Synthetic expression system

A synthetic expression system for methylotrophic yeast cells addresses methanol dependence by using non-native transcription factors and tunable promoters, achieving high-yield protein production without methanol, suitable for large-scale industrial applications.

JP2026108773APending Publication Date: 2026-06-30GINKGO BIOWORKS INC

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
GINKGO BIOWORKS INC
Filing Date
2026-03-25
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Methylotrophic yeast cells, such as Pichia pastoris, rely on methanol-regulated promoters like P(AOX1) for protein production, which limits their use in large-scale industrial applications due to the toxicity and flammability of methanol.

Method used

Development of a synthetic expression system with a first transcription unit encoding a non-native DNA-binding domain and transcription-activating domain, and a second transcription unit with a synthetic output promoter, allowing gene expression independent of methanol, driven by tunable input promoters responsive to nutrient conditions.

Benefits of technology

Enhances protein production yield by 200% to 10,000% compared to control host cells, enabling safe and efficient large-scale production without methanol.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026108773000113
    Figure 2026108773000113
  • Figure 2026108773000114
    Figure 2026108773000114
  • Figure 2026108773000115
    Figure 2026108773000115
Patent Text Reader

Abstract

The present invention provides transcription units, a synthetic expression system, and a host cell containing the transcription units and the synthetic expression system, the synthetic expression system being capable of expressing the target gene. [Solution] Methods for producing biological products (including, but not limited to, proteins or RNA expressed from a gene of interest) are also described. In some embodiments, the biological product is produced from host cells under culture conditions without the addition of methanol. A solution is needed that can match or exceed the production capacity of existing methanol-dependent expression systems on an industrial scale. This disclosure describes transcription units and synthetic expression systems, host cells comprising transcription units and synthetic expression systems, and methods for promoting high-yield synthesis of proteins and molecules, including under methanol-independent conditions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - References to Related Applications This application claims the priority of U.S. Provisional Application No. 63 / 075,134, filed on September 5, 2020, the entire content of which is incorporated herein by reference. Sequence Listing

[0002] In accordance with 37 CFR 1.52(e)(5), this specification refers to a sequence listing (submitted electronically as a.txt file named "G091970067WO00 - SEQ"). The.txt file was generated on August 26, 2021, and has a size of 401,042 bytes. The sequence listing is incorporated herein by reference in its entirety.

[0003] Field of the Invention The present disclosure relates to synthetic expression systems comprising transcription units, host cells comprising the synthetic expression systems, and methods for the methanol - independent bioproduction of proteins and other desired molecules.

Background Art

[0004] Background Certain methylotrophic yeast cells have been used for the production of biological products (e.g., proteins, nucleic acids, small molecules, etc.) due in part to the strong and regulatable characteristics of their native promoter systems. For example, many recombinant proteins have been successfully produced in the methylotrophic yeast Pichia pastoris, typically driven by the endogenous methanol - regulated AOX1 promoter, P(AOX1). The P(AOX1) - based production system is well - characterized, optimized, robust, and has a long history of industrial use. However, the methanol - dependence of P(AOX1) limits the use of the P. pastoris expression system to restrictive process conditions. This is a particularly serious problem in large - scale production environments because methanol is a highly dangerous, undesirable, and extremely toxic flammable compound on a large scale.

Summary of the Invention

[0005] overview A solution is needed that can match or exceed the production capacity of existing methanol-dependent expression systems on an industrial scale. This disclosure describes transcription units and synthetic expression systems, host cells comprising transcription units and synthetic expression systems, and methods for promoting high-yield synthesis of proteins and molecules, including under methanol-independent conditions.

[0006] Aspects of the present disclosure relate to a methylotropic host cell including a synthetic expression system, the synthetic expression system comprising: (1) a first transcription unit comprising a polynucleotide encoding at least one component of a synthetic transcription factor, which comprises a DNA-binding domain (DBD) and a transcription-activating domain (TAD), wherein the DBD and TAD are not native to the methylotropic host cell; and (2) a second transcription unit comprising a synthetic output promoter operably linked to the gene of interest, wherein the synthetic transcription factor is an activator of the synthetic output promoter, and the gene of interest is expressed in the absence of exogenously provided methanol. In some embodiments, the input promoter drives the expression of at least one component of the synthetic transcription factor.

[0007] In some embodiments, the polynucleotide of the first transcription unit encodes all components of the transcription factor.

[0008] In some embodiments, the input promoter is naturally occurring. In some embodiments, the input promoter has at least 90% sequence identity with a naturally occurring promoter. In some embodiments, the input promoter is synthetic. In some embodiments, the input promoter is a constitutive input promoter.

[0009] In some embodiments, the input promoter is a tunable input promoter. In some embodiments, the tunable input promoter is inductive. In some embodiments, the tunable input promoter is repressive. In some embodiments, the tunable input promoter responds to the addition, restriction, or depletion of nutrients related to the culture process of the gene. In some embodiments, the tunable input promoter responds to thiamine depletion. In some embodiments, the tunable input promoter responds to glycerol restriction. In some embodiments, the tunable input promoter responds to monosaccharide restriction. In some embodiments, the tunable input promoter responds to the restriction of carbon sources, sugars, starch, galactose, maltose, glucose, sorbitol, inositol, glycerol, vitamins, steroids, nitrogen sources, nitrate, nitrite, ammonium, amino acids, methionine, heavy metals, copper, benzoic acid, hydrogen peroxide, calcium-containing compounds, and / or phosphate. In some embodiments, the tunable input promoter responds to the absence of exogenously provided methanol. In some embodiments, the tunable input promoter responds to the restriction or depletion of any combination of two or more nutrients. In some embodiments, the activity of the tunable input promoter is increased by the presence of exogenously supplied formic acid. In some embodiments, the tunable input promoter is tunable in the absence of exogenously supplied methanol. In some embodiments, the input promoter is not methanol-inducible.

[0010] In some embodiments, the upstream activating sequence (UAS) and / or core promoter element of the input promoter are not native to methylotropic host cells.

[0011] In some embodiments, the input promoter is P(JEN1), P(GQ6704499), P(GQ6700926), P(HGT1), P(FDH1), P(AOX2), P(RGI2), P(THI13)_short, P(THI13)_long, or P(THI4). In some embodiments, the input promoter is P(JEN1). In some embodiments, the input promoter is P(GQ6704499). In some embodiments, the input promoter is P(GQ6700926). In some embodiments, the input promoter is P(HGT1). In some embodiments, the input promoter is P(FDH1). In some embodiments, the input promoter is P(AOX2). In some embodiments, the input promoter is P(RGI2). In some embodiments, the input promoter is P(THI13)_short. In some embodiments, the input promoter is P(THI13)_long. In some embodiments, the input promoter is P(THI4).

[0012] In some embodiments, the input promoter is a polynucleotide having at least 90%, at least 95%, or at least 99% identity with any one of the nucleic acid sequences of SEQ ID NOs. 16-25.

[0013] In some embodiments, the DNA-binding domain (DBD) of the synthetic transcription factor is Bm3R1, TetR, PhlF_AM, or VanR_AM.

[0014] In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is B112_TAD, B42_TAD, GAL4_TAD, miniVPR_TAD, Mxr1_TAD, PH_TAD, VP16_TAD, VP64_TAD, VP64v2_TAD, VPH_TAD, or VPR_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is B112_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is B42_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is GAL4_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is miniVPR_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is Mxr1_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is PH_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is VP16_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is VP64_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is VP64v2_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is VPH_TAD. In some embodiments, the transcriptional activation domain (TAD) of the synthetic transcription factor is VPR_TAD.

[0015] In some embodiments, the DNA-binding domain (DBD) of the synthetic transcription factor is Bm3R1, TetR, PhlF_AM, or VanR_AM, and the transcriptional activation domain (TAD) of the synthetic transcription factor is B112_TAD, B42_TAD, GAL4_TAD, miniVPR_TAD, Mxr1_TAD, PH_TAD, VP16_TAD, VP64_TAD, VP64v2_TAD, VPH_TAD, or VPR_TAD.

[0016] In some embodiments, the synthetic transcription factor is not an activator of the input promoter.

[0017] In some embodiments, the synthetic transcription factor is a one-component synthetic transcription factor. In some embodiments, the synthetic transcription factor is a two-component synthetic transcription factor. In some embodiments, the synthetic transcription factor is a multi-component synthetic transcription factor.

[0018] In some embodiments, the synthetic transcription factor includes a nuclear localization signal. In some embodiments, the nuclear localization signal is the SV40 nuclear localization signal.

[0019] In some embodiments, the synthetic transcription factor includes a linker.

[0020] In some embodiments, a two-component or multi-component synthetic transcription factor comprises a bioconjugate protein product moiety 1 (BPP1) and a bioconjugate protein moiety 2 (BPP2). In some embodiments, BPP1 is SpyTag002 and BPP2 is SpyCatcher002.

[0021] In some embodiments, the synthetic transcription factor includes a self-cleaving polypeptide. In some embodiments, the self-cleaving polypeptide is a 2A peptide. In some embodiments, the self-cleaving polypeptide is ERBV_1_P2A.

[0022] In some embodiments, the synthetic transcription factor includes an oligomerization domain. In some embodiments, the oligomerization domain is a Linker-only-for-oligomerization domain; a trimerization domain; or a heptamerization domain.

[0023] In some embodiments, the first transcription unit comprises or consists of a polynucleotide having any one of the nucleic acid sequences of SEQ ID NOs: 26-40 or 182-185. In some embodiments, the synthetic transcription factor comprises or consists of a polypeptide having any one of the amino acid sequences of SEQ ID NOs: 41-55, or is encoded by a polynucleotide having any one of the nucleic acid sequences of SEQ ID NOs: 182-185.

[0024] In some embodiments, the synthetic output promoter is not methanol-inducible.

[0025] In some embodiments, the synthetic output promoter comprises an upstream activation sequence and a core promoter element. In some embodiments, the upstream activation sequence (UAS) of the synthetic output promoter is not native to the methylotrophic host cell.

[0026] In some embodiments, the core promoter element of the synthetic output promoter has a nucleic acid sequence with a length of 300 base pairs or less. In some embodiments, the core promoter element of the synthetic output promoter has a nucleic acid sequence with a length of about 6 base pairs to about 300 base pairs, about 25 base pairs to about 250 base pairs, about 75 to about 225 base pairs, or about 100 base pairs to about 175 base pairs. In some embodiments, the distance between the 3' end of the upstream activation sequence (UAS) and the 5' end of the core promoter element of the synthetic output promoter is 0 to 200 base pairs in length. In some embodiments, the distance between the 3' end of the upstream activation sequence (UAS) and the 5' end of the core promoter element of the synthetic output promoter has a nucleic acid sequence with a length of about 6 base pairs to about 200 base pairs, about 6 base pairs to about 53 base pairs, about 20 base pairs to about 150 base pairs, about 50 base pairs to about 125 base pairs, or about 50 base pairs to about 100 base pairs.

[0027] In some embodiments, the core promoter element of the synthetic output promoter comprises a core promoter sequence that is at least 90%, at least 95%, or 100% identical to a naturally occurring core promoter sequence. In some embodiments, the core promoter element of the synthetic output promoter comprises a core promoter sequence that is at least 90%, at least 95%, or 100% identical to a core promoter sequence derived from P(AOX1) (SEQ ID NO: 162), P(DAS2) (SEQ ID NO: 163), P(HHF2) (SEQ ID NO: 164), or P(PMP20) (SEQ ID NO: 165). In some embodiments, the core promoter element of the synthetic output promoter comprises a core promoter sequence that is at least 90%, at least 95%, or 100% identical to a core promoter sequence derived from P(AOX1). In some embodiments, the core promoter element of the synthetic output promoter comprises a core promoter sequence that is at least 90%, at least 95%, or 100% identical to a core promoter sequence derived from P(DAS2). In some embodiments, the core promoter element of the synthetic output promoter comprises a core promoter sequence that is at least 90%, at least 95%, or 100% identical to a core promoter sequence derived from P(HHF2). In some embodiments, the core promoter element of the synthetic output promoter comprises a core promoter sequence that is at least 90%, at least 95%, or 100% identical to a core promoter sequence derived from P(PMP20).

[0028] In some embodiments, the upstream activation sequence (UAS) of the synthetic output promoter comprises bmO, tetO, phlO, or vanO. In some embodiments, the upstream activation sequence (UAS) of the synthetic output promoter comprises bmO. In some embodiments, the upstream activation sequence (UAS) of the synthetic output promoter comprises tetO. In some embodiments, the upstream activation sequence (UAS) of the synthetic output promoter comprises phlO. In some embodiments, the upstream activation sequence (UAS) of the synthetic output promoter comprises vanO.

[0029] In some embodiments, the synthetic output promoter further comprises one or more operators. In some embodiments, one or more operators of the synthetic output promoter are not native to methylotropic host cells.

[0030] In some embodiments, the synthetic transcription factor includes a DNA-binding domain (DBD) Bm3R1, and the upstream activation sequence (UAS) of the synthetic output promoter includes one or more copies of bmO. In some embodiments, the synthetic transcription factor includes a DNA-binding domain (DBD) PhlF_AM, and the upstream activation sequence (UAS) of the synthetic output promoter includes one or more copies of phlO. In some embodiments, the synthetic transcription factor includes a DNA-binding domain (DBD) TetR, and the upstream activation sequence (UAS) of the synthetic output promoter includes one or more copies of tetO. In some embodiments, the synthetic transcription factor includes a DNA-binding domain (DBD) VanR_AM, and the upstream activation sequence (UAS) of the synthetic output promoter includes one or more copies of vanO.

[0031] In some embodiments, the synthetic output promoter comprises or consists of a polynucleotide having one nucleic acid sequence of sequence numbers 56-70 or 186-193.

[0032] In some embodiments, the gene of interest is expressed as RNA. In some embodiments, the gene of interest encodes a protein. In some embodiments, the gene of interest encodes an enzyme, structural protein, signaling protein, regulatory protein, transport protein, sensory protein, motor protein, defense protein, or storage protein. In some embodiments, the protein synthesizes, modifies, or transforms a molecule. In some embodiments, the molecule is heme or an intermediate in the heme biosynthesis pathway. In some embodiments, the protein is a heme-binding protein. In some embodiments, the heme-binding protein is hemoglobin, neuroglobin, cytoglobin, leghemoglobin, or myoglobin. In some embodiments, the protein is vaccinia captase, T7 polymerase, or O-methyltransferase. In some embodiments, the protein is an enzyme in the heme biosynthesis pathway. In some embodiments, the enzyme in the heme biosynthesis pathway is cytochrome P450, 9-adenylate cyclase, soluble guanylate cyclase, peroxidase, catalase, and / or cytochrome oxidase.

[0033] In some embodiments, the methylotropic host cell further comprises a polynucleotide encoding a secretory tag in a second transcription unit. In some embodiments, the secretory tag is an α-amylase secretory tag, an Sc Mf α1 secretory tag, or a pre-inulinase secretory tag. In some embodiments, the second transcription unit comprises a secretory tag, the gene of interest encodes a protein, and the protein is secreted from the methylotropic host cell. In some embodiments, the secretory protein is α-amylase, β-lactoglobulin, or ovalbumin.

[0034] In some embodiments, the first and / or second transcription unit further comprises a transcription terminator. In some embodiments, the transcription terminator of the first and / or second transcription unit is naturally occurring. In some embodiments, the transcription terminator of the first and / or second transcription unit is synthetic. In some embodiments, the transcription terminator of the first and / or second transcription unit is derived from a gene encoding a ribosomal protein. In some embodiments, the gene encodes a ribosomal protein S2 (RPS2).

[0035] In some embodiments, the transcription terminator comprises or consists of a polynucleotide having either the nucleic acid sequence of SEQ ID NO: 146 or 147.

[0036] In some embodiments, the first and second transcription units are separated by a spacer.

[0037] In some embodiments, the first transcription unit and / or the second transcription unit are present in multiple copies in the methylotropic host cell. In some embodiments, the copy number ratio of the second transcription unit to the first transcription unit is 1:1. In some embodiments, the copy number ratio of the second transcription unit to the first transcription unit is at least 2:1, at least 4:1, or at least 10:1. In some embodiments, the copy number ratio of the first transcription unit to the second transcription unit is at least 2:1, at least 4:1, or at least 10:1.

[0038] In some embodiments, the first transcription unit exists as a single copy, and the second transcription unit exists as multiple copies. In some embodiments, at least two of the multiple second transcription units contain genes of different purposes. In some embodiments, the synthetic transcription factor of the first transcription unit is an activator of the synthetic output promoter of each of the multiple second transcription units.

[0039] In some embodiments, the synthetic expression system includes one or more sequences that are endogenous to methylotropic host cells.

[0040] In some embodiments, the first and second transcription units are located on a single plasmid. In some embodiments, the first and second transcription units are located on different plasmids. In some embodiments, the first and / or second transcription units are integrated into the genome of a methylotropic host cell. In some embodiments, the first and second transcription units are located on the same chromosome within the genome of a methylotropic host cell. In some embodiments, the first and second transcription units are oriented in the same direction. In some embodiments, the first and second transcription units are oriented in different directions. In some embodiments, the first and second transcription units are located on different chromosomes within the genome of a methylotropic host cell.

[0041] In some embodiments, the methylotropic host cell is a methylotropic yeast cell. In some embodiments, the methylotropic host cell is derived from a genus selected from Pichia, Komagataella, Hansenula, or Candida. In some embodiments, the methylotropic host cell is Pichia pastoris, Pichia pseudopastoris, Komagataella phaffii, Pichia stipitis, Pichia membranifaciens, Komagataella pseudopastoris, Komagataella pastoris, Komagataella kurtzmanii, Komagataella mondaviorum, Hansenula polymorpha, Candida boidinii, or Pichia methanolica. In some embodiments, the methylotropic host cell is Pichia pastoris.

[0042] In some embodiments, the synthetic expression system provides production of the biological product encoded by the gene of interest at a higher level than that produced in control host cells (i.e., host cells that do not contain the same synthetic expression system). In some embodiments, the control host cells are cells of the same species as the methylotropic host cells. In some embodiments, the control host cells are P. pastoris. In some embodiments, the control host cells have a native input promoter. In some embodiments, the control host cells have a methanol-inducible promoter operably linked to the gene of interest. In some embodiments, the methanol-inducible promoter of the control host cells is P(AOX1) of P. pastoris. In some embodiments, the control host cells are cultured in the presence of exogenously added methanol. In some embodiments, the gene of interest encoded by the control host cells is the same gene of interest encoded by the methylotropic host cells containing the synthetic expression system.

[0043] In some embodiments, methylotropic host cells are cultured under conditions including a proliferative phase and a production phase. In some embodiments, the amount of transcript of the gene of interest produced in the methylotropic host cells during the production phase is at least 100% higher than the amount of transcript of the gene of interest produced in the methylotropic host cells during the proliferative phase. In some embodiments, the amount of transcript of the gene of interest produced in the methylotropic host cells during the production phase is at least 200%, at least 300%, at least 400%, or at least 500% higher than the amount of transcript of the gene of interest produced in the methylotropic host cells during the proliferative phase.

[0044] In some embodiments, the synthetic expression system provides production of the biological product encoded by the gene of interest at a level at least 200% higher than the level of the biological product produced in control host cells. In some embodiments, the synthetic expression system provides production of the biological product encoded by the gene of interest at a level at least 600%, at least 900%, at least 1200%, at least 1500%, at least 1800%, at least 2100%, at least 2400%, at least 2700%, at least 3000%, at least 5000%, or at least 10,000% higher than the level of the biological product produced in control host cells. In some embodiments, the synthetic expression system provides production of the biological product encoded by the gene of interest at a level greater than 10,000% higher than the level of the biological product produced in control host cells. In some embodiments, the synthetic expression system provides production of the biological product encoded by the gene of interest at levels approximately 300% to 600%, 500% to 1000%, 800% to 1500%, 1000% to 2000%, 1200% to 2000%, 1800% to 2500%, 2000% to 2500%, 2200% to 3000%, 3000% to 5000%, or 5000% to 10,000% higher than the level of the biological product produced in control host cells.

[0045] Some aspects of the present invention describe methods for manipulating host cells for protein expression, which include transforming host cells with a synthetic expression system according to any embodiment of the present disclosure.

[0046] In other embodiments, a method for expressing a gene of interest is contemplated, comprising culturing a methylotropic host cell containing the synthetic expression system, transcription unit or components thereof described herein. In some embodiments, the gene of interest encodes a heme-binding protein or one or more enzymes of the heme biosynthesis pathway. In some embodiments, the heme-binding protein is hemoglobin, myoglobin, neuroglobin, cytoglobin, or leghemoglobin. In some embodiments, the heme-binding protein is myoglobin. In some embodiments, one or more enzymes of the heme biosynthesis pathway are cytochrome P450, 9-adenylate cyclase, soluble guanylate cyclase, peroxidase, catalase, and / or cytochrome oxidase. In some embodiments, the gene of interest encodes a vaccinia-capturing enzyme, a T7 polymerase enzyme, or an O-methyltransferase enzyme.

[0047] Specific aspects of the present invention describe a method for producing a molecule of interest, comprising culturing a methylotropic host cell containing a synthetic expression system, transcription units or components thereof, as described herein, and obtaining the molecule of interest from biomass or culture. In some embodiments, the molecule of interest is extracted from biomass. In some embodiments, the molecule is recovered from culture, culture medium, cell-free used culture medium, and / or cell-containing culture medium. In some embodiments where the gene of interest encodes an enzyme, the method comprises (1) purifying the enzyme encoded by the gene of interest; and (2) using the purified enzyme for the bioconversion of a substrate into the molecule of interest. In some embodiments, the molecule of interest is heme.

[0048] In other embodiments, a method for expressing a gene of interest or producing a molecule of interest is envisioned, comprising the steps of (a) culturing host cells in a suitable medium for a period of time that allows for cell proliferation, according to the method of the present disclosure, and (b) modifying culture conditions 1 or more to promote the expression of the gene of interest or the production of the molecule of interest.

[0049] In some embodiments, changing one or more culture conditions includes changing the composition of the culture medium. In some embodiments, step (b) includes restricting, adding, and / or depleting nutrients. In some embodiments, step (b) includes thiamine depletion. In some embodiments, step (b) includes glycerol restriction. In some embodiments, step (b) includes monosaccharide restriction. In some embodiments, step (b) includes formic acid addition. In some embodiments, step (b) includes restriction of any carbon source, sugar, starch, galactose, maltose, glucose, sorbitol, inositol, glycerol, vitamins, steroids, nitrogen source, nitrate, nitrite, ammonium, amino acids, methionine, heavy metals, copper, benzoic acid, hydrogen peroxide, calcium-containing compounds, and / or phosphate. In some embodiments, step (b) includes restriction of any combination of two nutrients. In some embodiments, step (b) includes glucose restriction and thiamine depletion.

[0050] In some embodiments, the synthetic expression system comprises or consists of a polynucleotide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of SEQ ID NOs: 1 to 15. In some embodiments, the synthetic expression system comprises or consists of an input promoter comprising a polynucleotide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of SEQ ID NOs: 16 to 25. In some embodiments, the synthetic expression system comprises or consists of a polynucleotide encoding at least one component of a synthetic transcription factor. In some embodiments, the polynucleotide comprises or consists of a polynucleotide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of SEQ ID NOs: 26 to 40 or 182 to 185. In some embodiments, the encoded synthetic transcription factor comprises or consists of a polypeptide having at least 90%, at least 95%, or at least 99% identity to any one amino acid sequence of SEQ ID NOs: 41 to 55. In some embodiments, the synthetic expression system includes or comprises a synthetic output promoter containing a polynucleotide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of sequence numbers 56-70 or 186-193.

[0051] In some embodiments, the synthetic expression system comprises or consists of a polynucleotide having at least 90%, at least 95%, or at least 99% identity with any one of the nucleic acid sequences of SEQ ID NOs. 16 to 25.

[0052] In some embodiments, the synthetic expression system comprises or consists of polynucleotides having at least 90%, at least 95%, or at least 99% identity with any one nucleic acid sequence of sequence numbers 56-70 or 186-193.

[0053] In some embodiments, the synthetic expression system comprises or comprises a synthetic transcription factor encoded by a polynucleotide having at least 90%, at least 95%, or at least 99% identity with any one nucleic acid sequence of sequence numbers 26-40 or 182-185.

[0054] In some embodiments, the synthetic expression system encodes or includes a synthetic transcription factor comprising or consisting of a polypeptide having at least 90%, at least 95%, or at least 99% identity with any one of the amino acid sequences of SEQ ID NOs. 41 to 55.

[0055] Some aspects of the present invention describe a synthetic expression system comprising: (1) a first transcription unit comprising a polynucleotide encoding one or more components of a transcription factor; and (2) a second transcription unit comprising a synthetic output promoter. In some embodiments, the transcription factor is an activator of the synthetic output promoter.

[0056] In some embodiments, the synthetic expression system is for use in methylotropic host cells, such as methylotropic yeast. In some embodiments, the synthetic expression system is expressed in methylotropic host cells. In some embodiments, the synthetic expression system is expressed in methylotropic yeast. In some embodiments, the synthetic expression system is used or expressed in methylotropic host cells. In some embodiments, the methylotropic host cells are yeast cells of the genus Pichia or Komagataella. In some embodiments, the synthetic expression system is a methanol-independent expression system for use or expression in methylotropic host cells. In some embodiments, the synthetic expression system is a methanol-independent expression system for use or expression in methylotropic yeast. In some embodiments, the yeast is of the genus Pichia or Komagataella.

[0057] Some aspects of the present invention describe a synthetic expression system comprising: (1) a first transcription unit comprising a polynucleotide encoding at least one component of a transcription factor; and (2) a second transcription unit comprising a synthetic output promoter. In some embodiments, the transcription factor is an activator of the synthetic output promoter.

[0058] Some aspects of the present invention describe methanol-independent synthetic expression systems, including: (1) a first transcription unit comprising a polynucleotide encoding one or more components of a transcription factor, and (2) a second transcription unit comprising a synthetic output promoter. In some embodiments, the transcription factor is an activator of the synthetic output promoter.

[0059] Some embodiments of the present invention describe a synthetic methanol-independent expression system comprising: (1) a first transcription unit comprising a polynucleotide encoding one or more components of a transcription factor; and (2) a second transcription unit comprising a synthetic output promoter. In some embodiments, the transcription factor is an activator of the synthetic output promoter. In some embodiments, the synthetic methanol-independent expression system is expressed in host cells of the genus Pichia or Komagataella.

[0060] Each feature of the present invention may be encompassed in various embodiments of the present invention. Each feature of the present invention, including any one element or combination of elements, may be included in each embodiment of the present invention. In its application, the present invention is not limited to the structural and arrangement details of the components described below or shown in the drawings. Other embodiments of the present invention are possible and can be implemented or performed in various ways. In embodiments of the present invention, for example, the following items are provided. (Item 1) A methylotropic host cell comprising a synthetic expression system, wherein the synthetic expression system is (a)(i) an input promoter comprising an upstream activation sequence (UAS) and a core promoter element, and (ii) a polynucleotide encoding at least one component of a synthetic transcription factor The synthetic transcription factor comprises a DNA-binding domain (DBD) and a transcription-activating domain (TAD), wherein the DBD and the TAD are not native to the methylotropic host cell, and are polynucleotides. A first transcription unit comprising the input promoter which drives the expression of at least one component of the synthetic transcription factor, (b) A second transcription unit comprising a synthetic output promoter operably linked to the gene of interest, wherein the synthetic transcription factor is an activator of the synthetic output promoter, Includes, The aforementioned target gene is expressed in a methylotropic host cell in the absence of exogenously supplied methanol. (Item 2) The methylotropic host cell according to item 1, wherein the polynucleotide of the first transcription unit encodes all components of the synthetic transcription factor. (Item 3) A methylotropic host cell as described in item 1, wherein the input promoter is synthetic. (Item 4) The methylotropic host cell described in item 3, wherein the input promoter has at least 90% sequence identity with a naturally occurring promoter. (Item 5) A methylotropic host cell as described in item 1, in which the aforementioned input promoter is naturally present. (Item 6) A methylotropic host cell as described in item 1, wherein the input promoter is natural to the cell. (Item 7) The methylotropic host cell described in item 1, wherein the input promoter is a regulatory input promoter. (Item 8) A methylotropic host cell as described in item 7, wherein the aforementioned adjustable input promoter is inducible. (Item 9) A methylotropic host cell as described in item 7, wherein the adjustable input promoter is repressive. (Item 10) The methylotropic host cell described in item 7, wherein the adjustable input promoter responds to the addition, restriction, or depletion of nutrients related to the culture process of the genus. (Item 11) The methylotropic promoter described in item 10 responds to thiamine depletion, glycerol restriction, monosaccharide restriction, or restriction of carbon sources, sugars, starch, galactose, maltose, glucose, sorbitol, inositol, glycerol, vitamins, steroids, nitrogen sources, nitrates, nitrites, ammonium, amino acids, methionine, heavy metals, copper, benzoic acid, hydrogen peroxide, calcium-containing compounds and / or phosphates, as described above. Principal cell. (Item 12) The methylotropic host cell according to item 10, wherein the adjustable input promoter responds to restriction or depletion of any combination of two or more nutrients. (Item 13) The activity of the aforementioned adjustable input promoter is affected by the presence of exogenously supplied formic acid. The methylotropic host cells described in item 10 increase. (Item 14) The methylotropic host cell according to item 7, wherein the tunable input promoter is tunable in the absence of exogenously provided methanol. (Item 15) A methylotropic host cell as described in item 1, wherein the input promoter is not methanol-inducible. (Item 16) The methylotropic host cell described in item 1, wherein the input promoter is a constitutive input promoter. (Item 17) The methylotropic host cell described in item 1, wherein the upstream activating sequence (UAS) and / or the core promoter element of the input promoter are not native to the methylotropic host cell. (Item 18) A methylotropic host cell as described in item 1, wherein the input promoter is P(JEN1), P(GQ6704499), P(GQ6700926), P(HGT1), P(FDH1), P(AOX2), P(RGI2), P(THI13)_short, P(THI13)_long, or P(THI4). (Item 19) The methylotropic host cell according to item 1, wherein the input promoter is a polynucleotide having at least 90%, at least 95%, or at least 99% identity with any one of the nucleic acid sequences of sequence numbers 16 to 25. (Item 20) The methylotropic host cell according to item 1, wherein the input promoter is a polynucleotide having one nucleic acid sequence from sequence numbers 16 to 25. (Item 21) The methylotropic host cell described in item 1, wherein the DNA-binding domain (DBD) of the synthetic transcription factor is Bm3R1, TetR, PhlF_AM, or VanR_AM. (Item 22) The methylotropic host cell described in item 1, wherein the transcriptional activation domain (TAD) of the synthetic transcription factor is B112_TAD, B42_TAD, GAL4_TAD, miniVPR_TAD, Mxr1_TAD, PH_TAD, VP16_TAD, VP64_TAD, VP64v2_TAD, VPH_TAD, or VPR_TAD. (Item 23) The methylotropic host cell described in item 1, wherein the DNA-binding domain (DBD) of the synthetic transcription factor is Bm3R1, TetR, PhlF_AM, or VanR_AM, and the transcriptional activation domain (TAD) of the synthetic transcription factor is B112_TAD, B42_TAD, GAL4_TAD, miniVPR_TAD, Mxr1_TAD, PH_TAD, VP16_TAD, VP64_TAD, VP64v2_TAD, VPH_TAD, or VPR_TAD. (Item 24) The synthetic transcription factor is not an activator of the input promoter, as described in item 1. A methylotropic host cell. (Item 25) The methylotropic host cell described in item 1, wherein the synthetic transcription factor is a one-component synthetic transcription factor. (Item 26) The methylotropic host cell described in item 1, wherein the synthetic transcription factor is a two-component or multi-component synthetic transcription factor. (Item 27) The methylotropic host cell according to item 26, wherein the two-component or multi-component synthetic transcription factor comprises at least two bioconjugate protein products. (Item 28) A methylotropic host cell as described in item 27, wherein the first bioconjugate protein product (BPP1) is SpyTag002 and the second bioconjugate protein product (BPP2) is SpyCatcher002. (Item 29) The methylotropic host cell described in item 1, wherein the synthetic transcription factor contains a nuclear localization signal (NLS). (Item 30) The methylotropic host cell described in item 29, wherein the nuclear localization signal is the SV40 nuclear localization signal. (Item 31) The methylotropic host cell described in item 1, wherein the synthetic transcription factor contains a linker. (Item 32) The methylotropic host cell described in item 1, wherein the synthetic transcription factor contains a self-cleaving polypeptide. (Item 33) The methylotropic host cell described in item 32, wherein the self-cleaving polypeptide is a 2A peptide. (Item 34) The methylotropic host cell described in item 32, wherein the self-cleaving polypeptide is ERBV_1_P2A. (Item 35) The methylotropic host cell described in item 1, wherein the synthetic transcription factor contains an oligomeric domain. (Item 36) A methylotropic host cell as described in item 35, wherein the oligomerization domain is linker_only_for_oligomerization, trimerization_domain, or heptamerization_domain. (Item 37) The methylotropic host cell according to item 1, wherein the synthetic transcription factor comprises a polypeptide having one of the amino acid sequences of sequence numbers 41 to 55. (Item 38) The methylotropic host cell according to item 1, wherein the first transcription unit comprises a polynucleotide having one nucleic acid sequence of sequence numbers 26-40 or 182-185. (Item 39) A methanolotropic host cell as described in item 1, wherein the aforementioned synthetic output promoter is not methanol-inducible. (Item 40) The methylotropic host cell described in item 1, wherein the synthetic output promoter comprises an upstream activation sequence (UAS) and a core promoter element. (Item 41) The methylotropic host cell described in item 40, wherein the upstream activating sequence (UAS) of the synthetic output promoter is not native to the methylotropic host cell. (Item 42) The methylotropic host cell according to item 40, wherein the core promoter element of the synthetic output promoter has a nucleic acid sequence of 300 base pairs or less in length. (Item 43) The methylotropic host cell according to item 40, wherein the core promoter element of the synthetic output promoter has a nucleic acid sequence having a length of approximately 6 to 300 base pairs, approximately 25 to 250 base pairs, approximately 75 to 225 base pairs, or approximately 100 to 175 base pairs. (Item 44) A methylotropic host cell as described in item 40, wherein the distance between the 3' end of the upstream activation sequence (UAS) and the 5' end of the core promoter element of the synthetic output promoter is 0 to approximately 200 base pairs in length. (Item 45) A methylotropic host cell according to item 40, wherein the distance between the upstream activation sequence (UAS) and the core promoter element of the synthetic output promoter is a nucleic acid sequence having a length of approximately 6 to 200 base pairs, approximately 6 to 53 base pairs, approximately 20 to 150 base pairs, approximately 50 to 125 base pairs, or approximately 50 to 100 base pairs. (Item 46) The methylotropic host cell according to item 40, wherein the core promoter element of the synthetic output promoter comprises a core promoter sequence that is at least 90%, at least 95%, or 100% identical to a naturally occurring core promoter sequence. (Item 47) A methylotropic host cell according to item 40, wherein the core promoter element of the synthetic output promoter comprises a core promoter sequence that is at least 90%, at least 95%, or 100% identical to a core promoter sequence derived from P(AOX1), P(DAS2), P(HHF2), or P(PMP20). (Item 48) The methylotropic host cell according to item 40, wherein the upstream activation sequence (UAS) of the synthetic output promoter is bmO, tetO, phlO, or vanO. (Item 49) The methylotropic host cell according to item 40, wherein the synthetic output promoter further comprises one or more operators. (Item 50) The methylotropic host cell according to item 49, wherein one or more operators of the synthetic output promoter are not native to the methylotropic host cell. (Item 51) The methylotropic host cell according to item 40, wherein the synthetic transcription factor comprises the DNA-binding domain (DBD)Bm3R1, and the upstream activation sequence (UAS) of the synthetic output promoter comprises one or more copies of bmO. (Item 52) The methylotropic host cell according to item 40, wherein the synthetic transcription factor comprises the DNA-binding domain (DBD)PhlF_AM, and the upstream activation sequence (UAS) of the synthetic output promoter comprises one or more copies of phlO. (Item 53) The methylotropic host cell according to item 40, wherein the synthetic transcription factor comprises the DNA-binding domain (DBD)TetR, and the upstream activation sequence (UAS) of the synthetic output promoter comprises one or more copies of tetO. (Item 54) The methylotropic host cell according to item 40, wherein the synthetic transcription factor comprises the DNA-binding domain (DBD) VanR_AM, and the upstream activation sequence (UAS) of the synthetic output promoter comprises one or more copies of vanO. (Item 55) The methylotropic host cell according to item 1, wherein the synthetic output promoter contains a polynucleotide having one nucleic acid sequence of sequence numbers 56-70 or 186-193. (Item 56) A methylotropic host cell as described in item 1, in which the aforementioned target gene is expressed as RNA. (Item 57) A methylotropic host cell as described in item 1, wherein the gene of interest codes for a protein. (Item 58) A methylotropic host cell as described in item 57, wherein the gene of interest encodes an enzyme, structural protein, signaling protein, regulatory protein, transport protein, sensory protein, motor protein, defense protein, or storage protein. (Item 59) The methylotropic host cell described in item 57, wherein the protein synthesizes, modifies, or transforms molecules. (Item 60) A methylotropic host cell as described in item 59, wherein the molecule is heme or an intermediate in the heme biosynthesis pathway. (Item 61) A methylotropic host cell as described in item 57, wherein the aforementioned protein is a heme-binding protein. (Item 62) A methylotropic host cell as described in item 61, wherein the heme-binding protein is hemoglobin, neuroglobin, cytoglobin, leghemoglobin, or myoglobin. (Item 63) The methylotropic host cell described in item 57, wherein the protein is vaccinia captransferase, T7 polymerase, or O-methyltransferase. (Item 64) A methylotropic host cell as described in item 57, wherein the aforementioned protein is an enzyme in the heme biosynthesis pathway. (Item 65) The methylotropic host cell described in item 64, wherein the enzymes in the heme biosynthesis pathway are cytochrome P450, 9-adenylate cyclase, soluble guanylate cyclase, peroxidase, catalase, and / or cytochrome oxidase. (Item 66) The methylotropic host cell described in item 1, further comprising a polynucleotide encoding a secretory tag in the second transcription unit. (Item 67) The methylotropic host cell described in item 66, wherein the secretory tag is an α-amylase secretory tag, an Sc Mf α1 secretory tag, or a pre-inulinase secretory tag. (Item 68) A methylotropic host cell as described in item 66, wherein the gene for the objective codes for a protein, and the protein is secreted from the methylotropic host cell. (Item 69) The methylotropic host cell described in item 68, wherein the secreted protein is α-amylase, β-lactoglobulin, or ovalbumin. (Item 70) The methylotropic host cell according to item 1, wherein the first transcription unit and / or the second transcription unit further comprises a transcription terminator. (Item 71) A methylotropic host cell as described in item 70, wherein the transcription terminator of the first transcription unit and / or the second transcription unit is naturally present. (Item 72) A methylotropic host cell as described in item 70, wherein the transcription terminator of the first transcription unit and / or the second transcription unit is synthetic. (Item 73) A methylotropic host cell as described in item 70, wherein the transcription terminator of the first transcription unit and / or the second transcription unit is derived from a gene encoding a ribosomal protein. (Item 74) A methylotropic host cell as described in item 73, wherein the aforementioned gene encodes the ribosomal protein S2 (RPS2). (Item 75) The methylotropic host cell according to item 73, wherein the transcription terminator comprises a polynucleotide having the nucleic acid sequence of either SEQ ID NO: 146 or SEQ ID NO: 147. (Item 76) The methylotropic host cell according to item 1, wherein the first transcription unit and the second transcription unit are separated by a spacer. (Item 77) A methylotropic host cell as described in item 1, wherein the first transcription unit and / or the second transcription unit are present in multiple copies. (Item 78) A methylotropic host cell as described in item 77, wherein the copy number ratio of the second transcription unit to the first transcription unit is 1:1. (Item 79) A methylotropic host cell according to item 77, wherein the copy number ratio of the second transcription unit to the first transcription unit is at least 2:1, at least 4:1, or at least 10:1. (Item 80) A methylotropic host cell according to item 77, wherein the copy number ratio of the first transcription unit to the second transcription unit is at least 2:1, at least 4:1, or at least 10:1. (Item 81) A methylotropic host cell as described in item 77, wherein the first transcription unit exists as a single copy and the second transcription unit exists as multiple copies. (Item 82) A methylotropic host cell as described in item 81, wherein at least two of the plurality of second transcription units contain genes of different purposes. (Item 83) The methylotropic host cell according to item 81, wherein the synthetic transcription factor of the first transcription unit is an activator of each synthetic output promoter of the plurality of second transcription units. (Item 84) The methylotropic host cell according to item 1, wherein the synthetic expression system contains one or more sequences that are endogenous to the methylotropic host cell. (Item 85) A methylotropic host cell as described in item 1, wherein the first transcription unit and the second transcription unit are located on a single plasmid. (Item 86) The first transcription unit and the second transcription unit are located on different plasmids, item Methylotropic host cells as described in 1. (Item 87) The methylotropic host cell according to item 1, wherein the first transcription unit and / or the second transcription unit are integrated into the genome of the methylotropic host cell. (Item 88) The methylotropic host cell according to item 87, wherein the first transcription unit and the second transcription unit are located on the same chromosome within the methylotropic host cell genome. (Item 89) The methylotropic host cell according to item 1, wherein the first transcription unit and the second transcription unit are oriented in the same direction. (Item 90) The methylotropic host cell according to item 1, wherein the first transcription unit and the second transcription unit are oriented in different directions. (Item 91) The methylotropic host cell according to item 1, wherein the first transcription unit and the second transcription unit are located on different chromosomes within the genome of the methylotropic host cell. (Item 92) The methylotropic host cell described in item 1, wherein the methylotropic host cell is a methylotropic yeast cell. (Item 93) The methylotropic host cell described in item 1, wherein the methylotropic host cell is derived from a genus selected from Pichia, Komagataella, Hansenula, or Candida. (Item 94) The methylotrophic host cell is Pichia pastoris, Pichia pseudopastoris, Komagataella phaffii, Pichia stipitis, Pichia membranifaciens, Komagataella pseudopastoris, Komagataella pastoris, Komagataella kurtzmanii, Komagataella Methylotropic host cells as described in item 93, which are Mondaviorum, Hansenula polymorpha, Candida boidinii, or Pichia methanolica. (Item 95) The methylotropic host cell described in item 93, wherein the methylotropic host cell is Pichia pastoris. (Item 96) The methylotropic host cell according to item 1, wherein the synthetic expression system provides production of the biological product encoded by the target gene at a level higher than that of the biological product produced in a control host cell. (Item 97) The methylotropic host cell described in item 96, wherein the control host cell is of the same species as the methylotropic host cell. (Item 98) The methylotropic host cell described in item 97, wherein the control host cell contains a methanol-inducible promoter operably linked to the gene of interest. (Item 99) A methylotropic host cell as described in item 98, wherein the gene of interest encoded by the control host cell is the same gene of interest encoded by the methylotropic host cell. (Item 100) The methanol-inducible promoter is P(AOX1) of P. pastoris, as described in item 98, a methylotropic host cell. (Item 101) The methylotropic host cells described in item 100, wherein the control cells are cultured in the presence of exogenously added methanol. (Item 102) The methylotropic host cells described in item 1, wherein the methylotropic host cells are cultured under conditions including a proliferation phase and a production phase. (Item 103) A methylotropic host cell according to item 102, wherein the amount of the transcript of the target gene produced in the methylotropic host cell during the production phase is at least 100% higher than the amount of the transcript of the target gene produced in the methylotropic host cell during the proliferation phase. (Item 104) A methylotropic host cell according to item 102, wherein the amount of transcript of the target gene produced in the methylotropic host cell during the production phase is at least 200%, at least 300%, at least 400%, or at least 500% higher than the amount of transcript of the target gene produced in the methylotropic host cell during the proliferation phase. (Item 105) The methylotropic host cell according to item 1, wherein the synthetic expression system provides production of the biological product encoded by the target gene at a level at least 200% higher than the level of the biological product produced in a control host cell. (Item 106) The methylotropic host cell according to item 105, wherein the synthetic expression system provides production of the biological product encoded by the gene of interest at a level at least 600%, at least 900%, at least 1200%, at least 1500%, at least 1800%, at least 2100%, at least 2400%, at least 2700%, or at least 3000% higher than the level of the biological product produced in a control host cell. (Item 107) The methylotropic host cell according to item 105, wherein the synthetic expression system provides production of the biological product encoded by the gene of the objective at a level approximately 300% to approximately 600%, approximately 500% to approximately 1000%, approximately 800% to approximately 1500%, approximately 1000% to approximately 2000%, approximately 1200% to approximately 2000%, approximately 1800% to approximately 2500%, approximately 2000% to approximately 2500%, or approximately 2200% to approximately 3000% higher than the level of the biological product produced in a control host cell. (Item 108) A methylotropic host cell comprising a synthetic expression system, wherein the synthetic expression system is (a)(i) an input promoter comprising an upstream activation sequence (UAS) and a core promoter element, and (ii) A polynucleotide encoding at least one component of a synthetic transcription factor, wherein the synthetic transcription factor comprises a DNA-binding domain (DBD) and a transcription activation domain (TAD), and the DBD and the TAD are not native to the methylotropic host cell. A first transcription unit comprising the input promoter which drives the expression of at least one component of the synthetic transcription factor, (b) A second transcription unit comprising a synthetic output promoter operably linked to the gene of interest, wherein the synthetic transcription factor is an activator of the synthetic output promoter, Includes, The aforementioned target gene is expressed in the absence of exogenously supplied methanol. Methylotropic host cells are cultured under conditions including the proliferation and production phases. A methylotropic host cell in which the amount of the transcript of the target gene produced by the methylotropic host cell during the production phase is at least 100% greater than that produced during the proliferation phase. (Item 109) A methylotropic host cell comprising a synthetic expression system, wherein the synthetic expression system is (a)(i) an input promoter comprising an upstream activation sequence (UAS) and a core promoter element, and (ii) A polynucleotide encoding at least one component of a synthetic transcription factor, wherein the synthetic transcription factor comprises a DNA-binding domain (DBD) and a transcription activation domain (TAD), and the DBD and the TAD are not native to the methylotropic host cell. A first transcription unit comprising the input promoter which drives the expression of at least one component of the synthetic transcription factor, (b) A synthetic output promoter operably linked to a gene of interest, wherein the synthetic transcription factor is an activator of the synthetic output promoter, and a second transcription unit comprising a polynucleotide encoding a secretory tag, Includes, The aforementioned target gene is expressed in a methylotropic host cell in the absence of exogenously supplied methanol. (Item 110) A methylotropic host cell comprising a synthetic expression system, wherein the synthetic expression system is (a)(i) an input promoter comprising an upstream activation sequence (UAS) and a core promoter element, and (ii) A polynucleotide encoding at least one component of a synthetic transcription factor, wherein the synthetic transcription factor comprises a DNA-binding domain (DBD) and a transcription activation domain (TAD), and the DBD and the TAD are not native to the methylotropic host cell. A first transcription unit comprising the input promoter which drives the expression of at least one component of the synthetic transcription factor, (b) A second transcription unit comprising a synthetic output promoter operably linked to the gene of interest, wherein the synthetic transcription factor is an activator of the synthetic output promoter, Includes, The aforementioned target gene is expressed in the absence of exogenously supplied methanol. A methylotropic host cell in which the synthetic expression system provides production of the biological product encoded by the target gene at a level at least 300% higher than the level of the biological product produced in a control host cell. (Item 111) Includes the step of culturing methylotropic host cells as described in any one of items 1 to 110. Hmm, a method for expressing the target gene. (Item 112) The method according to item 111, wherein the target gene encodes a heme-binding protein or one or more enzymes of the heme biosynthesis pathway. (Item 113) The method according to item 112, wherein the heme-binding protein is hemoglobin, myoglobin, neuroglobin, cytoglobin, or leghemoglobin. (Item 114) One or more enzymes in the aforementioned heme biosynthesis pathway are cytochrome P450, 9-adeny The method according to item 112, wherein the acid cyclase is a soluble guanylate cyclase, a peroxidase, a catalase, and / or a cytochrome oxidase. (Item 115) The method according to item 111, wherein the gene of interest encodes a vaccinia capting enzyme, a T7 polymerase enzyme, or an O-methyltransferase enzyme. (Item 116) A method for producing a target molecule, comprising the step of culturing a methylotropic host cell as described in any one of items 1 to 110, and obtaining the target molecule from biomass or culture. (Item 117) The method according to item 116, wherein the obtaining step includes extracting the target molecule from biomass. (Item 118) The method according to item 116, wherein the obtaining step includes recovering the molecule from a culture, culture medium, cell-free used culture medium, and / or cell-containing culture medium. (Item 119) A method for producing a target molecule, comprising the step of expressing a target gene in accordance with any one of items 111 to 115, wherein the target gene encodes an enzyme, and the method is (a) a step of purifying the enzyme encoded by the gene of the objective, and (b) A method comprising the step of using the purified enzyme for the biotransformation of a substrate into the molecule of the choice. (Item 120) The method according to any one of items 116 to 119, wherein the target molecule is heme. (Item 121) A method for expressing a target gene or producing a target molecule, (a) A step of culturing methylotrope host cells described in any one of items 1 to 110 in a suitable medium for a period of time to promote cell growth, and (b) A method comprising the step of modifying culture conditions 1 or more to promote the expression of the gene of the interest or the production of the molecule of the interest. (Item 122) The method according to item 121, wherein changing one or more culture conditions includes changing the composition of the culture medium. (Item 123) The method according to item 121 or item 122, wherein step (b) includes restricting, adding, and / or depleting nutrients. (Item 124) The method according to any one of items 121 to 123, wherein step (b) includes thiamine depletion, glycerol restriction, monosaccharide restriction, or formic acid addition. (Item 125) The method according to any one of items 121 to 124, wherein step (b) includes restrictions on any carbon source, sugar, starch, galactose, maltose, glucose, sorbitol, inositol, glycerol, vitamins, steroids, nitrogen source, nitrate, nitrite, ammonium, amino acids, methionine, heavy metals, copper, benzoic acid, hydrogen peroxide, calcium-containing compounds, and / or phosphoric acid. (Item 126) The method according to any one of items 121 to 125, wherein step (b) includes restricting any combination of two nutrients. (Item 127) The method according to any of items 121-125, wherein step (b) includes glucose restriction and thiamine depletion. (Item 128) A synthetic expression system comprising a polynucleotide having at least 90%, at least 95%, or at least 99% identity with any one nucleic acid sequence of sequence numbers 1 to 15. (Item 129) The synthetic expression according to item 128, wherein the synthetic expression system includes an input promoter containing a polynucleotide having at least 90%, at least 95%, or at least 99% identity with any one nucleic acid sequence of sequence numbers 16 to 25. (Item 130) The synthetic expression according to item 128 or item 129, wherein the synthetic expression system comprises a polynucleotide encoding at least one component of a synthetic transcription factor. (Item 131) The synthetic expression system according to item 130, wherein the polynucleotide encoding at least one component of the synthetic transcription factor comprises a polynucleotide having at least 90%, at least 95%, or at least 99% identity with any one nucleic acid sequence of sequence numbers 26-40 or 182-185. (Item 132) The synthetic expression system according to item 131, wherein the encoded synthetic transcription factor comprises a polypeptide having at least 90%, at least 95%, or at least 99% identity with any one of the amino acid sequences of SEQ ID NOs. 41 to 55. (Item 133) The synthetic expression according to any one of items 128 to 132, wherein the synthetic expression system includes a synthetic output promoter having at least 90%, at least 95%, or at least 99% identity with any one nucleic acid sequence of sequence numbers 56 to 70 or 186 to 193. (Item 134) A methylotropic host cell according to any one of items 1 to 110, comprising a polynucleotide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of sequence numbers 16 to 25. (Item 135) A methylotropic host cell according to any one of items 1 to 110, comprising a polynucleotide having at least 90%, at least 95%, or at least 99% identity to one nucleic acid sequence of sequence numbers 56-70 or 186-193. (Item 136) A methylotropic host cell according to any one of items 1 to 110, wherein the synthetic transcription factor is encoded by a polynucleotide having at least 90%, at least 95%, or at least 99% identity with any one nucleic acid sequence of sequence numbers 26-40 or 182-185. (Item 137) A methylotropic host cell according to any one of items 1 to 110, wherein the synthetic transcription factor comprises a polypeptide having at least 90%, at least 95%, or at least 99% identity with any one amino acid sequence of sequence numbers 41 to 55. (Item 138) A method for manipulating host cells for protein expression, A method comprising the step of transforming the host cells with a synthetic expression system described in any one of items 128 to 133.

[0061] The attached drawings are not intended to be drawn to scale. The drawings are illustrative and non-limiting examples only and are not required to enable this disclosure. For clarity, not all components are labeled in all drawings. The drawings are as follows: [Brief explanation of the drawing]

[0062] [Figure 1-1]Figures 1A and 1B show schematic diagrams of non-limiting examples of the synthetic expression systems of this disclosure, e.g., those induceable under methanol-independent fermentation processes. Figure 1A shows that the first transcription unit consists of an input promoter (P(in)) operably ligated to a polynucleotide encoding a synthetic transcription factor (sTF) and optionally a first transcriptional terminator (TT). Figure 1B shows that the first transcription unit consists of P(in) containing an upstream activation sequence (UAS), a core promoter element operably ligated to a polynucleotide encoding sTF, and optionally a first TT. In some embodiments, P(in) contains only the core promoter element (e.g., without a UAS). In some embodiments, as shown in Figure 1A or Figure 1B, P(in) is activated in response to manipulation of fermentation process (culture) conditions. The manipulation activates the transcription of the sTF-coding gene. Figures 1A and 1B both show that the second synthetic transcription unit includes a synthetic output promoter (P(out)) operably ligated to the gene of interest (GOI) and, optionally, a second TT, where the first and second TTs are either the same or different. P(out) contains an upstream activation sequence (UAS) operably ligated to the core promoter (CP) sequence. When expressed, the sTF protein binds to one or more congeneral sites (e.g., operators) in the upstream activation sequence of P(out), thereby activating transcription from the core promoter. P(out) is operably ligated to the gene of interest and drives its expression. [Figure 1-2]Figures 1A and 1B show schematic diagrams of non-limiting examples of the synthetic expression systems of this disclosure, e.g., those induceable under methanol-independent fermentation processes. Figure 1A shows that the first transcription unit consists of an input promoter (P(in)) operably ligated to a polynucleotide encoding a synthetic transcription factor (sTF) and optionally a first transcriptional terminator (TT). Figure 1B shows that the first transcription unit consists of P(in) containing an upstream activation sequence (UAS), a core promoter element operably ligated to a polynucleotide encoding sTF, and optionally a first TT. In some embodiments, P(in) contains only the core promoter element (e.g., without a UAS). In some embodiments, as shown in Figure 1A or Figure 1B, P(in) is activated in response to manipulation of fermentation process (culture) conditions. The manipulation activates the transcription of the sTF-coding gene. Figures 1A and 1B both show that the second synthetic transcription unit includes a synthetic output promoter (P(out)) operably ligated to the gene of interest (GOI) and, optionally, a second TT, where the first and second TTs are either the same or different. P(out) contains an upstream activation sequence (UAS) operably ligated to the core promoter (CP) sequence. When expressed, the sTF protein binds to one or more congeneral sites (e.g., operators) in the upstream activation sequence of P(out), thereby activating transcription from the core promoter. P(out) is operably ligated to the gene of interest and drives its expression.

[0063] [Figure 2]Figure 2 shows the components of two non-restrictive examples of synthetic transcription factors (sTFs). sTFs can be one-component sTFs, two-component sTFs, or multi-component (e.g., three or more components) sTFs. A one-component sTF may include a DNA-binding domain (DBD), a nuclear localization signal (NLS, optional), a linker (L, optional), and a transcriptional activation domain (TAD). A two-component sTF may include a DBD, NLS (optional), L (optional), a bioconjugate protein moiety 1 (BPP1, optional), a 2A peptide (2A, optional), a bioconjugate protein moiety 2 (BPP2, optional), NLS (optional), an oligomerization domain (OD, optional), and a TAD. In a two-component sTF, the DBD, NLS (optional), linker (optional), and BPP1 combine to form component 1. In a two-component sTF, BPP2, NLS (optional), OD (optional), and TAD combine to form component 2. Component 1 and component 2 combine to form a "bioconjugate (synthetic) transcription factor" (B(s)TF) containing the component 1-component 2 adduct.

[0064] [Figure 3] Figure 3 shows a non-limiting example of a fermentation (culture) flow chart. It shows three stages of fermentation. The batch stage of fermentation begins with a starting culture medium containing a fixed mass of carbon initially added (Stage I). Stage II, the fed batch stage, is the biomass production stage, where carbon supply is maintained at a rate sufficient to sustain growth while maintaining the desired residual carbon level. Stage III is the production stage. In Stage III, the carbon supply rate can be adjusted to maintain production while maintaining the desired residual carbon level. Addition (e.g., as either a single bolus or supply), restriction, or depletion (e.g., nutrients) can be performed throughout the fermentation process as needed.

[0065] [Figure 4] Figure 4 shows the test construct and control construct integrated into the host cell genome in Example 1. The upper construct represents the synthetic expression system (SES) that was integrated and tested, while the lower construct represents the control.

[0066] [Figure 5-1] Figure 5 shows the expression assay in deep-well plates (Assay 3). Each strain contains one synthetic expression system (SES) expressing one of three proteins with a luminescence tag. Each strain is assayed using the deep-well process corresponding to its P(in). One to three colonies were selected from each unique SES and assayed. Performance of 241 picks is summarized. The average background luminescence was approximately 337 luminescence units. [Figure 5-2] Figure 5 shows the expression assay in deep-well plates (Assay 3). Each strain contains one synthetic expression system (SES) expressing one of three proteins with a luminescence tag. Each strain is assayed using the deep-well process corresponding to its P(in). One to three colonies were selected from each unique SES and assayed. Performance of 241 picks is summarized. The average background luminescence was approximately 337 luminescence units.

[0067] [Figure 6-1] Figure 6 shows the expression assay in deep-well plate format in Process 3. Each dot represents a unique strain producing nine proteins. The values ​​in the upper panel represent the amount of intracellular myoglobin, and the values ​​in the lower panel represent the amount of heme within the same cell. [Figure 6-2] Figure 6 shows the expression assay in deep-well plate format in Process 3. Each dot represents a unique strain producing nine proteins. The values ​​in the upper panel represent the amount of intracellular myoglobin, and the values ​​in the lower panel represent the amount of heme within the same cell. [Modes for carrying out the invention]

[0068] Detailed explanation This disclosure provides a synthetic expression system, transcription units, a host cell comprising the synthetic expression system and transcription units, and a method for promoting high-yield production of a desired biological product (e.g., enzymes or other proteins, RNA, small molecules, etc.) under methanol-independent conditions, for example. "Synthetic" means a sequence that does not exist in nature (e.g., a nucleic acid sequence or amino acid sequence), or a component comprising one or more sequences that do not exist in nature. "Naturally occurring" means something that can be found in nature (e.g., a nucleic acid or polypeptide). For example, a naturally occurring nucleic acid or polypeptide sequence can be isolated from a natural source and has not been otherwise modified by humans in the laboratory. In some embodiments, the sequence that does not exist in nature comprises two or more naturally occurring sequences that combine to form a new sequence.

[0069] The transcription units and synthetic expression systems of this disclosure may comprise several components, which may include an input promoter, a synthetic output promoter, a polynucleotide encoding a transcription factor (e.g., a transcription activator), the gene of interest to be expressed, and an optional transcription terminator. These components may be used in conjunction with other components to construct a transcription unit or transcription system.

[0070] In some embodiments, the synthetic expression system includes a first transcription unit. In some embodiments, the first transcription unit includes a polynucleotide encoding at least one component of a transcription factor. In some embodiments, the first transcription unit further includes an input promoter operably ligated to the polynucleotide encoding at least one component of a transcription factor, enabling its expression. In some embodiments, the first transcription unit includes a polynucleotide encoding a transcription factor. In some embodiments, the first transcription unit includes a transcription factor or a polynucleotide encoding at least one component of a transcription factor, and an insertion site. In some embodiments, in the first transcription unit, the insertion site is arranged so that a promoter inserted into the insertion site (e.g., an input promoter) can be operably ligated to the transcription factor or a polynucleotide encoding at least one component of a transcription factor, enabling its expression. In some embodiments, the first transcription unit includes an input promoter inserted into the insertion site. In some embodiments, the input promoter is operably ligated to the transcription factor or a polynucleotide encoding at least one component of a transcription factor, regulating its transcription.

[0071] In some embodiments, the synthetic expression system includes a second transcription unit comprising an output promoter. In some embodiments, the synthetic expression system includes a second transcription unit comprising an output promoter and an insertion site. In some embodiments, in the second transcription unit, the insertion site is positioned so that the gene of interest inserted into the insertion site can be operably ligated to the output promoter and expressed. In some embodiments, a transcription factor (partially or entirely encoded by the first transcription unit) is an activator of the output promoter of the second transcription unit. In some embodiments, the output promoter is operably ligated to the gene of interest and regulates its transcription, and the transcription factor encoded by the first transcription unit is an activator of the output promoter of the second transcription unit. In some embodiments, the transcription factor and / or output promoter are synthetic. This disclosure also relates to host cells comprising a synthetic expression system, as well as to methods of using host cells, transcription units, or synthetic expression systems.

[0072] In some embodiments, a synthetic expression system within a host cell can be used to produce the biological product. In some embodiments, the timing and level of biological product production can be controlled by manipulating the design of the synthetic expression system, the selection of host cells, and the parameters of the culture conditions.

[0073] Synthetic expression system (SES) Aspects of this disclosure provide transcription units and synthetic expression systems that may be useful, for example, in the biosynthesis of a desired biological product.

[0074] As used in this disclosure, “synthetic expression system” refers to a non-natural expression system that enables the expression of a gene of interest [e.g., an endogenous and / or synthetic (e.g., a modified, heterologous, or exogenous host cell) gene of interest] for the purpose of synthesizing a desired biological product. In some embodiments, the synthetic expression system comprises one or more transcription units. In some embodiments, the first and / or second transcription units are synthetic.

[0075] In some embodiments, the synthetic expression system includes a first transcription unit comprising a polynucleotide encoding a transcription factor (e.g., an activator of transcription) or at least one component of a transcription factor, and a second transcription unit comprising an output promoter which is congenerate with the transcription factor. In some embodiments, the synthetic expression system includes a first insertion site, a first transcription unit comprising a polynucleotide encoding a transcription factor (e.g., an activator of transcription) or at least one component of a transcription factor, and a second transcription unit comprising an output promoter which is congenerate with the transcription factor and a second insertion site, wherein the promoter inserted into the first insertion site (e.g., an input promoter) can be operably ligated to the polynucleotide to promote the expression of the polynucleotide, and the gene of interest inserted into the second insertion site can be operably ligated to the output promoter and expressed by the output promoter. In some embodiments, the synthetic expression system comprises one or more components: (a) a first transcription unit comprising an input promoter operably linked to a transcription factor or a polynucleotide encoding at least one component of a transcription factor, which can express it; and (b) a second transcription unit comprising an output promoter operably linked to a gene of interest, which can express it, and optionally a downstream transcriptional terminator of the gene of interest. In some embodiments, the transcription factor is a synthetic transcription factor (sTF). In some embodiments, the synthetic transcription factor may be a one-component sTF, a two-component sTF, or a multi-component sTF. In some embodiments, the input promoter (P(in)) of the first transcription unit (whose transcriptional activity is regulated by specific culture conditions) drives the expression of a transcription factor or a polynucleotide encoding at least one component of a transcription factor, which then mediates the transcriptional activation of one or more second transcription units. In some embodiments, each second transcription unit comprises an output promoter (P(out)) having a binding site for a transcription factor or at least one component of a transcription factor, and the gene of interest. In some embodiments, the output promoter is synthetic.In some embodiments, the output promoter includes an upstream activation sequence (UAS), which may include one or more binding sites to the transcription factor; a core promoter; and a 5'-untranslated region (5'-UTR). In some embodiments, the input promoter includes a 5'-UTR, which is the portion of the promoter from the +1 transcription start (including the end) to the ATG translation start (excluding the end).

[0076] Examples, including Examples 1, 3, and 4, illustrate some non-limiting examples of the transcription units and synthetic expression systems of this disclosure.

[0077] Those skilled in the art will understand that the transcription units or synthetic expression systems of this disclosure can be constructed in a variety of ways within the host cell genome (e.g., on a continuous or discontinuous polynucleotide sequence; on the same or different chromosomes; or oriented in the same or opposite direction to the direction of transcription).

[0078] In some embodiments, the synthetic expression system (e.g., including a first transcription unit and a second transcription unit) is located on a single plasmid or chromosome. In some embodiments, the synthetic expression system is located on two or more plasmids and / or chromosomes. For example, in some embodiments, the first transcription unit is located on a first plasmid or chromosome, and the second transcription unit is located on a second plasmid or chromosome.

[0079] In some embodiments, the synthetic expression system comprises two or more copies of a first transcription unit; and / or two or more copies of a second transcription unit.

[0080] In some embodiments, the synthetic expression system comprises two or more first transcription units that are the same or different from each other; and / or two or more second transcription units that are the same or different from each other.

[0081] In some embodiments, the synthetic expression system can express two or more copies of the same or different gene of interest. In some embodiments, the synthetic expression system can produce two or more different biological products.

[0082] In some embodiments, the first transcription unit exists as a single copy, and the second transcription unit exists as multiple copies (e.g., two or more copies). In some embodiments, at least two of the multiple second transcription units contain genes for different purposes. For example, second transcription unit #1 may contain a gene encoding an enzyme in the heme biosynthesis pathway, and second transcription unit #2 may contain a gene encoding heme or an intermediate in the heme biosynthesis pathway. In some embodiments, the transcription factor of the first transcription unit (e.g., synthetic transcription factor) is an activator of the output promoter of each of the multiple second transcription units (e.g., synthetic output promoter). However, it will be understood that the multiple second transcription units do not need to contain the same output promoter (or output promoter containing the same components) in order for the transcription factor of the first transcription unit (e.g., synthetic transcription factor) to activate the output promoter of each of the multiple second transcription units (e.g., synthetic output promoter). For example, multiple output promoters of a second transcription unit (e.g., synthetic output promoters) may each contain different core promoter elements, but may share a common upstream activation sequence (UAS), thereby allowing each to be activated by a transcription factor of the first transcription unit (e.g., a synthetic transcription factor).

[0083] In some embodiments, the synthetic expression system comprises at least two first transcription units, each comprising a different input promoter operably linked to the same transcription factor or a polynucleotide encoding at least one component of a transcription factor; and / or at least two second transcription units, each comprising an output promoter operably linked to the gene of interest and activatable by a transcription factor, wherein the output promoters of the at least two second transcription units and the gene of interest are the same or different.

[0084] In some embodiments, the synthetic expression system comprises a first transcription unit capable of expressing a transcription factor or at least one component of a transcription factor; and two or more different second transcription units, each comprising a synthetic output promoter activated by the transcription factor and operably linked to a different gene of interest.

[0085] In some embodiments, the first transcription unit comprises an input promoter operably linked to two or more polynucleotides, each expressing the same or different transcription factors or at least one component of a transcription factor (e.g., a polycistronic or locus). In some embodiments, the same or different transcription factors activate the transcription of the same or different genes of interest.

[0086] In some embodiments, the synthetic expression system comprises (a) a first transcription unit comprising two or more polynucleotides operably linked to an input promoter, each expressing the same or different transcription factors or at least one component of a transcription factor; and (b) one or more second transcription units, each comprising a synthetic output promoter activated by a transcription factor and operably linked to the gene of interest; the synthetic output promoters and / or the gene of interest of the one or more second transcription units are the same or different.

[0087] In some embodiments, a functional unit of DNA includes two or more genes under the control of the same promoter (e.g., a multicistronic or polycistronic unit). In various embodiments, a transcription unit including a gene encoding a transcription factor or at least one component of a transcription factor is multicistronic or polycistronic [e.g., the transcription unit is multiple different transcription factors (or components thereof) or multiple copies of the same transcription factor (or component thereof)]; and / or, a transcription unit including a gene of interest is multicistronic or polycistronic (e.g., the transcription unit is encoding multiple different genes of interest or multiple copies of the same gene of interest). In some embodiments, a first transcription unit includes a single input promoter operably ligated to two or more polynucleotides encoding the same or different transcription factors or components thereof. In some embodiments, a second transcription unit includes a single output promoter operably ligated to two or more genes of interest (which may be the same or different).

[0088] In some embodiments, the synthetic expression system comprises (a) a transcription unit comprising two or more polynucleotides operably linked to an input promoter, each expressing a different transcription factor or at least one component of a transcription factor; and (b) two or more second transcription units comprising a synthetic output promoter, each activated by a different transcription factor or at least one component of a transcription factor encoded by the first transcription unit and operably linked to a different gene of interest.

[0089] In some embodiments, the host cell contains multiple copies of a transcription unit or synthetic expression system, such as one of the transcription units or transcription systems described in this application, within its genome. These multiple copies may, in some embodiments, result from multiple introductions of the system or unit into the host cell genome, or from a single introduction of one or more plasmids containing a synthetic expression system, unit(s) or components thereof, followed by self-replication.

[0090] In some embodiments, the synthetic expression system comprises one or more of the following components: an input promoter, a transcription factor or a polynucleotide encoding at least one component thereof, a synthetic output promoter, the gene of interest, and a transcription terminator (see, for example, Examples 1, 3, and 4). Examples 1, 3, and 4 describe some non-limiting examples of the transcription units and synthetic expression systems of the present disclosure. In some embodiments, the synthetic expression system of the present disclosure comprises or consists of a sequence (e.g., a nucleic acid or amino acid sequence) that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequences of Examples 1 and 3, Tables 21, 28, and 30-36, or to a sequence selected from any one of Sequence IDs 1-166.

[0091] In some embodiments, the host cell comprises a synthetic expression system containing one or more different first transcription units and / or second transcription units. The various transcription units can be oriented in any orientation relative to each other.

[0092] In some embodiments, a spacer can be placed between any two components of a transcription unit or synthetic expression system. A spacer is typically a short polynucleotide or amino acid sequence that can be inserted between components for various purposes, such as reducing or promoting interaction. Spacers are of any partial type and are not considered necessary for the proper functioning of the transcription units and / or synthetic expression systems of this disclosure. Non-limiting examples of spacers are listed in Table 20, and corresponding DNA sequences of these partial types are provided in Table 21. In some embodiments, a spacer comprises a polynucleotide having the sequence of SEQ ID NO: 166.

[0093] In some embodiments, the synthetic expression system comprises the following DNA sequences in order from 5' to 3': (1) P(in), (2) a polynucleotide encoding at least one component of a TF (e.g., sTF) or transcription factor, and (3) a TT of the first transcription unit, (4) an optional spacer, (5) P(out), and (6) the gene of interest. In some embodiments, the synthetic expression system comprises the following DNA sequences in order from 5' to 3': (1) P(in), (2) a polynucleotide encoding TF (e.g., sTF) or at least one component of a transcription factor, and (3) TT of the first transcription unit, (4) an optional spacer, (5) P(out), (6) a secretion tag, (7) a detection tag, and (8) the gene of interest.

[0094] In some embodiments, the expression systems are homologous with respect to the production process. In some embodiments, the expression systems are homologous with respect to a specific production process (e.g., a process described herein, such as process 1, process 2, process 3, or process 4) if the expression system is activated in the process under specific culture steps or conditions (e.g., glycerol restriction and formic acid addition in process 1; glucose restriction and formic acid addition in process 2; and glucose restriction and thiamine depletion in process 3).

[0095] Table 2 shows designs for non-restrictive examples of synthetic expression systems. These are particularly useful for the manufacturing process using Process 2, in which glucose is restricted and formic acid is added.

[0096] Table 3 shows designs for non-limiting combinations of synthetic expression systems. These are particularly useful for the production process using Process 3, where glucose is limited and thiamine is depleted.

[0097] In the process of designing, constructing, and / or evaluating synthetic expression systems, a reporter gene can be used as the gene of interest. As shown in the examples, several synthetic expression systems were constructed using red fluorescent protein (RFP) as the reporter gene. After the successful evaluation of a synthetic expression system (e.g., those described in the examples), if the reporter gene was used as the gene of interest, the reporter gene can be replaced with a different gene of interest that is useful for the production of a specific biological product.

[0098] In some embodiments, the synthetic expression system is methanol-independent. In some embodiments, the methanol-independent synthetic expression system comprises (a) a first transcription unit comprising a transcription factor or a polynucleotide encoding at least one component of a transcription factor, and (b) a second transcription unit comprising a synthetic output promoter. In some embodiments, one or more components of the transcription factor are activators of the synthetic output promoter in the second transcription unit. In some embodiments, the methanol-independent synthetic expression system is expressed in host cells of the genera Pichia, Komagataella, Hansenula, Candida, or any yeast (including, but not limited to, any methylotropic yeast).

[0099] Certain embodiments of this disclosure encompass synthetic expression systems for use in yeast under glycerol-restricted and formic acid-supplemented fermentation conditions (Process 1 as described in the Examples). Such a synthetic expression system comprises an input promoter (P(in)) operably linked to a synthetic transcription factor (sTF) and a synthetic output promoter (P(out)) operably linked to the gene of interest. In some embodiments, P(in) may be selected from P(GQ6704499), P(HGT1), and P(FDH1) (non-limiting examples of specific sequences for each of these promoters can be found in Table 21; suitable variants of these promoters are within the scope of the art of the art, as detailed above). In some embodiments, the sTF may be selected from a TetR-based one-component system, a VanR_AM-based one-component system, a PhlF-based one-component system, or a PhlF-based two-component system. Non-limiting examples of specific sequences for each of these sTFs can be found in Tables 30 and 36 (nucleic acid sequences) and 31 (amino acid sequences). Suitable variants of these sTFs are within the scope of the art of the art, as detailed above. In some embodiments, P(out) is selected from P(AOX1) or P(HHF2) core promoters modified with 8xtetO, 4xvanO, 8xphlO, 1xtetO, or 2xphlO (non-limiting examples of specific sequences for each P(out) can be found in Table 33 or Table 36. Suitable variants of these promoters are within the scope of the art of the art, as detailed above).

[0100] Certain embodiments of this disclosure also encompass synthetic expression systems for use in yeast under glucose-restricted and formic acid-supplemented fermentation conditions (Process 2 as described in the Examples). Such a synthetic expression system comprises an input promoter (P(in)) operably linked to a synthetic transcription factor (sTF) and a synthetic output promoter (P(out)) operably linked to the gene of interest. In some embodiments, P(in) may be selected from P(AOX2), P(RGI2), and P(FDH1) (non-limiting examples of specific sequences for each of these promoters can be found in Table 21; suitable variants of these promoters are within the scope of the art of the art, as detailed above). In some embodiments, the sTF may be selected from a Bm3R1-based one-component system, a PhlF-based one-component system, or a PhlF-based two-component system. Non-limiting examples of specific sequences for each of these sTFs can be found in Tables 30 and 36 (nucleic acid sequences) and 31 (amino acid sequences). Suitable variants of these sTFs are within the scope of the art of the art, as detailed above. In some embodiments, P(out) is selected from P(AOX1) or P(PMP20) core promoters modified with 4xbmO, 8xbmO, 8xphlO, or 2xphlO (non-limiting examples of specific sequences for each P(out) can be found in Table 33 or Table 36; suitable variants of these promoters are within the scope of the art of the art, as detailed above).

[0101] Certain embodiments of this disclosure also encompass synthetic expression systems for use in yeast under glucose-restricted and thiamine-depleted fermentation conditions (Process 3 described in the Examples). Such a synthetic expression system comprises an input promoter (P(in)) operably linked to a synthetic transcription factor (sTF) and a synthetic output promoter (P(out)) operably linked to the gene of interest. In some embodiments, P(in) may be selected from P(THI13)_short and P(THI13)_long (non-limiting examples of specific sequences for each of these promoters can be found in Table 21; suitable variants of these promoters are within the scope of the art of the art, as detailed above). In some embodiments, the sTF may be selected from a Bm3R1-based two-component system or a PhlF-based two-component system. Non-limiting examples of specific sequences for each of these sTFs can be found in Tables 30 and 36 (nucleic acid sequences) and 31 (amino acid sequences). Appropriate variants of these sTFs are within the scope of the art of the art, as detailed above. In some embodiments, the P(out) promoter is a P(AOX1) core promoter modified with 2xbmO or 2xphlO (non-limiting examples for each P(out) can be found in Table 33 or Table 36; appropriate variants of these promoters are within the scope of the art of the art, as detailed above).

[0102] Biological products The transcription units, synthetic expression systems, host cells, and other methods described herein can be used, for example, for high-yield, large-scale production of biological products under methanol-independent conditions.

[0103] The term “biological product” refers to any product made by or from biomass that can be expressed by the transcription units and / or synthetic expression systems of this disclosure. “Biomass” refers to any biological material available on a renewable basis, including that produced in any host cell.

[0104] In some embodiments, the biological product is a protein or polynucleotide expressed from the gene of interest; or any other composition synthesized, modified, or otherwise acted upon directly or indirectly by the protein or polynucleotide expressed from the gene of interest.

[0105] In some embodiments, the biological product is a compound or composition that is synthesized (whole or partially) directly or indirectly (whole or partially) by the action of a protein, nucleic acid (e.g., mRNA; or polynucleotide), small or large molecule, complex or supramolecular complex (or component thereof), or a protein or nucleic acid encoded by a gene of interest, and / or converted into another final, or more useful or stable form.

[0106] In some embodiments, when the gene of interest expresses a protein, the protein may be an enzyme, structural protein, signaling protein, regulatory protein, transport protein, sensory protein, motor protein, defense protein, or storage protein.

[0107] In some embodiments, the protein is an enzyme. In some embodiments, the protein expressed by the gene of interest is an enzyme in the heme biosynthesis pathway. In some embodiments, the enzyme expressed by the gene of interest is one or more of cytochrome P450, 9-adenylate cyclase, soluble guanylate cyclase, peroxidase, catalase, or cytochrome oxidase.

[0108] In some embodiments, the protein synthesizes, modifies, or transforms a molecule. In some embodiments, the molecule is heme.

[0109] In some embodiments, a synthetic expression system is used to produce heme-binding proteins. Various classes of heme-binding proteins that can be expressed using the transcription units or synthetic expression systems of this disclosure include, but are not limited to, globins (e.g., hemoglobin, myoglobin, neuroglobin, cytoglobin, leghemoglobin), cytochromes (e.g., type A, type B, and type C, CD1-nitrite reductase, cytochrome oxidase), transferrins (e.g., lactotransferrin, serotransferrin, melanotransferrin), bacterioferritin, and hydroxylamine. Examples include oxygenate reductases, nitrophorin, peroxidases (e.g., lignin peroxidase), cyclooxygenases (e.g., COX-1, COX-2, COX-3, prostaglandin H synthase), catalase, cytochrome P-450s, chloroperoxidase, PAS domain heme sensors, H-NOX heme sensors (e.g., soluble guanylate cyclase, FixL, DOS, HemAT, and CooA), heme oxygenase, and nitric oxide synthase. In some embodiments, recombinant heme-binding proteins expressed using the transcription units or synthetic expression systems of this disclosure may be of prokaryotic or eukaryotic origin. In some embodiments, the heme-binding proteins are of mammalian origin. In some embodiments, the heme-binding proteins are of bovine origin. In some embodiments, the heme-binding proteins are of bacterial origin. In some embodiments, the heme-binding proteins are of fungal origin (e.g., yeast). In some embodiments, the heme-binding protein is of plant origin or of any other origin.

[0110] In some embodiments, one or more synthetic expression systems are used to produce heme and heme-binding proteins in host cells.

[0111] In some embodiments, the synthetic expression system further includes a polynucleotide encoding the secretory tag in the second transcription unit. In some embodiments, the secretory tag is native to the host cell. In some embodiments, the secretory tag is native but not native to the host cell. In some embodiments, the secretory tag is Pre-OST1-Pro Sc MFα1, mouse IgG1, PHA-E, Sc invertase, Sc MEL1, Sc INU, YILip11, YILip2, Dan4, GAS1, MSB2, FRE2, PHO1, PHO5, SOD1, EXG1, BGL2, CPR5, YPS1, ENO1, PEP4, THI4, ILV5, CTR9, PIR3, FLO10, HSP150, NU145, MUC1, ROT1, or MET6. In some embodiments, the secretory tag is an α-amylase secretory tag, a Sc Mf α1 secretory tag, or a pre-inulinase secretory tag. In some embodiments, where the second transcription unit further includes a secretory tag and the gene of interest encodes a protein, the protein may be secreted from the host cell. As is understood, in some embodiments, secretion of the protein encoded by the synthetic expression system from the host cell is advantageous because it does not require lysing or otherwise damaging the host cell to extract and purify the encoded protein. Thus, in some embodiments, the host cell can continue to produce the protein of interest even after the recovery of the encoded protein. In some embodiments, the secreted protein is α-amylase, β-lactoglobulin, or ovalbumin.

[0112] In some embodiments, the biological product is nucleic acid (e.g., mRNA) transcribed from the gene of interest. In some embodiments, the biological product is mRNA encoding a viral protein. In some embodiments, the biological product is mRNA encoding the SARS-CoV-2 viral protein and useful as a vaccine against COVID-19. In some embodiments, the SARS-CoV-2 viral protein is the spike protein. In some embodiments, the biological product is mRNA encoding a viral protein and useful as an mRNA vaccine. In some embodiments, the biological product is vaccinia captase. In some embodiments, the biological product is O-methyltransferase or T7 polymerase.

[0113] In some embodiments, the biological product is a small molecule. In some embodiments, the small molecule is heme.

[0114] In some embodiments, the biological product is a small or large molecule that is synthesized (whole or partially) directly or indirectly, by the action of a protein expressed from the gene of interest, modified, and / or converted into another final, or more useful or stable form.

[0115] In some embodiments, the biological product is a complex or supramolecular complex comprising RNA(s), proteins(s), and / or one or more macromolecules or small molecules; or the biological product is a component of such a complex or supramolecular complex.

[0116] In some embodiments, the biological product is a component useful in the biotransformation process (e.g., a protein, nucleic acid, small molecule, or large molecule).

[0117] Measurement of biological products The yield of a biological product can be evaluated at any one or more steps in the pathway, such as the final product or intermediate product, using metrics well known to those skilled in the art. Production can be evaluated by any metric known in the art, for example, by evaluating the volume productivity, enzyme kinetics / reaction rate, specific productivity, biomass-specific productivity, titer, yield, and total titer of one or more biological products.

[0118] In some embodiments, the metrics used to measure production may depend on whether a continuous process is being monitored or whether a specific end product is being measured. For example, in some embodiments, metrics used to monitor production by a continuous process may include volume productivity, enzyme kinetics, and reaction rate. In some embodiments, metrics used to monitor production of a specific product may include specific productivity, biomass-specific productivity, activity, potency, and yield of a biological product of 1 or more. The terms “volume productivity” or “production rate” refer to the amount of product formed per unit time per volume of medium. Volume productivity can be reported in grams / liter / hour (g / L / h).

[0119] It should be understood that biological products can be measured by any means known to those skilled in the art.

[0120] In some embodiments, the biological product may be determined, for example, by measuring the amount of biological product produced per unit biomass per unit time. For example, the biological product may be measured, for example, in mmol of biological product produced per liter of fermentation medium per hour. In some embodiments, the transcription unit or synthetic expression system of the Disclosure, or a host cell containing the transcription unit or synthetic expression system of the Disclosure, may produce at least 0.1 mmol, at least 1 mmol, at least 1.5 mmol, at least 2 mmol, at least 2.5 mmol, at least 3, at least 3.5 mmol, at least 4 mmol, at least 4.5 mmol, at least 5 mmol, at least 5.5 mmol, at least 6 mmol, at least 6.5 mmol, at least 7 mmol, at least 7.5 mmol, at least 8 mmol, at least 8.5 mmol, at least 9 mmol, at least 9.5 mmol, or at least 10 mmol of biological product. In some embodiments, the transcription units or synthetic expression systems of the Disclosure, or host cells containing the transcription units or synthetic expression systems of the Disclosure, are present in concentrations of approximately 0.1 to 0.6 mmol, 0.5 to 1 mmol, 0.9 to 1.4 mmol, 1.3 to 1.8 mmol, 1.7 to 2.5 mmol, 2.4 to 2.9 mmol, 2.8 to 3.3 mmol, 3.2 to 3.7 mmol, 3.6 to 4.1 mmol, 4 to 4.5 mmol, and 4.4 mmol. It may produce biological products in amounts of approximately 4.9 mmol, 4.8–5.3 mmol, 5.2–5.7 mmol, 5.6–6.1 mmol, 6–6.5 mmol, 6.4–6.9 mmol, 6.8–7.3 mmol, 7.2–7.7 mmol, 7.6–8.1 mmol, 8–8.5 mmol, 8.4–8.9 mmol, 8.8–9.3 mmol, 9.2–9.7 mmol, or 9.6–10 mmol.In some embodiments, the transcription units or synthetic expression systems of the Disclosure, or host cells containing the transcription units or synthetic expression systems of the Disclosure, may produce biological products in amounts of about 0.1 to about 3 mmol, about 0.5 to about 4 mmol, about 1 to about 4.5 mmol, about 2 to about 5 mmol, about 2.5 to about 5 mmol, about 3 to about 7 mmol, about 3.5 to about 7.5 mmol, about 4 to about 8 mmol, about 4.5 to about 9 mmol, about 5 to about 10 mmol, about 6 to about 10 mmol, about 7 to about 10 mmol, or about 8 to about 10 mmol.

[0121] In some embodiments, the biological product can be determined, for example, by measuring the amount of the biological product transcript produced by the cell per million total transcripts (of any identity) produced by the cell (e.g., "transcript / million"). In some embodiments, the transcription units or synthetic expression systems of the Disclosure, or host cells containing the transcription units or synthetic expression systems of the Disclosure, may produce biological products of at least 300 transcripts per million cells, at least 500 transcripts per million cells, at least 1,000 transcripts per million cells, at least 5,000 transcripts per million cells, at least 10,000 transcripts per million cells, at least 50,000 transcripts per million cells, at least 100,000 transcripts per million cells, at least 300,000 transcripts per million cells, at least 400,000 transcripts per million cells, at least 500,000 transcripts per million cells, or at least 600,000 transcripts per million cells. In some embodiments, the transcription units or synthetic expression systems of the Disclosure, or host cells containing the transcription units or synthetic expression systems of the Disclosure, may produce biological products of more than 600,000 transcripts per million cells.

[0122] In some embodiments, the biological product may be determined, for example, by comparing the quantity or amount of the biological product produced by a host cell containing the synthetic expression system of this disclosure with that of a control host cell. In some embodiments, the synthetic expression system provides production of the biological product encoded by the gene of interest at a higher level than that produced in the control host cell. In some embodiments, the control host cell is a cell containing a methanol-inducible promoter operably linked to the gene of interest, e.g., P(AOX1) of P. pastoris. In some embodiments, the control host cell is a cell containing a methanol-inducible promoter operably linked to the gene of interest, e.g., P(AOX1) of P. pastoris. In some embodiments, the gene of interest encoded by the control host cell is the same gene of interest encoded by a methanol-inducible host cell. In some embodiments, the methanol-inducible promoter of the control host cell is P(AOX1) of P. pastoris. In some embodiments, the control host cell is cultured in the presence of exogenously added methanol. In some embodiments, the control host cells are cells containing P(AOX1) of P. pastoris operably ligated to the same target gene as the target gene of the synthetic expression system, and are cultured in the presence of exogenously added methanol. In some embodiments, the exogenously added methanol induces P(AOX1). In some embodiments, the control host cells and the host cells containing the synthetic expression system are of the same species.

[0123] In some embodiments, the control host cells include the transcription units or synthetic expression systems according to this disclosure, but are cultured under different conditions (e.g., methanol-dependent) than the host cells containing the same transcription units or synthetic expression systems, and the host cells are of the same species. In some embodiments, the control host cells include endogenous transcription units or expression systems cultured under the same or different conditions as the host cells containing the transcription units or synthetic expression systems, and the host cells are of the same species. In some embodiments, the control host cells include transcription units or expression systems expressed in a methanol-dependent manner. In some embodiments, the control host cells are wild-type Pichia pastoris, Komagataella phaffii, Komagataella pastoris, Komagataella pseudopastoris, Hansenula polymorpha, Candida boidinii, or Pichia These are wild-type cells, such as methanolica cells. In some embodiments, the control host cells contain the same transcription units or synthetic expression systems as those expressed in different types of host cells. In some embodiments, the concentration (or quantity, amount, etc.) of the biological product produced by the synthetic expression system of the Disclosure or by host cells containing the synthetic expression system of the Disclosure is at least 1.1 times, at least 1.3 times, at least 1.5 times, at least 1.7 times, at least 1.9 times, at least 2 times, at least 2.5 times, at least 3 times, at least 4 times, at least 5 times, at least 10 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, or at least 100 times higher than the concentration in control host cells. In some embodiments, the concentration (or quantity, amount, etc.) of the biological product produced by host cells containing the synthetic expression system of the Disclosure is 100 times higher than that of the same host cells without the synthetic expression system. In some embodiments, the concentration of the biological product produced by the synthetic expression system of the Disclosure or by a host cell containing the synthetic expression system of the Disclosure is about 1.1 to about 4 times, about 2 to about 10 times, about 5 to about 15 times, about 10 to about 20 times, about 15 to about 30 times, about 25 to about 40 times, about 35 to about 50 times, about 45 to about 60 times, about 55 to about 70 times, about 70 to about 90 times, or about 85 to about 100 times higher than the concentration of the control host cell containing the synthetic expression system or the same host cell without the synthetic expression system.

[0124] In some embodiments, the level (or concentration, quantity, amount, etc.) of the biological product produced by host cells comprising the synthetic expression system of this disclosure is at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, at least 600%, at least 700%, at least 800%, at least 900%, at least 1000%, at least 1100%, at least 1200%, at least 1300%, at least 1400%, and at least 1500%, at least 1600%, at least 1700%, at least 1800%, at least 1900%, at least 2000%, at least 2100%, at least 2200%, at least 23000%, at least 2400%, at least 2500%, at least 2600%, at least 2700%, at least 2800%, at least 2900%, at least 3000%, at least 3200%, at least 3400%, at least 3600%, at least 3800%, at least 4000%, or at least 5000% higher. In some embodiments, the level (or concentration, quantity, amount, etc.) of the biological product produced by host cells including the synthetic expression system of this disclosure is more than 5000% higher than the level of control host cells.

[0125] In some embodiments, the level (or concentration, quantity, amount, etc.) of the biological product produced by the synthetic expression system of this disclosure or by host cells containing the synthetic expression system of this disclosure is approximately 100% to 500%, 300% to 600%, 300% to 800%, 500% to 1000%, 800% to 1200%, and 800% to 150% higher than the level of control host cells. 0%, approximately 1000% to 1500%, approximately 1000% to 2000%, approximately 1200% to 2000%, approximately 1500% to 2000%, approximately 1800% to 2500%, approximately 2000% to 2500%, approximately 2200% to 3000%, approximately 2500% to 3000%, approximately 3000% to 3500%, approximately 3500% to 4000%, approximately 4000% to 4500%, or approximately 4500% to 5000% higher. In some embodiments, the transcription units or synthetic expression systems of the Disclosure, or host cells containing the transcription units or synthetic expression systems of the Disclosure, can produce one or more biological products in concentrations of at least 5 g / L, 10 g / L, at least 15 g / L, at least 20 g / L, at least 25 g / L, at least 30 g / L, at least 35 g / L, or at least 40 g / L. In some embodiments, the transcription units or synthetic expression systems of the Disclosure, or host cells containing the transcription units or synthetic expression systems of the Disclosure, can produce one or more biological products in concentrations greater than 40 g / L. In some embodiments, the transcription units or synthetic expression systems of the Public Disclosure, or host cells containing the transcription units or synthetic expression systems of the Public Disclosure, can produce one or more of the following biological products: approximately 5 g / L to approximately 11 g / L, approximately 9 g / L to approximately 15 g / L, approximately 13 g / L to approximately 19 g / L, approximately 17 g / L to approximately 23 g / L, approximately 21 g / L to approximately 27 g / L, approximately 25 g / L to approximately 31 g / L, approximately 29 g / L to approximately 35 g / L, or approximately 33 g / L to approximately 40 g / L.

[0126] In some embodiments, the transcription units or synthetic expression systems of the Disclosure, or host cells comprising the transcription units or synthetic expression systems of the Disclosure, can produce one or more biological products of at least 5 g / L, 10 g / L, 15 g / L, at least 20 g / L, 25 g / L, at least 30 g / L, at least 35 g / L, or at least 40 g / L under methanol-independent conditions. In some embodiments, the transcription units or synthetic expression systems of the Disclosure, or host cells containing the transcription units or synthetic expression systems of the Disclosure, can produce one or more of the following bioproducts under methanol-independent conditions: approximately 5 g / L to approximately 11 g / L, approximately 9 g / L to approximately 15 g / L, approximately 13 g / L to approximately 19 g / L, approximately 17 g / L to approximately 23 g / L, approximately 21 g / L to approximately 27 g / L, approximately 25 g / L to approximately 31 g / L, approximately 29 g / L to approximately 35 g / L, or approximately 33 g / L to approximately 40 g / L. In some embodiments, the potency of the synthetic expression system is evaluated based on the amount of bioproduct produced during a particular culture phase (e.g., growth phase, production phase, etc.). Excess bioproduct produced during the growth phase may be an indicator of nonspecific or "leaky" promoter activity, which may be undesirable. In some embodiments, the amount of bioproduct produced using the synthetic expression systems of the Disclosure is greater during the production phase than during the growth phase. In some embodiments, the amount of biological product produced during the production phase using the synthetic expression system of this disclosure is greater than the amount that can be produced during the production phase by a control host cell.

[0127] In some embodiments, the amount of biological product produced in the production phase using the synthetic expression system of the Disclosure, or using host cells containing the transcription units or synthetic expression system of the Disclosure, is at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, or at least 500% higher than the amount that can be produced in the production phase by a control host cell. In some embodiments, the amount of biological product produced in the production phase using the synthetic expression system of the Disclosure, or using host cells containing the transcription units or synthetic expression system of the Disclosure, is more than 500% higher than the amount that can be produced in the production phase by a control host cell. In some embodiments, the amount of biological product produced in the production phase using the synthetic expression system of the Disclosure, or using host cells comprising the transcription units or synthetic expression system of the Disclosure, is about 80% to about 120%, about 110% to about 150%, about 140% to about 180%, about 170% to about 220%, about 210% to about 260%, about 250% to about 300%, about 290% to about 340%, about 330% to about 380%, about 370% to about 420%, about 410% to about 460%, or about 450% to about 500% higher than the amount that can be produced in the production phase by a control host cell. In some embodiments, the amount of biological product produced during the production phase using the synthetic expression system of the Disclosure, or using host cells containing the transcription units or synthetic expression system of the Disclosure, is about 1% to about 100%, about 50% to about 150%, about 100% to about 200%, or about 150% to about 200% greater than the amount that can be produced during the production phase by control cells or the same host cells without the synthetic expression system. In some embodiments, the amount of biological product produced using the synthetic expression system of the Disclosure is less during the growth phase than during the production phase. In some embodiments, the amount of biological product produced during the growth phase using the synthetic expression system of the Disclosure is less than the amount produced during the growth phase by control host cells.

[0128] In some embodiments, the amount of biological product produced during the growth phase using the synthetic expression system of the Disclosure, or using host cells containing the transcription units or synthetic expression system of the Disclosure, is at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, or at least 500% less than the amount of biological product produced during the growth phase by control cells or the same host cells without the synthetic expression system. In some embodiments, the amount of biological product produced during the growth phase using the synthetic expression system of the Disclosure, or using host cells containing the transcription units or synthetic expression system of the Disclosure, is about 80% to about 120%, about 110% to about 150%, about 140% to about 180%, about 170% to about 220%, about 210% to about 260%, about 250% to about 300%, about 290% to about 340%, about 330% to about 380%, about 370% to about 420%, about 410% to about 460%, or about 450% to about 500% less than the amount of biological product produced during the growth phase by control cells or the same host cells without the synthetic expression system.

[0129] In some embodiments, the efficiency of the synthetic expression system of the Disclosure, or a host cell containing the transcription unit or synthetic expression system of the Disclosure, may be expressed as the ratio of the biological product expressed during the growth phase to the biological product expressed during the production phase (e.g., 1:1, 1:2, 1:3, etc.). In some embodiments, using the synthetic expression system of the Disclosure, or using a host cell containing the transcription unit or synthetic expression system of the Disclosure, the ratio of the biological product expressed during the growth phase to the biological product expressed during the production phase may be approximately 1:1.1, approximately 1:1.2, approximately 1:1.3, approximately 1:1.4, approximately 1:1.5, approximately 1:1.6, approximately 1:1.7, approximately 1:1.8, approximately 1:1.9, approximately 1:2, 1:3, The ratios are 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, 1:100, approximately 1:110, approximately 1:130, approximately 1:130, approximately 1:140, approximately 1:150, approximately 1:160, approximately 1:170, approximately 1:180, approximately 1:190, or approximately 1:200 (or any ratio contained within these). In some embodiments, using the synthetic expression system of the Disclosure or a host cell containing the transcription unit or synthetic expression system of the Disclosure, the ratio of the biological product expressed during the growth phase to the biological product expressed during the production phase is approximately 1:1.1 to approximately 1:10, approximately 1:9.5 to approximately 1:20, approximately 1:10 to approximately 1:40, approximately 1:30 to approximately 1:60, approximately 1:50 to approximately 1:80, approximately 1:70 to approximately 1:100, approximately 1:100 to approximately 1:140, approximately 1:140 to approximately 1:170, approximately 1:160 to approximately 1:190, or approximately 1:180 to approximately 1:200. In some embodiments, using the synthetic expression system of the Disclosure or a host cell containing the transcription unit or synthetic expression system of the Disclosure, the ratio of biological products expressed during the growth phase to biological products expressed during the production phase is approximately 1:10 to approximately 1:50, approximately 1:25 to approximately 1:75, approximately 1:50 to approximately 1:100, approximately 1:75 to approximately 1:125, approximately 1:100 to approximately 1:150, or approximately 1:150 to approximately 1:200.

[0130] In some embodiments, any of the methods described herein may include isolation and / or purification of the product of the expression of the gene of interest (e.g., a protein and / or nucleic acid). For example, isolation and / or purification may include one or more of cell lysis, centrifugation, extraction, column chromatography, distillation, crystallization, and lyophilization.

[0131] Any synthetic expression system, host cells expressing any synthetic expression system disclosed herein, or products produced by any in vitro method described herein may be identified, isolated, extracted, and / or purified using any method known in the art. Mass spectrometry (e.g., LC-MS, GC-MS) is a non-limiting example of an identification method and may be used to analyze the chemical composition and / or chemical structure and / or concentration of a compound of interest.

[0132] Cell-free expression In some embodiments, the transcription units or synthetic expression systems of this disclosure are components of a cell-free expression system. In some embodiments, the transcription units or synthetic expression systems of this disclosure are used to produce one or more biological products in a cell-free expression system. Exemplary cell-free expression systems include cell extracts prepared from Escherichia coli (ECE), rabbit reticulocytes (RRL), wheat germ (WGE), insect cells (ICE), or yeast Kluyveromyces (D2P system).

[0133] host cell In some embodiments, the Disclosure provides a host cell comprising a transcription unit or a synthetic expression system. Either the transcription unit or synthetic expression system of the Disclosure may be used in a host cell.

[0134] The transcription units or synthetic expression systems described in this application can be introduced into suitable host cells using any method known in the art.

[0135] In some embodiments, the host cell includes a transcription unit or synthetic expression system integrated into the host cell genome. In some embodiments, the synthetic expression system includes one copy of a first transcription unit and one copy of a second transcription unit. The amounts of the first and second transcription units can be expressed as the ratio of the first transcription unit to the second transcription unit, or as the ratio of the second transcription unit to the first transcription unit (i.e., the "copy number ratio"). In some embodiments, the copy number ratio of the second transcription unit to the first transcription unit is 1:1.

[0136] In some embodiments, the host cell contains multiple copies of the transcription unit or synthetic expression system. In some embodiments, the first or second transcription unit exists in multiple copies. In some embodiments, both the first and second transcription units exist in multiple copies. In some embodiments, the synthetic expression system contains two or more copies of the first transcription unit; and / or two or more copies of the second transcription unit. In some embodiments, the copy number ratio of the second transcription unit to the first transcription unit is at least 2:1, at least 3:1, at least 4:1, at least 5:1, at least 10:1, at least 20:1, or at least 30:1. In some embodiments, the copy number ratio of the first transcription unit to the second transcription unit is at least 2:1, at least 3:1, at least 4:1, at least 5:1, at least 10:1, at least 20:1, or at least 30:1.

[0137] In some embodiments, the first transcription unit exists as a single copy within the host genome, while the second transcription unit exists as multiple copies.

[0138] In some embodiments, the synthetic expression system includes one or more sequences that are endogenous to the host cell.

[0139] “Host cell” refers to a cell that can be used to express a transcription unit or synthetic expression system and its precursor. In some embodiments, the host cell is a Pichia pastoris, Pichia pseudopastoris, Komagataella phaffii, Pichia stipitis, Pichia membranifaciens, Komagataella pastoris, Komagataella pseudopastoris, Komagataella kurtzmanii, Komagataella mondaviorum, Hansenula polymorpha, Candida boidinii, or Pichia methanolica cell. In some embodiments, it is understood that the host cell refers not only to the specific recombinant host into which the transcription unit or synthetic expression system is introduced, but also to the offspring or potential offspring of such a host cell. As used in this application, the term “cell” may refer to a single cell or a population of cells, e.g., the same cell line or population of cells belonging to the same cell line. The use of the singular term “cell” should not be interpreted as explicitly referring to a single cell rather than a population of cells.

[0140] Any suitable host cell, including eukaryotic or prokaryotic cells, can be used to express the transcription units or synthetic expression systems disclosed herein. Suitable host cells include, but are not limited to, animal cells, including fungal cells (e.g., yeast cells), bacterial cells (e.g., Escherichia coli cells), algal cells, plant cells, insect cells, and mammalian cells.

[0141] In some embodiments, the host cell is a yeast cell. In some embodiments, the host cell is methylotropic. A “methylotropic cell” is one that naturally (i.e., before any human manipulation) has the ability to utilize reduced one-carbon compounds such as methanol or methane, and carbon-carbon-free polycarbon compounds such as dimethyl ether and dimethylamine, as carbon sources for its growth. Methylotropic cells are known in the art and include, for example, those of the genera Pichia, Komagataella, Hansenula, and Candida. While host cells that are naturally methylotropic include, for example, those of the genera Pichia, Komagataella, Hansenula, or Candida, host cells that have been rendered incapable of utilizing methanol by manipulation are still considered methylotropic host cells for the purposes of this disclosure.

[0142] In some embodiments, the host cell is a member of the genera Pichia, Komagataella, Candida, Dipodascus, Galactomyces, Hansenula, Kluyveromyces (e.g., K. lactis), Magnusiomyces, Ogatae, Phaffomyces, Saccharomyces (e.g., S. cerevisiae), Schizosaccharomyces, Starmera, Starmerella, Sugiyamaella, Trichomonascus, Wickerhamomyces, Wickerhamiella, Williopsis, Yarrowia, or Zygoascus; or a member of the Komagataella Clade, Phaffomyces Clade, Dipodascaceae, Phaffomycetaceae, or Trichomonasceae. In some embodiments, the host cell is a member of the genus Pichia or Komagataella. In some embodiments, the host cells are Pichia pastoris, Pichia pseudopastoris, Pichia stipitis, Pichia membranifaciens, Pichia methanolica, Pichia finlandica, Pichia trehalophila, Pichia kodamae, Pichia opuntiae, Pichia thermotolerans、Pichia salictaria、Pichia quercuum、Pichia pijperi、Pichia angusta、Komagataella phaffii、Komagataella pastoris、Komagataella pseudopastoris、Komagataella kurtzmanii、Komagataella mondaviorum、Wickerhamomyces anomalus、Candida albicans、Candida lusitaniae、Ogataea glucozyma、Candida blankii、Candida boidinii、Candida orba、Candida petrohuensis、Candida santjacobensis、Candida sorboxylosa、Candida sp.、Dipodascus albidus、Galactomyces geotrichum、Hansenula polymorpha、Kluyveromyces lactis、Magnusiomyces magnusii、Phaffomyces antillensis、Phaffomyces opuntiae、Phaffomyces thermotolerans、Saccharomyces cerevisiae、Saccharomyces carlsbergensis、Saccharomyces diastaticus、Saccharomyces norbensis、Saccharomyces kluyveri、Schizosaccharomyces pombe、Starmerella bombicola、Sugiyamaella smithiae、Trichomonascus petasosporus、Wickerhamiella domercqiae、Yarrowia The host cell is either lipolytica or Zygoascus hellenicus. In some embodiments, the host cell is an undescribed species of Pichia or Komagataella. In some embodiments, the host cell is a Pichia species or a Komagataella species.

[0143] In some embodiments, the yeast strain is an industrial yeast strain. In some embodiments, the host cell is a fungal cell. In some embodiments, the fungal cell includes cells of the species Aspergillus, Penicillium, Fusarium, Rhizopus, Acremonium, Neurospora, Sordaria, Magnaporthe, Allomyces, Ustilago, Botrytis, or Trichoderma.

[0144] While we do not wish to be bound by any particular theory, this disclosure notes that some reports in the scientific literature have reassigned P. pastoris to the genus Komagataella, and that various strains of P. pastoris have been separated into K. phaffii, K. pastoris, and K. pseudopastoris. In some embodiments, Pichia pastoris is identical to Komagataella phaffii, and Komagataella phaffii is its former species name Pichia It is sometimes referred to as pastoris. In use in this disclosure, Pichia pseudopastoris is interchangeable with Komagataella pseudopastoris. These various genera and species, as well as the relationships between them, are discussed in scientific literature, e.g., Feng et al. 2020 Yeast 37(2):237-245; De Schutter et al. 2009 Nature Biotechnology. 27(6):561-566; Heistinger et al. 2018 Molecular and Cellular Biology 38 Issue 2 e00398-17; Kurtzman International Journal of Systematic and Evolutionary Microbiology (2005), 55:973-976; Kurtzman 2011 This information is described in Antonie van Leeuwenhoek 99:13-23; Kurtzman 2013 Antonie van Leeuwenhoek 104:339-347; Kurtzman 2012 Antonie van Leeuwenhoek 101:859-868; Naumov 2018 Antonie van Leeuwenhoek 111:1197-1207; and Yamada et al. 1995 Biosci. Biotech. Biochem. 59:439-444.

[0145] In some embodiments, the host cells are algal cells such as Chlamydomonas (e.g., C. reinhardtii) and Phormidium (P. sp. ATCC29409).

[0146] In some embodiments, the host cell is a prokaryotic cell. Suitable prokaryotic cells include Gram-positive, Gram-negative, and Gram-variable bacterial cells.

[0147] Various strains that may be used as host cells in the implementation of this disclosure include American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research It is readily available from numerous culture collections, including the Service Patent Culture Collection and the Northern Regional Research Center (NRRL).

[0148] In addition to possessing transcription units, host cells may undergo genetic modification relative to their wild-type counterparts. In some embodiments, host cells are modified to reduce or inactivate one or more endogenous genes. Reduction of gene expression and / or gene inactivation can be achieved by any suitable method, including but not limited to gene deletion, introduction of point mutations into genes, gene cleavage, introduction of insertions into genes, introduction of tags or fusion into genes, or selective editing of genes. For example, methods based on polymerase chain reaction (PCR) may be used (see, e.g., Gardner et al., Methods Mol Biol. 2014;1205:45-78), or gene editing techniques may be used. In a non-limiting example, genes may be deleted by gene substitution (e.g., using markers containing a selection marker). Genes may also be cleaved by the use of transposon systems (see, e.g., Poussu et al., Nucleic Acids Res. 2005;33(12):e104).

[0149] Those skilled in the art will understand that the transcription units or synthetic expression systems of this disclosure can be constructed in a variety of ways within the host cell genome (e.g., on the same or different polynucleotide sequences; on the same or different chromosomes; or oriented in the 5' or 3' direction relative to the primary direction of transcription mediated by the promoters of the first and second transcription units).

[0150] In some embodiments, the synthetic expression system (including, for example, a first transcription unit and a second transcription unit) is located on a single plasmid. In some embodiments, the first transcription unit and the second transcription unit are located on a single plasmid. In some embodiments, the synthetic expression system is located on two or more (e.g., different) plasmids. In some embodiments, the first transcription unit and the second transcription unit are located on two or more (e.g., different) plasmids. For example, in some embodiments, the first transcription unit is located on a first plasmid and the second transcription unit is located on a second plasmid.

[0151] In some embodiments, the synthetic expression system is located on a single chromosome in the host cell genome. In some embodiments, the components of the synthetic expression system are located on two or more (e.g., different) chromosomes in the host cell genome. In some embodiments, the first and second transcription units are located on the same chromosome in the host cell genome. In some embodiments, the synthetic expression system is located on two or more (e.g., different) chromosomes in the host cell genome. In some embodiments, the first and second transcription units are located on two or more (e.g., different) chromosomes in the host cell genome.

[0152] In some embodiments, the first and second transcription units are oriented in the same direction (e.g., oriented in the same 5' or 3' direction with respect to the primary direction of transcription mediated by the promoters of the first and second transcription units). In some embodiments, the first and second transcription units are oriented in different directions (e.g., oriented in the 5' or 3' direction with respect to the primary direction of transcription mediated by the promoters of the first and second transcription units). In some embodiments, multiple different first and / or second transcription units may be present in the host cell, and they may be oriented in any direction relative to each other. In some embodiments, the host cell may be manipulated for synthetic protein expression, and such manipulation includes transforming the host cell with one or more polynucleotides comprising a synthetic expression system. Any synthetic expression system of this disclosure may be used.

[0153] Host cells can be cultured under any suitable conditions, including but not limited to the culture conditions described herein. For example, any culture medium, temperature, and incubation conditions known in the art can be used. Exemplary culture conditions are provided herein, including methanol-independent conditions. In the case of host cells with an inducible vector, the cells can be cultured with a suitable inducer to promote expression.

[0154] Expression of the target gene in host cells This disclosure encompasses the expression of a target gene by a synthetic expression system in a host cell. In some embodiments, the method by which the target gene is expressed in a host cell includes culturing the host cell. The host cell may be any host cell of this disclosure.

[0155] In some embodiments, the target gene to be expressed is synthetic. In some embodiments, the synthetic gene to be introduced into a host cell may be a polynucleotide derived from a different organism, genus, or species than the host cell; or a synthetic, engineered, or chimeric polynucleotide; or a polynucleotide that is similarly endogenously expressed in the same organism or species as the host cell but has been altered. For example, a polynucleotide that is endogenously present in a host cell may be considered synthetic if it is modified to be located unnaturally within the host cell; if it is recombinantly expressed in the host cell, either stably or transiently; if it is modified within the host cell; if it is selectively edited within the host cell; if it is expressed at a copy number different from the copy number present naturally within the host cell; or if it is expressed in an unnatural manner within the host cell, such as by manipulating a regulatory region that controls the expression of the polynucleotide.

[0156] In some embodiments, the synthetic gene of interest is a polynucleotide that is endogenously present in the host cell but whose expression is driven by a promoter that does not naturally regulate the expression of the polynucleotide. In some embodiments, the synthetic gene of interest is a polynucleotide that is endogenously present in the host cell and whose expression is driven by a promoter that naturally regulates the expression of the polynucleotide, and the promoter is modified. In some embodiments, the promoter is activated or repressed by recombination. For example, gene editing-based techniques can be used to regulate the expression of a polynucleotide containing an endogenous polynucleotide from a promoter containing an endogenous promoter. See, for example, Chavez et al., Nat Methods. 2016 Jul;13(7):563-567. The synthetic gene of interest may contain a variant sequence compared to a reference polynucleotide sequence; or it may contain a wild-type sequence that is not possible in a wild-type situation within the genome (e.g., a wild-type sequence that is not normally expressed, but is expressed in / by the host cell or at a chromosomal location).

[0157] In some embodiments, the gene of interest encodes a heme-binding protein or one or more enzymes in the heme biosynthesis pathway. In some embodiments, the heme-binding protein is hemoglobin, myoglobin, neuroglobin, cytoglobin, or leghemoglobin. In some embodiments, the heme-binding protein is myoglobin. In some embodiments, one or more enzymes in the heme biosynthesis pathway are cytochrome P450, 9-adenylate cyclase, soluble guanylate cyclase, peroxidase, catalase, and / or cytochrome oxidase. In some embodiments, the gene of interest encodes a vaccinia capting enzyme, a T7 polymerase enzyme, or an O-methyltransferase enzyme.

[0158] In some embodiments, the coding sequence of the gene of interest may be codon-optimized for expression in specific host cells, including but not limited to Pichia pastoris, Pichia pseudopastoris, Komagataella phaffii, Pichia stipitis, Pichia membranifaciens, Komagataella pastoris, Komagataella pseudopastoris, Komagataella kurtzmanii, Komagataella mondaviorum, Hansenula polymorpha, Candida boidinii, or Pichia methanolica.

[0159] Culture of host cells In some embodiments, the disclosure relates to a host cell comprising a transcription unit or synthetic expression system, wherein, when the host cell is cultured, the unit or system within the host cell can produce a biological product (e.g., a molecule of interest). In some embodiments, the biological product is obtained from biomass or culture. In some embodiments, obtaining the biological product includes extracting the biological product from biomass. In some embodiments, obtaining the biological product includes recovering the biological product from culture medium.

[0160] In some embodiments, a method is provided for producing a biological product, comprising the steps of: expressing a gene of interest by culturing host cells; purifying an enzyme encoded by the gene of interest; and using the purified enzyme for the bioconversion of a substrate into a molecule of interest. In some embodiments, the molecule of interest is heme.

[0161] Any host cells containing the synthetic expression systems disclosed in this application can be cultured using any method and any type of culture medium known in the art (e.g., rich and / or minimal and / or nutrient-restricted) to control the timing and / or level of production of the biological product.

[0162] In some embodiments, culture can be carried out over several phases, and it may be desirable to restrict the expression of the gene of interest until later phases, such as the production phase, because the expression or high expression of the gene of interest may cause toxicity and / or reduce cell proliferation in other ways. While we do not wish to be bound by any particular theory, this disclosure notes that even in relatively tightly controlled genetic systems, low or basal levels of expression of the gene of interest may occur before the production phase, but if such expression results in toxicity, the cells and synthetic expression systems may be maintained under conditions that reduce expression to the lowest level technically feasible.

[0163] As a non-limiting example, the culture conditions of host cells, including those in synthetic expression systems, can be modified to the production phase so that input promoters are induced and high levels of expression of the target gene are achieved through the action of transcription factors and synthetic output promoters.

[0164] In some embodiments, the input promoter can be activated by restricting nutrients during the production phase or by another modification of the culture conditions, thereby inducing the promoter and increasing the expression of the gene of interest. In some embodiments, the expression of the gene of interest can be further increased by adding a second nutrient.

[0165] In some embodiments, the input promoter is constitutively active and cannot be activated by nutrient restriction or other changes in culture conditions.

[0166] In some embodiments, host cells containing the synthetic expression systems disclosed herein are cultured in methanol-independent media or using methanol-independent methods. “Methanol-independent” or “methanol-free” with respect to media, culture conditions, transcription units, synthetic expression systems, etc., means that no exogenous methanol is added to the media. While not wishing to be bound by any particular theory, this disclosure notes that under certain culture conditions, some host cells may endogenously produce small amounts of methanol, but such methanol is disregarded when considering whether the media is methanol-free or not. “Methanol-independent” means that the synthetic expression system operates within the host cell independently of exogenous methanol added to the media, and the addition of exogenous methanol is not required for the function of the synthetic expression system. The fact that under certain culture conditions, some host cells may endogenously produce small amounts of methanol is disregarded when considering whether the system is methanol-independent or methanol-dependent.

[0167] In some embodiments, a method is provided for expressing a gene of interest or producing a molecule of interest, comprising the steps of (a) culturing host cells in a suitable medium for a period of time that allows for cell proliferation, according to the method of the present disclosure, and (b) modifying the culture conditions by 1 or more to promote the expression of the gene of interest or the production of the molecule of interest. In some embodiments, modifying the culture conditions includes modifying the composition of the culture medium. In some embodiments, modifying the culture conditions includes restricting or depleting nutrients such as thiamine, glycerol, 1 or more monosaccharides, and / or formic acid. In some embodiments, modifying the culture conditions includes restricting any of the following: carbon sources, sugars, starch, galactose, maltose, glucose, sorbitol, inositol, glycerol, vitamins, steroids, nitrogen sources, nitrates, nitrites, ammonium, amino acids, methionine, heavy metals, copper, benzoic acid, hydrogen peroxide, calcium-containing compounds, and / or phosphates. In some embodiments, modifying the culture conditions includes restricting any combination of two nutrients. In some embodiments, modifying the culture conditions includes adding formic acid.

[0168] In some embodiments, the culture of host cells including a synthetic expression system is carried out over several phases or stages. The terms “stage” and “phase” are used interchangeably in this application.

[0169] In some embodiments, host cell culture is carried out in stages I, II, and III.

[0170] In some embodiments, in stage I (also known as the batch stage), host cells containing a synthetic expression system are first inoculated into fresh sterile medium. After the growth period, the culture from stage I is ready for the next phase.

[0171] In some embodiments, during stage II (also known as the cell proliferation phase), the culture grows and biomass increases. In some embodiments, cell proliferation is exponential in at least part of stage II.

[0172] In some embodiments, during stage III (also known as the production phase or induction phase), the synthetic expression system is induced to express the gene of interest if it has not yet been induced. In some embodiments, the synthetic expression system is not induced during stage I or II, but is induced during stage III, enabling high expression of the gene of interest. In some embodiments, an additional component is added to the culture medium during the production phase. In some embodiments, the additional component is a nutrient. In some embodiments, the additional component further increases expression from the input promoter. In some embodiments, the additional component is formic acid or methanol.

[0173] Various stages can also be performed using the same or different growth media, volume, duration, temperature (e.g., 30°C, 35°C, 37°C, or 42°C), pH level (e.g., acidic, slightly acidic, neutral, slightly basic, or basic), stirring level, aeration level, dissolved oxygen level, restriction nutrient level, supplement nutrient level and / or concentration and / or flow rate, conditions, etc.

[0174] As is known in the art, and to accommodate differences in culture volume and cell density, the various steps can occur in any container and do not need to occur in containers of the same type or size.

[0175] In some embodiments, host cells can be cultured in an industrial-scale process. In some embodiments, the industrial-scale process is operated in continuous, semi-continuous, or discontinuous mode. Non-limiting examples of operating modes include batch, feed batch, extension batch, repeat batch, suction / fill, rotating wall, spinning flask, and / or perfusion operating modes.

[0176] In some embodiments, the bioreactor, fermenter, or other vessel comprises sensors and / or a control system for measuring and / or adjusting reaction parameters. Non-limiting examples of reaction parameters include biological parameters (e.g., growth rate, cell size, cell number, cell density, cell type, or cell state, etc.), chemical parameters (e.g., pH, redox potential, concentration of reaction substrate and / or product, concentration of dissolved gas, nutrient concentration, metabolite concentration, etc.), and physical / mechanical parameters (e.g., density, conductivity, degree of agitation, pressure, and flow rate, etc.).

[0177] The medium can include, but is not limited to, potassium, potassium monobasic phosphate, ammonium, ammonium sulfate, calcium, calcium sulfate dihydrate, potassium sulfate, magnesium, magnesium sulfate heptahydrate, trace metals, PTM4 solution, copper, copper(II) sulfate pentahydrate, sodium iodide, manganese, manganese(II) sulfate monohydrate, sodium, molybdenum, sodium molybdate dihydrate, boric acid, cobalt, cobalt(II) chloride (anhydrous), zinc, zinc chloride (anhydrous), iron, iron(II) sulfate heptahydrate, biotin, sulfate, sulfuric acid, water, and any other optional nutrients (which may be present, present abundantly, present excessively, or limited (e.g., the nutrients may not be present in the medium or not added exogenously)). The medium can be sterilized by any method known in the art. In some embodiments, the culture medium contains a carbon source. In some embodiments, the carbon source(s) during fermentation (e.g., during the growth phase such as phase I and / or phase II) is glucose; glycerol and / or sorbitol; or glycerol and / or sorbitol. Various non-limiting examples of the culture medium are described in the examples. Various culture media suitable for various vessels, purposes, and host cells are described herein and / or generally known in the art.

[0178] As described in detail below, in some embodiments, an input promoter (e.g., in a synthetic expression system) is inducible (e.g., can be induced by nutrient depletion). In some embodiments, nutrients are abundant or excessive in stages I and II (e.g., when the input promoter is not induced), but limited in stage III (e.g., when the input promoter is induced and the target gene is highly expressed). In some embodiments, nutrients are added as a bolus in stage I and / or stage II (e.g., when the input promoter is not induced), but restricted in stage III. In some embodiments, nutrients can be depleted.

[0179] "Restriction" means that a nutrient or other culture additive is consumed at a rate equal to or faster than it is exogenously added. "Depletion" means that an exogenously added nutrient or other culture additive is partially or completely consumed.

[0180] In some cases, the limiting nutrient contains carbon. Thus, "nutrient restriction" (and similar phrases) can also be referred to as "carbon restriction". In some embodiments, the act of restricting nutrients (e.g., during production) is referred to as induction. In some embodiments, the condition of nutrient restriction does not require the complete absence of nutrients.

[0181] In some embodiments, the nutrients that can be depleted or restricted are inositol, methionine, phosphate, glucose, glycerol or thiamine. In some embodiments, under conditions of nutrient restriction or depletion, the nutrients are provided or supplied in the culture medium (e.g., at low or medium levels), but the host cells consume the nutrients at a rate faster than they are supplied, so that there are no free (or detectable) levels of nutrients available in the culture medium.

[0182] In some embodiments, under conditions where nutrient limitations are not met, nutrients are provided or supplied to the culture medium (e.g., at high levels or in excess), and host cells consume the nutrients at a slower rate than they are supplied, so that there are available free (or detectable) levels of nutrients in the culture medium.

[0183] A person skilled in the art, possessing basic knowledge of host cells (as well as their biochemistry and proliferation patterns) and understanding synthetic expression systems at any given cell density or biomass density, can, as desired, calculate, predict, and / or monitor the rate at which specific nutrients are supplied to the culture medium to achieve conditions where nutrients are limited or depleted, or where nutrients are not limited.

[0184] In some embodiments, the culture process includes a batch phase in which nutrients are maintained in excess, and a fed-batch phase in which the culture is supplied in stages to maintain the excess levels of nutrients. In some embodiments, dissolved oxygen levels can provide an indicator of nutrient levels. For example, nutrient depletion may result in an increase in dissolved oxygen, such an increase may trigger a fed-batch phase, in which the culture is supplied in stages to maintain the excess levels of nutrients. In some embodiments, the input promoter is induced by glucose depletion, which may induce a sudden spike in dissolved oxygen. In some embodiments, the batch phase can be considered the final part of stage I, followed by a fed-batch phase in stage II. In some embodiments, the batch phase can be considered the first part of stage II, followed by a fed-batch phase in the second part of stage II.

[0185] Aspects of this disclosure relate to the production of proteins and / or nucleic acids expressed from a gene of interest under methanol-independent fermentation conditions. In some embodiments, the input promoter of a first transcription unit and / or the output promoter of a second transcription unit are inductive promoters. In some embodiments, the inductive promoter is responsive (e.g., inductive) in the absence of methanol. In some embodiments, the inductive promoter responds to nutrient restriction, addition, or depletion related to the gene culture process.

[0186] In some embodiments, the input promoter is responsive to thiamine depletion. In some embodiments, the input promoter is responsive to glycerol depletion. In some embodiments, the input promoter is responsive to glucose restriction. In some embodiments, the input promoter is responsive to formic acid restriction. In some embodiments, the inductive promoter is responsive to monosaccharide restriction. In some embodiments, the inductive promoter is responsive to restriction of carbon sources, sugars, starch, galactose, maltose, glucose, dextrose, sorbitol, inositol, glycerol, methionine, vitamins, phosphate, steroids, nitrogen sources, nitrate, nitrite, ammonium, amino acids, methionine, metals (e.g., heavy metals), copper, benzoic acid, hydrogen peroxide, calcium-containing compounds, alcohols, methanol, tetracycline, steroids, and / or phosphate. Various inductive promoters are known in the art. In some embodiments, the inducible promoter responds to the presence or addition (e.g., an excess of any of the following) of nutrients, antibiotics, tetracycline, doxycycline, sugars, starch, galactose, maltose, glucose, sorbitol, inositol, glycerol, formic acid, vitamins, steroids, nitrogen sources, nitrate, nitrite, ammonium, amino acids, methionine, ions, sodium, and / or phosphate.

[0187] In some embodiments, a single restriction nutrient is used. In some embodiments, the inductive promoter responds to restriction of a combination of nutrients (e.g., two nutrients, or more than two nutrients) (e.g., during the production phase of a host cell culture, including a synthetic expression system). In some embodiments, a combination of restriction nutrients is used. In some embodiments, the inductive promoter responds to restriction of a combination of nutrients including, but not limited to, glycerol, glucose, and thiamine, or the combination is glycerol and formic acid; glucose and formic acid; or glucose and thiamine. In some embodiments, the activity of the inductive promoter is increased by the presence of formic acid. In some embodiments, the promoter response is activation (e.g., once induced). In some embodiments, the promoter response is repression (e.g., once induced).

[0188] In some embodiments, more than one nutrient can be restricted or depleted, and any method or composition useful for culturing host cells under controlled conditions of restriction or depletion of a single nutrient can be combined, replicated, and / or modified for use when culturing host cells under controlled conditions of restriction or depletion of two or more nutrients.

[0189] In some embodiments, the nutrients that are simultaneously restricted during the production phase are thiamine and glucose. In some embodiments, glucose may be restricted while thiamine may be depleted.

[0190] In some embodiments, the limiting nutrient is inositol; the carbon source(s) during fermentation (e.g., growth phases such as stage I and / or stage II) is glucose, glycerol, or sorbitol; and the input promoter P(in) is P(INO1).

[0191] In some embodiments, the limiting nutrient is methionine; the carbon source(s) during fermentation (e.g., growth phases such as stage I and / or stage II) is glucose, glycerol, or sorbitol; and the input promoter P(in) is P(MET6), P(SAH1), P(SAM2), or P(MXR1).

[0192] In some embodiments, the limiting nutrient is phosphate; the carbon source(s) during fermentation (e.g., growth phases such as stage I and / or stage II) is glucose, glycerol, or sorbitol; and the input promoter P(in) is P(PHO89).

[0193] In some embodiments, the restriction nutrient is glucose; the carbon source(s) during fermentation (e.g., growth phases such as stage I and / or stage II) is glycerol or sorbitol; and the input promoter P(in) is one of the various promoters that can be induced by the restriction glucose described herein.

[0194] In some embodiments, the restricting nutrient is glycerol; the carbon source(s) during fermentation (e.g., growth phases such as stage I and / or stage II) is glucose or sorbitol; and the input promoter P(in) is one of the various promoters that can be induced by the restricting glycerol described herein.

[0195] In some embodiments, the inductive promoter is a chemically modified promoter.

[0196] In some embodiments, the inductive promoter is a physically modulated promoter, for example, whose transcriptional activity is modulated by changes in culture conditions, including but not limited to changes in light (e.g., light frequency, light wavelength, light intensity, light duration, light / dark cycle), temperature (e.g., heat shock or cold shock promoter), pressure, gravity, pH (acidic or basic conditions), salinity, or any other physical conditions. In some embodiments, if the input promoter is a physically modulated promoter, during the production phase of a host cell culture including a synthetic expression system, the culture conditions (e.g., light or temperature) can be changed during the production phase to activate the input promoter and result in high expression of the gene of interest.

[0197] Example 1 presents various non-limiting examples of synthetic expression systems, as well as various culture conditions (Processes 1, 2, and 3) useful for culturing host cells containing these systems and expressing biological products.

[0198] Table 1 shows designs for non-restrictive combinations of synthetic expression systems. These are particularly useful for the manufacturing process by Process 1, in which glycerol is restricted and formic acid is added.

[0199] In some embodiments, promoters are homologous with respect to the production process. In some embodiments, an input promoter is homologous with respect to a specific production process (e.g., a process described herein, such as process 1, process 2, or process 3) if the input promoter is activated in the process under specific culture steps or conditions (e.g., glycerol restriction + formic acid addition for process 1; glucose restriction + formic acid addition for process 2; and glucose restriction + thiamine depletion for process 3).

[0200] In some embodiments, the output promoter is cognate with respect to the transcription factor. In some embodiments, a particular output promoter is cognate with respect to a particular transcription factor [e.g., a transcription factor (TF) or a synthetic transcription factor (sTF)] in that the transcription factor activates transcription from the output promoter.

[0201] In some embodiments, a synthetic transcription factor (sTF) is described as being based on a wild-type transcription factor in that a portion of the sTF (e.g., a DNA binding domain or TAD) can be derived from the corresponding portion of the wild-type transcription factor or can be a variant of the corresponding portion of the wild-type transcription factor (e.g., the sTF can be a Bm3R1-based sTF). In some embodiments, a synthetic output promoter is cognate (e.g., is cognate therewith) with respect to a particular sTF in that the output promoter can be activated by the sTF. In a non-limiting example, a synthetic output promoter that is cognate with respect to an sTF can include an operator that is bound by the DNA binding domain of the sTF.

[0202] In some embodiments, the synthetic expression system includes an input promoter that is cognate with respect to Process 1 (e.g., as described in Table 4); a one-component Bm3R1-based sTF, Table 7; any transcription terminator, Table 19; any spacer, Table 20; a synthetic output promoter that is cognate with respect to the Bm3R1-based sTF, Table 15; and a gene of interest.

[0203] In some embodiments, the synthetic expression system includes an input promoter that is cognate with respect to Process 1 (e.g., as described in Table 4); a one-component PhlF_AM-based sTF, Table 8; any transcription terminator, Table 19; any spacer, Table 20; a synthetic output promoter that is cognate with respect to the PhlF_AM-based sTF, Table 16; and a gene of interest. phIF_AM refers to phIF as described in Meyer et al. 2019 Nat. Chem. Biol. 15:196 AM or a variant or derivative thereof.

[0204] In some embodiments, the synthetic expression system comprises a congeneral input promoter with respect to process 1 (e.g., listed in Table 4); a one-component TetR-based sTF, Table 9; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter with respect to the TetR-based sTF, Table 17; and the gene of interest.

[0205] In some embodiments, the synthetic expression system comprises a congeneral input promoter with respect to process 1 (e.g., listed in Table 4); a one-component VanR_AM-based sTF, Table 10; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter with respect to the VanR_AM-based sTF, Table 18; and the gene of interest. VanR_AM is VanR_AM as described in Meyer et al. 2019 Nat. Chem. Biol. 15:196. AM This refers to either a variant or derivative thereof.

[0206] In some embodiments, the synthetic expression system comprises a congeneral input promoter for process 1 (e.g., listed in Table 4); a two-component Bm3R1-based sTF, Table 11; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the Bm3R1-based sTF, Table 15; and the gene of interest.

[0207] In some embodiments, the synthetic expression system comprises a congeneral input promoter for process 1 (e.g., listed in Table 4); a two-component PhlF_AM-based sTF, Table 12; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the PhlF_AM-based sTF, Table 16; and the gene of interest.

[0208] In some embodiments, the synthetic expression system comprises a congeneral input promoter with respect to process 1 (e.g., listed in Table 4); a two-component TetR-based sTF, Table 13; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter with respect to the TetR-based sTF, Table 17; and the gene of interest.

[0209] In some embodiments, the synthetic expression system comprises a congeneral input promoter for process 1 (e.g., listed in Table 4); a two-component VanR_AM-based sTF, Table 14; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the VanR_AM-based sTF, Table 18; and the gene of interest.

[0210] Table 2 shows designs for non-restrictive examples of synthetic expression systems. These are particularly useful for the manufacturing process using Process 2, in which glucose is restricted and formic acid is added.

[0211] In some embodiments, the synthetic expression system comprises a congeneral input promoter for process 2 (e.g., listed in Table 5); a one-component Bm3R1-based sTF, Table 7; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the Bm3R1-based sTF, Table 15; and the gene of interest.

[0212] In some embodiments, the synthetic expression system comprises a congeneral input promoter for process 2 (e.g., listed in Table 5); a one-component PhlF_AM-based sTF, Table 8; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the PhlF_AM-based sTF, Table 16; and the gene of interest.

[0213] In some embodiments, the synthetic expression system comprises a congeneral input promoter with respect to process 2 (e.g., listed in Table 5); a one-component TetR-based sTF, Table 9; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter with respect to the TetR-based sTF, Table 17; and the gene of interest.

[0214] In some embodiments, the synthetic expression system comprises a congeneral input promoter for process 2 (e.g., listed in Table 5); a one-component VanR_AM-based sTF, Table 10; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the VanR_AM-based sTF, Table 18; and the gene of interest.

[0215] In some embodiments, the synthetic expression system comprises a congeneral input promoter for process 2 (e.g., listed in Table 5); a two-component Bm3R1-based sTF, Table 11; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the Bm3R1-based sTF, Table 15; and the gene of interest.

[0216] In some embodiments, the synthetic expression system includes a congeneral input promoter for process 2 (e.g., listed in Table 5); a two-component PhlF_AM-based sTF, Table 12; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the PhlF_AM-based sTF, Table 16; and the gene of interest.

[0217] In some embodiments, the synthetic expression system comprises a congeneral input promoter with respect to process 2 (e.g., listed in Table 5); a two-component TetR-based sTF, Table 13; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter with respect to the TetR-based sTF, Table 17; and the gene of interest.

[0218] In some embodiments, the synthetic expression system comprises a congeneral input promoter for process 2 (e.g., listed in Table 5); a two-component VanR_AM-based sTF, Table 14; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the VanR_AM-based sTF, Table 18; and the gene of interest.

[0219] Table 3 shows designs for non-limiting combinations of synthetic expression systems. These are particularly useful for the production process using Process 3, where glucose is limited and thiamine is depleted.

[0220] In some embodiments, the synthetic expression system comprises a congeneral input promoter with respect to process 3 (e.g., listed in Table 6); a one-component Bm3R1-based sTF, Table 7; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter with respect to the Bm3R1-based sTF, Table 15; and the gene of interest.

[0221] In some embodiments, the synthetic expression system comprises a congeneral input promoter for process 3 (e.g., listed in Table 6); a one-component PhlF_AM-based sTF, Table 8; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the PhlF_AM-based sTF, Table 16; and the gene of interest.

[0222] In some embodiments, the synthetic expression system comprises a congeneral input promoter with respect to process 3 (e.g., listed in Table 6); a one-component TetR-based sTF, Table 9; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter with respect to the TetR-based sTF, Table 17; and the gene of interest.

[0223] In some embodiments, the synthetic expression system comprises a congeneral input promoter with respect to process 3 (e.g., listed in Table 6); a one-component VanR_AM-based sTF, Table 10; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter with respect to the VanR_AM-based sTF, Table 18; and the gene of interest.

[0224] In some embodiments, the synthetic expression system includes a congeneral input promoter for process 3 (e.g., listed in Table 6); a two-component Bm3R1-based sTF, Table 11; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the Bm3R1-based sTF, Table 15; and the gene of interest.

[0225] In some embodiments, the synthetic expression system comprises a congeneral input promoter for process 3 (e.g., listed in Table 6); a two-component PhlF_AM-based sTF, Table 12; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter for the PhlF_AM-based sTF, Table 16; and the gene of interest.

[0226] In some embodiments, the synthetic expression system comprises a congeneral input promoter with respect to process 3 (e.g., listed in Table 6); a two-component TetR-based sTF, Table 13; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter with respect to the TetR-based sTF, Table 17; and the gene of interest.

[0227] In some embodiments, the synthetic expression system comprises a congeneral input promoter with respect to process 3 (e.g., listed in Table 6); a two-component VanR_AM-based sTF, Table 14; an optional transcriptional terminator, Table 19; an optional spacer, Table 20; a congeneral synthetic output promoter with respect to the VanR_AM-based sTF, Table 18; and the gene of interest.

[0228] In some embodiments, the disclosure relates to compositions and methods relating to synthetic expression systems selected from P96.sTF.Tet.13.102.4;P96.sTF.Van.9.103.4;P96.sTF.Phl.12.99.6;P96.sTF.Tet.1.106.4;P96.sTF.Phl.7.11.7; and P96.sTF.Phl.5.107.4; as well as to synthetic expression systems further comprising the gene of interest.

[0229] In some embodiments, the present disclosure relates to a method for producing a biological product from host cells cultured under Process 1 and comprising a synthetic expression system selected from P96.sTF.Tet.13.102.4;P96.sTF.Van.9.103.4;P96.sTF.Phl.12.99.6;P96.sTF.Tet.1.106.4;P96.sTF.Phl.7.11.7; and P96.sTF.Phl.5.107.4; as well as a synthetic expression system further comprising the gene of interest. Various components of these synthetic expression systems are described in detail.

[0230] In some embodiments, the disclosure relates to compositions and methods relating to synthetic expression systems selected from P96.sTF.Phl.5.40.8;P96.sTF.Bm.9.118.8;P96.sTF.Phl.12.25.7;P96.sTF.Phl.5.109.8;P96.sTF.Bm.13.100.7;P96.sTF.Phl.12.17.9; and P96.sTF.Phl.9.107.7; as well as to synthetic expression systems further comprising the gene of interest.

[0231] In some embodiments, the present disclosure relates to a method for producing a biological product from host cells cultured under Process 2 and comprising a synthetic expression system selected from P96.sTF.Phl.5.40.8;P96.sTF.Bm.9.118.8;P96.sTF.Phl.12.25.7;P96.sTF.Phl.5.109.8;P96.sTF.Bm.13.100.7;P96.sTF.Phl.12.17.9; and P96.sTF.Phl.9.107.7; as well as a synthetic expression system further comprising the gene of interest. Various components of these synthetic expression systems are described in detail herein.

[0232] In some embodiments, the disclosure relates to compositions and methods relating to synthetic expression systems selected from P96.sTF.Phl.5.41.10; and P96.sTF.Bm.5.23.11; as well as to synthetic expression systems further comprising the gene of interest.

[0233] In some embodiments, the present disclosure relates to a method for producing a biological product from host cells cultured under process 3 and comprising a synthetic expression system selected from P96.sTF.Phl.5.41.10; and P96.sTF.Bm.5.23.11; as well as a synthetic expression system further comprising the gene of interest. Various components of these synthetic expression systems are described in detail.

[0234] In some embodiments, the synthetic expression system comprises or consists of a polynucleotide having at least 90%, at least 95%, or at least 99% identity with any one of the nucleic acid sequences of sequence numbers 1 to 15. In some embodiments of these synthetic expression systems, the input promoter contains or comprises a polynucleotide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of SEQ ID NOs: 16-25; the transcription factor or component of the transcription factor is encoded by a polynucleotide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of any one of SEQ ID NOs: 26-40 or 182-185; the transcription factor or component of the transcription factor contains a polypeptide having at least 90%, at least 95%, or at least 99% identity to any one amino acid sequence of any one of SEQ ID NOs: 41-55; and / or the output promoter contains a polynucleotide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of any one of SEQ ID NOs: 56-70 or 186-193.

[0235] In some embodiments, the disclosure provides individual components (such as transcription units, input promoters, transcription factors or their components, synthetic output promoters, genes of interest, transcription terminators, spacers, etc.) that can be used in transcription units or expression systems.

[0236] In some embodiments, the synthetic expression system includes an input promoter comprising or consisting of a polynucleotide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of SEQ ID NOs. 16-25. In some embodiments, the synthetic expression system includes an output promoter comprising or consisting of a polynucleotide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of SEQ ID NOs. 56-70 or 186-193. In some embodiments, the synthetic expression system includes a transcription factor encoded by a polynucleotide comprising or consisting of a polypeptide having at least 90%, at least 95%, or at least 99% identity to any one nucleic acid sequence of SEQ ID NOs. 26-40 or 182-185, or at least 90%, at least 95%, or at least 99% identity to any one amino acid sequence of SEQ ID NOs. 41-55.

[0237] Transcription unit In some embodiments, the disclosure provides a synthetic expression system comprising a transcription unit, or first and second transcription units. In some embodiments, the synthetic expression system comprises a first transcription unit comprising a transcription factor (or at least one component thereof) and a second transcription unit comprising a synthetic output promoter. In some embodiments, the transcription factor is an activator of the synthetic output promoter of the second transcription unit.

[0238] In some embodiments, the first transcription unit includes an insertion site (e.g., a site suitable for promoter insertion) upstream of a polynucleotide encoding a transcription factor or a component thereof.

[0239] In some embodiments, the promoter can be inserted into the insertion site of a first transcription unit so that the promoter can be operably ligated to a polynucleotide encoding a transcription factor or a component thereof, thereby enabling its expression.

[0240] In some embodiments, the second transcription unit includes an output promoter upstream of the insertion site (e.g., a site suitable for inserting the gene of interest).

[0241] In some embodiments, the gene of interest can be inserted into the insertion site of a second transcription unit so that an output promoter can be operably linked to the gene of interest and expressed.

[0242] In some embodiments, the disclosure provides an expression vector comprising a synthetic expression system or transcription unit. In some embodiments, the expression vector includes an insertion site. In some embodiments, the target gene encoding the protein of interest is inserted into the insertion site. In some embodiments, the expression vector promotes the expression of the protein of interest.

[0243] In some embodiments, the insertion site is a site within a nucleic acid suitable for directed insertion of a polynucleotide (e.g., synthetic or exogenous polynucleotide) containing, but not limited to, a promoter or the gene of interest. In some embodiments, the insertion site includes one or more restriction enzyme sites. In some embodiments, the insertion site is a multicloning site. In some embodiments, the multicloning site is a short span of nucleic acid containing two or more restriction sites (e.g., EcoRI, SalI, XmaI, BamHI, SwaI, AsiSI, NotI, SacII, NheI, AccI, etc.). In some embodiments, the insertion site is a landing pad. In some embodiments, the insertion site is a landing pad, which is suitable for recombinase-mediated insertion of a synthetic or exogenous polynucleotide (e.g., a promoter or the gene of interest). In some embodiments, the insertion site is a multi-landing pad site. Various landing pads and multi-landing pads are known in the art (e.g., Leonid Gaidukov). et al.2018 Nucleic Acids Res.46(8):4072-4086;Chi et al.2019 PLOS ONE,Published:July 25,2019,A system for site-specific integration of transgenes in mammalian cells; and Phan et al.2017 Nature Scientific Rep.7:17771).

[0244] In some embodiments, the synthetic expression system comprises one or more of the following components: (a) a first transcription unit comprising an input promoter operably ligated to a transcription factor or a polynucleotide encoding at least one component of a transcription factor, and capable of expressing it; and (b) a second transcription unit comprising a synthetic output promoter operably ligated to a gene of interest, and capable of expressing it, and optionally a transcriptional terminator downstream of the gene of interest.

[0245] The various terms used in this disclosure, relating to the transcription units and other components of the synthetic expression system, and other aspects of the invention are described in further detail below.

[0246] In some embodiments, as used in this disclosure, “transcription unit” refers to a sequence of nucleotides encoding at least one RNA molecule (e.g., a polynucleotide encoding at least one component of a transcription factor or a transcription factor in a first transcription unit; or the gene of interest in a second transcription unit), as well as a sequence necessary for its instantiation, e.g., a promoter; the transcription unit optionally includes a transcription terminator and / or other regulatory sequences. In some embodiments, “transcription unit” refers to a sequence of nucleotides encoding at least one RNA molecule (e.g., a polynucleotide encoding at least one component of a transcription factor), as well as a site suitable for insertion of a sequence necessary for its instantiation (e.g., an insertion site), e.g., a promoter; the transcription unit optionally includes a transcription terminator and / or other regulatory sequences. In some embodiments, “transcription unit” refers to a sequence of nucleotides including a promoter (e.g., an output promoter) and a site suitable for insertion of the gene of interest (e.g., an insertion site), as well as a sequence necessary for its instantiation, e.g., a transcription terminator and / or other regulatory sequences. In some embodiments, the transcription unit further includes a spacer. In some embodiments, the promoter and / or transcription factor, at least one component of the transcription factor or a polynucleotide encoding the gene of interest, comprises the protein encoded therein, e.g., a 5'-UTR (5'-untranslated region), a leader sequence and / or a 3'-UTR (3'-untranslated region), and / or one or more introns, plus additional sequences for expression, transcription, and / or translation.

[0247] "Synthetic transcription unit" refers to a transcription unit that does not exist in nature. "Synthetic expression system" refers to an expression system that does not exist in nature. In some embodiments, a synthetic transcription unit or synthetic expression system is one or more modifications of one or more sequences found in nature, and includes, but is not limited to: rearranging sequences; creating chimeras between two sequences of different origins (e.g., from different species or from different arrangements within a single genome); altering the spacing between sequences (e.g., so that proteins that bind to different sequences can rotate better on the DNA helix to improve their interaction); altering DNA binding sequences to improve the binding of proteins to those sequences; introducing point mutations to increase expression or control of expression; substituting or rearranging different domains of transcription factors or other polypeptides; rearranging components or introducing components (e.g., operators, enhancers, upstream activating sequences, etc.) into promoters; replacing a promoter that is usually upstream of a particular gene of interest with a different promoter; etc. In some embodiments, the synthetic expression system of this disclosure consists of two or more transcription units.

[0248] In some embodiments, the synthetic expression system comprises a second transcription unit containing the gene of interest, which is a gene that is preferably expressed in a host cell [operably ligated to various cis-active components such as a 5'-UTR, coding segment, 3'-UTR, any intron(s), any translational enhancer, any translational terminator, etc.]. The gene of interest may be expressed, for example, to produce the mRNA or protein of interest. In some embodiments, the biological product is mRNA expressed from the gene of interest. In some embodiments, the biological product is a protein or polynucleotide expressed from the gene of interest, or a compound or other composition that is synthesized, modified or otherwise acted upon directly or indirectly by the polynucleotide.

[0249] In some embodiments, the first transcription unit includes a transcription factor. In some embodiments, the first transcription unit further includes an input promoter. In some embodiments, the first transcription unit includes an input promoter operably ligated to a polynucleotide encoding the transcription factor or a component thereof, thereby regulating transcription. In some embodiments, the first transcription unit further includes a transcription terminator.

[0250] In some embodiments, the first transcription unit is integrated into the genome of a host cell. In some embodiments, the first transcription unit resides on a plasmid.

[0251] In some embodiments, the first transcription unit includes a transcription terminator.

[0252] In some embodiments, the first transcription unit includes an input promoter (P(in)) and a transcription terminator that are operably ligated to a polynucleotide encoding a transcription factor or a component thereof and regulate transcription. In some embodiments, the first transcription unit includes or comprises a polynucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequences of Example 1, Example 3, Tables 21, 28, and 30-36, or to any of the nucleic acid sequences of Sequence ID No. 71-85, and which can encode a transcription factor (e.g., a transcription activator) or at least one component thereof.

[0253] In some embodiments, the first transcription unit is integrated into the genome of a host cell or exists on a plasmid in combination with a second transcription unit, thereby comprising a synthetic expression system.

[0254] In some embodiments, the first and second transcription units are separated by a spacer. In some embodiments, the spacer is a polynucleotide sequence having about 2 to about 30 base pairs, about 2 to about 25 base pairs, about 2 to about 20 base pairs, about 2 to about 10 base pairs, or about 5 to about 10 base pairs. In some embodiments, the spacer is a polynucleotide having at least 7 base pairs. In some embodiments, the spacer includes a polynucleotide having the sequence GCTTACA (SEQ ID NO: 166).

[0255] In some embodiments, the second transcription unit includes a synthetic output promoter. In some embodiments, the synthetic output promoter is operably ligated to the gene of interest. In some embodiments, the gene of interest is endogenous. In some embodiments, the gene of interest is exogenous to the host cell. In some embodiments, the gene of interest is synthetic. In some embodiments, the second transcription unit further includes a transcription terminator. In some embodiments, the second transcription unit includes a polynucleotide that is at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of Example 1, Example 3, or Tables 21, 28, and 30-36.

[0256] In some embodiments, induction of the input promoter by user-controlled culture conditions activates transcription of the first transcription unit. In some embodiments, the transcription factor of the first transcription unit activates the synthetic output promoter of the second transcription unit. In some embodiments, activation of the synthetic output promoter activates transcription of the second transcription unit.

[0257] promoter As used in this application, “promoter” (e.g., input promoter or output promoter) refers to a regulatory region of DNA that directs the transcription of a DNA sequence into RNA. In some embodiments, the promoter (e.g., input promoter or output promoter) includes a similar sequence that can instruct RNA polymerase II to initiate RNA synthesis at a suitable transcription start site of a TATA box or a particular polynucleotide sequence. In some embodiments, the promoter (e.g., input promoter or output promoter) may further include other sequences, called upstream promoter elements, which are generally located upstream of the TATA box, but not always, and which affect the transcription initiation rate.

[0258] In some embodiments, the promoter (e.g., an input promoter or an output promoter) includes an upstream activating sequence (UAS) and a core promoter element. In some embodiments, the promoter (e.g., an input promoter or an output promoter) includes a core promoter element but does not include an upstream activating sequence (UAS).

[0259] In certain organisms (e.g., yeast), a promoter (e.g., an input promoter or an output promoter) can be understood as encompassing a sequence extending from up to 1500 bp upstream of the gene's start codon to the base adjacent to the first base of the gene's start codon. In some embodiments, the 5'-UTR region is a region of mRNA that begins at the transcription start site and ends immediately upstream of the start codon. In some embodiments, the promoter (e.g., an input promoter or an output promoter) includes a 5'-UTR that encompasses the region from position +1 of transcription start to the base adjacent to (immediately upstream of) the gene's start codon (e.g., ATG). In some embodiments, the promoter (e.g., an input promoter or an output promoter) includes a core promoter and a 5' untranslated region (5'-UTR). In some embodiments, for any particular promoter (e.g., an input promoter or an output promoter), the exact 5' and 3' ends of the promoter sequence may be defined differently by different sources, scientific references, etc. In some embodiments, this disclosure relates to any sequence of any promoter as defined herein (e.g., an input promoter or an output promoter) (e.g., any sequence in the attached sequence listings, or sequences shown in Tables 21, 28 and 30-36).

[0260] In some embodiments, the promoter (e.g., an input promoter or an output promoter) comprises or consists of a polynucleotide having one of the nucleic acid sequences SEQ ID NOs. 16-25, 56-70, or 186-193, or a functional fragment thereof. In some embodiments, the promoter (e.g., an input promoter or an output promoter) comprises or consists of a polynucleotide having at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with one of the nucleic acid sequences SEQ ID NOs. 16-25, 56-70, or 186-193, or a functional fragment thereof.

[0261] A “fragment” of a promoter (e.g., an input promoter or an output promoter) refers to a portion less than the full-length promoter sequence. A “functional fragment” of a promoter (e.g., an input promoter or an output promoter) in this disclosure refers to a biologically active portion of the promoter sequence. A “biologically active portion” of a gene regulatory element, such as a promoter (e.g., an input promoter or an output promoter), includes a portion or fragment of the full-length gene regulatory element and may have the same or similar types of activity as the full-length gene regulatory element, although the level of activity of the biologically active portion of the gene regulatory element may vary compared to the level of activity of the full-length gene regulatory element.

[0262] Input Promoter In some embodiments, the Disclosure provides the expression of a polynucleotide encoding a transcription factor or at least one component of a transcription factor, under the control of an input promoter, as part of a first transcription unit. As used in this application, “input promoter” refers to a promoter that is operably ligated to a polynucleotide encoding a transcription factor or at least one component of a transcription factor, and which can activate transcription. In some embodiments, the input promoter drives (e.g., is operably ligated to) the expression of a transcription factor or component of a transcription factor.

[0263] In some embodiments, the input promoter includes an upstream activating sequence (UAS) and a core promoter element. In some embodiments, the input promoter includes a core promoter element but does not include an upstream activating sequence (UAS).

[0264] In some embodiments, the input promoter is naturally occurring. In some embodiments, the input promoter has at least 90% sequence identity with a naturally occurring promoter. In some embodiments, the input promoter is endogenous to the host cell. In some embodiments, the input promoter is exogenous to the host cell. In some embodiments, the input promoter is synthetic.

[0265] In some embodiments, the input promoter of a first transcription unit is a regulated input promoter. As used in this application, “regulated input promoter” is an input promoter that is controlled by the presence or absence of a molecule, nutrient, or compound, or by certain physical conditions. In some embodiments, the regulated input promoter is inductive. In some embodiments, the regulated input promoter is repressive. A regulated input promoter may be used, for example, to controllly activate (e.g., induce) or repress the expression of a transcription factor or at least one component of a transcription factor, the transcription factor activating a synthetic output promoter to express the gene of interest. As understood, “repression” of the expression of a transcription factor or at least one component of a transcription factor may, in some embodiments, include reducing the expression level of the transcription factor or at least one component of a transcription factor. In some embodiments, the expression of a transcription factor or at least one component of a transcription factor may be completely eliminated and may still be considered “repressed” as the term is used in this disclosure.

[0266] Non-limiting examples of tunable input promoters include chemically tunable and physically tunable input promoters. In the case of chemically tunable input promoters, transcriptional activity can be tunable by one or more compounds, such as alcohols (e.g., methanol), tetracycline, galactose, glycerol, glucose, maltose, dextrose, sorbitol, inositol, methionine, formic acid, phosphoric acid, steroids, metals, nutrients, and combinations thereof. In some embodiments, transcriptional activity is tunable by the addition, restriction, or depletion of compounds or combinations thereof. In the case of physically tunable input promoters, transcriptional activity can be tunable by changes in light, pressure, temperature, or other factors.

[0267] Non-limiting examples of tetracycline-regulating promoters include anhydrotetracycline (aTc)-responsive promoters and other tetracycline-responsive promoter systems (e.g., tetracycline repressor protein (TetR), tetracycline operator sequence (tetO), and tetracycline transactivator fusion protein (tTA)). Non-limiting examples of steroid-regulating promoters include promoters based on rat glucocorticoid receptors, human estrogen receptors, mos-ecdysone receptors, and promoters from the steroid / retinoid / thyroid receptor superfamily. Non-limiting examples of metal-regulating promoters include promoters derived from metallothionein (proteins that bind to and capture metal ions) genes. Non-limiting examples of pathogenicity-regulating promoters include promoters induced by salicylic acid, ethylene, or benzothiadiazole (BTH). Non-limiting examples of temperature / heat-inducible promoters include heat shock promoters. Non-limiting examples of light-regulating promoters include photoresponsive promoters derived from plant cells.

[0268] In some embodiments, the adjustable input promoter is a methanol-inducible input promoter. As used in this disclosure, “methanol-inducible promoter” is a promoter (e.g., an input promoter or an output promoter) whose activity is substantially increased by the presence of methanol in the culture medium. In some embodiments in which the methanol-inducible promoter drives the expression of the gene of interest, “substantial increase in activity” means that when exogenously added methanol is present in the medium, at least 20 times more transcripts are produced per million copies of the gene of interest compared to when exogenously added methanol is not present in the medium.

[0269] Conversely, a promoter that is "not methanol-inducible" is a promoter (e.g., an input or output promoter) whose activity does not substantially increase in the presence of methanol in the culture medium. In some embodiments where a methanol-inducible promoter drives the expression of a gene of interest, a "non-substantial increase in activity" is defined as a difference of less than twofold in the amount of transcript produced per million copies of the gene of interest when exogenously added methanol is present in the culture medium compared to when exogenously added methanol is not present in the culture medium.

[0270] In some embodiments, the tunable input promoter is tunable under methanol-independent conditions. In some embodiments, the tunable input promoter is tunable in the absence of exogenously provided methanol. In some embodiments, the input promoter is not methanol-inducible. In some embodiments, the inducible input promoter is induced by one or more physiological conditions (e.g., pH, temperature, radiation, osmotic pressure, saline gradient, cell surface binding, or concentration of one or more exogenous or endogenous inducers). Non-limiting examples of exogenous inducers or inducers include amino acids and amino acid analogs, sugars and polysaccharides, polynucleotides, protein transcription activators and repressors, cytokines, toxins, petroleum compounds, metal-containing compounds, salts, ions, enzyme substrate analogs, hormones, or any combination thereof.

[0271] Aspects of this disclosure relate to the production of proteins and / or nucleic acids expressed from a gene of interest under methanol-independent fermentation conditions. In some embodiments, the input promoter of a first transcription unit and / or the output promoter of a second transcription unit is a tunable input promoter. In some embodiments, the tunable input promoter is responsive (e.g., inducible) in the absence of methanol. In some embodiments, the tunable input promoter responds to the addition, restriction, or depletion of nutrients related to the gene culture process. In some embodiments, the tunable input promoter is responsive to thiamine depletion. In some embodiments, the tunable input promoter is responsive to glycerol depletion. In some embodiments, the tunable input promoter is responsive to glucose restriction. In some embodiments, the tunable input promoter is responsive to formic acid restriction. In some embodiments, the tunable inducible promoter is responsive to monosaccharide restriction. In some embodiments, the moduloable inductive promoter responds to the restriction of carbon sources, sugars, starch, galactose, maltose, glucose, dextrose, sorbitol, inositol, glycerol, methionine, vitamins, phosphates, steroids, nitrogen sources, nitrate, nitrite, ammonium, amino acids, methionine, metals (e.g., heavy metals), copper, benzoic acid, hydrogen peroxide, calcium-containing compounds, alcohols, methanol, tetracycline, steroids, and / or phosphates. Various moduloable input promoters are known in the art. In some embodiments, the moduloable input promoter responds to the presence or addition (e.g., addition in excess to the medium) of any of the following: nutrients, antibiotics, tetracycline, doxycycline, sugars, starch, galactose, maltose, glucose, sorbitol, inositol, glycerol, formic acid, vitamins, steroids, nitrogen sources, nitrate, nitrite, ammonium, amino acids, methionine, ions, sodium, and / or phosphates.

[0272] In some embodiments, a single restriction nutrient is used. In some embodiments, the moduloable input promoter responds to restriction of a combination of nutrients (e.g., two nutrients, or more than two nutrients). In some embodiments, a combination of restriction nutrients is used. In some embodiments, the moduloable input promoter responds to restriction of a combination of nutrients including, but not limited to, glycerol, glucose, and thiamine, or the combination is glycerol and formic acid; glucose and formic acid; or glucose and thiamine. In some embodiments, the activity of the moduloable input promoter is increased by the presence of exogenously provided formic acid. The activity of the moduloable input promoter is considered "increased" by the presence of exogenously provided formic acid if, for example, the expression level of the transcription factor is elevated compared to the expression level of the transcription factor before the exogenous provision of formic acid. In some embodiments, the response of the moduloable input promoter is activation (e.g., once induced). In some embodiments, the response of the moduloable input promoter is repression.

[0273] In some embodiments, an input promoter is homologous with respect to a specific production process (e.g., a process described herein, such as process 1, process 2, or process 3) if the input promoter is activated in the process under specific culture steps or conditions (e.g., glycerol restriction + formic acid addition in process 1; glucose restriction + formic acid addition in process 2; and glucose restriction + thiamine depletion in process 3).

[0274] In some embodiments, the input promoter is activated under culture conditions with glycerol and formic acid supplementation. In some embodiments, the input promoter is activated under culture conditions with glucose and formic acid supplementation. In some embodiments, the input promoter is activated under culture conditions with glucose and thiamine depletion. In some embodiments, the input promoter is activated in a methanol-dependent process. In some embodiments, the input promoter is homogeneous with respect to process 1, which includes culture conditions with glycerol and formic acid supplementation. In some embodiments, the input promoter is homogeneous with respect to process 2, which includes culture conditions with glucose and formic acid supplementation. In some embodiments, the input promoter is homogeneous with respect to process 3, which includes culture conditions with glucose and thiamine depletion. In some embodiments, the input promoter is homogeneous with respect to process 4, which is a methanol-dependent process. In some experiments described herein, process 4 is used as a control.

[0275] In some embodiments, the input promoters are homogeneous with respect to process 1, as listed in Table 4, for example. In some embodiments, the input promoters are homogeneous with respect to process 2, as listed in Table 5, for example. In some embodiments, the input promoters are homogeneous with respect to process 3, as listed in Table 6, for example. In some embodiments, the input promoters are listed in Table 4. In some embodiments, the input promoters are listed in Table 5. In some embodiments, the input promoters are listed in Table 6.

[0276] In some embodiments, the input promoter of a first transcription unit and / or the output promoter of a second transcription unit are constitutive promoters. As used in this application, “constitutive promoter” is a promoter that, when operably ligated to a DNA sequence in relation to a given host genome, results in the continuous transcription of the DNA sequence. Non-limiting examples of constitutive promoters include P(GAP), P(ENO1), P(GPM1), P(HSP82), P(ILV5), P(KAR2), P(KEX2), P(PET9), P(PGK1), P(SSA4), P(TEF1), P(TPI1), and P(YPT1).

[0277] In some embodiments, the input promoter of the first transcription unit comprises or consists of polynucleotides that are at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequences of Examples 1 and 3, Table 21, or to any one of the nucleic acid sequences of Sequence IDs 16-25. In some embodiments, the input promoter comprises a polynucleotide having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 50, 100, 150, 200, 250, or 300 or fewer nucleotide substitutions, insertions, additions, or deletions to any one nucleic acid sequence of SEQ ID NOs. In some embodiments, the input promoter can initiate transcription of a polynucleotide encoding a transcription factor or at least one component thereof. In some embodiments, the transcription factor is a transcription activator. In some embodiments, the input promoter of a first transcription unit comprises or comprises a polynucleotide having any one nucleic acid sequence of SEQ ID NOs.

[0278] In some embodiments, the input promoter is one of P(CMC1), P(JEN1), P(GQ6704499), P(GQ700926), P(HGT1), P(FDH1), P(AOX2), P(RGI2), P(PIH1), P(THI4a), or P(THI4b). In some embodiments, the input promoter is P(AT249_GQ6704499). In some embodiments, the input promoter does not include P(AOX1) or a promoter having more than 90%, 80%, or 70% sequence identity to P(AOX1).

[0279] Non-restrictive examples of P(in) are shown in Tables 4, 5, and 6. The DNA sequences (by sequence number) of P(in) in Tables 4, 5, or 6 can be found in Table 21.

[0280] Transcription factor [TF or sTF] In some embodiments, the disclosure relates to transcription units expressing at least one component of a transcription factor. In some embodiments, the synthetic expression system comprises a first and a second transcription unit, the first transcription unit expressing at least one component of a transcription factor, and the second transcription unit comprising a synthetic output promoter activated by the transcription factor, the synthetic output promoter promoting the expression of the gene of interest.

[0281] In some embodiments, a synthetic expression system is provided in which an input promoter drives the expression of at least one component of a transcription factor encoded by a polynucleotide present in a first transcription unit. In some embodiments, the synthetic transcription factor is not an activator of the input promoter. In some embodiments, the synthetic transcription factor is an activator of a synthetic output promoter. In some embodiments, the component of the transcription factor binds to the synthetic output promoter of a second transcription unit and drives the expression of the gene of interest. In some embodiments, the transcription factor (TF) is a synthetic transcription factor (sTF).

[0282] A "transcription factor" is a protein that regulates the transcription rate from a homologous promoter by binding to one or more specific DNA sequences within or around the promoter.

[0283] In some embodiments, transcription factors increase the transcription rate of a gene of interest by binding to a synthetic output promoter operably linked to the gene of interest. Transcription factors may act alone or in conjunction with other proteins in a complex by recruiting and / or stabilizing components of the complex, including RNA polymerase, at the synthetic output promoter. In some embodiments, the transcription factor includes at least one of the following: (1) a DNA-binding domain that binds to a specific DNA sequence, and / or (2) a transcription-activating domain (e.g., a trans-acting domain; TAD) that can interact with another protein, such as RNA polymerase, another protein, or another component in a complex containing RNA polymerase.

[0284] While we do not wish to be bound by any particular theory, it should be noted that transcription factors can increase expression from synthetic output promoters through a variety of mechanisms, including but not limited to stabilizing the binding of RNA polymerase to the promoter; catalyzing the acetylation of histone proteins via histone acetyltransferase (HAT) activity; weakening the association of DNA with histones to make DNA more accessible for transcription; and / or recruiting coactivator or corepressor proteins to the transcription complex. In some embodiments, transcription factors include a signal-sensing domain (SSD) (e.g., a ligand-binding domain) that senses external signals and, in response, transmits these signals to the rest of the transcription complex, resulting in upregulation of the expression of the gene of interest.

[0285] Various transcription factors, as well as their structures and functions, are described in the following literature: Latchman 1997 Int.J.Biochem.Cell Biology.29(12):1305-12; Karin 1990 The New Biologist.2(2):126-31; Babu et al.2004 Current Opinion in Structural Biology.14(3):283-91; Roeder 1996 Trends in Biochemical Sciences.21(9):327-35; Nikolov et al.1997 Proc.Nat.Acad.Sci.United States of America.94(1):15-22;Lee et al.2000 Annual Review of Genetics.34:77-137;Mitchell et al.1989 Science.245(4916):371-8;Ptashne et al.1997 Nature.386(6625):569-77;Jin et al. al.2014 Nucleic Acids Research.42(Database issue):D1182-7; and Matys et al.2006 Nucleic Acids Research.34(Database issue):D108-10.

[0286] In some embodiments, the transcription factor comprises one or more of the following components: (a) a DNA-binding domain that binds to a synthetic output promoter (e.g., an operator within the synthetic output promoter), and / or (b) a transcription-activating domain that binds to another factor that promotes transcription from the synthetic output promoter (e.g., RNA polymerase), (c) a nuclear localization signal, if desired, (d) an oligomerization domain, if desired, and (e) one or more linkers between any of components (a) to (d), if desired. In some embodiments, the transcription factor further comprises one or more of the following components: (f) one or more additional domains, if desired, and (g) one or more linkers between component (f) and any of components (a) to (d), if desired, and / or one or more linkers between any of components (f), if more than one component (f) is present. In some embodiments, one or more components (f) can perform any of a variety of functions, including but not limited to binding to ATP; directly or indirectly catalyzing the acetylation or deacetylation of one or more histones; binding to another protein; recruiting a coactivator; binding to another transcription factor; binding to a component of a pre-transcriptional complex; binding to a ligand or signaling compound; acting as a signal-sensing domain; performing a function in a signaling cascade; performing a function related to the regulation of the cell cycle; performing a function related to the control of development; acting as a phosphorylation site; and / or binding to a membrane. As used in this disclosure, “components” or “component portions” of a transcription factor refer to a portion type such as those provided in (a) to (f) above. In some embodiments, a transcription factor is a chimeric one in that any two or more of the DNA-binding domain, transcriptional activation domain, nuclear localization signal (NLS), and / or any other components originate from different sources (e.g., different species).

[0287] In some embodiments, the synthetic expression system comprises a transcription factor or at least one component of a transcription factor, the transcription factor comprising or consisting of a sequence (e.g., a nucleic acid or amino acid sequence) that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence selected from any one of SEQ ID NOs. In some embodiments, the synthetic expression system comprises a transcription factor or at least one component of a transcription factor, the transcription factor not comprising methanol expression regulator 1 (mxr1) or a transcription factor having 90%, 80%, or 70% sequence identity with mxr1. In some embodiments, the synthetic expression system comprises a transcription factor or at least one component of a transcription factor, the transcription factor not comprising human estrogen receptor alpha (hERα) or a transcription factor having 90%, 80%, or 70% sequence identity with hERα. In some embodiments, the synthetic expression system comprises a transcription factor or at least one component of a transcription factor, wherein the transcription factor does not include pheromone regulatory membrane protein 1 (prm1) or a transcription factor having 90%, 80%, or 70% sequence identity with prm1.

[0288] In some embodiments, the transcription factor includes a DNA-binding domain (DBD). A "DNA-binding domain" is an independently folded protein domain containing at least one structural motif that recognizes double-stranded or single-stranded DNA. The DNA-binding domain may recognize a specific DNA sequence (recognition sequence) or have a general affinity for DNA. In some embodiments, the DNA-binding domain is that of or derived from Bm3R1, TetR, PhlF_AM, or VanR_AM.

[0289] In some embodiments, the DNA-binding domain of Bm3R1 is a DNA-binding domain based on the full-length Bm3R1 repressor (e.g., a part thereof, derived therefrom, or a variant thereof). In some embodiments, Bm3R1 encodes the full-length sequence of the transcriptional repressor Bm3R1 derived from Bacillus megaterium (NCBI accession number WP_013083972.1).

[0290] In some embodiments, the DNA-binding domain of TetR is a DNA-binding domain based on the full-length TetR repressor. In some embodiments, TetR encodes the full-length sequence of the Tn10-derived transcriptional repressor TetR (NCBI accession number WP_000088605.1).

[0291] In some embodiments, the DNA-binding domain of PhlF_AM is a DNA-binding domain based on the full-length PhlF_AM. In some embodiments, PhlF_AM encodes a variant of the full-length sequence (NCBI accession number AYJ72227.1) of the transcriptional repressor PhlF derived from Pseudomonas fluorescens.

[0292] In some embodiments, the DNA-binding domain of VanR_AM is a DNA-binding domain based on the full-length VanR_AM. In some embodiments, VanR_AM encodes a variant of the full-length sequence of the Caulobacter-derived transcriptional repressor VanR (NCBI accession number AYJ72236.1).

[0293] In some embodiments, the DNA-binding domain comprises or consists of a polynucleotide having one of the nucleic acid sequences of SEQ ID NOs. 86-89, or a functional fragment thereof. In some embodiments, the DNA-binding domain comprises an amino acid having one of the nucleic acid sequences of SEQ ID NOs. 90-93, or a functional fragment thereof.

[0294] In some embodiments, the transcription factor is a one-component, two-component, or multi-component transcription factor.

[0295] In some embodiments, the transcription factor is one of eight different types of sTFs: (1) a one-component Bm3R1-based sTF, (2) a one-component PhlF_AM-based sTF, (3) a one-component TetR-based sTF, (4) a one-component VanR_AM-based sTF, (5) a two-component Bm3R1-based sTF, (6) a two-component PhlF_AM-based sTF, (7) a two-component TetR-based sTF, and (8) a two-component VanR_AM-based sTF. As used herein, “one-component,” “two-component,” and “multi-component” refer to several subunits present in an sTF. An sTF “subunit” may include component portions (e.g., a DNA-binding domain, a transcriptional activation domain, BPP1, BPP2, a nuclear localization signal, a spacer, etc.). In some embodiments, a one-component sTF is a synthetic transcription factor comprising one or more monomers of a polypeptide chain having DBD, NLS, and TAD, the polypeptide chain being encoded by a single DNA coding sequence.

[0296] In some embodiments, the transcription factor is a Bm3R1-based sTF. In some embodiments, the transcription factor is a PhlF_AM-based sTF. In some embodiments, the transcription factor is a TetR-based sTF. In some embodiments, the transcription factor is a VanR_AM-based sTF. In some embodiments, the transcription factor is a Bm3R1-based sTF. In some embodiments, the transcription factor is a PhlF_AM-based sTF. In some embodiments, the transcription factor is a TetR-based sTF. In some embodiments, the transcription factor is a VanR_AM-based sTF. In some embodiments, the transcription factor is a one-component Bm3R1-based sTF. In some embodiments, the transcription factor is a one-component PhlF_AM-based sTF. In some embodiments, the transcription factor is a one-component TetR-based sTF. In some embodiments, the transcription factor is a one-component VanR_AM-based sTF. In some embodiments, the transcription factor is a one-component Bm3R1-based sTF, for example, those listed in Table 7. In some embodiments, the transcription factor is a one-component PhlF_AM-based sTF, for example, those listed in Table 8. In some embodiments, the transcription factor is a single-component TetR-based sTF, e.g., listed in Table 9. In some embodiments, the transcription factor is a single-component VanR_AM-based sTF, e.g., listed in Table 10.

[0297] In some embodiments, the transcription factor is a two-component Bm3R1-based sTF. In some embodiments, the transcription factor is a two-component PhlF_AM-based sTF. In some embodiments, the transcription factor is a two-component TetR-based sTF. In some embodiments, the transcription factor is a two-component VanR_AM-based sTF. In some embodiments, the transcription factor is a two-component Bm3R1-based sTF, for example, those listed in Table 11. In some embodiments, the transcription factor is a two-component PhlF_AM-based sTF, for example, those listed in Table 12. In some embodiments, the transcription factor is a two-component TetR-based sTF, for example, those listed in Table 13. In some embodiments, the transcription factor is a two-component VanR_AM-based sTF, for example, those listed in Table 14.

[0298] In some embodiments, a single-component sTF is designed to conjugate with a congeneral synthetic output promoter and RNA polymerase complex to bring DBD and TAD, which mediate transcriptional activation of the synthetic output promoter, into molecular proximity. In some embodiments, DBD and TAD are essential components for the functionality of the synthetic expression system mediated by the single-component sTF.

[0299] Transcription factors containing one or more components In some embodiments, the disclosure relates to a synthetic expression system comprising any transcription factor or at least one component of a transcription factor described herein, or a method of using the same. In some embodiments, the disclosure relates to any transcription factor or at least one component of a transcription factor described herein, or a method of using the same. In some embodiments, the disclosure relates to any transcription factor or at least one component of a transcription factor described herein, or a method of using the same, for use in combination with a homologous output promoter.

[0300] In some embodiments, a transcription factor contains one, two, three, four, five, or more components. A transcription factor having more than two components is called a “multicomponent” transcription factor. In some embodiments, a transcription factor contains or consists of one component. In some embodiments, a transcription factor contains two components. In some embodiments, a transcription factor contains or consists of two or more components.

[0301] In some embodiments, at least one component of the transcription factor includes a DNA-binding domain (DBD) or a portion thereof. In some embodiments, at least one component of the transcription factor includes a transcriptional activation domain (TAD) or a portion thereof. In some embodiments, at least one component of the transcription factor includes a portion that binds to a different component of the transcription factor. In various embodiments, two or more components of the transcription factor may originate from different sources (e.g., different genera, different species, etc.).

[0302] In some embodiments, two or more components of a transcription factor bind together (for example, one binds to the other, or to each other) to form a transcription factor. In some embodiments, two or more components of a transcription factor bind together to form a heterodimer, chimera, or fusion. In some embodiments, two components of a transcription factor bind together to form a heterodimer, chimera, or fusion via any biochemical mechanism in which a portion of one component binds to the other, or vice versa, or a portion of the two components bind to each other.

[0303] In some embodiments, a two-component sTF is a synthetic transcription factor comprising a complex containing one or more monomers of two-component sTF component polypeptide #1 and one or more monomers of two-component sTF component polypeptide #2. Intermolecular complexation between two-component sTF component polypeptide #1 and two-component sTF component polypeptide #2 may be mediated by either non-covalent interactions or covalent bonds (e.g., the use of a bioconjugate protein). In some embodiments, the two-component or multi-component transcription factor further comprises a bioconjugate protein.

[0304] In some embodiments of non-covalent complexation, two-component sTF polypeptide #1 and two-component sTF polypeptide #2 can be combined via specific high-affinity non-covalent interactions between a protein domain or other subsequence (e.g., a short epitope or tag) on ​​two-component sTF polypeptide #1 and a congeneral protein domain or other subsequence (e.g., a short epitope or tag) on ​​two-component sTF polypeptide #2. An example of such a system is embodied in the ALFA tag / NbALFA system, which includes a short peptide sequence to which an ALFA tag is tightly bound by a congeneral nanobody (NbALFA).

[0305] In some embodiments of covalent complexation, two-component sTF polypeptide #1 and two-component sTF polypeptide #2 can be joined together via a specific covalent bond formation event between a protein domain or other subsequence (e.g., a short epitope or tag) on ​​two-component sTF polypeptide #1 and a congeneral protein domain or other subsequence (e.g., a short epitope or tag) on ​​two-component sTF polypeptide #2. In some embodiments, the formed covalent bond is an isopeptide bond. An example of such a system is embodied in the SpyTag / SpyCatcher system, where SpyTag contains a short peptide sequence that forms an isopeptide bond with a congeneral SpyCatcher domain.

[0306] In some embodiments, the two-component sTF component polypeptide #1 possesses a DBD and a first NLS (NLS1), and the two-component sTF component polypeptide #2 possesses a TAD and a second NLS (NLS2). Thus, the two-component sTF is designed to conjugate with a homologous synthetic output promoter to bring one or more DBDs and one or more TADs into molecular proximity, mediating the transcriptional activation of the synthetic output promoter.

[0307] In some embodiments, intermolecular complexation between two-component sTF component polypeptide #1 and two-component sTF component polypeptide #2 is mediated by the formation of a covalent isopeptide bond. In some embodiments, the two-component or multi-component transcription factor further comprises SpyTag and / or SpyCatcher. In some embodiments, two-component sTF component polypeptide #1 has one or more copies of a SpyTag variant, and two-component sTF component polypeptide #2 has one copy of a SpyCatcher variant. Other examples of such systems include SpyTag / SpyCatcher, SnoopTag / SnoopCatcher, SdyTag / SdyCatcher, and / or variants of any other bioconjugate proteins known in the art. In this specification, a short protein sequence functionally equivalent to the SpyTag variant is referred to as "bioconjugate protein moiety 1 (BPP1)," and a relatively large congeneral protein sequence functionally equivalent to the SpyCatcher variant is referred to as "bioconjugate protein moiety 2 (BPP2)."

[0308] In some embodiments, the transcription factor comprises a single copy of BPP1. In some embodiments, the single copy of BPP1 comprises or comprises a polynucleotide having the nucleic acid sequence of SEQ ID NO: 148. In some embodiments, the single copy of BPP1 comprises or comprises a polypeptide having the amino acid sequence of SEQ ID NO: 151.

[0309] In some embodiments, the transcription factor comprises multiple copies, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more copies of BPP1. In some embodiments, the transcription factor comprises 2 copies of BPP1. In some embodiments, the 2 copies of BPP1 comprises or consist of a polynucleotide having the sequence of SEQ ID NO: 149. In some embodiments, the 2 copies of BPP1 comprises or consist of a polypeptide having the amino acid sequence of SEQ ID NO: 152. In some embodiments, the transcription factor comprises 6 copies of BPP1. In some embodiments, the 6 copies of BPP1 comprises or consist of a polynucleotide having the nucleic acid sequence of SEQ ID NO: 150. In some embodiments, the 6 copies of BPP1 comprises or consist of a polypeptide having the amino acid sequence of SEQ ID NO: 153.

[0310] In some embodiments, the transcription factor comprises one or more copies of BPP1 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 copies) and / or a single copy of BPP2. In some embodiments, the single copy of BPP2 comprises or consists of a polynucleotide having the sequence of SEQ ID NO: 154. In some embodiments, the single copy of BPP2 comprises or consists of a polypeptide having the amino acid sequence of SEQ ID NO: 155. In some embodiments, the transcription factor comprises one or more copies of BPP1 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 copies) and / or one or more copies of BPP2 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 copies).

[0311] In some embodiments, the transcription factor further comprises a self-cleaving polypeptide. In some embodiments, the self-cleaving polypeptide is a 2A peptide. In some embodiments, the self-cleaving polypeptide is ERBV_1_P2A. In some embodiments, the self-cleaving polypeptide is E2A, F2A, or T2A.

[0312] In some embodiments, the protein sequences of two-component sTF component polypeptide #1 and two-component sTF component polypeptide #2 are encoded in the same transcription unit driven by a single promoter, and the two distinct polypeptide chains are generated from a single coding sequence via a “ribosome skipping” event mediated by an intervening encoded 2A peptide sequence. In some embodiments, the protein sequences of two-component sTF component polypeptide #1 and two-component sTF component polypeptide #2 are encoded in separate transcription units driven by separate promoters.

[0313] In some embodiments, different components of a transcription factor are encoded by different genes. In some embodiments of the synthetic expression system, the transcription factor comprises or consists of two or more components, each component being encoded by a different gene.

[0314] In some embodiments of the synthetic expression system, the transcription factor comprises or consists of two or more components, each component encoded by a different gene, and the different genes encoding the two or more components are polycistronic (e.g., controlled by an input promoter and / or the same promoter).

[0315] In some embodiments of the synthetic expression system, the transcription factor comprises or consists of three or more components, each component encoded by a different gene, and two or more of the different genes are polycistronic (e.g., controlled by an input promoter and / or the same promoter, and may be regulated or not).

[0316] In various embodiments, the synthetic expression system may include a transcription factor comprising two or more components, the components being expressed as part of the same or different transcription units.

[0317] In some embodiments, the first transcription unit comprises an input promoter that controls the expression of two genes, each encoding a component of a transcription factor, and the input promoter and the two genes are part of a polycistronic (or bicistronic) unit (e.g., a polycistronic or bicistronic locus, system, etc.).

[0318] In some embodiments, a transcription factor comprises two components, each encoded by a separate gene, both of which are expressed as part of a first transcription unit. When the genes encoding the two components are expressed, the two components can bind to form a transcription factor, which can be operably linked to a gene of interest and activate an output promoter that expresses the gene of interest.

[0319] In some embodiments, the synthetic expression system includes (a) a first transcription unit comprising a first input promoter operably linked to (i) a gene encoding a first component of a transcription factor and (ii) a gene encoding a second component of a transcription factor, thereby enabling its expression; and (b) a second transcription unit comprising a second transcription unit operably linked to a gene of interest, thereby enabling its expression; the first and second components can bind to form a transcription factor, which can activate the output promoter to express the gene of interest.

[0320] In some embodiments, a transcription factor comprises at least two components, each component expressed as part of the same or different transcription unit, and when a gene encoding at least two components is expressed, the at least two components can bind to form a transcription factor, which can be operably ligated to a gene of interest and activate an output promoter that expresses the gene of interest.

[0321] In some embodiments, the synthetic expression system comprises (a) a first transcription unit comprising a first input promoter operably linked to a gene encoding a first component of a transcription factor, thereby enabling its expression; (b) a second transcription unit comprising a second transcription unit comprising an output promoter operably linked to a gene of interest, thereby enabling its expression; and (c) a third transcription unit comprising a third transcription unit comprising a second input promoter operably linked to a gene encoding a second component of a transcription factor, thereby enabling its expression; the first and second input promoters may be the same or different; neither the first nor the second input promoter may be inducible, or either or both may be inducible; the first and second components may bind to form a transcription factor, which may activate the output promoter to express the gene of interest.

[0322] In some embodiments, a transcription factor comprises at least three components, each expressed as part of a different transcription unit, and when a gene encoding at least three components is expressed, the at least three components can bind to form a transcription factor, which can be operably linked to a gene of interest and activate an output promoter that expresses the gene of interest.

[0323] In some embodiments, the synthetic expression system includes: (a) a first transcription unit comprising a first input promoter operably linked to a gene encoding a first component of a transcription factor, which can express it; (b) a second transcription unit comprising a second output promoter operably linked to a gene of interest, which can express it; and (c) a third transcription unit comprising a third transcription unit comprising a second input promoter operably linked to a gene encoding a second component of a transcription factor, which can express it. ; and (d) a fourth transcription unit comprising a third input promoter operably linked to a gene encoding a third component of a transcription factor, thereby enabling its expression; the first, second, and third input promoters may be the same or different; none of the first, second, or third input promoters may be inducible, or any or all of them may be inducible; the first, second, and third components may bind to form a transcription factor, the transcription factor may activate an output promoter to express the gene of interest.

[0324] In some embodiments, a transcription factor comprises at least three components, each component expressed as part of the same or different transcription units, and when a gene encoding at least three components is expressed, the at least three components can bind to form a transcription factor, which can be operably ligated to a gene of interest and activate an output promoter that expresses the gene of interest.

[0325] In some embodiments, the synthetic expression system includes (a) a first transcription unit comprising a first input promoter operably linked to a gene encoding a first component of a transcription factor, thereby enabling its expression; (b) a second transcription unit comprising a second transcription unit operably linked to a gene of interest, thereby enabling its expression; and (c) a third transcription unit comprising a third transcription unit operably linked to a second input promoter comprising (i) a gene encoding a second component of a transcription factor, and (ii) a gene encoding a third component of a transcription factor, thereby enabling its expression; the first and second input promoters may be the same or different; neither input promoter may be inducible, or either or both may be inducible; the first, second, and third components may bind to form a transcription factor, which may activate the output promoter to express the gene of interest.

[0326] In some embodiments, a transcription factor comprises n components, where n is 2 or more, and the 2 or more n components are expressed as part of the same or different transcription units. When a gene encoding the n components is expressed, the n components can bind to form a transcription factor, which can be operably linked to a gene of interest to activate an output promoter that expresses the gene of interest.

[0327] In some embodiments, a synthetic expression system comprising a transcription factor having n components, each of the n components being encoded by a different gene, the system comprising: (a) a first transcription unit comprising a first input promoter operably linked to genes encoding the n components of the transcription factor and capable of expressing it; and (b) a second transcription unit comprising a second transcription unit comprising an output promoter operably linked to a gene of interest and capable of expressing it; the n components can bind to form a transcription factor, the transcription factor can activate the output promoter to express the gene of interest; where n is 2 or greater.

[0328] In some embodiments, the synthetic expression system comprises a transcription factor having multiple components, each component being encoded by a different gene, and the system comprises (a) a first transcription unit having one or more first transcription units, each comprising an input promoter operably linked to at least one gene encoding a component of the transcription factor, and all the transcription units together expressing all components of the transcription factor; and (b) a second transcription unit comprising an output promoter operably linked to a gene of interest, and capable of expressing it; the multiple components can bind to form a transcription factor, and the transcription factor can activate the output promoter to express the gene of interest.

[0329] In some embodiments, a synthetic expression system comprising a transcription factor comprising multiple components, each of which is encoded by a different gene, the system comprising (a) one or more first transcription units, each comprising an input promoter operably linked to at least one gene encoding a component of the transcription factor, the input promoters on the one or more first transcription units being the same or different, the number of the one or more first transcription units being equal to or less than the number of components, and all the transcription units together expressing all components of the transcription factor; and (b) a second transcription unit comprising an output promoter operably linked to a gene of interest, the gene of interest, the gene of interest, the multiple components can bind together to form a transcription factor, the transcription factor can activate the output promoter to express the gene of interest.

[0330] In some embodiments, the transcription factor includes a transcription activation domain (TAD). The "transcription activation domain" is a region of the transcription factor that, together with the DNA-binding domain, can activate transcription from the promoter. In some embodiments, the transcription activation domain is B112_TAD, B42_TAD, GAL4_TAD, miniVPR_TAD, Mxr1_TAD, PH_TAD, VP16_TAD, VP64_TAD, VP64v2_TAD, VPH_TAD, or VPR_TAD (for example, the transcription activation domains of B112, B42, GAL4, miniVPR, Mxr1, PH, VP16, VP64, VP64v2, VPH, or VPR, respectively). In some constructs described herein, for example, in some controls, "No_TAD" indicates the absence of a TAD in that particular construct. In some constructs described herein, for example, in some controls, the location of the transcriptional activation domain is indicated herein as No_TAD, indicating the absence of a transcriptional activation domain. In some constructs, for example, in some controls, components (e.g., TAD, operator, etc.) may be absent and can be replaced by spacers.

[0331] In some embodiments, the DNA-binding domain is or derived from the DNA-binding domain of Bm3R1, TetR, PhlF_AM, or VanR_AM, and the transcriptional activation domain is one of B112_TAD, B42_TAD, GAL4_TAD, miniVPR_TAD, Mxr1_TAD, PH_TAD, VP16_TAD, VP64_TAD, VP64v2_TAD, VPH_TAD, or VPR_TAD (as described herein).

[0332] In some embodiments, the transcriptional activation domain includes a polynucleotide or a functional fragment thereof having at least 90%, at least 95%, or at least 99% identity with any one nucleic acid sequence of SEQ ID NOs: 94-104. In some embodiments, the transcriptional activation domain includes a polypeptide or a functional fragment thereof having at least 90%, at least 95%, or at least 99% identity with any one nucleic acid sequence of SEQ ID NOs: 105-115.

[0333] In some embodiments, the transcription factor optionally includes a nuclear localization signal. The "nuclear localization signal" is an amino acid sequence that mediates the transport of a nuclear protein to the cell nucleus. In some embodiments, the nuclear localization signal is derived from Simian virus 40 (SV40). In some embodiments, the polynucleotide sequence encoding the SV40-derived nuclear localization signal is GAGTTCCCACCAAAAAAAAAGAGGAAAGTC (SEQ ID NO: 116). In some embodiments, the polynucleotide sequence encoding the SV40-derived nuclear localization signal is GAGTTCCCCCCCAAGAAAAAGAGGAAAGTT (SEQ ID NO: 117). In some embodiments, the polynucleotide sequence of the SV40-derived nuclear localization signal encodes a protein (e.g., a polypeptide) having the amino acid sequence EFPPKKKRKV (SEQ ID NO: 118). In some embodiments, the polynucleotide sequence of the SV40-derived nuclear localization signal encodes a protein having the amino acid sequence PKKKRKV (SEQ ID NO: 119).

[0334] For example, but not limited to, the homeodomain of yeast repressor α2; cytosolic proteins; maize regulatory protein Opaque-2; Ras; small GTPases of the Rho family; Agrobacterium VirD2 protein; VirE2 and VirD2; hsp56 immunophilin component of steroid receptor heterocomplexes; cytoplasmic fixed proteins; various signal transducers; glucocorticoid receptors; human cytomegalovirus UL84 protein; pore complex or cytoplasmic proteins; ErbB3 13; ErbB4 1; ErbB2; retinoblastoma gene product; Ty1 integrase; or as part of proteins including SV40, many different nuclear localization signals have been described in the art. For example, Nguyen et al.BMC Bioinformatics volume 10,Article number:202(2009);Lin et al.PLoS One,October 29,2013,https: / / doi.org / 10.1371 / journal.pone.0076864;Hawkins et al.J.Proteome Res.2007,6,4,1402-1409;Nair et al.Nucleic Acids Research,Volume 31,Issue 1,1 January 2003,Pages See pages 397-399.

[0335] In some embodiments, the transcription factor further comprises an oligomerization domain (OD). In some embodiments, the oligomerization domain is a Linker_only_for_oligomerization (e.g., Linker for oligomerization; SEQ ID NO: 157); a Trimerization_domain (e.g., Trimerization domain; SEQ ID NO: 158); or a Heptamerization_domain (e.g., Heptamerization domain; SEQ ID NO: 157). In some embodiments, the transcription factor comprises an oligomerization domain containing a polynucleotide having one of the sequences of SEQ ID NOs. 156-158. In some embodiments, the transcription factor comprises an oligomerization domain containing a polypeptide having one of the amino acid sequences of SEQ ID NOs. 159-161.

[0336] As used in this disclosure, “Linker_only_for_oligomerization” refers to the polynucleotide encoding “Linker 1” in the supplemental information of Kim D et al. (2014) Biomaterials, 35:6026. In some embodiments, this linker is used for a bipartite transcription factor lacking an oligomerization domain.

[0337] In some embodiments, Trimerization_Domain encodes an oligomerization domain flanked by linkers on both sides. In some embodiments, Trimerization_Domain includes a human collagen Xv trimerization domain and a second linker after the linker. In some embodiments, Trimerization_Domain encodes the linkage of the following three coding subparts in the order shown: (i) "Linker 1" from Supplementary Information of Kim D et al. (2014); (ii) the trimerization domain and associated TDB structure 3N3F derived from Wirz JA et al. (2011) Matrix Biol., 30:9; and (iii) "Linker 2" from Supplementary Information of Kim D et al. (2014).

[0338] In some embodiments, the Heptamerization_domain encodes a heptamerization domain flanked by linkers on both sides. In some embodiments, the Heptamerization_domain encodes the Archaeoglobus fulgidus Sm1 heptamerization domain and a second linker after the linker. In some embodiments, the Heptamerization_domain encodes the concatenation of the following three code subparts in the order shown: (i) “Linker 1” from Supplemental Information of Kim D et al. (2014); (ii) “Heptamerization Domain” derived from Table 1 of Kim D et al. (2012) PLoS One., 7:e43077; and (iii) “Linker 2” from Supplemental Information of Kim D et al. (2014).

[0339] In some embodiments, the transcription factor comprises one or more linkers. In some embodiments, the linker comprises a polynucleotide having the nucleic acid sequence of SEQ ID NO: 120. In some embodiments, the linker comprises or comprises a polynucleotide having the nucleic acid sequence of SEQ ID NO: 121. In some embodiments, the linker comprises or comprises an amino acid having the nucleic acid sequence of SEQ ID NO: 122. In some embodiments, the linker comprises or comprises a polypeptide having the amino acid sequence of SEQ ID NO: 123.

[0340] Those skilled in the art will understand that transcription factors may be oligomers (e.g., containing multiple monomers or subunits) or monomers (e.g., containing a single monomer or subunit). In some embodiments, a transcription factor that is an oligomer may contain two or more identical or different subunits. In some embodiments, when expressed in a host cell, the transcription factor is translated as a single polypeptide chain. In some embodiments, the transcription factor is translated as multiple polypeptide chains. In some embodiments, the transcription factor comprises at least two polypeptide chains that associate post-translation. In some embodiments, the polypeptide chain is encoded by a polynucleotide encoding a self-cleaving polypeptide. In some embodiments, the self-cleaving polypeptide is a 2A peptide. In some embodiments, the self-cleaving polypeptide is P2A. In some embodiments, the self-cleaving polypeptide is E2A, F2A, or T2A. In some embodiments, the self-cleaving polypeptide comprises a polynucleotide having the nucleic acid sequence of SEQ ID NO: 124. In some embodiments, the self-cleaving polypeptide comprises a polypeptide having the amino acid sequence of SEQ ID NO: 125.

[0341] In some embodiments, the transcription factor includes one or more linkers. Non-limiting examples of one-component sTFs (used in all three processes) are listed in Tables 7, 8, 9, and 10, and include four subparts: DBD, NLS, linker, and TAD. Subpart types of sTFs required for synthetic expression system function include DBD and TAD.

[0342] Non-restrictive examples of two-component sTFs are listed in Tables 11, 12, 13, 14, and 36, and include nine possible subparts: DBD (required), NLS1, linker, BPP1, 2A, BPP2, NLS2, OD, and TAD (required).

[0343] Non-restrictive examples of sTF variants are listed in Tables 7, 8, 9, 10, 11, 12, 13, 14, and 36.

[0344] In some embodiments, the DNA sequence of the gene encoding the sTF variant can be obtained by referring to the corresponding row in Table 7, Table 8, Table 9, Table 10, Table 11, Table 12, Table 13, Table 14, or Table 36, and then generating the complete sTF gene sequence by concatenating the DNA sequences of partial type variants of the corresponding component, as shown in Table 21. The complete DNA and amino acid sequences of certain sTF variants of this disclosure can be found in Tables 30, 31, and 36 (by SEQ ID NO).

[0345] In some embodiments, the DNA sequence of the transcription terminator of the first transcription unit (for example, used in Example 1) is shown in Table 21 (by sequence number).

[0346] In some embodiments, the polynucleotide encoding the transcription factor comprises or consists of a sequence that is at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequences of Examples 2, 3, Tables 21, 30, and 36, or to any one of the nucleic acid sequences of Sequence IDs 26-40 or 182-185. In some embodiments, the polynucleotide encoding the transcription factor comprises any one of the nucleic acid sequences of Sequence IDs 26-40 or 182-185. In some embodiments, the polynucleotide encoding the transcription factor contains or consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 50, 100, 150, 200, 250, or 300 or fewer nucleotide substitutions, insertions, additions, or deletions to any one nucleic acid sequence of sequence numbers 26-40 or 182-185.

[0347] In some embodiments, the transcription factor comprises or consists of a polypeptide that is at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one amino acid sequence of SEQ ID NOs. In some embodiments, the encoded transcription factor comprises or consists of polypeptides having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 50, or 100 or fewer amino acid substitutions, insertions, additions, or deletions to any one amino acid sequence of SEQ ID NOs.

[0348] Synthetic output promoter [P(out)] In some embodiments, the Disclosure provides a second transcription unit comprising a gene of interest under the control of a synthetic output promoter. In some embodiments, the Disclosure provides a second transcription unit comprising a synthetic output promoter and an insertion site, wherein the insertion site is configured such that the gene of interest inserted into the insertion site is operably ligated to and under the control of the synthetic output promoter. As used in this application, for example, “synthetic output promoter” or “P(out)” refers to a synthetic promoter that is driven by a transcription factor of the first transcription unit (e.g., a homologous one thereto) and is operably ligated to a polynucleotide encoding the gene of interest, thereby activating its transcription. In some embodiments, the gene of interest may or may not be endogenous to the host cell when expressed in the host cell genome.

[0349] A coding sequence and a regulatory sequence (e.g., a promoter sequence) are said to be "operably linked" or "operably ligated" if the coding sequence and the regulatory sequence are covalently linked, and / or if the expression or transcription of the coding sequence is under the influence or control of the regulatory sequence.

[0350] In some embodiments, P(out) is operably ligated to a target gene encoding RNA. In some embodiments, P(out) is operably ligated to a target gene encoding a protein. In some embodiments, the target gene encodes an enzyme. In some embodiments, the target gene encodes a protein involved in the biosynthesis of organic molecules.

[0351] When a coding sequence is translated into a functional biological product, the coding sequence and regulatory sequence are said to be operably bound or ligated if the induction of a promoter in the 5' regulatory sequence enables the transcription of the coding sequence, and the nature of the ligation between the coding sequence and the regulatory sequence does not (1) result in a frameshift event that alters the reading frame of the coding sequence, (2) interfere with the promoter region's ability to direct the transcription of the coding sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein.

[0352] In some embodiments, the output promoter is a synthetic output promoter of the same family as Bm3R1-based sTF. In some embodiments, the output promoter is a synthetic output promoter of the same family as PhlF_AM-based sTF. In some embodiments, the output promoter is a synthetic output promoter of the same family as TetR-based sTF. In some embodiments, the output promoter is a synthetic output promoter of the same family as VanR_AM-based sTF. In some embodiments, the output promoter is a synthetic output promoter of the same family as Bm3R1-based sTF, for example, those listed in Table 15. In some embodiments, the output promoter is a synthetic output promoter of the same family as PhlF_AM-based sTF, for example, those listed in Table 16. In some embodiments, the output promoter is a synthetic output promoter of the same family as TetR-based sTF, for example, those listed in Table 17. In some embodiments, the output promoter is a synthetic output promoter of the same family as VanR_AM-based sTF, for example, those listed in Table 18.

[0353] In some embodiments, the synthetic expression system includes an output promoter, and the output primers include or consist of polynucleotides that are at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequences of Examples 2 and 3, Table 33, and Table 36, or to any one of the nucleic acid sequences of SEQ ID NOs. 56-70 or 186-193. In some embodiments, the output promoter comprises or consists of a polynucleotide having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 50 or fewer nucleotide substitutions, insertions, additions, or deletions with respect to one nucleic acid sequence of any one of sequence numbers 56-70 or 186-193. In some embodiments, the synthetic output promoter comprises or consists of a polynucleotide having one nucleic acid sequence of any one of sequence numbers 56-70 or 186-193.

[0354] In some embodiments, the transcription factor binds to the output promoter. In some embodiments, the synthetic output promoter includes a DNA sequence directly bound by RNA polymerase and a DNA sequence bound by the DNA-binding domain component of the transcription factor. In some embodiments, the DNA sequence bound by the transcription factor is or includes an operator and / or enhancer. In some embodiments, the upstream activation sequence is or includes an operator and / or enhancer. In some embodiments, the operator is a DNA sequence directly bound by the transcription factor, and the enhancer is a larger region of DNA containing the operator. In some embodiments, the core promoter or core promoter sequence is a polynucleotide segment or sequence directly bound by RNA polymerase.

[0355] As used in this application, “core promoter” refers to the smallest portion of a promoter that is necessary to initiate transcription and contains the transcription start site. Typically, the core promoter extends from about 15–20 base pairs upstream of the TATA box to the translation start site.

[0356] In some embodiments, the core promoter of the output promoter refers to a polynucleotide containing a nucleotide sequence that is the minimum nucleotide sequence required to initiate transcription of a coding sequence that is directly bound by RNA polymerase and operably linked.

[0357] In some embodiments, a promoter (e.g., an input promoter or an output promoter) comprises (a) a core promoter and (b) one or more copies of an upstream activation sequence, operator, and / or enhancer, or a polynucleotide or sequence conjugated by a transcription factor containing them. In some embodiments, an enhancer may include multiple operators. In some embodiments, a synthetic output promoter may include one or more operators and / or enhancers.

[0358] In some embodiments, the synthetic output promoter includes an upstream activating sequence and a core promoter. In some embodiments, the synthetic output promoter includes a core promoter element but does not include an upstream activating sequence (UAS). In some embodiments, the upstream activating sequence is operably linked to the core promoter. In some embodiments, the upstream activating sequence is synthetic. In some embodiments, the upstream activating sequence is chimeric. In some embodiments, the upstream activating sequence includes one or more operators. In some embodiments, one or more operators may include bmO, tetO, phlO, or vanO. In some embodiments, the designation or description of an operator (or transcription unit or other component of the expression system) includes a prefix indicating the copy number of the operator (or other component), for example, "1×" indicates one copy, "2×" indicates two copies, and so on.

[0359] In some constructs, such as controls, the designation or description of an operator (or transcription unit or other component of the expression system) includes a prefix indicating the copy number of the operator (or other component), where 0x indicates no copies (zero) (e.g., the operator or component does not exist). In some constructs, such as controls, the designation or description of a TAD (or transcription unit or other component of the expression system) includes the prefix "No_" to indicate the absence of this component; for example, "No_TAD" indicates the absence of TAD.

[0360] In some embodiments, one copy of bmO is located within the upstream activation sequence. The bmO is created by concatenating the following three non-coding subparts in the order shown: (i) a non-repeating sequence spacer, (ii) the Bm3R1 operator CGGAATGAACTTTCATTCCG (sequence number 130), and (iii) the non-repeating sequence spacer. In some embodiments, one copy of bmO includes sequence number 126.

[0361] In some embodiments, one copy of tetO is located within an upstream activation sequence containing one copy of a TetR operator. The tetO is created by concatenating the following three non-coding subparts in the order shown: (i) a non-repeating sequence spacer, (ii) a TetR operator TCCCTATCAGTGATAGAGA (sequence ID 131), and (iii) a non-repeating sequence spacer. In some embodiments, one copy of tetO contains sequence ID 128.

[0362] In some embodiments, one copy of phlO is located within the upstream activation sequence. The phlO is created by concatenating the following three non-coding subparts in the order shown: (i) a non-repeating sequence spacer, (ii) the PhlF operator ATGATACGAAACGTACCGTATCGTTAAGGT (SEQ ID NO: 132), and (iii) the non-repeating sequence spacer. In some embodiments, one copy of phlO includes SEQ ID NO: 127.

[0363] In some embodiments, one copy of vanO is located within an upstream activation sequence containing one copy of a VanR operator. vanO is created by concatenating the following three non-coding subparts in the order shown: (i) a non-repeating sequence spacer, (ii) the VanR operator ATTGGATCCAAT (sequence number 133), and (iii) the non-repeating sequence spacer. In some embodiments, one copy of vanO contains sequence number 129.

[0364] In some embodiments, the upstream activation sequence does not contain an operator ("0xoperator").

[0365] In some embodiments, one or more operators are bound by a transcription factor, the transcription factor or its components are encoded by a first transcription unit of the present disclosure. In some embodiments, one or more bound operators activate a core promoter sequence.

[0366] In some embodiments, the core promoter includes a naturally occurring core promoter sequence. In some embodiments, the core promoter sequence includes, or consists of, a sequence that is at least 90%, at least 95%, or 100% identical to a naturally occurring core promoter sequence. In some embodiments, the core promoter sequence is synthetic. In some embodiments, the core promoter sequence is endogenous to the host cell. In some embodiments, the core promoter sequence is exogenous to the host cell. In some embodiments, the core promoter sequence includes a sequence homologous to the endogenous core promoter sequence of the host cell. In some embodiments, the core promoter sequence includes, or consists of a sequence that is at least 90%, at least 95%, or 100% identical to the endogenous core promoter sequence of the host cell. In some embodiments, the core promoter sequence includes or consists of a sequence that is at least 90%, at least 95%, or 100% identical to the core promoter sequence derived from P(AOX1) (SEQ ID NO: 162), P(DAS2) (SEQ ID NO: 163), P(HHF2) (SEQ ID NO: 164), or P(PMP20) (SEQ ID NO: 165).

[0367] Non-limiting examples of synthetic output promoters are listed in Tables 15, 16, 17, 18, and 36, based on the four different DBD types used, and include two components: an upstream activating sequence (UAS) and a core promoter.

[0368] The DNA sequence of the synthetic output promoter used in Example 1 can be obtained by referring to the corresponding row in Table 15, Table 16, Table 17, Table 18, or Table 36. The complete DNA sequence of the synthetic output promoter used in Example 1 is shown in Tables 33 and 36 (by sequence number).

[0369] In some embodiments, the transcription factor includes the DNA-binding domain of Bm3R1, and the upstream activation sequence of the synthetic output promoter includes 0, 1, 2, 4, or 8 copies of bmO, or other multiple copies. In some embodiments, 2 copies of bmO include or are derived from SEQ ID NO: 134. In some embodiments, 4 copies of bmO include or are derived from SEQ ID NO: 135. In some embodiments, 8 copies of bmO include or are derived from SEQ ID NO: 136.

[0370] In some embodiments, the transcription factor includes the DNA-binding domain of PhlF_AM, and the upstream activation sequence of the synthetic output promoter includes 0, 1, 2, 4, or 8 copies, or other multiple copies of phlO. In some embodiments, 2 copies of phlO include or are derived from SEQ ID NO: 137. In some embodiments, 4 copies of phlO include or are derived from SEQ ID NO: 138. In some embodiments, 8 copies of phlO include or are derived from SEQ ID NO: 139.

[0371] In some embodiments, the transcription factor includes the DNA-binding domain of TetR, and the upstream activation sequence of the synthetic output promoter includes 0, 1, 2, 4, or 8 copies of tetO, or other multiple copies. In some embodiments, 2 copies of tetO include or are derived from SEQ ID NO: 140. In some embodiments, 4 copies of tetO include or are derived from SEQ ID NO: 141. In some embodiments, 8 copies of tetO include or are derived from SEQ ID NO: 142.

[0372] In some embodiments, the transcription factor includes the DNA-binding domain of VanR_AM, and the upstream activation sequence of the synthetic output promoter includes 0, 1, 2, 4, or 8 copies of vanO, or other multiple copies. In some embodiments, 2 copies of vanO include or are derived from SEQ ID NO: 143. In some embodiments, 4 copies of vanO include or are derived from SEQ ID NO: 144. In some embodiments, 8 copies of vanO include or are derived from SEQ ID NO: 145.

[0373] Transfer Terminator [TT] In some embodiments, the transcription unit may include a transcription terminator as needed.

[0374] In some embodiments, a transcription terminator can terminate transcription (e.g., transcription of a transcription factor, transcription activator, or biological product). In some embodiments, the transcription terminator is a forward terminator. When located downstream of a polynucleotide sequence primed for transcription, a forward transcription terminator terminates transcription after the transcription of the polynucleotide.

[0375] In some embodiments, either or both of the first transcription unit and / or the second transcription unit optionally include a transcription terminator. In some embodiments, the first transcription unit may optionally include the first transcription terminator downstream of the polynucleotide encoding the transcription factor. In some embodiments, the second transcription unit may optionally include the transcription terminator downstream of the gene of interest. In various embodiments, the first and second transcription terminators may be the same or different.

[0376] In some embodiments, the first transcription unit and / or the second transcription unit comprises a naturally occurring transcription terminator. In some embodiments, the first transcription unit and / or the second transcription unit comprises a synthetic transcription terminator. In some embodiments, when expressed in a host cell, the first transcription unit and / or the second transcription unit comprises an endogenous transcription terminator for the host cell.

[0377] In some embodiments, the transcription terminator comprises or consists of a polynucleotide that is at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequences of Example 1, Example 3, Tables 21 and 32, or to either SEQ ID NO: 146 or 147. In some embodiments, the transcription terminator comprises or consists of a polynucleotide having either SEQ ID NO: 146 or 147.

[0378] In some embodiments, the first transcription terminator and the transcription terminator of the second transcription unit contain the same polynucleotide sequence. In some embodiments, the first transcription unit and / or the second transcription unit contain a transcription terminator derived from a gene encoding a ribosomal protein. In some embodiments, the first transcription unit and / or the second transcription unit contain a transcription terminator derived from a gene encoding ribosomal protein S2 (RPS2) (SEQ ID NO: 146). In some embodiments, the first transcription unit and / or the second transcription unit contain a transcription terminator derived from a gene encoding aldehyde oxidase 1 (AOX1) (SEQ ID NO: 147).

[0379] Non-restrictive examples of transcription terminators (TTs) are shown in Tables 19 and 21 (corresponding DNA sequences of transcription terminators derived from RPS2) and Table 32 (corresponding DNA sequences of transcription terminators derived from AOX1).

[0380] Various transcription terminators are described herein and / or in the scientific literature. See, for example, Matsuyama et al. 2019 J.Biosci.Bioeng.128:655-661; Candelli et al. 2018 EMBO J.37:e97490; Fox et al. 2016 WIREs RNA 7:91-104; LaRochelle et al. 2018 Nat.Comm.9:Article 4364; and Karbalaei et al. 202 J.Cell.Phys.9:5867. Any suitable transcription terminator described herein and / or in the scientific literature can be incorporated as a transcription unit or a component of a synthetic expression system.

[0381] variant In some embodiments, the present disclosure provides variants of transcription units or synthetic expression systems.

[0382] Aspects of this disclosure relate to polynucleotides including polynucleotides encoding transcription factors (e.g., expressed from an input promoter) and genes of interest encoding biological products (e.g., expressed from a synthetic output promoter activated by a transcription factor). Variants of the polynucleotides, transcription factors, and biological products described in this application are also included in this disclosure. A variant may share at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the reference sequence.

[0383] Unless otherwise specified, the term “sequence identity” as known in the art refers to the relationship between sequences of two polypeptides or polynucleotides, determined by sequence comparison (alignment). In some embodiments, sequence identity is determined over the entire length of the sequence, while in other embodiments, sequence identity is determined over a region of the sequence.

[0384] Identity can also refer to the degree of sequence relevance between two sequences, determined by the number of matches between strings of two or more residues (e.g., polynucleotides or amino acid residues). Identity measures the percentage of identical matches between the smaller of the two or more sequences and a gap alignment (if any) addressed by a particular mathematical model, algorithm, or computer program.

[0385] The identity of related polynucleotide sequences, transcription factors, and / or biological products can be readily calculated by any method known to those skilled in the art. In a preferred embodiment, the "identity percentage" of two sequences (e.g., polynucleotide or amino acid sequence) is determined using the algorithm of Karlin and Altschul Proc.Natl.Acad.Sci.USA 87:2264-68,1990 (modified in Karlin and Altschul Proc.Natl.Acad.Sci.USA 90:5873-77,1993). Such an algorithm is provided by Altschul These are incorporated into the NBLAST® and XBLAST® programs (version 2.0) described in et al., J.Mol.Biol.215:403-10, 1990. When a gap exists between two sequences, Gapped BLAST® can be used, for example, as described in Altschul et al., Nucleic Acids Res.25(17):3389-3402, 1997. When using the BLAST® and Gapped BLAST® programs, the default parameters of each program (e.g., XBLAST® and NBLAST®) can be used, or the parameters can be appropriately adjusted as understood by those skilled in the art.

[0386] Another local alignment technique that may be used is, for example, based on the Smith-Waterman algorithm (Smith, TF & Waterman, MS (1981) "Identification of common molecular subsequences." J.Mol.Biol.147:195-197). A common global alignment technique that may be used is, for example, the Needleman-Wunsch algorithm based on dynamic programming (Needleman, SB & Wunsch, CD (1970) "A general method applicable to the search for similarities in the amino acid sequences of two proteins." J.Mol.Biol.48:443-453).

[0387] More recently, the Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed, which is said to generate global alignments of nucleic acids and amino acid sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm. In some embodiments, the identity of two polypeptides is determined by aligning the two amino acid sequences, calculating the number of identical amino acids, and dividing by the length of one of the amino acid sequences. In some embodiments, the identity of two polynucleotides is determined by aligning the two nucleotide sequences, calculating the number of identical nucleotides, and dividing by the length of one of the polynucleotides.

[0388] For multiple sequence alignments, a computer program including Clustal Omega (Sievers et al., Mol Syst Biol. 2011 Oct 11;7:539) can be used. In some embodiments, sequences comprising polynucleotides or amino acid sequences are found to have a certain percentage identity with respect to a reference sequence, such as the sequences disclosed and / or claimed in this application, when sequence identity is determined using Clustal Omega (Sievers et al., Mol Syst Biol. 2011 Oct 11;7:539).

[0389] As used in this application, a residue (e.g., a nucleic acid residue or an amino acid residue) in sequence "X" is referred to as corresponding to a different position or residue (e.g., a nucleic acid residue or an amino acid residue) "Z" in sequence "Y" if the residue in sequence X is at the corresponding position of Z in sequence Y when sequences X and Y are aligned using an amino acid sequence alignment tool known in the art.

[0390] Mutations can be generated in nucleotide sequences by various methods known to those skilled in the art. For example, mutations can be produced by PCR-directed mutation, site-directed mutagenesis by the method of Kunkel (Kunkel, Proc. Nat. Acad. Sci. USA 82:488-492, 1985), chemical synthesis of polypeptide-encoding genes, gene editing tools, or insertions such as the insertion of tags (e.g., HIS tags or GFP tags). Mutations may include substitutions, deletions, and translocations generated by any method known in the art. Methods for generating mutations can be found in references such as Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Fourth Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2012, or Current Protocols in Molecular Biology, FMAusubel, et al., eds., John Wiley & Sons, Inc., New York, 2010.

[0391] In some embodiments, methods for constructing variants include cyclic substitution (Yu and Lutz, Trends Biotechnol. 2011 Jan;29(1):18-25). Circular substitution allows for the cyclic formation of the linear primary sequence of a polypeptide (e.g., by joining the N-terminus and C-terminus of the sequence) and the cleavage ("cut") of the polypeptide at different positions. Therefore, the linear primary sequence of the new polypeptide may have low sequence identity (e.g., <80%, <75%, <70%, <65%, <60%, <55%, <50%, <45%, <40%, <35%, <30%, <25%, <20%, <15%, <10%, <5 While not bound by any particular theory, variant polypeptides created by cyclic substitution of a reference polypeptide and possessing a similar tertiary structure to the reference polypeptide may share similar functional characteristics (e.g., enzyme activity, enzyme rate, substrate specificity, or product specificity). In some cases, cyclic substitution can alter the secondary, tertiary, or quaternary structure, producing enzymes with different functional characteristics (e.g., increased or decreased enzyme activity, different substrate specificity, or different product specificity). See, for example, Yu and Lutz, Trends Biotechnol. 2011 Jan;29(1):18-25.

[0392] It should be understood that in proteins with cyclic substitutions, the linear amino acid sequence of the protein will differ from that of a reference protein without cyclic substitutions. However, those skilled in the art may be able to determine which residues in a cyclically substituted protein correspond to residues in a reference protein without cyclic substitutions, for example, by aligning the sequences and detecting conserved motifs, and / or by comparing the structure or predicted structure of the protein, for example, by homology modeling.

[0393] In some embodiments, the variant sequence includes homologous sequences. As used in this application, homologous sequences have a certain percentage of identity (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%). These are sequences (e.g., polynucleotides or amino acid sequences) that share at least 98%, at least 99%, or 100% percent identity. Homologous sequences include, but are not limited to, paralogous sequences, orthologous sequences, or sequences arising from convergent evolution. In some embodiments, paralogous sequences arise from gene duplication within the genome of a species, while orthologous sequences diverge after a speciation event. Two different species may have evolved independently, but as a result of convergent evolution, each may contain sequences that share a certain percentage of identity with sequences from the other species.

[0394] In some embodiments, the polypeptide variant includes a domain that shares a secondary structure (e.g., an alpha helix, a beta sheet) with the reference polypeptide. In some embodiments, the polypeptide variant shares a tertiary structure with the reference polypeptide. As a non-limiting example, a variant polypeptide may have lower primary sequence identity compared to the reference polypeptide (e.g., less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5%) but may share one or more secondary structures (e.g., loops, alpha helices, or beta sheets) or have the same tertiary structure as the reference polypeptide. For example, a loop may be located between a beta sheet and an alpha helix, between two alpha helices, or between two beta sheets. Homology modeling can be used to compare two or more tertiary structures.

[0395] Functional variants of proteins, enzymes, or other biological products disclosed in this application are also included in this disclosure. Functional variants can be identified using any method known in the art. For example, homologous proteins with known functions can be identified using the algorithm described above in Karlin and Altschul Proc.Natl.Acad.Sci.USA 87:2264-68,1990.

[0396] Presumed functional variants can also be identified by searching for polypeptides with functionally annotated domains. Databases including Pfam (Sonnhammer et al., Proteins. 1997 Jul;28(3):405-20) can be used to identify polypeptides with specific domains.

[0397] Those skilled in the art will also recognize that mutations in the coding sequence of a biological product may result in a conserved amino acid substitution that provides a functionally equivalent variant of the aforementioned biological product, such as a variant that preserves the activity of the biological product. As used in this application, “conserved amino acid substitution” means an amino acid substitution that does not alter the relative charge or size characteristics or functional activity of the biological product on which the amino acid substitution is made.

[0398] Those skilled in the art will also recognize that mutations in the coding sequence of recombinant polypeptides can result in conserved amino acid substitutions that provide functionally equivalent variants of the polypeptide, such as variants that preserve the polypeptide's activity. As used in this application, “conserved amino acid substitution” refers to amino acid substitutions that do not alter the relative charge or size characteristics or functional activity of the protein being substituted.

[0399] In some cases, amino acids are characterized by their R groups (see, for example, Table 29). For example, amino acids may contain nonpolar aliphatic R groups, positively charged R groups, uncharged R groups, nonpolar aromatic R groups, or polar uncharged R groups. Non-limiting examples of amino acids containing nonpolar aliphatic R groups include alanine, glycine, valine, leucine, methionine, and isoleucine. Non-limiting examples of amino acids containing positively charged R groups include lysine, arginine, and histidine. Non-limiting examples of amino acids containing uncharged R groups include aspartic acid and glutamic acid. Non-limiting examples of amino acids containing nonpolar aromatic R groups include phenylalanine, tyrosine, and tryptophan. Non-limiting examples of amino acids containing polar uncharged R groups include serine, threonine, cysteine, proline, asparagine, and glutamine.

[0400] Non-limiting examples of functionally equivalent variants of polypeptides may include conserved amino acid substitutions in the amino acid sequences of the proteins disclosed herein. Conserved amino acid substitutions include substitutions made between amino acids in the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D. Further non-limiting examples of conserved amino acid substitutions are provided in Table 29.

[0401] In some embodiments, when preparing the variant polypeptide, one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more than twenty residues can be modified. In some embodiments, amino acids are replaced by conservative amino acid substitutions. [Table 29]

[0402] Amino acid substitutions in the amino acid sequence of a polypeptide to produce recombinant polypeptide variants having desired properties and / or activity can be performed by modifying the coding sequence of the polypeptide. Similarly, conservative amino acid substitutions in the amino acid sequence of a polypeptide to produce functionally equivalent variants of the polypeptide are typically performed by modifying the coding sequence of the recombinant polypeptide.

[0403] In some embodiments, the polynucleotide encoding any of the biological products described herein is under the control of one or more regulatory sequences. In some embodiments, the polynucleotide is expressed under the control of a promoter. In some embodiments, the promoter is a native promoter. As used herein, “native” promoter means a promoter that is naturally present in a host cell in at least one copy. A native promoter may include, but is not limited to, the original copy (one or more) in the host cell. Nevertheless, a promoter at a locus in a cell different from its native locus is considered a promoter that is native to that cell. In some embodiments, the promoter is synthetic.

[0404] The expressions and terminology used in this application are for illustrative purposes only and should not be considered limiting. The use of terms such as “including,” “comprising,” “having,” “containing,” “involving,” and / or variations thereof in this application means that the items listed therein, their equivalents, and additional items are included.

[0405] The present invention is further illustrated by the following examples. Any specific details of any particular methods, processes, culture media, or conditions in the examples are illustrative and not intended to limit the scope.

[0406] The embodiments described Specific embodiments are described in the sections below. 1. A methylotropic host cell comprising a synthetic expression system, wherein the synthetic expression system is (a)(i) an input promoter comprising an upstream activation sequence (UAS) and a core promoter element, and (ii) A polynucleotide encoding at least one component of a synthetic transcription factor, wherein the synthetic transcription factor comprises a DNA-binding domain (DBD) and a transcription activation domain (TAD), and the DBD and the TAD are not native to the methylotropic host cell. A first transcription unit comprising the input promoter which drives the expression of at least one component of the synthetic transcription factor, (b) A second transcription unit comprising a synthetic output promoter operably linked to the gene of interest, wherein the synthetic transcription factor is an activator of the synthetic output promoter, Includes, The aforementioned target gene is expressed in a methylotropic host cell in the absence of exogenously supplied methanol. 2. The methylotropic host cell according to item 1, wherein the polynucleotide of the first transcription unit encodes all components of the synthetic transcription factor. 3. A methylotropic host cell according to any one of items 1 to 2, wherein the input promoter is synthetic. 4. The methylotropic host cell according to item 3, wherein the input promoter has at least 90% sequence identity with a naturally occurring promoter. 5. A methylotropic host cell as described in item 4, wherein the input promoter is naturally present. 6. A methylotropic host cell according to item 5, wherein the input promoter is native to the cell. 7. A methylotropic host cell according to any one of items 1 to 5, wherein the input promoter is a regulated input promoter. 8. The methylotropic host cell according to item 7, wherein the moduloable input promoter is inducible. 9. The methylotropic host cell according to item 7, wherein the adjustable input promoter is repressive. 10. The methylotropic host cell according to subsection 7, wherein the adjustable input promoter responds to the addition, restriction, or depletion of nutrients related to the culture process of the genus. 11. A methylotropic host cell as described in paragraph 10, wherein the moduloable input promoter responds to thiamine depletion, glycerol restriction, monosaccharide restriction, or restriction of a carbon source, sugar, starch, galactose, maltose, glucose, sorbitol, inositol, glycerol, vitamin, steroid, nitrogen source, nitrate, nitrite, ammonium, amino acids, methionine, heavy metal, copper, benzoic acid, hydrogen peroxide, calcium-containing compounds and / or phosphate. 12. A methylotropic host cell according to claim 10, wherein the modulotable input promoter responds to restriction or depletion of any combination of two or more nutrients. 13. A methylotropic host cell according to claim 10, wherein the activity of the modulotable input promoter is increased by the presence of exogenously provided formic acid. 14. The methylotropic host cell according to item 7, wherein the tunable input promoter is tunable in the absence of exogenously provided methanol. 15. A methylotropic host cell according to any one of items 1 to 14, wherein the input promoter is not methanol-inducible. 16. A methylotropic host cell according to any one of items 1 to 9, wherein the input promoter is a constitutive input promoter. 17. A methylotropic host cell according to any one of items 1 to 16, wherein the upstream activating sequence (UAS) and / or the core promoter element of the input promoter are not native to the methylotropic host cell. 18. A methylotropic host cell according to any one of items 1 to 15, wherein the input promoter is P(JEN1), P(GQ6704499), P(GQ6700926), P(HGT1), P(FDH1), P(AOX2), P(RGI2), P(THI13)_short, P(THI13)_long, or P(THI4). 19. A methylotropic host cell according to any one of claims 1 to 18, wherein the input promoter is a polynucleotide having at least 90%, at least 95%, or at least 99% identity with any one nucleic acid sequence of sequence numbers 16 to 25. 20. A methylotropic host cell according to any one of claims 1 to 18, wherein the input promoter is a polynucleotide having any one nucleic acid sequence of sequence numbers 16 to 25. 21. A methylotropic host cell according to any one of items 1 to 20, wherein the DNA-binding domain (DBD) of the synthetic transcription factor is Bm3R1, TetR, PhlF_AM, or VanR_AM. 22. A methylotropic host cell according to any one of items 1 to 21, wherein the transcriptional activation domain (TAD) of the synthetic transcription factor is B112_TAD, B42_TAD, GAL4_TAD, miniVPR_TAD, Mxr1_TAD, PH_TAD, VP16_TAD, VP64_TAD, VP64v2_TAD, VPH_TAD, or VPR_TAD. 23. A methylotropic host cell according to any one of items 1 to 22, wherein the DNA-binding domain (DBD) of the synthetic transcription factor is Bm3R1, TetR, PhlF_AM, or VanR_AM, and the transcriptional activation domain (TAD) of the synthetic transcription factor is B112_TAD, B42_TAD, GAL4_TAD, miniVPR_TAD, Mxr1_TAD, PH_TAD, VP16_TAD, VP64_TAD, VP64v2_TAD, VPH_TAD, or VPR_TAD. 24. A methylotropic host cell according to any one of items 1 to 23, wherein the synthetic transcription factor is not an activator of the input promoter. 25. A methylotropic host cell according to any one of items 1 to 23, wherein the synthetic transcription factor is a one-component synthetic transcription factor. 26. A methylotropic host cell according to any one of items 1 to 23, wherein the synthetic transcription factor is a two-component or multi-component synthetic transcription factor. 27. The methylotropic host cell according to item 26, wherein the two-component or multi-component synthetic transcription factor comprises at least two bioconjugate protein products. 28. A methylotropic host cell as described in item 27, wherein the first bioconjugate protein product (BPP1) is SpyTag002 and the second bioconjugate protein product (BPP2) is SpyCatcher002. 29. A methylotropic host cell according to any one of items 1 to 28, wherein the synthetic transcription factor includes a nuclear localization signal (NLS). 30. The methylotropic host cell according to item 29, wherein the nuclear localization signal is the SV40 nuclear localization signal. 31. A methylotropic host cell according to any one of items 1 to 30, wherein the synthetic transcription factor includes a linker. 32. A methylotropic host cell according to any one of items 1 to 31, wherein the synthetic transcription factor comprises a self-cleaving polypeptide. 33. The methylotropic host cell according to item 32, wherein the self-cleaving polypeptide is a 2A peptide. 34. The methylotropic host cell according to item 32, wherein the self-cleaving polypeptide is ERBV_1_P2A. 35. A methylotropic host cell according to any one of items 1 to 34, wherein the synthetic transcription factor comprises an oligomerization domain. 36. A methylotropic host cell according to item 35, wherein the oligomerization domain is Linker_only_for_oligomerization, Trimerization_domain, or Heptamerization_domain. 37. A methylotropic host cell according to any one of items 1 to 36, wherein the synthetic transcription factor comprises a polypeptide having one amino acid sequence of any one of SEQ ID NOs. 41 to 55. 38. A methylotropic host cell according to any one of items 1 to 37, wherein the first transcription unit comprises a polynucleotide having one nucleic acid sequence of sequence numbers 26-40 or 182-185. 39. A methylotropic host cell according to any one of items 1 to 38, wherein the synthetic output promoter is not methanol-inducible. 40. A methylotropic host cell according to any one of items 1 to 39, wherein the synthetic output promoter comprises an upstream activation sequence (UAS) and a core promoter element. 41. The methylotropic host cell according to item 40, wherein the upstream activating sequence (UAS) of the synthetic output promoter is not native to the methylotropic host cell. 42. The methylotropic host cell according to item 40, wherein the core promoter element of the synthetic output promoter has a nucleic acid sequence of 300 base pairs or less in length. 43. The methylotropic host cell according to item 40, wherein the core promoter element of the synthetic output promoter has a nucleic acid sequence having a length of about 6 to about 300 base pairs, about 25 to about 250 base pairs, about 75 to about 225 base pairs, or about 100 to about 175 base pairs. 44. The methylotropic host cell according to item 40, wherein the distance between the 3' end of the upstream activation sequence (UAS) and the 5' end of the core promoter element of the synthetic output promoter is 0 to about 200 base pairs in length. 45. The methylotropic host cell according to item 40, wherein the distance between the upstream activation sequence (UAS) and the core promoter element of the synthetic output promoter is a nucleic acid sequence having a length of approximately 6 to 200 base pairs, approximately 6 to 53 base pairs, approximately 20 to 150 base pairs, approximately 50 to 125 base pairs, or approximately 50 to 100 base pairs. 46. ​​The methylotropic host cell according to claim 40, wherein the core promoter element of the synthetic output promoter comprises a core promoter sequence that is at least 90%, at least 95%, or 100% identical to a naturally occurring core promoter sequence. 47. The methylotropic host cell according to claim 40, wherein the core promoter element of the synthetic output promoter comprises a core promoter sequence that is at least 90%, at least 95%, or 100% identical to a core promoter sequence derived from P(AOX1), P(DAS2), P(HHF2), or P(PMP20). 48. The methylotropic host cell according to item 40, wherein the upstream activation sequence (UAS) of the synthetic output promoter is bmO, tetO, phlO, or vanO. 49. The methylotropic host cell according to item 40, wherein the synthetic output promoter further comprises one or more operators. 50. The methylotropic host cell according to item 49, wherein one or more operators of the synthetic output promoter are not native to the methylotropic host cell. 51. The methylotropic host cell according to item 40, wherein the synthetic transcription factor comprises the DNA-binding domain (DBD) Bm3R1, and the upstream activation sequence (UAS) of the synthetic output promoter comprises one or more copies of bmO. 52. The methylotropic host cell according to item 40, wherein the synthetic transcription factor comprises the DNA-binding domain (DBD)PhlF_AM, and the upstream activation sequence (UAS) of the synthetic output promoter comprises one or more copies of phlO. 53. The methylotropic host cell according to item 40, wherein the synthetic transcription factor comprises the DNA-binding domain (DBD)TetR, and the upstream activation sequence (UAS) of the synthetic output promoter comprises one or more copies of tetO. 54. The methylotropic host cell according to item 40, wherein the synthetic transcription factor comprises the DNA-binding domain (DBD) VanR_AM, and the upstream activation sequence (UAS) of the synthetic output promoter comprises one or more copies of vanO. 55. A methylotropic host cell according to any one of items 1 to 54, wherein the synthetic output promoter comprises a polynucleotide having one nucleic acid sequence of sequence numbers 56-70 or 186-193. 56. A methylotropic host cell as described in any of items 1 to 55, wherein the gene of interest is expressed as RNA. 57. A methylotropic host cell according to any one of items 1 to 55, wherein the gene of interest codes for a protein. 58. A methylotropic host cell as described in subsection 57, wherein the gene of interest encodes an enzyme, structural protein, signaling protein, regulatory protein, transport protein, sensory protein, motor protein, defense protein, or storage protein. 59. A methylotropic host cell as described in subsection 57, wherein the protein synthesizes, modifies, or transforms molecules. 60. A methylotropic host cell as described in item 59, wherein the molecule is heme or an intermediate in the heme biosynthesis pathway. 61. A methylotropic host cell as described in item 57, wherein the protein is a heme-binding protein. 62. The methylotropic host cell according to item 61, wherein the heme-binding protein is hemoglobin, neuroglobin, cytoglobin, leghemoglobin, or myoglobin. 63. The methylotropic host cell according to item 57, wherein the protein is vaccinia captransferase, T7 polymerase, or O-methyltransferase. 64. A methylotropic host cell as described in item 57, wherein the protein is an enzyme in the heme biosynthesis pathway. 65. A methylotropic host cell according to item 64, wherein the enzymes in the heme biosynthesis pathway are cytochrome P450, 9-adenylate cyclase, soluble guanylate cyclase, peroxidase, catalase, and / or cytochrome oxidase. 66. The methylotropic host cell according to item 1, further comprising a polynucleotide encoding a secretory tag in the second transcription unit. 67. The methylotropic host cell according to item 66, wherein the secretory tag is an α-amylase secretory tag, an Sc Mf α1 secretory tag, or a pre-inulinase secretory tag. 68. A methylotropic host cell according to item 66, wherein the gene of interest codes for a protein, and the protein is secreted from the methylotropic host cell. 69. The methylotropic host cell according to item 68, wherein the secreted protein is α-amylase, β-lactoglobulin, or ovalbumin. 70. The methylotropic host cell according to claim 1, wherein the first transcription unit and / or the second transcription unit further comprises a transcription terminator. 71. A methylotropic host cell according to item 70, wherein the transcription terminator of the first transcription unit and / or the second transcription unit is naturally present. 72. A methylotropic host cell according to item 70, wherein the transcription terminator of the first transcription unit and / or the second transcription unit is synthetic. 73. The methylotropic host cell according to sub-sub 74. A methylotropic host cell as described in item 73, wherein the gene encodes the ribosomal protein S2 (RPS2). 75. A methylotropic host cell according to claim 73, wherein the transcription terminator comprises a polynucleotide having the nucleic acid sequence of either SEQ ID NO: 146 or SEQ ID NO: 147. 76. A methylotropic host cell according to any one of claims 1 to 75, wherein the first transcription unit and the second transcription unit are separated by a spacer. 77. A methylotropic host cell according to any one of items 1 to 76, wherein the first transcription unit and / or the second transcription unit are present in multiple copies. 78. A methylotropic host cell according to item 77, wherein the copy number ratio of the second transcription unit to the first transcription unit is 1:1. 79. A methylotropic host cell according to paragraph 77, wherein the copy number ratio of the second transcription unit to the first transcription unit is at least 2:1, at least 4:1, or at least 10:1. 80. A methylotropic host cell according to item 77, wherein the copy number ratio of the first transcription unit to the second transcription unit is at least 2:1, at least 4:1, or at least 10:1. 81. A methylotropic host cell according to item 77, wherein the first transcription unit exists as a single copy and the second transcription unit exists as multiple copies. 82. A methylotropic host cell according to item 81, wherein at least two of the plurality of second transcription units contain genes of different purposes. 83. The methylotropic host cell according to item 81, wherein the synthetic transcription factor of the first transcription unit is an activator of each of the synthetic output promoters of the plurality of second transcription units. 84. A methylotropic host cell according to any one of items 1 to 83, wherein the synthetic expression system contains one or more sequences that are endogenous to the methylotropic host cell. 85. A methylotropic host cell according to any one of items 1 to 84, wherein the first transcription unit and the second transcription unit are located on a single plasmid. 86. A methylotropic host cell according to any one of items 1 to 84, wherein the first transcription unit and the second transcription unit are located on different plasmids. 87. A methylotropic host cell according to any one of items 1 to 84, wherein the first transcription unit and / or the second transcription unit are incorporated into the genome of the methylotropic host cell. 88. The methylotropic host cell according to item 87, wherein the first transcription unit and the second transcription unit are located on the same chromosome within the methylotropic host cell genome. 89. A methylotropic host cell according to any one of items 87-88, wherein the first transcription unit and the second transcription unit are oriented in the same direction. 90. A methylotropic host cell according to any one of sections 87-88, wherein the first transcription unit and the second transcription unit are oriented in different directions. 91. The methylotropic host cell according to item 87, wherein the first transcription unit and the second transcription unit are located on different chromosomes within the methylotropic host cell genome. 92. A methylotropic host cell according to any one of items 1 to 91, wherein the methylotropic host cell is a methylotropic yeast cell. 93. The methylotropic host cell described in any of sections 1 to 92, whe...

Claims

[Claim 1] The invention described herein.