency (or both). Therefore, CBT was measured in a cohort of neonatal mice in which OPN3 was conditionally deleted either from brown adipocytes with Ucp1-cre or from all adipocytes with Adipoq-cre. Ucp1-cre;OPN3 fl / fl and Adipoq-cre;OPN3 fl / fl Efficient cre-mediated deletion of the floxed region of OPN3 in both mice was first confirmed by PCR. Cold-exposed Ucp1-cre;OPN3 fl / fl The mouse, under arbitrary lighting conditions, compared to the control OPN3 fl / fl The cells possessed CBT indistinguishable from that of mice (Figures 12D and 12E). This indicated that brown adipocyte OPN3 is not required for normal NST.

[0130] In contrast, neonatal Adipoq-cre;OPN3 under full-spectrum illumination fl / flマ Us is OPN3 fl / fl They showed a more limited ability to protect their body temperature than control mice (Figure 12F). When 480 nm light was removed for 180 minutes, OPN3 fl / fl CBT in mice rapidly decreased to the level of the conditional null (Figure 12F). Adult OPN3 fl / fl and Adipoq-cre;OPN3 fl / fl Repeated cold exposure experiments in null mice showed similar heat production deficits (Figures 12G and 12H), and it was found that the absence of blue light can mimic the conditional loss of adipocyte OPN3 through cold exposure (Figure 12G) or rapidly within 180 minutes (Figure 12H). Rx-cre;OPN3 is conditionally deleted from retinal neurons. fl / fl The absence of NST deficiency in mice confirms that retinal OPN3 is not required for this pathway. Furthermore, Adipoq-cre;OPN3 fl / flUnchanged tail temperature, measured via infrared thermography in mice, suggests that the observed CBT difference is unlikely to be a result of cutaneous vasodilation and conduction heat loss. Finally, qPCR evaluation of a set of thermogenic pathway transcripts (Ucp1, Pgc1a, Prdm16, Dio2, Cidea, and Pparg) in iAT, consistent with transcriptome analysis and NST deficiency, showed that loss of adipocyte OPN3 leads to decreased expression of Ucp1, Pgc1a, and Prdm16 (Figure 12I). Taken together, these data suggest that OPN3 expression in white adipocytes is required for the light-dependent component of thermogenic response, but not in the retina or BAT.

[0131] (Loss of OPN3 leads to a decrease in energy consumption.) To determine how OPN3 contributes to long-term energy balance and homeostasis, we used OPN3 in 4-month-old animals. + / + (n=5) and OPN3 lacz / lacz (n=10) Indirect calorimetry was performed in male mice. The animals were acclimatized and individually housed in metabolic chambers (TSE Systems, PhenoMaster Cages), and energy consumption was evaluated at 22°C, 16°C, 10°C, and 30°C (Figure 13A). On average, OPN3 lacz / lacz Mice showed lower oxygen consumption (Figure 13B) and carbon dioxide emissions (Figure 13C) than controls, with the difference being significant at the lowest ambient temperature (p=0.03 and p=0.04 for O2, respectively, performed using separate repeated-measures ANOVA over 5 hours with and without lights). These differences disappeared when the ambient temperature returned to thermal neutrality (30°C), suggesting that these differences represent an adaptive rather than pathological response. In response to this, OPN3 lacz / lacz Animals showed lower energy consumption (Figure 13D), with a significant difference at 10°C. Denormalized energy consumption data also showed that lowering the ambient temperature was beneficial. OPN3+ / + mice and OPN3 are worsened by lacz / lacz This asserts a difference in energy consumption between mice and other animals.

[0132] Figure 12 shows, for example, that white adipocyte OPN3 is required for a normal thermogenesis response. (A and B): OPN3 on P16 fl / fl (A) and Adipoq-cre;OPN3fl / fl(B)inWAT were stained with hematoxylin. (C): OPN3 on P16 fl / fl and Adipoq-cre;OPN3 fl / fl Evaluation of adipocyte size in WAT. * = p<0.05 by Student's t-test. (D~H): CBT evaluation over time after 4°C cold exposure for adult mice of the indicated genotype. Lighting conditions during cold exposure are indicated by the colored lines on the horizontal axis of the chart. (D and E): OPN3 fl / fl and Ucp1-cre;OPN3 fl / fl Mice were subjected to CBT (D) under negative blue conditions and (E) full-spectrum illumination for 180 minutes, followed by a further 120 minutes under negative blue conditions. (F):Newborn Adipoq-cre;OPN3 fl / fl and the control OPN3 fl / fl Similar to (E), except for the mouse cohort. (G): Adult Adipoq-cre; OPN3 fl / fl and the control OPN3 fl / fl Similar to (D), except for the mouse cohort. (H): Same as (F), except for adult mice. (I): Relative expression iBATs of the thermogenic pathway genes Ucp1, Pgc1a, Prdm16, Dio2, Cidea, and Pparg in mice of the indicated genotypes were collected from control mice at ambient temperature (24°C) and mice exposed to 4°C for 3 hours. Data are shown as mean ± standard error. Scale bar: 100 μm

[0133] Figure 13 shows, for example, that the loss of OPN3 alters energy metabolism. (A): A schematic diagram detailing the ambient temperature and duration of measurement intervals throughout the entire experiment. (B~D): VO2 (B), VCO2 (C), and energy consumption (EE, D) measured by indirect calorimetry (TSE Systems, PhenoMaster Cages) were performed at 22°C, 16°C, 10°C, and 30°C using OPN3. + / + (Gray trace, n5) and OPN3 lacz / lacz (Blue traces, n=10) were obtained from animals. Each graph shows the 24-hour mean data ± standard error for the corresponding ambient temperature. Lighting conditions were maintained on a standard 12L:12D cycle, with the lights turned off from 6 PM to 6 AM (gray shaded area) and then on from 6 AM to 6 PM (yellow shaded area). (E): The respiratory exchange ratio (RER) was calculated using the ratio VCO2 / VO2. (F): Spontaneous kinetic activity (XY) was measured by infrared beam cutoff. (G and H): 24-hour average food (G) and water consumption (H) were measured using differential weight-based sensors and plotted for each ambient temperature. (I): Postmortem fat accumulation in iAT, inWAT, and pgWAT. All statistics performed on data (B) to (F) are repeated measures ANOVAs over 5-hour intervals, i.e., 7 PM to 12 AM, 1 AM to 5 AM, 7 AM to 12 PM, and 12 PM to 5 PM. Statistics performed on data (G) to (I) are two-way ANOVAs using p-values ​​reported from Holm-Sydak® corrected multiple comparisons.

[0134] The respiratory exchange ratio (RER) is estimated by calculating the VCO2 / VO2 ratio, and through experiments, OPN3 + / + and OPN3 lacz / lacz There was no significant change among the animals. This suggests a lack of substrate utilization preference and reflects a decrease in overall metabolic demand caused by the loss of OPN3. + / + Animals and OPN3 lacz / lacz There was no difference in motor activity between the animals, and this is supported by separating the observed changes in energy expenditure from the total activity bell (Figure 13F). Furthermore, the walking motor activity data was found in OPN3+ / + Animals and OPN3 lacz / lacz This strongly suggests that there is no change in circadian phasing between animals and humans, and that loss of OPN3 does not result in changes in the activity cycle. Finally, OPN3 lacz / lacz The animals consumed less food (Figure 13G) and water (Figure 13H) compared to the controls, which was consistent with their lower energy expenditure. Postmortem fat accumulation was measured in OPN3 lacz / lacz The levels were higher in animals, likely suggesting a decrease in fat mobilization (Figure 13I). Overall, these data assert the importance of OPN3 for adaptive thermogenesis, along with its direct consequences for overall energy storage and utilization in organisms.

[0135] (White adipocyte OPN3 is required for normal lipolysis during cold exposure.) According to some embodiments, the long-held belief that BAT lipolysis is essential for NST has been overturned, for example, by analyses showing that inhibiting BAT lipolysis does not impair protected CBT as long as WAT or myocardial lipolysis is not impaired. This difference was observed in Ucp1-cre;OPN3fl / fl mice and Adipoq-cre;OPN3 mice. fl / fl Because it is similar to the difference in CBT between mice and animals, the question arose as to whether OPN3 in white adipocytes is necessary to provide heat-producing fuel during cold exposure. This was addressed with two complementary approaches. First, in vivo fasting experiments were performed with the aim of enhancing the use of fat storages via lipolysis during cold exposure.

[0136] In this analysis, the control (OPN3 fl / fl ) and experiments (Adipoq-cre; OPN3 fl / fl A cohort of mice was either freely fed or fasted overnight, followed by exposure to 4°C for 3 hours (Figure 14A). At the end of the experiment, the fat deposits were dissected and weighed. After subtracting the difference in fat content between the fed and fasted animals, the inventors determined that Adipoq-cre;OPN3 fl / flWe found that the animals mobilized significantly less fat than the controls (380 vs. 230 mg iAT, 380 vs. 180 mg inWAT, and 300 vs. 33 mg perigodinous white adipose tissue [pgWAT]) (Figure 14C). This was consistent with the hypothesis that adipocyte OPN3 is required for the normal utilization of fat. Changes in fat volume under feeding conditions compared to fasting conditions have been previously demonstrated, indicating the need for lipolysis under nutrient-deficient conditions.

[0137] Lipid breakdown is initiated by β-adrenergic receptor activation of Gαs and adenyl cyclase. This increases cyclic AMP (cAMP) and involves the targeting of protein kinase A (PKA), including HSL, PLIN, and cAMP response element-binding protein (CREB), releasing glycerol and FFA from stored triglycerides. Fasted mice showed significantly elevated serum glycerol compared to fed mice, and this difference was attributed to Adipoq-cre;OPN3 compared to controls. fl / fl Decreased levels were observed in mice (Figure 14D). Evaluation of cAMP from inWAT lysates showed that control mice had lower levels of Adipoq-cre;OPN3 during the light phase of a 12:12 light-dark cycle (12L:12D). fl / fl It was revealed that the mice showed significantly elevated cAMP levels compared to mice (Figure 14E). However, this difference disappeared during the dark period. Therefore, the measurement of both serum glycerol and cAMP in inWAT supports the hypothesis that OPN3 is required for the light-dependent regulation of the lipolytic response.

[0138] In the second approach, the question was whether adipocytes could respond to light in isolation. Therefore, adipocytes are OPN3 + / + and OPN3 lacz / lacz The cells were differentiated from the stromal vascular fraction (SVF) of mouse-derived inWAT. cAMP measurements from these white adipocytes followed a dose-dependent response to the photon flux (Figure 14F). Subsequently, cultured adipocytes of both genotypes were exposed to 480 nm light, and the phosphorylated PKA substrate was compared to unexposed cultures. Bell was compared. Light-stimulated OPN3 compared to dark fat cells. + / + A consistent increase in phosphorylated HSL (phospho-HSL) was observed in adipocytes (Figure 14G). However, this light-dependent increase was due to OPN3 lacz / lacz It was not present in fat cells. Quantification of this response was performed using OPN3. lacz / lacz Instead, OPN3 + / + Cultured adipocytes showed significantly higher photo-induced phospho-HSL levels (Figure 14H). Photo-induced OPN3-dependent changes were also observed in other PKA targets. Free glycerol in the culture medium from differentiated white adipocytes was also measured, and a significant increase in free glycerol was found in blue light-stimulated control adipocytes (Figure 14I), but not in OPN3-null adipocytes (Figure 14J). These data suggest a direct photoresponsiveness in isolated adipocytes requiring OPN3.

[0139] According to some embodiments, OPN4 is suggested to be able to mediate photoresponses in cultured primary adipocytes. Therefore, we investigated the potential of OPN3-OPN4 interactions in photomediated adipocyte function. cre Evaluation of OPN4 expression in iscWAT and iBAT from Z / EG mice did not show strain marking in adipocytes despite strong signaling in the retina. To address the potential role of OPN4 in NST, CBT was measured in cold-exposed cohorts of OPN4 wild-type and null mice, but no significant differences were observed.

[0140] Finally, OPN4 + / +Adipocytes differentiated from OPN4 null in WAT were stimulated with blue light, and strong induction of phospho-HSL was observed in both cases. These data were inconsistent with the in vivo role of adipocyte OPN4 in local light responses. The involvement of rhodopsin (opsin 2 [OPN2]), a photopigment-mediated vision under twilight, was also tested in the protection of CBT during cold exposure. Mice with a P23H mutation in the OPN2 gene that produce a non-functional rhodopsin protein were used. The evaluation of protected CBT during cold exposure did not show a significant difference. These data contradict the non-visual function of OPN2 in NST.

[0141] Figure 14 shows, for example, OPN3-dependent utilization of fat mass in vivo, as well as photo- and OPN3-dependent activation of lipolysis in vivo and in vitro. (A): A schematic diagram illustrating the timeline of the fasting-cold exposure experiment. (B): Feeding and fasting during 180 minutes of cold exposure OPN3 fl / fl and Adipoq-cre;OPN3 fl / fl CBT for the mouse. (C):OPN3 fl / fl and Adipoq-cre;OPN3 fl / fl Mice used under various conditions including fat intake, feeding, fasting, and cold exposure. (D): OPN3 with the same diet and fasting as (C) after 180 minutes of cold exposure. fl / fl and Adipoq-cre;OPN3 fl / fl Serum glycerol levels from mice. (E): OPN3 + / + In mice, cAMP levels in the inWAT lysate increased during the light-dark period, but OPN3 lacz / lacz The cAMP levels in mouse inWAT were similar in both phases, and OPN3 + / + The levels are comparable to those observed during the dark period, and OPN3 + / + This chart shows that the levels are significantly lower than those seen during the peak season. (F): Cultured in vitro differentiated adipocytes show a 475 nm light-dependent dose-response increase in cAMP. (G): Two examples of immunoblots showing photo-dependent and OPN3-dependent induction of phospho-660-HSL in cultured in vitro differentiated adipocytes. Each set of immunoblots (Experiment 1 and Experiment 2) was performed using white adipocytes isolated from separate mice. (H): Wild-type control (OPN3) + / + (n=5 mice) and OPN3 loss-of-function type (OPN3 lacz / lacz Quantification of phospho-HSL induction in white adipocytes (n=3 mice). (I and J): In vitro differentiated OP in response to 2 hours of blue light stimulation compared to darkness. N3 + / + (I) and OPN3 lacz / lacz (J) Quantification of glycerol released from cells.

[0142] (Consideration) In some embodiments, the evaluation of OPN3 (encephalopsin) function has been presented in mice, where adipocytes use OPN3-dependent photosensing to regulate metabolic physiological functions. Extraocular photoreception is found in many species, including vertebrates such as fish and birds. However, to date, there are only a few examples of extraocular photoreception in mammals. Non-standard opsins can function in adipocytes and skin, mediate vasodilation responses, and induce autophagy in human colon cancer cells. In some embodiments, adipocyte OPN3 may play a crucial role in regulating lipid homeostasis.

[0143] (OPN3 activity mediates light-dependent pathways that regulate energy metabolism.) OPN3 possesses all the key molecular characteristics of the opsin family of photoresponsive G protein-coupled receptors. Therefore, one hypothesis explaining the OPN3 phenotype is to position OPN3 as a candidate detector for decoding optical information to regulate energy homeostasis. This hypothesis was tested by breeding C57BL / 6J mice under minus-blue conditions, excluding the 480 nm wavelength known to stimulate OPN3 homologs in other vertebrates. Notably, the minus-blue mice exhibited the same abnormal WAT tissue structure as OPN3 null mice, as well as low NAD, reduced iAT ETC complex, low UCP1, and NST deficiency. This result is consistent with the existence of an OPN3-dependent photodecoded metabolic regulatory pathway. According to some embodiments, it is suggested that OPN3 functions during development to establish the histological and functional characteristics of metabolic tissues.

[0144] A key characteristic of non-standard opsins is their ability to mediate acute responses to light. OPN4 mediates pupillary light reflex and photophobic behavior in neonatal mice. According to some embodiments, OPN3 may mediate photoresponses on a similar timescale by demonstrating light- and OPN3-dependent changes in CBT during cold exposure. Upon removal of blue light, wild-type mice rapidly reduced their CBT to abnormally low OPN3 null levels. According to some embodiments, the CBT of OPN3 null mice and wild-type mice were indistinguishable under minus-blue conditions, indicating that OPN3 activity is required for acute enhancement of body temperature induced by blue light. However, since animals housed under minus-blue conditions also showed a deficiency in NST even under blue light stimulation (Figure 11c), OPN3 likely has further developmental roles not addressed in this study.

[0145] Acute light stimulation increases human body temperature, and this response is mediated by 460 nm light but not by 550 nm light. While OPN4 has been associated with the known circadian regulation of CBT, current analysis suggests another hypothesis: that the OPN3-dependent photoresponse is central to this physiological function. According to some embodiments, acute light exposure may trigger an increase in temperature preference, suggesting that this configuration of photoinformation decoding is deeply conserved. Humans, unlike mice, are diurnal species, and the metabolic interaction between OPN3 and the human circadian clock remains unresolved. Nevertheless, the activity of OPN3 in metabolic pathways and the photodependent regulation of body temperature is very likely to be closely integrated with OPN4-dependent circadian and ocular photoinput pathways that also regulate this physiological function.

[0146] (White adipocytes are the site of OPN3 metabolic activity.) Since many cell types express OPN3, extraocular photoreception may be common in mammals. According to some embodiments, white adipocytes are an important site for OPN3 function for NST. Furthermore, further adipocyte-independent activity of OPN3 (e.g., There may be brown adipose tissue OPN3 activity involved in NST.

[0147] Partially prompted by transcriptome analysis, according to some embodiments, lipolysis is observed in cultured white adipocytes and is enhanced by blue light in an OPN3-dependent manner. Lipolysis is an essential component of the normal thermogenesis response in mice, as evidenced by the lower-than-normal body temperature when lipid mobilization enzymes are impaired. Blue light-stimulated white adipocytes show elevated cAMP and, importantly, a dramatic increase in phospho-HSL, the rate-limiting enzyme in the lipolysis pathway, which is a lost response in OPN3-null adipocytes. Since lipolysis is an essential response for maintaining normal body temperature, and the resulting FFA is required for UCP1 activation, according to some embodiments, a mechanistic explanation for the OPN3-dependent deficiency in NST is provided. According to some embodiments, the reduced ability of Adipoq-cre;OPN3fl / fl mice to utilize body fat mass in response to fasting and cold exposure is consistent with the role of OPN3 in enhancing lipolysis in vivo. Furthermore, elucidating the specific OPN3-dependent signaling mechanism in adipose tissue may allow for a better understanding of the direct relationship between blue light-sensing OPN3 and lipolytic enzymes.

[0148] According to some embodiments, OPN3 mediates light-dependent regulation of cellular physiological functions in mice and various human cell types. Therefore, there is important evidence that OPN3 can regulate physiological functions at the biological level, at least in mice. Both the primary amino acid sequence and expression pattern of OPN3 are highly conserved. If the light-OPN3 adipocyte pathway exists in humans, it may have potentially widespread implications for human health. Modern human lifestyles expose humans to metabolic disruption factors such as unnatural lighting spectra, nocturnal light exposure, shift work, and jet lag. Based on current knowledge, insufficient stimulation of the light-OPN3 adipocyte pathway may be part of the explanation for the prevalence of metabolic deregulation in developed industrial countries where unnatural lighting is the norm. [Table 1-1] [Table 1-2] [Table 1-3]

[0149] (Experimental model and subject details) All experiments were approved by the Animal Experimentation Committees of Cincinnati Children's Hospital Medical Center, the University of Michigan, Ann Arbor, and the University of Washington, and followed National Institutes of Health guidelines. The age of the mice used in this study was determined by P16 (immunohistochemical analysis and microscopic This includes array imaging, P21-P24 (neonatal cold exposure), P28 (transmission electron microscopy), 2 months (adult cold exposure), and 3-4 months (fiber radiation and indirect calorimetry). Unless otherwise specified, male and female mice were used in all studies.

[0150] (mouse) The animals were housed in a pathogen-free animal facility in accordance with the facility's policy. The genetically modified mice used in this study were as follows: B6;FVB-Tg(Adipoq-cre)1Evdr / J (Eguchi et al., 2011) (Jax stock number 010803), Ai14 (Madisen et al., 2010) (Jax stock number 007914), OPN4 (Panda et al., 2003), and Tg(OPN3-EGFP)JY3Gsat (MMRRC stock number 030727-UCD). The Ucp1cre mouse strain used in the thermoregulation assay study was B6.FVB-Tg(Ucp1-cre)1Evdr / J (Jax stock number 024670) obtained from Jackson Laboratories. The OPN4cre;Z / EG mouse strain was generously donated by Kwoon Y. Wong of the University of Michigan, Ann Arbor. The OPN3tm2a(EUCOMM)Wtsi mouse was generated from C57BL / 6N ES cells obtained from EUCOMM (ES clone ID: EPD0197_3_E01). The ES cells have a genetic modification in which the lacZ-neomycin cassette is adjacent to the FRT site, and the loxP site separates lacZ from the neomycin coding region. The loxP site is also adjacent to exon 2 of OPN3, enabling multiple mouse strains that can function as reporter nulls, conditionally floxed mice, and null mice. The OPN3Lacz reporter null strain was created by mating the OPN3tm2a(EUCOMM)Wtsi mouse with the FVB / N-Tg(EIIa-cre)C5379 Lmgd / J mouse (Lakso et al., 1996) (Jax stock number 003314). The OPN3fl / lf strain was created by mating the OPN3tm2a(EUCOMM)Wtsi mouse with the 129S4 / SvJaeSor-Gt(ROSA)26Sortm1(FLP1)Dym / J (Jax stock number 003946) and removing the lacZ cassette. This means that the OPN3lacz mice have a mixed C57Bl6 / 6N, FVB / N background, while the Adipoq-cre;OPN3fl mice have a mixed C57Bl6 / 6N, 129S4 / Sv, B6;FVB background.Except for C57BL / 6J mice reared under different lighting conditions, littermates were used as control animals in all experiments.

[0151] OPN3cre was generated in-house using CRISPR-Cas9 technology. Four gRNAs targeting exon 2 of OPN3 were selected and used to knock in the Cre cassette. Plasmids containing the gRNA sequences were transfected into MK4 cells (an in-house mouse cell line representing induced post-renal mesenchyme used for epithelial transformation). The gRNA editing efficiency was determined by a T7E1 assay of PCR products of the target region amplified from the genomic DNA of the transfected MK4 cells. The sequence of the gRNA used for subsequent transfection was TACCGTGGACTGGAGATCCA (SEQ ID NO: 17). Sanger sequencing was performed to validate the knock-in sequence in the founder mouse.

[0152] The OPN3△Ex2 allele was generated in-house using CRISPR-Cas9 technology as described above. Four gRNAs targeting exon 2 of OPN3 were selected. The gRNA sequences at the 50 end are TAGCAACGAATGCAAAGGTA GGG (SEQ ID NO: 18) and ATCCACATGTTCTGCC CAGGAGG (SEQ ID NO: 19). At the 30 end, the sequences are GGCTATGTTGGTAAGGTGT GGG (SEQ ID NO: 20) and TGTGGTTTTAATCAGCACAGGGG (SEQ ID NO: 21). Of the six offspring derived from a single injection, the founder animal had a 2203 bp deletion, which was also confirmed by Sanger sequencing. The proximal breakpoint of this deletion is from intron 1 (bp175,667,424) to intron 2 (bp175,665,0 54) and therefore the entire exon 2 is missing.

[0153] Mice were given free rein to eat a standard diet (NCD: 29% protein, 13% fat, and 58% carbohydrates kcal; LAB Diet No. 5010) and free access to water.

[0154] (Genotype determination) The primer sequences and pairs used to determine the genotype of each allele in this study are listed in the table below. [Table 2]

[0155] (OPN3 mouse strain) All OPN3 mouse strains used in this study are detailed in the table below, along with their scientific basis. [Table 3]

[0156] (Details of the method) (Lighting conditions) Animals were housed under standard fluorescence illumination (photon flux 1.62 × 10¹⁵ photons / cm² / sec) in a 12L:12D cycle, unless otherwise noted. For full-spectrum illumination, an LED was used to obtain a comparable total photon flux of 1.68 × 10¹⁵ photons / cm² / sec. Spectral and photon flux information for LED illumination is as follows: near-ultraviolet (λmax=380nm, 4.23 × 10¹⁴ photons / cm² / sec in the 370–400nm range), blue (λmax=480nm, 5.36 × 10¹⁴ photons / cm² / sec in the 430–530nm range), and red (λmax=630nm, 6.72 × 10¹⁴ photons / cm² / sec in the 590–660nm range). Photon flux was measured through an empty standard mouse cage at approximately 24 inches from the light source. For wavelength-limited experiments, C57BL / 6J animals were housed in a 12L:12D cycle starting from late pregnancy (embryonic stage E16) under either full-spectrum (380nm+480nm+630nm LED) or "minus blue" (380nm+630nm LED) illumination.

[0157] (Radiation measurement in adipose tissue) The fabrication of the Holt-Sweeney microprobe (HSM) is described as follows (Holt et al., 2014): One end of a 100 mm silica core optical fiber patch cable (Ocean Optics, Dunedin, FL, USA) was terminated. The fiber branch tube and jacket were stripped, and the polyimide buffer of the fiber was removed from the end of the fiber using a butane torch for 5 cm. A 10 g weight was attached to the end of the fiber, and then heated and pulled with a butane torch to narrow the diameter. The narrowed area of ​​the fiber was then cut using carborundum paper to obtain a flat fiber end with a diameter of 30-50 μm. The sides of the narrowed fiber were painted with a film opaque pen to prevent stray light from entering, leaving a small transparent opening at the tip of the fiber. For structural support, this bare tapered fiber was then fixed to the tip of a stretched glass Pasteur pipette using a drop of cyanoacrylate adhesive, with only 6-9 mm of the bare optical fiber protruding. For spectral scalar irradiance measurements, a small light-scattering ball was added to the end of a tapered optical fiber. To do this, titanium dioxide was bonded to a high-viscosity UV-curable resin, DELO-PHOTOBOND, GB368 (DELO Industrie K The resin (lebstoffe, Windach, Germany) was thoroughly mixed with the resin. The tip of the stretched fiber was quickly inserted and removed from the droplet of resin-titanium dioxide mixture, obtaining a sphere with a diameter approximately twice that of the tapered fiber. Since all measurements from a particular probe are normalized to the signal from the same probe in a gelatin blank, small variations in probe diameter do not affect the results. The sphere was cured for 12 hours using a Thorlabs fiber-coupled LED light source (M375F2, Thorlabs Inc, Newton, NJ, USA).

[0158] For intratissue radiometry in mice, 4-month-old adult mice were anesthetized under ventilated isoflurane and placed on a mouse stereotactic frame (Stoelting Co., Wood Dale, IL, USA). Hair covering the intrascapular region was shaved, and a small 10 mm rostral-caudal incision was made through the dorsal skin to expose the underlying tissue. A 21-gauge needle attached to the stereotactic frame was first lowered through the intrascapular region to create a pilot hole through the adipose tissue. Subsequently, a Holt-Sweeney microprobe was fixed to the stereotactic frame and lowered through the pilot hole. After the probe was positioned, the dorsal skin was repositioned to cover as much of the incision site as possible without obstructing the probe's descent. For broadband light irradiation, a Thorlabs plasma light source (HPLS345, Thorlabs Inc., Newton, NJ, USA) was placed above and in front of the mouse stereotactic frame. Light was delivered to the animal via a 5mm liquid light guide connected to a 2-inch collimating lens fixed in a vise. The distance from the collimating lens to the animal was approximately 2 feet.

[0159] Scalar irradiance measurements as a function of wavelength were obtained on the surface of adipose tissue with probe depth increments from 0.5 mm to 2.5 mm. Spectral irradiance data were collected using an Ocean Optics 200–850 nm spectrometer (JAZ series, Ocean Optics, Dunedin, FL, USA).

[0160] (Immunohistochemistry and tissue processing) Animals were anesthetized under isoflurane and sacrificed by cervical dislocation. Adipose tissue repositories (interscapular adipose tissue complex and inguinal WAT) were collected from P16 male mice and fixed in ice-cold 10% zinc formalin at 4°C for 1 hour. After washing in PBS, the adipose tissue samples were prepared for freeze-sectioning as described above. Gelatin-embedded tissues were sectioned to 16 μm using a cryostat and labeled with primary antibodies as described above. Chicken antibody against GFP (ab13970, 1 / 500) and rabbit antibody against UCP1 (ab10983, 1 / 500) were purchased from Abcam. Alexa488-conjugated isolectin (1 / 300) and Alexa594-conjugated F-actin were purchased from Thermo Fisher Scientific. Alexa488-conjugated secondary antibody (1 / 300) was purchased from Jackson ImmunoResearch.

[0161] (X-Gal staining) For X-Gal labeling, tissue samples were fixed in X-Gal fixative (1% formaldehyde, 0.2% glutaraldehyde, 2 mM MgCl2, 5 mM EGTA, and 0.01% Nonidet P-40) at room temperature for 2 hours. The tissue was frozen into sections as described above and then labeled with X-Gal. The reaction was closely monitored and stopped when background began to appear in the control (wild-type) tissue. After washing twice in PBS, the frozen sections were imaged using a bright-field microscope.

[0162] (Hematoxylin labeling and cell size quantification) Gelatin-embedded frozen sections of inguinal WAT (as described above) were stained with hematoxylin and imaged under bright-field imaging. The samples were imaged using a rhodamine filter to evaluate the adipocyte size distribution. Using the freehand selection tool in ImageJ, the contours of adipocytes were drawn and their area measured in μm². The cell size distribution was determined by quantifying 60 cells from at least 10 regions, resulting in a total of approximately 600 cells per animal. The cell areas were binned at 200 μm² intervals, and the frequency (%) of all cells was recorded for each interval.

[0163] (Pre-adipocyte differentiation and photoinduction) IngWAT dissociation and extraction of the interstitial vascular fraction were performed as described above (Liu et al., 2017). Briefly, the inguinal fat body was collected in PBS and digested in 1.5 mg / ml collagenase A in PBS containing 4% BSA and penicillin / streptomycin at 37°C for 40 minutes with intermittent agitation. The interstitial vascular fraction was extracted by passing the enzymatically dispersed cells through a 100 μm cell strainer and cultured in basal medium (DMEM containing 10% fetal bovine serum and penicillin / streptomycin). For differentiation, stromal vascular cells were plated on day 1 and allowed to reach confluence on day 3. On day 4, the basal medium was replaced with induction medium containing insulin (100 nM), rosiglitazone (1 μM), IBMX (0.5 mM), and dexamethasone (2 μg / ml). Subsequently, differentiated cells were maintained in a basal culture medium containing insulin (100 nM) until the experimental day.

[0164] Photoinduction for assaying lipolysis response was typically performed on days 13–15 of differentiation. For this purpose, the cultures were transferred to a 37°C incubator in the dark and protected from light overnight. The following day, the cultures were serum-starved under dim red light, the complete basal medium was washed off with serum-free medium (at least three times), and the cells were left in serum-free medium for 3 hours before photoinduction. For photoinduction, OPN3 + / + and OPN3 Lacz / Lacz Half of the culture was left in a dark incubator, and the remainder was moved to an adjacent incubator housing a light setting for delivering 5 × 10¹⁴ photons / cm² / second at a wavelength of 480 nm. Culture conditions in the two incubators were equivalent except for the illumination. Any movement between incubators prior to stimulation was achieved within a few seconds, taking care to avoid any potential temperature shock. Wild-type controls were always processed in parallel with OPN3 null samples. Light induction was performed for 30 minutes, after which the cells were washed in PBS, and the culture plates were rapidly frozen by immersion in liquid nitrogen and frozen at -80°C until lysate preparation for Western blotting.

[0165] For photo-induced cyclic AMP response, in vitro differentiated OPN3 + / + and OPN3 Lacz / Lacz Adipocytes were used between days 7 and 10 of differentiation. Cells were incubated with 9-cis-retinal (5 mM) the day before assay, and 1 hour before photoinduction, cells were incubated in fresh DMEM without phenol red. Light pulses (465 nm) were delivered for 30 minutes at varying intensities, as shown in the results. Cells were then harvested and cAMP levels were quantified by direct immunoassay (Abcam fluorescence quantification kit, ab138880) according to the manufacturer's instructions. For ex vivo cAMP quantification from collected tissue, incised inguinal white adipose tissue samples were homogenized with a pellet mortar and pestle in ice-cold lysis buffer. Briefly, all samples and standards (50 μl each) were tested twice, to which 25 mL of 1 × HRP-cAMP was added. Plates were incubated at room temperature for 2 hours, and after a washing step, 100 μL of AbRed indicator was added. The plates were incubated for 1 hour, and fluorescence was measured at Ex / Em = 540 / 590 nm using a Biotek Synergy4 microplate reader.

[0166] (Western blotting) Western blotting was performed using a standard protocol. Adipose tissue lysates were fused with NP40 lysis buffer (150 mM NaCl, 1% NP40, 50 mM Tris 8.0 and Phosphate). The lysate was prepared in a phatase inhibitor. The lysate was prepared by sonication, and separated from the upper lipid layer by three centrifugations. After BCA quantification of the protein, the lysate was boiled in Laemmli sample buffer (4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004% bromophenol blue, and 0.125 M Tris HCl, pH 6.8). The blot was incubated with OxPhos antibody (Thermofisher 45-8099 1:1000) and UCP-1 (Abcam ab10983). HRP-conjugated secondary antibody was used at a 1:5000 dilution and detected by enhanced chemiluminescence (ThermoFisher Scientific).

[0167] (Glycerol assay) The glycerol assay was performed using a free glycerol detection reagent (Sigma, F6428). Serum glycerol was collected using cardiac puncture and immediately frozen at -80°C until use. For glycerol detection, an assay was performed using a 1:20 ratio serum to free glycerol reagent.

[0168] For in vitro differentiated adipocytes, wild-type and OPN3 null cells were dark-adapted overnight on day 13 or 14 of differentiation, and serum-starved for at least 3 hours on the experimental day. One set of wild-type and OPN3 null cells were given fresh serum-free medium before stimulation with blue light, while the other set of cells was left in a dark incubator. The culture medium was collected at the end of the 2-hour incubation in blue light or dark and immediately frozen on dry ice for storage at -80°C until use. For the glycerol assay, the amount of glycerol released during the 2-hour dark or blue light stimulation was determined using a 1:10 ratio of culture medium to free glycerol reagent.

[0169] (Microarray analysis) Interscapular adipose tissue complex and inguinal white adipose tissue from P16 mice were collected 1 hour after illumination (ZT1) and rapidly frozen on dry ice. Tissue samples were homogenized in TRIzol (TriReagent Invitrogen) using RNase-free zirconium oxide beads (2.0 mm) in TissueLyser II (QIAGEN). Phase separation was achieved using chloroform, and RNA in the aqueous phase was precipitated using ethanol. RNA was purified by column chromatography using the GeneJET RNA purification kit (ThermoFisher Scientific No. K0732) and eluted in RNase-free water. RNA quality was assessed using the Agilent 2100 Bioanalyzer, and a cutoff of 7 RNA integrity numbers was applied to select samples for microarray assays. RNA from biological triplicates was submitted to the Genomics and Bioinformatics Technology Center at the University of California, Los Angeles, for microarray assays (California, Affymetrix).

[0170] Data analysis, including standardization, gene expression changes, and gene enrichment analysis, was performed using AltAnalyze, developed by Nathan Salomonis of Cincinnati Children's Hospital Medical Center. AltAnalyze employs a robust multi-array averaging method for standardization. Briefly, raw intensity values ​​are background-corrected, log2-transformed, and then quantile-normalized. Next, the data is subjected to a normalized linear model to obtain expression measures for each probe set on each array. Gene expression changes greater than 1.1 times were calculated using an independent t-test, with a p-value < 0.05 used as the cutoff.

[0171] (Quantitative RT-PCR) Fat deposits within the scapula were collected immediately after the cold stress assay. Rapidly frozen tissue was homozygous. The RNA was denized and treated as described above. RNA was treated with RNase-free DNase. cDNA was synthesized using the Verso cDNA synthesis kit (ThermoFisher Scientific AB1453 / B) after processing with I (ThermoFisher Scientific number EN0521). Quantitative RT-PCR was performed using the ThermoFisher QuantStudio 6 Flex Real-Time PCR system with Radiant SYBR Green Lo-ROX qPCR mix (Alkali Scientific Inc.). Primer information for quantitative PCR is included in the table. Relative expression was calculated using the △△CT method with Tbp (TATA-binding protein) as the normalization gene. Statistical significance was calculated by unpaired t-tests using a p-value cutoff of <0.05.

[0172] The primers used for the corresponding target genes are as follows: [Table 4]

[0173] (Transmission electron microscopy) Freshly excised adipose tissue was collected from male P28 mice, and 1 mm samples from nearly the same area were fixed in PBS with 2% glutaraldehyde and 1% paraformaldehyde at room temperature for 1 hour, then processed and sectioned for transmission electron microscopy as described above.

[0174] (NAD / NADH quantification) NAD levels were measured using the Abcam NAD / NADH assay kit (ab65348). Briefly, tissue samples (inguinal adipose tissue and liver) from P16 mouse pups were rapidly frozen in liquid nitrogen, homogenized in NADH / NAD extraction buffer, and filtered through a 10kD spin column (ab93349) to remove the enzyme. The assay procedure was followed according to the kit instructions to determine NADH and NAD+ levels, which were then normalized to tissue weight.

[0175] (Temperature-controlled assay) Core body temperature assessment during acute cold exposure is performed using an OPN3 reporter null (OPN3 + / + and OPN3 lacz / lacz ), exon 2 deletion on C57BL / 6J background (OPN3△Ex2), panadipocyte conditional deletion of OPN3 (OPN3fl / fl and Adipoq-cre;OPN3 fl / fl ), conditional deletion of brown adipose tissue (OPN3 fl / fl and Ucp1cre;OPN3 fl / fl ), conditioned retinal deletion of OPN3 (OPN3 fl / fl and Rx-cre;OPN3 fl / fl The assay was performed on control and experimental male and female mice, as well as control and OPN4 null mice. Furthermore, C57BL / 6J mice (with or without blue, as described above) reared under wavelength-restricted conditions were subjected to this assay. Lumplings were isolated from their home cages and individually housed in a custom-made illumination chamber located in an electronically monitored 4°C cryogenic room for 3 or 5 hours, depending on the assay. The mice were conscious, and their body temperature was measured rectally every 20 minutes during the assay using a RET-3 Microprobe Thermometer (Kent Scientific). Food and water were freely available to all mice, except for Adipoq-cre;OPN3fl / fl mice that were fasted overnight, and diet deprivation was maintained throughout the cold assay. Thermoprobe operators were not informed of the mouse genotype or previous temperature measurements throughout the study. At the end of the cold exposure, the mice were euthanized and relevant tissues were collected. In the 3-hour cold exposure assay, mice were exposed to either a combination of red (630nm) and violet (380nm) LED lighting (RV) or a combination of red (630nm), blue (480nm), and violet (380nm) LED lighting (RBV). In the 5-hour cold exposure assay, the entire 3-hour assay was extended by 2 hours after the 480nm wavelength LED lighting was stopped. Two animals of different ages, one 21 days old (P21) and the other 2 months old, were selected for these cold exposure assays. The order of cage placement was randomized at this point so that the thermoprobe operator would remain blinded. Adipoqcre;OPN3 was fed or fasted overnight. fl / fl For all cold exposure assays, including those involving animals, adipose tissue was collected from the scapula (iAT), inguinal region (inWAT), and perigodinal region (pgWAT). After euthanasia, the adipose pads were manually incised and their weight recorded. For adipose deposits with both left and right pads, both were collected and weighed, and the average weight per animal was recorded.

[0176] (Indirect calorific value measurement and energy consumption) OPN3 in 12-16 week olds + / + and OPN3 lacz / laczMale mice were acclimatized in a metabolic chamber (PhenoMaster®, TSE Systems GmbH, Germany) for 3 days prior to the start of the study. Mice were continuously recorded for a total of 17 days, with gas exchange (O2 and CO2), food intake, water intake, and spontaneous movement (in the XY plane) measured every 15 minutes. Ambient temperature was controlled via a climate-controlled chamber housing the metabolic chamber. VO2, VCO2, and energy consumption (EE) were calculated according to the manufacturer's guidelines (PhenoMaster® Software, TSE Systems GmbH, Germany), with EE estimated via a shortened Weir formula. Respiratory exchange ratio (RER) was calculated as the ratio VCO2 / VO2. Where appropriate, values ​​were normalized by body weight (mL / hr / kg for VO2 and VCO2, and kcal / hr / kg for EE). Food and water intake was measured by a top-mounted load cell sensor, from which food and water containers were suspended in a sealed cage environment. Regarding food consumption, mice exhibiting excessive food-grabbing behavior were excluded from the statistical analysis. After 9 consecutive days of recording, the cages were replaced with fresh cages and sealed, and gas exchange re-equilibrium was completed within 2 hours in all cases.

[0177] (Tail infrared thermography (FLIR)) Adult OPN3 fl / fl and Adipoq-cre;OPN3 fl / fl Animals were placed in tubular mouse restraints (Kent Scientific, Torrington, CT). These restraints allowed breathing through a slotted nose cone while fixing the animals in place with their tails exposed through a posterior port. IR thermographic images were acquired using a FLIR T530 infrared camera (FLIR® Systems, Wilsonville, OR). Tail temperature was quantified by describing a pixel-averaged circular region of interest of consistent size and rostral-caudal distance from the base of the tail.

[0178] (Quantitative analysis and statistical analysis) Statistical analysis was performed using GraphPad Prism version 4.00 (GraphPad Software), Microsoft Excel, and MATLAB 2018a (Figure 6). Statistical significance between two independent groups was determined using a two-sided distribution, two-sample unequal variance t-test. Time series datasets between the two groups (Figures 4, 5, and 6) were analyzed via one-way repeated measures ANOVA. Datasets containing two or more factors (Figures 6G-6I) were also analyzed. The data was analyzed using two-way ANOVA with Holm-Sidak® corrected multiple comparisons.

[0179] (Data and code availability) The whole-genome expression profile is available under accession number GEO:GSE140757.

[0180] Neuropsin (OPN5) is a circadian rhythm gene in exposed mouse skin highlights. It mediates the local light-dependent induction of the gene and circadian rhythm. According to some embodiments, OPN5 may be expressed in mouse melanocytes in the skin of the outer ear and tactile pads.

[0181] According to some embodiments, OPN5 may be required for ex vivo photosynchronization of the circadian clock in mouse skin.

[0182] According to some embodiments, OPN5 may be required for the normal photomediated expression of clock genes in vivo.

[0183] According to some embodiments, the cutaneous circadian clock in blind mice can be photosynchronized in vivo.

[0184] A brief explanation: The main circadian clock in the mammalian brain is thought to determine the phase of peripheral clocks. According to some embodiments, it has been demonstrated that the circadian clock in exposed areas of mouse skin can respond directly to ambient light cues.

[0185] (overview) Almost all mammalian tissues possess a functional, autonomous circadian clock, which operates independently on a non-24-hour cycle and needs to be synchronized (tuned) to the 24-hour day. This tuning mechanism is thought to be hierarchical, with light input to the retina synchronizing the master circadian clock in the suprachiasmatic nucleus (SCN), which then synchronizes peripheral tissues via an endocrine mechanism. Here, we evaluated the function of populations of melanocyte progenitor cells in hair and tactile follicles that express the photochromic neuropsin (OPN5). Organ-type cultures of mouse external ear and tactile skin synchronize to the light-dark cycle ex vivo and require cis-retinal chromophore and OPN5 gene function. Short-wavelength light strongly phase-shifts the cutaneous circadian rhythm ex vivo via an OPN5-dependent mechanism. In vivo, the normal amplitude of Period mRNA expression in external ear skin depends on both the light-dark cycle and OPN5 function. In OPN4- / -;Pde6brd1 / rd1 mice, which are unable to behaviorally synchronize with the light-dark cycle, the phase of skin clock gene expression remains synchronized with the light-dark cycle, even when other peripheral clocks remain phase-locked to autonomous behavioral rhythms. In summary, these results demonstrate the existence of a direct photocircadian synchronization pathway and direct photoresponsive elements for clock genes in mouse skin, similar to the pathways described above for invertebrates and certain non-mammalian vertebrates.

[0186] (Introduction) Mammalian peripheral tissues, when cultured in vitro, can maintain circadian rhythms of gene expression for several months. The synchronization of these peripheral clocks with each other and with the 24-hour light-dark (LD) cycle in vivo is thought to be mediated via signals emanating from the subcutaneous neurocyte (SCN). Another mechanism by which the light cycle directly synchronizes peripheral oscillators via local photopigments is utilized by invertebrates such as Drosophila and non-mammalian vertebrates such as zebrafish. However, to date, direct light uptake by non-ocular tissues in mammals has not been demonstrated.

[0187] The expression of opsin family members in the skin has been reported in several organisms, including mammals. The functions of these opsins are not yet determined and may be diverse. Exposure to light induces chromatophoric proliferation in dermal melanocytes of the African clawed frog, which is mediated by melanopsin (OPN4). Similarly, opsin-mediated photoreception is thought to cause chromatophoric expansion in the skin of octopuses. Short-wavelength light has been shown to induce a localized delayed electrical response from the skin of the mammalian outer ear, but the photoreceptor responsible for this effect is unknown.

[0188] Neuropsin (OPN5) is near UV (λ max OPN5 is a member of the opsin family known to function as a photopigment that responds to wavelengths of 380 nm. OPN5 is expressed in periventricular organ neurons in birds and has been suggested to mediate seasonality-related photoreception. In mammals, OPN5 is required for the photosynchronization of local circadian oscillators in the mouse retina and cornea. OPN5 expression has been found in the external ear skin of mice, but its function in this tissue is unknown. According to some embodiments, short-wavelength light can directly photosynchronize circadian rhythms in mouse skin and induce clock gene expression both in vitro and in vivo via an OPN5-dependent mechanism. This suggests that mammals may be able to utilize local light cues in peripheral tissues for circadian synchronization.

[0189] (result) (Localization of OPN5-expressing cells in skin melanocytes) To analyze OPN5 expression in the skin, (since no validated anti-OPN5 antibodies have been reported to date, and published antibodies show nonspecific staining in knockout strains) the Cre recombinase knock-in allele of OPN5 was used and crossed with a tdTomato-expressing Ai14 reporter. According to some embodiments, histological analysis of ear (pinna) and thorn pad skin from P8 mice revealed reporter expression in two cell populations: a small subepidermal population diffusely distributed (Figure 15B, dashed line) and a larger population at the base of the hair follicle (Figures 15A-15C). These clusters of OPN5-expressing cells were co-labeled for c-KIT, MITF, DCT (TRP-2), β-catenin, and LEF1 (Figures 15D-15I). These represent markers for melanocyte progenitor cells within the hair bulb. However, OPN5 - / - It should be noted that the mice did not exhibit obvious hyperpigmentation or leukodystrophy. In adult mice, PCR-based investigations confirmed OPN5 expression in the retina, auricle, and tactile bristles of the nasal skin (Figure 15J). OPN5 transcripts were not observed in the ventral or dorsal skin of the forelimb, nor in the pituitary gland or liver. Skin evaluation from adult auricles derived from OPN5cre;Ai14 mice showed an expression pattern similar to that observed in P8 mice with positive cells in the hair follicle base (Figure 15K). These data indicate that a dominant population of OPN5-expressing cells in the auricle and tactile bristles is present within the hair and tactile bristles.

[0190] Transcription levels of other opsins were also analyzed in various regions of adult mouse skin. PN5 expression was observed in the dorsal and caudal skin, in addition to the auricle and tactile hairs. OPN2 (rhodopsin) was also detected in the tactile hair pads and dorsal skin. OPN4, OPN3, and OPN1sw were not detected at levels above baseline (liver) in any skin area. OPN3 was qualitatively observed in most tissues when assayed for the presence of accurate amplicon size using gel electrophoresis.

[0191] (Ex vivo photosynchronization of the skin's circadian clock) A lack of photosynchronization has been previously reported in cultured auricular tissue from Per2Luc mice. This may indicate that OPN5 is insufficient in photosynchronization of ear skin. Yes, it exists. However, previous studies were conducted in the absence of exogenous chromophores that may be necessary for the production of functional photopigments. Exogenous retinaldehyde is required to induce photoresponses in tissue culture experiments using African clawed flea melanocytes and mammalian cells transfected with human OPN5 or OPN4. Therefore, we attempted ex vivo photosynchronization of ear cultures supplemented with exogenous 9-cis-retinaldehyde or total trans-retinaldehyde. Per2 Luc The excised outer ear (pinna) of a mouse was divided in half along the cartilage, and each half of the auricle was cultured separately. The two cultures were then exposed to 10-hour light:14-hour dark cycles in opposite phases (referred to as 0° and 180°) for five complete cycles, either in the presence or absence of 10 μM 9-cis-retinal. The tissues were then maintained in constant darkness and subjected to Per2 filtration. Luc The circadian phase of the reporter was determined. In the absence of exogenous retinaldehyde, auricular cultures could not be photosynchronized (Figure 16A). However, in the presence of 9-cis-retinal, a reverse-phase Per2Luc luminescence rhythm was adopted in auricular cultures (Figures 16B and 16J). Photosynchronization in the trichome pad (three trichome follicles including surrounding fat, dermis, and epidermis) was evaluated using reverse-phase Per2 Luc Similar rhythmic adoption was observed in 0° and 180° cultures, but only in the presence of 9-cis-retinal (Figure 16D, E, J). When incubated in the presence of total trans-retinal, auricle cultures did not exhibit photosynchronization. This is likely because mammalian OPN5 is unable to bind to retinaldehyde in its total trans state. These data suggest that the skin of the auricle and tactile pads photosynchronizes their circadian clocks ex vivo.

[0192] To determine whether OPN5 is necessary for ex vivo photosynchronization in the auricle and triceps, - / -Mouse-derived tissues were tested under the same conditions as the wild-type experiments. OPN5 - / - Neither mouse auricle nor tactile pad cultures showed ex vivo photosynchronization, even in the presence of 9-cis-retinal (Figure 16C, F, J). Wild-type tissues (including the pituitary gland and liver) in which OPN5 was not detectable by RT-PCR were not photosynchronizable ex vivo, regardless of the presence or absence of 9-cis-retinal (Figure 16G, H, I, J). Therefore, the skin tissues of the outer ear and microtactile pads contain a photosynchronizable circadian clock that requires OPN5 and retinaldehyde chromophores, suggesting that this opsin functions as a photopigment in these tissues.

[0193] A common feature of vertebrate circadian systems undergoing phase shifts is photoinduction of Per family genes. In mammals, acute light induces phase-dependent induction of Per1 and Per2 in the SCN. To further evaluate the direct effects of light on the circadian clock in mouse skin, photoinduction of Per genes in the auricle was measured ex vivo. Luc After keeping mouse-derived tissue in the dark for at least 36 hours, Per2 Luc Over the time of the circadian cycle based on the phase of emission, a violet light-emitting diode (peak λ=415nm, 2×10⁻¹⁶) 14 photon cm -2 s -1 The mice were exposed to a 90-minute light pulse from ) . Both Per2 and Per1 mRNA were strongly induced by violet light, and the response was gated by the phase of the circadian clock (Figure 17A). Similar to the SCN clock phase-dependent behavioral response to light, we observed a “dead zone” during the time when the tissue was in the light phase of the LD cycle (subjective day). During this “dead zone,” bright violet light did not induce a response from the Per genes. However, as the transition from light to dark (dusk) approached and subjective night began, both Per genes responded strongly to light (Figure 17A). In vivo, violet light administered to mice at circadian time (CT) 13 induced strong induction of Per1 and Per2 transcripts, which is OPN5 - / -It was eliminated in mice (Figure 17B). These results suggest that photoinduction of Per1 and Per2 in the skin is gated by the circadian clock, and that OPN5 functions as a photoreceptor for this induction.

[0194] Photo-induced phase shifts of Per2Luc luminescence rhythms in cultured auricles showed similar sensitivity patterns with a strong "Type 0" reset waveform during subjective nighttime (Figure 17C). ). To confirm the spectral sensitivity of the phase shift effect, equal photon beams of 475 nm (blue) and 525 nm (green) light (2 × 10⁻¹⁰). 14 photon cm -2 s -1 A light pulse of ) was used. Similar phase-dependent responses were observed for 475 nm light, but their magnitude was reduced, and no subjective nocturnal photoresponse was observed for 525 nm light (Figure 17C). A violet light pulse (415 nm) as shown in Figure 17C was used in any phase of the circadian period, OPN5 - / -It was not sufficient to induce phase shift from cultured auricle derived from mice (Figures 17D and 17E). According to some embodiments, OPN5 is required for chromophore-dependent phototuning of ear skin ex vivo and circadian gating light induction of Per mRNA. Although the spectral sensitivity peak of mammalian OPN5 is in the UVA range, we used 415 nm light in most of these ex vivo experiments to avoid prolonged exposure of cell culture media and cultures to UV light. To better test the spectral tuning of the photophase shift response, phase-delayed light pulses (CT17-19) were administered using five wavelengths from 370 nm to 525 nm over a 10,000-fold intensity range for each wavelength (Figure 17F). According to some embodiments, the strongest phase-setting effect was observed at near-UV at 370 nm, and the effect monotonically decreased with increasing wavelength. Analysis of the relative efficacy of light at different wavelengths yielded an action spectrum for circadian phase shift consistent with the absorption spectrum reported for OPN5 (Figure 17G), and these data strongly suggest that OPN5 acts as a primary photoreceptor for circadian synchronization in the skin. Importantly, no significant phase shift activity was observed at 475 nm or 525 nm, which is the wavelength range encompassing maximum sensitivity to melanopsin (OPN4) and rhodopsin (OPN2).

[0195] When bioluminescence from Per2Luc ear cultures was imaged using a cooled charge-coupled device (CCID) camera, areas of strong luminescence appeared around hair follicle areas (Figure 17H). Bioluminescence from hair follicles was spatially associated with populations of Ai14-expressing cells in OPN5Cre;Ai14 tissue (Figure 17I). Continuous imaging over several days revealed strong circadian oscillations in the hair follicles, confirming previous reports of strong circadian activity within the hair follicles. When measured as an independent region of interest from time-lapse images of cultured ear, the luminescence rhythms of individual hair follicles within a single tissue drifted in phase over culture days but returned to a common phase with a 90-minute 415 nm light pulse (Figure 17J). According to some embodiments, this suggests that local synchronization of the circadian clock via OPN5 mediates the coordination of circadian phases via daily resets.

[0196] (In vivo effect of OPN5 loss on the skin circadian clock) To determine the extent to which this photoreceptor system functions in vivo, clock gene expression was evaluated by qPCR in the auricle over a 24-hour time course of a 12:12 LD cycle, or after 36 hours of constant darkness (DD). In wild-type auricles during LD, Per1 and Per2 showed strong mRNA expression amplitudes (Figures 18A and 18B, blue lines). In contrast, OPN5 during the same LD cycle... - / - The animals did not exhibit the same amplitude of clock gene expression. In particular, in wild-type mice (or twilight), a large transcription induction was observed around clock time 12 for Per2, Per1, Cry2, and Dbp, but this induction was associated with OPN5. - / - It was not present in ear skin (Figures 18A-18D). A similar pattern was observed for Rev-erbα, but with prolonged high-amplitude expression throughout the light phase (Figures 18F and 18L). At constant darkness (DD), the skin of wild-type animals showed a decrease in the amplitude of the same gene that showed strong expression amplitude in LD, and OPN5 - / - The results were statistically consistent with the tissue (Figures 18G-18J and 18L). Interestingly, the expression of the core clock gene Bmal1 did not change with lighting conditions or genotype (Figures 18E and 18K). This suggests that photo-induced amplitude enhancement acts over an already active circadian clock and is not required for the function of the core clock itself. Furthermore, a significant "hump" in expression was observed in OPN5 - / - In the skin, this occurs in Per2 and Cry2 from midnight to late night, indicating the presence of systemic photocues in addition to OPN5-driven photosensitivity in the early and late morning (Figures 18A and 18C). In the liver, Per1 and Examination of Per2 expression (Figures 18M and 18N) shows that expected expression remains unchanged in OPN5 null mice under both LD and DD conditions. According to some embodiments, this suggests that the role of OPN5 in regulating the amplitude of clock gene expression in the ear skin is local to the skin and not a result of a decrease in central synchronization. According to one embodiment, photomodulation of Per gene expression is suggested as a fundamental mechanism of photosynchronization of the SCN clock by the retina. These results reveal similar strong diurnal induction of clock-related genes in areas of exposed skin.

[0197] (In vivo photosynchronization of the skin clock) The currently accepted model for peripheral circadian oscillator synchronization in mammals assumes that synchronization signals for peripheral tissues originate from photo-synchronized SCNs. According to some embodiments, the behavior of some peripheral circadian clocks can synchronize in the absence of a functional SCN, thus contradicting this model. This suggests that peripheral opsin expression may potentially substitute for the SCN in providing photo-synchronization signals in ivivo. To evaluate the relative contributions of central (SCN-dependent) and local phase control of the cutaneous circadian clock, mice lacking photoinput to the SCN but possessing intact OPN5 function in the skin were used. Melanopsin (OPN4) - / - ) is null, and degeneration of rods and cones (Pde6b rd1 / rd1 Mice with ) do not deliver light-synchronization signals to the SCN, allowing their motor activity cycle to "move freely" through the light-dark cycle. Therefore, OPN4 - / - In Pde6brd1 / rd1 mice, there are days during which the active phase progresses to the exact opposite of the LD cycle phase. According to some embodiments, this provides an opportunity to determine whether the ear skin clock is taken up independently by the light-dark cycle or oscillates in phase with the SCN.

[0198] After at least 3 weeks of exposure to a 12-hour light:12-hour dark cycle, OPN4 - / -;Pde6b rd1 / rd1Mouse wheel-running behavior was recorded and used as an indicator of the SCN clock phase (Figure 19a). Clock gene expression rhythms were analyzed in two cohorts of mice. In one cohort, activity onset coincided with lighting (diurnal) (Figure 19A, colored boxes), while in the other cohort, activity onset coincided with lighting out (nocturnal) (blue boxes). RT-PCR analysis showed that the expression phases of Bmal1, Per2, Per1, and Dbp were the same in both cohorts in the auricle and tactile pads (Figures 19B and 19C, red and blue traces), indicating synchronization with the LD cycle. In contrast, clock gene expression in the liver and pituitary gland remained synchronized with behavior and the SCN phase (Figures 19D and 19E). This strongly suggests that (1) photoreceptors present in the skin can photosynchronize the local circadian clock in vivo, and (2) these signals can neutralize signals from the central circadian pacemaker that control behavior in the presence of the LD cycle.

[0199] Figure 15 shows, for example, that OPN5 is expressed in LEF1-positive hair follicle stem cells: (A and B): P8 OPN5 + / cre Overview images of dorsal ear skin (A) and P8 tactile pad skin (B) from labeled frozen sections derived from Ai14 mice. In these and all panels of the figures, blue indicates nuclear labeling by Hoechst 33258, and red indicates expression of the Ai14 tdTomato cre activity reporter. Clusters of tdTomato-positive cells are observed in hair follicles (A and B) and tactile hair follicles (VF) (B). Sparsely distributed populations of tdTomato-positive cells are observed outside the hair follicles and closer to the skin surface (B, white dashed line). (C): tdTomato cell clusters (red) around the base of the hair follicle in a full-length adult ear image using white light to visualize the hair shaft. (D~I): OPN5 + / cre;Ai14 dorsal ear skin (D, F, and H~I) and tactile pad skin (E and G). tdTomato-positive cells also include c-KIT (D and E), MITF (F), DCT (G), β-catenin (H, transverse), and LEF1 ( Observed together with antibodies against I). White arrows indicate strongly double-labeled cells or cell clusters. (J): OPN5 transcripts were detected in adult tissues using quantitative or endpoint RT-PCR as a label indicating active OPN5 transcription at this stage of development. All transcription levels measured by standard curve qPCR are shown in comparison to expression in the liver. Retina, n=5; cornea, n=5; ear, n=5; tactile pad, n=5; tactile follicular, n=4; tail, n=4; foot, n=4; pituitary, n=5; liver, n=5. Bars represent mean ± standard error. *p<0.05, one-way ANOVA, Tukey post-hoc analysis. (K) Adult OPN5 on the dorsal ear skin, sg (sebaceous glands) + / cre Images from Hoechst 33258-labeled frozen sections of Ai14 mice. Scale bars represent 50 μm unless otherwise specified.

[0200] Figure 16 shows, for example, that cultures of the outer ear tactile pads exhibit OPN5-mediated photosynchronization. (A~C): Does not contain 10mM 9-cis-retinaldehyde (A) or contains ( B) Per2 5 days after ex vivo LD cycle, derived from wild-type mice or (C) from OPN5- / - mice containing 10 μM 9-cis-retinaldehyde. Luc Luminescence traces of cultured ear (pinna) tissue from mice. The blue and red traces represent two tissue samples from the same animal in separate culture dishes exposed to out-of-phase light-dark cycles. (D~F): Same as (A~C), but with tactile pad tissue. (G~I): Luminescence traces of pituitary (G and H) or liver (I) cultures 5 days after the LD cycle in ex vivo. (J): Phase of the Per2Luc emission peak 5 days after LD at either the 0° or 180° position of the phototuning device. The dots indicate the mean ± standard error. White and gray dashes represent the time the tissue experienced light or dark in the previous LD cycle. There are n=5 pairs of cultures for each group.

[0201] Figure 17 shows, for example, the induction and phase shift per gene from acute light exposure. (A): Relative RNA transcripts from the outer ear measured by qPCR from wild-type organoid tissue cultures. Tissues were cultured for 2 days, then subjected to a 90-minute 5 W / m2 violet light pulse starting at the indicated phase (white bar), or placed in the dark (dark bar). All transcripts are shown against β-actin and against their own dark control (dark bar) using △△Ct RT-PCR. All tissues were incubated in 10 μM 9-cisretinaldehyde. (B): Wild-type or OPN5 that received an optical pulse in vivo - / - Induction of Per2 and Per1 in the auricular skin of mice. Mice are synchronized to the LD cycle, and then induced at 2 W / m² starting at circadian time 13. 2 The samples were kept in constant darkness for two days before being subjected to a 60-minute pulse of violet light. (A and B) Two-way ANOVA p<0.05. *=p<0.05 in Tukey post-hoc analysis. CT2 n=3, CT4 n=3, CT6 n=5, CT8 n=5, CT10 n=4, CT12 n=4, CT14 n=15, CT16 n=4, CT18 n=3, CT20 n=3, CT22 n=3, CT24 n=3. In vivo, the dark group For the first group, n=5, and for the second group, n=7. (C): 90 minutes, 2×10 14 photon cm -2 s -1 , Culture Per2 that receives light pulses of 415nm, 475nm, or 525nm LucPhase response curves of mouse auricle. Handling controls performed in the dark are indicated by gray circles. Pulse times are shown as the start of pulses corresponding to the peak of Per2Luc emission at circadian time 12. (D): Wild type (purple, same data as C, left) and OPN5 - / - (Gray) Phase response curves comparing cultured auricles. (E): Wild-type (purple) or OPN5 cells that received a 90-minute 415 nm light pulse on the third day of the illustration. - / - (Gray) Raw Per2 of the auricle luc Luminous tracing. (F): Phase delay induced by a 90-minute optical pulse of the illustrated optical flux and wavelength. Dots and error bars represent the mean ± standard error. (G): Action spectrum of the half-maximum relative sensitivity of the data from (F) (black dots) compared with the mouse OPN5 absorbance spectrum fitted from

[16] (purple line). (H): Per2 from cultured mouse auricle viewed from the base of the hair follicle Luc Bioluminescence. (I):OPN5 Cre / + tdTomato expression from (red); Per2 Luc Ai14 ear tissue overlaid with bioluminescence from the ear (white from H). (J): Quantification of individual bioluminescent hair follicles in (H) imaged over 6 days. 415 nm, 2 × 10⁻⁶ 14 photon cm -2 s -1 Light pulses were applied for 90 minutes on day 2.7, as described.

[0202] (Consideration) According to some embodiments, OPN5 may be expressed in retinal neurons and function in the eye to mediate local photosynchronization of the retinal endogenous circadian clock. Furthermore, according to some embodiments, OPN5 may be expressed extraocularly in tactile cilia and auricular skin and function locally in photoreceptor mechanisms that directly synchronize the circadian rhythms of these tissues with the external light-dark cycle. Isolated skin can synchronize its circadian oscillations with the light-dark cycle ex vivo, possibly via OPN5-dependent induction of Per gene expression. In vivo, this local mechanism allows skin rhythms to maintain synchronization with the light-dark cycle even under conditions where the central oscillator (represented by motor activity) is freely moving. OPN5 expression is also required for the full amplitude of circadian rhythm Per gene expression in the LD cycle in vivo.

[0203] The fact that exogenous cis-retinaldehyde is required in cultured skin to exhibit photosensitivity, and that the action spectrum and reported absorption spectrum for OPN5 are consistent, strongly suggests that the skin's photoreceptor mechanism utilizes OPN5 as a photopigment. The circadian clock in mammalian skin controls responses to UV light, as well as cell cycle progression in hair follicles and keratinocytes, and responses to physical damage. According to some embodiments, photomodulation of these clocks by OPN5 function can significantly affect these physiological functions. Furthermore, these results suggest that mammals such as fish, amphibians, and birds utilize extraocular opsin photopigments for direct, light-dependent modulation of circadian clock function in certain peripheral tissues. According to some embodiments, this challenges the widely accepted notion that peripheral circadian rhythms in mammals are exclusively synchronized by a master SCN circadian pacemaker via ocular photoreception, suggesting that mammals also utilize local photosensing in peripheral tissues for this purpose.

[0204] Opsin expression in the extrinsic region raises important questions regarding their physiological function. In the retina, 11-cis-retinaldehyde is produced by the retinal pigment epithelium (RPE). However, in frog skin, avian hypothalamus, mammalian smooth muscle, and mammalian skin, opsins need to receive retinaldehyde from alternative sources. In culture systems, exogenous retinaldehyde is often required. Determining the sources and processing mechanisms for proper chromophore function in these extrinsic regions is of interest. According to some embodiments, skin exposure to short-wavelength light has been demonstrated to produce diverse systemic effects, including β-endorphin and urocanic acid production. The photoreceptors for these important effects have not been identified. According to some embodiments, OPN5 is suggested to be a candidate photopigment in the skin for mediating diverse light-dependent physiological functions.

[0205] Figure 18 shows, for example, the wild type and OPN5. - / - The expression of clock genes in the outer ear is shown. Ears were collected from mice housed in either a 12-hour:12-hour LD cycle (AF) or at least 36 hours of constant darkness (GL). Transcription levels were determined using △△Ct RT-PCR. The white and black boxes on the chart indicate the light or dark duration in the LD cycle or subjective LD cycle for the group in DD. Wild-type data are indicated using blue symbols and OPN5. - / - Data from these sources is indicated using red symbols. Charts (M and N) show labeled wild-type and OPN5. - / - The data for the liver from LD and DD mice are shown. Each chart point represents the mean ± standard error for n=4 in each group. To assess significance over time, the inventors used ANOVA with Tukey's post-hoc statistical test. p<0.05 is indicated by a hash symbol (number). The same statistical test was used to assess differences over time: between groups p<0.05 is indicated by an asterisk (*). n=4 mice for each point.

[0206] Figure 19 shows, for example, that circadian transcripts in the skin are synchronized to the LD cycle in vivo. (A): OPN4 in a 12-hour light:12-hour dark cycle - / - ;Pde6b rd1 / rd1 Representative actograms of wheel-running behavior in mice. Actograms outlined in red represent animals whose behavioral phase matches the last day's lighting, indicating the start of the behavior. Actograms outlined in blue represent mice in the opposite behavioral phase to the last day's lighting. (B~E): Transcript abundance from auricular skin (B), tactile pad (C), pituitary gland (D), or liver (E) collected at clock times indicated based on the LD cycle. Red traces indicate animals collected on days when behavior coincided with the onset of light. Blue traces were collected from animals when the onset of behavior coincided with the onset of dark. n=4 mice for each point. Two-way ANOVA results for (B) non-significant p=0.43~0.91; (C) non-significant p=0.16~0.70; (D) p=0.001~0.009 (excluding Dbp=0.16); and (E) p=0.001~0.043. [Table 5-1] [Table 5-2]

[0207] (Availability of materials) No new or unique reagents were generated in this study.

[0208] (Experimental model and subject details) (mouse) All animal experiments were conducted in accordance with protocols approved by the Animal Experimentation Committees of the University of Washington and Cincinnati Children's Hospital Medical Center. OPN5 - / - The mice were generated as described in

[19] . OPN5 CreMice were generated in-house in a CCHMC transgenic core using CRISPR-Cas9 targeting. See Allele Design for details. Four guide RNAs targeting exon 1 of OPN5 were selected and used to knock in Cre cassettes. Plasmids containing the gRNA sequences were transfected into MK4 cells (an in-house mouse cell line representing induced post-renal mesenchyme used for epithelial transformation). The gRNA editing efficiency was determined by a T7E1 assay using MK4 cells transfected with PCR products. The gRNA sequence used for subsequent transfection was TGGAGTCCTACTCGCGGACG (SEQ ID NO: 44). Sanger sequencing was performed to validate the knock-in sequence in the founder mice. OPN5 cre The primer sequence for determining the genotype of the allele is as follows: OPN5 cre -inF1:TGGAAAGAGATGCATTTGTGAG (Sequence ID 45), OPN5cre-inR1:ACAGCCTATGAATTCTCTCAATGC (Sequence ID 46), and OPN5 cre -inF2:CACTGCATTCTAGTTGTGGTTTGTCC (SEQ ID NO: 47). Primer vs. OPN5 cre -inF1 / OPN5 cre -inR1 detects the wild-type allele (300 bp) and OPN5cre-inF2 / OPN5 cre -inR1 detects the cre allele (209 bp). Founder: OPN5 Cre The mouse was crossed with the B6;129S6-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze / J mouse (JAX stock number 007908) to obtain OPN5 Cre I created the Ai14 tdTomato animal.

[0209] For immunohistochemistry, 8-day-old mice were used as neonatal mice, and mice older than 6 weeks but under 1 year were used as adult mice.

[0210] Mice older than 6 weeks but less than 1 year were used for behavioral studies, in vivo studies of gene expression, and ex vivo tissue cultures.

[0211] OPN4- / -;Pde6b rd1 / rd1 Regarding the free movement of the mice, the mice were 4 to 6 months old at the start of each experiment.

[0212] Care was taken to use both male and female mice in all experiments. Mice were given free access to food and water and maintained at a standard humidity of 20°C–25°C. Mice were randomly assigned to experimental groups based on their genotype.

[0213] (Details of the method) (immunohistochemistry) The animals were euthanized, and skin samples were collected at the indicated age. The tissue was fixed in 4% PFA at room temperature for 2 hours, then washed in 1×PBS for 15 minutes. The skin was cryoprotected in a 30% sucrose solution in PBS, embedded in OCT (TissueTek), and sectioned into 16 μm sections. The slides were subjected to antigen recovery for 10 minutes in ice-cold 10 mM sodium citrate containing 0.05% Tween-20. Next, the sections were blocked in 10% donkey serum containing 0.5% Triton in 1×PBS and stained overnight at 4°C with antibodies against c-KIT (1:250, CellSignaling no. mAb3074), MITF (1:250, Abcam no. ab12039), DCT (1:250, Proteintech no. 13095-1-ap), LEF1 (1:500, CellSignaling no. 2230S), and 0-catenin (1:500, Santa Cruz Biotechnology no. sc-7199). After three 15-minute washes with 1×PBS, the samples were labeled with secondary antibodies (1:1000 Alexa488 donkey anti-rabbit, 1:1000 Alexa647 donkey anti-mouse, or 1:1000 Alexa647 goat anti-rabbit) and Hoeschst 33342 for 1 hour at room temperature. Imaging was performed using a Zeiss LSM700 confocal microscope.

[0214] (Ex vivo photosynchronization and photo-induced gene expression) The animals were euthanized by CO2 asphyxiation, skin was collected, and the epidermal side was sterilized with a 70% isopropyl alcohol swab before being placed in cold Hank's Balanced Salt Solution (HBSS, Thermo Fisher). The outer ear (auricle) was incised along the cartilage layer by separating the dermis on both sides of the cartilage layer. The muscle tactile pad was collected, and the three adjacent micro-tactiles, including the surrounding fat and muscle, were incised down to the base of the hair follicle. All skin explants were placed epiderm-side up on cell culture inserts (PICM0RG50, Millipore). Pituitary and liver samples were immediately placed on cell culture inserts. The cell culture medium consisted of Dulbecco's modified Eagle medium (DMEM) supplemented with B-27 supplement (Thermo Fisher), 352.5 μg / mL NaHCO3, 10 mM HEPES (Thermo Fisher), 25 units / mL penicillin; 25 μg / mL streptomycin (Thermo Fisher), 0.1 mM luciferin potassium salt (Biosynth), and 10 μM 9-cisretinaldehyde (Sigma) or 10 μM total trans-retinaldehyde (Sigma). Organ-type cultures were sealed with vacuum grease and maintained in a 36°C incubator without CO2.

[0215] As previously described, cultured tissues were subjected to light-dark cycling using a device that allows tissues located at opposite positions (specified as 0° and 180°) to experience out-of-phase light-dark cycles

[27] . Briefly, a motor rotated a solid black disk with a pie-shaped transparent window for 24 hours so that each pair of tissues was irradiated for 9 hours in each 24-hour cycle. The light was produced from LEDs with peak wavelengths of 415 nm, 475 nm, and 530 nm. A Macam Q203 quantum radiometer was used for radiometric photometric measurements.

[0216] After a 5-day light-dark cycle, cultured tissues were placed in constant darkness using a Lumicycle illuminometer (Actimetrics), and bioluminescence was continuously measured. Bioluminescence data were detrend-removed by using a first-order polynomial fit to remove the steady-state decline of background bioluminescence. A best-fit sine wave was fitted to the detrend-removed data to measure the oscillation period (Lumicycle analysis). The phase was determined using oscillations of at least 3 days.

[0217] For acute photo-induced and phase-shift experiments, the phase of cultured tissue is controlled in a Lumicycle machine. As a guide, the second peak of luminescence was used for measurement compared to a non-phototreated control tissue. The tissue was then incubated in a light-shielding, insulated chamber (to maintain a constant culture temperature) at 5 W / m². 2 The tissue was then transferred to an incubator with 415 nm light for 90 minutes. The tissue was then placed in an ice-cold RNAlater (QIAGEN) for subsequent RNA extraction, or monitored for luciferase expression rhythm. Phase delay was measured as a predicted value, subtracting the Per2 luciferase rhythm observed after the light pulse, based on the phase and period of the rhythm before the light pulse. For the action spectrum, irradiance response curves for individual wavelengths were fitted using a four-parameter sigmoid curve with a Hill slope. These curves were then normalized to half-value 1 for comparison with published absorption spectra.

[0218] For in vivo light-induced experiments, mice were tuned to 12 hours of light. A 12-hour dark cycle was performed for at least three weeks, followed by two days of constant darkness. At a point corresponding to one hour after the start of the dark phase (CT13) of the previous light-dark cycle, the mice were exposed to 415 nm light at a w / m² intensity. 2 After 60 minutes of exposure, the animals were euthanized by dislocating their necks, their ears were incised, and the contents were placed in a cold RNAlater.

[0219] (Imaging bioluminescence using ex vivo imaging) A custom darkroom was created to allow the Retiga Lumo CCD camera (Q imaging) to image the cultured tissue from below. The tissue was maintained at 36°C using a microscope stage incubator (Bioscience Tools). Luminescence was collected at 30-minute intervals, generating one image for a total of 48 images / day.

[0220] (Analysis of in vivo clock gene transcription) OPN4- / -;Pde6b rd1 / rd1 Mice were placed in cages equipped with running wheels. Their wheel-running behavior was continuously monitored and recorded using ClockLab software (Actimetrics). The light used was 415nm (4.2 × 10⁻¹⁰). 14 photon cm -2 s -1 ) and 475nm (7.2 × 10 14 photon cm -2 s -1 The LD cycle included an LED with peak spectral output. At least three weeks after exposure to the LD cycle, when the onset of activity coincided with either the on or off of the light, the mice were euthanized using neck dislocation, the tissue was dissected under dim red light and preserved in cold RNAlater. The animals were 3–12 months old and included both male and female mice. Wild type and OPN5 - / - For the analysis of clock gene expression in mice (Figure 17), mice were housed in cages as described above for at least 3 weeks, then euthanized using cervical dislocation at a specific clock time, or kept in constant darkness for at least 36 hours before tissue collection.

[0221] (RNA extraction and RT-PCR) Total RNA was extracted from tissue using TRI reagent (Thermo Fisher) according to the manufacturer's instructions, and cDNA was generated using the High Capacity RNA to cDNA kit (Applied Biosystems). QPCR was performed using the Absolute Blue QPCR mix (Thermo Fisher) on an Applied Biosystems 7500fast Real Time PCR machine. The relative amount of the transcript was quantified using the 2^-△△Ct method, the transcript of interest was compared to β-actin, and the light-treated group was compared to dark control tissue from the same animal.

[0222] To compare transcripts between tissue types in Figure 15, standard curve RT-PCR was used to avoid complications of differential expression of endogenous control genes between tissues. The amplicon of the OPN5 transcript was generated from mouse retinal cDNA and cloned into the pCR2.1 TOPO cloning vector (Life Technologies). Standard curves were constructed using 10⁹–10⁻² copies of the OPN5-pCR2.1 TOPO plasmid in a 1:100 dilution series.

[0223] (Quantitative analysis and statistical analysis) To quantify the opsin transcript abundance in Figure 15J, ANOVA was performed on the entire dataset, and Tukey post-hoc analysis was carried out using Sigma Plot 11.0 software. N is reported in the legend of the figure. For ex vivo light induction in Figure 17A, the transcript abundance was compared with the abundance of dark samples collected from the same animal cohort. In vivo, different animals were used for light and dark experiments. ANOVA was performed on the entire dataset, and Tukey post-hoc analysis was carried out using Sigma Plot 11.0 software. N is reported in the legend of the figure. For the action spectrum in Figure 17F, N is as follows: 370nm light 10 11 n=5, 10 12 n=6, 3×10 12 n=5, 10 13 n=5, 10 14 n=7, 10 15 n=5;400nm light 1011 n=4, 10 12 n=6, 3×10 12 n=4, 10 13 n=5, 10 14 n=4, 10 15 n=4;4 15 nm light 10 11 n=4, 10 12 n=5, 3×10 12 n=6, 10 13 n=7, 10 14 n=8, 10 15 n=7, 10 16 n=4;475nm light 10 13 n=4, 10 14 n=7, 10 15 n=4, 10 16 n=7, 10 17 n=7;525nm light 10 13 n=5, 10 14 n=7, 10 15 n=5, 10 16 n=6, 10 17 n=6. Using Sigma Plot 11.0, sigmoid Hill curves with four parameters were fitted to the data from individual wavelengths. For Figure 18, ANOVA was performed, comparing WT and OPN5. - / - We compared both light conditions and genotypes between the groups and used Tukey's post-hoc test. For Figure 19, we performed ANOVA on the between-group data for individual tissues and used Tukey's post-hoc test. N in Figures 18 and 19 is listed in the legend of the figures. The mean ± standard error of all quantified data is shown. n represents individual animals for in vivo experiments and individual organ-type tissue cultures for ex vivo experiments.

[0224] (Data and code availability) This specification did not generate any datasets or new code.

[0225] (The opsin-5-dopamine pathway mediates light-dependent vascular development in the eye.) During postnatal eye development in mice, the embryonic vitreous vascular network regresses from the vitreous humor as an adaptation to higher vision. This process occurs at precisely controlled timings. According to some embodiments, opsin 5 (OPN5; also known as neuropsin)-dependent retinal photoresponse modulates vascular development in the postnatal eye. In OPN5 null mice, vitreous vessels regress prematurely. According to some embodiments, 380 nm light stimulation via OPN5 and VGAT (vesicular GABA / glycine transporter) in retinal ganglion cells is demonstrated to enhance the activity of endoretinal DAT (SLC6A3; also known as dopamine reuptake transporter) and thus suppress vitreous dopamine. Dopamine then acts directly on vitreous vascular endothelial cells to suppress the activity of vascular endothelial growth factor receptor 2 (VEGFR2), promoting vitreous vascular regression. Loss of OPN5 function leads to elevated vitreous dopamine levels and premature vitreous regression. Therefore, these studies identify violet light as an onset timing cue that adjusts axial clearance in preparation for visual function via the OPN5 dopamine pathway.

[0226] (overview) Photons from the sun reach Earth at high flux. In response, organisms have evolved detection systems to decode light information for adaptive advantages. Examples from mammals include the visual system, which detects photons reflected from objects to decode their identity, and the circadian system, where the 24-hour light cycle synchronizes time-dependent physiological functions. Most photodetectors in metazoans are opsins, a class of G protein-coupled receptors that convert photon energy into cellular signaling responses. Rhodopsin (opsin of the mammalian rod photoreceptor) is a well-characterized example of a visual opsin, but melanopsin (opsin 4 (OP)) is another example. N4) also known as N4 plays a central role in circadian clock light synchronization. Neuropsin (also known as OPN5) is another member of the opsin family. OPN5 is known for its violet light wavelength (λ maxOPN5 responds to light at 380 nm and regulates seasonal breeding behavior in birds and activity cycles in mice, but is relatively little known about it, except that it also mediates the optical synchronization of the retinal circadian clock. Here, OPN5 function has been investigated in mouse eye development and, according to some embodiments, has been shown to be necessary for normal biological timing. In this case, OPN5 is required for the optical response that modulates the timing of vascular regression.

[0227] (result) According to some embodiments, OPN5 is expressed in a subset of retinal ganglion cells. OPN5 is expressed in retinal ganglion cells (RGCs) of adult mice. To further evaluate the characteristics of OPN5-expressing cells, OPN5 cre The allele was combined with Ai14, a tdTomato expression cre reporter. Labeling with multiple markers showed that the overall structure of the OPN5 null retina remained unchanged. In the P5 (5 days postnatally) retinal flat mount, OPN5 cre Ai14 cells were relatively sparse throughout the inner retina (Figure 20A). In P12 calretinin-labeled frozen sections, OPN5-expressing cell bodies were located in the ganglion layer (Figures 20C, D). In P5, Ai14-expressing processes were immature (Figure 20A), while in P12, the processes were prominent and observed as bundles within multiple layers of the nerve fiber layer (NFL) and the inner plexiform layer (IPL; S1-S5 (sublamina of the IPL); Figures 20C, D). These morphological features are consistent with those of RGC.

[0228] OPN4 antibody-labeled cre;Ai14 retina in OPN5 demonstrated that OPN4 and OPN5 are expressed in different RGC subsets. In P5, OPN5 cre The densities of Ai14 and OPN4-labeled cells were similar (Figure 20B). In P12 (Figures 20E-H), co-labeling was mainly OPN4 and OPN5. creWe again demonstrated that Ai14 cells consist of two distinct subsets. Prominent bundles of axons from OPN5 and OPN4 RGCs were cofasciculated (Figure 20E-G). Rare co-labeled cells were identified (Figure 20F, H, approximately 50 cells per retina), but these may have arisen from cre lineage marking oversampling. In P24, OPN5 cre Brainbow20-labeled retinal cells (Figure 20I, J) have the appearance of mature RGCs with extensive dendritic axes and axons. OPN5 cre Frozen brain sections from Ai14 mice showed axons in the optic tract, lateral geniculate nucleus, and superior colliculus, as expected for RGCs. Labeling of the Ai6 retina at P8 with the RGC marker RBPMS (a multisplicing RNA-binding protein) and the RGC / amacrine marker calretinin provided evidence that OPN5 is exclusively expressed in RGCs.

[0229] Figure 20 shows, for example, that OPN5 is expressed in different subsets of RGCs. P5, OPN5, showing tdTomato cre reporter (a, b), nuclear labeling with Hoechst 33258 (b), and counterlabeling for OPN4 (b). cre ;Flat-mount retina derived from Ai14 mice. c, d: P12, OPN5 showing the Tomato Cre reporter. cr e; Retinal frozen sections from Ai14 mice (c, d), nuclei containing Hoechst 33258 (c, d), and labeling for calretinin (d). Retinal layers are indicated by abbreviations between panels: GCL, ganglion cell layer; S5-S1, sublamina of the inner plexiform layer; INL, inner granular layer; OPL, outer plexiform layer. e~h: Same as a and b except P12. i, j: P24 OPN5 creFlat-mount retina showing labeling of cell bodies (asterisks), dendritic regions, and axons (arrows) for RGCs labeled with the Brainbow3.2 reporter in mice. Scale bar: 20 μm. Panels a-j are representative examples from at least three separate experiments. Further examples of these images can be found on Figshare (https: / / figshare.com / ar It is available at ticles / NCB_Additional_Images_pptx / 7450961.

[0230] According to some embodiments, normal vitreous vascular regression timing requires OPN5 and violet light. According to some embodiments, light stimulation of OPN4 modulates vitreous vascular regression and retinal neovascularization. Vitreous regression was evaluated in OPN5 null mice, induced by this. At P1, OPN5 null mice showed normal vitreous vascular count (Figure 21a, b, g, h) and normal vascular cell density (Figure 21c, d, control: 13.3 ± 1.2, OPN5 null: 13.2 ± 1.6 nuclei per 100 μm length, P = 0.92). At P8, OPN5 null mice had fewer vitreous vascular cells (Figure 21e-h) and showed early regression. This phenotype is unique because all previously described hyaloid phenotypes, including those of OPN4 null mice, exhibit hyaloid persistence. Premature vitreous regression in OPN5 null mice is best demonstrated when the number of blood vessels is quantified over time (P1-P8) (Figure 21g, h, blue line) and compared with controls (Figure 21g, h, gray line) and OPN4-null mice (Figure 21h, green line). Premature vitreous regression is observed when OPN5fl is conditionally deleted in the retina using Chx10-cre or Rx-cre (Figure 21i-k). Therefore, according to some embodiments, OPN5 is locally required in retinal neurons to regulate vitreous regression.

[0231] To mimic OPN5 loss of function using lighting conditions, mice were reared from birth in the absence of 380nm wavelength light, which maximally stimulates OPN5. Control mice were reared on light-dark cycles with "VBGR" (purple (380nm), blue (480nm), green (520nm), and red (630nm)) lighting and showed typical vitreous vascular numbers at P8 (Figure 21l, n, gray bars). In contrast, mice reared on "BGR" lighting without purple light showed premature vitreous regression (Figure 21m, n, blue bars). This phenotypicly mimics OPN5 null mice and is consistent with a model in which 380nm photons stimulate OPN5 and suppress vitreous vascular regression.

[0232] Figure 21 shows, for example, premature vitreous vascular regression and the absence of 380 nm photons in OPN5 null mice. P1 OPN5 + / + (a) and OPN5 - / - (b) Vitreous vascular preparations labeled with Hoechst 33258 (blue) from mice. c, d: OPN5 labeled with Hoechst 33258 (red) and isolectin (green). + / + (c) and OPN5 - / - (d) High-magnification images of two examples each of the P1 vitreous vascular segment from mice. e, f: P8 OPN5 + / + (e) and OPN5 - / - (f) Hoechst 33258-labeled vitreous vascular preparations from mice. g: OPN5 over a period of P1-P8 hours. + / + (WT), OPN5 + / - (het) and OPN5 - / - Quantification of vitreous vessel number in mice. Similar to h:e, but with control and OPN5. - / - and OPN4 - / - Relative number of vitreous vessels in mice. i, j: P8 OPN5 fl / fl Control (i) and OPN5 fl / fl Vitreous vascular preparations labeled with Hoechst 33258 from Rx-cre(j) mice. k:OPN5 fl / fl In contrast, OPN5 fl / fl ;Chx10-cre and OPN5 fl / flQuantification of P8 vitreous vessel count in Rx-cre mice. l, m: Hoechst 33258-labeled vitreous vessel preparations from P8 mice reared from birth under full-spectrum (VBGR) (l) or "minus violet" (BGR) (m) illumination. n: Quantification of P8 vitreous vessel count from P8 mice reared from birth under full-spectrum (VBGR) or "minus violet" (BGR) illumination. All P-values ​​were determined by Student's t-test. NS (not significant). The number at the bottom of each chart is n, representing the number of animals evaluated. Error bars are standard errors. Scale bars: 400 μm (a, b, e, f, i, j, l, m) and 20 μm (c, d).

[0233] Figure 22 shows, for example, that the OPN5-dependent pathway and the light-dependent pathway are present in the eye of a newborn mouse. It has been shown to regulate dopamine levels. Controlled OPN5 in P8(a~d) and P15(e,f) + / + (a, b, e) and OPN5 - / - (c, d, f) Immunofluorescence labeling of TH (grayscale) in mouse-derived flat-mount retinas. Scale bars: 100 μm (a-d) and 20 μm (ef). g-k: Chart showing ELISA quantification of dopamine in retinal lysates (g, h) and vitreous fluid (h, i, k). P2-P8 shows dopamine levels in each tissue over developmental time (g, h). P6 OPN5 + / + Control (j, k), OPN5 + / - Heterozygotes (j,k) and OPN5 - / -The dopamine levels in retinal lysis (j) and vitreous fluid (k) from homozygotes (j, k) are also shown. Dopamine levels over developmental time courses P2–P6 are also shown, comparing normal lighting (LD) with results from dark rearing (DD) (i). P values ​​were determined by two-way ANOVA (g, h), Student's t-test (i), and one-way ANOVA (j, k). Error bars are standard errors. The number at the base of each chart is n, representing the number of animals evaluated. Panels a–f are representative examples from at least three separate experiments. Further examples of a–d are available on Figshare (https: / / doi.org / 10.6084 / m9.figshare.7450961).

[0234] According to some embodiments, the photo-OPN5 pathway modulates dopamine levels in the eye. In OPN4 null mice, elevated levels of vascular endothelial growth factor A (VEGFA) explain vitreous vascular persistence. Assessment of VEGFA and its inhibitor FLT1 levels in the vitreous humor of OPN5 null mice showed no changes. According to some embodiments, this suggests that the OPN5 photoresponse pathway modulates vitreous regression by a different mechanism. An abnormal labeling pattern for tyrosine hydroxylase (TH) was observed in the OPN5 null retina. In wild-type (WT) mice in P8, TH immunoreactivity was weak and largely limited to the perinuclear region of a subset of amacrine cells (Figure 22a, b). In OPN5 null mice, TH labeling was stronger and more prominent in cellular processes (Figure 22c, d). Even in P15, where dopaminergic amacrine cells were more fully developed, the increased intensity of TH labeling in the OPN5 null retina was evident (Figure 22e, f). TH is the rate-limiting enzyme that mediates the first step in dopamine biosynthesis. Since TH levels are under feedback regulation, these data indicated that dopamine levels can be regulated in eyes with OPN5 null. Interestingly, dopamine is known to have antivascular activity in vitro through the suppression of VEGF receptor 2 (VEGFR2) signaling. This means that OPN5-dependent regulation of dopamine may explain the OPN5-dependent regulation of vitreous regression. Therefore, according to some embodiments, it was hypothesized that OPN5-dependent release of dopamine from the retina promotes vitreous vascular regression by direct signaling.

[0235] Dopaminergic amacrine cells expressing TH develop in mice during the first few days after birth. This also means that dopamine levels in the retina typically rise rapidly postnatally. Using enzyme-linked immunosorbent assay (ELISA) quantification, we confirmed that retinal dopamine levels rise over a P2–P8 time course (Figure 22g). The dopamine in the soluble retinal tissue is mainly from intracellular storage. ELISA quantification also showed that dopamine levels in the vitreous humor, where vitreous blood vessels are present, also rise over the postnatal period (Figure 22h). In adult mice, ocular dopamine levels are photoregulated. To assess this possibility in neonatal mice, vitreous dopamine was quantified over postnatal time courses under normal lighting and constant darkness. At P4 and P6, vitreous dopamine levels were significantly elevated at constant darkness (Figure 22i), indicating that postnatally, light stimulation normally suppresses vitreous dopamine. To determine whether photomodulatory dopamine may be a result of OPN5 activity, dopamine levels were quantified by isolating the retina and vitreous humor from the OPN5 allele series in P6 (Figure 22j, k). This suggests that OPN5 homozygous null mice exhibit lower levels of intracellular dopamine in the retina. While present in both compartments (Figure 22j), it was shown to be present in higher levels in the vitreous humor (Figure 22k). According to some embodiments, these data indicate that dopamine in both compartments is regulated by OPN5.

[0236] Figure 23 shows, for example, that the photodependent activation of phospho-T53-DAT in IPL requires OPN5. P8 OPN5 in the nucleus + / +Labeling of retinal and dark-adapted mice with phospho-T53-DAT (a), half of which were exposed to 380 nm light for 30 minutes (b). NBL (neuroblastic layer). Scale bar: 50 μm. The indicated area in each panel is exported to the chart in panel e. e: Chart showing the mean (n=3) quantification profile of phospho-T53-DAT in retinal frozen sections (a, b). Gray shading highlights the elevated signal in light-induced samples. c, d: Similar to a and b, respectively, but with OPN5 - / -Regarding the retina. f:OPN5 - / - The same chart as e, except for the mouse. Traces from the chart in panel e are reproduced on the chart in f for comparison. g, h: Charts showing the area under peak quantification (n=3) of phospho-T53-DAT labeling in IPL(g) and NFL(h) for P8 mice of labeled genotype and light exposure. The vertical dashed lines in e and f indicate the quantified area. i: OPN5 during the light period + / + and OPN5 - / - Immunoblot for detecting DAT, phospho-T53-DAT (pDAT), and β-tubulin (TUBB) in the retina of mice. Phospho-T53-DAT expression was lower than normal in OPN5 null mice. P8 vitreous vessels were quantified in WT mice injected with a DAT inhibitor (DATi) derived from vehicle (veh) or E17 under either normal lighting or constant darkness. OPN5 mice injected with a DAT inhibitor from k:1 to P8 + / + , OPN5 + / - and OPN5 - / - Quantification of P8 vitreous vessels in mice. P-values ​​were determined by two-way ANOVA. Error bars represent standard errors. The number at the bottom of each chart is n, representing the number of animals evaluated. Panels a-d are representative examples of three separate experiments.

[0237] According to some embodiments, the photo-OPN5 pathway suppresses dopamine release into the vitreous humor by enhancing DAT activity. The biological effects of dopamine are regulated by its release, signaling, and reuptake. A key regulator of reuptake, and therefore a good candidate for OPN5-dependent activity, is the dopamine transporter DAT (also known as SLC6A3). Threonine 53 of DAT is phosphorylated, enhancing the rate of dopamine uptake by DAT. This activation marker can be detected using phosphate-specific antibodies. The basal phosphorylation stoichiometry of T53-DAT is typically 50%, but increases with stimuli that increase dopamine uptake. To determine whether phospho-T53-DAT levels are photoregulated and OPN5-dependent, P8 littermates use OPN5 + / + and OPN5 - / - Retinal frozen sections from a mouse cohort were dark-adapted and then labeled, followed by 1 × 10¹² photons per cm². -2 s -1 The samples were irradiated with 380 nm light for ±30 minutes. Phospho-T53-DAT labeling was observed throughout the IPL and NFL of all samples (Figures 23a-d). The phospho-T53-DAT signal was quantified by averaging the pixel intensity across horizontal pixel rows of aligned images as shown (Figures 23a-d) to generate intensity profiles (Figure 23e, gray and blue profiles) and calculating the area under the peak (shown by gray vertical dashed lines in Figures 23e and f). This revealed that the phospho-T53-DAT signal significantly increased in response to 380 nm light for the IPL (Figure 23g, gray and blue bars) rather than the NFL (Figure 23h, gray and blue bars).

[0238] To determine whether the photoinduction of the phospho-T53-DAT signaling pathway is OPN5-dependent, the same analysis was performed in OPN5 null mice (Figure 23c, d, f-h). This showed that in the OPN5 null retina, the phospho-T53-DAT signaling pathway for IPL is photoinduction. We revealed that it does not increase in response to exposure (Figure 23g, orange and red bars), indicating OPN5 dependence. Interestingly, in NFL, OPN5 null mice have lower levels of phospho-T53-DAT independently of light exposure (Figure 23h, compare gray and orange bars). However, this low level of phospho-T53-DAT can be rescued by light exposure (Figure 23h, compare orange and red bars). This indicates that NFL phospho-T53-DAT levels are regulated by both OPN5 (negative, light-independent) and a separate photoresponse pathway (positive). While the pathway for positive regulation of phospho-T53-DAT in NFL (other opsins are obvious candidates) may not be fully understood, it serves as a useful indoor control to demonstrate that OPN5 null retinas can be photoresponsive. Immunoblots detecting phospho-T53-DAT in the entire soluble retina from the light phase (Figure 23i) revealed that, overall, levels were lower in OPN5 null mice, suggesting that NFL phospho-T53-DAT constitutes a smaller proportion of the total. In summary, according to some embodiments, the analysis of T53-DAT indicates that OPN5 is required for light-dependent upregulation within IPL. Since T53 phosphorylated DAT sequesters dopamine with greater efficiency, this finding is consistent with a model in which loss of OPN5 function leads to decreased dopamine uptake by DAT and therefore elevated levels of vitreous dopamine.

[0239] Inhibition of DAT promotes vitreous regression in an OPN5-dependent manner. To determine whether DAT plays a functional role in regulating vitreous regression in vivo, the DAT inhibitor GBR12909 was used. Based on data showing that dopamine signaling can suppress VEGFR2 activation via the phosphatase SHP2, it was predicted that, according to some embodiments, inhibition of DAT activity should increase dopamine levels in the eye, and therefore counteract the effects of dark rearing, as dark rearing results in increased VEGFA levels. To test this, the effect of P1-P8 GBR12909 injection on vitreous vascular regression was compared in C57BL / 6J mice reared under either normal lighting or constant darkness. This showed that GBR12909 had no significant effect on mice reared under normal lighting (Figure 23j, normal lighting), but could reverse vitreous vascular persistence resulting from dark rearing (Figure 23j, constant darkness). According to some embodiments, this indicates that DAT activity is a key light-dependent regulator of vitreous vascular regression.

[0240] Figure 24 shows, for example, that the OPN5 RGC uses Vgat in the vitreous regression pathway (model of OPN4-VEGFA and OPN5 dopamine pathway integration). a:P8 OPN5 + / + ;Vglut2 + / + , OPN5+ / cre;Vglut2 + / + , OPN5 + / cre ;Vglut2 fl / + and OPN5 + / cre ;Vglut2 fl / fl Quantification of vitreous blood vessels in mice. b~e: P8 OPN5 + / + ;Vgat + / + (b), OPN5 + / cre ;Vgat + / + (c), OPN5 + / cre ;Vgat fl / + (d) and OPN5 + / cre ;Vgat fl / fl(e) Quantification of vitreous blood vessels from mice. f: Quantification of vitreous blood vessels in P8 mice having the genotypes listed in b~e. g~j: P8 OPN5 cre ;Ai6;Vgat + / + (g, h) or OPN5cre;Ai6;Vgat fl / fl (i, j) Retinal frozen sections imaged for phospho-T53-DAT and Ai6-cre from mice. Further examples of g-j are available on Figshare (https: / / doi.org / 10.6084 / m9.figshare.7450961). Sample size (n) for a and f is shown at the base of each bar and represents the number of mice. P values ​​were determined by one-way ANOVA. Error bars are standard errors. Images b-e represent at least 6 distinct experiments, and images g-j represent at least 3 distinct experiments. Scale bars: 200 μm (b-e) and 20 μm (g-j). k, l: Schematic diagram illustrating the integration of the OPN4-VEGFA and OPN5 dopamine vitreous regression pathways. This schematic diagram illustrates the integration of OPN4 and OPN5, respectively. Two key developmental stages, E16-E18(k) and P3-P8(l), are identified. In late pregnancy, blue light stimulation of OPN4 RGCs suppresses retinal cell solidification. In dark-housed mice or OPN4 null mice, increased cellular solidification increases oxygen demand ([O2]), and via the hypoxia response pathway, increases VEGFA expression in amacrine cells and RGCs. High levels of VEGFA induce indiscriminate retinal neovascularization and suppress vitreous vascular regression. This analysis shows that postnatal violet light stimulation of OPN5 RGCs suppresses dopamine in the vitreous humor by upregulating T53 phosphorylation of dopamine transporters in neurons during IPL. Normally, OPN5-dependent phosphorylation of DAT results in increased dopamine uptake and decreased dopamine flux from dopaminergic amacrine cells to the vitreous humor. In the absence of violet light stimulating OPN5 or OPN5, vitreous dopamine levels rise prematurely. This leads to early activation of the dopamine receptor DRD2 in the vitreous venous ecclesiastes (VEC), suppression of VEGFR2 survival signaling, and premature regression. These data suggest that both 480 nm blue light via OPN4 and 380 nm violet light via OPN5 function as timing signals for onset.

[0241] To evaluate DAT activity in the OPN5-dependent regulation of vitreous regression, GBR12909 was converted from P1 to P8 to OPN5 + / + , OPN5 + / - and OPN5 - / -The drug was injected daily into mouse pups. Quantification of vitreous blood vessels at P8 showed no significant response in WT mice (Figure 23k), but in heterozygous mice, GBR12909 induced premature vitreous regression comparable to that of OPN5 homozygous mice (Figure 23k). GBR12909 did not produce any change in homozygous mice (Figure 23k). Inhibitory activity may be buffered by intact feedback regulation in WT mice. However, in OPN5 heterozygous mice, where dopamine levels are elevated (Figure 22k) and feedback regulation may be impaired, the DAT inhibitor was able to convert the vitreous phenotype from normal to premature regression. The inhibitor is likely ineffective in OPN5 homozygotes because endogenous vitreous dopamine levels are already high (Figure 22k) and signaling activity may be near maximum. These data demonstrate a finely balanced interaction between OPN5 and DAT, consistent with OPN5-dependent regulation of DAT activity via phosphorylation.

[0242] According to some embodiments, VGAT in OPN5 RGC is required for the regulation of phospho-T53-DAT and vitreous revolution. Glutamate, gamma-aminobutyric acid (GABA), and glycine are neurotransmitters important for visual function. In adult mice, glutamate is used as an excitatory neurotransmitter by the standard photoreceptor and OPN4 RGC. GABA and glycine are inhibitory neurotransmitters, and their receptors are detected in various retinal neurons, including amacrine cells and RGCs. Glutamate and GABA / glycine are loaded into presynaptic vesicles by the VGLUT (vesicular glutamate transporter) and VGAT (vesicular GABA transporter) families, respectively. During mouse retinal development, VGAT is expressed immediately postnatally, preceding the expression of VGLUT2. Loss of function of these transporters eliminates neurotransmitter activity. To determine whether OPN5 RGC can use one of these neurotransmitters for vascular response pathways, the vitreous blood vessels of Vglut2 and Vgat OPN5 creQuantification was performed in conditional deletion mutants. Deletion of Vglut2fl did not yield results (Figure 24a), but isozygous deletion of Vgatf1 phenotypicly mimicked OPN5 germline null-premature vitreous regression (Figures 24b-f). Furthermore, OPN5 cre / + The heterozygote did not exhibit the vitreous phenotype, but OPN5 + / cre ;Vgat fl / + The mice showed significant early regression (Figure 24d, f). This transheterozygous phenotype is genetic evidence that OPN5 and Vgat function in the same pathway and in the same cell type. If this is true, Vgat conditional deletion is predicted to result in a decrease in phospho-T53-DAT levels under illumination conditions, similar to OPN5 loss of function. + / cre ;Vgat fl / + (Figure 24g, h) and OPN 5 + / cre ;Vgat fl / fl This was confirmed using immunofluorescence labeling in mice (Figure 24i, j). These data indicate that OPN5 RGCs use VGAT to signal within the vascular regression pathway.

[0243] According to some embodiments, dopamine acts directly on vitreous vascular endothelial cells to promote vitreous regression. According to some embodiments, dopamine release from the neonatal retina is light- and OPN5-dependent, and it is hypothesized that dopamine then directly signals vitreous vascular endothelial cells (VECs) to promote regression. To evaluate whether the retinal source of dopamine regulated vitreous regression, the Thfl allele was conditionally deleted. Chx10-cre was effective in studying TH function in adult mice, but did not efficiently delete Thfl during the postnatal period. However, Rx-cre was effective (Figure 25a, b), resulting in vitreous vascular persistence (Figure 25c-e), and showed that active dopamine was locally produced in the retina.

[0244] To evaluate the involvement of dopamine receptors in vitreous regression, we first used the receptor agonist SK38393. SK38393 was then used to stimulate OPN5 from P1-P8.+ / + , OPN5 + / - and OPN5 - / - Mouse pups were injected daily. SK38393 had no significant effect on WT mice, but induced premature vitreous regression in heterozygous mice. SK38393 did not cause a significant decrease in vitreous vascular number in OPN5 null mice. This response pattern is very similar to that observed with DAT inhibitors (Figure 23k). Again, this regulatory pattern is likely explained by the resilience of the intact dopamine feedback pathway in WT animals, the sensitized background in heterozygotes, and the already saturated level of dopamine signaling in homozygotes. Injection of two different dopamine receptor antagonists derived from P1-P8 in WT mice resulted in an increase in vitreous vascular number. Thus, according to some embodiments, pharmacological manipulations demonstrate that vitreous vascular regression can be positively and negatively regulated by dopamine receptor modulators.

[0245] According to some embodiments, one prediction of the hypothesis that retinal dopamine modulates vitreous regression was that dopamine receptors would be expressed in vitreous blood vessels. Since dopamine receptor D2 (DRD2) was involved in the suppression of VEGFR2 signaling, we focused on members of this family. Vascular cells, rather than vitreous-connected myeloid cells, showed Drd2-GFP reporter expression (Figure 25f, g). Furthermore, labeling with anti-DRD2 detected cells in vitreous blood vessels (Figure 25h), indicating that Drd2 targets VECs. fl / fl ;Pdgfb-icreERT2 conditional deletion was eliminated (Figure 25i). According to some embodiments, these data indicate that DRD2 is expressed in the vitreous ventricle (VEC).

[0246] Drd2 fl / flIn Pdgfb-icreERT2 mice, vitreous vascularization is persistent (Figure 25j), but there are no quantifiable results regarding the development of the superficial retinal vascular system. According to some embodiments, this identifies vitreous VECs as dopamine-responsive cells and indicates that dopamine signaling promotes vitreous regression. A further prediction of this hypothesis is that in vitreous VECs, dopamine signaling suppresses VEGFR2 activation. To test this, Drd2 in P5 fl / fl Control and Drd2 fl / fl Immunoblotting was performed for VEGFR2 from both Pdgfb-icreERT2 vitreous vessels and for the activated phosphotyrosine-1173 form of VEGFR2 (pY1173-VEGFR2). By pooling excised vitreous tissue from six animals of each genotype, threshold detection of pY1173-VEGFR2 in the control was possible (Figure 25k, left lane). To evaluate the reliability of comparative immunoblotting, a 3-step, 2-fold loading dilution was performed, and immunoblot band intensity was quantified. As shown in Figure 6, the band intensities for VEGFR2, pY1173-VEGFR2, and β-tubulin show high Pearson coefficients, indicating a linear relationship between the amount of dissolved material and the band intensity. When the pY1173-VEGFR2 value is normalized relative to VEGFR2 (Figure 6), Drd2 fl / flThe Pdgfb-icreERT2 genotype value was significantly higher (Figure 25l) and consistent with the band intensity observed by immunoblotting (Figure 25k). According to some embodiments, these data indicate that Drd2 deletion in vitreous vascular vascular cavities (VECs) allows for increased VEGFR2 activation, which typically indicates that dopamine signaling suppresses VEGFR2 activity. In further testing of this model, pY1173-VEGFR2 and pS473-AKT levels were evaluated in OPN5 null mice. pY1173-VEGFR2 levels were lower in the vitreous vessels of OPN5 null mice (Figure 25m). In addition, across allele lineages, pS473-AKT levels were lower only in OPN5 homozygotes and only in this genotype was this consistent with premature vitreous regression (Figure 25n). The elevated dopamine levels in OPN5 null mice suggest that these data are consistent with a model in which dopamine promotes vitreous vascular regression by suppressing downstream survival signaling mediated by VEGFR2 activity and AKT.

[0247] As a genetic test of the relationship between OPN5 and vascular signaling, we determined whether the deletion of Drd2 in the vein vascular center (VEC) reverses premature vitreous regression in OPN5 null mice. The number of P8 vitreous vessels was compared to the genotype OPN5. - / - In mice, OPN5 + / + ;Pdgfb-icreERT2;Drd2 fl / fl and OPN5 - / - ;Pdgfb-icreERT2;Drd2 fl / fl This was compared with the previous case. In some embodiments, this experiment confirmed premature regression of vitreous vessels due to OPN5 loss of function (Figure 25o, p, r, light blue bars), but showed that Drd2 deletion in VECs can switch to a persistent vitreous phenotype (Figure 25q, p, dark blue bars). These results establish that OPN5 and Drd2 function in the same developmental pathway and have opposite effects on vitreous regression.

[0248] Figure 25 shows, for example, that retinal dopamine promotes vitreous vascular regression through DRD2-dependent inhibition of VEGFR2 activity. fl / fl (a) and Rx-cre;Th fl / fl TH labeling (green) in four regions of mouse-derived P8 flat-mount retina. c, d: P8 control TH fl / fl (c) and Rx-cre;Th fl / fl (d) Vitreous body derived from mice. e: control (Th + / + or Th + / fl ), Rx-cre;Th + / fl and Rx-cre;Th fl / fl Number of P8 vitreous vessels in mice. f, g: Vitreous vessels from Drd2-GFP mice showing reporter expression in vessels (green) rather than macrophages (circles). h, i: Tamoxifen-treated Drd2 fl / fl (h) and Drd2 fl / fl Immunolabeling of DRD2 in the P8 vitreous humor from Pdgfb-icreERT2(i) mice. j:Drd2 fl / fl and Drd2 fl / fl Number of P8 vitreous vessels in Pdgfb-icreERT2 mice. k:Drd2 fl / fl and Drd2 fl / fl Immunoblots for VEGFR2, pY1173-VEGFR2, and β-tubulin in P6 vitreous vascular lysates from Pdgfb-icreERT2 mice. To ensure detection of a linear range, vitreous lysates were loaded in successive halves. l: n=3 mice normalized to total VEGFR2 from k, the band intensity of pY1173-VEGFR2 confirms higher active VEGFR2 expression in the Drd2 mutant. m, n: Immunoblots for VEGFR2 and pY1173-VEGFR2 (m) and AKT and pS473-AKT (n) from P6 vitreous genotypes shown. In the graph of m, OPN5 + / + and OPN5 - / - This shows the quantification of pY1173-VEGFR2 relative to VEGFR2 in vitreous vessels. pY1173-VEGFR2 and pS473-AT levels are related to OPN5 - / -Lower in mice. n=3 mice. o~q: Tamoxifen-treated OPN5 + / + ;Drd2 f l / fl (o), OPN5 - / - ;Drd2 fl / fl (p) and OPN5 - / - ;Drd2 fl / fl P8 vitreous humor from Pdgfb-icreERT2(q) mice. r:OPN5 + / + ;Drd2 fl / fl , OPN5 - / - ;Drd2 fl / fl and OPN5 - / - ;Drd2 fl / fl Number of P8 vitreous vessels in Pdgfb-icreERT2 mice. s~u:Flt1 fl / fl (s), Rx-cre;Flt1 fl / fl (t) and Rx-cre;Flt1 injected with SKF38393 fl / f l(u): P8 vitreous preparation from mice. v: control Flt1 fl / fl , Rx-cre;Flt1 fl / fl P8 vitreous vessel count in Rx-cre;Flt1fl / fl mice injected with SKF38393. Scale bars: 20 μm (a, b, f~i) and 200 μm (c, d, o~q, s~u). The number at the bottom of each chart bar is n, representing the number of mice (e, j, r, v). P-values ​​were determined by one-way ANOVA (e, r, v) and Student's t-test (j, l, m). Error bars are standard errors. The images are representative examples from at least three separate experiments.

[0249] One implication from immunoblotting data regarding pY1173-VEGFR2 (Figure 25k) and genetic analysis (Figures 25o-r) is that the balance of VEGFA and dopamine signaling determines the fate of vitreous vessels. To determine whether this balance can be demonstrated at the receptor ligand level, a rescue experiment was designed. Conditional deletion of the gene encoding the naturally occurring VEGFA inhibitor FLT1 in the retina resulted in increased levels of VEGFA activity, and therefore vitreous vessel persistence.fl / fl Chx10-cre deletion results in hyaloid persistence, but in this case, Rx-cre was used (Figure 25s, t, v, light blue bars). To determine whether dopamine receptor signaling can reverse vitreous persistence, a litter cohort of Rx-cre;Flt1fl / fl mice was injected with the dopamine receptor agonist SKF38393 (daily, from P1 to P8). This resulted in a reversal of vitreous persistence, which, according to some embodiments, demonstrates a balance of VEGFA and dopamine signaling that modulates vitreous regression (Figure 6s-v).

[0250] (Consideration) According to some embodiments, an unexpected angiogenic pathway in the eye has been identified. OPN5, an atypical opsin known to respond to near-UV photons, initiates the pathway response and becomes functional after birth (Figure 25l). Dopamine, a widely functioning neurotransmitter and neuromodulator, is an OPN5-regulated signaling intermediate that induces a DRD2-mediated response and restricts DRD2-mediated VEGFR2 signaling (Figure 25l). Based on OPN5-dependent and photodependent phosphorylation at T53, and its pharmacological inhibition, according to some embodiments, the dopamine transporter DAT is a key component of this pathway that normally suppresses dopamine levels in the vitreous humor (Figure 25l). In addition, the GABA transporter VGAT is involved in OPN5 RGC signaling because its conditional deletion at OPN5 RGC phenotypicly mimics OPN5 null premature vitreous regression and low phospho-T53-DAT levels. Therefore, the mild OPN5-VGAT-dopamine-DRD2-VEGFR2 vitreous pathway is characterized by two inhibitory steps: mild OPN5 inhibits dopamine levels in the vitreous humor, while dopamine inhibits VEGFR2 signaling in vitreous blood vessels (Figure 25l).

[0251] Light-dependent modulation of vitreous dopamine occurs against a background of generally elevated dopamine levels in the eye after birth. This means that while dopamine's function is to promote vitreous vascular regression, the effects of 380 nm photons and OPN5 suppress vitreous vascular regression. This may have evolved as a mechanism to optimize the timing of vitreous vascular regression and ensure that they continue to function after birth until the superficial retinal vascular plexus is complete. According to some embodiments, OPN4 also modulates light-dependent dopamine in the eye. It mediates vascular development and suppresses VEGFA levels because it suppresses retinal cell solidification and thus limits oxygen demand that can increase VEGFA levels (Figure 25l). The critical window for activation of the OPN4 response is late pregnancy and requires direct light stimulation of the mouse fetus. Therefore, the OPN4 and OPN5 response pathways can be considered timing signals for development, as they use separate mediators to regulate angiogenesis and function at different stages of development (Figure 25l). Notably, the spontaneous waves of neuronal activity occurring in the neonatal mouse retina are partially dependent on OPN4 regulation of gap junctions, which are then regulated by dopamine. According to some embodiments, the relationship between retinal wave activity and vascular development can be evaluated.

[0252] OPN5 is highly conserved, and the described pathway (Figure 25l) may be relevant to human biology. According to some embodiments, the latter step in the pathway, involving DRD2-dependent inhibition of VEGFR2 activity, may explain the observation that premature infants treated with dopamine (due to hypotension) have a higher risk of retinopathy of prematurity, a disease characterized by hypervascularization. According to some embodiments, therapeutic dopamine promotes vitreous vascular regression, thus exacerbating hypoxia and leading to rebound hypervascularization. Furthermore, the risk of retinopathy of prematurity in premature infants is partially dependent on the season of pregnancy, with shorter days and lower light exposure associated with a higher risk. The OPN5-dopamine pathway may be a component of this risk equation, as insufficient light is expected to lead to elevated levels of vitreous dopamine, premature vitreous regression, and therefore more severe hypoxia in premature eyes. Understanding the relationship between OPN4-dependent and OPN5-dependent regulation of ocular vascular development (Figure 25l) raises the intriguing possibility, according to some embodiments, that premature infants at risk of retinopathy of prematurity may be treated with phototherapy that differentially targets each pathway response. Furthermore, according to some embodiments, both violet light in the 360–400 nm range and dopamine are important regulators of refractive development, each capable of inhibiting the progression to myopia. Current observations suggest that the OPN5-dopamine pathway is likely involved.

[0253] (method) Mice. Animals were housed in pathogen-free animal facilities, and all pharmacological treatments were performed according to protocols approved by the Animal Experimentation Committee of Cincinnati Children's Hospital Medical Center. This study complies with all relevant ethical guidelines for animal research. The date of birth is defined as P1. The genetically modified mice used in this study were as follows: Chx10-cre(Tg(Chx10-eGFP / cre-ALPP)2Clc / J)(Jax source 005105), Pdgfb-icreER(T2) 60 , Rx-cre 49Ai14 (Jax stock 007914), Brainbow (Jax stock 021227; Brainbow3.2), Drd2 eGFP (Tg(Drd2-eGFP)S118Gsat) 61 Drrd2 loxp (Jax Stock 020631), Flt1 flox (Jax Stock 02809 Vegfr-1flox), TH flox (ref. 48 ), Vglut2 fl (Jax Stock 012898), Vgat fl (Jax Stock 012897), OPN4 (ref. 62 ) and OPN5 tm1a(KOMP)Wtsi These were generated from C57BL / 6N embryonic stem cells obtained from KOMP (embryonic stem cell clone 1D: KOMP-(HTGRS6008_A_B12-OPN5-ampicillin)). The embryonic stem cells have a genetic modification in which the LacZ-neomycin cassette is adjacent to the FRT site between exons 3 and 4, and the loxp site separates Lacz from the neomycin coding region. The loxP site is also adjacent to exon 4 of OPN5, enabling multiple mouse lines that can function as reporter nulls, conditionally floxed mice, and null mice. The OPN5fl allele is OPN5 tm1a(KOMP)Wtsi This was created by crossbreeding mice with FLPeR (Jax stock 003946) and removing the LacZ cassette. OPN5 - / - The strain is OPN5fl mice, which are E2a-cre These mice were created by crossing with (Jax Stock 003724). Except for C57BL / 6J mice reared under different lighting conditions, littermates were used as control animals in all experiments.

[0254] Genotyping primers and protocols for alleles except OPN5 are described in the cited publications or on the Jackson Labs website. OPN5 - / - or OPN5 fl / flThe primer sequences for determining the genotype of the allele are as follows: F1:CACAGTATGTGTGACAACCT (SEQ ID NO: 48); R1:R2:GTGGACAGATTAACTGAAGC (SEQ ID NO: 49);GAACTGATGGCGAGCTCAGA (SEQ ID NO: 25). F1-R1 gives a 626 bp WT band, and OPN5 fl The allele gives a 700 bp band. F1-R2 is OPN5 ヌル For comparison, a 376bp band and OPN5 fl The allele yields a 1,617 bp band. OPN5 cre The primer sequences for determining the genotype of the alleles are as follows: OPN5creF1:TGGAAAGAGATGCATTTGTGAG (Sequence ID 45); OPN5creF2:CACTGCATTCTAGTTGTGGTTTGTCC (Sequence ID 47); OPN5creR1:ACAGCCTATGAATTCTCTCAATGC (Sequence ID 46). F1-R1 gives a 300 bp band for the WT allele, and F2-R1 gives a 209 bp band for the cre allele.

[0255] OPN5 cre Mice were generated in-house using CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 (CRISPR-associated protein 9) technology. Four guide RNAs targeting exon 1 of OPN5 were selected and used to knock in Cre cassettes. Plasmids containing the guide RNA sequences were transfected into MK4 cells (an in-house mouse cell line representing induced post-renal mesenchyme used for epithelial transformation). The editing efficiency of the guide RNAs was determined by a T7E1 assay of PCR products of the target region amplified from the genomic DNA of transfected MK4 cells. The sequence of the guide RNA used for subsequent transfection was TGGAGTCCTACTCGCGGACG (SEQ ID NO: 44). Sanger sequencing was performed to validate the knock-in sequences in the founder mice.

[0256] Mice were given free rein to a standard diet (29% protein, 13% fat, and 58% carbohydrates kcal; LAB Diet 5010) and free access to water. Lactate controls were used for genetic crossbreeding, and both male and female offspring were included in the study.

[0257] (Lighting conditions) Animals are exposed to standard fluorescent lighting with 12 light / 12 dark cycles (photon flux: 1.62 × 10¹⁶) unless otherwise specified. 15 photon cm -2 s -1 It was housed in ). For full-spectrum illumination (VBGR), LEDs were used, with a total output of 1.68 × 10⁻¹⁶. 15 photon cm -2 s -1 An equivalent total photon flux was obtained. Spectral and photon flux information for LED illumination is shown in purple (λ). max =380nm, 4.23 × 10 in the 370-400nm range 14 photon cm -2 s -1 ), blue (λ max = 480nm, 5.36 × 10 in the 430~530nm range 15 photon cm -2 s -1 ), green (λ max = 530nm, 5.82 × 10 in the 480~600nm range 15 photon cm -2 s -1 ), and red (λ max = 630nm, 1.93 × 10 in the 590~660nm range 15 photon cm -2 s -1 ) For the evaluation of wavelength-limited vitreous humor, C57BL / 6J animals were housed in either full-spectrum (VBGR) or without violet (BGR) illumination for a 12-light / 12-dark cycle starting in late pregnancy (embryonic day 18 (E18)). For the dark rearing experiment, pregnant females were moved to the dark at gestational age E16. For the light induction experiment, lactating females and their offspring were moved to the dark at P7 (light off) and allowed to darken for 24 hours. OPN5 + / + and OPN5 - / - The baby, with the subjective lighting turned off for two hours. Later, 1 × 10 12 photon cm -2 s -1 (At this wavelength, the sample was exposed to 380nm light at ±30 minutes, which is approximately 1% of the sunlight on a clear summer day.)

[0258] Immunohistochemistry and imaging. Animals were anesthetized under isoflurane, and early postnatal offspring were sacrificed by neck dislocation or decapitation. Retinal and vitreous vessel preparation and immunofluorescence staining were as described above.39 For phospho-T53-DAT quantification, retinas for each genotype and light condition were collected from at least three different induction experiments under dim red light (dark-adapted) or normal light and mounted on the same OCT (optimal cutting temperature) block. Retinal sections were processed, stained, and imaged together to correct for batch differences. Alexa-conjugated secondary antibody was purchased from Jackson ImmunoResearch. Images were acquired using a Zeiss ApoTome AX10 or Zeiss LSM700 confocal microscope and processed with ImageJ(NH) and Adobe Photoshop® (Adobe Systems).

[0259] (ELISA) Vitreous humor and retina were collected from pups and rapidly frozen on dry ice. To detect dopamine levels, vitreous samples were pooled from 3 to 6 pups of varying ages and from the retinas of 6 pups for each pup. Dopamine extraction and ELISA were performed using a BA E-5300 (Rocky The procedure was performed using Mountain Diagnostics, following the manufacturer's protocol. For dark adaptation experiments, the vitreous humor and retina were collected under dim red light. To detect VEGA and FLT1 levels, samples from P5 offspring were pooled from six eyes for each n. The mouse VEGFA kit Quantikine (MMV00) and mouse VEGFR1 (FLT1) kit Quantikine (MVR100) from R&D Systems were used. ELISA readings were performed using an EnVision Multimode Plate Reader (Perkin Elmer).

[0260] (Pharmacological reagents and procedures) All dopamine pharmacological modulators except the antagonist 2-CMDO (2-chloro-11-(4-methylpiperazino)piperazino) dibenz(Z)[b,f]oxepin) were intraperitoneally injected at 1 mg / kg body weight into lactating female mothers on the day of birth and on P2, and then directly into the offspring up to P. 2-CMDO was injected into the offspring at 2 mg / kg body weight from P5 to P8. Injections were administered under dim red light one hour before the lights were turned on. The dopamine agonist SKF38393 hydrobromide, the high-affinity D2 antagonist L-741626, the dopamine transporter 1 inhibitor GBR12909 dihydrochloride, and 2-CMDO were all purchased from Tocris Biosciences. For experiments using the Pdgfb-icreERT2 mouse strain, 2 mg of tamoxifen was injected into lactating female mothers on birth day and P2 to activate tamoxifen-dependent creatinine.

[0261] Western blotting. Western blotting was performed using a standard protocol. Immediately after dissection, 12 vitreous vascular tissues or retinas from P6 (6 pups) were pooled in 100 μl of 1 × AEMMLI sample buffer and sonicated. After centrifugation, 20 μl of supernatant was used. Proteins were loaded onto a 4-20% gradient protein gel (Thermo Fisher Scientific). The separated protein bands were transferred to a PVDF (polyvinylidene difluoride) membrane, and the bands were visualized by chemiluminescence (Thermo Fisher Scientific). Band intensity was measured by ImageJ (NIH). The following antibodies were used: VEGFR2 (9698, Cell Signaling Technology), phospho-VEGFR2 (2478, Cell Signaling Technology), β-tubulin (ab6046, Abcam), DAT (NB300-254, Novus), and phospho-DAT (PA5-35414, Thermo Fisher). Scientific), AKT(4691, Cell Signaling Tec) Antibodies (Henology) and Phospho-AKT S473 (4060, Cell Signaling Technology) were used for Western blotting. All antibodies were used at a 1:1,000 dilution.

[0262] Statistics and Reproducibility. Samples for immunoblotting were pooled from multiple animals (6 pups and 6 retinas for the vitreous vascular system), and each experiment was repeated at least twice with independent samples. ELISA evaluation was performed at least twice with independent biological samples. In this analysis, each n is a distinct animal, except for immunoblotting and ELISA, where pooled samples from animals of the same genotype represent one n. Retinal images with immunofluorescence labeling represent n=3 independent biological samples from distinct littermates. Data collected for vitreous vascular quantification represent samples from multiple littermates reaching n, as shown in the chart for each genotype and state. Data are presented as mean ± standard error (standard error of the mean) in aligned dot plots overlaid with bar or line graphs. Statistical analysis for two-sided Student's t-test, one-way ANOVA, or two-way ANOVA was performed using GraphPad Prism version 4.00 (GraphPad Software) and Microsoft Excel, as shown in the figure. Statistical significance between two independent groups was determined using a two-sided distribution, two-sample unequal variance t-test, with the exception of the one-sided case shown in Figure 25m. If a significant difference was found by ANOVA, Sidak or Tukey's multiple comparison test was performed retrospectively.

[0263] (Summary of the report) (statistics) Data acquisition: Perkin Elmer Envision; Plate reader: Wallac Envision Manager version 1.12; Zeiss Zen Software for image acquisition.

[0264] Data analysis: ImageJ for Fiji (NIH), Photoshop® CS3 (Adobe), Excel 2016 (Microsoft), GraphPad Prism v4.00 (GraphPad Software, Inc.)

[0265] (data) Data exclusion: No data was excluded.

[0266] Replication: For all genetic models and pharmacological procedures, multiple litter cohorts were measured to eliminate litter influence and demonstrate reproducibility. For all immunohistochemistry, tissues were collected and analyzed from multiple animals (n≧3) across different litters. Drd2-eGF vitreous images were from two Drd2-eGFP+ eyes (generous donation from Dr. D. Copenhagen). For Western blotting experiments, hyaloids were pooled from different littermates (n=8 eyes) for each genotype, and the experiment was repeated three times. For VEGFA and FLT1 ELISA, vitreous fluid for each genotype was pooled from 6 individual eyes for each n (n=3). For dopamine extraction and ELISA, vitreous fluid for each genotype was pooled from ≧6 eyes for each n, and OPN5 + / + Except for (n=2), n=3 was used for all other cases. Retinal tissue from six individual eyes was pooled for each n of dopamine extraction and ELISA. Two to three independent ELISAs were performed depending on the genotype and tissue. For pDAT quantification, retinas from at least three different induction experiments were collected for each genotype and light condition and mounted on the same OCT block. Retinal fragments were processed, stained, and imaged together to correct for batch differences. For C57BL / 6J LD and DD dopamine time courses, offspring from each litter were randomly divided at different time points.

[0267] Randomization: The studies conducted herein were conducted using wild-type (control) and mutant (experimental) animals. These were compared and assigned to groups based on genotype. Randomization was performed while assigning littermates from the genetic model to different experiments. Offspring were randomly selected from C57BL / 6J littermates and designated for pharmacological treatment or vehicle treatment. Animals were randomized from the littermate cohort to different experiments, with one control and experimental animal from each litter designated for a specific experiment, and littermates assigned to other purposes. For light-induction experiments, offspring with different genotypes were randomly assigned from different littermates to either dark adaptation only or dark adaptation + light induction to achieve a sufficient sample size.

[0268] Blinding: For all pharmacological procedures, researchers were blinded to genotype during the procedure, except for C57BL / 6J. Since samples were pooled for Western blotting and ELISA, researchers were not informed of the animals' genotypes. Researchers were not blinded for experiments under different illumination conditions (vitreous and retinal labeling). Researchers were not informed of genotypes for other vitreous and retinal vascular quantifications and assigned genotypes to the endpoint data.

[0269] (antibody) Antibodies used: Primary antibodies against IF source calretinin (1:100) MAB1568 (Millipore), Drd2 (1:200) ADR-002 (Alomone), ChAT (1:200) AB144 (Millipore), DAT / SLC6A3 (1:200) MAB369 (Millipore), RBPMS (1:200) AB194213 (Abcam), Melanopsin (1:1000) AB-N38 (Advance Targeting Systems), pDAT (1:500) PA5-35414 (Thermo Fisher Scientific), Tyrosine hydroxylase (1:1000) AB1542 (Millipore). Primary antibodies against Western Source AKT (1:1000) No. 4691 (Cell Signaling Technology), pAKT-Ser473 (1:1000) No. 4060 (Cell Signaling Technology) DAT (1:1000) NB300-254 (Novus) pDAT (1:1000) PA5-35414 (Thermo Fisher Scientific) VEGFR2 (1:1000) No. 9698 (Cell Signaling Technology) pVEGFR2 (1:1000) No. 2478 (Cell Signaling Technology) ~- Tubulin (1:1000) ab6046 (Abcam)

[0270] Verification: All antibodies were validated both by the manufacturer and using a negative control in this study.

[0271] (Eukaryotic cell line) Cell line source: MK4 cells were used within the CCHMC Gene Targeting Core Facility to test the efficacy of guide RNA against CRISPR.

[0272] Authentication: MK4 cells were generated from CCHMC (derived from mouse metanephromemorial cells), thus they are the original source material.

[0273] Mycoplasma contamination: The inventors do not have any information regarding whether this cell line has been tested for mycoplasma contamination.

[0274] Generally misidentified strains (see ICLAC register): MK4 is the original in-house isolate.

[0275] (Animals and other living things) Experimental animals: Animals were housed in pathogen-free animal facilities, and all pharmacological treatments followed the guidelines of the CCHMC system. P1 was defined as the afternoon of the day in which offspring were born in the morning. The genetically modified mice used in this study were as follows: Chx10cre1 (Jax stock number 00515), PdgfbicreER(T2)2, Rxcre3, Ai144 (Jax stock number 007914), Brainbow5 (Jax stock number 021227) Brainbow3.2), Drd2EGFP(ref6)(Tg(Drd2-EGFP)S118Gsat), Drd2loxp(Jax stock number 020631), Flt1flox(ref8)(Jax stock number 02809 Vegfr-1flox), THflox(ref9)OPN410 and OPN5tm1a(KOMP)Wtsi, which are C57BL / 6N obtained from KOMP (ES clone ID: KOMP-(HTGRS6008_A_B12-OPN5-ampicillin)). Generated from ES cells. The ES cells have a genetic modification in which the LacZ-neomycin cassette is adjacent to the FRT site between exons 3 and 4, and the loxp site separates Lacz from the neomycin coding region. The loxp site is also adjacent to exon 4 of OPN5, enabling multiple mouse strains that can function as reporter nulls, conditionally floxed mice, and null mice. OPN5 tm1a(KOMP)Wtsi The OPN5fl allele was generated by crossing mice with FLPeR11 (Jax stock number 003946) and removing the lacZ cassette. fl / fl By crossbreeding mice with E2a-Cre12 Jax stock number 003724, OPN5 - / -A strain was created. All experiments used littermates as control animals, except for C57BL / 6J mice reared under different light conditions. OPN5cre was generated in-house using CRISPR-Cas9 technology. Four gRNAs targeting exon 1 of OPN5 were selected and used to knock in the Cre cassette. Plasmids containing the gRNA sequences were transfected into MK4 cells (an in-house mouse cell line representing induced post-renal mesenchyme used for epithelial transformation). The gRNA acquisition efficiency was determined by a T7E1 assay of PCR products of the target region amplified from the genomic DNA of the transfected MK4 cells. The sequence of the gRNA used for subsequent transfection was TGGAGTCCTACTCGCGGACG (SEQ ID NO: 44). Sanger sequencing was performed to validate the knock-in sequence in the founder mice. Mice were given free respiration on a standard diet (NCD: 29% protein, 13% fat, and 58% carbohydrates kcal; LAB Diet No. 5010) and free access to water. For this analysis, the animals were not sex-matched during the neonatal period.

[0276] (A direct, melanopsin-dependent fetal photoresponse regulates eye development in mice.) (overview) Vascular pattern formation is crucial for organ function. In the eye, regression of the embryonic vitreous vascular system (important for clearing light pathways) and formation of the retinal vascular system (important for the high metabolic demands of retinal neurons) occur simultaneously. These events occur postnatally in mice. According to some embodiments, photoresponsive pathways that modulate both processes have been identified. According to some embodiments, if mice have a mutation in the gene for the atypical opsin melanopsin (OPN4) or are housed in the dark from late pregnancy, vitreous vascularization persists to postpartum day 8, and the retinal vascular system becomes hypertrophied. Evidence suggests that these vascular abnormalities are explained by a photoresponsive pathway that suppresses the number of retinal neurons, limits hypoxia, and consequently suppresses local expression of vascular endothelial growth factor (VEGFA). It has also been shown that the photoresponse to this pathway occurs around embryonic day 16 in late pregnancy and requires photopigments in the fetus rather than the mother. Measurements indicate that visceral lumen photon flux is likely sufficient to activate melanopsin-expressing retinal ganglion cells in mouse fetuses. Therefore, these data suggest that, according to some embodiments, light (stimulation for the function of a mature eye) is also important in preparing the eye for vision by initiating a series of events that modulate the number of retinal neurons and ultimately pattern the ocular blood vessels.

[0277] Prompted by the recognition that neonatal mice are light-responsive and exhibit light-dependent neuronal connectivity changes, some embodiments suggest that a pathway exists in which light responsiveness in the early retina can induce vitreous regression, and thus optical axis clearance. To test this, pregnant mothers were kept in darkness during late pregnancy (fetal (E) days 16-17). Offspring reared in darkness until postpartum day 8 (P8) showed persistent vitreous vascularization (Figure 26a), which was confirmed by quantification over P1-P8 time (Figure 26b). Evaluation of vitreous vascular count at P15 indicated that they had regressed by this stage, suggesting that dark rearing resulted in delayed regression. Quantification of apoptosis at P5 showed a quantitatively similar decrease (Figure 26c) to previously characterized persistent hyaloid mutants, regardless of whether we quantified isolated events that are initially dominant in hyaloid regression or the subsequent segmented pattern of apoptosis. These data suggest that photoresponsive pathways promote vitreous regression.

[0278] Vitreous vascular regression and superficial retinal neovascularization occurred simultaneously in mice, indicating that dark rearing can affect both processes. Retinal neovascularization in mice begins on birth day with the extension of vascular precursors from the head of the optic nerve. The superficial vascular structure within the retinal ganglion cell (RGC) layer extends to the retinal periphery by P7. Starting around P8, neovascular buds extend vertically downward into deeper layers of the retina, eventually forming the deep vascular system in the intermediate plexus at the outer edge of the inner granular layer and within the inner plexus 2. In mice reared in the dark until E16–E17, increased density of superficial vascular plexuses was observed, regardless of whether the region was a simple plexus or a vein. Depth-encoded P8 image stacks showed the presence of more descending vessels than in wild-type mice, many of which were abnormally located. These changes were confirmed by quantification. Thus, the retinal vascular system is the second vascular structure in the eye whose normal development is disrupted by the absence of light.

[0279] Figure 26 shows, for example, that hyaloid regression is regulated by light. a: Vitreous vascular specimens at indicated postnatal (P) days from pups reared under normal light conditions (LD) or constant darkness (DD) from E16-17. Original magnification, 350. b: Similar to a, but with quantification of the number of vessels from P1 to P8. P-values ​​obtained by analysis of variance (ANOVA). c: P5 apoptosis index in vessels used for vitreous vascular cells (isolated apoptotic) or apoptotic segment patterns. P-values ​​obtained by Student's t-test. Labeled sample size (n). NS (not significant). Error bars are standard errors.

[0280] Melanopsin is expressed from the early stages of pregnancy in both mice and humans and, unlike photoreceptor opsins, is known to function in the mouse eye prior to P10. Endogenous photosensitive retinal ganglion cells (ipRGCs) that express melanopsin are a subset of RGCs that function in circadian synchronization and pupillary reflex. ipRGCs are located in the superficial layer of the retina, adjacent to both the retinal and vitreous vascular systems. This location, melanopsin's prephotoreceptor function, and the vascular abnormalities present in mice lacking RGCs suggest, according to some embodiments, that it is a good candidate for mediating light-dependent vascular development in the eye. To test this possibility, vitreous vascular regression and retinal angiogenesis were evaluated in mice with mutations in Opn4, the gene encoding melanopsin. - / - The mice showed a normal number of vitreous vessels in P1, but this persisted in P8 (Figure 27a). Examination of the eye in P15 showed vitreous regression in Opn4. - / - In mice, completeness was demonstrated, and vitreous humor persistence was not prolonged, similar to mice raised in the dark. Opn4 - / - The mice also exhibited a retinal hypervascular proliferation phenotype that qualitatively and quantitatively mimicked changes resulting from dark-condition rearing (Figures 27b-k). Quantitative evaluations at P15, P25, and P180 were performed to determine whether the changes in retinal vascular density persisted. These evaluations showed that the elevated vascular density persisted locally at least up to P180. More generally, Opn4- / - Mouse vascular representation The pattern is a phenocopy observed in mice housed in darkness. This provides an independent means of relating the photoresponse pathway in ocular vascular development and identifies melanopsin as the required opsin.

[0281] VEGFA is a potent signal for vascular endothelial cell survival necessary for retinal angiogenesis and is also present in the vitreous humor of rodents and human eyes where vitreous blood vessels are present. According to some embodiments, light-dependent vascular development can be explained by the regulation of VEGFA. Consistent with this, homozygous and heterozygous deletions of Vegfafl with Chx10-cre retinal driver 18 resulted in either vitreous hypoplasia or reduced vitreous regression, respectively (Figure 28a). Immunoblotting of vitreous VEGFA over time courses P1–P8 revealed that in control mice, VEGFA164 levels decreased at P5 but increased again by P8 (Figure 3b). When VEGFA immunoblotting was quantified at three different time courses, P5 VEGFA signaling was approximately 5-fold decreased compared to P1 (Figure 28b). Low levels of VEGFA at P5 are consistent with the idea that it is a key regulator of vitreous regression, as P5 is the time when peak levels of vascular endothelial cell apoptosis exist.

[0282] Dark-room rearing and Opn4 - / - Using mice, we determined whether actual or functional darkness leads to regulation of vitreous VEGFA. In four independent experiments, an increase in vitreous VEGFA levels was consistently observed regardless of how photoresponsiveness was impaired (Figure 28c). Furthermore, enzyme-linked immunosorbent assay (ELISA)-based evaluation of VEGFA in the P5 vitreous humor showed that VEGFA levels were approximately 7 times higher than controls, regardless of whether the offspring were reared in the dark or had mutations in Opn4 (Figure 28d). Dark rearing and Opn4 - / -A sevenfold increase in VEGFA in the mouse vitreous humor was reflected in a similar twofold increase in retinal Vegfa messenger RNA levels, as indicated by quantitative polymerase chain reaction (qPCR) (Figure 28e). Flow sorting / qPCR further showed that Thy1.11+ RGC and Thy1.1-Vc1.11+ amacrine / horizontal cells showed increased Vegfa mRNA, while Thy1.1-Vc1.1-PDGFR+ astrocytes did not. Considering the VEGFA dependence of vitreous and retinal neovascularization, the increase in retinal VEGFA expression is linked to dark rearing and OPN4 - / - This explains the vascular abnormalities observed in mice.

[0283] Figure 27 shows, for example, that hyaloid regression and retinal neovascularization are regulated by melanopsin. a: Opn4+ / + and Opn4 over P1-P8 time courses - / - Quantification of vitreous blood vessels in mice. P-values ​​were obtained by ANOVA. b-i: wild-type mice (b-e) and Opn4 mice reared under normal lighting. - / - (f~i) Low magnification (×100; b, f) and high magnification (×200; c~e, g~i) images of isolectin-labeled P8 retina from offspring. e, i: wild type (e) and Opn4 - / - (i) Depth-coded z-stack image shows the appearance of vertical angiocytes. j, k: Graphs show the quantification of branching point (j) and vertical buds (k) in animals of the indicated genotype. WT, wild type. P-value obtained by Student's t-test. Error bars are standard errors. Labeled sample size (n).

[0284] Figure 28 shows, for example, the photo- and melanopsin-dependent regulation of VEGFA expression and hypoxia in the retina. a: Vitreous vessel counts P1-P8 in labeled genotype mice. P values ​​were obtained by ANOVA. b: Vitreous VEGFA immunoblot (IB) of wild-type mice in P1, P5, and P8 using quantified histograms. c: Wild-type and OPN4 - / -Immunoblotting of P1 or P5 vitreous VEGFA in mice, or in mice reared under labeled LD or DD light conditions. d:OPN4 - / - Control from mice (light blue bar) / LD mouse pups (gray bar) or from E16-17 to a certain dark ELISA quantification of VEGFA levels in the P5 vitreous humor of animals reared at 1°C (DD, blue bar). e: control / LD (gray bar), OPN4 - / - qPCR detection of Vegfa mRNA in the P5 retina of mice (light blue bars) and mice housed in the dark (DD, dark blue bars). P values ​​in b, d, and e were obtained by Student's t-test. Labeled sample size (n). Error bars are standard error. f, g: Wild-type (f) and OPN4 for blood vessels (isolectin, green) and hypoxia (red). - / - (g) Labeling of flat-mount P5 retina derived from mice. Retinal myeloid cells are slightly labeled with isolectin. Original magnification, 3100. h, i: LD and DD mice (c) and wild type vs. OPN4 - / - (d) Quantification of the relative levels of hypoxyprobe labeling in the retina.

[0285] P5 OPN4 - / - Quantification of BRN3B+RGC and calretinin+amacrine in mice revealed a slight increase in the number of both cell types. Retinal angiogenesis in mice has been shown to be driven by a hypoxic response pathway that upregulates VEGFA expression. Since an increase in cell number can increase oxygen demand, we tested whether OPN4 mutation and dark rearing result in retinal hypoxia (Figure 28f, g). Quantification of hypoxicprobe labeling at P5 (Figure 28h, i) revealed that the increased signal was a result of both OPN4 mutation and dark rearing. This is consistent with the idea that, according to some embodiments, increased VEGFA expression in the retina is a result of increased oxygen demand due to an increase in the number of retinal neurons.

[0286] Figure 29 shows, for example, that pregnancy light controls vascular development in the eye. a: Quantification of vitreous blood vessels in mice housed under normal lighting (LD, gray bars) and mice housed in darkness after E16=17 (dark blue bars), E17~18 (medium blue bars), or E18 (light blue bars). b, c: Wild-type embryos and wild-type pseudopregnant females (OPN4) transferred into wild-type pseudopregnant females (WT>WT). - / - OPN4 imported into >WT) - / - P8 vitreous vascular preparations from embryos. Original magnification, 350. d: Left panel: P8 WT>WT (n=5) and OPN4 - / - >Quantification of vitreous vessels in WT (n=6) offspring. Right panel: Quantification of vitreous vessels in normal control offspring (C; n=8) and P8 offspring (n=8) born from enucleated females (EN) of P8. Labeled sample size (n). P-value (a) was obtained by ANOVA, and P-value (d) was obtained by Student's t-test. Error bars are standard errors.

[0287] In evaluating the role of light response in ocular vascular development, some embodiments hypothesized that birth was likely the trigger event, as vascular pattern formation events occur postnatally and light levels to the neonatal eye increase. To test this, offspring were reared in the dark from different points in late pregnancy (E16-17, E17-E18, or after E18) and vitreous persistence was evaluated. A dose-response was observed, with vitreous vasculature becoming progressively more persistent with earlier initiation of dark rearing (Figure 29a). In particular, starting dark rearing after E18 (birth day is usually E19) had little effect (Figure 29a, light blue bars). These data present the surprising result that, according to some embodiments, the critical light response period stimulating vitreous regression is E16-17 or earlier in pregnancy. This further increases the possibility that, according to some embodiments, this developmental pathway required a direct fetal light response. To directly test this claim, embryos were raised in OPN4 + / - ×OPN4 + / -Pseudopregnant wild-type females were transferred from mating, and vitreous regression was evaluated. While control wild-type offspring mice in the transplanted litter showed normal vitreous regression (Figure 29d, b, gray bars), OPN4- / - mice showed persistence at P8 (Figure 29d, c, blue bars). Furthermore, to test the reciprocal possibility that maternal photoresponse may influence fetal eye vascular development, female mice were enucleated, pregnant under normal lighting conditions, and littermates were raised. This did not result in vitreous persistence (Figure 29d). Together, these experiments suggest that, according to some embodiments, melanopsin in the fetus, rather than the mother, is important in regulating ocular vascular development.

[0288] The light level inside the visceral cavity of adult mice living under indoor fluorescent lighting was measured at 1.4 × 10⁻⁶. 13 (Regarding BALB / c) and 1.1 × 10 12 (Regarding C57BL / 6) Photon cm -2 s -1 The bundle density was shown. The published response threshold for rodent ipRGC is approximately 1.2 × 10⁻⁶. 10 photon cm -2 s -1 This range is (References 21-23). ​​Furthermore, according to some embodiments, ipRGCs have the ability to respond continuously to light stimulation via melanopsin for up to 10 hours. According to some embodiments, ipRGCs in neonatal mice are suggested to be less sensitive than in adults, but the decrease in sensitivity is about 1.5 log quantum, and therefore 1.1 × 10⁻¹⁰. 12 photon cm -2 s -1 Visceral light levels in pigmented animals may still exceed the threshold. These data are consistent with the hypothesis that, according to some embodiments, mouse fetuses can respond directly to light via melanopsin.

[0289] These experimental studies, according to some embodiments, identify light as a trigger for the suppression of vitreous vascular regression and indiscriminate neovascularization in the retina. The observation that dark rearing from late pregnancy or OPN4 mutations produce essentially identical perturbations to angiogenesis provides supporting evidence for the involvement of a melanopsin-dependent photoresponse pathway. Furthermore, the data also show, according to some embodiments, that the origin of persistent vitreous and disregulated retinal neovascularization is an increase in VEGFA levels derived from retinal neurons. These findings are surprising, as it had not been previously shown that light could induce changes in developmental programs, apart from neuronal connectivity. The data show, according to some embodiments, that the primary light-dependent change is an increase in the number of retinal neurons, and that the vascular changes occur in response to increased oxygen demand considerably later in developmental time. This pathway is an interesting example of a pathway in which events unfold slowly over approximately two weeks. According to some embodiments, it is interesting to determine whether this pathway influences susceptibility to retinal vascular disorders in premature infants, where promiscuous neovascularization can lead to blindness.

[0290] (Overview of the method) VEGFA was detected in the vitreous humor of OPN4 mutant and dark-housed mice using standard immunoblotting and ELISA (R&D) techniques. Retinal neurons were identified and counted using standard immunofluorescence labeling techniques. The level of retinal hypoxia in OPN4 mutant and dark-housed mice was assessed using detection of injected pimonidazole hydrochloride (Hypoxyprobe). All animal experiments were conducted in accordance with IACUC-approved guidelines and regulations.

[0291] (method) Mouse. Vegfafl (Reference 26), Chx10-cre (Reference 18), OPN4cre (Reference 27), Ai4 (Reference 28), and OPN4 - / -Genotyping was performed as described. All animal experiments were conducted using protocols approved by the Animal Experimentation Committees of Cincinnati Children's Hospital Medical Center and the University of California, San Francisco.

[0292] Labeling and quantification of the vitreous humor and retina. Vitreous vessels were harvested, stained with Hoechst, and stained for TdT-mediated dUTP nick-end labeling (TUNEL) as described. Retinal flat mounts were prepared and labeled with isolecto or melanopsin. Vitreous vessel quantification was previously described¹. Retinal vascular density was quantified by counting vascular junctions using ImageJ for many X200 microscope fields. Depth-coded three-dimensional image reconstructions were generated using a Zeiss Apotome equipped microscope with Axiovision software. Antibodies for labeling retinal flat mounts included anti-Brn3b (Abcam), anti-calretinin (Millipore), and anti-melanopsin (ATS).

[0293] Evaluation of hypoxia. P5 mouse pups were injected with 60 mg / kg-1 (approximately 180 μg per pup) of pimonidazole hydrochloride (Hypoxyprobe), sacrificed 45 minutes later, and the retinas were collected. A rabbit primary antibody against pimonidazole hydrochloride was then used in conjunction with an anti-rabbit Alexa594 secondary antibody to label the retinal tissue. The inventors quantified the labeling by generating intensity values ​​along line spacings extending from the center to the periphery of the retina. Pixel intensity values ​​were averaged across 20-25 line spacings per retina and 5-6 retinas per genotype. Significance was calculated using the MatLab ANOVA test.

[0294] Isolation and analysis of the vitreous humor. The vitreous humor was collected from offspring reared in the dark indoors using red light. Eyes from P1 and P5 offspring were washed twice in sterile ice-cold PBS. Excess PBS was aspirated using Kimwipes, a small slit was made through the retina, and the vitreous humor was collected. ELISA was performed on the vitreous humor using the Vegfa Quantikine Kit (R&D) containing recombinant protein standards. Immunoblots were probed with a unique carboxy-terminal antibody against VEGFA from Santa Cruz. Quantification was performed using ImageJ.

[0295] Cell sorting. The retina was dissociated as described, except that 16 mg ml-1 of liberase CI (Roche) and 20 μg ml-1 of DNase I (Sigma) were used for flow sorting using markers for retinal neurons.25 The cells were then labeled with goat PDGFR-α on ice for 30 minutes, washed with PBS, and labeled with PerCP-conjugated anti-CD90 (clone OX-7), FITC-conjugated anti-CD57 (clone VC1.1), Alexa fluor350, and 7-AAD. Cells were sorted using FACSAria II running DiVa software.

[0296] RNA isolation and qPCR. qPCR was performed using QuantiTect SYBR green (Qiagen) with actin amplification for normalization. In the analysis of qPCR data, the P-value refers to the comparison of △△CT values. The primers used were: Vegfa 5'-GACAGAACAAAGCCAGA-3' (SEQ ID NO: 50), 5'-CACCGCCTTGGCTTGTCAC-3' (SEQ ID NO: 51).

[0297] Light Measurement. To estimate the radiant flux density incident on mice housed in cages at the UCSF animal facility, the inventors determined the spectral distribution S(λrelative) and absolute power (watts cm⁻²s⁻¹) of fluorescent lamps illuminating the room. Both measurements were performed at floor level. S(λrelative) was measured as light reflected from the S(λrelative) surface (Spectralon Target, Labsphere) (Photo Research, PR670 spectraradiometer). Radiant intensity was measured using a calibrated radiometric detector (UDT Instruments; Model S471). S(λrelative) was measured by scaling the area under S(λrelative) to match the radiant intensity, and then these values ​​were measured in photons cm⁻¹ for each wavelength. -2 s -1 By converting to S(λabsolute), the melanopsin spectral absorbance curve was converted to S(λabsolute). The melanopsin spectral absorbance curve was then convolved with S(λabsolute). The area under this curve was used as a measure of the radiant flux density that can stimulate the melanopsin pigment (λmax 5479 nm). It was calculated that at least 5 × 10¹³ photons cm⁻²s⁻¹ equivalent is available to stimulate melanopsin. Similar measurements and calculations for sunlight (December 20, 2011, 12:00) revealed a radiant flux density of 2.6 × 10¹⁶ photons cm⁻²s⁻¹.

[0298] To estimate the attenuation of light that can stimulate melanopsin in mouse fetuses in the uterus, the inventors used a blue LED (Philips Lumile) placed 1 inch from the skin. A ds Lighting Company (model: Luxeon III star, LXHL-LB3C, peak wavelength 5470 nm) was directed at a small silicon photodiode photodetector placed in the peritoneal cavity. The light penetrated both the skin and the subcutaneous muscle layer. Measurements were performed on live, anesthetized adult mice (intramuscular (IM) injection of ketamine / xylazine).

[0299] Figure 30 shows, in particular, an exemplary system architecture 100 that uses artificial lighting to promote the circadian health of a patient. The system architecture 100 may include a computer 110, a network 112, lighting devices 120 (e.g., including one or more LEDs 122), and a patient 130.

[0300] In one embodiment, the lighting device 120 may provide indoor lighting (for example, in a commercial medical facility). Furthermore, the lighting device 120 or the computer 110 may include a controller for controlling one or more LEDs 122. For example, the controller may control the rhythmic intensity or spectral modulation of the lighting device 122 or the LEDs 122. Furthermore, the emission wavelength of the LEDs 122 may target a specific human opsin absorption spectrum. Specific emission wavelengths of the LEDs 122 may include 380 nm, 430 nm, 480 nm, 530 nm, 580 nm, and 630 nm.

[0301] In some embodiments, the lighting device can regulate the patient's circadian clock by stimulating opsins (e.g., opsins 3, 4, and 5) in the patient 130. For example, an emission wavelength of 480 nm may stimulate opsin 4 in the patient 130, or an emission wavelength of 380 nm may stimulate opsin 5 in the patient 130.

[0302] Furthermore, in some embodiments, the lighting device 120 can simulate normal sunlight by reproducing the transitions between dawn and dusk, such as intensity and spectrum. In some embodiments, the LEDs 122 may be distributed around the inner perimeter of the room to further simulate the direction of normal sunlight (e.g., the rising sun in the east or the setting of the sun in the west).

[0303] Furthermore, the lighting device 120 can reproduce spectral composition changes that occur in different seasons. For example, the lighting device 120 may provide a specific spectrum associated with a given season (e.g., winter, spring, summer, or autumn) or a specific day or time in a calendar year (e.g., including a transition spectrum). As another example, the duration of illumination may vary within a given season based on the length of daylight associated with the season (e.g., the duration of illumination may be shorter in winter than in summer).

[0304] Therefore, the lighting device 120 can promote the health and well-being of patient 130 by adjusting the patient's circadian rhythm.

[0305] Figure 31, in particular, illustrates an exemplary method 200 for using artificial lighting to promote a patient's circadian health. In some examples, method 200 is performed by a device or machine (e.g., computer 110). Furthermore, method 200 may be performed in a network device, desktop, laptop, mobile device, server device, or by multiple devices communicating with each other. In some examples, method 200 is performed by processing logic including hardware, firmware, software, or a combination thereof. In some examples, method 200 is performed by a processor that executes code stored in a computer-readable medium (e.g., memory).

[0306] In block 210, method 200 provides indoor lighting by a lighting device, lighting The device includes one or more LEDs. For example, the LEDs in the lighting device may be arranged around a patient room, in one or more overhead lights, or as part of a floor lamp or desk lamp.

[0307] In block 220, method 200 controls each of the LEDs. For example, method 200 may control the intensity of one or more LEDs to control rhythm intensity, spectral modulation, spectral composition, etc.

[0308] In block 230, method 200 stimulates one or more opsins in the patient. For example, an LED may target one or more human opsin absorption spectra by emitting specific wavelengths (e.g., 380 nm, 430 nm, 480 nm, 530 nm, 580 nm, or 630 nm).

[0309] In block 240, method 200 adjusts the patient's circadian clock based on opsin stimulation. For example, method 200 may simulate normal sunlight by reproducing the transition between dawn and dusk. In some embodiments, method 200 can reproduce color separations typical of dawn and dusk, including, for example, specific color orientations based on time of day. Furthermore, method 200 can reproduce spectral composition changes that occur in different seasons (e.g., spring, summer, autumn, and winter).

[0310] Examples of the methods disclosed herein may be implemented in the operation of such computing devices. The order of the blocks presented in the examples herein can be changed. For example, blocks may be rearranged, combined, or divided into subblocks. Certain blocks or processes may be executed in parallel.

[0311] Figure 32 is a block diagram of a network device 400 that may be connected to or include components of network 112. The network device 400 may include hardware or a combination of hardware and software. Functions that facilitate communication over the communication network may be present in one of the network devices 400 or in a combination thereof. The network device 400 shown in Figure 32 may represent or perform the functions of an appropriate network device 400 or combination of network devices 400, such as components or various components of a cellular broadcast system wireless network, a processor, a server, a gateway, an LTE or 5G anchor node or eNB, a mobile switching center (MSC), a short message service center (SMSC), an automatic location function server (ALFS), a gateway mobile location center (GMLC), a serving gateway (S-GW) 430, a packet data network (PDN) gateway, a RAN, a serving mobile location center (SMLC), or any appropriate combination thereof. It is emphasized that the block diagram shown in Figure 32 is illustrative and is not intended to imply limitation to any particular example or configuration. Therefore, the network device 400 can be implemented in a single device or multiple devices (e.g., a single server or multiple servers, a single gateway or multiple gateways, a single controller or multiple controllers). Multiple network entities may be distributed or centrally located. Multiple network entities may communicate wirelessly, via hardwires, or in any suitable combination thereof.

[0312] The network device 400 may include a processor 402 and a memory 404 coupled to the processor 402. The memory 404 may contain executable instructions, when executed by the processor 402, that cause the processor 402 to perform actions related to the use of artificial lighting to promote the patient's circadian health. As is evident from the description herein, The twerk device 400 should not be interpreted as software in itself.

[0313] In addition to the processor 402 and memory 404, the network device 400 may include an input / output system 406. The processor 402, memory 404, and input / output system 406 may be coupled to each other to enable communication between them (the coupling is not shown in Figure 32). Each part of the network device 400 may include circuitry for performing the function associated with each respective part. Thus, each part may include hardware, or a combination of hardware and software. Therefore, each part of the network device 400 should not be interpreted as software in itself. The input / output system 406 may be capable of receiving information from or providing information to communication devices or other network entities configured for telecommunications. For example, the input / output system 406 may include a wireless communication (e.g., 3G / 4G / 5G / GPS) card. The input / output system 406 may be capable of receiving or transmitting video information, audio information, control information, image information, data, or any combination thereof. The input / output system 406 may be capable of transferring information in the network device 400. In various configurations, the input / output system 406 may receive or provide information via any suitable means, such as optical means (e.g., infrared), electromagnetic means (e.g., RF, Wi-Fi, Bluetooth®, ZigBee®), acoustic means (e.g., speakers, microphones, ultrasonic receivers, ultrasonic transmitters), or combinations thereof. In an exemplary configuration, the input / output system 406 may include a Wi-Fi finder, a two-way GPS chipset or equivalent, or a combination thereof.

[0314] The input / output system 406 of the network device 400 may also include a communication connection 408 that enables the network device 400 to communicate with other devices, network entities, etc. The communication connection 408 may include a communication medium. The communication medium typically includes any information distribution medium that embodies computer-readable instructions, data structures, program modules, or other data in modulated data signals such as carrier waves or other transport mechanisms. By example, but not limited to, the communication medium may include wired media such as wired networks or direct wired connections, or wireless media such as acoustic, RF, infrared, or other wireless media. As used herein, the term computer-readable medium includes both storage media and communication media. The input / output system 406 may also include an input device 410 such as a keyboard, mouse, pen, voice input device, or touch input device. The input / output system 406 may also include an output device 412 such as a display, speaker, or printer.

[0315] The processor 402 may be capable of performing functions related to the use of artificial lighting to promote the patient's circadian health, as described herein. For example, the processor 402, in conjunction with any other part of the network device 400, may be capable of determining the type of patient or target opsin and controlling the lighting device accordingly.

[0316] The memory 404 of the network device 400 may include a storage medium having a concrete, tangible physical structure. As is known, signals do not have a concrete, tangible physical structure. Memory 404, and any computer-readable storage medium described herein, should not be interpreted as signals. Memory 404, and any computer-readable storage medium described herein, should not be interpreted as transient signals. Memory 404, and any computer-readable storage medium described herein, should not be interpreted as propagating signals. Memory 404, and any computer-readable storage medium described herein, should be interpreted as a product.

[0317] Memory 404 can store any information used in connection with communication. Depending on the exact configuration or type of the processor, memory 404 may include volatile storage 414 (such as certain types of RAM), non-volatile storage 416 (such as ROM, flash memory), or a combination thereof. Memory 404 may also include additional storage (e.g., removable storage 418 or non-removable storage 420), including, for example, tape, flash memory, smart cards, CD-ROM, DVD, or other optical storage, magnetic cassette, magnetic tape, magnetic disk storage, or other magnetic storage devices, USB-compatible memory, or any other media that can be used to store information and can be accessed by the network device 400. When executed by processor 402, memory 404 may include executable instructions that cause processor 402 to perform actions using artificial lighting to promote the patient's circadian health.

[0318] Figure 33 shows an exemplary schematic diagram of a machine in the form of computer system 500, within which a set of instructions, when executed, can cause the machine to perform any one or more of the methods described above. One or more instances of the machine can operate, for example, as a processor 402, a computer 110, and other devices in Figures 1-32. In some examples, the machine can be connected to other machines (for example, using network 112). In a networked configuration, the machine can operate as a server or client user machine in a server-client user network environment, or as a peer machine in a peer-to-peer (or distributed) network environment.

[0319] A machine may include a server computer, a client user computer, a personal computer (PC), a tablet, a smartphone, a laptop computer, a desktop computer, a control system, a network router, a switch or bridge, or any machine capable of executing a set of instructions (sequentially or otherwise) specifying actions to be performed by that machine. A communication device in this disclosure will be understood to broadly include any electronic device that provides voice, video, or data communication. Furthermore, although a single machine is shown, the term “machine” shall also be interpreted to include any set of machines individually or collectively executing a set of instructions (or sets of instructions) to perform any one or more of the methods considered herein.

[0320] The computer system 500 may include a processor (or controller) 504 (e.g., a central processing unit (CPU)), a graphics processing unit (GPU, or both), main memory 506, and static memory 508, which communicate with each other via a bus 510. The computer system 500 may further include a display unit 512 (e.g., a liquid crystal display (LCD), a flat panel, or a solid-state display). The computer system 500 may also include an input device 514 (e.g., a keyboard), a cursor control device 516 (e.g., a mouse), a machine-readable medium 518, a signal generating device 520 (e.g., a speaker or remote control), and a network interface device 522. In a distributed environment, the examples described herein may be adapted to utilize multiple display units 512 controlled by two or more computer systems 500. In this configuration, the presentations described herein may be partially shown on a first of the display units 512, and the remainder on a second of the display units 512.

[0321] The disk drive unit 518 may include a tangible computer-readable storage medium that stores one or more instruction sets (e.g., instruction 526) that embody any one or more of the methods or functions described herein, including the method described above. Instruction 526 also includes a computer During its execution by the computer system 500, it may reside entirely or at least partially in the main memory 506, static memory 508, or processor 504. The main memory 506 and processor 504 may also constitute tangible computer-readable storage media.

[0322] Figure 34 shows a graph of the spectral power distribution (SPD(λ)) of standard LED light compared to melanopsin (OPN4(λ)) and neuropsin (OPN5(λ)) in some embodiments. LED lighting is gaining increasing adoption due to its inherent advantages, including long lifespan, scalable size, and very high energy efficiency. For example, LEDs can generate light of very specific wavelengths very efficiently. A standard LED partially transmits through a phosphor amalgam, generating a narrow blue peak around 450 nm to excite and produce the desired spectrum. An example of this method is shown in Figure 34, which shows that the strategy remains the same regardless of the resulting color of the light source. Furthermore, energy efficiency is designed toward visual efficiency. However, each of these LED spectra lacks the OPN4 stimulating energy (e.g., blue light in the range of 400-525 nm). In addition, each of these spectra from Figure 34 lacks any type of energy (e.g., violet light in the range of 360–420 nm) necessary to stimulate OPN5.

[0323] In some embodiments, OPN5 activation and OPN4 activation are relative numbers calculated for comparative purposes, for example, to compare the activation capabilities of different spectral power distributions, and to create a unitless OPN5 / OPN4 ratio. Each of these activations is calculated by taking the dot product of the normalized sensitivity functions of each opsin type with respect to candidate spectral power distributions over the wavelength range of 360 nm to 780 nm. The formula is as follows:

number

number

[0324] Figure 35 shows graphs of the spectral power distribution (SPD(λ)) of daylight during the day, compared to melanopsin (OPN4(λ)) and neuropsin (OPN5(λ)), according to some embodiments. Looking at the daylight spectrum in Figure 35, we can see that OPN4 (melanopsin) and A broad spectral power distribution exists that includes sufficient excitation of both OPN5 (neuropsin) molecules.

[0325] Figure 36 shows graphs of the spectral power distribution (SPD(λ)) of daylight during twilight compared to melanopsin (OPN4(λ)) and neuropsin (OPN5(λ)) in some embodiments. As the sun sets and the remaining skyglow of twilight persists, the spectral power distribution also changes (for example, Figure 36), leaving a greater amount of OPN5 stimulation compared to OPN4 stimulation.

[0326] The OPN5 / OPN4 ratio is shown in Figures 37, 38, and 39. Figure 37 shows a graph of the OPN5 / OPN4 ratio for sunset versus solar altitude in some embodiments, where 0 degrees represents actual sunset. Figure 38 shows a graph of the OPN5 / OPN4 ratio for sunrise versus solar altitude in some embodiments, where 0 degrees represents actual sunrise. Figure 39 shows a graph of the OPN5 / OPN4 ratio for a second sunset versus solar altitude in some embodiments, where 0 degrees represents actual sunset. When the sun is above the horizon, the OPN5 / OPN4 ratio is less than 0.4. However, when the sun sets below the horizon, the OPN5 / OPN4 ratio is greater than 0.4. Evolutionarily speaking, this ratio is considered particularly important because the ratio of light is consistent across various habitats. A similar approach has been demonstrated to be important in phytochromes, and therefore, the plant's photosteady state, i.e., the ratio of far-red light to red light, is important for indicating the beginning and end of the plant's day.

[0327] Figure 40 shows a graph of the spectral power distribution in which the OPN5 / OPN4 ratio transitions, similar to sunrise or sunset, in some embodiments. Figure 40 also shows one embodiment of the spectrum representing a twilight transition, which also includes a transition from a day with an OPN5 / OPN4 ratio of less than 0.4 to twilight with an OPN5 / OPN4 ratio greater than 0.4. This OPN5 / OPN4 transition is shown in Figure 41. In this embodiment shown in Figure 40, the "SPD" line is an illumination source that transmits light in the wavelength and intensity range shown in the graph. In this particular embodiment, as the OPN5 / OPN4 stimulus increases, the resulting color becomes more purple, similar to how the sky turns purple as the sun sets. Figure 42 shows a graph of the OPN5 / OPN4 ratio and lumens for the spectral transition shown in Figure 40, in some embodiments, where, for example, the OPN5 / OPN4 ratio is inversely proportional to the lumens.

[0328] Figure 43 shows a different type of spectral transition that also generates transitions in OPN5 / OPN4 stimulation, such as when the OPN5 / OPN4 stimulation is less than 0.4 during the day and greater than 0.4 at night. However, this spectral embodiment differs in that its color becomes more yellow as OPN5 / OPN4 increases. This embodiment is analogous to how sunlight becomes more yellow as the sun sets. Again, in this embodiment shown in Figure 43, the "SPD" line is an illumination source that transmits light in the wavelength and intensity range shown in the graph. This OPN5 / OPN4 transition is shown in Figure 44. Figure 45 shows graphs of the OPN5 / OPN4 ratio and lumens of the spectral transition shown in Figure 43 in some embodiments, for example, where the OPN5 / OPN4 ratio is modulated, but the intensity is only slightly modulated.

[0329] Material selection is particularly important when considering these types of novel spectra. Most optical materials, such as polycarbonate and acrylic (PMMA), are spectrally characterized with a sharp cutoff around 400 nm, and do not allow any wavelengths below 400 nm to pass through. In addition, surface pigments may not reflect the same violet wavelengths as longer wavelengths. Titanium dioxide (TiO2) is a common pigment for producing white. Therefore, The spectral reflectance serves as a baseline for white paint or surface coatings. Considering the combination of UV plastic and TiO2-based surfaces, the spectrum required to produce the highest biological stimulation of OPN5 shifts from its peak sensitivity at 380 nm to a longer wavelength of 388 nm. Furthermore, when using standard plastics, this combination shifts much further to 405 nm, accompanied by a significant decrease in overall biological potency at 405 nm. These interactions are shown in Figures 46 and 47. For example, Figure 46 shows a graph of the obtained system spectral potency of a device considering the spectral sensitivity of OPN5, the spectral transmittance of the UV polycarbonate optics material, the spectral reflectance of titanium dioxide (TiO2), and light traveling through the polycarbonate optics device, taking into account a single bounce from the TiO2-based paint. Figure 47 shows a graph of the obtained system spectral efficacy of the device, taking into account the spectral sensitivity of OPN5, the spectral transmittance of a standard polycarbonate optical material, the spectral reflectance of titanium dioxide (TiO2), and the light traveling through the polycarbonate optical device, as well as a single bounce from a TiO2-based coating.

[0330] Figure 48 shows a block diagram of system 4800 according to some embodiments. System 4800 includes cloud-based computing and data storage 4810 and device 4820. Device 4820 includes a user interface 4830, a controller 4840, a power supply 4850, and multiple light-emitting diode types (e.g., LED board 4860 including LED 4862). For example, user interface 4830 can select the timing and duration of twilight based on multiple variables such as latitude, longitude, atmospheric conditions, weather conditions, genetic factors, age, and health status. Furthermore, perinatal lighting schemes may be designed to provide lighting thumbprints specific to the child's genetic structure, place of conception, place of birth, time of birth, gestational age, and sex.

[0331] The controller 4840 may be located on a control panel and may include a radio 4844, one or more microcontrollers 4842, and one or more LED drivers 4846. The user interface 4830 may interact with...

Claims

1. A lighting device, A first illumination source that emits light with the maximum wavelength of 380 nm, A second illumination source that emits light with the maximum wavelength of 430 nm, A third illumination source that emits light with the maximum wavelength of 480 nm, A fourth illumination source that emits light with the maximum wavelength of 530 nm, A fifth illuminator that emits light with the maximum wavelength of 580 nm, A lighting device comprising a sixth light source that emits light with a maximum wavelength of 630 nm.

2. A lighting device according to claim 1, Memory that stores computer instructions, The system further comprises one or more processors connected to the memory and configured to execute computer instructions stored in the memory, A lighting device in which the computer instructions include the step of controlling the selective operation of the first, second, third, fourth, fifth, and sixth lighting sources based on the human circadian clock.

3. A lighting device according to claim 2, wherein the computer instructions further control the selective operation of the first, second, third, fourth, fifth, and sixth lighting sources based on one or more spectral composition changes associated with one or more seasons.

4. A lighting device according to claim 2, wherein the computer instructions further control the selective operation of the first, second, third, fourth, fifth, and sixth lighting sources based on transitions related to geographical location.

5. A lighting device according to claim 4, The computer instructions further control the selective operation of the first, second, third, fourth, fifth, and sixth illumination sources based on one or more additional conditions selected from the group consisting of time, atmospheric conditions, and meteorological conditions. A lighting device in which the computer instructions further control the selective operation of the first, second, third, fourth, fifth, and sixth lighting sources based on one or more additional conditions selected from a group consisting of human genetic factors, age, and health status.

6. A lighting device according to claim 2, wherein the computer instructions control the selective operation of the first, second, third, fourth, fifth, and sixth lighting sources based on two or more conditions: the patient's genetic structure, the patient's place of conception, the patient's place of birth, the patient's time of birth, the patient's age at gestation, and the patient's sex.

7. A lighting device according to claim 1, The memory for storing the aforementioned computer instructions, The system further comprises one or more processors connected to the memory and configured to execute computer instructions stored in the memory, A lighting device, wherein the computer instructions include the step of controlling the selective operation of the first, second, third, fourth, fifth, and sixth lighting sources based on the geographical location of the lighting device, the current season, and the current time of day.

8. A lighting device according to claim 1, wherein one or more of the first, second, third, fourth, fifth, and sixth lighting sources are equipped with LEDs.

9. A lighting device according to claim 1, wherein the first, second, third, fourth, fifth and sixth A lighting device in which one or more of the light sources are equipped with micro-LEDs.

10. A lighting device according to claim 9, wherein the microLED is incorporated into a display.

11. A lighting device according to claim 9, wherein the microLED is a display pixel of a display.

12. It is a display, One or more first micro-LEDs that emit violet light in the range of 360-420 nm, One or more second microLEDs that emit violet light within the range of emitting blue light in the 400-525 nm range, A memory containing computer instructions for controlling the selective activation of one or more first micro-LEDs and one or more second LEDs based on a human circadian rhythm, A display comprising one or more processors connected to the memory and configured to execute computer instructions stored in the memory.

13. A lighting device according to claim 12, wherein the computer instructions further control the selective operation of the one or more first microLEDs and the one or more second microLEDs based on one or more spectral composition changes associated with one or more seasons.

14. A lighting device according to claim 12, wherein the computer instructions further control the selective operation of the one or more first micro-LEDs and the one or more second LEDs based on transitions related to geographic location.

15. A lighting device according to claim 14, The computer instruction further controls the selective operation of one or more first micro-LEDs and one or more second LEDs based on one or more additional conditions selected from the group consisting of time, atmospheric conditions, and weather conditions. The computer instructions further control one or more of the first micro-LEDs and the selective operation of one or more of the first LEDs based on one or more additional conditions selected from a group consisting of human genetic factors, age, and health status, in a lighting device.

16. A lighting device according to claim 12, wherein the computer instruction controls the selective operation of one or more first micro-LEDs and one or more second LEDs based on two or more conditions: the patient's genetic structure, the patient's place of conception, the patient's place of birth, the patient's time of birth, the patient's age at gestation, and the patient's sex.

17. A lighting device according to claim 12, The one or more first microLEDs emit purple light in the range of 400 to 410 nm. The lighting device comprises one or more second microLEDs that emit blue light in the range of 450 to 500 nm.

18. A lighting device, A first illumination source that emits light with the maximum wavelength of 380 nm, A second illumination source that emits light with the maximum wavelength of 430 nm, A third illumination source that emits light with the maximum wavelength of 530 nm, A fourth illumination source that emits light with the maximum wavelength of 580 nm, A lighting device comprising a fifth light source that emits light with a maximum wavelength of 630 nm.

19. A lighting device according to claim 18, Memory that stores computer instructions, The system further comprises one or more processors connected to the memory and configured to execute the computer instructions stored in the memory, A lighting device comprising the steps of controlling the selective operation of the first, second, third, fourth, and fifth lighting sources to simulate a spectrum including the transition between twilight and dawn sunlight.

20. A lighting device according to claim 19, further comprising a sixth illuminator emitting light with a maximum wavelength of 480 nm, wherein the computer instruction includes the step of controlling the selective operation of the first, second, third, fourth, fifth and sixth illuminators to simulate a spectrum including the transition between twilight and dawn.

21. A lighting device, A first illumination source that emits light with the maximum wavelength of 400 nm, A second illumination source that emits light with the maximum wavelength of 480 nm, A third illumination source that emits light with the maximum wavelength of 550 nm, A lighting device comprising a fourth light source that emits light with a maximum wavelength of 630 nm.

22. A lighting device according to claim 21, Memory that stores computer instructions, The system further comprises one or more processors connected to the memory and configured to execute computer instructions stored in the memory, A lighting device in which the computer instructions include the step of controlling the selective operation of the first, second, third, and fourth lighting sources based on a human circadian rhythm.

Images