Therapeutic drugs for treating refractory asthma and therapeutic drugs for treating inflammation caused by IL-33

GSK-3β inhibitors are developed to target and suppress IL-33 expression, addressing the inadequacies of current refractory asthma treatments by reducing IL-33 levels and ILC2 activation, offering a cost-effective solution for refractory asthma and IL-33-induced inflammation.

JP2026095815APending Publication Date: 2026-06-12KEIO UNIV

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
KEIO UNIV
Filing Date
2024-12-02
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Current treatments for refractory asthma, particularly those involving steroid resistance, are inadequate due to insufficient understanding of IL-33 production mechanisms and the lack of effective small molecule compounds to suppress IL-33 expression.

Method used

Development of therapeutic agents containing glycogen synthase kinase type 3 β inhibitors, such as LY2090314, SB216763, CHIR-99021, and others, to target and suppress IL-33 expression, thereby improving refractory asthma and IL-33-induced inflammation.

Benefits of technology

The GSK-3β inhibitors effectively reduce IL-33 expression and suppress ILC2 activation, providing a less expensive and more accessible treatment option for refractory asthma and IL-33-induced inflammation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026095815000001_ABST
    Figure 2026095815000001_ABST
Patent Text Reader

Abstract

To provide therapeutic drugs that can improve refractory asthma. [Solution] A therapeutic agent for treating refractory asthma, comprising a glycogen synthase kinase type 3 β inhibitor.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention relates to therapeutic agents for treating refractory asthma and therapeutic agents for treating inflammation caused by IL-33. [Background technology]

[0002] Bronchial asthma (asthma) is a respiratory disease characterized by cough, wheezing, and difficulty breathing due to chronic inflammation of the airways, and there are approximately 1.2 million patients in Japan. The first-line treatment for asthma is inhaled corticosteroids, but in about 5% to 10% of patients, symptoms cannot be adequately controlled even with multiple treatments including inhaled corticosteroids, and these cases are called refractory asthma (or severe asthma).

[0003] One of the causes of asthma refractory disease is thought to be "steroid resistance," which is a decrease in sensitivity to steroid drugs. In recent years, it has been suggested that IL-33, which is produced and released from airway epithelial cells, is involved in the refractory treatment of asthma. In particular, the present inventors have reported that IL-33 induces steroid resistance in ILC2s and causes refractory treatment of asthma (see, for example, Non-Patent Document 1).

[0004] Therefore, IL-33 has attracted attention as a new therapeutic target for refractory asthma, and clinical trials of biological agents targeting IL-33 and its receptors are underway (see, for example, Non-Patent Documents 2-3). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Kabata H, et al. Nat Commun, 2013 [Non-Patent Document 2] J Allergy Clin Immunol. 2021;148(3):790-798. [Non-Patent Document 3] N Engl J Med . 2021 Oct 28;385(18):1656-1668. [Overview of the Initiative] [Problems that the invention aims to solve]

[0006] However, the mechanisms of IL-33 production in asthma patients and the identification of small molecule compounds that suppress IL-33 expression are still not sufficiently understood.

[0007] The present invention aims to solve the aforementioned conventional problems and achieve the following objectives. Specifically, one embodiment of this disclosure aims to provide a therapeutic agent that can improve refractory asthma. [Means for solving the problem]

[0008] The means to solve the aforementioned problem are as follows: <1> A therapeutic drug for treating refractory asthma, This therapeutic agent is characterized by containing a glycogen synthase kinase type 3 β inhibitor. <2> A therapeutic drug for treating inflammation caused by IL-33, This therapeutic agent is characterized by containing a glycogen synthase kinase type 3 β inhibitor. <3> The glycogen synthase kinase type 3 β inhibitor is selected from the group consisting of LY2090314, SB216763, CHIR-99021, AZD1080, tideglucib, SAR502250, AZD2858, AR-A014418, PF-04802367, pyridinyl isonicotinamide, and thiadiazolidinone-8. <1> or <2> It is a therapeutic drug as described in [reference]. <4> The above is used in combination with asthma medications. <1> or <2> It is a therapeutic drug as described in [reference]. <5> The asthma treatment drug is a steroid. <4> It is a therapeutic drug as described in [reference]. <6> The aforementioned refractory asthma is refractory asthma mediated by IL-33. <1> It is a therapeutic drug as described in [reference]. <7> The therapeutic agent according to <1>, wherein the refractory asthma is steroid-resistant refractory asthma.

Advantages of the Invention

[0009] According to the present invention, it is possible to solve the above-mentioned various problems in the prior art, achieve the above object, and provide a therapeutic agent capable of improving refractory asthma.

Brief Description of the Drawings

[0010] [Figure 1] Figure 1 is a model diagram schematically showing the cellular and molecular mechanism of asthma in the prior art. [Figure 2] Figure 2 is a model diagram schematically showing the function of IL-33 in airway epithelial cells in the prior art. [Figure 3A] Figure 3A is a bright-field image of cystic organoids prepared by long-term organoid culture. [Figure 3B] Figure 3B is an immunostaining image of cystic organoids. [Figure 3C] Figure 3C is flow cytometry using nuclear staining of IL-33 and basal cell markers (ITGA6, NGFR) in cystic organoids. [Figure 3D] Figure 3D is a bright-field image of spherical organoids. [Figure 3E] Figure 3E is flow cytometry using epithelial marker (EpCAM) and basal cell markers (ITGA6, NGFR) in spherical organoids. [Figure 4A] Figure 4A is a diagram showing a comparison of IL-33 mRNA expression by real-time PCR of basal cell organoids from asthma patients and non-asthma volunteers. [Figure 4B] Figure 4B is a diagram showing a comparison of IL-33 mRNA expression by real-time PCR between specimens with high IL-33 mRNA expression and specimens with low IL-33 mRNA expression. [Figure 4C]Figure 4C shows a comparison of IL-33 protein expression corrected by total protein by capillary Western blot analysis between specimens with high IL-33 mRNA expression and specimens with low IL-33 mRNA expression. [Figure 4D] Figure 4D shows the correlation between IL-33 mRNA expression and IL-33 protein expression measured in Figures 4B - C. [Figure 4E] Figure 4E shows a comparison of IL-33 protein in the supernatant by ELISA between specimens with high IL-33 mRNA expression and specimens with low IL-33 mRNA expression. [Figure 5A] Figure 5A shows a comparison by real-time PCR of the difference in IL-33 mRNA expression in basal cell organoids by R-spondin. [Figure 5B] Figure 5B shows a comparison by immunostaining of the difference in IL-33 protein expression in basal cell organoids by R-spondin. [Figure 5C] Figure 5C shows a comparison by real-time PCR of the difference in IL-33 mRNA expression in basal cell organoids using 23 specimens by R-spondin. [Figure 5D] Figure 5D shows a comparison by real-time PCR of the difference in IL-33 mRNA expression in basal cell organoids derived from the lung by R-spondin. [Figure 5E] Figure 5E shows RNA sequence data of 4 non-R-spondin specimens and 4 R-spondin specimens. [Figure 5F] Figure 5F shows a heatmap of genes extracted by the Wnt signaling pathway based on Figure 5E. [Figure 5G] Figure 5G shows the results of comparing the expression of IL-33 mRNA by real-time PCR after adding Wnt3A, R-spondin, and PORCN inhibitor to organoid medium without R-spondin, respectively. [Figure 5H]Figure 5H shows the results of comparing the expression of CTNNB1 and IL-33 mRNA in control sh-RNA-introduced basal cell organoids and basal cell organoids in which CTNNB1 was knocked down by the introduction of sh-CTNNB1, using real-time PCR. [Figure 5I] Figure 5I is a heatmap comparing the expression of gene markers in epithelium and EMT based on TPM data of RNA sequencing in Figure 5E. [Figure 5J] Figure 5J shows the results of flow cytometry analysis of EpCAM (epithelial marker) and NGFR (basal cell marker) expression in basal cells of non-R-spondin and R-spondin. [Figure 6A] Figure 6A shows a comparison of common genes among those highly expressed in IL-33 high and those whose expression is decreased by R-spondin stimulation, based on RNA sequencing of four IL-33 high samples and four IL-33 low samples from Figure 4B. [Figure 6B] Figure 6B shows the correlation between IL-33 mRNA expression and DEPTOR mRNA expression in 23 samples. [Figure 6C] Figure 6C shows a comparison of DEPTOR mRNA and IL-33 mRNA in sh-control and sh-DEPTOR-introduced basal cell organoids using real-time PCR. [Figure 6D] Figure 6D shows a comparison of DEPTOR protein expression and IL-33 protein expression in basal cell organoids introduced with sh-control and sh-DEPTOR, as determined by capillary Western blot analysis. [Figure 6E] Figure 6E shows a comparison of IL-33 mRNA expression using real-time PCR stimulated with DMSO and the mTOR inhibitor (Torin 1 μM). [Figure 6F] Figure 6F shows a comparison of IL-33 mRNA expression using real-time PCR stimulated with DMSO and the ULK inhibitor (MRT68921 1 μM). [Figure 7A] Figure 7A shows a comparison of β-catenin protein expression corrected for total protein by capillary Western blot analysis. [Figure 7B] Figure 7B shows a comparison of AXIN2, LEF1, and TCF7 mRNAs, which are target genes of the Wnt / β-catenin signal, as measured by real-time PCR. [Figure 7C] Figure 7C shows a comparison of DEPTOR mRNA expression using real-time PCR. [Figure 7D] Figure 7D shows a comparison of IL-33 mRNA obtained by real-time PCR and IL-33 protein obtained by capillary Western blot analysis. [Figure 7E] Figure 7E shows immunohistochemical staining images of cystic organoids with and without GSK-3 inhibitor stimulation. [Figure 7F] Figure 7F shows a comparison of IL-33 mRNA expression using real-time PCR. [Figure 7G] Figure 7G shows the results of comparing IL-33 protein levels in the culture medium by ELISA after stimulating planar cultured basal cells with Alternaria extract at 50 μg / mL for 4 hours. [Figure 7H] Figure 7H shows a comparison of IL-13 mRNA and IL-5 mRNA expression in ILC2 co-cultured with basal cells, as measured by real-time PCR. [Figure 7I] Figure 7I shows a comparison of IL-33 mRNA expression in basal cell organoids induced by dexamethasone using real-time PCR. [Figure 7J] Figure 7J shows a comparison of cell counts in BALF (bone marrow lavage fluid) from mice treated with Alternaria nasal injection. [Modes for carrying out the invention]

[0011] (Medications for treating refractory asthma) The therapeutic agent of this embodiment is a therapeutic agent for treating refractory asthma and contains a glycogen synthase kinase type 3 β inhibitor (GSK-3β inhibitor).

[0012] (Medications used to treat inflammation caused by IL-33) Another embodiment of the therapeutic agent is a therapeutic agent for treating inflammation caused by IL-33 and contains a glycogen synthase kinase type 3 β inhibitor (GSK-3β inhibitor).

[0013] (Treatment method) The treatment method of this embodiment is a method for treating refractory asthma, and includes administering the aforementioned therapeutic agent to the target. Furthermore, another embodiment of the treatment method is a method for treating inflammation caused by IL-33, which includes administering the aforementioned therapeutic agent to the target.

[0014] [About asthma] Currently, it is estimated that there are approximately 300 million asthma sufferers worldwide, and about 1.2 million in Japan, making it a very common disease. Asthma is characterized by chronic inflammation of the airways, variable airway narrowing (wheezing and difficulty breathing), and clinical symptoms such as cough, but it is not a disease with a clear definition. Asthma is diagnosed when allergic inflammation occurs mainly in the bronchi, causing bronchial swelling, increased phlegm and poor airway passage, and hypersensitivity of the bronchi leading to coughing.

[0015] The pathogenesis of asthma is highly diverse, and various mechanisms are known. Classically, the mechanism was thought to be "acquired immunity" mediated by an allergic reaction to a specific allergen, as in hay fever. However, in clinical practice, asthma is often exacerbated by nonspecific stimuli such as infections and air pollutants. In recent years, attention has been drawn to the "innate immunity" mechanism in which cytokines released from the airway epithelium in response to nonspecific environmental stimuli activate immune cells such as type 2 innate lymphocytes (ILC2), causing inflammation. This inflammation triggers airway narrowing and hypersensitivity, leading to symptoms such as shortness of breath and cough. Figure 1 shows a schematic model diagram illustrating the cellular and molecular mechanisms of asthma that have been proposed to date.

[0016] The basic treatment for asthma is the administration of inhaled corticosteroids that target immune cells such as lymphocytes and eosinophils. While the advent of inhaled corticosteroids has dramatically improved asthma control, approximately 5% to 10% of patients still exhibit treatment resistance, resulting in refractory or severe cases. In recent years, biological agents such as antibodies against various cytokines have become available for these cases, increasing treatment options. However, these agents are very expensive, making access to treatment difficult.

[0017] [About IL-33] IL-33 is a cytokine primarily expressed in the nucleus of epithelial cells and released extracellularly in response to various stimuli (Reference 1: Liew FY, et al. Nat Rev Immunol, 2016). Multiple genome-wide association studies (GWAS) have reported that SNPs in IL-33 and its receptor are associated with the development of asthma (Reference 2: N Engl J Med, 2010). IL-33 activates various immune cells and induces eosinophilic inflammation, but it is particularly known to strongly activate type 2 innate lymphocytes (ILC2). In previous research by the inventors, they discovered that while inflammation was suppressed by steroids in conventional asthma model mice using ovalbumin (OVA), steroid resistance developed in model mice with IL-33 added to OVA, and the asthma condition became refractory and more severe. They also reported that ILC2 is involved in this condition (see Non-Patent Literature 1). Figure 2 is a schematic model illustrating the function of IL-33 in airway epithelial cells as previously proposed. As shown in Figures 2 and 1, extracellularly released IL-33 is thought to promote the induction of IL-5 and IL-13 in ILC2s and to be involved in eosinophil activation and the induction of mucin production in airway epithelial cells. Therefore, IL-33 and ILC2s are considered targets for the intractability and severity of asthma.

[0018] Furthermore, elevated levels of IL-33 have been observed in the blood and airways of asthma patients, and this has been reported to be particularly correlated with the severity of the condition. However, it has also been pointed out that steroid administration cannot suppress the increased expression of IL-33 (Reference 3: Prefontaine D, et al. JACI 2010).

[0019] Currently, anti-IL-33 antibody preparations and anti-IL-33 receptor antibody preparations have been developed and shown to be effective in suppressing exacerbations of refractory asthma in clinical trials, confirming their validity as therapeutic targets for refractory asthma. However, they are not yet in clinical use.

[0020] In order to solve the above-mentioned objective, the inventors diligently conducted research and found the following findings. Specifically, we investigated the regulatory mechanisms of IL-33 expression using human airway epithelial organoids derived from subjects with refractory asthma and / or subjects with high IL-33 expression. As a result, we discovered that the Wnt / β-catenin pathway strongly regulates IL-33 expression in human airway epithelium, and for the first time, we revealed that the DEPTOR / mTOR / ULK pathway is involved downstream of it. Furthermore, we confirmed that activating the Wnt / β-catenin pathway can suppress IL-33 expression in airway epithelial organoids derived from asthma patients with high IL-33 expression.

[0021] The Wnt / β-catenin pathway has been reported to be essential for cell proliferation and migration during development. On the other hand, increased activity of GSK-3β, which inhibits β-catenin, is associated with depression, Alzheimer's disease, schizophrenia, ALS, diabetes, and cancer, and GSK-3β inhibitors are being developed as therapeutic agents. We discovered that GSK-3β inhibitors suppress IL-33 expression in airway epithelial organoids derived from asthma patients. In particular, we found that the upregulation of IL-33 expression, which cannot be suppressed by steroids, is suppressed by GSK-3β inhibitors, suggesting that this could be a new therapeutic candidate for refractory asthma and / or IL-33-induced inflammation. Furthermore, we confirmed that the function of ILC2, which is activated by IL-33 derived from airway epithelial cells, can also be suppressed by GSK-3β inhibitors, and confirmed that it has an effect of suppressing airway inflammation in a mouse model of refractory asthma.

[0022] Based on the above findings, we discovered that GSK-3β inhibitors can be used as therapeutic agents for treating refractory asthma and / or inflammation caused by IL-33, leading to the completion of the present invention. The therapeutic agent of this embodiment, containing a GSK-3β inhibitor, is expected to be a new therapeutic candidate for refractory asthma, being less expensive and easier to administer compared to existing biological agents.

[0023] According to the refractory asthma therapeutic agent of the present embodiment, a refractory asthma therapeutic agent capable of treating refractory asthma can be provided. According to the inflammatory disease therapeutic agent by IL-33 of the present embodiment, an inflammatory disease therapeutic agent by IL-33 capable of treating inflammation by IL-33 can be provided.

[0024] <Refractory asthma> The refractory asthma is not particularly limited and can be appropriately selected according to the purpose. Specifically, it refers to asthma that does not show an effect even when general treatment is performed among bronchial asthma, and is preferably refractory asthma with high IL-33 expression and / or steroid-resistant refractory asthma. Here, "high IL-33 expression" refractory asthma means a case where the expression level of IL-33 protein and / or IL-33 mRNA is high in a subject with refractory asthma compared to a healthy subject. In addition, "steroid-resistant" refractory asthma means asthma that requires treatment with therapeutic agents such as high-dose steroid drugs as a control, or asthma with poor control even with these treatments.

[0025] <Inflammation by IL-33> The inflammation by IL-33 is not particularly limited as long as it is inflammation induced by IL-33 and can be appropriately selected according to the purpose. Specifically, it means a case where the expression level of IL-33 protein and / or IL-33 mRNA in a tissue showing inflammation is high compared to a healthy subject, or a case where IL-33 is released extracellularly and inflammation is induced. Examples of tissues and cells showing inflammation include airway epithelium (trachea, bronchus, alveoli), nasal epithelium, and laryngeal epithelium.

[0026] As mentioned above, IL-33 is a physiological cytokine that induces inflammation, and if the conditions for IL-33 release into the extracellular space are met, even subjects with normal IL-33 expression levels (healthy individuals) may exhibit inflammatory conditions. Examples of IL-33-induced inflammation include airway inflammation based on type 2 inflammation (asthma, eosinophilic sinusitis, allergic rhinitis, etc.); and airway inflammation that does not involve type 2 inflammation but is reported to be caused by a different pathway mediated by IL-33 (e.g., COPD, viral pneumonia, ARDS, interstitial pneumonia, etc.).

[0027] <IL-33タンパクおよびIL-33 mRNA> The IL-33 protein and IL-33 mRNA are as registered in HGNC ID:16028, NCBI Gene ID:90865, Ensembl ID:ENSG00000137033, OMIM ID:608678, UniProt KB / Swiss-Prot ID:O95760, etc., and variants registered as the same protein, as well as the genes and mRNAs encoding them, are also included in the IL-33 of this embodiment.

[0028] There are no particular restrictions on the IL-33 protein, as long as it is a protein transcribed, translated, and optionally post-modified from the IL-33 gene locus, and can be appropriately selected depending on the purpose. However, the amino acid sequence of IL-33 is preferably 90% or more identical to that of each known variant of IL-33, and more preferably 95% or more identical. There are no particular restrictions on the antibody capable of detecting the IL-33 protein, and can be appropriately selected depending on the purpose. For example, Goat polyclonal anti-IL-33 (R&D systems, #AF3625) can be used as an anti-IL-33 antibody. Furthermore, the release of IL-33 into the extracellular space can be evaluated by measuring cell culture medium, bronchoalveolar lavage fluid, and nasal lavage fluid using enzyme-linked immunosorbent assay (ELISA).

[0029] There are no particular restrictions on the IL-33 mRNA as long as it is mRNA transcribed and spliced ​​from the IL-33 gene locus, and it can be appropriately selected depending on the purpose. However, it is preferable that it be 90% or more identical to each known variant of IL-33, and more preferably 95% or more identical. There are no particular restrictions on the PCR primer or hybridize probe that can detect the IL-33 mRNA, and it can be appropriately selected depending on the purpose. There are no particular restrictions on the PCR primer, and it can be appropriately selected depending on the purpose. For example, a primer set of IL-33 forward primer: GTGACGGTGTTGATGGTAAGAT (SEQ ID NO: 1) and IL-33 reverse primer: AGCTCCACAGAGTGTTCCTTG (SEQ ID NO: 2) can be used.

[0030] Methods for evaluating IL-33 protein expression levels include, for example, Western blotting, immunohistochemistry (IHC), immunofluorescence (IF), immunochromatography, enzyme immunosorbent assay (ELISA), chemiluminescent enzyme immunosorbent assay (CLEIA), chemiluminescent enzyme immunosorbent assay (CLIA), fluorescence enzyme immunosorbent assay, aptamer assay, immunoturbidimetry, dye colorimetric assay, immunowax assay, latex agglutination assay, Jaffe assay, and gold colloid colorimetric assay. Methods for evaluating IL-33 mRNA expression levels include, for example, in situ hybridization, quantitative reverse transcription polymerase chain reaction (RT-qPCR), and spatial transcriptome analysis.

[0031] As reference values ​​for the expression levels of IL-33 protein and / or IL-33 mRNA, reference values ​​such as 1.5 times or more, or 2 times or more, can be appropriately selected depending on the purpose, based on the expression levels in healthy subjects.

[0032] The subject is generally a mammal, and examples thereof include humans, non-human primates, dogs, cats, mice, rats, cows, horses, pigs, etc. Among these, humans are preferred. The subject may be any of an adult, an infant, a child, or an elderly person, and preferably a subject suspected of having asthma, a subject diagnosed or confirmed to have a disease associated with asthma, etc.

[0033] There is no particular limitation on the specimen to be used as the subject for evaluating the expression level of IL-33 protein and / or IL-33 mRNA, and it can be appropriately selected according to the purpose. Examples thereof include airway epithelium (trachea, bronchus, alveoli), nasal epithelium, pharyngeal and laryngeal epithelium, etc.

[0034] <GSK-3β inhibitor> There is no particular limitation on the GSK-3β inhibitor, and it can be appropriately selected according to the purpose. Examples thereof include LY2090314 (Eli Lilly), SB216763 (GlaxoSmithKline), CHIR-99021 (Laduviglusi, Tocris Bioscience), AZD1080 (GlaxoSmithKline), Tideglusib (Noscira), SAR502250 (Sanofi), AZD2858 (AstraZeneca), AR-A014418 (AstraZeneca), PF-04802367 (Pfizer), Pyridinyl isonicotinamides (Bristol Myers), Thiadiazolidinone-8 (TDZD-8), etc. These may be used alone or in combination of two or more.

[0035] The therapeutic agent may consist of a GSK-3β inhibitor, may be used in combination with other agents such as known asthma therapeutic agents, may contain an asthma therapeutic agent, or may contain a pharmaceutically acceptable carrier. There are no particular restrictions on the asthma treatment drugs mentioned above, and they can be appropriately selected according to the purpose. Examples include long-acting β2-agonists (LABAs), long-acting anticholinergics (LAMAs), leukotriene receptor antagonists (LTRAs), steroids such as inhaled corticosteroids (ICS), theophylline, and biological agents. These may be used individually or in combination of two or more.

[0036] Examples of long-acting β2-agonists (LABAs) include salmeterol (Serevent), formoterol (Oxis), vilanterol, indacaterol (Onbrez), and olodaterol.

[0037] Examples of long-acting anticholinergic drugs (LAMAs) include glycopyrronium (Seebri), umeclidinium (Encrase), and tiotropium (Spiriva).

[0038] Examples of leukotriene receptor antagonists (LTRAs) include pranlukast (Onon) and montelukast (Kipres, Singulair).

[0039] Examples of inhaled corticosteroids (ICS) include fluticasone propionate (Flutide), budesonide (Pulmicort), fluticasone furoate (Anuty), and mometasone furoate (Asmanex).

[0040] Examples of biological agents include omalizumab (anti-IgE antibody), mepolizumab (anti-IL-5 antibody), benralizumab (anti-IL-5Rα antibody), dupilumab (anti-IL-4Rα antibody), and tezeperumab (anti-TSLP antibody).

[0041] Among the aforementioned asthma treatment drugs, in one embodiment, it is preferable to use them in combination with steroids such as inhaled corticosteroids (ICS) from the viewpoint of improving steroid-resistant, refractory asthma.

[0042] Other medications besides asthma medications are not particularly restricted and can be selected as appropriate depending on the purpose. Examples include anti-allergic drugs other than leukotriene receptor antagonists (LTRAs).

[0043] "Pharmacologically acceptable" means a non-toxic component or composition that is physiologically acceptable and, when administered to humans, does not typically cause gastrointestinal disorders, dizziness, or other allergic reactions, or similar reactions. Examples of such carriers include solvents, dispersion media, oil-in-water or water-in-oil emulsions, aqueous compositions, liposomes, microbeads and microsomes, and biodegradable nanoparticles.

[0044] The aforementioned therapeutic agent may be formulated into a dosage form with an appropriate carrier depending on the route of administration. There are no particular restrictions on the route of administration of the aforementioned therapeutic agent, and it can be appropriately selected depending on the purpose. For example, it may be administered into the airway by inhalation, orally, or parenterally to a route other than the airway. Examples of parenteral administration routes include transdermal, nasal, abdominal, intramuscular, subcutaneous, and intravenous administration.

[0045] When the therapeutic agent is administered to the airway by inhalation, the therapeutic agent may be formulated in a dosage form according to a method known in the industry, together with a suitable inhalation carrier, and may be administered by a known inhaler (nebulizer) such as a pressurized metered-dose inhaler, a dry powder metered-dose inhaler, or a soft mist metered-dose inhaler.

[0046] The therapeutic agent may be formulated using methods known in the art to provide rapid, sustained, or delayed release of the active ingredient after administration to a mammal.

[0047] The therapeutic agent, formulated in the manner described above, may be administered in an effective dose via various routes, including inhalation, oral, transdermal, subcutaneous, intravenous, or intramuscular. In this context, “effective dose” means the amount of substance administered to a patient that allows for the diagnosis or tracking of therapeutic effect.

[0048] The dosage of the aforementioned therapeutic agent can be appropriately selected according to the route of administration, the target recipient, the target disease and its severity, age, sex, weight, individual differences, and disease state. The therapeutic agent may contain different amounts of the active ingredient depending on the severity of the disease, but typically, when administered to adults, for example, by inhalation using a nebulizer, an effective dose of 5 ng / ml / dose to 10 μg / ml / dose (e.g., 10 ng / ml / dose) may be administered repeatedly several times a day.

[0049] When the aforementioned therapeutic agent is used in combination with other drugs, the therapeutic agent and the other drugs may be contained in a single formulation, or they may be contained in separate formulations. If they are in separate formulations, each formulation may be administered simultaneously, or they may be administered separately at different times. [Examples]

[0050] The present invention will be described more specifically below based on examples, but the present invention is not limited to the following examples.

[0051] <Materials and Methods> <<Human specimen>> This study included adult Japanese patients with asthma, non-asthma volunteers, and lung cancer patients who were receiving outpatient treatment at Keio University Hospital. Asthma patients using biological agents, oral steroids, or immunosuppressants were excluded. The study included 12 asthma patients, aged 32.6 ± 4.7 years (mean ± SD), with 4 males (33%). The non-asthma volunteers were 31.8 ± 1.3 years old, with 7 males (64%). Swabs for influenza testing were inserted into the nasal cavities of patients and non-asthma volunteers, and nasopharyngeal airway epithelial cells were collected by scraping and used in the study. Some participants also had blood samples taken for ILC2 isolation. To confirm the properties of lower airway epithelial cells, a portion of surgical lung specimens from lung cancer patients were collected, and lower airway epithelial specimens were also taken. This study protocol was approved by the Institutional Review Board (IRB) of Keio University School of Medicine (20090009, 20110171). This study was conducted in accordance with the principles of the Declaration of Helsinki, with written informed consent obtained from all participants, and patient anonymity was maintained through methods approved by the IRB.

[0052] <<Mouse>> The C56BL / 6J mice were purchased from Sankyo Research Institute (Tokyo, Japan). All mice were reared at the designated pathogen-free barrier facility of Keio University School of Medicine. In in vivo experiments, female mice aged 6 to 10 weeks were used together with age- and sex-matched control mice. All animal experiments and handling procedures were approved by the Keio University Animal Experiment Committee (No. 08086) and carried out in accordance with the institution's guidelines.

[0053] <<Organoid Culture>> Human airway epithelial cells were collected by inserting an influenza test swab into the nasal cavity and swabbing the nasopharynx, or by collecting them from surgical lung specimens. The collected specimens were incubated with Suptazyme (sputum-lytic enzyme, Kyokuto Pharmaceutical Co., Ltd.) for 5 minutes at room temperature to decompose secretions, then centrifuged at 300G for 5 minutes, the supernatant was removed, and the specimens were washed with advanced DMEM (Gibco). After washing, the pellet was centrifuged at 300G for 5 minutes, the supernatant was removed, and 20 μL / well of Matrigel (Corning) was added to the pellet to turbidify it. Matrigel (Corning) was dropped into a 48-well plate (Corning) in a dome shape, with 20 μL per well. After incubation at 37°C for 20 minutes, 250 μL of organoid medium was added per well and the cells were cultured at 37°C in 5% CO2. The airway epithelial organoid medium was prepared by removing Y-27632 from the medium used in a previous report (Reference 4: EMBO J. 2019 Feb 15;38(4): e100300.). The medium was changed twice a week. When creating differentiated cystic type organoids, 10 4 Cells were cultured for 4 weeks at the number of cells per well. When using basal cell organoids, 10 5 Cells were seeded in / well and experiments were performed within 7 days of subculturing. Unless otherwise specified, RNA and protein extraction and staining were performed 24 hours after stimulation. Supernatant for ELISA was collected 4 hours after stimulation.

[0054] <<Collection of lung tissue and airway epithelium>> Cells were isolated from resected lung specimens from lung cancer patients. Samples were taken from a macroscopically normal peripheral area at least 10 cm away from the tumor. The tissue was washed with ice-cold phosphate-buffered saline (PBS) and cut into small pieces. The fragments were digested with Liberase TH (Roche) at 37°C for 30 minutes. Before seeding, the collected epithelium was washed with PBS supplemented with 10% fetal bovine serum (FBS) to inactivate digestive enzymes. These cells were embedded in Matrigel in the same manner as described above and cultured as organoids.

[0055] <<Isolation and culture of ILC2>> Peripheral blood mononuclear cells (PBMCs) were isolated using Lymphoprep (Serumwerk, Bernburg, Germany) according to the manufacturer's protocol. The single cell suspension of PBMCs was incubated on ice for 30 minutes with antibodies against lineage markers (CD3, CD14, CD16, CD19, CD20, CD56), CD45, CD127, CRTH2, and CD161. ILC2 was classified as cells by flow cytometry (MoFlo XDP; Beckman Coulter, Brea, CA, USA) using CD45 + Lineage - CRTH2 + CD127 + CD161 + PI - and classified as cells.

[0056] Purified human type 2 innate lymphoid cells (ILC2) were cultured at 37°C in 200 μL of RPMI - 1640 medium supplemented with 10% fetal bovine serum (FBS), HEPES, non - essential amino acids, penicillin, streptomycin, and 2 - mercaptoethanol, together with IL - 2 (20 U / mL) in 96 - well round - bottom plates. For proliferation, ILC2 were stimulated with IL - 2 (20 U / mL) and IL - 33 (50 ng / mL) and cultured with only IL - 2 (20 U / mL) for at least 5 days before use in experiments.

[0057] <<Real - time quantitative PCR>> RNA was isolated from airway epithelial cells using the RNeasy mini kit (Qiagen) according to the manufacturer's instructions, and cDNA was generated using the High-Capacity RNA-to-cDNA Kit (Thermo Fisher). Expression levels of IL-33, DEPTOR, LEF1, TCF7, AXIN2, IL-5, IL-13, and CTNNB1 mRNA were determined by real-time quantitative PCR using the Quantstudio 5 Real-Time PCR System (Applied Biosystems) with either KAPA SYBR FAST qPCR Kits (Roche) or TaqMan Fast Universal PCR Master Mix (Applied Biosystems, Foster City, Louisiana, USA). In this study, ACTB, the gene encoding actin β, was used as a normalization control.

[0058] <<Primer Set>> The sequence information for the primer set used is as follows: IL-33 forward primer:GTGACGGTGTTGATGGTAAGAT (SEQ ID NO: 1) IL-33 reverse primer:AGCTCCACAGAGTGTTCCTTG (SEQ ID NO: 2) DEPTOR-qPCR forward primer:CTCAGGCTGCACGAAGAAAAG (SEQ ID NO: 3) DEPTOR-qPCR reverse primer: TTGCGACAAAACAGTTTGGGT (SEQ ID NO: 4) LEF1-qPCR forward primer: AGAACACCCCGATGACGGA (SEQ ID NO: 5) LEF1-qPCR reverse primer:GGCATCATTATGTACCCGGAAT (SEQ ID NO: 6) TCF7-qPCR forward primer: CTGGCTTCTACTCCCTGACCT (SEQ ID NO: 7) TCF7-qPCR reverse primer: ACCAGAACCTAGCATCAAGGA (SEQ ID NO: 8) AXIN2-qPCR forward primer: CAACACCAGGCGGAACGAA (SEQ ID NO: 9) AXIN2-qPCR reverse primer:GCCCAATAAGGAGTGTAAGGACT (SEQ ID NO: 10) IL5-qPCR forward primer: TGGAGCTGCCTACGTGTATG (SEQ ID NO: 11) IL5-qPCR reverse primer: TTCGATGAGTAGAAAGCAGTGC (SEQ ID NO: 12) IL13-qPCR forward primer: CCTCATGGCGCTTTTGTTGAC (SEQ ID NO: 13) IL13-qPCR reverse primer:TCTGGTTCTGGGTGATGTTGA (SEQ ID NO: 14) CTNNB1-qPCR forward primer:AAAGCGGCTGTTAGTCACTGG (SEQ ID NO: 15) CTNNB1-qPCR reverse primer: CGAGTCATTGCATACTGTCCAT (SEQ ID NO: 16) ACTB-qPCR forward primer:CATGTACGTTGCTATCCAGGC (SEQ ID NO: 17) ACTB-qPCR reverse primer: CTCCTTAATGTCACGCACGAT (SEQ ID NO: 18)

[0059] <<RNAシークエンス> > Basal cell organoids were passaged and cultured, and RNA was extracted on day 7. RNA was isolated from airway epithelial cells using the RNeasy plus mini kit (Qiagen) according to the manufacturer's instructions. RNA integrity number (RIN value), which indicates the degree of RNA degradation, was measured by electrophoresis using a Bioanalyzer (Agilent), and a RIN value > 7 was confirmed. Poly(A) mRNA Magnetic Isolation Module (Cat No. E7490, New England Biolabs) was used to isolate the RNA. +RNA was isolated. A strand-specific library was prepared using the NEBNext® UltraTMII Directional RNA Library Prep Kit (Cat No. E7760, New England Biolabs), sequenced on a NovaSeq 6000 (Illumina), and a FASTQ file was created. The quality of the created FASTQ file was verified using the BaseSpace Sequence Hub (BSSH) software FastQC (version 0.11.7). Sequence reads (short base sequence fragments) were trimmed using Trimmomatic (version 0.38), a tool for removing adapters and terminal sequences on the FASTQ file. The trimmed sequence reads were mapped to the reference genome (hg38) using HISAT2 software. The number of reads mapped to known exon regions and the transcript per million (TPM value) were calculated using FeatureCounts software (version 1.6.3) after correcting for reads per transcript and then correcting for the total number of reads. The obtained read count data was analyzed using iDEP 2.01 (http: / / bioinformatics.sdstate.edu / idep11 / ), a web tool for RNA sequencing analysis, to identify differentially expressed genes using the DEseq2 package in R. Pathway analysis was then performed using GO term (The Gene Ontology Consortium) and KEGG (Kyoto Encyclopedia of Genes and Genomes), which were annotated with gene ontology (GO) data.

[0060] <<Enzyme-linked immunosorbent assay (ELISA)>> TrypLE Express (Thermo Fisher Scientific) was added to the basal cell organoids and warmed in a 37°C water pool for 20 to 30 minutes, then made into single cells by pipetting. Subsequently, pellets were formed by centrifugation at 300 G for 5 minutes, and the supernatant was removed. The pellets were suspended in organoid medium without R-spondin and seeded in a 96-well plate at 10 5 / well, and planar culture was performed. Stimulation was applied when the density reached 80%, and the supernatant was collected 4 hours later. The IL-33 level in the culture supernatant was measured using a Quantikine ELISA kit (R&D Systems) according to the manufacturer's protocol.

[0061] <<Capillary Western Immunoblotting>> Proteins were extracted from cultured airway epithelial cells using Cell Lysis Buffer (Cell signaling Technology) containing a protease inhibitor cocktail (1x, Sigma Aldrich) and phenylmethylsulfonyl fluoride (PMSF, 1 mM, Tocris Bioscience), and the protein amount was quantified using a bicinchoninic acid (BCA) assay (Thermo Fisher). Capillary Western immunoblotting was performed on a Jess Simple Western System (ProteinSimple, San Jose, CA, USA) using a Size Separation Master Kit with Split Buffer (12 kDa - 230 kDa) according to the manufacturer's instructions (ProteinSimple). Total protein detection on the same capillary was performed by running an immunoassay on the same capillary using a RePlex Module (ProteinSimple). The Jess Simple Western System was programmed using Compass software (version 6.0.0, Protein Simple) to obtain Western immunoblotting images and fluorescence measurement data.

[0062] <<Microscopic Examination>> Organoids were removed from Matrigel using Cell Recovery Solution (Corning). They were transferred to 1.5 ml Eppendorf tubes coated with FBS, and the organoids were allowed to settle by gravity. The supernatant was removed and washed with PBS. Fixation was performed with 4% paraformaldehyde, and after washing with PBS, Power Block Universal Blocking Reagent (10×, BioGenex) was added. After removing the supernatant, the primary antibody was added to Triton® X-100 diluted to 0.2%-1% in PBS and added to the specimen. The culture was incubated overnight at 4°C with shaking. After removing the supernatant and washing with PBS, the secondary antibody diluted in PBS and the nuclear stain Hoechst 33342 (Thermo Fisher Science) were added, and the culture was shaken at room temperature for 30 minutes. The supernatant was removed, prolong diamond antifade mountant (Thermo Fisher Science) was added, and the culture was transferred to a glass bottom culture dish and observed with a confocal laser scanning microscope. Confocal laser scanning microscopy was performed using TCS-SP5 (Leica, Wetzlar, Germany) and THUNDER Imager 3D Cell Culture (Leica, Wetzlar, Germany). The following excitation and emission windows were used for Hoechst and each stain detection: 405 nm, 430 nm–470 nm, 488 nm, and 500 nm–600 nm. Image analysis was performed using Leica Application Suite X (Leica). Bright-field images of organoids on a 48-well plate were acquired using BZ-X810 (Keyence Corporation).

[0063] <<Flow cytometry of organoids>> Cultured organoids were treated with TrypLE Express (Thermo Fisher Scientific) and incubated in a 37°C water pool for 20-30 minutes. After pipetting to single cells, they were transferred to filtered FACS tubes. Each labeled antibody (EpCAM-PE / Cy7, NGFR-APC, ITGA6-APC / Cy7) was administered using PBS as the solvent (0.1 μL / cell, 100,000 cells) and incubated for 20 minutes. For IL-33 intranuclear staining, cells were then fixed using a Foxp3 / transcription factor staining buffer set (Invitrogen) according to the manufacturer's protocol, permeabilized, and then IL-33 antibody was added and allowed to stand for 20 minutes. After washing, secondary antibody was added and allowed to stand for 20 minutes. After washing, the cells were suspended in 100 μL of PBS. The data was analyzed using Cytoflex (Beckman Coulter), and the resulting data was analyzed using FlowJo analysis software (version 10, TreeStar, Ashland, Oregon, USA).

[0064] <<ShRNA transfer experiment using lentiviral vectors>> The lentivirus solution was prepared as follows: On day 1, human embryonic kidney cells HEK 293T cells (5 × 10¹⁶) were added to a 10 cm dish coated with 0.1% gelatin. 6Cells (in a dish) were seeded on Dulbecco's Modified Eagle Medium (Gibco) supplemented with 10% fetal bovine serum (FBS) and cultured at 37°C. On day 2, 7 μL of Lentiviral High Titer Packaging Mix (Takara Bio), 30 μL of X-tream GENE HP (Roche), and 10 μg of vector plasmid were mixed with 1 mL of Opti-MEM (Gibco), incubated at room temperature for 20 minutes, and then mixed with HEK 293T cell culture medium. On day 3, the medium was replaced with 10 μM forskolin-containing medium. On day 4, the supernatant was collected and filtered through a 0.45 μm filter to obtain the virus solution. The virus solution was mixed with Lenti-X Concentrator (Takara Bio) in a 3:1 ratio, incubated overnight at 4°C, centrifuged at 1500 G for 45 minutes at 4°C, and the pellet was concentrated by suspension in the required amount of organoid medium.

[0065] Next, a viral vector (VectorBuilder, Chicago, Illinois, USA) was introduced into human basal cells. On day 1, the cultured organoids were made into single cells using TrypLE Express (Thermo Fisher Scientific) and turbidified in 30 μL of Matrigel. A mixed solution of 1 mL of viral solution, 1 μL of Polybrene Infection (Merck Millipore #TR-1003-G (10 mg / mL)), and 1 μL of the ROCK-specific inhibitor Y-27632 (FUJIFILM Wako Pure Chemical Corporation) was placed in the well of an ultra-low attachment 24-well plate (Corning), and the cells encapsulated in Matrigel were added drop by drop. This plate was centrifuged at 600 G for 1 hour and then incubated at 37°C in 5% CO2 for 6 hours. After incubation, it was transferred to 2 mL of advanced DMEM (Thermo Fisher Scientific), and the pellet obtained by centrifugation at 400 G for 3 minutes was embedded in Matrigel. 20 μL / well was transferred to each well of a 48-well plate and cultured in organoid medium. The culture medium was changed to a medium containing 2.0 μg / mL of puromycin on day 3 for selection. Passage was carried out on day 7, and subsequent experiments were performed.

[0066] <<Co-culture of ILC2 and airway epithelium>> A mixed solution of 8.5 ml of distilled water, 100 μL of Collargen Type I (Corning), and 10 μL of Acetic acid (FUJIFILM Wako Pure Chemical Corporation) was added to the insert of Transwell 24well 0.4 μm (Corning) at 200 μL / well, left standing overnight at room temperature for collagen coating. The cells made into single cells using TrypLE Express (Thermo Fisher Scientific) were suspended in organoid medium without R-spondin and added to the collagen-coated insert at 10 5Seeds were seeded in / well. The same medium was placed in the basal side of a Transwell 24well and incubated at 37°C and 5% CO2. When the airway epithelium reached 80% density, stimulation was performed with DMSO or a GSK-3β inhibitor (LY2090314) for 24 hours. After stimulation, ILC2s cultured in medium from which IL-33 had been removed for 5 days were placed in the basal side with 100 μL of IL-33-removed medium, 5 × 10⁶. 4 Seeds were seeded in a single well. At this time, 50 μL of organoid medium with R-spondin removed was added to the insert side, and Alternaria extract at a final concentration of 50 μg / mL was added. After stimulation, the culture medium containing ILC2s from the basal side was collected after 24 hours, and the ILC2s and supernatant were collected by centrifugation at 500 G for 3 minutes.

[0067] <<In vivo experiments with mice>> A 50 μL mixture of 90.5% H2O, 7.5% PEG-300, and 2% Dimethyl sulfoxide (DMSO) was used as the vehicle, and 3 mg / kg of the GSK-3β inhibitor (LY2090314) and / or 0.3 mg / kg of Dexamethasone (Dex) were added. This mixture was administered intranasally to ketamine-anesthetized mice from day 1 to day 5. From day 2 to day 4, 5 μg of Alternaria extract dissolved in 50 μL of PBS was administered nasally to ketamine-anesthetized mice six hours after drug administration. On day 7, the lungs were flushed with PBS via a tracheal cannula to obtain bronchoalveolar lavage fluid (BALF), and the supernatant of the BALF was collected and stored at -80°C for cytokine assay. Cells obtained from the BALF were cell-counted and analyzed using Cytoflex (Beckman Coulter). Eosinophils were CD45 + SiglecF + CD11c + Cells were identified. All data were analyzed using FlowJo analysis software (version 10, TreeStar, Ashland, Oregon, USA).

[0068] <<Quantification and Statistical Analysis>> All data were presented as mean ± standard deviation and analyzed using GraphPad Prism 8 software (GraphPad, San Diego, California, USA). Statistical tests between two groups were performed using the Student t-test for unpaired data and the Paired t-test for paired data. For comparisons of three or more groups, one-way ANOVA was used with Tukey or Dunnett post-hoc tests. P-values ​​were based on two-tailed tests. Correlations were tested using Pearson's correlation coefficient. Unless otherwise specified, results of p < 0.05 were considered statistically significant.

[0069] <1. Development of an IL-33 evaluation system in human airway epithelial cells> We obtained airway epithelial cells by swabbing the human nasopharynx and cultured them into organoids to create cystic-type organoids that differentiated into ciliated cells and produced mucin, thus acquiring a structure similar to that of the living airway (Figure 3A, B).

[0070] Figure 3A is a bright-field image of a cystic organoid created from collected airway epithelial cells through a 4-week long-term organoid culture. In Figure 3A, the left scale bar represents 1 mm, and the right scale bar represents 100 μm. Figure 3B is an immunohistochemical image of the cystic organoid. In Figure 3B, the left arrow indicates the MU5AC staining site for the mucin marker, and the right arrow indicates the Acetyl α tublin staining site for the ciliary marker. The nucleus was stained with Hoechst. The scale bar represents 100 μm.

[0071] IL-33-expressing cells were evaluated using flow cytometry with the constructed organoids (Figure 3C). Figure 3C shows the nuclear staining of IL-33 in cystic organoids and flow cytometry using basal cell markers (ITGA6, NGFR). As a result, IL-33-positive cells were confirmed to be positive for ITGA6 and NGFR, which are surface antigen markers of basal cells (Figure 3C).

[0072] Therefore, as an evaluation system for IL-33 in airway epithelium, we decided to create basal cell organoids composed solely of basal cells. When basal cell organoids were created by short-term organoid culture for one week, spherical organoids were obtained, and it was confirmed that 97.4% of the spherical organoids were composed of basal cells (Figure 3D, E).

[0073] Here, Figure 3D is a bright-field image of a spherical organoid prepared in a short-term organoid culture of one week. In Figure 3D, the left scale bar represents 1 mm and the right scale bar represents 100 μm. Figure 3E is flow cytometry of the spherical organoid using epithelial marker (EpCAM) and basal cell markers (ITGA6, NGFR).

[0074] Thus, as an evaluation system for airway epithelial cells, we constructed a cystic organoid for evaluating differentiated human airway epithelium and a spherical organoid composed of basal cells for evaluating IL-33 expression.

[0075] <2. Comparison of clinical specimens (airway epithelial cells from asthma patients and healthy volunteers)> We compared IL-33 expression in basal cell organoids using airway epithelial cells from asthma patients and non-asthma volunteers. The asthma patients included 12 individuals, aged 32.6 ± 4.7 years (mean ± SD), with 4 males (33%). The non-asthma volunteers were aged 31.8 ± 1.3 years, with 7 males (64%).

[0076] Figure 4A shows a comparison of IL-33 mRNA expression in basal cell organoids from asthma patients and non-asthma volunteers by real-time PCR. Figure 4B shows a comparison of IL-33 mRNA expression in samples with high and low IL-33 mRNA expression by real-time PCR. Figure 4C shows a comparison of IL-33 protein expression corrected for total protein by capillary Western blot analysis in samples with high and low IL-33 mRNA expression. Figure 4D shows the correlation between IL-33 mRNA expression and IL-33 protein expression measured in Figures 4B-C. Figure 4E shows a comparison of IL-33 protein in the supernatant of samples with high and low IL-33 mRNA expression by ELISA. In Figures 4A-E, the error bars represent the mean ± standard deviation (SD), and in Figures A-C and E, the p-values ​​obtained from Student's t-test are shown; *p-value < 0.05, **p-value < 0.01, ***p-value < 0.001, ****p-value < 0.0001.

[0077] As a result, a comparison of mRNA expression in organoids of each group using real-time PCR showed that IL-33 expression was significantly higher in the asthma group (Figure 4A). Similarly, samples with high IL-33 mRNA expression also showed high IL-33 protein expression, and a significant correlation (R=0.8897, P=0.0031) was confirmed between mRNA expression and protein expression (Figures 4B-D). Furthermore, it is known that airway epithelial cells release IL-33 in response to stimulation by Alternaria, a type of fungus, and it was confirmed that the amount of IL-33 protein released in response to stimulation with Alternaria extract was also higher in samples with high levels of intracellular mRNA and protein expression (Figure 4E). These findings reveal that airway epithelial cells of asthma patients have high IL-33 expression and release more IL-33 in response to stimulation.

[0078] <3. Suppression of IL-33 expression by Wnt / β-catenin signaling> Next, through experiments shown in Figures 5A and 5B below, we searched for factors that alter IL-33 expression in basal cell organoids and discovered that R-spondin, an inducer of the Wnt / β-catenin signal, suppresses the expression of IL-33 mRNA and protein (Figures 5A and 5B). Figure 5A shows a comparison of the difference in IL-33 mRNA expression in basal cell organoids due to R-spondin, using real-time PCR. Figure 5B shows a comparison of the difference in IL-33 protein expression in basal cell organoids due to R-spondin, using immunostaining. In Figures 5A and 5B and Figures 5C and 5G described later, Non-R-spondin represents basal cell organoids cultured in a medium from which R-spondin has been removed, and R-spondin represents basal cell organoids cultured in a medium to which R-spondin has been added. In Figure 5A, error bars represent the mean ± standard deviation (SD), and the p-value by Student's t-test is shown;****p-value<0.0001. In Figure 5B, the scale bar represents 30 μm.

[0079] Next, in all 23 samples evaluated in Figure 4A, including asthma patients and non-asthma volunteers, a decrease in IL-33 mRNA expression was confirmed when R-spondin was added (Figure 5C). Furthermore, the inhibitory effect of R-spondin on IL-33 expression was also confirmed in basal cell organoids created from airway epithelium collected from the lower respiratory tract (Figure 5D). Here, Figure 5C shows a comparison of the difference in IL-33 mRNA expression in basal cell organoids using 23 samples with R-spondin, as determined by real-time PCR. In Figure 5C, the error bars indicate the mean ± standard deviation (SD), and the p-value for the paired t-sample is shown;****p-value < 0.0001. Figure 5D shows a comparison of the difference in IL-33 mRNA expression in lung-derived basal cell organoids with R-spondin, as determined by real-time PCR. In Figure 5D, the error bars indicate the mean ± standard deviation (SD), and the p-value for Student's t-test is shown;****p-value < 0.0001.

[0080] Furthermore, RNA sequencing was performed using organoids that were not stimulated with R-spodin, and pathway analysis was conducted using differentially expressed genes. Figure 5E shows the RNA sequencing data for four non-R-spondin samples and four R-spondin samples. Figure 5E shows pathway analysis (KEGG) using differentially expressed genes extracted with Fold change > 2 and FDR < 0.05. Each pathway was extracted with FDR < 0.1. Pathways in which the expression of genes involved in each pathway was upregulated in the R-spondin group are shown. Figure 5F shows a heatmap of genes extracted in the Wnt signaling pathway based on Figure 5E. As a result, a Wnt signal was extracted (Figures 5E, F).

[0081] Furthermore, R-spondin is known to enhance the Wnt / β-catenin signal in the presence of the Wnt ligand, and it was found that the inhibitory effect of R-spondin on IL-33 disappears in the presence of the Wnt ligand release inhibitor, PORCN inhibitor (LGK974) (Figure 5G). On the other hand, even in the presence of LGK974, the inhibitory effect of R-spondin on IL-33 was observed when the Wnt ligand (Wnt 3A) was added (Figure 5G). Here, Figure 5G shows the results of comparing the expression of IL-33 mRNA by real-time PCR after adding Wnt3A, R-spondin, and PORCN inhibitor to organoid medium from which R-spondin had been removed. In Figure 5G, the error bars show the mean ± standard deviation (SD), and the p-values ​​from one-way ANOVA using Dunnett's post-hoc test are shown; ns > 0.05, ****p-value < 0.0001.

[0082] The Wnt / β-catenin signaling pathway includes both a canonical pathway mediated by β-catenin and a non-canonical pathway that does not. Therefore, β-catenin (CTNNB1) was knocked down by introducing shRNA using a lentivirus. Figure 5H shows the results of comparing the expression of CTNNB1 and IL-33 mRNA in control sh-RNA-introduced basal cell organoids and basal cell organoids in which CTNNB1 was knocked down by introducing sh-CTNNB1, using real-time PCR. As a result, an increase in IL-33 mRNA expression was confirmed, suggesting that R-spondin suppresses IL-33 expression via the canonical pathway (Figure 5H). In Figure 5H, error bars indicate the mean ± standard deviation (SD), and the p-value is shown by Student's t-test; ****p-value < 0.0001.

[0083] Furthermore, since Wnt / β-catenin is suggested to be involved in cell proliferation, differentiation, and EMT (epithelial-mesenchymal transition), we compared the expression of epithelial and EMT gene markers using TPM RNA sequencing data (Figure 5E) as shown in Figure 5I, and the resulting heatmap is shown in Figure 5I. As a result, there were no clear changes in the expression of marker genes in basal cells or EMT (Figure 5I). Flow cytometry also showed no changes in surface markers of epithelial or basal cells (Figure 5J). Figure 5J shows the results of flow cytometry confirmation of the expression of EpCAM (epithelial marker) and NGFR (basal cell marker) of non-R-spondin and R-spondin in basal cells.

[0084] These results indicate that the Wnt / β-catenin signal reduces IL-33 expression in basal cells of human airway epithelium.

[0085] <4. Suppression of IL-33 expression via DEPTOR> Next, to investigate the involvement of Wnt / β-catenin signaling in clinical samples, RNA sequencing of IL-33 high and IL-33 low samples extracted 203 genes that were highly expressed in the IL-33 high samples and 52 genes that were similarly suppressed by R-spondin to IL-33, and common factors were searched (Fold change > 2, FDR < 0.05). Figure 6A shows a comparison of gene expression in basal cell organoids under R-spondin-free organoid medium culture in the four IL-33 high samples and four IL-33 low samples shown in Figure 4B. Specifically, 203 genes that were highly expressed in the IL-33 high group under the conditions of Fold change > 2, FDR < 0.05 by RNA sequencing were compared with eight samples each cultured under R-spondin or non-R-spondin conditions, and 52 genes that were downregulated in the R-spondin group were extracted. Two common genes were extracted from these. As a result, DEPTOR, an inhibitor of the mTOR pathway, and MMP10, which is involved in the degradation of the extracellular matrix, were extracted (Figure 6A).

[0086] Next, as shown in Figure 6B, the correlation between IL-33 mRNA expression and DEPTOR mRNA expression in 23 samples was examined. The results showed that the expression level of DEPTOR in clinical samples showed a significant correlation with the expression level of IL-33 (Pearson correlation coefficient: R=0.8021, P<0.0001) (Figure 6B).

[0087] Knockdown of DEPTOR using shRNA significantly suppressed IL-33 expression at both the RNA and protein levels (Figure 6C, D). Figure 6C shows a comparison of DEPTOR mRNA and IL-33 mRNA in sh-control and sh-DEPTOR-introduced basal cell organoids by real-time PCR. In Figure 6C, error bars represent the mean ± standard deviation (SD) and the p-values ​​from Student's t-test; **p-value < 0.01, ****p-value < 0.0001. Figure 6D shows a comparison of DEPTOR protein expression and IL-33 protein expression in sh-control and sh-DEPTOR-introduced basal cell organoids by capillary Western blot analysis. The right-hand lane for each condition represents total protein.

[0088] Furthermore, since DEPTOR is known to be a factor that suppresses mTOR signaling, we confirmed the change in IL-33 expression caused by an mTOR inhibitor. Figure 6E shows a comparison of IL-33 mRNA expression using real-time PCR stimulated by DMSO and an mTOR inhibitor (Torin 1 μM). In Figure 6E, error bars indicate the mean ± standard deviation (SD) and the p-value calculated by Student's t-test; ***p-value < 0.001. As a result, IL-33 expression was significantly induced by Torin 1 μM (mTOR inhibitor) (Figure 6E).

[0089] Furthermore, mTOR is known to suppress the action of unc-51-like autophagy activating kinase 1 (ULK1), and the action of the ULK1 inhibitor (MRT68921) was confirmed. Figure 6F shows a comparison of IL-33 mRNA expression using real-time PCR stimulated with DMSO and the ULK inhibitor (MRT68921 1 μM). In Figure 6F, error bars indicate the mean ± standard deviation (SD), and the p-value is shown by Student's t-test;**** p-value < 0.0001. As a result, it was confirmed that IL-33 expression was significantly suppressed by MRT68921 1 μM (Figure 6F).

[0090] Based on these results, a DEPTOR correlated with IL-33 expression was identified in clinical samples, and it became clear that the Wnt / β-catenin signal suppresses DEPTOR expression and inhibits IL-33 via mTOR and ULK.

[0091] <5. Therapeutic applicability of GSK-3β inhibitors targeting IL-33 in human airway epithelium> GSK-3β inhibitors have been developed as small molecule compounds that induce Wnt / β-catenin signaling, and clinical trials are underway for cancer and neurological diseases. We investigated whether GSK-3β inhibitors reduce IL-33 expression in the airways.

[0092] When the GSK-3β inhibitor (LY2090314 10nM) was added to airway epithelial basal cells, an increase in β-catenin protein and induction of Wnt / β-catenin target gene expression were observed, suggesting induction of the Wnt / β-catenin signal (Figures 7A and 7B). Figure 7A shows a comparison of β-catenin protein expression corrected for total protein by capillary Western blot analysis. Figure 7B shows a comparison of AXIN2, LEF1, and TCF7 mRNAs of the Wnt / β-catenin signal target genes by real-time PCR. In Figures 7A-B and Figures 7C-J described later, Non-R-spondin represents basal cell organoids cultured in a medium from which R-spondin has been removed, R-spondin represents basal cell organoids cultured in a medium to which R-spondin has been added, and GSK-3 inhibitor represents basal cell organoids cultured in a medium from which R-spondin has been removed and a GSK-3β inhibitor (LY2090314 10nM) has been added. In Figures 7A-D, the error bars represent the mean ± standard deviation and show the p-values ​​from one-way ANOVA using Tukey's post-hoc test; ns > 0.05, * ≤ 0.05, ** < 0.01, *** < 0.001, **** < 0.0001.

[0093] Furthermore, suppression of DEPTOR expression and suppression of IL-33 RNA and protein levels were confirmed (Figures 7C and 7D). Figure 7C shows a comparison of DEPTOR mRNA expression by real-time PCR. Figure 7D shows a comparison of IL-33 mRNA by real-time PCR and IL-33 protein by capillary Western blot analysis.

[0094] Loss of IL-33 protein in the nuclei of basal cells was also observed in differentiated airway epithelial organoids (Figure 7E). When a GSK-3 inhibitor was added to clinical samples, including those from asthma patients, IL-33 mRNA expression was suppressed in all samples (Figure 7F). Figure 7E shows immunohistochemical staining images of cystic organoids with and without GSK-3 inhibitor stimulation. In Figure 7E, arrows indicate the staining sites of IL-33, and the scale bar represents 40 μm. IL-33 stained cells are keratin 5 stained cells. The nuclei were stained with Hoechst. Figure 7F shows a comparison of IL-33 mRNA expression using real-time PCR.

[0095] Furthermore, it was confirmed that the release of IL-33 protein was also suppressed by a GSK-3β inhibitor (Figure 7G). Figure 7G shows the results of comparing IL-33 protein in the culture medium by ELISA after stimulating planar cultured basal cells with Alternaria extract at 50 μg / mL for 4 hours. In Figures 7F-7G, error bars indicate the mean ± standard deviation and the p-value calculated by the paired t-test;**** < 0.0001.

[0096] Furthermore, it is known that when airway epithelial cells and type 2 innate lymphoid cells (ILC2s) are co-cultured and stimulated with Alternaria, ILC2s co-cultured with organoids that have high IL-33 expression show increased production of type 2 inflammatory cytokines such as IL-5 and IL-13. Therefore, as shown in Figure 7H, we compared the expression of IL-13 mRNA and IL-5 mRNA in ILC2s co-cultured with basal cells using real-time PCR. In Figure 7H, the error bars represent the mean ± standard deviation and show the p-value from one-way ANOVA using Tukey's post-hoc test;**** < 0.0001. As a result, IL-5 mRNA and IL-13 mRNA expression in ILC2s were significantly suppressed by GSK-3β inhibitors (Figure 7H).

[0097] Furthermore, while inhaled corticosteroids are key drugs in the treatment of bronchial asthma, the inventors have reported that IL-33 expression in basal cells is steroid-resistant (see Non-Patent Literature 1). Therefore, the effect of steroid addition to organoids was evaluated. Figure 7I shows a comparison of IL-33 mRNA expression in basal cell organoids by real-time PCR with dexamethasone. In Figure 7I, "DEX" indicates the addition of dexamethasone, the error bars show the mean ± standard deviation, and the p-values ​​from one-way ANOVA using Dunnett's post-hoc test are shown; ns > 0.05, **** < 0.0001. As a result, IL-33 expression was not suppressed by the addition of dexamethasone, but a significant suppressive effect was shown by a GSK-3β inhibitor (Figure 7I).

[0098] Finally, an asthma model mouse was created by administering Alternaria extract nasally. In this model, administration of dexamethasone resulted in approximately 40% improvement in eosinophilic inflammation, and a similar effect was observed with GSK-3β inhibitors. Furthermore, when GSK-3β inhibitors were administered in addition to dexamethasone, a synergistic effect was observed, resulting in approximately 80% improvement in eosinophilic inflammation (Figure 7J). Figure 7J shows a comparison of cell counts in BALF (bone marrow lavage fluid) from Alternaria nasal administration mice. In Figure 7J, the vertical axis of the left graph shows the total number of BALF cells, and the vertical axis of the right graph shows the number of eosinophils in BALF cells. On the horizontal axis, "PBS Vehicle" indicates that the mice were administered PBS nasally instead of Alternaria, "Alt" indicates that the mice were derived from an asthma model, "LY" indicates administration of the GSK-3β inhibitor LY2090314, and "DEX+LY" indicates co-administration of dexamethasone and LY2090314. Error bars represent the mean ± standard deviation, and the p-values ​​from one-way ANOVA using Tukey's post-hoc test are shown: * ≤ 0.05, ** < 0.01, *** < 0.001, **** < 0.0001.

[0099] Based on these results, GSK-3β inhibitors are novel drugs that reduce IL-33 expression in airway epithelium, which is difficult to suppress with steroids. They are expected to be applied as therapeutic agents for treating refractory asthma and inflammation associated with high IL-33 expression.

[0100] <References> Reference 1: Liew FY, et al. Nat Rev Immunol, 2016 Reference 2: N Engl J Med, 2010 Reference 3: Prefontaine D, et al. JACI 2010 Reference 4: EMBO J. 2019 Feb 15;38(4): e100300.

Claims

1. A therapeutic drug for treating refractory asthma, A therapeutic agent characterized by containing a glycogen synthase kinase type 3 β inhibitor.

2. A therapeutic drug for treating inflammation caused by IL-33, A therapeutic agent characterized by containing a glycogen synthase kinase type 3 β inhibitor.

3. The therapeutic agent according to claim 1 or 2, wherein the glycogen synthase kinase type 3 β inhibitor is selected from the group consisting of LY2090314, SB216763, CHIR-99021, AZD1080, tideglucib, SAR502250, AZD2858, AR-A014418, PF-04802367, pyridinyl isonicotinamide, and thiadiazolidinone-8.

4. The therapeutic agent according to claim 1 or 2, used in combination with an asthma treatment agent.

5. The therapeutic agent according to claim 4, wherein the asthma treatment agent is a steroid.

6. The therapeutic agent according to claim 1, wherein the refractory asthma is a refractory asthma characterized by high expression of IL-33.

7. The therapeutic agent according to claim 1, wherein the refractory asthma is steroid-resistant refractory asthma.