RNA degradation promoter

The use of giant kelp extract as an RNA degradation accelerator addresses the need for safer post-transcriptional regulation by enhancing RNA destabilizing enzymes, effectively reducing inflammatory cytokines and improving conditions like psoriasis and autoimmune diseases.

JP2026096985APending Publication Date: 2026-06-16NIPPON MENARD COSMETIC CO

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
NIPPON MENARD COSMETIC CO
Filing Date
2024-12-04
Publication Date
2026-06-16

Smart Images

  • Figure 2026096985000001
    Figure 2026096985000001
  • Figure 2026096985000002
    Figure 2026096985000002
  • Figure 2026096985000003
    Figure 2026096985000003
Patent Text Reader

Abstract

To provide RNA degradation accelerators that are highly safe and suitable for clinical application. [Solution] The giant kelp extract effectively activates intracellular RNA degradation and also exhibits excellent safety. Therefore, the RNA degradation accelerator of the present invention is expected to be applicable to foods, cosmetics, quasi-drugs, and pharmaceuticals as a mitigating agent for conditions related to excessive RNA retention, such as psoriasis, inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, and RNA virus infections.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an RNA degradation promoter characterized by containing an extract of giant kelp.

Background Art

[0002] Gene expression is carried out through steps of transcription and translation called the central dogma. First, the genetic information stored in DNA is transcribed, and messenger RNA (mRNA) is synthesized. Next, based on the synthesized mRNA, a protein (enzyme) is synthesized by a protein synthesis mechanism called translation and exhibits various functions in the living body. In addition, gene expression is precisely controlled by post-transcriptional regulation that performs selective splicing on the transcribed mRNA, controls its stability and translation efficiency, in addition to transcriptional regulation by transcription factors, enabling a proper biological response without excess or deficiency (Non-Patent Document 1).

[0003] The importance of post-transcriptional regulation in cells has been reported many times. For example, Tristetraprolin (TTP), one of the enzymes that destabilize mRNA, binds to a characteristic sequence called an AU-rich element present in the 3′ untranslated region of the mRNA of inflammatory cytokine genes, and suppresses the onset of autoimmune diseases such as rheumatoid arthritis and systemic lupus erythematosus due to an excessive inflammatory response, and the onset of Parkinson's disease caused by nerve inflammation (Non-Patent Documents 2 and 3). In addition, these post-transcriptional regulations are antagonized by HuR, one of the enzymes that binds to the AU-rich element of mRNA and stabilizes mRNA, enabling the regulation of the intensity of the inflammatory response without excess or deficiency for maintaining the homeostasis of the living body such as biological defense and tissue repair (Non-Patent Document 1).

[0004] In addition, Regnase-1, one of the RNA-degrading enzymes, is known to act as a brake on excessive immune responses by binding to a characteristic stem-loop structure present in the 3′ untranslated region of the mRNA of inflammatory cytokines such as interleukin-6 (IL-6) and interleukin-12p40 (IL-12p40), thereby inducing their degradation. Furthermore, Arid5A, one of the RNA-stabilizing enzymes, recognizes the stem-loop structure of these mRNAs in the same way as Regnase-1, and it is known that the induction of inflammatory responses is appropriately regulated by the mutual antagonism between Regnase-1 and Arid5A within cells (Non-Patent Literature 1).

[0005] Furthermore, post-transcriptional regulation of RNA is comprehensively controlled by various RNA-binding proteins and non-coding RNAs (RNAs that function in the body as RNA without being translated), including small RNA molecules such as microRNAs, as described above. This regulation helps maintain homeostasis in the body by controlling the onset of diseases such as autoimmune diseases, cancer, psoriasis, and viral infections, as well as the differentiation of immune and nerve cells (Non-Patent Literature 1).

[0006] As described above, post-transcriptional regulation within cells is known to be associated with excessive inflammatory responses and the control of cell differentiation. Therefore, research is underway to develop substances that control the activity of post-transcriptional regulation in order to improve autoimmune diseases such as rheumatoid arthritis, psoriasis, and viral diseases. However, there is a need for post-transcriptional regulation regulators that are safer and more suitable for clinical application.

[0007] Giant kelp (scientific name: Macrocystis pyrifera, Japanese name: Ōukimo) is a type of seaweed (brown algae) belonging to the genus Macrocystis in the family Laminariaceae, order Laminariales. To date, extracts of giant kelp have been known to have skin-whitening effects (Patent Document 1), inflammatory cytokine suppression effects (Patent Document 2), and lipase activity suppression effects (Patent Document 3). However, it is not known that extracts of giant kelp have an effect of promoting RNA degradation. [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] Japanese Patent Application Publication No. 2-124810 [Patent Document 2] Special Publication No. 5-502863 [Patent Document 3] Japanese Patent Application Publication No. 9-301821 [Non-patent literature]

[0009] [Non-Patent Document 1] Masanori Yoshinaga, Osamu Takeuchi, Regulation of inflammatory diseases via the control of mRNA decay. Inflammation and Regeneration, 44:14(2024) [Non-Patent Document 2] Brittany L. Snyder, Perry J. Blackshear, Clinical implications of tristetraprolin (TTP) modulation in the treatment of inflammatory diseases. Pharmacology & Therapeutics, 239: 108198. (2022). [Non-Patent Document 3] Peter Rappl et al.,Role of Tristetraprolin in the Resolution of Inflammation, Biology,10(1),66.(2021) [Overview of the project] [Problems that the invention aims to solve]

[0010] The objective of this invention is to provide an RNA degradation accelerator that is highly safe. [Means for solving the problem]

[0011] In other words, the present invention consists of the following (1) to (4). (1) An RNA degradation accelerator characterized by containing an extract of giant kelp. (2) An RNA destabilizing enzyme enhancer characterized by containing an extract of giant kelp. (3) The RNA destabilizing enzyme enhancer according to (2), wherein the RNA destabilizing enzyme is tristetraprolin (TTP). (4) A palliative agent for at least one disease selected from the group consisting of psoriasis, inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, and RNA virus infections, characterized by containing the agent described in any one of (1) to (3). [Modes for carrying out the invention]

[0012] The giant kelp (scientific name: Macrocystis pyrifera, Japanese name: Ooukimo) used in this invention is a seaweed (brown algae) belonging to the genus Macrocystis in the family Laminariaceae, order Laminariales. It is mainly distributed in the northeastern Pacific Ocean from the Alaska Peninsula to the Gulf of California. The thallus is 20-30m in size, and some can reach up to 50m. The stem has a float bladder that stores air, which allows it to float upright in the sea.

[0013] Giant kelp can be obtained from the above-mentioned growing regions. In the present invention, it is preferable to use the entire seaweed (whole alga) as the raw material for extraction, but a part thereof, such as the leaves (thallus / mature leaves), stems (core / midrib), spore-bearing leaves, or roots, may also be used. Furthermore, the seaweed itself may be used for extraction, or it may be subjected to processing such as desalting, drying, crushing, or shredding.

[0014] The solvent extraction method is not particularly limited and can be performed by methods such as heat extraction (e.g., 40-100°C), room temperature extraction (e.g., 15-25°C), low temperature extraction (e.g., 0-15°C), stirring extraction, or column extraction. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are used, and particularly preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are used. These solvents may be used individually or in mixtures of two or more. The most preferred extraction solvents include water, a water-ethanol mixed polar solvent, or a water-1,3-butylene glycol mixed polar solvent. Among these, a solvent containing 20-100% by weight of ethanol or 1,3-butylene glycol is preferred, with 50-100% by weight being the most preferred. Furthermore, a solvent with pH adjusted by adding an acid or alkali to the above extraction solvent can also be used.

[0015] There are no particular limitations on the amount of solvent used; for example, it should be 5 times or more, preferably 10 times or more, relative to the total weight (dry weight) of the giant kelp. However, for convenience in operations such as concentration or isolation after extraction, it is preferable to use 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used and the pressure during extraction.

[0016] The above extract may be used as is, but if necessary, it may be used after treatment such as concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, etc., to the extent that the effects of the present invention are achieved. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, freeze-drying, etc., and used as a dried product.

[0017] The present invention may use the above extract as it is, and within a range that does not impair the effects of the extract, it may contain components such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, ultraviolet absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, acidulants, etc., which are components used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc.

[0018] The RNA degradation promoter in the present invention refers to something that has the effect of activating the RNA degradation mechanism in cells or inhibiting the RNA degradation inhibitory mechanism. Examples of the RNA degradation mechanism include Tristetraprolin (TTP) and AU-rich element binding / degrading factor 1 (AUF1) of RNA destabilizing enzymes, and Regnase-1 of RNA degrading enzymes. Further, examples of the RNA degradation inhibitory mechanism include HuR and Arid5A of RNA stabilizing enzymes.

[0019] Examples of the effect of activating the RNA degradation mechanism include the effect of increasing the gene expression level or protein expression level of TTP, Regnase-1, etc., or enhancing the enzyme activity, and these effects are collectively called enhancement effects. Further, examples of the effect of inhibiting the RNA degradation inhibitory mechanism include the effect of decreasing the gene expression level or protein expression level of HuR, Arid5A, etc., or inhibiting the enzyme activity.

[0020] The present invention can be used in any of cosmetics, quasi-drugs, pharmaceuticals, and foods, and its dosage forms include, for example, lotion, cream, emulsion, gel agent, aerosol agent, essence, pack, cleaning agent, bath agent, foundation, powder, lipstick, ointment, patch, tablet confectionery, chocolate, gum, candy, beverage, powder, granule, tablet, sugar-coated tablet, capsule agent, syrup agent, pill, suspension, liquid agent, emulsion, suppository, injection solution, etc.

[0021] When used externally, the content of the above extract used in the present invention is preferably 0.00001% by weight or more, more preferably 0.00001 - 5% by weight, in terms of solids. Further, 0.00001 - 1% by weight is most preferable. If it is less than 0.00001% by weight, sufficient effects may not be obtained, and if it exceeds 10% by weight, it is difficult to recognize an enhancement of the effect and it is uneconomical.

[0022] When used internally, the intake amount varies depending on age, body weight, symptoms, treatment effect, administration method, treatment time, etc. Usually, as the daily intake amount per adult, 5 mg or more is preferable, 10 mg - 5 g is more preferable, and 20 mg - 2 g is most preferable.

[0023] Next, in order to explain the present invention in detail, production examples, experimental examples and formulation examples of the extract used in the present invention are given as examples, but the present invention is not limited thereto. The % shown in the production examples indicates % by weight, and the parts of the content shown in the formulation examples indicate parts by weight.

Examples

[0024] Production Example of Extract of Giant Kelp The extract of giant kelp was produced as follows. In Production Examples 1 - 4, the whole algae of giant kelp were used as the extraction material.

[0025] (Production Example 1) Preparation of Hot Water Extract of Giant Kelp 200 mL of water was added to 10 g of the dried product of giant kelp, and extraction was carried out at 95 - 100 °C for 2 hours. The obtained extract was filtered, and the filtrate was concentrated and freeze - dried to obtain 0.41 g of the hot water extract of giant kelp.

[0026] (Production Example 2) Preparation of 50% Ethanol Extract of Giant Kelp 10 g of the dried product of giant kelp was immersed in 200 mL of 50% ethanol aqueous solution at room temperature for 7 days for extraction. After the obtained extract was filtered, it was concentrated to dryness with an evaporator to obtain 0.28 g of the 50% ethanol extract of giant kelp.

[0027] (Manufacturing Example 3) Preparation of Ethanol Extract of Giant Kelp 10 g of dried giant kelp was immersed in 200 mL of ethanol at room temperature for 7 days to extract the material. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 0.12 g of ethanol extract of giant kelp.

[0028] (Manufacturing Example 4) Preparation of 1,3-butylene glycol extract of giant kelp 10 g of dried giant kelp was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days to extract the material. The resulting extract was filtered to obtain 189 g of 1,3-butylene glycol extract of giant kelp. [Examples]

[0029] (Example prescription 1) Lotion Formulation Content (per portion) 1. Hot water extract of giant kelp (Production example 1) 0.1 2,1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Components 1-6 and 11 and components 7-10 are uniformly dissolved, mixed together, and filtered to obtain the product.

[0030] (Prescription example 2) Cream Formulation Content (per portion) 1. 50% ethanol extract of giant kelp (production example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-9, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1 and 11-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. Add component 10 at 45°C, and further cool to 30°C to obtain the final product.

[0031] (Prescription example 3) Emulsion Formulation Content (per portion) 1. Ethanol extract of giant kelp (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 1-8, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 10-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. At 45°C, add component 9, and further cool to 30°C to obtain the final product.

[0032] (Prescription example 4) Gel Formulation Content (per portion) 1. 1,3-butylene glycol extract of giant kelp (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5.Fragrance (appropriate amount) 6.1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve components 2-5 and components 1 and 6-11 uniformly, then mix them together to obtain the product.

[0033] (Prescription example 5) Pack Formulation Content (per portion) 1. Hot water extract of giant kelp (Production example 1) 1.0 2. Giant kelp 50% ethanol extract (Production Example 2) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5.1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20 E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-11 uniformly to form the product.

[0034] (Prescription example 6) Foundation Formulation Content (per portion) 1. 50% ethanol extract of giant kelp (production example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20 E.O.) 2.0 5. Cetanol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengara 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-8, maintain at 80°C to form the oil phase. Swell component 9 thoroughly in component 19, then add components 1 and 10-13 and mix uniformly. Add components 14-17, which have been crushed and mixed in a pulverizer, and stir with a homomixer, maintaining at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase while stirring and emulsify. Then, cool, add component 18 at 45°C, and cool to 30°C while stirring to obtain the product.

[0035] (Prescription example 7) Bath additive Formulation Content (per portion) 1. Ethanol extract of giant kelp (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to bring the total volume to 100. [Manufacturing Method] Mix ingredients 1-5 uniformly to form the product.

[0036] (Prescription example 8) Ointment Formulation Content (per portion) 1. Hot water extract of giant kelp (Production example 1) 5.0 2. Ethanol extract of giant kelp (Production Example 3) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 3-6, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1, 2 and 7-9, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool to 30°C while stirring to obtain the final product.

[0037] (Prescription example 9) Powder Formulation Content (per portion) 1. Hot water extract of giant kelp (Production example 1) 1.0 2. Dried corn starch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1-3 and prepare as a powder.

[0038] (Prescription example 10) Tablets Formulation Content (per portion) 1. Ethanol extract of giant kelp (Production Example 3) 5.0 2. Dried corn starch 25.0 3. Carboxymethylcellulose calcium 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Mix ingredients 1-4, then add an aqueous solution of ingredient 5 as a binder and form into granules. Add ingredient 6 to the formed granules and compress into tablets. Each tablet should weigh 0.52g.

[0039] (Prescription example 11) Tablet confectionery Formulation Content (per portion) 1. Ethanol extract of giant kelp (Production Example 3) 2.0 2. Dried cornstarch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing Method] Mix ingredients 1-4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet should weigh 1.0g.

[0040] (Prescription example 12) Beverages Formulation Content (per portion) 1. Hot water extract of giant kelp (Production example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-3 in a small amount of water. Then add ingredients 4 and 5 and mix.

[0041] Next, to explain the effects of the present invention in detail, experimental examples will be given. [Examples]

[0042] Experimental Example 1: Evaluation of the persistence rate of inflammatory cytokines IL1α and IL6 mRNA, whose expression is induced by oxidative stress. <Method> First, 100,000 HaCaT cells, a human epidermal keratinocyte line, were seeded in each well of a 24-well plate. After culturing overnight in DMEM containing 10% FBS, the culture medium in the wells was removed, and DMEM containing 100 μM hydrogen peroxide, 1% FBS, and a 50% ethanol extract of giant kelp as the test substance at final concentrations of 0%, 0.00003%, and 0.0003% was added. The cells were incubated at 37°C under 5% CO2 for 4 hours to induce oxidative stress.

[0043] Next, the culture medium in the wells was removed, and DMEM containing 5 μg / mL of the transcription inhibitor actinomycin D and 1% FBS was added to inhibit the transcription of new RNA within the cells. Cells were harvested 0, 1, and 2 hours after the action of actinomycin D and suspended using RNAiso Plus (Takara Bio). Total RNA was purified according to the product protocol. mRNA expression levels were measured using RT-qPCR based on the total RNA extracted from the cells. High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used for the RT-qPCR method. Specifically, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures followed the prescribed method, and the expression levels of IL1α mRNA and IL6 mRNA were determined as a percentage of the expression level of the internal standard GAPDH mRNA. The mRNA retention rate (%) was determined as the percentage of mRNA expression in actinomycin-free cells. The primers used to measure the expression levels of each gene are as follows:

[0044] Primer for IL1α ATTGTATGTGACTGCCCAAGATGA (Sequence ID 1) TGGGTATCTCAGGCATCTCCTT (Sequence 2) Primer for IL6 ATGGCTGAAAAAGATGGATGCT (Sequence No. 3) GCTCTGGCTTGTTCCTCACTACTC (Sequence ID 4) Primer for GAPDH TGCACCACCAACTGCTTAGC (Sequence ID 5) TCTTCTGGGTGGCAGTGATG (Sequence No. 6)

[0045] The results obtained are shown in Tables 1 and 2. The remaining rates of IL1α mRNA and IL6 mRNA decreased in a concentration-dependent manner with giant kelp extract. Therefore, giant kelp extract promoted the degradation of IL1α mRNA and IL6 mRNA in a concentration-dependent manner.

[0046] [Table 1]

[0047] [Table 2]

[0048] From the above results, it has become clear that the giant kelp extract of the present invention has the effect of promoting the degradation of intracellular RNA. Therefore, it can be expected that applying the intracellular RNA degradation promoter of the present invention to autoimmune diseases such as rheumatoid arthritis, psoriasis, viral diseases, etc., will yield significant improvement effects.

[0049] Experimental Example 2: Giant kelp extract promotes the induction of TTP mRNA expression, an RNA destabilizing enzyme. <Method> In the aforementioned experiment, cells were collected before treatment with actinomycin D, suspended using RNAiso Plus (Takara Bio Inc.), and total RNA was purified according to the product protocol. Based on the total RNA extracted from the cells, TTP mRNA expression levels were measured by RT-qPCR. TTP mRNA expression levels were determined as a percentage of the expression level of the internal standard GAPDH mRNA, and then as a percentage of the mRNA expression level in cells unaffected by giant kelp extract. The primers used to measure TTP gene expression levels are as follows. For measuring GAPDH mRNA expression levels, the primers shown in SEQ ID NOs. 5 and 6 of the previous section were used.

[0050] Primer for TTP GACTGCCATCTACGAGAGC (Sequence ID 7) AGTCGGAGGGGCTCAGG (Sequence 8)

[0051] The results obtained are shown in Table 3. The increase in TTP mRNA expression levels after exposure to giant kelp extract revealed that giant kelp extract has an effect of promoting the induction of RNA destabilizing enzymes.

[0052] [Table 3] [Industrial applicability]

[0053] The giant kelp extract of the present invention had the effect of promoting the degradation of intracellular RNA. Therefore, the intracellular RNA degradation promoter of the present invention is expected to be applied to foods, cosmetics, quasi-drugs, and pharmaceuticals as a remedy for at least one disease selected from the group consisting of psoriasis, inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, and RNA virus infections.

Claims

1. An RNA degradation accelerator characterized by containing an extract of giant kelp.

2. An RNA destabilizing enzyme enhancer characterized by containing giant kelp extract.

3. The RNA destabilizing enzyme enhancer according to claim 2, wherein the RNA destabilizing enzyme is tristetraprolin (TTP).

4. A palliative agent for at least one disease selected from the group consisting of psoriasis, inflammatory diseases, autoimmune diseases, allergic diseases, fibrotic diseases, and RNA virus infections, characterized by containing the agent described in any one of claims 1 to 3.