Therapy including therapeutic antibodies and interleukin-2 (IL-2)

Combining IL2 with antibody-based immunotherapy addresses resistance in tumors with impaired antigen presentation or IFN signaling by enhancing immune recognition and elimination, effectively treating resistant cancers.

JP2026136222APending Publication Date: 2026-08-25BIONTECH SE +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026084870
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-09-24
Filing Date
2026-05-20
Publication Date
2026-08-25

AI Technical Summary

Technical Problem

Existing immunotherapies for cancer, such as MHC-dependent T cell-based therapies, face resistance due to impaired antigen presentation and IFN signaling pathways, particularly in tumors with MHC-I deficiency or mutations, leading to incomplete tumor cell recognition and elimination.

Method used

Administering a combination of IL2 or its functional variants with antibody-based immunotherapy to restore immune recognition and eliminate resistant tumors, potentially combined with chemotherapy or radiotherapy.

Benefits of technology

The combination therapy effectively invades resistant tumors with immune cells, resulting in complete rejection and improved control of tumors with impaired antigen presentation or IFN signaling defects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026136222000015
    Figure 2026136222000015
  • Figure 2026136222000016
    Figure 2026136222000016
  • Figure 2026136222000017
    Figure 2026136222000017
Patent Text Reader

Abstract

A method for treating patients with cancer that is at least partially resistant to the MHC-dependent T cell response. [Solution] Tumor cells often evade the immune response by reducing or eliminating MHC expression and / or IFN signaling, for example, enabling uncontrolled proliferation. The inventors hereby demonstrate that antibody-based immunotherapy combined with IL2 administration is an effective treatment for such resistant tumors. Specifically, the disclosure relates to a method for treating a subject having cancer that is at least partially resistant to the MHC-dependent T cell response, comprising administering to the subject a polypeptide comprising IL2 or a functional variant thereof or a polynucleotide encoding IL2 or a functional variant thereof; and b. antibody-based immunotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This disclosure relates to methods for treating subjects with cancer that does not respond well to MHC-dependent T cell-based therapy, for example, due to MHC-I deficiency or IFN signaling deficiency in the cancer. These methods are particularly useful for treating cancerous diseases characterized by disease cells expressing antigens on the cell surface. Specifically, this disclosure relates to methods for treating subjects with cancer that is at least partially resistant to the MHC-dependent T cell response, comprising administering to the subject a. polypeptide containing IL2 or a functional variant thereof (collectively referred to herein as "IL2") or a polynucleotide encoding IL2 or a functional variant thereof; and b. an antibody-based immunotherapy against cancer. This disclosure also relates to methods for preventing cancer from developing resistance to the MHC-dependent T cell response in subjects with cancer, comprising administering to the subject a. polypeptide containing IL2 or a functional variant thereof or a polynucleotide encoding IL2 or a functional variant thereof; and b. an antibody-based immunotherapy against cancer. The methods of this disclosure may further include administering to further cancer therapies such as chemotherapy or radiotherapy, particularly chemotherapy. [Background technology]

[0002] The immune system plays a crucial role in the onset, progression, and treatment of cancer. CD8 + T cells and NK cells can directly lyse tumor cells, and high tumor infiltration by these cells is generally considered favorable for outcomes in various tumor diseases. CD4 + T cells contribute to the antitumor immune response by secreting IFNγ or licensing antigen-presenting dendritic cells (DCs), which then lead to CD8 + It primes and activates T cells (Kreiter et al. Nature 520, 692-6 (2015)). CD8 +The recognition and elimination of tumor cells by T cells rely on antigen presentation via the major histocompatibility complex (MHC) class I. MHC class I molecules are located on the cell surface and consist of an α-chain and β2-microglobulin (B2M). All human individuals carry six different alleles of the gene encoding the α-chain and two redundant alleles of the gene encoding B2M. B2M is necessary for the stability of the complex, while the α-chain forms a groove that accommodates peptide antigens, which can in principle be derived from any endogenous protein. When the antigen is immunogenic (e.g., because the antigen is derived from a mutated gene product or a viral gene product), CD8 T cells carrying a T cell receptor (TCR) that fits this specific peptide-MHC class I complex + T cells can recognize tumor cells as foreign cells. CD8 + When CD8 T cells are primed and activated, they lyse tumor cells and secrete IFNγ. Surrounding tumor cells can sense IFNγ, which leads to growth inhibition and enhanced antigen presentation via upregulation of MHC class I, making the tumor cells more sensitive to CD8 + T cell recognition. Furthermore, CD4 + T cells and NK cells located in the tumor microenvironment (TME) can be a source of IFNγ, while DCs and macrophages can secrete type I IFNs that have a similar effect on tumor cell growth and antigen presentation.

[0003] Several immunotherapies, such as adoptive T cell transfer, recombinant cytokines, or immune checkpoint blockade (ICB), have been approved for the treatment of cancer patients. In particular, ICB has revolutionized the field of cancer treatment and led to durable responses in patient populations (Larkin et al. N Engl J Med 373, 23 - 34 (2015)). ICB relies on the reactivation of existing CD8 + T cell responses against tumor cells. Due to the success of ICB, further T cell-based immunotherapy approaches are highly promising, and many are currently being investigated in clinical trials. However, CD8 +T cell-based therapies have an inherent drawback: their reliance on functional antigen presentation by tumor cells, which opens the door for the development of resistance mechanisms.

[0004] Tumor cells are often genetically unstable (Burrell et al. Nature 501, 338-45 (2013)). Therefore, tumor cells can accumulate mutations, leading to non-functional gene products (e.g., via missense or nonsense mutations) or deletions of entire genes. Loss of function in genes essential to the response to cancer treatment can be involved in primary, adaptive, or acquired resistance (Sharma et al. Cell 168, 707-23 (2017)). The development of acquired resistance leads to the selection and proliferation of treatment-resistant tumor cell clones, often resulting in patient death. In particular, mutations that impair antigen presentation have been observed as a mechanism of resistance to immunotherapy, including adoptive T cell transfer, ICB, and vaccination (Restifo et al. J Natl Cancer Inst 88,100-8 (1996), Zaretsky et al. N Engl J Med 375,819-29 (2016), Sahin et al. Nature 547,222-6 (2017)). For example, loss of MHC class I, particularly due to B2M mutations, results in a complete cessation of antigen presentation. As a result, tumor cells lose CD8 +It evades recognition and elimination by T cells. Depending on the tumor entity, partial or complete loss of MHC class I alleles has been observed in up to 93% of tumors (Garrido et al. Cancer Immunol Immunother 66,259-271 (2017)), but loss of B2M in particular has been shown to affect nearly 30% of patients who do not respond to ICB (Sade-Feldman et al. Nat Commun 8,1136 (2017)). Furthermore, mutations in several genes involved in the IFN signaling pathway are associated with resistance to ICB (Zaretsky et al. N Engl J Med 375,819-29 (2016), Gao et al. Cell 167,397-404 (2016)). For example, loss of function of Janus kinase 1 (JAK1), a central IFN signaling molecule, impairs the response to both type I IFN and IFNγ. Recent reports have shown that classical cancer treatments rely on the activation of cellular immune responses against tumor cells (Galluzzi et al. Cancer Cell 28, 690-714 (2015), Weichselbaum et al. Nat Rev Clin Oncol 14, 365-379 (2017)), so in addition to immunotherapy, impaired antigen presentation is also a potential mechanism for resistance to classical cancer treatments (chemotherapy and radiotherapy). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Kreiter et al.Nature 520,692-6(2015) [Non-Patent Document 2] Larkin et al.N Engl J Med 373,23-34(2015) [Non-Patent Document 3] Burrell et al.Nature 501,338-45(2013) [Non-Patent Document 4] Sharma et al.Cell 168,707-23(2017) [Non-Patent Document 5] Restifo et al. J Natl Cancer Inst 88,100-8(1996) [Non-Patent Document 6] Zaretsky et al.N Engl J Med 375,819-29(2016) [Non-Patent Document 7] Sahin et al.Nature 547,222-6(2017) [Non-Patent Document 8] Garrido et.al.Cancer Immunol Immunother 66,259-271(2017) [Non-Patent Document 9] Sade-Feldman et al.Nat Commun 8,1136(2017) [Non-Patent Document 10] Gao et al.Cell 167,397-404(2016) [Non-Patent Document 11] Galluzzi et.al.Cancer Cell 28,690-714(2015) [Non-Patent Document 12] Weichselbaum et.al.Nat Rev Clin Oncol 14,365-379(2017) [Overview of the Initiative] [Problems that the invention aims to solve]

[0006] This disclosure confirms that antigen presentation impairment due to MHC class I loss is a comprehensive mechanism of resistance to immunotherapy in mouse tumor models. In addition, it provides data demonstrating that MHC class I loss mediates resistance to classical cancer treatments. To date, there are no therapies described as effective against resistant tumors that evade immune recognition through impaired antigen presentation due to complete or partial loss of functional MHC class I or loss of functional IFN signaling. Therefore, there is a high medical need for novel strategies to restore immune recognition and the elimination of resistant tumor cells.

[0007] This disclosure describes strategies for immunotherapeutic interventions for tumors that have acquired resistance through loss of MHC class I or alterations that impair antigen presentation via disruption of the IFN signaling pathway. The treatments include antibodies that bind to tumor antigens in combination with the cytokine IL2. The described combination therapies result in tumor invasion by various immune cells and complete rejection of resistant tumors in mouse models. Furthermore, this disclosure demonstrates that classical cancer treatments, such as chemotherapy, further improve the control of resistant tumors with antibody and IL2 combination immunotherapy. [Means for solving the problem]

[0008] The present invention encompasses targeted immunotherapy treatments, generally comprising administering a polypeptide comprising IL2 or a functional variant thereof, or a polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof, and an antibody-based immunotherapy for treating tumors that have acquired resistance by alterations that impair antigen presentation via loss of MHC class I or impairment of the IFN signaling pathway, or for treating tumors to prevent them from acquiring resistance by said alterations.

[0009] The methods and agents described herein are particularly effective when IL2 is bound to a pharmacokinetic modifying group (hereinafter referred to as "extended pharmacokinetic (PK) IL2"). The methods and agents described herein are particularly effective when the polynucleotide encoding IL2, such as extended PK IL2, is RNA. In one embodiment, the RNA targets the liver for systemic availability. Hepatocytes can be efficiently transfected and produce large amounts of protein.

[0010] In one embodiment, a method for treating a subject having cancer that is at least partially resistant to the MHC-dependent T cell response, a. Polynucleotides encoding IL2 or functional variants thereof, or polynucleotides encoding IL2 or functional variants thereof; and b. Immunotherapy based on antibodies against cancer A method comprising administering to a target is provided herein.

[0011] In one embodiment, cancer is caused by MHC-dependent T cells, particularly CD8 + In one embodiment, the cancer does not adequately respond to T cell-based, i.e., T cell-intensive therapies. In one embodiment, the cancer does not adequately respond to one or more of the following: vaccination, immune checkpoint inhibition, and T cell transfer. In one embodiment, the cancer is deficient in antigen processing and / or presentation. In one embodiment, the cancer is MHC-I deficient. In one embodiment, the MHC-I deficiency results from a mutation or partial or complete loss of the MHC-I allele or β2-microglobulin (B2M). In one embodiment, the cancer is deficient in T cell stimulating ability. In one embodiment, the cancer is deficient in IFN signaling, such as type I IFN or IFNγ signaling. Such IFN signaling deficiencies may result from one or more mutations in one or more genes involved in the IFN signaling pathway. In one embodiment, the gene is Janus kinase 1 (JAK1).

[0012] In one embodiment, a method for preventing cancer from developing resistance to the MHC-dependent T cell response in a subject with cancer, a. Polynucleotides encoding IL2 or functional variants thereof, or polynucleotides encoding IL2 or functional variants thereof; and b. Immunotherapy based on antibodies against cancer A method comprising administering to a target is provided herein.

[0013] In one embodiment, resistance is caused by cancer affecting MHC-dependent T cells, particularly CD8 + Resistance includes failure to adequately respond to T cell-based therapies, i.e., T cell-intensive therapies. In one embodiment, resistance includes cancer failing to adequately respond to one or more of the following: vaccination, immune checkpoint inhibition, and T cell transfer. In one embodiment, resistance includes cancer being deficient in antigen processing and / or presentation. In one embodiment, resistance includes cancer being MHC-I deficient. In one embodiment, MHC-I deficiency results from mutations or partial or complete loss of the MHC-I allele or β2-microglobulin (B2M). In one embodiment, resistance includes cancer being deficient in T cell stimulating ability. In one embodiment, resistance includes cancer being deficient in IFN signaling, such as type I IFN or IFNγ signaling. Such IFN signaling deficiencies may result from one or more mutations in one or more genes involved in the IFN signaling pathway. In one embodiment, the gene is Janus kinase 1 (JAK1).

[0014] In one embodiment, the polynucleotide encoding a polypeptide containing IL2 or a functional variant thereof is RNA.

[0015] In one embodiment, immunotherapy based on an antibody against cancer comprises administering a therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer. In one embodiment, the therapeutic antibody against cancer is against a tumor antigen expressed by cancer cells. In one embodiment, the polynucleotide encoding the therapeutic antibody against cancer is RNA.

[0016] In one embodiment, this method applies to the target, a. RNA encoding a polypeptide containing IL2 or a functional variant thereof; and b. Therapeutic antibodies against cancer This includes administering [the drug].

[0017] In one embodiment, cancer is associated with the expression or increased expression of an antigen. In one embodiment, the antigen is a tumor antigen. In one embodiment, the antibody-based immunotherapy for cancer is against the said antigen.

[0018] In one embodiment, the polypeptide comprising IL2 or a functional variant thereof is extended pharmacokinetic (PK) IL2. In one embodiment, extended PK IL2 comprises a fusion protein. In one embodiment, the fusion protein comprises a portion of IL2 or a functional variant thereof and a portion selected from the group consisting of serum albumin, immunoglobulin fragment, transferrin, Fn3, and variants thereof. In one embodiment, serum albumin comprises mouse serum albumin or human serum albumin. In one embodiment, the immunoglobulin fragment comprises an immunoglobulin Fc domain.

[0019] In one embodiment, a. Polypeptides containing IL2 or functional variants thereof, or polynucleotides encoding IL2 or functional variants thereof; b. A therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer; and c. Instructions for use of pharmaceutical formulations for the treatment or prevention of cancers that are at least partially resistant to the MHC-dependent T cell response. Pharmaceutical formulations containing the above are provided herein.

[0020] In one embodiment, for treating or preventing cancer that is at least partially resistant to the MHC-dependent T cell response, a. Polynucleotides encoding IL2 or functional variants thereof, or polynucleotides encoding IL2 or functional variants thereof; and b. A therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer. Pharmaceutical formulations containing the above are provided herein.

[0021] In one embodiment, a. Polypeptides containing IL2 or functional variants thereof, or polynucleotides encoding IL2 or functional variants thereof; b. A therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer; and c. Instructions for use of pharmaceutical formulations to prevent cancer from developing resistance to MHC-dependent T-cell response. Pharmaceutical formulations containing the above are provided herein.

[0022] In one embodiment, to prevent cancer from developing resistance to the MHC-dependent T cell response, a. Polynucleotides encoding IL2 or functional variants thereof, or polynucleotides encoding IL2 or functional variants thereof; and b. A therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer. Pharmaceutical formulations containing the above are provided herein.

[0023] In one embodiment, the pharmaceutical preparation is a kit.

[0024] In one embodiment, the pharmaceutical formulation comprises a polypeptide containing IL2 or a functional variant thereof, or a polynucleotide encoding a polypeptide containing IL2 or a functional variant thereof, and a therapeutic antibody against cancer, or a polynucleotide encoding a therapeutic antibody against cancer, in separate containers.

[0025] In one embodiment, the pharmaceutical preparation is a pharmaceutical composition. In one embodiment, the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers, diluents and / or excipients.

[0026] In one embodiment, a polypeptide comprising IL2 or a functional variant thereof, or a polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof, is provided herein for treating or preventing cancer that is at least partially resistant to the MHC-dependent T cell response, wherein the polypeptide comprising IL2 or a functional variant thereof, or the polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof, is to be administered together with a therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer.

[0027] In one embodiment, a therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer is provided herein for treating or preventing cancer that is at least partially resistant to the MHC-dependent T cell response, wherein the therapeutic antibody against cancer or the polynucleotide encoding the therapeutic antibody against cancer is to be administered together with a polypeptide comprising IL2 or a functional variant thereof or a polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof.

[0028] In one embodiment, a polypeptide comprising IL2 or a functional variant thereof, or a polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof, is provided herein for preventing cancer from developing resistance to the MHC-dependent T cell response, wherein the polypeptide comprising IL2 or a functional variant thereof, or the polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof, is to be administered together with a therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer.

[0029] In one embodiment, a therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer is provided herein for preventing cancer from developing resistance to the MHC-dependent T cell response, wherein the therapeutic antibody against cancer or the polynucleotide encoding a therapeutic antibody against cancer is administered together with a polypeptide comprising IL2 or a functional variant thereof or a polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof.

[0030] In one embodiment, a pharmaceutical formulation, a polypeptide comprising IL2 or a functional variant thereof, or a polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof, or a therapeutic antibody against cancer, or a polynucleotide encoding a therapeutic antibody against cancer, are for use in the method of the present invention described above.

[0031] Preferred embodiments of a pharmaceutical formulation, a polypeptide containing IL2 or a functional variant thereof, or a polynucleotide encoding a polypeptide containing IL2 or a functional variant thereof, or a therapeutic antibody against cancer, or a polynucleotide encoding a therapeutic antibody against cancer, are as described above in relation to the method of the present invention. [Brief explanation of the drawing]

[0032] [Figure 1]Tumor infiltration by CD8+ T cells and CD45+ immune cells in different mouse tumor models. Balb / c mice were subcutaneously inoculated with 5 × 10⁵ CT26 cells. C57Bl / 6 mice were subcutaneously inoculated with 5 × 10⁵ MC38 cells, 3 × 10⁵ B16F10 cells, or 1 × 10⁵ TC1 cells. The percentage of intratumoral CD8+ T cells (A) and total immune cells (B) was measured by flow cytometry 20 days after tumor inoculation. Dots represent individual mice, and lines represent the group mean. [Figure 2] Loss of MHC class I surface expression in CT26 mouse colon cancer and MC38 mouse colon adenocarcinoma tumor cell lines after B2m gene knockout. MHC class I surface expression in control and B2m- / - CT26 cells (A) and MC38 cells (B). B2m- / - clones generated by transient transfection with Cas9 mRNA and B2m-target sgRNA. MHC class I expression on the cell surface determined by flow cytometry. [Figure 3] Loss of MHC class I surface expression in B16F10 mouse melanoma and TC1 mouse lung epithelial carcinoma tumor cell lines after B2m gene knockout. MHC class I surface expression in control and B2m- / - B16F10 (A) and TC1 cells (B). B2m- / - clones constructed as shown in Figure 2. MHC class I expression on the cell surface determined by flow cytometry. B16F10 cells were treated with 25 ng / mL IFNγ for 24 hours, followed by flow cytometry analysis. [Figure 4] The IFN response in B16F10 mouse melanoma cells induces upregulation of PD-L1 and MHC class I. PD-L1(A) and MHC class I(B) expression in B16F10 cells, determined by flow cytometry after 24 hours of stimulation with 1000 U / mL IFN-α. Controls were unstimulated. [Figure 5]Impaired IFN response in B16F10 mouse melanoma cells after Jak1 gene knockout. PD-L1 (A) and MHC class I (B) expression in B16F10-Jak1- / - cells determined by flow cytometry after IFN stimulation, as shown in Figure 4. The control group was unstimulated. B16F10-Jak1- / - cells were generated using sgRNA targeting Jak1, as shown in Figure 2. [Figure 6] Comparison of tumor growth in natal CT26 mouse colon cancer and MC38 mouse colon adenocarcinoma tumors with B2m- / - variants. Tumor growth in Balb / c mice (n=5 / group) (A) subcutaneously inoculated with 5 × 10⁵ CT26 or CT26-B2m- / - cells (sc) and C57Bl / 6 mice (n=5) (B) subcutaneously inoculated with 5 × 10⁵ MC38 or MC38-B2m- / - cells (sc). Data shown are group mean ± SEM. Statistical significance was determined using two-way ANOVA followed by Sidak's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 7] Comparison of tumor growth in parental B16F10 mouse melanoma and TC1 mouse lung epithelial tumors with B2m- / - variants. Tumor growth in C57Bl / 6 mice (n=10 / group) (A) subcutaneously inoculated with 3 × 10⁵ B16F10 or B16F10-B2m- / - cells (sc) and C57Bl / 6 mice (n=10) (B) subcutaneously inoculated with 1 × 10⁵ TC1 or TC1-B2m- / - cells (sc). Data shown are group mean ± SEM. Statistical significance was determined using two-way ANOVA followed by Sidak's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 8]Comparison of immune cell infiltration in CT26 and CT26-B2m- / - mouse colon cancer tumors. Balb / c mice were subcutaneously inoculated (sc) with 5 × 10⁵ CT26 or CT26-B2m- / - cells. The number of intratumoral lymphoid (A), myeloid (B), and dendritic (DC) (C) subsets was determined by flow cytometry 20 days after tumor inoculation and normalized to tumor weight. Points represent individual mice, and lines represent the group mean ± SEM. Outliers were removed using Grubb's test. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 9] Comparison of immune cell composition in tumor-discharge lymph nodes isolated from CT26 or CT26-B2m- / - mice carrying colon cancer tumors. Balb / c mice were subcutaneously inoculated (sc) with 5 × 10⁵ CT26 or CT26-B2m- / - cells. The number of lymphoid (A), myeloid (B), and dendritic (DC) (C) subsets in tumor-discharge lymph nodes was determined by flow cytometry 20 days after tumor inoculation. Dots represent individual mice, and lines represent the group mean ± SEM. Outliers were removed using Grubb's test. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 10]Comparison of immune cell infiltration in MC38 and MC38-B2m- / - mouse colon adenocarcinoma tumors. C57Bl / 6 mice were subcutaneously inoculated with 5 × 10⁵ MC38 or MC38-B2m- / - cells. The number of intratumoral lymphoid (A), myeloid (B), and dendritic (DC) (C) subsets was determined by flow cytometry 20 days after tumor inoculation and normalized to tumor weight. Points represent individual mice, and lines represent the group mean ± SEM. Outliers were removed using Grubb's test. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 11] Comparison of immune cell composition from tumor-discharge lymph nodes isolated from MC38 or MC38-B2m- / - mouse colon adenocarcinoma tumor-bearing mice. 5 × 10⁵ MC38 or MC38-B2m- / - cells were subcutaneously (sc) inoculated into C57Bl / 6 mice. The number of lymphoid (A), myeloid (B), and dendritic (DC) (C) subsets in tumor-discharge lymph nodes was determined by flow cytometry 20 days after tumor inoculation. Points represent individual mice, and lines represent the group mean ± SEM. Outliers were removed using Grubb's test. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 12]Comparison of immune cell infiltration in B16F10 and B16F10-B2m- / - mouse melanoma tumors. C57Bl / 6 mice were subcutaneously inoculated with 3 × 10⁵ B16F10 or B16F10-B2m- / - cells. The number of intratumoral lymphoid (A), myeloid (B), and dendritic (DC) (C) subsets was determined by flow cytometry 20 days after tumor inoculation and normalized to tumor weight. Points represent individual mice, and lines represent the group mean ± SEM. Outliers were removed using Grubb's test. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 13] Comparison of immune cell composition from tumor-discharging lymph nodes isolated from B16F10 and B16F10-B2m- / - mice carrying melanoma tumors. C57Bl / 6 mice were subcutaneously inoculated with 3 × 10⁵ B16F10 or B16F10-B2m- / - cells. The number of lymphoid (A), myeloid (B), and dendritic (DC) (C) subsets in tumor-discharging lymph nodes was determined by flow cytometry 20 days after tumor inoculation. Points represent individual mice, and lines represent the group mean ± SEM. Outliers were removed using Grubb's test. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 14]Comparison of immune cell infiltration in TC1 and TC1-B2m- / - mouse lung epithelial tumors. C57Bl / 6 mice were subcutaneously inoculated with 1 × 10⁵ TC1 or TC1-B2m- / - cells. The number of intratumoral lymphoid (A), myeloid (B), and dendritic (DC) (C) subsets was determined by flow cytometry 20 days after tumor inoculation and normalized to tumor weight. Points represent individual mice, and lines represent the group mean ± SEM. Outliers were removed using Grubb's test. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 15] Comparison of immune cell composition from tumor-discharging lymph nodes isolated from TC1 and TC1-B2m- / - mouse lung epithelial tumor-bearing mice. C57Bl / 6 mice were subcutaneously inoculated with 1 × 10⁵ TC1 or TC1-B2m- / - cells. The number of lymphoid (A), myeloid (B), and dendritic (DC) (C) subsets in the tumor-discharging lymph nodes was determined by flow cytometry 20 days after tumor inoculation. Points represent individual mice, and lines represent the group mean ± SEM. Outliers were removed using Grubb's test. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 16]Differences in invasion of CT26 and CT26-B2m- / - mouse colon cancer tumors by T cells and NK cells at different time points. Balb / c mice (n=5 / group / time point) were subcutaneously inoculated with 5 × 10⁵ CT26 or CT26-B2m- / - cells. The number of intratumoral CD3+ T cells (A) and NK cells (B), normalized to tumor volume and determined by flow cytometry at 8, 12 (NK cells only), 20, and 26 days post-tumor inoculation. Data shown are group mean ± SEM. Statistical significance was determined using mixed-effects analysis followed by Sidak's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 17] Different phenotypes of intratumoral CD8+ T cells in CT26 and CT26-B2m- / - mouse colon cancer tumors or TC1 and TC1-B2m- / - mouse lung epithelial tumors. 5 × 10⁵ CT26 or CT26-B2m- / - cells were subcutaneously (sc) inoculated into Balb / c mice. 1 × 10⁵ TC1 or TC1-B2m- / - cells were subcutaneously (sc) inoculated into C57Bl / 6 mice. Frequency of intratumoral gp70-specific (A) and PD-1+CD8+ T cells (B) from CT26 and CT26-B2m- / - tumors, and frequency of intratumoral PD-1+CD8+ T cells (C) from TC1 and TC1-B2m- / - tumors, determined by flow cytometry 20 days after tumor inoculation. Dots represent individual mice, and lines represent group mean ± SEM. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 18]Different phenotypes of intratumor macrophages (TAMs) and tumor cells derived from CT26 and CT26-B2m- / - mouse colon cancer tumors. 5 × 10⁵ CT26 or CT26-B2m- / - cells were subcutaneously (sc) inoculated into Balb / c mice (n=8 / group). MHC class II (A) and PD-L1 expression by intratumor TAMs (B) and PD-L1 expression by tumor cells (C) were determined by flow cytometry 20 days after tumor inoculation. Data are mean + SEM. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 19] Different phenotypes of intratumor macrophages (TAMs) and tumor cells derived from TC1 and TC1-B2m- / - mouse lung epithelial tumors. 1 × 10⁵ TC1 or TC1-B2m- / - cells were subcutaneously (sc) inoculated into C57Bl / 6 (n=8 / group). MHC class II (A) and PD-L1 expression by intratumor TAMs (B) and PD-L1 expression by tumor cells (C) were determined as shown in Figure 18. Data are mean + SEM. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 20] Different expression levels of Ifng and chemokines in the tumor mesenteric cell (TME) of CT26 and CT26-B2m- / - mouse colon cancer tumors. 5 × 10⁵ CT26 or CT26-B2m- / - cells were subcutaneously (sc) inoculated into Balb / c mice. Intratumoral relative gene expression levels of Ifng (A), Cxcl9 (B), Cxcl10 (C), Cxcl11 (D), Ccl5 (E), and Xcl1 (F) were determined by qRT-PCR 19 days after tumor inoculation. Data are mean + SEM for n=3 mice / group. [Figure 21]Different expression levels of Ifng and chemokines in TME of MC38 and MC38-B2m- / - mouse colon adenocarcinoma tumors. 5 × 10⁵ MC38 or MC38-B2m- / - cells were subcutaneously (sc) inoculated into C57Bl / 6 mice. Intratumoral relative gene expression levels of Ifng (A), Cxcl9 (B), Cxcl10 (C), Cxcl11 (D), Ccl5 (E), and Xcl1 (F) were determined as shown in Figure 20. Data are mean + SEM for n=5 mice / group. Statistical significance was determined using the Mann-Whitney U test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 22] B2m deficiency results in resistance to anti-PD-1, anti-CTLA4, and anti-4-1BB antibody therapy in a CT26 mouse colon cancer model. Balb / c mice (n=10 / group) were subcutaneously (sc) inoculated with 5 × 10⁵ CT26 or CT26-B2m- / - cells. Mice were intraperitoneally (ip) injected with 200 μg of antibodies targeting PD-1, CTLA4, or 4-1BB at days 0, 3, 7, and 10 after the tumor reached a mean volume of 32–36 mm³. A control group was injected with antibodies binding to unrelated antigens. Tumor growth in CT26(A) or CT26-B2m- / -(B) tumor-bearing mice. Data shown are mean + SEM. Statistical significance was determined using two-way ANOVA followed by Dunnett's multiple comparison test, and is shown for the last plotted time point. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 23]Differences in CD8+ T cell infiltration in CT26 and CT26-B2m- / - mouse colon cancer tumors after treatment with anti-PD-1, anti-CTLA4, and anti-4-1BB antibody therapy. Balb / c mice were subcutaneously inoculated with 5 × 10⁵ CT26 or CT26-B2m- / - cells and treated as shown in Figure 22. Number of intratumoral CD8+ T cells from CT26 tumors treated with anti-PD-1 or anti-CTLA4 (A) or anti-4-1BB (B) and CT26-B2m- / - tumors treated with anti-PD-1 or anti-CTLA4 (C) or anti-4-1BB (D), determined by flow cytometry and normalized to tumor volume or tumor weight. Tumors treated with anti-4-1BB antibody analyzed 7 days after initial treatment, and tumors treated with anti-PD-1 or anti-CTLA4 antibody analyzed 10 days after initial treatment. The dots represent individual mice, and the lines represent the group mean ± SEM. Statistical significance was determined using one-way ANOVA followed by Dunnett's multiple comparison tests (A and C) or Student's unpaired t-tests (B and D). All analyses were two-tailed and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 24] B2m deficiency results in resistance to anti-PD-1, anti-CTLA4, and anti-4-1BB antibody therapy in the MC38 mouse colon adenocarcinoma model. 5 × 10⁵ MC38 or MC38-B2m- / - cells were subcutaneously (sc) inoculated into C57Bl / 6 mice (n=10 / group). Mice were treated with the antibodies described in Figure 22 on days 0, 4, 7, and 10. MC38-carrying mice received two additional injections on days 14 and 17. Tumor growth in MC38(A) or MC38-B2m- / -(B) tumor-carrying mice. Data shown are mean + SEM. Statistical significance was determined using two-way ANOVA followed by Dunnett's multiple comparison test, and is shown for the last plotted time point. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 25] B2m deficiency results in resistance to therapeutic RNA vaccination in the CT26 mouse colon cancer model. Balb / c mice (n=10 / group) were subcutaneously (sc) inoculated with 5 × 10⁵ CT26 or CT26-B2m- / - cells. On days 5, 8, 12, and 19 after tumor inoculation, mice were intravenously (iv) injected with 40 μg of gp70AH5 RNA-LPX or RNA-LPX that does not encode any antigen (irrelevant RNA). The control group was untreated. Tumor growth in CT26(A) or CT26-B2m- / -(B) tumor-bearing mice. Data shown are mean + SEM. Statistical significance was determined using two-way ANOVA followed by Dunnett's multiple comparison test, and is shown for the last plotted time point. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 26] Differences in CD8+ T cell infiltration and antigen specificity in CT26 and CT26-B2m- / - mouse colon cancer tumors after therapeutic RNA vaccination. Balb / c mice were subcutaneously inoculated with 5 × 10⁵ CT26 or CT26-B2m- / - cells and treated as shown in Figure 25. Number of intratumoral CD8+ T cells from CT26(A) and CT26-B2m- / -(B) tumors, determined by flow cytometry 17 days after initial treatment and normalized to tumor weight. Frequency of gp70-specific CD8+ T cells from CT26(C) and CT26-B2m- / - tumors(D). Dots represent individual mice, and lines represent group mean ± SEM. Statistical significance was determined using one-way ANOVA followed by Dunnett's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 27]B2m deficiency results in resistance to therapeutic RNA vaccination in a TC1 mouse lung epithelial tumor model. C57Bl / 6 mice (n=10 / group) were subcutaneously (sc) inoculated with 1 × 10⁵ TC1 or TC1-B2m- / - cells. On days 0 and 7, after the tumors reached an average volume of approximately 20 mm³, mice were intravenously (iv) injected with 20 μg of E7 RNA-LPX or RNA-LPX (irrelevant RNA) that does not encode any antigen. The control group was untreated. Tumor growth in TC1(A) or TC1-B2m- / -(B) tumor-bearing mice. Data shown are mean + SEM. Statistical significance was determined using two-way ANOVA followed by Dunnett's multiple comparison test, and is shown for the last plotted time point. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 28] Differences in CD8+ T cell infiltration and antigen specificity in TC1 and TC1-B2m- / - mouse lung epithelial tumors after therapeutic RNA vaccination. C57Bl / 6 mice (n=10 / group) were subcutaneously inoculated with 1 × 10⁵ TC1 or TC1-B2m- / - cells and treated as described in Figure 27. Number of intratumoral CD8+ T cells from TC1(A) and TC1-B2m- / -(B) tumors, determined by flow cytometry 9 days after initial treatment and normalized to tumor weight. Frequency of E7-specific CD8+ T cells from TC1(C) and TC1-B2m- / -(D) tumors. Dots represent individual mice, and lines represent group mean ± SEM. Statistical significance was determined using one-way ANOVA followed by Dunnett's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 29]B2m deficiency prevents tumor rejection after chemotherapy in a CT26 mouse colon cancer model. Balb / c mice (n=9-10 / group) were subcutaneously inoculated with 5 × 10⁵ CT26 or CT26-B2m- / - cells. On days 0, 7, and 14, after the tumors reached an average volume of approximately 6 mm³, mice were intraperitoneally (ip) injected with 5 mg / kg oxaliplatin (OX) and intravenously (iv) injected with 60 mg / kg 5-fluorouracil (5-FU). The control group received a vehicle. Tumor growth curves are shown as mean + SEM (A) and survival rate (B) for tumor-bearing mice. Statistical significance was determined using two-way ANOVA followed by Sidak's multiple comparison test, and is shown for the last plotted time point. Significant differences in survival rates were determined using the log-rank (Mantel-Cox) test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 30] Differences in CD8+ T cell infiltration and antigen specificity in CT26 and CT26-B2m- / - mouse colon cancer tumors after chemotherapy treatment. Balb / c mice were subcutaneously inoculated with 5 × 10⁵ CT26 or CT26-B2m- / - cells and treated as shown in Figure 29. Number of intratumoral CD8+ T cells from CT26(A) and CT26-B2m- / -(B) tumors, determined by flow cytometry 13 days after initial treatment. Frequency of gp70-specific CD8+ T cells from CT26(C) and CT26-B2m- / - tumors(D). Dots represent individual mice, and lines represent group mean ± SEM. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 31]B2m deficiency prevents tumor rejection after radiotherapy in a CT26 mouse colon cancer model. Balb / c mice (n=10 / group) were subcutaneously inoculated with 5 × 10⁵ CT26 or CT26-B2m- / - cells. After the tumors reached an average volume of approximately 30 mm³, they were locally irradiated with 12 Gy. The control group was untreated. Tumor growth curves are shown as mean + SEM (A) and survival rate (B) for tumor-bearing mice. Statistical significance was determined using two-way ANOVA followed by Sidak's multiple comparison test, and is shown for the last plotted time point. Significant differences in survival rates were determined using the log-rank (Mantel-Cox) test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 32] Differences in CD8+ T cell infiltration and antigen specificity in CT26 and CT26-B2m- / - mouse colon cancer tumors after radiotherapy treatment. Balb / c mice were subcutaneously inoculated with 5 × 10⁵ CT26 or CT26-B2m- / - cells and treated as shown in Figure 31. Number of intratumoral CD8+ T cells from CT26(A) and CT26-B2m- / -(B) tumors, determined by flow cytometry 8 days after treatment. Frequency of gp70-specific CD8+ T cells from CT26(C) and CT26-B2m- / - tumors(D). Dots represent individual mice, and lines represent group mean ± SEM. Statistical significance was determined using Student's unpaired t-test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 33]Combination therapy with anti-Trp1 antibody and mAlb-mIL2 RNA reduces the growth of B16F10 and B16F10-B2m- / - mouse melanoma tumors. C57Bl / 6 mice (n=9-10 / group) were subcutaneously inoculated with 3 × 10⁵ B16F10 or B16F10-B2m- / - cells. Mice were intraperitoneally (ip) injected with 200 μg of anti-Trp1 antibody (TA99) or isotype control on days 5, 8, 12, 15, 19, 22, and 26 post-tumor inoculation, and intravenously (iv) injected with 1 μg of mAlb-mIL2 or mAlb-coding RNA (not encoding any cytokine) formulated with TransIT® on days 5, 12, 19, and 26 post-tumor inoculation. The control group was treated with isotype and mAlb RNA (not encoding any cytokine). Tumor growth in B16F10(A) or B16F10-B2m- / -(B) tumor-bearing mice. The data shown are mean + SEM. Statistical significance was determined using two-way ANOVA followed by Dunnett's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 34] Combination therapy with anti-Trp1 antibody and mAlb-mIL2 RNA results in long-term survival in B16F10 and B16F10-B2m- / - mouse melanoma models. C57Bl / 6 mice (n=9-10 / group) were subcutaneously inoculated with 3 × 10⁵ B16F10 or B16F10-B2m- / - cells and treated as described in Figure 33. Survival rates of B16F10 (A) or B16F10-B2m- / - (B) tumor-bearing mice. Significant differences in survival rates were determined using the log-rank (Mantel-Cox) test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 35]mAlb-mIL2 RNA alone or in combination with an anti-Trp1 antibody increases CD4+ T cell and CD8+ T cell infiltration in a B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells, and treatment as described in Figure 33 was initiated 9 days after tumor inoculation. The number of intratumoral CD4+ Th cells (A), Treg cells (B), and CD8+ T cells (C), normalized to tumor weight, was determined by flow cytometry 20 days after tumor inoculation. Dots represent individual mice, and lines represent the group mean. Significance was determined using the Kruskal-Wallis test followed by Dunn's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 36] mAlb-mIL2 RNA alone or in combination with an anti-Trp1 antibody increases γδ T cell, NK cell, and NKT cell infiltration in the B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells, and treatment as described in Figure 33 was initiated 9 days after tumor inoculation. The number of intratumoral δγ T cells (A), NK cells (B), and NKT cells (C), normalized to tumor weight, was determined by flow cytometry 20 days after tumor inoculation. Dots represent individual mice, and lines represent the group mean. Significance was determined using the Kruskal-Wallis test followed by Dunn's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 37]mAlb-mIL2 RNA alone or in combination with an anti-Trp1 antibody increases macrophage infiltration in a B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells, and treatment as described in Figure 33 was initiated 9 days after tumor inoculation. The number of intratumor macrophages (A), monocytes (B), and neutrophils (C), normalized to tumor weight, was determined by flow cytometry 20 days after tumor inoculation. Dots represent individual mice, and lines represent the group mean. Significance was determined using the Kruskal-Wallis test followed by Dunn's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 38] mAlb-mIL2 RNA alone or in combination with an anti-Trp1 antibody increases eosinophil and DC infiltration in a B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells, and treatment as described in Figure 33 was initiated 9 days after tumor inoculation. The number of intratumor eosinophils (A), cDC1 (B), and CD11b+DC (C), normalized to tumor weight and determined by flow cytometry 20 days after tumor inoculation, is shown. Dots represent individual mice, and lines represent group means. Significance was determined using the Kruskal-Wallis test followed by Dunn's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 39]mAlb-mIL2 RNA induces upregulation of FcγR by intratumor macrophages in a B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice (n=7-8 / group) were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells, and the treatment described in Figure 33 was initiated 9 days after tumor inoculation. Expression of FcγRI(A), FcγRII / III(B), and FcγRIV(C) by intratumor macrophages, determined by flow cytometry 20 days after tumor inoculation, is shown. Data shown are mean + SEM. Statistical significance was determined using one-way ANOVA followed by Dunnett's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 40] mAlb-mIL2 RNA induces upregulation of FcγR by tumor monocytes in a B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice (n=7-8 / group) were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells, and the treatment described in Figure 33 was initiated 9 days after tumor inoculation. Expression of FcγRI(A), FcγRII / III(B), and FcγRIV(C) by tumor macrophages, determined by flow cytometry 20 days after tumor inoculation, is shown. Data shown are mean + SEM. Statistical significance was determined using one-way ANOVA followed by Dunnett's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 41]Macrophage depletion appears to impair the survival of mice treated with mAlb-mIL2 RNA combined with anti-Trp1 antibody in a B16F10-B2m- / - mouse melanoma model, while NK cell or neutrophil depletion does not appear to impair survival. C57Bl / 6 mice (n=10 for the control group, n=8-15 for all other groups) were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells and treated with anti-Trp1 (TA99) antibody on days 5, 8, 12, 15, 19, and 22 post-tumor inoculation, and with mAlb-mIL2 encoding RNA on days 5, 12, and 19 post-tumor inoculation, as shown in Figure 33. The control group was administered isotype control antibodies and mAlb-encoding RNA (which does not encode any cytokines). Depleted antibodies against NK1.1, CSF1R, or Ly6G, or unrelated control antibodies (non-depleted), were administered intraperitoneally (ip) at a loading dose of 400 μg on day 4 after tumor inoculation, and at subsequent doses of 200 μg (unrelated antibody, NK1.1, or Ly6G) or 300 μg (CSF1R) on days 7, 11, 14, 18, and 20 after tumor inoculation. [Figure 42] Flow cytometry analysis of blood samples to confirm immune cell depletion. Flow cytometry analysis of NK1.1 (NK cells) (A) or Ly6G (neutrophils) (B) depletion in blood from mice treated as shown in Figure 41, one day after injection of depletion antibody. The upper panel shows blood from representative mice injected with control antibody, and the lower panel shows blood from representative mice injected with depletion antibody. [Figure 43]The reduction in tumor growth by mAlb-mIL2 RNA combined with anti-Trp1 antibody is enhanced by chemotherapy in a B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice (n=12-13 / group) were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells, and 200 mg / kg of cyclophosphamide (CTX) or a control vehicle was intraperitoneally injected (ip) on day 6 post-tumor inoculation. Mice were treated with anti-Trp1 (TA99) antibody and / or mAlb-mIL2 encoding RNA on days 7, 14, and 21 post-tumor inoculation, as described in Figure 33. The control group was treated with an isotype control antibody or mAlb-encoding RNA (which does not encode any cytokines). The data shown are mean + SEM. Statistical significance was determined using two-way ANOVA followed by Dunnett's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. NS P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 44]Combination therapy with anti-Trp1 antibody and mAlb-mIL2 RNA reduces the growth of B16F10-Jak1- / mouse melanoma tumors. C57Bl / 6 mice (n=10 / group) were subcutaneously inoculated with 3 × 10⁵ B16F10-Jak1- / - cells and treated with anti-Trp1 (TA99) antibody on days 5, 8, 12, 15, and 19 post-tumor inoculation, and with mAlb-mIL2 encoding RNA on days 5, 12, and 19 post-tumor inoculation, as shown in Figure 33. A control group was treated with either an isotype control antibody or mAlb-encoding RNA (which does not encode any cytokines). Tumor growth (A) and survival (B) of tumor-bearing mice. Data shown are mean + SEM. Statistical significance was determined using two-way ANOVA followed by Dunnett's multiple comparison test. Significant differences in survival were determined using the log-rank (Mantel-Cox) test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 45] Comparison of immune cell infiltration in TC1 and TC1-B2m- / - mouse lung epithelial tumors. C57Bl / 6 mice were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells. Anti-CSF1R antibody was administered intraperitoneally (ip) at a dose of 600 μg on day 10 and 350 μg on day 12 after tumor inoculation. The presence of the GR-1-CD11b+F4 / 80+ macrophage population was analyzed by flow cytometry 13 days after tumor inoculation. The upper panel represents untreated controls, and the lower panel shows individual mice injected with the antibody. [Figure 46]Flow cytometry analysis of blood samples to confirm CD4+ T cell and total lymphocyte depletion. C57Bl / 6 mice (n=10 for the control group, n=15 for all other groups) were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells and treated with anti-Trp1 (TA99) antibody on days 5, 8, 12, 15, and 19 post-inoculation, and with mAlb-mIL2 encoding RNA on days 5, 12, and 19 post-inoculation, as shown in Figure 33. CD4 or CD90.2 depletion antibodies or unrelated control antibodies (non-depletion) were administered intraperitoneally (ip) at a loading dose of 400 μg on day 3 post-inoculation, and at a subsequent dose of 200 μg on days 7, 10, 14, and 20 post-inoculation (control and anti-CD4 only on day 20). CSF1R depletion antibodies were administered intraperitoneally (ip) at a loading dose of 600 μg on day 2 after tumor inoculation, and at subsequent doses of 350 μg on days 5, 7, 10, 12, and 14 after tumor inoculation. Flow cytometry analysis of CD4 (CD4+ T cells) (A) or CD90.2 (total lymphocytes) (B) depletion in the blood of mice 2 days after injection of the depletion antibody. The upper panel shows blood from representative mice injected with the control antibody, and the lower panel shows blood from representative mice injected with the depletion antibody. [Figure 47] Macrophage or total lymphocyte depletion impairs the survival of mice treated with mAlb-mIL2 RNA combined with anti-Trp1 antibody in a B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice were inoculated and treated as shown in Figure 46. Significant differences in survival were determined using the log-rank (Mantel-Cox) test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 48]Flow cytometry analysis of blood samples to confirm CD8+ T cell depletion. As shown in Figure 46, C57Bl / 6 mice (n=8 for the control group, n=14 for the group administered with an unrelated control antibody, n=15 for the group administered with anti-IFNγ, and n=13 for the group administered with anti-CD8) were inoculated and treated with RNA encoding anti-Trp1 (TA99) and mAlb-mIL2. CD8 depletion antibodies or neutralizing antibodies against IFNγ or an unrelated control antibody (non-depletion) were administered intraperitoneally (ip) at a loading dose of 400 μg on day 3 after tumor inoculation, followed by 200 μg of anti-CD8 or 5 on days 7 and 10, and 250 μg of control antibody or anti-IFNγ as subsequent doses on days 7 and 10. Flow cytometry analysis of CD8 (CD8+ T cell) depletion in the blood of mice 2 days after injection of anti-CD8 antibody. The upper panel shows blood from representative mice injected with a control antibody, while the lower panel shows blood from representative mice injected with a depleted antibody. [Figure 49] CD8+ T cell depletion or IFNγ neutralization impairs the survival of mice treated with mAlb-mIL2 RNA combined with anti-Trp1 antibody in a B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice were inoculated and treated as shown in Figure 47. Significant differences in survival were determined using the log-rank (Mantel-Cox) test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 50]CD8+ T cells and IFNγ are required for pro-inflammatory polarization of macrophages in response to mAlb-mIL2 alone or in combination with an anti-Trp1 antibody in a B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice were subcutaneously inoculated with 3 × 10⁵ B16F10-B2m- / - cells, and the treatment described in Figure 33 was initiated 9 days after tumor inoculation. In (B), mice were further injected with anti-IFNγ, anti-CD8, or unrelated control antibodies as a loading dose of 400 μg on day 7 after tumor inoculation, and as subsequent doses of 200 μg of anti-CD8 or 9 on days 11 and 14, and 250 μg of control antibody or anti-IFNγ on days 11 and 14. Polarization of intratumor macrophages after combination therapy with mAlb-mIL2 and anti-Trp1 (TA99), either monotherapy or control, just 20 days after tumor inoculation (A), and after combination therapy with mAlb-mIL2 and anti-Trp1 (TA99) and injection of anti-CD8 antibody or anti-IFNγ antibody, 18 days after tumor inoculation (B). [Figure 51]Combination therapy with antibodies and mAlb-mIL2 improves the antitumor activity of anti-PD-1 and anti-CTLA4 therapy against heterogeneous tumors consisting of B16F10 and B16F10-B2m- / - cells. C57Bl / 6 mice (n=15 / group) were subcutaneously inoculated (sc) with 3 × 10⁵ cells of a mixture containing 75% B16F10 and 25% B16F10-B2m- / - cells. Mice were treated with anti-Trp1 (TA99) antibody on days 3, 7, 10, 14, and 17 after tumor inoculation, and with RNA encoding mAlb-mIL2 on days 3, 10, and 17, as shown in Figure 33. Mice were further administered intraperitoneally (ip) by injection: 200 μg of anti-PD-1 on days 3, 7, 10, 14, and 17, followed by a loading dose of 200 μg of anti-CTLA4 on day 3, and subsequent doses of 100 μg on days 7, 10, 14, and 17. Isotypes and mAlb RNA were used as controls. Single tumor growth curves (A) and survival rates (B) of tumor-bearing mice. Significant differences in survival rates were determined using the log-rank (Mantel-Cox) test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 52] Combination therapy with antibody and mAlb-mIL2 prevents the acquisition of resistance to PD-1 and anti-CTLA4 in the B16F10 mouse melanoma model. C57Bl / 6 mice were inoculated and treated as shown in Figure 51. Tumors were harvested when the mice reached the endpoint criteria and stimulated with 25 ng / mL IFNγ for 24 hours, after which the percentage of MHC class I+ tumor cells in the tumor cell suspension was determined by flow cytometry. Statistical significance was determined using one-way ANOVA followed by Dunnett's multiple comparison test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 53]Her2 surface expression in MC38-Her2-B2m- / - cells. MC38-Her2-B2m- / - cells were incubated with 20 μg / mL anti-Her2 antibody at 4°C for 20 minutes, antibody binding was detected using an anti-mouse secondary antibody, and analysis was performed by flow cytometry. [Figure 54] Combination therapy with anti-Her2 antibody and mAlb-mIL2 RNA reduced tumor growth and resulted in long-term survival in the MC38-Her2-B2m- / - mouse colon adenocarcinoma model. 5 × 10⁵ MC38-Her2-B2m- / - cells were subcutaneously (sc) inoculated into C57Bl / 6 mice (n=10 / group). Mice were intraperitoneally (ip) injected with 200 μg of anti-Her2 antibody (7.16.4) or an isotype control on days 3, 6, 10, 13, 17, and 24 post-tumor inoculation, and with mAlb-mIL2 or mAlb-encoding RNA (not encoding any cytokines) as described in Figure 33 on days 3, 10, 17, and 24. The control group was treated with isotype and mAlb RNA. Tumor growth is shown as mean + SEM (A) and survival rate (B) for tumor-bearing mice. Statistical significance was determined using a two-way ANOVA followed by Dunnett's multiple comparison test, and is shown (A) or by a log-rank (Mantel-Cox) test (B) for the last plotted time point. All analyses were two-tailed and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 55]B2m deficiency prevents tumor rejection after chemotherapy in the MC38 mouse colon adenocarcinoma model. C57Bl / 6 mice were subcutaneously inoculated with 5 × 10⁵ MC38 (n=15 / group) or MC38-B2m- / - (n=10 / group) cells. Mice were intraperitoneally injected with 5 mg / kg of oxaliplatin on days 4, 11, and 18 after tumor inoculation. The control group received a vehicle. Survival rates of tumor-bearing mice were analyzed. Significant differences in survival rates were determined using the log-rank (Mantel-Cox) test. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 56] Combination therapy with anti-Trp1 antibody and mAlb-mIL2 RNA synergistically interacts with chemotherapy in an MC38-Her2-B2m- / - mouse colon adenocarcinoma model. C57Bl / 6 mice (n=15 / group) were subcutaneously inoculated with 5 × 10⁵ MC38-Her2-B2m- / - cells and treated with oxaliplatin (OX) as shown in Figure 55. Mice were further treated with anti-Her2 (7.16.4) antibody on days 5, 8, 12, 15, and 19, and with mAlb-mIL2 encoding RNA on days 7, 14, and 21, as shown in Figure 54. The control group was treated with vehicle, isotype control antibody, or mAlb-encoding RNA (which does not encode any cytokines). Survival rates of tumor-bearing mice were determined using the log-rank (Mantel-Cox) test for statistical significance of survival. All analyses were two-sided and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 57]The reduction in tumor growth by mAlb-mIL2 RNA combined with anti-Trp1 antibody is enhanced by chemotherapy in a B16F10-B2m- / - mouse melanoma model. C57Bl / 6 mice (n=14 for the control-only group, n=15 for all other groups) were subcutaneously inoculated (sc) with 5 × 10⁵ B16F10-Jak1- / - cells, and 7 days post-tumor inoculation were intraperitoneally (ip) injected with 150 mg / kg of cyclophosphamide (CTX) or a control vehicle. Mice were treated with anti-Trp1 (TA99) antibody on days 8, 11, 15, 18, and 22 post-tumor inoculation, and with mAlb-mIL2 encoding RNA on days 8, 15, and 22, as shown in Figure 33. The control group was treated with vehicle, isotype control antibody, or mAlb-encoding RNA (not encoding any cytokines). Survival rate of tumor-bearing mice. The significance of survival rates was determined using the log-rank (Mantel-Cox) test. All analyses were two-tailed and performed using GraphPad Prism 8. ns P>0.05, *P≦0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Modes for carrying out the invention]

[0033] This disclosure is described in detail below, but it should be understood that this disclosure is not limited to the specific methodologies, protocols, and reagents described herein, and that these may vary. Furthermore, it should be understood that the terms used herein are intended solely to describe specific embodiments and are not intended to limit the scope of this disclosure, which is limited only by the accompanying claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.

[0034] Preferably, the terms used herein are defined as those found in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", H.G. W. Heuenberger, B. Nagel, and H. Kolbl, Eds., Helvetica Chimica Acta, CH-4010 Basel, Switzerland, (1995).

[0035] Unless otherwise indicated, the implementation of this disclosure will utilize conventional methods of chemistry, biochemistry, cell biology, immunology, and recombinant DNA techniques as described in the literature in the art (see, for example, Molecular Cloning: A Laboratory Manual, 2nd Edition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989).

[0036] The elements of this disclosure are described below. These elements are listed along with specific embodiments, but it should be understood that they may be combined in any way and in any number to create further embodiments. The various examples and embodiments described should not be construed as limiting this disclosure to only the embodiments expressly described. This description should be understood as disclosing and encompassing embodiments that combine the expressly described embodiments with any number of disclosed elements. Furthermore, any permutations and combinations of all described elements should be considered disclosed by this description unless specifically indicated in the context.

[0037] The term "about" means approximately or nearly, and in the context of the numbers or ranges described herein, in one embodiment, means ±20%, ±10%, ±5%, or ±3% of the listed or claimed numbers or ranges.

[0038] In the context describing this disclosure (particularly in the context of the claims), the terms “one” and “it,” and similar references, should be interpreted as encompassing both singular and plural, unless otherwise specifically indicated herein or unless the context clearly contradicts it. Enumerations of value ranges herein are intended simply as a way of concisely referring to each separate value belonging to that range individually. Unless otherwise specifically indicated herein, individual values ​​are incorporated herein as if they were individually listed herein. All methods described herein may be performed in any suitable order unless otherwise specifically indicated herein or unless the context clearly contradicts it. The use of any examples or illustrative language provided herein (e.g., “etc.”) is intended solely to better illustrate this disclosure and does not impose limitations on the claims. No language herein should be interpreted as referring to any unclaimed element essential to the practice of this disclosure.

[0039] Unless otherwise specified, the term “including” is used in the context of this Document to indicate that there may be additional members in addition to the members of the list introduced by “including”. However, the term “including” is intended to encompass the possibility that there may be no additional members, i.e., for the purposes of this embodiment, “including” should be understood to mean “consisting of”.

[0040] Throughout this specification, several sources are referenced. Each source referenced herein (including all patents, patent applications, scientific publications, manufacturer specifications, instructions, etc.) is incorporated herein by reference in its entirety, either above or below. Nothing in this specification should be construed as an acknowledgment that this disclosure had no prior rights to such disclosure.

[0041] The following definitions are provided, applicable to all aspects of this disclosure. Unless otherwise indicated, the following terms have the meanings set forth below. Terms not defined have the meanings widely recognized in their respective art.

[0042] definition Cancers that are “at least partially resistant to the MHC-dependent T cell response” mean that the MHC-dependent T cell response to the cancer is reduced, in particular, because the cancer expresses the resistance mechanisms described herein, compared to normal circumstances, such as when the cancer is not resistant to the MHC-dependent T cell response, such as when a proliferative MHC-dependent T cell response to the cancer can ultimately lead to the attack and death of tumor cells, and / or when the cancer responds to T cell-based, i.e., T cell-involved therapies. Cancers that are not at least partially resistant to the MHC-dependent T cell response preferably exhibit normal antigen processing and / or presentation as well as normal IFN signaling. Thus, cancers that are “at least partially resistant to the MHC-dependent T cell response” may be partially or completely immune to the proliferative MHC-dependent T cell response to the cancer and / or tumor cell killing by MHC-dependent T cells. The MHC-dependent T cell response may be an endogenous response to cancer and / or a response resulting from the induction of the MHC-dependent T cell response by, for example, T cell-involved immunotherapy.

[0043] The term "under-responsive" means that the response is reduced compared to a normal situation, for example, when cancer is at least partially resistant to the MHC-dependent T cell response and responds to T cell-based, i.e., T cell-containing therapy. Such cancers that are at least partially resistant to the MHC-dependent T cell response preferably exhibit normal antigen processing and / or presentation as well as normal IFN signaling. The term "deficient" means that the deficient property or activity of the object is reduced compared to a normal situation where such a deficiency does not exist.

[0044] Preferably, cancers that are at least partially resistant to MHC-dependent T cell responses and / or do not respond well to T cell-based therapies may have: 1) a deficiency in the mechanisms that lead to antigen processing and / or presentation, for example, the cancer may be MHC-I deficient, and the MHC-I deficiency may result from mutations or partial or complete loss of the MHC-I allele or β2-microglobulin (B2M); 2) a deficiency in T cell stimuli due to a deficiency in IFN signaling, such as type I IFN or IFNγ signaling; or 3) a deficiency in CD8, for example. + They may have lost antigens that are presented in relation to MHC for recognition by T cells or combinations thereof.

[0045] As used herein, terms such as “reduce,” “decrease,” “inhibit,” or “impair” relate to the ability to produce an overall reduction or overall decrease of a level, for example, a binding level, preferably 5% or more, 10% or more, 20% or more, more preferably 50% or more, more preferably 75% or more, and most preferably 100%.

[0046] Terms such as “increase,” “boost,” or “exceed” preferably relate to an increase or boost of at least about 10%, preferably at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 80%, most preferably at least 100%, at least 200%, at least 500%, or even more.

[0047] According to this disclosure, the term “peptide” refers to a substance comprising a sequence of amino acids, up to approximately 2, 3, 4, 6, 8, 10, 13, 16, 20, and up to approximately 50, 100, or 150, linked together by peptide bonds. The terms “protein” or “polypeptide” refer to a larger peptide, particularly a peptide having at least approximately 150 amino acids, but the terms “peptide,” “protein,” and “polypeptide” are generally used as synonyms herein.

[0048] A “therapeutic protein,” when administered to a subject in a therapeutically effective amount, exerts a positive or beneficial effect on the subject’s condition or pathology. In one embodiment, a therapeutic protein may have curative or palliative properties and may be administered to improve, alleviate, reduce, reverse, delay the onset of, or reduce the severity of one or more symptoms of a disease or disorder. A therapeutic protein may have prophylactic properties and may be used to delay the onset of a disease or to reduce the severity of such a disease or pathological condition. The term “therapeutic protein” may include whole proteins or peptides, or may refer to therapeutically active fragments thereof. It may also include therapeutically active variants of proteins. Examples of therapeutically active proteins include, but are not limited to, cytokines.

[0049] With respect to an amino acid sequence (peptide or protein), a “fragment” refers to a portion of the amino acid sequence, i.e., a sequence that is shortened at the N-terminus and / or C-terminus. A C-terminal shortened fragment (N-terminal fragment) can be obtained, for example, by translation of a truncated open reading frame lacking the 3' end of the open reading frame. An N-terminal shortened fragment (C-terminal fragment) can also be obtained, for example, by translation of a truncated open reading frame lacking the 5' end of the open reading frame, insofar as it contains a start codon that acts to initiate translation of the truncated open reading frame. An amino acid sequence fragment contains, for example, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the amino acid residues from the amino acid sequence. An amino acid sequence fragment preferably contains at least 6, more particularly at least 8, at least 12, at least 15, at least 20, at least 30, at least 50, or at least 100 consecutive amino acids from the amino acid sequence.

[0050] In this specification, “variant,” “variant protein,” or “variant polypeptide” means a protein that differs from the wild-type protein by at least one amino acid modification. The parent polypeptide may be a naturally occurring or wild-type (WT) polypeptide, or a modified wild-type polypeptide. Preferably, the variant polypeptide has at least one amino acid modification compared to the parent polypeptide, for example, 1 to about 20 amino acid modifications compared to the parent, preferably 1 to about 10 or 1 to about 5 amino acid modifications.

[0051] As used herein, "parent polypeptide," "parent protein," "precursor polypeptide," or "precursor protein" means an unmodified polypeptide that is subsequently modified to produce a variant. The parent polypeptide may be a wild-type polypeptide, or a variant or modified form of a wild-type polypeptide.

[0052] In this specification, “wild-type,” “WT,” or “natural” means the amino acid sequence found in nature, including allelic mutations. Wild-type proteins or polypeptides have an amino acid sequence that is not intentionally modified.

[0053] For the purposes of this disclosure, the term "variant" of an amino acid sequence (peptide, protein, or polypeptide) includes amino acid insertion variants, amino acid addition variants, amino acid deletion variants, and / or amino acid substitution variants. The term "variant" includes all splice variants, post-translational modification variants, conformational variants, isoform variants, and species homologs, in particular those naturally expressed by cells. The term "variant" also includes, in particular, fragments of amino acid sequences.

[0054] Amino acid insertion variants involve the insertion of one or more amino acids into a specific amino acid sequence. In the case of amino acid sequence variants with insertions, one or more amino acid residues are inserted at a specific site in the amino acid sequence, but random insertions are also possible with appropriate screening of the resulting product. Amino acid addition variants involve amino-terminal and / or carboxyl-terminal fusions of one or more amino acids, e.g., 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. Amino acid deletion variants are characterized by the removal of one or more amino acids from a sequence, e.g., 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletion may be at any position in the protein. Amino acid deletion variants containing a deletion at the N-terminus and / or C-terminus of a protein are also called N-terminal and / or C-terminal cleavage variants. Amino acid substitution variants are characterized by the removal of at least one residue in a sequence and the insertion of another residue in its place. It is preferable to modify amino acid sequences at non-conserved positions between homologous proteins or peptides, and / or to substitute an amino acid with another amino acid having similar properties. Preferably, amino acid changes in peptides and protein variants are conservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids. Conservative amino acid changes include substitutions of one of the families of amino acids whose side chains are related. Naturally occurring amino acids are generally divided into four families: acidic (aspartic acid, glutamic acid), basic (lysine, arginine, histidine), nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified together as aromatic amino acids. In one embodiment, conservative amino acid substitutions include substitutions within the following groups: Glycine, alanine; Valine, isoleucine, leucine; Aspartic acid, glutamic acid; Asparagine, glutamine; Serine, threonine; Lysine, arginine; and Phenylanine, tyrosine.

[0055] Preferably, the degree of similarity, preferably identity, between a given amino acid sequence and an amino acid sequence that is a variant of the given amino acid sequence is at least about 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The degree of similarity or identity is preferably given for an amino acid region that is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the total length of the reference amino acid sequence. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is preferably given for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids, preferably consecutive amino acids. In a preferred embodiment, the degree of similarity or identity is given for the entire length of the reference amino acid sequence. Alignment for determining sequence similarity, preferably sequence identity, can be performed using tools known in the art, preferably using the best sequence alignment, for example, using Align, with a standard setting, preferably EMBOSS::Needle, Matrix:Blosum62, Gap Open 10.0, Gap Extension 0.5.

[0056] "Sequence similarity" indicates the percentage of amino acids that are identical or represent a conserved amino acid substitution. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between those sequences.

[0057] The term "identity percentage" is intended to indicate the percentage of amino acid residues that are identical between two sequences being compared, obtained after best alignment. This percentage is purely statistical, and differences between the two sequences are distributed randomly and throughout their entire length. Sequence comparisons between two amino acid sequences are typically performed by comparing them after optimal alignment, and the comparison is done segment by segment or "comparison window" by segment to identify and compare local regions of sequence similarity. Optimal alignment of sequences for comparison can be achieved manually, by local homology algorithms (Smith and Waterman, 1981, Ads App.Math.2, 482; Neddleman and Wunsch, 1970, J.Mol.Biol.48, 443; Pearson and Lipman, 1988, Proc.Natl Acad.Sci.USA 85, 2444; or by computer programs using these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA from Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).

[0058] The identity percentage is calculated by determining the number of identical positions in the two sequences being compared, dividing this number by the total number of positions being compared, and multiplying the result by 100 to obtain the identity percentage between these two sequences.

[0059] Homologous amino acid sequences, according to this disclosure, exhibit identity of at least 40%, particularly at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, preferably at least 95%, at least 98%, or at least 99% of the amino acid residues.

[0060] The amino acid sequence variants described herein can be readily prepared by those skilled in the art, for example, by recombinant DNA manipulation. Manipulation of DNA sequences for preparing peptides or proteins with substitutions, additions, insertions, or deletions is described in detail, for example, Sambrook et al. (1989). Furthermore, the peptides and amino acid variants described herein can be readily prepared using known peptide synthesis techniques, such as solid-phase synthesis and similar methods.

[0061] In one embodiment, a fragment or variant of an amino acid sequence (peptide or protein) is preferably a “functional fragment” or “functional variant.” The term “functional fragment” or “functional variant” of an amino acid sequence refers to any fragment or variant that exhibits one or more functional properties identical or similar to those of the amino acid sequence from which it is derived, i.e., functionally equivalent. With respect to cytokines such as IL2, one particular function is one or more immunomodulatory activities exhibited by the amino acid sequence from which the fragment or variant is derived, and / or binding to one or more receptors to which the amino acid sequence from which the fragment or variant is derived binds. As used herein, the term “functional fragment” or “functional variant” refers in particular to a variant molecule or sequence that is altered by one or more amino acids compared to the amino acid sequence of the parent molecule or sequence, and that still performs one or more of the functions of the parent molecule or sequence, such as binding to a target molecule or contributing to binding to a target molecule. In one embodiment, the alteration of the amino acid sequence of the parent molecule or sequence does not significantly affect or alter the binding properties of the molecule or sequence. In different embodiments, the binding of functional fragments or functional variants may be reduced but still significant; for example, the binding of functional variants may be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of that of the parent molecule or sequence. However, in other embodiments, the binding of functional fragments or functional variants may be enhanced compared to the parent molecule or sequence.

[0062] An amino acid sequence (peptide, protein, or polypeptide) "derived" from a specified amino acid sequence (peptide, protein, or polypeptide) refers to the origin of the original amino acid sequence. Preferably, an amino acid sequence derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical, or homologous to that particular sequence or fragment thereof. An amino acid sequence derived from a particular amino acid sequence may be a variant or fragment of that particular sequence. For example, it will be understood by those skilled in the art that IL2 compounds suitable for use herein can be modified to have a sequence different from the naturally occurring or natural sequence from which they are derived, while retaining the desired activity of the natural sequence.

[0063] Where used herein, “instructional materials” or “instructions” include publications, records, diagrams, or any other medium of expression that can be used to convey the usefulness of the compositions and methods of the present invention. Instructional materials for a kit of the present invention may, for example, be affixed to the container containing the compositions of the present invention, or shipped together with the container containing the compositions. Alternatively, the instructional materials may be shipped separately from the container, with the intention that the instructional materials and the compositions be used in conjunction by the recipient.

[0064] "Isolated" means modified or removed from its natural state. For example, nucleic acids or peptides that are naturally present in living animals are not "isolated," but the same nucleic acids or peptides that have been partially or completely separated from their naturally occurring coexisting substances are "isolated." Isolated nucleic acids or proteins may exist in a substantially purified form or in a non-natural environment, such as a host cell.

[0065] In the context of this invention, the term "recombinant" means "produced through genetic manipulation." Preferably, "recombinant products," such as recombinant cells, in the context of this invention do not exist in nature.

[0066] As used herein, the term “naturally occurring” refers to the fact that a substance can be found in nature. For example, peptides or nucleic acids that are present in living organisms (including viruses), can be isolated from natural sources, and have not been intentionally modified by humans in a laboratory are considered naturally occurring.

[0067] The term “genetic modification” includes the transfection of cells with nucleic acids. The term “transfection” relates to the introduction of nucleic acids, particularly RNA, into cells. For the purposes of this invention, the term “transfection” also includes the introduction of nucleic acids into cells or the uptake of nucleic acids by such cells, and the cells may be present in a subject, e.g., a patient. Accordingly, according to this invention, the cells for nucleic acid transfection described herein may be present in vitro or in vivo, and for example, the cells may form an organ, tissue, and / or part of an organism of a patient. According to this invention, transfection may be transient or stable. In some applications of transfection, it is sufficient that the transfected genetic material is expressed only transiently. Since nucleic acids introduced in the process of transfection are not usually incorporated into the nuclear genome, the foreign nucleic acids are diluted or degraded by mitosis. Cells that enable episomal amplification of nucleic acids significantly reduce the dilution rate. If it is desired that the transfected nucleic acids actually remain in the genome of the cells and their daughter cells, stable transfection must occur. Such stable transfection can be achieved by using virus-based or transposon-based systems for transfection. Generally, nucleic acids encoding cytokines such as IL-2 are transiently transfected into cells. RNA can be transfected into cells to transiently express the protein it encodes.

[0068] In the context of this invention, the terms “immune effector cell” or “effector cell” refer to cells that exert effector functions during an immune response. For example, immune effector cells include T cells (cytotoxic T cells, helper T cells, tumor-infiltrating T cells), B cells, natural killer cells, neutrophils, macrophages, and dendritic cells. The terms “T cell” and “T lymphocyte” are used interchangeably herein and include cytotoxic T cells (CTLs, CD8+ T cells), including T helper cells (CD4+ T cells) and cytolytic T cells. The term “MHC-dependent T cell” or similar terms refer to T cells that recognize antigens when presented in relation to MHC and preferably exert effector functions, such as the killing of target cells expressing the antigen.

[0069] T cells belong to the group of white blood cells known as lymphocytes and play a central role in cellular immunity. They can be distinguished from other types of lymphocytes, such as B cells and natural killer cells, by the presence of special receptors on their cell surface called T cell receptors (TCRs). The thymus is the main organ involved in the maturation of T cells. Several different subsets of T cells have been discovered, each with distinct functions.

[0070] T helper cells, among their many functions, particularly assist other leukocytes in immunological processes, including the maturation of B cells into plasma cells and the activation of cytotoxic T cells and macrophages. These cells are also known as CD4+ T cells because they express the CD4 glycoprotein on their surface. Helper T cells are activated when presented with peptide antigens by MHC class II molecules expressed on the surface of antigen-presenting cells (APCs). Once activated, they rapidly divide and secrete small proteins called cytokines that regulate or assist the active immune response.

[0071] Cytotoxic T cells destroy virus-infected cells and tumor cells and are also involved in graft rejection. These cells are also known as CD8+ T cells because they express the CD8 glycoprotein on their surface. These cells recognize their targets by binding to antigens associated with MHC class I, which are present on the surface of almost every cell in the body.

[0072] All T cells possess a T cell receptor (TCR), which exists as a complex of several proteins. The TCR of a T cell can bind to the major histocompatibility complex (MHC) molecule and interact with immunogenic peptides (epitopes) presented on the surface of target cells. Specific binding of the TCR triggers a signaling cascade within the T cell, leading to proliferation and differentiation into mature effector T cells. In most T cells, the actual T cell receptor is produced from independent T cell receptor alpha and beta (TCRα and TCRβ) genes and consists of two distinct peptide chains called α- and β-TCR chains. A much less common group of T cells (2% of all T cells), γδ T cells (gamma delta T cells), have a distinct T cell receptor (TCR) on their surface, consisting of one γ chain and one δ chain.

[0073] All T cells originate from hematopoietic stem cells in the bone marrow. Hematopoietic progenitor cells, derived from hematopoietic stem cells, reside in the thymus and expand through cell division to form a large population of immature thymocytes. The earliest thymocytes do not express either CD4 or CD8 and are therefore classified as double-negative (CD4-CD8-) cells. As they develop, they become double-positive thymocytes (CD4+CD8+) and eventually mature into single-positive (CD4+CD8- or CD4-CD8+) thymocytes, which are then released from the thymus into peripheral tissues.

[0074] As used herein, the terms “NK cells” or “natural killer cells” refer to a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of T cell receptors.

[0075] In humans, MHC molecules are commonly referred to as HLA (human leukocyte antigen) molecules. There are two main classes of MHC molecules: Class I and Class II. MHC class I antigens are found on almost all nucleated cells in the body. The primary function of this class of MHC molecules is to display (or present) peptide fragments of intracellular proteins on CTLs (cytotoxic leukocytes). Based on this display, CTLs attack those displaying MHC-binding peptides, including disease-related peptides (antigens) such as cancer antigens. CD8-positive T cells are typically cytotoxic (hence the name cytotoxic T cells = CTLs) and are processed intracellularly from proteins of any intracellular localization, recognizing peptides of 9-10 amino acids presented on the cell surface by MHC class I molecules. Therefore, surface expression of MHC class I molecules plays a crucial role in determining the sensitivity of target cells to CTLs.

[0076] A common problem encountered in cancer immunotherapy is the reduced immunogenicity in cancer tissue, which can lead to resistance to MHC-dependent T cell responses. This so-called "immune evasion" can be understood based on the phenotypic differences encountered in neoplastic cells. For example, tumor cells exhibit reduced ability to process and present antigens, reduced ability to stimulate T cells, such as autologous T cells, complete downregulation of immunogenic proteins associated with transformed cells, and / or absence or reduction of expression of leukocyte adhesion molecules or other accessory molecules, as well as selective downregulation of specific MHC class I and class II alleles or B2M, for example, due to a deficiency in IFN signaling. Loss of MHC function or expression can be caused by the loss of a single MHC allele, loss of an MHC haplotype, or complete loss of MHC class I due to the loss of two B2M genes. Therefore, tumors that have lost MHC expression are resistant to MHC-dependent T cell-based therapies. Indeed, impaired MHC function is one of the important "immune evasion" mechanisms in tumor cells and therefore limits the application of T cell-mediated immunotherapy. According to the present invention, cancers that are at least partially resistant to the MHC-dependent T cell response may have acquired one or more of these immune evasion mechanisms.

[0077] Genomic instability is a prominent feature of cancer. This allows tumors to progress, adapt, and develop resistance to treatment. Interaction with the host immune system determines the ability of a given tumor cell clone to survive and disseminate. Thus, the process of "selection," particularly due to T cell immunosuppression against, for example, MHC-I deficient tumor variants, can be a natural process. Many therapies, such as vaccination, select for resistance and therefore do not effectively address the impairment. Therapies in which cancer cells are subjected to alternative selection pressure resulting from switching cancer cell targeting are disclosed herein. This alternative selection pressure also allows for the avoidance of the development of resistance to the MHC-dependent T cell response.

[0078] interferon Interferons (IFNs) are a group of signaling proteins produced and released by host cells in response to the presence of several pathogens, including viruses, bacteria, parasites, and tumor cells. In a typical scenario, a virus-infected cell releases interferons to enhance the antiviral defenses of nearby cells.

[0079] Based on the type of receptor through which interferons signal, interferons are typically divided into three classes: type I interferons, type II interferons, and type III interferons.

[0080] All type I interferons bind to specific cell surface receptor complexes known as IFN-α / β receptors (IFNARs), which consist of IFNAR1 and IFNAR2 chains.

[0081] The type I interferons present in humans are IFNα, IFNβ, IFNε, IFNκ, and IFNω. Generally, type I interferons are produced when the body recognizes a virus that has entered the body. They are produced by fibroblasts and monocytes. Upon release, type I interferons bind to specific receptors on target cells, leading to the expression of proteins that prevent the virus from producing and replicating its RNA and DNA.

[0082] IFNα proteins are primarily produced by plasmacytoid dendritic cells (pDCs). They are mainly involved in innate immunity against viral infections. The genes involved in their synthesis belong to 13 subtypes called IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, and IFNA21. These genes are found together in a cluster on chromosome 9.

[0083] IFNβ proteins are produced in large quantities by fibroblasts. They possess antiviral activity, primarily involved in the innate immune response. Two types of IFNβ, IFNβ1 and IFNβ3, have been described. Both the native and recombinant forms of IFNβ1 have antiviral, antibacterial, and anticancer properties.

[0084] Type II interferon (IFNγ in humans), also known as immunointerferon, is activated by IL-12. Furthermore, type II interferon is released by cytotoxic T cells and T helper cells.

[0085] Type III interferons signal via a receptor complex consisting of IL10R2 (also known as CRF2-4) and IFNLR1 (also known as CRF2-12). Although discovered more recently than type I and type II IFNs, recent information demonstrates the importance of type III IFNs in several types of viral or fungal infections.

[0086] Generally, type I and type II interferons are responsible for regulating and activating the immune response.

[0087] The term "autologous" is used to describe something that originates from the same source. For example, "autotransplantation" refers to the transplantation of tissue or organs from the same source. Such a procedure is advantageous because it overcomes immunological barriers that would otherwise lead to rejection.

[0088] The term "homogenetic" is used to describe things that originate from different individuals of the same species. Two or more individuals are said to be homogeneous if they do not have identical genes at one or more gene loci.

[0089] The term "related" is used to describe individuals or tissues that have the same genotype, i.e., identical twins or animals of the same inbred lineage, or tissues derived from them.

[0090] The term "xenotransplant" is used to describe something consisting of multiple different elements. For example, transferring bone marrow from one individual to another constitutes xenotransplantation. Xenogenes are genes that originate from a source other than the target organism.

[0091] nucleic acid As used herein, the terms “polynucleotide” or “nucleic acid” are intended to include DNA and RNA, such as genomic DNA, cDNA, mRNA, recombinantly produced molecules, and chemically synthesized molecules. Nucleic acids may be single-stranded or double-stranded. RNA includes in vitro transcribed RNA (IVT RNA) or synthetic RNA.

[0092] Nucleic acids may be included in vectors. As used herein, the term “vector” includes any vector known to those skilled in the art, including plasmid vectors, cosmid vectors, phage vectors such as lambda phages, retroviral vectors, viral vectors such as adenovirus vectors or baculovirus vectors, or artificial chromosome vectors such as bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), or P1 artificial chromosomes (PACs). Such vectors include expression vectors and cloning vectors. Expression vectors include plasmids and viral vectors and generally contain a desired coding sequence and appropriate DNA sequences necessary for the expression of an operablely linked coding sequence in a particular host organism (e.g., bacteria, yeast, plants, insects, or mammals) or in an in vitro expression system. Cloning vectors are generally used to manipulate and amplify a particular desired DNA fragment and may lack the functional sequences necessary for the expression of the desired DNA fragment.

[0093] In one embodiment of all aspects of the present invention, a nucleic acid, such as a nucleic acid encoding IL2 or an antibody, is expressed in the treated target cells to provide IL2 or the antibody. In one embodiment of all aspects of the present invention, the nucleic acid is transiently expressed in the target cells. Therefore, in one embodiment, the nucleic acid is not incorporated into the cell's genome. In one embodiment of all aspects of the present invention, the nucleic acid is RNA, preferably in vitro transcribed RNA.

[0094] The nucleic acids described herein may be recombinant and / or isolated molecules.

[0095] In this disclosure, the term “RNA” refers to nucleic acid molecules containing ribonucleotide residues. In preferred embodiments, RNA comprises all or most of the ribonucleotide residues. As used herein, “ribonucleotide” refers to a nucleotide having a hydroxyl group at the 2' position of the β-D-ribofuranosyl group. RNA includes, but is not limited to, isolated RNA such as double-stranded RNA, single-stranded RNA, partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, and modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and / or alteration of one or more nucleotides. Such alterations may refer to the addition of non-nucleotide material to internal RNA nucleotides or the ends (one or more) of RNA. In this disclosure, nucleotides in RNA are also construed to be non-standard nucleotides such as chemically synthesized nucleotides or deoxynucleotides. In this disclosure, these modified RNAs are considered analogues of naturally occurring RNA.

[0096] In certain embodiments of this disclosure, RNA is messenger RNA (mRNA) associated with an RNA transcript encoding a peptide or protein. As is established in the art, mRNA generally comprises a 5' untranslated region (5'-UTR), a peptide-coding region, and a 3' untranslated region (3'-UTR). In some embodiments, RNA is produced by in vitro transcription or chemosynthesis. In one embodiment, mRNA is produced by in vitro transcription using a DNA template, where DNA refers to a nucleic acid comprising deoxyribonucleotides.

[0097] In one embodiment, the RNA is in vitro transcribed RNA (IVT-RNA), which can be obtained by in vitro transcription of a suitable DNA template. The promoter for regulating transcription can be any promoter for any RNA polymerase. The DNA template for in vitro transcription can be obtained by cloning nucleic acid, particularly cDNA, and introducing it into a suitable vector for in vitro transcription. cDNA can be obtained by reverse transcription of RNA.

[0098] In one embodiment, the RNA described herein may have a modified nucleoside. In some embodiments, the RNA comprises a modified nucleoside instead of at least one (e.g., all) uridines.

[0099] As used herein, the term "uracil" refers to one of the nucleic acid bases that may be present in RNA. The structure of uracil is: [ka] That is the case.

[0100] As used herein, the term "uridine" refers to one of the nucleosides that can be present in RNA. The structure of uridine is: [ka] That is the case.

[0101] UTP (uridine 5'-triphosphate) has the following structure: [ka] It has.

[0102] PseudoUTP (pseudouridine 5'-triphosphate) has the following structure: [ka] It has.

[0103] Pseudouridine is an example of a modified nucleoside, an isomer of uridine, in which uracil is bonded to the pentose ring via a carbon-carbon bond instead of a nitrogen-carbon glycosidic bond.

[0104] Another exemplary modified nucleoside is N1-methylpsoiduridine (m1Ψ), which has the structure: [ka] It has.

[0105] N1-methylpsoid UTP has the following structure: [ka] It has.

[0106] Another exemplary modified nucleoside is 5-methyluridine (m5U), which has the structure: [ka] It has.

[0107] In some embodiments, one or more uridines in the RNA described herein are replaced with modified nucleosides. In some embodiments, the modified nucleosides are modified uridines.

[0108] In some embodiments, the RNA contains a modified nucleoside in place of at least one uridine. In some embodiments, the RNA contains a modified nucleoside in place of each uridine.

[0109] In some embodiments, the modified nucleoside is independently selected from pseudouridine (ψ), N1-methylpsoiduridine (m1ψ), and 5-methyluridine (m5U). In some embodiments, the modified nucleoside includes pseudouridine (ψ). In some embodiments, the modified nucleoside includes N1-methylpsoiduridine (m1ψ). In some embodiments, the modified nucleoside includes 5-methyluridine (m5U). In some embodiments, the RNA may contain two or more modified nucleosides, which are independently selected from pseudouridine (ψ), N1-methylpsoiduridine (m1ψ), and 5-methyluridine (m5U). In some embodiments, the modified nucleoside includes pseudouridine (ψ) and N1-methylpsoiduridine (m1ψ). In some embodiments, the modified nucleoside comprises pseudouridine (ψ) and 5-methyluridine (m5U). In some embodiments, the modified nucleoside comprises N1-methylpsoiduridine (m1ψ) and 5-methyluridine (m5U). In some embodiments, the modified nucleoside comprises pseudouridine (ψ), N1-methylpsoiduridine (m1ψ), and 5-methyluridine (m5U).

[0110] In some embodiments, the modified nucleoside that substitutes one or more uridines in the RNA is 3-methyluridine (m 3 U), 5-methoxyuridine (mo 5 U), 5-azauridine, 6-azauridine, 2-thio-5-azauridine, 2-thiouridine(s) 2 U), 4-thiouridine (s 4 U), 4-thiopsoiduridine, 2-thiopsoiduridine, 5-hydroxyuridine (ho 5 U), 5-aminoallyluridine, 5-halouridine (e.g., 5-iodouridine or 5-bromouridine), uridine 5-oxyacetic acid (cmo 5 U), Uridine 5-oxyacetate methyl ester (mcmo 5 U), 5-carboxymethyluridine (cm 5U), 1-carboxymethylpsoidouridine, 5-carboxyhydroxymethyluridine (chm 5 U), 5-carboxyhydroxymethyl-uridinemethyl ester (mchm 5 U), 5-methoxycarbonylmethyluridine (mcm 5 U), 5-methoxycarbonylmethyl-2-thiouridine (mcm 5 s 2 U), 5-aminomethyl-2-thiouridine (nm 5 s 2 U), 5-methylaminomethyluridine (mnm 5 U), 1-ethylpsoidouridine, 5-methylaminomethyl-2-thiouridine (mnm 5 s 2 U), 5-methylaminomethyl-2-selenouridine (mnm 5 se 2 U), 5-Carbamoylmethyluridine (ncm 5 U), 5-carboxymethylaminomethyluridine (cmnm 5 U), 5-carboxymethylaminomethyl-2-thiouridine (cmnm 5 s 2 U), 5-propynyluridine, 1-propynylpsoiduridine, 5-taurinomethyluridine (τm 5 U), 1-taurinomethylpsoidouridine, 5-taurinomethyl-2-thiouridine (τm5s2U), 1-taurinomethyl-4-thiopsoidouridine, 5-methyl-2-thiouridine (m 5 s 2 U), 1-methyl-4-thiopsoiduridine (m 1 s 4 ψ), 4-thio-1-methylpsoiduridine, 3-methylpsoiduridine (m 3 ψ), 2-thio-1-methylpsoidouridine, 1-methyl-1-deazapsoidouridine, 2-thio-1-methyl-1-deazapsoidouridine, dihydrouridine(D), dihydropsoidouridine, 5,6-dihydrouridine, 5-methyldihydrouridine(m 5D) 2-Thiodihydrouridine, 2-Thiodihydropsoiduridine, 2-Methoxyuridine, 2-Methoxy-4-Thiouridine, 4-Methoxypsoiduridine, 4-Methoxy-2-Thiopsoiduridine, N1-Methylpsoiduridine, 3-(3-Amino-3-Carboxypropyl)uridine (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)psoidouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uridine (inm 5 U), 5-(isopentenylaminomethyl)-2-thiouridine(inm 5 s 2 U), α-thiouridine, 2'-O-methyluridine (Um), 5,2'-O-dimethyluridine (m 5 Um), 2'-O-methylpsoiduridine (Ψm), 2-thio-2'-O-methyluridine (s 2 Um), 5-methoxycarbonylmethyl-2'-O-methyluridine (mcm 5 Um), 5-Carbamoylmethyl-2'-O-methyluridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm 5 Um), 3,2'-O-dimethyluridine (m 3 Um), 5-(isopentenylaminomethyl)-2'-O-methyluridine(inm 5 It may be one or more of the following modified uridines known in the art: Um), 1-thiouridine, deoxythymidine, 2'-F-arauridine, 2'-F-uridine, 2'-OH-arauridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine, or any other modified uridine known in the art.

[0111] In some embodiments, the RNA according to this disclosure includes a 5' cap. In one embodiment, the RNA according to this disclosure does not have an uncapped 5'-triphosphate. In one embodiment, the RNA may be modified by a 5' cap analogue. The term “5' cap” refers to a structure found at the 5' end of an mRNA molecule, and generally consists of a guanosine nucleotide linked to the mRNA by a 5'-5' triphosphate bond. In one embodiment, this guanosine is methylated at position 7. Providing a 5' cap or a 5' cap analogue to RNA can be achieved by in vitro transcription in which the 5' cap is co-transcribed onto the RNA strand, or by post-transcriptional addition to the RNA using a capping enzyme.

[0112] In some embodiments, the building block cap for RNA is m2 7,3'-O Gppp(m1 2'-O )ApG(sometimes m2 7,3'O G(5')ppp(5')m 2'-O It is also called ApG, and it has the following structure: [ka] It has.

[0113] The following are RNA and m2 7,3'O G(5')ppp(5')m 2'-O This is an example of cap 1 RNA containing ApG: [ka] .

[0114] The following is another example of capped 1 RNA (without cap analogues): [ka] .

[0115] In some embodiments, RNA is structured as follows: [ka] The anti-reverse cap (ARCA cap (m2 7,3'O G(5')ppp(5')G)) of a cap analog having is used to modify the "cap 0" structure.

[0116] The following are exemplary cap 0 RNAs containing RNA and m2 7,3'O G(5')ppp(5')G:

Chemical formula

[0117] In some embodiments, the "cap 0" structure has the structure:

Chemical formula

[0118] The following is an exemplary cap 0 RNA containing β-S-ARCA (m2 7,2'O G(5')ppSp(5')G) and RNA.

Chemical formula

[0119] In some embodiments, the RNA according to this disclosure includes a 5'-UTR and / or a 3'-UTR. The terms “untranslated region” or “UTR” refer to a region within a DNA molecule that is transcribed but not translated into an amino acid sequence, or a corresponding region within an RNA molecule such as an mRNA molecule. Untranslated regions (UTRs) may be located on the 5' side (upstream) (5'-UTR) and / or the 3' side (downstream) (3'-UTR) of the open reading frame. The 5'-UTR, if present, is located at the 5' end upstream of the start codon of the protein-coding region. The 5'-UTR is downstream of the 5' cap (if present) and, for example, directly adjacent to the 5' cap. The 3'-UTR, if present, is located at the 3' end downstream of the stop codon of the protein-coding region, although the term “3'-UTR” preferably does not include a poly(A) sequence. Thus, the 3'-UTR is upstream of a poly(A) sequence (if present) and, for example, directly adjacent to the poly(A) sequence.

[0120] In some embodiments, the RNA according to this disclosure includes a 3'-poly(A) sequence. As used in the present invention, the terms “poly(A) sequence” or “polyA tail” typically refer to a continuous or discontinuous sequence of adenylate residues located at the 3' end of an RNA molecule. Poly(A) sequences are known to those skilled in the art and may follow the 3'UTR of the RNA described herein. The poly(A) sequence may be of any length. In some embodiments, the poly(A) sequence contains or consists of at least 20, at least 30, at least 40, at least 80, or at least 100, and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides, particularly about 110 nucleotides. In some embodiments, the poly(A) sequence consists only of A nucleotides. In some embodiments, the poly(A) sequence consists essentially of A nucleotides but is interrupted by a random sequence of four nucleotides (A, C, G, and U), as disclosed in International Publication No. 2016 / 005324A1, incorporated herein by reference. Such random sequences may be 5–50, 10–30, or 10–20 nucleotides in length. A poly(A) cassette present in the coding strand of DNA, consisting essentially of dA nucleotides but with four nucleotides (dA, dC, dG, dT) evenly distributed and interrupted by a random sequence having, for example, 5–50 nucleotides in length, exhibits consistent proliferation of plasmid DNA in Escherichia coli (E. coli) at the DNA level and remains associated with beneficial properties in terms of supporting RNA stability and translation efficiency at the RNA level. In some embodiments, nucleotides other than A nucleotides are not adjacent to the poly(A) sequence at their 3' end; i.e., the poly(A) sequence is not masked at its 3' end or is not followed by nucleotides other than A.

[0121] In the context of this disclosure, the term “transcription” refers to the process by which the genetic code in a DNA sequence is transcribed into RNA. The RNA can then be translated into peptides or proteins.

[0122] "Code" refers to the inherent properties of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, and the biological properties that arise therefrom, which have either a defined sequence of nucleotides (i.e., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and act as a template for the synthesis of other polymers and macromolecules in biological processes. Thus, if the transcription and translation of mRNA corresponding to a gene produce a protein in a cell or other biological system, that gene codes for a protein. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing, and the non-coding strand, which is used as a template for the transcription of the gene or cDNA, may be said to code for a protein or other product of that gene or cDNA.

[0123] As used herein, “endogenous” means any substance produced from or within a living organism, cell, tissue, or system.

[0124] As used herein, the term “exogenous” means any substance introduced from or produced outside of a living organism, cell, tissue, or system.

[0125] As used herein, the term “expression” is defined as the transcription and / or translation of a particular nucleotide sequence.

[0126] As used herein, the terms “linked,” “fused,” and “fused” are interchangeable. These terms refer to the combination of two or more elements, components, or domains.

[0127] Cytokine Cytokines are a category of small proteins (approximately 5–20 kDa) that are crucial for cellular signaling. The release of cytokines influences the behavior of cells around them. Cytokines are involved in autocrine, parasecrine, and endocrine signaling as immunomodulators. Cytokines include chemokines, interferons, interleukins, lymphokines, and tumor necrosis factor, but generally do not include hormones or growth factors (despite some overlap in terminology). Cytokines are produced by a wide range of cells, including immune cells such as macrophages, B lymphocytes, T lymphocytes, and mast cells, as well as endothelial cells, fibroblasts, and various stromal cells. A given cytokine can be produced by multiple types of cells. Cytokines act via receptors and are particularly important in the immune system; they regulate the balance between humoral and cellular immune responses and modulate the maturation, growth, and responsiveness of specific cell populations. Some cytokines enhance or inhibit the effects of other cytokines in complex ways.

[0128] IL2 Interleukin 2 (IL2) is a cytokine that induces the proliferation of antigen-activated T cells and stimulates natural killer (NK) cells. The biological activity of IL2 is mediated through the multi-subunit IL2 receptor complex (IL2R), which consists of three polypeptide subunits spanning the cell membrane: p55 (IL2Rα, alpha subunit, also known as CD25 in humans), p75 (IL2Rβ, beta subunit, also known as CD122 in humans), and p64 ​​(IL2Rγ, gamma subunit, also known as CD132 in humans). The T cell response to IL2 depends on a variety of factors, including (1) the concentration of IL2; (2) the number of IL2R molecules on the cell surface; and (3) the number of IL2Rs occupied by IL2 (i.e., the affinity of the binding interaction between IL2 and IL2R) (Smith, "Cell Growth Signal Transduction is Quantal," In Receptor Activation by Antigens, Cytokines, Hormones, and Growth Factors 766:263-271, 1995). The IL2:IL2R complex is internalized upon ligand binding, and various components undergo different sorting. When administered as an intravenous (iv) bolus, IL2 has rapid systemic clearance (an initial clearance phase with a half-life of 12.9 minutes, followed by a slower clearance phase with a half-life of 85 minutes) (Konrad et al., Cancer Res. 50:2009-2017, 1990).

[0129] In eukaryotic cells, human IL-2 is synthesized as a 153-amino acid precursor polypeptide, from which 20 amino acids are removed to produce mature secreted IL-2. Recombinant human IL-2 is produced in E. coli, insect cells, and mammalian COS cells.

[0130] According to this disclosure, IL2 (optionally as part of extended PK IL2) may be naturally occurring IL2 or a fragment or variant thereof. IL2 may be human IL2 and may originate from any vertebrate, in particular any mammal. As used herein, “human IL2” or “wild-type human IL2” has the normally present 133-amino acid sequence of natural human IL2 (excluding a signal peptide consisting of an additional 20 N-terminal amino acids), with or without the additional N-terminal methionine that is necessarily present when the protein is expressed as an intracellular fraction in Escherichia coli, whether natural or recombinant, and the amino acid sequence is described in Fujita, et al., PNAS USA, 80, 7437-7441 (1983).

[0131] In one embodiment, IL2 comprises the amino acid sequence of SEQ ID NO: 1 or 2. In one embodiment, a functional variant of IL2 comprises an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1 or 2. In one embodiment, a functional variant of IL2 binds to the IL2 receptor or a subunit of the IL2 receptor, e.g., the α subunit and / or the β / γ subunit. Generally, for the purposes of this disclosure, the term “IL2” as used herein includes any polypeptide comprising a naturally occurring IL2 moiety or a functional variant thereof, unless otherwise inconsistent with the context.

[0132] According to this disclosure, in certain embodiments, IL2 is conjugated to a pharmacokinetic modifying group. The resulting molecule, hereafter referred to as “extended pharmacokinetic (PK) IL2,” has an extended circulating half-life compared to free IL2. The extended circulating half-life of extended PK IL2 allows serum IL2 concentrations to be maintained within the therapeutic range in vivo, potentially leading to enhanced activation of many types of immune cells, including T cells. Due to its favorable pharmacokinetic profile, extended PK IL2 can be administered at lower frequencies and for longer periods compared to unmodified IL2.

[0133] Thus, in certain embodiments described herein, the IL2 moiety is fused to a heterologous polypeptide (i.e., a polypeptide that is not IL2 and preferably not a variant of IL2), and thus is extended PK IL2. In certain embodiments, the IL2 moiety of the extended PK IL2 is human IL2. In other embodiments, the IL2 moiety of the extended PK IL2 is a fragment or variant of human IL2. The heterologous polypeptide can increase the circulating half-life of IL2. As discussed in more detail below, polypeptides that increase the circulating half-life can be serum albumins such as human or mouse serum albumin.

[0134] IL15 In embodiments disclosed herein that include the use of a polypeptide comprising IL2 or a functional variant thereof or a polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof, in addition to or instead of the polypeptide comprising IL2 or a functional variant thereof or the polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof, a polypeptide comprising IL15 or a functional variant thereof or a polynucleotide encoding a polypeptide comprising IL15 or a functional variant thereof can be used.

[0135] Interleukin 15 (IL15) is a cytokine that has structural similarity to interleukin 2 (IL2). Similar to IL2, IL15 binds to and signals through a complex composed of the IL-2 / IL-15 receptor beta chain (CD122) and the common gamma chain (gamma-C, CD132). IL15 induces the cell proliferation of natural killer cells.

[0136] Extended PK moiety The IL2 polypeptides described herein can be prepared as fusion polypeptides or chimeric polypeptides comprising an IL2 moiety and a heterogeneous polypeptide (i.e., a polypeptide that is not IL2 or a variant thereof). IL2 may be fused to an extended PK group, which increases its circulating half-life. Non-limiting examples of extended PK groups are described below. It should be understood that other PK groups that increase the circulating half-life of cytokines or variants thereof are also applicable to this disclosure. In certain embodiments, the extended PK group is a serum albumin domain (e.g., mouse serum albumin, human serum albumin).

[0137] As used herein, the term “PK” is an acronym for “pharmacokinetics” and encompasses, for example, the properties of a compound including absorption, distribution, metabolism, and excretion by a subject. As used herein, “extended PK group” refers to a protein, peptide, or portion that, when fused to or administered together with a biologically active molecule, increases the circulating half-life of a biologically active molecule. Examples of extended PK groups include serum albumin (e.g., HSA), immunoglobulin Fc or Fc fragments and their variants, transferrin and its variants, and human serum albumin (HSA) binder (disclosed in U.S. Patent Applications Publications 2005 / 0287153 and 2007 / 0003549). Other exemplary extended PK groups are disclosed in Kontermann, Expert Opin Biol Ther, 2016 Jul;16(7):903-15, which is incorporated herein by reference in whole. As used herein, “extended PK cytokine” refers to a cytokine moiety combined with an extended PK group. In one embodiment, the extended PK cytokine is a fusion protein in which the cytokine moiety is linked to or fused to an extended PK group. As used herein, “extended PK IL” refers to an interleukin (IL) moiety (including an IL variant moiety) combined with an extended PK group. In one embodiment, the extended PK IL is a fusion protein in which the IL moiety is linked to or fused to an extended PK group. An exemplary fusion protein is an HSA / IL2 fusion in which the IL2 moiety is fused with HSA.

[0138] In certain embodiments, the serum half-life of the extended PK IL is increased compared to IL alone (i.e., IL not fused to the extended PK group). In certain embodiments, the serum half-life of the extended PK IL is at least 20, 40, 60, 80, 100, 120, 150, 180, 200, 400, 600, 800, or 1000% longer than the serum half-life of IL alone. In certain embodiments, the serum half-life of the extended PK IL is at least 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 6 times, 7 times, 8 times, 10 times, 12 times, 13 times, 15 times, 17 times, 20 times, 22 times, 25 times, 27 times, 30 times, 35 times, 40 times, or 50 times longer than the serum half-life of IL alone. In certain embodiments, the serum half-life of the extended PK IL is at least 10 hours, 15 hours, 20 hours, 25 hours, 30 hours, 35 hours, 40 hours, 50 hours, 60 hours, 70 hours, 80 hours, 90 hours, 100 hours, 110 hours, 120 hours, 130 hours, 135 hours, 140 hours, 150 hours, 160 hours, or 200 hours.

[0139] As used herein, “half-life” refers to the time required for the serum or plasma concentration of a compound, such as a peptide or protein, to decrease by 50% in vivo, for example, due to degradation and / or clearance or sequestration by natural mechanisms. Extended PK cytokines suitable for use herein, such as extended PK interleukins (ILs), are stabilized in vivo, and their half-lives are increased, for example, by fusion with serum albumin (e.g., HSA or MSA) that is resistant to degradation and / or clearance or sequestration. Half-life can be determined by any method known in itself, such as by pharmacokinetic analysis. Appropriate techniques will be apparent to those skilled in the art and may include, for example, the steps of appropriately administering an appropriate dose of an amino acid sequence or compound to a subject; collecting blood samples or other samples from the subject at periodic intervals; determining the level or concentration of the amino acid sequence or compound in the blood samples; and calculating, from the data (plots of) thus obtained, the time required for the level or concentration of the amino acid sequence or compound to decrease by 50% compared to the initial level at administration. Further details are provided in standard handbooks such as Kenneth, A. et al., Chemical Stability of Pharmaceuticals: A Handbook for Pharmacists, and Peters et al., Pharmacokinetic Analysis: A Practical Approach (1996). See also Gibaldi, M. et al., Pharmacokinetics, 2nd Rev. Edition, Marcel Dekker (1982).

[0140] In certain embodiments, the extended PK group comprises serum albumin or a fragment thereof, or a variant of serum albumin or a fragment thereof (all of which, for the purposes of this disclosure, are included in the term “albumin”). The polypeptides described herein may be fused to albumin (or a fragment or variant thereof) to form albumin fusion proteins. Such albumin fusion proteins are described in U.S. Patent Application Publication No. 20070048282.

[0141] As used herein, “albumin fusion protein” refers to a protein formed by the fusion of at least one molecule of albumin (or a fragment or variant thereof) with at least one molecule of a therapeutic protein, particularly IL2 (or a variant thereof). Albumin fusion proteins can be produced by the translation of a nucleic acid in which a polynucleotide encoding the therapeutic protein is in-frame bound to a polynucleotide encoding albumin. Once the therapeutic protein and albumin become part of the albumin fusion protein, they may be referred to as “part,” “region,” or “segment” of the albumin fusion protein (e.g., “therapeutic protein segment” or “albumin protein segment”), respectively. In a very preferred embodiment, the albumin fusion protein comprises at least one molecule of therapeutic protein (including, but not limited to, a mature form of the therapeutic protein) and at least one molecule of albumin (including, but not limited to, a mature form of albumin). In one embodiment, the albumin fusion protein is processed by host cells, such as hepatocytes, of the target organ of the administered RNA and secreted into circulation. Processing of the nascent albumin fusion protein occurring in the secretory pathway of the host cell used for RNA expression may include, but are not limited to, signal peptide cleavage, disulfide bond formation, proper folding, carbohydrate addition and processing (e.g., N- and O-linked glycosylation), specific proteolytic cleavage, and / or assembly into a multimeric protein. The albumin fusion protein is preferably encoded by an unprocessed form of RNA having a signal peptide, particularly at its N-terminus, and after secretion by the cell, preferably exists in a processed form, particularly with the signal peptide cleaved. In the most preferred embodiment, “processed form of albumin fusion protein” refers to the albumin fusion protein product that has undergone N-terminal signal peptide cleavage, also referred herein to as “mature albumin fusion protein.”

[0142] In preferred embodiments, albumin-fused proteins containing a therapeutic protein have higher plasma stability compared to the plasma stability of the same therapeutic protein when it is not fused to albumin. Plasma stability typically refers to the period from when the therapeutic protein is administered in vivo and transported into the bloodstream until it is broken down, removed from the bloodstream by organs such as the kidneys or liver, and ultimately removed from the body. Plasma stability is calculated with respect to the half-life of the therapeutic protein in the bloodstream. The half-life of a therapeutic protein in the bloodstream can be readily determined by common assays known in the art.

[0143] As used herein, “albumin” collectively refers to an albumin protein or amino acid sequence, or an albumin fragment or variant, having one or more functional activities (e.g., biological activity) of albumin. In particular, “albumin” refers to human albumin or its fragments or variants, in particular the mature form of human albumin, or albumin or its fragments derived from other vertebrates, or variants of these molecules. Albumin may be derived from any vertebrate, in particular any mammal, such as humans, cattle, sheep, or pigs. Non-mammalian albumins include, but are not limited to, hens and salmon. The albumin portion of an albumin fusion protein may be derived from a different animal than the therapeutic protein portion.

[0144] In certain embodiments, albumin is human serum albumin (HSA), or a fragment or variant thereof, as disclosed in, for example, U.S. Patent No. 5,876,969, International Publication No. 2011 / 124718, International Publication No. 2013 / 075066, and International Publication No. 2011 / 0514789.

[0145] The terms human serum albumin (HSA) and human albumin (HA) are used interchangeably herein. The terms “albumin” and “serum albumin” are broader and include human serum albumin (and its fragments and variants) as well as albumin (and its fragments and variants) from other species.

[0146] As used herein, an albumin fragment sufficient to prolong the therapeutic activity or plasma stability of a therapeutic protein refers to an albumin fragment of sufficient length or structure to stabilize or extend the therapeutic activity or plasma stability of a protein, such that the plasma stability of the therapeutic protein portion of an albumin fusion protein is prolonged or enhanced compared to its plasma stability in the unfused state.

[0147] The albumin portion of the albumin fusion protein may contain the full length of the albumin sequence, or one or more fragments thereof that can stabilize or extend therapeutic activity or plasma stability. Such fragments may be 10 or more amino acid lengths, or may contain about 15, 20, 25, 30, 50 or more consecutive amino acids from the albumin sequence, or may contain part or all of a specific domain of albumin. For example, one or more fragments of HSA spanning the first two immunoglobulin-like domains may be used. In a preferred embodiment, the HSA fragment is a mature form of HSA.

[0148] Generally speaking, albumin fragments or variants are at least 100 amino acids long, preferably at least 150 amino acids long.

[0149] According to this disclosure, albumin may be naturally occurring albumin or a fragment or variant thereof. Albumin may be human albumin and may originate from any vertebrate, in particular any mammal. In one embodiment, albumin comprises the amino acid sequence of SEQ ID NO: 3 or 4 or an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3 or 4.

[0150] Preferably, the albumin fusion protein contains albumin as the N-terminal portion and a therapeutic protein as the C-terminal portion. Alternatively, an albumin fusion protein containing albumin as the C-terminal portion and a therapeutic protein as the N-terminal portion may also be used. In other embodiments, the albumin fusion protein has therapeutic proteins fused to both the N-terminus and the C-terminus of albumin. In a preferred embodiment, the therapeutic proteins fused at the N-terminus and C-terminus are the same therapeutic protein. In another preferred embodiment, the therapeutic proteins fused at the N-terminus and C-terminus are different therapeutic proteins. In one embodiment, both different therapeutic proteins are cytokines.

[0151] In one embodiment, one or more therapeutic proteins are bound to albumin via one or more peptide linkers. The linker peptides between the fusion regions provide greater physical separation between the regions and thus can maximize the accessibility of the therapeutic protein region for binding to its homologous receptor, for example. The linker peptides may be composed of amino acids so that they are flexible or more rigid. The linker sequence may be cleavable by proteases or chemically.

[0152] As used herein, the term “Fc region” refers to a portion of innate immunoglobulin formed by the Fc domains (or Fc portions) of each of the two heavy chains of innate immunoglobulin. As used herein, the term “Fc domain” refers to a portion or fragment of a single immunoglobulin (Ig) heavy chain in which the Fc domain does not contain an Fv domain. In certain embodiments, the Fc domain begins in a hinge region immediately upstream of the papain cleavage site and ends at the C-terminus of the antibody. Thus, a complete Fc domain includes at least a hinge domain, a CH2 domain, and a CH3 domain. In certain embodiments, the Fc domain includes at least one of the hinge (e.g., upper, middle, and / or lower hinge regions), a CH2 domain, a CH3 domain, a CH4 domain, or a variant, portion, or fragment thereof. In certain embodiments, the Fc domain includes a complete Fc domain (i.e., the hinge domain, the CH2 domain, and the CH3 domain). In certain embodiments, the Fc domain includes a hinge domain (or portion thereof) fused to a CH3 domain (or portion thereof). In certain embodiments, the Fc domain includes a CH2 domain (or a portion thereof) fused to a CH3 domain (or a portion thereof). In certain embodiments, the Fc domain consists of a CH3 domain or a portion thereof. In certain embodiments, the Fc domain consists of a hinge domain (or a portion thereof) and a CH3 domain (or a portion thereof). In certain embodiments, the Fc domain consists of a CH2 domain (or a portion thereof) and a CH3 domain. In certain embodiments, the Fc domain consists of a hinge domain (or a portion thereof) and a CH2 domain (or a portion thereof). In certain embodiments, the Fc domain lacks at least a portion of the CH2 domain (e.g., all or part of the CH2 domain). As used herein, an Fc domain generally refers to a polypeptide that includes all or part of the Fc domain of an immunoglobulin heavy chain. This includes, but is not limited to, polypeptides that include the entire CH1, hinge, CH2, and / or CH3 domains, as well as fragments of such peptides that include only, for example, the hinge, CH2, and CH3 domains.The Fc domain may originate from any species and / or any subtype of immunoglobulin, including but not limited to human IgG1, IgG2, IgG3, IgG4, IgD, IgA, IgE, or IgM antibodies. The Fc domain encompasses native Fc and Fc variant molecules. As described herein, it will be understood by those skilled in the art that any Fc domain may be modified so that its amino acid sequence differs from the native Fc domain of naturally occurring immunoglobulin molecules. In certain embodiments, the Fc domain has reduced effector function (e.g., FcγR binding).

[0153] The Fc domains of polypeptides described herein may be derived from different immunoglobulin molecules. For example, the Fc domain of a polypeptide may include CH2 and / or CH3 domains derived from the IgG1 molecule, as well as a hinge region derived from the IgG3 molecule. In another example, the Fc domain may include a chimeric hinge region that is partly derived from the IgG1 molecule and partly from the IgG3 molecule. In yet another example, the Fc domain may include a chimeric hinge that is partly derived from the IgG1 molecule and partly from the IgG4 molecule.

[0154] In certain embodiments, the extended PK group comprises an Fc domain or a fragment thereof, or a variant of an Fc domain or a fragment thereof (all of which are included in the term “Fc domain” for the purposes of this disclosure). The Fc domain does not contain a variable region that binds to an antigen. Fc domains suitable for use in this disclosure can be obtained from several different sources. In certain embodiments, the Fc domain is derived from human immunoglobulin. In certain embodiments, the Fc domain is derived from the human IgG1 constant region. However, it is understood that the Fc domain may be derived from immunoglobulins of other mammalian species, including, for example, rodent species (e.g., mouse, rat, rabbit, guinea pig) or non-human primate species (e.g., chimpanzee, macaque).

[0155] Furthermore, the Fc domain (or its fragments or variants) may originate from any immunoglobulin class, including IgM, IgG, IgD, IgA, and IgE, as well as any immunoglobulin isotype, including IgG1, IgG2, IgG3, and IgG4.

[0156] Various Fc domain gene sequences (e.g., mouse and human constant region gene sequences) are available in the form of publicly accessible deposits. Constant region domains can be selected that contain Fc domain sequences lacking specific effector function and / or possessing specific modifications that reduce immunogenicity. Many sequences of antibodies and antibody-coding genes are publicly available, and suitable Fc domain sequences (e.g., hinge, CH2, and / or CH3 sequences, or fragments or variants thereof) can be derived from these sequences using techniques widely accepted in the art.

[0157] In certain embodiments, the extended PK group is a serum albumin-binding protein, such as those described in U.S. Patent Publication No. 2005 / 0287153, U.S. Patent Publication No. 2007 / 0003549, U.S. Patent Publication No. 2007 / 0178082, U.S. Patent Publication No. 2007 / 0269422, U.S. Patent Publication No. 2010 / 0113339, International Publication No. 2009 / 083804, and International Publication No. 2009 / 133208, which are incorporated herein by reference in their entirety. In certain embodiments, the extended PK group is transferrin, as disclosed in U.S. Patent No. 7,176,278 and U.S. Patent No. 8,158,579, which are incorporated herein by reference in their entirety. In certain embodiments, the extended PK group is a serum immunoglobulin-binding protein, such as those disclosed in U.S. Patent Application Publication 2007 / 0178082, U.S. Patent Application Publication 2014 / 0220017, and U.S. Patent Application Publication 2017 / 0145062, which are incorporated herein by whole reference. In certain embodiments, the extended PK group is a serum albumin-binding fibronectin (Fn)-based scaffold domain protein, such as those disclosed in U.S. Patent Application Publication 2012 / 0094909, which are incorporated herein by whole reference. A method for producing a fibronectin-based scaffold domain protein is also disclosed in U.S. Patent Application Publication 2012 / 0094909. A non-limiting example of an Fn3-based extended PK group is Fn3(HSA), i.e., a human serum albumin-binding Fn3 protein.

[0158] In certain embodiments, an extended PK IL suitable for use according to this disclosure may use one or more peptide linkers. As used herein, the term "peptide linker" refers to a peptide or polypeptide sequence that links two or more domains in the linear amino acid sequence of a polypeptide chain (e.g., an extended PK portion and an IL portion such as IL2). For example, a peptide linker may be used to link the IL2 portion to an HSA domain.

[0159] For example, linkers suitable for fusing an extended PK group to IL2 are well known in the art. Exemplary linkers include glycine-serine polypeptide linkers, glycine-proline polypeptide linkers, and proline-alanine polypeptide linkers. In certain embodiments, the linker is a glycine-serine polypeptide linker, i.e., a peptide consisting of glycine and serine residues.

[0160] In addition to, or instead of, the heterologous polypeptides described herein may include sequences encoding a “marker” or “reporter.” Examples of marker or reporter genes include β-lactamase, chloramphenicol acetyltransferase (CAT), adenosine deaminase (ADA), aminoglycoside phosphotransferase, dihydrofolate reductase (DHFR), hygromycin B phosphotransferase (HPH), thymidine kinase (TK), β-galactosidase, and xanthine guanine phosphoribosyltransferase (XGPRT).

[0161] antigen The term “antigen” refers to an active substance that includes an epitope to which an immune response or an immune effector molecule such as an antibody is directed and / or should be directed. The term “antigen” includes proteins and peptides in particular. In one embodiment, the antigen is a disease-associated antigen, such as a tumor antigen.

[0162] The term “disease-associated antigen” is used in its broadest sense to refer to any antigen associated with a disease, preferably including an epitope that stimulates the host immune system to produce a cellular antigen-specific immune response and / or humoral antibody response to the disease. Therefore, disease-associated antigens, their epitopes, or drugs targeting disease-associated antigens or epitopes may be used for therapeutic purposes. Disease-associated antigens may be associated with microorganisms, typically infections caused by microbial antigens, or with cancer, typically tumors.

[0163] The term "tumor antigen" refers to components of cancer cells that may originate from the cytoplasm, cell surface, and cell nucleus. In particular, the term refers to antigens produced intracellularly or as surface antigens on tumor cells. Tumor antigens are typically selectively expressed by cancer cells (e.g., expressed at higher levels in cancer cells than in non-cancerous cells), and in some cases, expressed only by cancer cells. Examples of tumor antigens include, but are not limited to, p53, ART-4, BAGE, β-catenin / m, Bcr-abL CAMEL, CAP-1, CASP-8, CDC27 / m, CDK4 / m, CEA, claudin family cell surface proteins such as claudin 6, claudin 18.2, and claudin 12, c-MYC, CT, Cyp-B, DAM, ELF2M, ETV6-AML1, G250, GAGE, GnT-V, and Gap. 100, HAGE, HER-2 / neu, HPV-E7, HPV-E6, HAST-2, hTERT (or hTRT), LAGE, LDLR / FUT, MAGE-A, preferably MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, or MAGE-A12, MAGE-B, MAGE-C, MART-1 / Melan A, MC1R, Myosin / m, MUC This includes 1, MUM-1, MUM-2, MUM-3, NA88-A, NF1, NY-ESO-1, NY-BR-1, pl90 minor BCR-abL, Pml / RARa, PRAME, Proteinase 3, PSA, PSM, RAGE, RU1 or RU2, SAGE, SART-1 or SART-3, SCGB3A2, SCP1, SCP2, SCP3, SSX, Survivin, TEL / AML1, TPI / m, TRP-1, TRP-2, TRP-2 / INT2, TPTE, WT, and WT-1.

[0164] The terms “expressed on the cell surface,” “associated with the cell surface,” or similar terms mean that a molecule, such as an antigen, is positioned in association with the cell’s plasma membrane, with at least a portion of the molecule facing the extracellular space of the cell, and accessible from the outside of the cell, for example, by an antibody located outside the cell. In this context, the portion is preferably at least four, preferably at least eight, preferably at least twelve, and more preferably at least twenty amino acids. Association can be direct or indirect. For example, association can be by one or more transmembrane domains, one or more lipid anchors, or by interaction with any other protein, lipid, saccharide, or other structure that may be found on the outer layer of the cell’s plasma membrane. For example, a molecule associating with the cell surface may be a transmembrane protein having an extracellular portion, or a protein that associates with the cell surface by interacting with another protein that is a transmembrane protein.

[0165] "Cell surface" or "surface of a cell" is used according to its ordinary meaning in the art and therefore includes the outside of the cell that is accessible for binding by proteins and other molecules.

[0166] In the context of the present invention, the terms “exodomain” refer to a portion of a molecule, such as a protein, that faces the extracellular space of a cell and is accessible from the outside of the cell, preferably by binding to a molecule such as an antibody located outside the cell. Preferably, the term refers to one or more extracellular loops or domains or fragments thereof.

[0167] The term “epitope” refers to an antigenic determinant in a molecule, i.e., a part or fragment of a molecule such as an antigen that is recognized by the immune system. For example, an epitope may be recognized by T cells, B cells, or antibodies. An antigenic epitope may consist of a continuous or discontinuous portion of the antigen and may be about 5 to about 100, for example about 5 to about 50, more preferably about 8 to about 30, and most preferably about 10 to about 25 amino acid lengths. For example, an epitope may preferably be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid lengths. In one embodiment, the epitope is about 10 to about 25 amino acid lengths. The term “epitope” includes B cell epitopes and T cell epitopes.

[0168] The term "T cell epitope" refers to a portion or fragment of a protein that is recognized by T cells when presented in association with an MHC molecule. The term "major histocompatibility complex" and the abbreviation "MHC" refer to a complex of genes present in all vertebrates, including MHC class I and MHC class II molecules. MHC proteins or molecules are important for signaling between lymphocytes and antigen-presenting cells or disease cells in immune responses, and MHC proteins or molecules bind to peptide epitopes and present them for recognition by T cell receptors on T cells. Proteins encoded by MHC are expressed on the surface of cells and present both self-antigens (peptide fragments from the cell itself) and non-self-antigens (e.g., fragments of invading microorganisms) to T cells. For class I MHC / peptide complexes, the bound peptide is typically about 8 to 10 amino acids long, but longer or shorter peptides may also be effective. For class II MHC / peptide complexes, the bound peptide is typically about 10 to 25 amino acids long, particularly about 13 to 18 amino acids long, but longer and shorter peptides may also be effective.

[0169] therapeutic antibodies A "therapeutic antibody" is an antibody that can bind to an antigen, particularly a cell surface antigen on a target cell, such as a cancer cell, to produce a therapeutic effect. Therapeutic monoclonal antibodies are considered a class of pharmaceutically active agents that should enable tumor-selective therapy by targeting tumor-selective antigens or epitopes. In preferred embodiments, the therapeutic antibody targets a tumor or cancer antigen.

[0170] The term “antibody” refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains linked together by disulfide bonds, and includes any molecule containing its antigen-binding moiety. The term “antibody” includes, but is not limited to, human antibodies, humanized antibodies, chimeric antibodies, single-chain antibodies, monoclonal antibodies and antibody fragments or derivatives, i.e., constructs derived from antibodies, including antigen-binding antibody fragments such as scFv and Fab and Fab' fragments, and also includes all recombinant forms of antibodies, e.g., antibodies expressed in prokaryotes, non-glycosylated antibodies, and any antigen-binding antibody fragments and derivatives described herein. Each heavy chain consists of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. Each light chain consists of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The VH and VL regions can be further subdivided into hypervariable regions called complementarity-determining regions (CDRs), with more conserved regions called framework regions (FRs) interposed between them. Each VH and VL consists of three CDRs and four FRs arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The constant region of the antibody can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system.

[0171] The antibodies described herein may be human antibodies. As used herein, the term “human antibody” is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. Human antibodies described herein may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-directed mutagenesis in vitro or by somatic mutation in vivo).

[0172] The term "humanized antibody" refers to a molecule having an antigen-binding site substantially derived from an immunoglobulin from a non-human species, while the rest of the molecule's immunoglobulin structure is based on the structure and / or sequence of a human immunoglobulin. The antigen-binding site may consist of a complete variable domain fused to a constant domain, or only a complementation-determining region (CDR) transplanted into an appropriate framework region within the variable domain. The antigen-binding site may be wild-type or modified by one or more amino acid substitutions, for example, to more closely resemble a human immunoglobulin. Some forms of humanized antibodies preserve all CDR sequences (e.g., a humanized mouse antibody containing all six CDRs from a mouse antibody). Other forms have one or more CDRs that are altered relative to the original antibody.

[0173] The term "chimeric antibody" refers to an antibody in which portions of the amino acid sequences of the heavy and light chains are homologous to the corresponding sequences of an antibody from a particular species or belonging to a particular class, while the remaining segments of the chain are homologous to the corresponding sequences of an antibody from another species or class. Typically, the variable regions of both the light and heavy chains mimic the variable region of an antibody from one species of mammal, while the constant region is homologous to the sequence of an antibody from another species. One obvious advantage of such a chimeric form is that the variable region can be conveniently induced from currently known sources using readily available non-human host organism B cells or hybridomas, for example, in combination with a constant region derived from human cell preparations. The variable region has the advantage of being easy to prepare and its specificity is not affected by the source, although the human constant region is less likely to induce an immune response from a human subject than a constant region from a non-human source when the antibody is injected. However, the definition is not limited to this particular example.

[0174] The terms “antigen-binding portion” (or simply “binding portion”) or “antigen-binding fragment” (or simply “binding fragment”) of an antibody, or similar terms, refer to one or more fragments of an antibody that possess the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed by the term “antigen-binding portion” of an antibody include: (i) Fab fragments, which are monovalent fragments consisting of VL, VH, CL, and CH domains; (ii) F(ab')2 fragments, which are bivalent fragments containing two Fab fragments linked by disulfide crosslinks at a hinge region; (iii) Fd fragments consisting of a VH domain and a CH domain; (iv) Fv fragments consisting of a VL domain and a VH domain of one arm of the antibody; (v) dAb fragments consisting of a VH domain (Ward et al., (1989) Nature 341:544-546); (vi) isolated complementarity-determining regions (CDRs), and (vii) combinations of two or more isolated CDRs, which may optionally be linked by a synthetic linker. Furthermore, although the two domains of the Fv fragment, VL and VH, are encoded by separate genes, they can be linked using recombination by synthetic linkers, which allow them to be constructed as a single protein chain (known as single-chain Fv (scFv); see, for example, Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883) where the VL and VH regions pair up to form a monovalent molecule. Such single-chain antibodies are also intended to be included in the term "antigen-binding fragment" of the antibody. Further examples include binding-domain immunoglobulin fusion proteins, which contain (i) a binding-domain polypeptide fused to an immunoglobulin hinge-domain polypeptide, (ii) an immunoglobulin heavy chain CH2 constant region fused to the hinge region, and (iii) an immunoglobulin heavy chain CH3 constant region fused to the CH2 constant region. The binding domain polypeptide may be a heavy chain variable region or a light chain variable region.The binding domain immunoglobulin fusion proteins are further disclosed in U.S. Patent Application Publications 2003 / 0118592 and 2003 / 0133939. These antibody fragments are obtained using prior art known to those skilled in the art, and the fragments are screened for usefulness in the same manner as intact antibodies.

[0175] The term “bispecific molecule” is intended to include any active substance having two distinct binding specificities, e.g., a protein, peptide, or protein- or peptide complex. For example, a molecule may bind to (a) a cell surface antigen and (b) an Fc receptor on the surface of an effector cell, or interact with them. The term “multispecific molecule” or “heterospecific molecule” is intended to include any active substance having three or more distinct binding specificities, e.g., a protein, peptide, or protein- or peptide complex. For example, a molecule may bind to (a) a cell surface antigen, (b) an Fc receptor on the surface of an effector cell, and (c) at least one other component, or interact with them. Thus, the present invention includes, but is not limited to, bispecific, triplicate, quadruplespecific, and other multispecific molecules to tumor antigens and other targets such as Fc receptors on effector cells. The term “bispecific antibody” also includes multivalent antibodies such as trivalent antibodies having two distinct binding specificities and quadruple antibodies having two or three distinct binding specificities. The term “bispecific antibody” also includes diabodies. Diabody is a bivalent, bispecific antibody in which the VH and VL domains are expressed on a single polypeptide chain, but a linker that is too short to allow pairing between the two domains on the same chain is used, thereby pairing the domains with complementary domains on another chain to create two antigen-binding sites (see, for example, Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ, et al. (1994) Structure 2:1121-1123).

[0176] Antibodies can be conjugated to therapeutic parts or therapeutic agents such as cytotoxicities, drugs (e.g., immunosuppressants) or radioisotopes. Cytotoxic or cytotoxic agents include any drugs that are harmful to cells and, in particular, kill them. Examples include meitansine (e.g., meltansine, rabtansine, or emtansine), auristatins (monomethyl auristatin F (MMAF), monomethyl auristatin E (MMAE)), dorastatin, calicheamycin (e.g., ozogamicin), pyrrolobenzodiazepine dimers (e.g., tecilin, tyrin), duocalmycin (e.g., duocalmycin SA, CC-1065, duocalmazine), and α-amanitin, i Linotecan or its derivative SN-38, Taxol, Cytochalasin B, Gramicidin D, Ethidium bromide, Emetine, Mitomycin, Etoposide, Tenoposide, Vincristine, Vinblastine, Colchicine, Doxorubicin, Daunorubicin, Dihydroxyanthracine dione, Mitoxantrone, Mitramycin, Actinomycin D, 1-Dehydrotestosterone, Glucocorticoid, Procaine, Tetracaine, Lidocaine, These include propranolol and puromycin and their analogues or homologs, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechloretamine, thiotepachlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C and cis-dichlorodiamine platinum(II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mitramycin, and anthramycin (AMC)), and mitotic inhibitors (e.g., vincristine and vinblastine). In a preferred embodiment, the therapeutic agent is a cytotoxic agent or a radiotoxic agent. In another embodiment, the therapeutic agent is an immunosuppressant. In yet another embodiment, the therapeutic agent is GM-CSF.In preferred embodiments, the therapeutic agent is doxorubicin, cisplatin, bleomycin sulfate, carmustine, chlorambucil, cyclophosphamide, or lysine A.

[0177] Antibodies can also be conjugated with radioactive isotopes, such as iodine-131, yttrium-90, or indium-111, to produce cytotoxic radiopharmaceuticals.

[0178] The antibody conjugates of the present invention can be used to modify a given biological response, and the drug portion should not be interpreted as being limited to classical chemotherapeutic agents. For example, the drug portion may be a protein or polypeptide having the desired biological activity. Such proteins may include, for example, enzymatically active toxins such as abrin, lysine A, Pseudomonas exotoxin, or diphtheria toxin, or their active fragments; proteins such as tumor necrosis factor or interferon-γ; or biological response modifiers such as lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), granulocyte-macrophage colony-stimulating factor ("GM-CSF"), granulocyte colony-stimulating factor ("G-CSF"), or other growth factors.

[0179] Techniques for conjugating such therapeutic portions into antibodies are well known, for example, Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp.243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp.623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp.475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of See Radiolabeled Antibody In Cancer Therapy'', in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., ``The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates'', Immunol. Rev., 62:119-58 (1982).

[0180] As used herein, an antibody is “derived” from a particular germline sequence if it is obtained by immunizing an animal or by screening an immunoglobulin gene library, and the selected antibody is at least 90%, more preferably at least 95%, even more preferably at least 96%, 97%, 98%, or 99% identical in amino acid sequence to the amino acid sequence encoded by the germline immunoglobulin gene. Typically, an antibody derived from a particular germline sequence exhibits 10 or fewer amino acid differences, more preferably 5 or fewer, or even more preferably 4, 3, 2, or 1 or fewer amino acid differences from the amino acid sequence encoded by the germline immunoglobulin gene.

[0181] As used herein, the term “heteroantibody” refers to two or more antibodies, their derivatives, or antigen-binding regions linked to each other, having at least two distinct specificities. These distinct specificities include binding specificity to Fc receptors on effector cells and binding specificity to antigens or epitopes on target cells, such as tumor cells.

[0182] The antibodies described herein may be monoclonal antibodies. As used herein, the term “monoclonal antibody” refers to a preparation of an antibody molecule with a single molecular composition. Monoclonal antibodies exhibit a single binding specificity and affinity. In one embodiment, monoclonal antibodies are produced by a hybridoma containing B cells obtained from a non-human animal, such as a mouse, fused to immortalized cells.

[0183] The antibodies described herein may be recombinant antibodies. As used herein, the term “recombinant antibody” includes all antibodies produced, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from animals (e.g., mice) that are transgenic or transchromosomal with respect to an immunoglobulin gene, or hybridomas produced therefrom; (b) antibodies isolated from host cells transformed to express an antibody, e.g., transfectomas; (c) antibodies isolated from a recombinant combinatorial antibody library; and (d) antibodies produced, expressed, created or isolated by any other means, including splicing an immunoglobulin gene sequence with another DNA sequence.

[0184] Antibodies can originate from a variety of species, including but not limited to mice, rats, rabbits, guinea pigs, and humans.

[0185] The antibodies described herein include polyclonal and monoclonal antibodies, and include IgA antibodies such as IgA1 or IgA2, IgG1, IgG2, IgG3, IgG4, IgE, IgM, and IgD antibodies. In various embodiments, the antibodies are IgG1 antibodies, more specifically IgG1 kappa or IgG1 lambda isotypes (i.e., IgG1κ, IgG1λ), IgG2a antibodies (e.g., IgG2aκ, IgG2aλ), IgG2b antibodies (e.g., IgG2bκ, IgG2bλ), IgG3 antibodies (e.g., IgG3κ, IgG3λ), or IgG4 antibodies (e.g., IgG4κ, IgG4λ).

[0186] As used herein, the term “transfectoma” includes recombinant eukaryotic host cells that express antibodies, such as CHO cells, NS / O cells, HEK293 cells, HEK293T cells, plant cells, or fungi, including yeast cells.

[0187] As used herein, “heterogeneous antibody” is defined in relation to transgenic organisms that produce such antibodies. The term refers to antibodies that have an amino acid sequence or coding nucleic acid sequence corresponding to one found in organisms not composed of transgenic organisms, and generally originate from species other than transgenic organisms.

[0188] As used herein, "heterohybrid antibody" refers to an antibody having light and heavy chains of different biological origins. For example, an antibody having a human heavy chain bound to a mouse light chain is a heterohybrid antibody.

[0189] The present invention includes all antibodies and antibody derivatives described herein, which are encompassed by the term “antibody” for the purposes of the present invention. The term “antibody derivative” refers to any modified form of an antibody, such as a conjugate of an antibody with another active substance or another antibody, or an antibody fragment.

[0190] The antibodies described herein are preferably isolated. As used herein, “isolated antibodies” are intended to include antibodies that substantially do not contain other antibodies with different antigen specificities (for example, an isolated antibody that specifically binds to a tumor antigen substantially does not contain antibodies that specifically bind to antigens other than tumor antigens). However, isolated antibodies that specifically bind to an epitope, isoform, or variant of a human tumor antigen may exhibit cross-reactivity to other relevant antigens, such as antigens from other species (e.g., species homologs of the tumor antigen).

[0191] The term "binding" in this invention preferably refers to specific binding.

[0192] According to the present invention, an antibody can bind to a predetermined target if it has significant affinity for that target in a standard assay and binds to that predetermined target. "Affinity" or "binding affinity" is often expressed using the equilibrium dissociation constant (K). D ) is measured by. Preferably, the term “significant affinity” is used. -5Less than M, 10 -6 Less than M, 10 -7 Less than M, 10 -8 Less than M, 10 -9 Less than M, 10 -10 Less than M, 10 -11 Less than M, or 10 -12 Dissociation constant (K D ) binding to a predetermined target.

[0193] Antibodies that do not have significant affinity for the target in a standard assay and do not bind significantly, particularly detectably, to the target cannot (substantially) bind to the target. Preferably, the antibody is present at a concentration of up to 2 μg / ml, preferably 10 μg / ml, more preferably 20 μg / ml, particularly 50 μg / ml or 100 μg / ml or more and does not detectably bind to the target. Preferably, the antibody has a K D of at least 10-fold, 100-fold, 10 3 -fold, 10 4 -fold, 10 5 -fold, or 10 6 -fold higher K D for binding to the target and does not have significant affinity for the target. For example, if the K D for antibody binding to a target to which the antibody can bind is 10 -7 M, the K D for binding to a target to which the antibody does not have significant affinity is at least 10 -6 M, 10 -5 M, 10 -4 M, 10 -3 M, 10 -2 M, or 10 -1 M.

[0194] An antibody is specific for a given target if it can bind to the given target but cannot bind to other targets, i.e., it has no significant affinity for other targets in a standard assay and does not significantly bind to other targets. According to the present invention, an antibody is specific for a tumor antigen if it can bind to the tumor antigen but cannot (substantially) bind to other targets. Preferably, such affinity and binding for other targets do not significantly exceed the affinity or binding for proteins unrelated to the tumor antigen such as bovine serum albumin (BSA), casein, human serum albumin (HSA), or non-tumor antigen transmembrane proteins such as MHC molecules or transferrin receptors, or any other specific polypeptide, then the antibody is specific for the tumor antigen. Preferably, the antibody binds to the given target with a K D that is at least 10-fold, 100-fold, 10 3 -fold, 10 4 -fold, 10 5 -fold, or 10 6 -fold lower than the K D for binding to other targets, then it is specific for the given target. For example, if the K D for binding to the target for which the antibody is specific is 10 -7 M, then the K D for binding to a target for which the antibody is not specific is at least 10 -6 M, 10 -5 M, 10 -4 M, 10 -3 M, 10 -2 M, or 10 -1 M.

[0195] The binding of an antibody to its target can be experimentally determined using any suitable method; see, for example, Berzofsky et al., "Antibody-Antigen Interactions," In Fundamental Immunology, Paul, WE, Ed., Raven Press New York, NY (1984), Kuby, Janis Immunology, WH Freeman and Company New York, NY (1992), and the methods described herein. Affinity can be readily determined using conventional techniques, e.g., by equilibrium dialysis; by using a BIAcore 2000 instrument with the general procedures outlined by the manufacturer; by radioimmunoassay using a radiolabeled target antigen; or by other methods known to those skilled in the art. Affinity data can be analyzed, for example, by the method of Scatchard et al., Ann NYAcad. ScL, 51:660 (1949). The measured affinity of a particular antibody-antigen interaction may differ when measured under different conditions, e.g., different salt concentrations, pH. Therefore, affinity and other antigen-binding parameters, e.g., K D ,I C 50 The measurement is preferably performed using standard solutions of the antibody and antigen, as well as a standard buffer.

[0196] As used herein, “isotype” refers to the antibody class (e.g., IgM or IgG1) encoded by a heavy chain constant region gene.

[0197] As used herein, "isotype switching" refers to the phenomenon in which the class or isotype of an antibody changes from one Ig class to one of other Ig classes.

[0198] As used herein, the term “reorganized” refers to the configuration of a heavy-chain or light-chain immunoglobulin locus in which the V segment is located directly adjacent to the DJ or J segment in a conformation that essentially encodes a complete VH or VL domain, respectively. A rearranged immunoglobulin (antibody) locus can be identified by comparison with germline DNA; a rearranged locus has at least one recombinant heptamer / nonamer homologous element.

[0199] As used herein with respect to the V segment, the terms “unreorganized” or “germline configuration” refer to a configuration in which the V segment is not recombined to be directly adjacent to a D or J segment.

[0200] According to the present invention, an antitumor antigen antibody is an antibody that can bind to an epitope present in a tumor antigen, preferably an epitope located within the extracellular domain of the tumor antigen. According to the present invention, an antitumor antigen antibody is preferably an antibody specific to the tumor antigen. Preferably, an antitumor antigen antibody is an antibody that binds to a tumor antigen expressed on the cell surface. In certain preferred embodiments, the antitumor antigen antibody binds to a native epitope of the tumor antigen present on the surface of living cells. Preferably, the antibody binds to cancer cells and substantially does not bind to non-cancer cells. Preferably, the binding of the antitumor antigen antibody to cells expressing the tumor antigen induces or mediates the death of the cells expressing the tumor antigen. The cells expressing the tumor antigen are preferably cancer cells. Preferably, the antibody induces or mediates cell death by inducing one or more of the following: antibody-dependent cell-mediated lysis, antibody-dependent cell-mediated lysis, complement-dependent cell-mediated lysis, apoptosis, and inhibition of proliferation of cells expressing the tumor antigen.

[0201] In preferred embodiments, the antibodies described herein can be characterized by one or more of the following properties: a) Specificity against tumor antigens; b) Binding affinity to tumor antigens of approximately 100 nM or less, preferably approximately 5 to 10 nM or less, more preferably approximately 1 to 3 nM or less; c) Ability to induce or mediate ADCC in tumor antigen-positive cells; d) Ability to induce or mediate ADCP in tumor antigen-positive cells; e) Ability to induce or mediate CDC in tumor antigen-positive cells; f) Ability to inhibit the proliferation of tumor antigen-positive cells; g) The ability to induce apoptosis in tumor antigen-positive cells.

[0202] The antibodies described herein preferably interact with components of the immune system via ADCC, ADCP, or CDC. The antibodies described herein can also be used to directly kill tumor cells by targeting a payload (e.g., a radioisotope, drug, or toxin), or to attack tumors through complementary mechanisms of action that may include an antitumor immune response that may be impaired due to the cytotoxic side effects of the chemotherapy agent against T lymphocytes. However, the antibodies described herein may also exert their effects simply by binding to tumor antigens on the cell surface, and thus, for example, by inhibiting cell proliferation.

[0203] Antibody-dependent cell-mediated cytotoxicity (ADCC) Antibody-dependent cell-mediated cytotoxicity (ADCC) is the death of antibody-coated target cells by cytotoxic effector cells via a non-phagocytic process, characterized by the release of cytotoxic granule contents or the expression of cell death-inducing molecules. ADCC is independent of the immune complement system, which also lyses targets but does not require other cells. ADCC is caused by the interaction between a target-binding antibody (belonging to the IgG, IgA, or IgE class) and a specific Fc receptor (FcR), a glycoprotein present on the surface of effector cells that binds to the Fc region of immunoglobulin (Ig). Effector cells that mediate ADCC include natural killer (NK) cells, monocytes, macrophages, neutrophils, eosinophils, and dendritic cells. ADCC is a rapid effector mechanism whose effectiveness depends on many parameters (density and stability of antigens on the surface of target cells; antibody affinity and FcR binding affinity). ADCC, which involves human IgG1, the most widely used IgG subclass for therapeutic antibodies, is highly dependent on the glycosylation profile of its Fc portion and polymorphisms of the Fcγ receptor.

[0204] Antibody-dependent cellular phagocytosis (ADCP) ADCP is one of the key mechanisms of action in many antibody therapies. It is defined as a highly regulated process in which an antibody eliminates its bound target by binding its Fc domain to a specific receptor on a phagocytic cell and inducing phagocytosis. Unlike ADCC, ADCP can be mediated by monocytes, macrophages, neutrophils, and dendritic cells via FcγRIIa, FcγRI, and FcγRIIIa, with FcγRIIa (CD32a) on macrophages being the primary pathway.

[0205] Complement-dependent cell injury (CDC) CDC is another method of cell death that can be directed by antibodies. IgM is the most effective isotype for complement activation. IgG1 and IgG3 are also very effective in directing CDC via the classical complement activation pathway. Preferably, in this cascade, the formation of an antigen-antibody complex involves the C of an antibody molecule, such as an IgG molecule. HThis results in the exposure of multiple C1q binding sites in close proximity to the two domains (C1q is one of the three subcomponents of complement C1). Preferably, these exposed C1q binding sites convert the previously low-affinity C1q-IgG interaction to a high-affinity one, initiating a cascade of events involving a series of other complement proteins, resulting in the proteolytic release of effector cell chemotactic / activating substances C3a and C5a. Preferably, the complement cascade terminates with the formation of membrane invasion complexes, which create pores in the cell membrane that facilitate the free passage of water and solutes into and out of the cell.

[0206] The antibodies described herein can be produced by a variety of techniques, including conventional monoclonal antibody methods, such as the standard somatic cell hybridization technique described in Kohler and Milstein, Nature 256:495 (1975). While somatic cell hybridization procedures are preferred in principle, other techniques for producing monoclonal antibodies, such as viral or oncogenic transformation of B lymphocytes, or phage display techniques using antibody gene libraries, can also be used.

[0207] The preferred animal strain for preparing hybridomas that secrete monoclonal antibodies is the mouse strain. Hybridoma production in mice is a well-established procedure. Immunization protocols and techniques for isolating immunized splenocytes for fusion are known in the art. Fusion partners (e.g., mouse myeloma cells) and fusion procedures are also known.

[0208] Other preferred animal systems for preparing hybridomas that secrete monoclonal antibodies are rat and rabbit systems (see, for example, Spieker-Polet et al., Proc.Natl.Acad.Sci.USA92:9348 (1995), and also Rossi et al., Am.J.Clin.Pathol.124:295 (2005)).

[0209] In yet another preferred embodiment, human monoclonal antibodies can be produced using transgenic or transchromosomal mice that carry a portion of the human immune system rather than a mouse lineage. These transgenic and transchromosomal mice include mice known as HuMAb mice and KM mice, respectively, and are collectively referred to herein as “transgenic mice.” Production of human antibodies in such transgenic mice can be carried out as detailed with respect to CD20 in International Publication No. 2004 035607.

[0210] Another strategy for producing monoclonal antibodies is to directly isolate the antibody-coding gene from lymphocytes that produce antibodies of defined specificities; see, for example, Babcock et al., 1996; A novel strategy for generating monoclonal antibodies from single, isolated lymphocytes producing antibodies of defined specificities. For further details on recombinant antibody engineering, see also Welschof and Kraus, Recombinant antibodydes for cancer therapy ISBN-0-89603-918-8 and Benny KCLo Antibody Engineering ISBN 1-58829-092-1.

[0211] To produce antibodies, mice can be immunized with, as described, carrier-bound peptides derived from an antigen sequence, i.e., the sequence against which antibodies should be directed, concentrated preparations of recombinantly expressed antigens or fragments thereof, and / or cells expressing the antigen. Alternatively, mice can be immunized with DNA encoding the antigen or fragments thereof. If immunization using purified or concentrated preparations of the antigen does not yield antibodies, mice can also be immunized with cells expressing the antigen, such as cell lines, to promote an immune response.

[0212] Plasma and serum samples obtained by tail vein or retroorbital blood collection can be used to monitor the immune response throughout the course of the immunization protocol. Mice with sufficient immunoglobulin titers can be used for fusion. Three days before sacrificial death and splenectomy, mice can be boosted with antigen-expressing cells intraperitoneally or intravenously to increase the proportion of hybridomas secreting specific antibodies.

[0213] To produce hybridomas that produce monoclonal antibodies, splenocytes and lymph node cells from immunized mice can be isolated and fused to suitable immortalized cell lines, such as mouse myeloma cell lines. The resulting hybridomas can then be screened for antigen-specific antibody production. Individual wells can then be screened by ELISA for antibody-secreting hybridomas. Antibodies with specificity to the antigen can be identified by immunofluorescence and FACS analysis using antigen-expressing cells. Antibody-secreting hybridomas can be reseeded and screened again; if monoclonal antibodies remain positive, they can be subcloned by limiting dilution. Stable subclones can then be cultured in vitro to generate antibodies in tissue culture medium for characterization.

[0214] Antibodies can also be produced in host cell transfectomas using, for example, a combination of recombinant DNA technology and gene transfection methods well known in the art (Morrison, S. (1985) Science 229:1202).

[0215] For example, in one embodiment, one or more genes of interest, such as antibody genes, can be ligated to an expression vector, such as a eukaryotic expression plasmid, as used by the GS gene expression system disclosed in International Publication No. 87 / 04462, International Publication No. 89 / 01036, and European Patent No. 338841, or other expression systems well known in the art. The purified plasmid containing the cloned antibody gene can be introduced into eukaryotic host cells such as CHO cells, NS / O cells, HEK293T cells, or HEK293 cells, or other eukaryotic cells such as plant-derived cells, fungal or yeast cells. The method used to introduce these genes may be one of the methods described in the art, such as electroporation, lipofectin, or lipofectamine. After introducing these antibody genes into host cells, cells expressing the antibody can be identified and selected. These cells are transfectomas, and their expression levels can then be amplified and scaled up to produce antibodies. Recombinant antibodies can be isolated and purified from these culture supernatants and / or cells.

[0216] Alternatively, the cloned antibody gene can be expressed in other expression systems, including prokaryotic cells such as E. coli. Furthermore, antibodies can be produced in transgenic non-human animals such as sheep and rabbit milk or chicken eggs, or in transgenic plants; see, for example, Verma, R., et al. (1998) J.Immunol.Meth. 216:165-181; Pollock, et al. (1999) J.Immunol.Meth. 231:147-157; and Fischer, R., et al. (1999) Biol.Chem. 380:825-839.

[0217] Chimera transformation Mouse monoclonal antibodies, when labeled with toxins or radioisotopes, can be used as therapeutic antibodies in humans. Unlabeled mouse antibodies, when repeatedly applied, are highly immunogenic in humans, leading to reduced therapeutic efficacy. The main immunogenicity is mediated by the heavy chain constant region. The immunogenicity of mouse antibodies in humans can be reduced or completely avoided if the respective antibodies are chimeric or humanized. A chimeric antibody is an antibody whose different parts originate from different animal species, for example, an antibody having a variable region derived from a mouse antibody and a human immunoglobulin constant region. Antibody chimerization is achieved by ligating the variable regions of the heavy and light chains of a mouse antibody with the constant regions of the heavy and light chains of a human antibody (as described, for example, in Kraus et al., Methods in Molecular Biology series, Recombinant antibody for cancer therapy ISBN-0-89603-918-8). In a preferred embodiment, the chimeric antibody is produced by ligating the human κ light chain constant region with the mouse light chain variable region. In another preferred embodiment, chimeric antibodies can be produced by ligating a human λ light chain constant region to a mouse light chain variable region. Preferred heavy chain constant regions for the production of chimeric antibodies are IgG1, IgG3, and IgG4. Other preferred heavy chain constant regions for the production of chimeric antibodies are IgG2, IgA, IgD, and IgM.

[0218] Humanization Antibodies interact with target antigens primarily through amino acid residues located in six heavy and light chain complementarity-determining regions (CDRs). For this reason, amino acid sequences within CDRs are more diverse among individual antibodies than sequences outside of CDRs. Since CDR sequences are involved in most antibody-antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific native antibodies by constructing expression vectors containing CDR sequences from specific native antibodies transplanted into framework sequences from different antibodies with different properties (see, for example, Riechmann, L. et al. (1998) Nature 332:323-327; Jones, P. et al. (1986) Nature 321:522-525; and Queen, C. et al. (1989) Proc. Natl. Acad. Sci. USA 86:10029-10033). Such framework sequences can be obtained from public DNA databases containing germline antibody gene sequences. These germline sequences differ from mature antibody gene sequences because they do not contain fully constructed variable genes formed by V(D)J junctions during B cell maturation. The germline gene sequences also differ individually and uniformly from the sequences of high-affinity secondary repertory antibodies across the entire variable region.

[0219] The ability of an antibody to bind to an antigen can be determined using standard binding assays (e.g., ELISA, Western blotting, immunofluorescence, and flow cytometry).

[0220] To purify the antibody, the selected hybridoma can be grown in a 2-liter spinner flask for monoclonal antibody purification. Alternatively, the antibody can be produced in a dialysis-based bioreactor. The supernatant can be filtered and, if necessary, concentrated before affinity chromatography using protein G-Sepharose or protein A-Sepharose. The eluted IgG can be confirmed by gel electrophoresis and high-performance liquid chromatography to ensure purity. The buffer can be replaced with PBS, and the concentration can be determined by OD280 using an extinction coefficient of 1.43. The monoclonal antibody can be aliquoted and stored at -80°C.

[0221] Site-specific or multi-site-specific mutagenesis can be used to determine whether the selected monoclonal antibody binds to a specific epitope.

[0222] To determine the antibody isotype, isotyping ELISA can be performed using various commercially available kits (e.g., Zymed, Roche Diagnostics). Wells on a microtita plate can be coated with anti-mouse Ig. After blocking, the plate is reacted with monoclonal antibody or purified isotyping control at ambient temperature for 2 hours. The wells can then be reacted with either mouse IgG1, IgG2a, IgG2b, or IgG3, IgA, or mouse IgM-specific peroxidase-binding probes. After washing, the plate can be developed with ABTS substrate (1 mg / ml) and analyzed at an OD of 405–650. Alternatively, the IsoStrip Mouse Monoclonal Antibody Isotyping Kit (Roche, catalog no. 1493027) can be used, as described by the manufacturer.

[0223] Flow cytometry can be used to demonstrate the presence of antibodies in the serum of immunized mice or the binding of monoclonal antibodies to living cells expressing the antigen. Cell lines that express the antigen naturally or after transfection, and negative controls lacking antigen expression (grown under standard growth conditions), can be mixed with various concentrations of monoclonal antibodies in hybridoma supernatant or PBS containing 1% FBS and incubated at 4°C for 30 minutes. After washing, APC or Alexa647-labeled anti-IgG antibodies can be bound to antigen-binding monoclonal antibodies under the same conditions as primary antibody staining. Samples can be analyzed by flow cytometry using a FACS instrument that uses light and lateral scattering properties to gate single living cells. To distinguish antigen-specific monoclonal antibodies from non-specific binding antibodies in a single measurement, a simultaneous transfection method can be used. Cells transiently transfected with plasmids encoding the antigen and a fluorescent marker can be stained as described above. Transfected cells can be detected with different fluorescence channels than antibody-stained cells. Since the majority of transfected cells express both transgenes, antigen-specific monoclonal antibodies selectively bind to cells expressing the fluorescent marker, while non-specific antibodies bind to non-transfected cells at a similar rate. In addition to or instead of flow cytometry assays, alternative assays using fluorescence microscopy may be used. Cells can be accurately stained as described above and examined by fluorescence microscopy.

[0224] Immunofluorescence microscopy can be used to demonstrate the presence of antibodies in the serum of immunized mice, or the binding of monoclonal antibodies to living cells expressing an antigen. For example, cell lines that spontaneously or post-transfection express the antigen and negative controls lacking antigen expression are grown in chamber slides under standard growth conditions in DMEM / F12 medium supplemented with 10% fetal bovine serum (FCS), 2 mM L-glutamine, 100 IU / ml penicillin, and 100 μg / ml streptomycin. The cells can then be fixed with methanol or paraformaldehyde, or left untreated. Next, the cells can be reacted with a monoclonal antibody against the antigen at 25°C for 30 minutes. After washing, the cells can be reacted with Alexa555-labeled anti-mouse IgG secondary antibody (Molecular Probes) under the same conditions. The cells can then be examined by fluorescence microscopy.

[0225] Cell extracts from antigen-expressing cells and appropriate negative controls can be prepared and subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. After electrophoresis, the separated antigens are transferred to a nitrocellulose membrane, blocked, and probed with the monoclonal antibody to be tested. IgG binding can be detected using anti-mouse IgG peroxidase and developed with an ECL substrate.

[0226] Antibodies can be further tested for reactivity with antigens by immunohistochemistry using methods well known to those skilled in the art, for example, using paraformaldehyde or acetone-fixed frozen sections or paraformaldehyde-fixed paraffin-embedded tissue sections from non-cancerous or cancerous tissue samples obtained from patients during routine surgical procedures or from mice carrying xenograft tumors inoculated with cell lines expressing the antigen spontaneously or after transfection. For immunostaining, antibodies reactive to the antigen can be incubated, followed by incubation with horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit antibody (DAKO) according to the distributor's instructions.

[0227] Antibodies can be tested for their ability to mediate phagocytosis and death of cells expressing tumor antigens. Testing monoclonal antibody activity in vitro provides initial screening before testing in vivo models.

[0228] Antibody-dependent cell-mediated cytotoxicity (ADCC): In short, polymorphonuclear cells (PMNs), NK cells, monocytes, mononuclear cells, or other effector cells derived from healthy donors can be purified by Ficoll Hypaque density centrifugation followed by lysis of contaminating red blood cells. The washed effector cells are suspended in RPMI supplemented with 10% heat-inactivated fetal bovine serum or 5% heat-inactivated human serum, and tumor antigens are expressed in various ratios of effector cells to target cells. 51 It can be mixed with Cr-labeled target cells. Alternatively, the target cells can be labeled with a fluorescence-enhancing ligand (BATDA). The highly fluorescent chelate of europium with the enhancing ligand released from dead cells can be measured by fluoroscopy. Another alternative technique can utilize transfection of target cells with luciferase. The added Lucifer Yellow can then be oxidized only by living cells. Purified antitumor antigen IgG can then be added at various concentrations. Unrelated human IgG can be used as a negative control. The assay can be carried out at 37°C for 4 to 20 hours, depending on the type of effector cells used. The sample is 51 Cell lysis can be assayed by measuring Cr release or the presence of EuTDA chelates in the culture supernatant. Alternatively, the luminescence resulting from the oxidation of Lucifer Yellow may be an indicator of viable cells.

[0229] By testing various combinations of antitumor antigen monoclonal antibodies, it is also possible to determine whether cell lysis is enhanced by multiple monoclonal antibodies.

[0230] Antibody-dependent cellular phagocytosis (ADCP): In short, the classical ADCP assay is based on using macrophages derived from peripheral blood mononuclear cells (PBMCs) as effector cells. After extraction of fresh human PBMCs, monocytes can be isolated and differentiated into macrophages during culture. Phagocytic events can be analyzed using FACS screening, and dose-dependent curves can be created to evaluate ADCP potency in detail. Effector cells from different donors cannot be pooled due to MHC constraints. Therefore, to reduce donor-specific variability, samples from a range of donors must be applied.

[0231] Complement-dependent cell-mediated cytotoxicity (CDC): Monoclonal antitumor antigen antibodies can be tested for their ability to mediate CDC using various known techniques. For example, serum for complement can be obtained from blood by methods known to those skilled in the art. Various methods can be used to determine the CDC activity of mAbs. For example 51 Cr release can be measured, or increased membrane permeability can be evaluated using a propidium iodide (PI) exclusion assay. In short, target cells can be washed, 5 × 10⁶ 5 Cells / ml can be incubated with various concentrations of mAbs at room temperature or 37°C for 10-30 minutes. Then, serum or plasma can be added to a final concentration of 20% (v / v), and the cells can be incubated at 37°C for 20-30 minutes. All cells from each sample can be added to the PI solution in a FACS tube. The mixture can then be immediately analyzed by flow cytometry using a FACS array.

[0232] Another assay can determine the induction of CDC on adherent cells. In one embodiment of this assay, cells are placed in a tissue culture flat-bottom microtiter plate in a 3 × 10⁶ layer 24 hours before the assay. 4Seed cells at a density of cells / well. The following day, remove the growth medium and incubate the cells in triplicates with the antibody. To determine background lysis and maximum lysis, control cells are incubated with growth medium or growth medium containing 0.2% saponin, respectively. After incubation at room temperature for 20 minutes, remove the supernatant and add 20% (v / v) human plasma or serum in DMEM (preheated to 37°C) to the cells, and incubate for a further 20 minutes at 37°C. Add all cells from each sample to propidium iodide solution (10 μg / ml). Then, replace the supernatant with PBS containing 2.5 μg / ml ethidium bromide and measure the fluorescence emission at 600 nm when excited at 520 nm using a Tecan Safire. Calculate the specific lysis percentage as follows: Specific lysis % = (fluorescent sample - fluorescence background) / (maximum fluorescence lysis - fluorescence background) × 100.

[0233] Induction of apoptosis and inhibition of cell proliferation by monoclonal antibodies: To test the ability to initiate apoptosis, monoclonal antitumor antigen antibodies can be incubated, for example, with tumor antigen-positive tumor cells or tumor antigen-transfected tumor cells at 37°C for approximately 20 hours. The cells can be harvested, washed with Annexin V-binding buffer (BD Biosciences), and incubated in the dark for 15 minutes with Annexin V (BD Biosciences) conjugated with FITC or APC. All cells from each sample can be added to PI solution (10 μg / ml in PBS) in a FACS tube and immediately evaluated by flow cytometry (as described above). Alternatively, general inhibition of cell proliferation by monoclonal antibodies can be detected using commercially available kits. The DELFIA Cell Proliferation Kit (Perkin-Elmer, catalog no. AD0200) is a non-isotope immunoassay based on the measurement of 5-bromo-2'-deoxyuridine (BrdU) uptake during DNA synthesis in proliferating cells in a microplate. The uptaken BrdU is detected using a europium-labeled monoclonal antibody. To enable antibody detection, cells are fixed and DNA is denatured using Fix solution. Unbound antibodies are washed away, and a DELFIA inducer is added to dissociate europium ions from the labeled antibody into solution, where they form highly fluorescent chelates with the components of the DELFIA inducer. The fluorescence, measured using time-resolved fluorescence assays in detection, is proportional to DNA synthesis in the cells of each well.

[0234] Preclinical trials Monoclonal antibodies that bind to tumor antigens can also be tested in vivo models (e.g., cell lines that express tumor antigens or express tumor antigens after transfection, e.g., immunodeficient mice carrying xenograft tumors inoculated with HEK293) to determine their effectiveness in controlling the proliferation of tumor cells expressing tumor antigens.

[0235] In vivo studies following xenotransplantation of tumor cells expressing tumor antigens into immunodeficient mice or other animals can be performed using the antibodies described herein. The antibodies can be administered to tumor-free mice, followed by injection of tumor cells, to measure the effect of the antibodies in preventing tumor formation or tumor-related symptoms. The antibodies can be administered to tumor-bearing mice to determine the therapeutic effect of each antibody in reducing tumor growth, metastasis, or tumor-related symptoms. Antibody application can be combined with the application of other substances, such as immune checkpoint inhibitors, cell proliferation inhibitors, growth factor inhibitors, cell cycle blockers, angiogenesis inhibitors, or other antibodies, to determine the efficacy and potential toxicity of the combination. To analyze antibody-mediated toxic side effects, animals can be inoculated with the antibody or a control reagent and thoroughly investigated for symptoms that may be associated with tumor antigen antibody therapy. Possible side effects of in vivo application of tumor antigen antibodies include, in particular, toxicity in tumor antigen-expressing tissues, including the stomach. Antibodies that recognize tumor antigens in humans and other species, such as mice, are particularly useful in predicting potential side effects mediated by the application of monoclonal tumor antigen antibodies in humans.

[0236] Mapping of antibody-recognized epitopes can be performed as detailed in "Epitope Mapping Protocols (Methods in Molecular Biology)" by Glenn E. Morris (ISBN-089603-375-9) and "Epitope Mapping: A Practical Approach" by Olwyn MrWestwood and Frank C. Hay (Practical Approach Series 248).

[0237] As used herein, “tumor antigen” or “cancer antigen” includes (i) tumor-specific antigens, (ii) tumor-associated antigens, (iii) embryonic antigens on tumors, (iv) tumor-specific membrane antigens, (v) tumor-associated membrane antigens, (vi) growth factor receptors, and (xi) any other type of antigen or substance associated with cancer.

[0238] The therapeutic antibodies that can be used in accordance with the present invention include, but are not limited to, any anticancer antibodies that are approved for use, in clinical trials, or under development for clinical use, or that are recognized in the art. In certain embodiments, multiple anticancer antibodies may be included in the combination therapy of the present invention.

[0239] For example, the following tumor antigens can be targeted by the therapeutic antibodies disclosed herein.

[0240] Tumor antigens may include epithelial cancer antigens (e.g., breast cancer, gastrointestinal cancer, lung cancer), prostate-specific cancer antigen (PSA) or prostate-specific membrane antigen (PSMA), bladder cancer antigen, lung cancer (e.g., small cell lung cancer) antigen, colon cancer antigen, ovarian cancer antigen, brain cancer antigen, gastric cancer antigen, renal cell carcinoma antigen, pancreatic cancer antigen, liver cancer antigen, esophageal cancer antigen, head and neck cancer antigen, or colorectal cancer antigen. In certain embodiments, tumor antigens may include lymphoma antigens (e.g., non-Hodgkin lymphoma or Hodgkin lymphoma), B-cell lymphoma cancer antigen, leukemia antigen, myeloma (e.g., multiple myeloma or plasmacytosis myeloma) antigen, acute lymphoblastic leukemia antigen, chronic myeloid leukemia antigen, or acute myeloid leukemia antigen. The tumor antigens described are illustrative examples, and it should be understood that any tumor antigen can be targeted according to the present invention.

[0241] Tumor antigens are well known in the art and include those described herein. Tumor antigens include, for example, glioma-associated antigens, carcinoembryonic antigens (CEA), β-human chorionic gonadotropins, alpha-fetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxyesterase, and mut. This may include hsp70-2, M-CSF, prostase, prostate-specific antigen (PSA), PAP, NY-ESO-1, LAGE-LA, p53, tyrosinase, prostain, PSMA, ras, Her2 / neu, TRP-1, TRP-2, TAG-72, KSA, CA-125, PSA, BRCI, BRC-II, bcr-abl, pax3-fkhr, ews-fli-l, survivorbin and telomerase, prostate cancer tumor antigen 1 (PCTA-1), MAGE, GAGE, GP-100, MUC-1, MUC-2, ELF2M, neutrophil elastase, ephrin B2, CD22, insulin growth factor (IGF)-I, IGF-II, IGF-I receptor, VEGF, claudin molecules such as claudin 18 isoform 2 and claudin 6, and mesothelin.

[0242] Tumor antigens can be unique antigens (usually caused by mutations) (e.g., p53, ras, β-catenin, CDK4, CDC27, α-actinin 4), differentiation antigens (e.g., tyrosinase, TRP1 / gp75, TRP2, gp100, Melan-A / MART1, ganglioside, PSMA), overexpression antigens (e.g., HER2, WT1, EphA3, EGFR, CD20), cancer testicular antigens (e.g., MAGE, BAGE, GAGE, NY-ESO-1), or universal antigens (e.g., telomerase, survivorin).

[0243] Tumor antigens can also be tumor-specific antigens (TSAs) or tumor-associated antigens (TAAs). TSAs are unique to tumor cells and are not present on other cells in the body. TAAs are not unique to tumor cells and are expressed on normal cells under conditions that do not induce a state of immune tolerance to the antigen. Antigen expression on tumors can occur under conditions that allow the immune system to respond to the antigen. TAAs may be antigens expressed on normal cells during fetal development when the immune system is immature and unable to respond, or they may be antigens that are usually present at very low levels on normal cells but are expressed at much higher levels on tumor cells.

[0244] Non-exclusive examples of anti-cancer antibodies include, but are not limited to, the following: Trastuzumab (HERCEPTIN®; target: HER2 / neu) is used to treat HER-2 / neu-positive breast cancer or metastatic breast cancer. Bevacizumab (AVASTIN®; target: VEGF-A) is used to treat colorectal cancer, metastatic colorectal cancer, breast cancer, metastatic breast cancer, non-small cell lung cancer, or renal cell carcinoma. Rituximab (RITUXAN®; target: CD20) is used to treat non-Hodgkin lymphoma or chronic lymphocytic leukemia. Pertuzumab (OMNITARG®; target: HER2 / neu), used to treat breast cancer, prostate cancer, non-small cell lung cancer, or ovarian cancer. Cetuximab (ERBITUX®; target: EGFR) can be used to treat colorectal cancer, metastatic colorectal cancer, lung cancer, head and neck cancer, colon cancer, breast cancer, prostate cancer, stomach cancer, ovarian cancer, brain cancer, pancreatic cancer, esophageal cancer, renal cell carcinoma, prostate cancer, cervical cancer, or bladder cancer. Tositumomab (BEXXAR®; target: CD20) is used to treat non-Hodgkin lymphoma and follicular non-Hodgkin lymphoma. Ofatumumab (ARZERRA®; target: CD20) for chronic lymphocytic leukemia Panitumumab (VECTIBIX®; target: EGFR) for colorectal cancer Alemtuzumab (CAMPATH®; target: CD52) for chronic lymphocytic leukemia Obinutuzumab (Gazyva®; target: CD20) for chronic lymphocytic leukemia.

[0245] chemotherapy In addition to immunotherapy based on polypeptides containing IL2 or functional variants thereof, or polynucleotides encoding polypeptides containing IL2 or functional variants thereof, and antibodies against cancer, further treatments may be administered to the patient. Such further treatments include classic cancer treatments, such as radiotherapy, surgery, hyperthermia, and / or chemotherapy.

[0246] Chemotherapy is a type of cancer treatment that typically uses one or more anticancer drugs (chemotherapeutic agents) as part of a standardized chemotherapy regimen. The term chemotherapy has come to imply the nonspecific use of intracellular toxins to inhibit mitosis. This implied exclusion of more selective drugs that block extracellular signals (signaling). The development of therapies with specific molecules or gene targets that inhibit growth-promoting signals from classical endocrine hormones (primarily estrogen for breast cancer and androgens for prostate cancer) is now called hormone therapy. In contrast, other inhibitions of growth signals, such as those related to receptor tyrosine kinases, are called targeted therapies.

[0247] Importantly, the use of drugs (whether chemotherapy, hormone therapy, or targeted therapy) constitutes systemic therapy for cancer in that they are introduced into the bloodstream and, in principle, can address cancer at any anatomical location within the body. Systemic therapy is often used in combination with other modalities that constitute local therapy for cancer (i.e., treatments whose effectiveness is limited to the anatomical area to which it is applied), such as radiotherapy, surgery, or hyperthermia.

[0248] Traditional chemotherapy agents are cytotoxic by interfering with cell division (mitosis), but cancer cells vary greatly in their sensitivity to these drugs. For the most part, chemotherapy can be thought of as a way to damage or stress cells, and if apoptosis is initiated, it can lead to cell death.

[0249] Chemotherapy agents include alkylating agents, antimetabolites, antimicrotubule agents, topoisomerase inhibitors, and cytotoxic antibiotics.

[0250] Alkylating agents have the ability to alkylate many molecules, including proteins, RNA, and DNA. Subtypes of alkylating agents include nitrogen mustards, nitrosoureas, tetrazines, aziridines, cisplatins and their derivatives, as well as non-classical alkylating agents. Nitrogen mustards include mechloretamine, cyclophosphamide, melphalan, chlorambucil, ifosfamide, and busulfan. Nitrosoureas include N-nitroso-N-methylurea (MNU), carmustine (BCNU), lomustine (CCNU), semustine (MeCCNU), fotemustine, and streptozotocin. Tetrazines include dacarbazine, mitozolomide, and temozolomide. Aziridines include thiotepa, mitomycin, and diazicone (AZQ). Cisplatins and their derivatives include cisplatin, carboplatin, and oxaliplatin. These impair cellular function by forming covalent bonds with amino groups, carboxyl groups, sulfhydryl groups, and phosphate groups in biologically important molecules. Non-classical alkylating agents include procarbazine and hexamethylmelamine. In one particularly preferred embodiment, the alkylating agent is cyclophosphamide.

[0251] Antimetabolites are a group of molecules that interfere with the synthesis of DNA and RNA. Many of them have structures similar to the building blocks of DNA and RNA. Antimetabolites are similar to either nucleic acid bases or nucleosides, but have altered chemical groups. These drugs exert their effects by blocking enzymes necessary for DNA synthesis or by being incorporated into DNA or RNA. Subtypes of antimetabolites include folate antagonists, fluoropyrimidines, deoxynucleoside analogs, and thiopurines. Folate antagonists include methotrexate and pemetrexed. Fluoropyrimidines include fluorouracil and capecitabine. Deoxynucleoside analogs include cytarabine, gemcitabine, decitabine, azacitidine, fludarabine, nerarabine, cladribine, clofarabine, and pentostatin. Thiopurines include thioguanine and mercaptopurine.

[0252] Antimicrotubule agents inhibit cell division by interfering with microtubule function. Vinca alkaloids inhibit microtubule formation, while taxanes prevent microtubule degradation. Vinca alkaloids include vinorelbine, vindesine, and vinflunine. Taxanes include docetaxel (Taxotere) and paclitaxel (Taxol).

[0253] Topoisomerase inhibitors are drugs that affect the activity of two enzymes: topoisomerase I and topoisomerase II, and include irinotecan, topotecan, camptothecin, etoposide, doxorubicin, mitoxantrone, teniposide, novobiocin, melbaron, and acralubicin.

[0254] Cytotoxic antibiotics are a diverse group of drugs with various mechanisms of action. A common theme they share in their chemotropic applications is the disruption of cell division. The most important subgroups are anthracyclines (e.g., doxorubicin, daunorubicin, epirubicin, idarubicin, pirarubicin, and acralubicin) as well as bleomycin; other notable examples include mitomycin C, mitoxantrone, and actinomycin.

[0255] Immune checkpoint inhibitors In certain embodiments, immune checkpoint inhibitors are used in combination with other therapeutic agents described herein.

[0256] As used herein, “immune checkpoint” refers to co-stimulatory and inhibitory signals that modulate the magnitude and quality of immune cell activity, such as NK cell activity. In certain embodiments, the immune checkpoint is an inhibitory signal. In certain embodiments, the inhibitory signal is the interaction between PD-1 and PD-L1. In certain embodiments, the inhibitory signal is the interaction between CTLA-4 and CD80 or CD86, replacing CD28 binding. In certain embodiments, the inhibitory signal is the interaction between LAG3 and MHC class II molecules. In certain embodiments, the inhibitory signal is the interaction between TIM3 and galectin 9.

[0257] As used herein, “immune checkpoint inhibitor” refers to a molecule that completely or partially reduces, inhibits, interferes with or modulates one or more checkpoint proteins. In certain embodiments, an immune checkpoint inhibitor prevents an inhibitory signal associated with an immune checkpoint. In certain embodiments, an immune checkpoint inhibitor is an antibody or fragment thereof that interferes with an inhibitory signaling signal associated with an immune checkpoint. In certain embodiments, an immune checkpoint inhibitor is a small molecule that interferes with an inhibitory signaling signal. In certain embodiments, an immune checkpoint inhibitor is an antibody, fragment thereof, or antibody mimetic that interferes with the interaction between checkpoint blocking proteins, for example, an antibody or fragment thereof that interferes with the interaction between PD-1 and PD-L1. In certain embodiments, an immune checkpoint inhibitor is an antibody or fragment thereof that interferes with the interaction between CTLA-4 and CD80 or CD86. In certain embodiments, an immune checkpoint inhibitor is an antibody or fragment thereof that interferes with the interaction between LAG3 and its ligand, or between TIM-3 and its ligand. A checkpoint inhibitor may also be in the form of a soluble form of the molecule (or its variant) itself, for example, a soluble PD-L1 or PD-L1 fusion.

[0258] The “programmed death 1 (PD-1)” receptor refers to an immunosuppressive receptor belonging to the CD28 family. PD-1 is primarily expressed on previously activated T cells in vivo and binds to two ligands, PD-L1 and PD-L2. As used herein, the term “PD-1” includes human PD-1 (hPD-1), variants, isoforms, and species homologs of hPD-1, as well as analogs having at least one common epitope with hPD-1.

[0259] "Programmed death ligand 1 (PD-L1)" is one of two cell surface glycoprotein ligands of PD-1 (the other being PD-L2) that, upon binding to PD-1, downregulate T cell activation and cytokine secretion. As used herein, the term "PD-L1" includes human PD-L1 (hPD-L1), variants, isoforms, and species homologs of hPD-L1, as well as analogs having at least one common epitope with hPD-L1.

[0260] Cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) is an immune cell surface molecule and a member of the immunoglobulin superfamily. This protein downregulates the immune system by binding to CD80 and CD86. As used herein, the term "CTLA-4" includes human CTLA-4 (hCTLA-4), variants, isoforms, and species homologs of hCTLA-4, as well as analogs having at least one common epitope with hCTLA-4.

[0261] Lymphocyte-activating gene 3 (LAG3) is an inhibitory receptor associated with the inhibition of immune cell activity by binding to MHC class II molecules. This receptor enhances the function of Treg cells and inhibits the function of CD8+ effector T cells. As used herein, the term "LAG3" includes human LAG3 (hLAG3), variants, isoforms, and species homologs of hLAG3, as well as analogs having at least one common epitope.

[0262] T cell membrane protein 3 (TIM3) is an inhibitory receptor involved in inhibiting immune cell activity by inhibiting the TH1 cell response. Its ligand is galectin 9, which is upregulated in various types of cancer. As used herein, the term "TIM3" includes human TIM3 (hTIM3), variants, isoforms, and species homologs of hTIM3, as well as analogs having at least one common epitope.

[0263] The "B7 family" refers to inhibitory ligands for an undefined receptor. The B7 family includes B7-H3 and B7-H4, both of which are upregulated in tumor cells and tumor-infiltrating cells.

[0264] In certain embodiments, immune checkpoint inhibitors suitable for use in the methods disclosed herein are antibodies targeting inhibitory signal antagonists, such as PD-1, PD-L1, CTLA-4, LAG3, B7-H3, B7-H4, or TIM3. These ligands and receptors are reviewed in Pardoll, D., Nature. 12:252-264, 2012.

[0265] In certain embodiments, an immune checkpoint inhibitor is an antibody or its antigen-binding moiety that interferes with or inhibits signaling from inhibitory immunomodulators. In certain embodiments, an immune checkpoint inhibitor is a small molecule that interferes with or inhibits signaling from inhibitory immunomodulators.

[0266] In certain embodiments, inhibitory immunomodulators are components of the PD-1 / PD-L1 signaling pathway. Therefore, certain embodiments of the present disclosure provide the targeted administration of an antibody or its antigen-binding moiety that interferes with the interaction between the PD-1 receptor and its ligand, PD-L1. Antibodies that bind to PD-1 and interfere with the interaction between PD-1 and its ligand, PD-L1, are known in the art. In certain embodiments, the antibody or its antigen-binding moiety specifically binds to PD-1. In certain embodiments, the antibody or its antigen-binding moiety specifically binds to PD-L1, inhibiting its interaction with PD-1 and thereby increasing immune activity.

[0267] In certain embodiments, inhibitory immunomodulators are components of the CTLA4 signaling pathway. Accordingly, certain embodiments of the present disclosure provide targeted administration of antibodies or their antigen-binding moieties that target CTLA4 and interfere with its interaction with CD80 and CD86.

[0268] In certain embodiments, inhibitory immunomodulators are components of the LAG3 (lymphocyte activator gene 3) signaling pathway. Accordingly, certain embodiments of the present disclosure provide targeted administration of antibodies or their antigen-binding moieties that target LAG3 and interfere with its interaction with MHC class II molecules.

[0269] In certain embodiments, inhibitory immunomodulators are components of the B7 family signaling pathway. In certain embodiments, the B7 family members are B7-H3 and B7-H4. Accordingly, certain embodiments of this disclosure provide targeted administration of antibodies or their antigen-binding moieties that target B7-H3 or B7-H4. Although the B7 family does not have defined receptors, these ligands are upregulated in tumor cells or tumor-infiltrating cells. Preclinical mouse models have shown that blocking these ligands can enhance anti-tumor immunity.

[0270] In certain embodiments, inhibitory immunomodulators are components of the TIM3 (T cell membrane protein 3) signaling pathway. Accordingly, certain embodiments of the present disclosure provide targeted administration of an antibody or its antigen-binding moiety that targets TIM3 and interferes with its interaction with galectin 9.

[0271] It will be understood by those skilled in the art that other immune checkpoint targets can also be targeted by antagonists or antibodies, provided that the targeting results in stimulation of an immune response, such as an antitumor immune response, which may manifest as increased immune cell proliferation, enhanced immune cell activation, and / or increased cytokine production (e.g., IFN-γ, IL-2).

[0272] RNA targeting According to the present invention, the peptides, proteins, or polypeptides described herein, particularly the IL2 polypeptide and / or antibodies, are especially preferably administered in the form of RNA encoding the peptides, proteins, or polypeptides described herein. In one embodiment, different peptides, proteins, or polypeptides described herein are encoded by different RNA molecules.

[0273] In one embodiment, the RNA is formulated into a delivery vehicle. In one embodiment, the delivery vehicle contains particles. In one embodiment, the delivery vehicle contains at least one lipid. In one embodiment, the at least one lipid contains at least one cationic lipid. In one embodiment, the lipid forms a complex with the RNA and / or encapsulates the RNA. In one embodiment, the lipid is contained in a vesicle that encapsulates the RNA. In one embodiment, the RNA is formulated into liposomes.

[0274] According to this disclosure, after administration of the RNA described herein, at least a portion of the RNA is delivered to target cells. In one embodiment, at least a portion of the RNA is delivered to the cytosol of the target cells. In one embodiment, the RNA is translated by the target cells to produce an encoded peptide or protein.

[0275] Some aspects of this disclosure include targeted delivery of RNA disclosed herein (e.g., RNA encoding an IL2 polypeptide, RNA encoding an antibody).

[0276] RNA can be delivered by so-called lipoplex formulations, in which RNA binds to liposomes containing cationic lipids and optionally further lipids or helper lipids to form injectable nanoparticle formulations. Liposomes can be obtained by injecting a lipid solution in ethanol into water or a suitable aqueous phase. RNA lipoplex particles can be prepared by mixing liposomes with RNA.

[0277] In the context of this disclosure, the term “RNA lipoplex particles” refers to particles comprising lipids, particularly cationic lipids, and RNA. Electrostatic interactions between positively charged liposomes and negatively charged RNA result in the complexation and spontaneous formation of RNA lipoplex particles. Positively charged liposomes can generally be synthesized using cationic lipids such as DOTMA and further lipids such as DOPE. In one embodiment, the RNA lipoplex particles are nanoparticles.

[0278] As used herein, “cationic lipid” refers to a lipid that has a net positive charge. Cationic lipids bind negatively charged RNA to the lipid matrix through electrostatic interactions. Generally, cationic lipids have lipophilic moieties such as sterols, acyls, or diacyl chains, and the lipid head group is typically positively charged. Examples of cationic lipids include 1,2-di-O-octadecenyl-3-trimethylammoniumpropane (DOTMA), dimethyldioctadecylammonium (DDAB); 1,2-dioleoyl-3-trimethylammoniumpropane (DOTAP); 1,2-dioleoyl-3-dimethylammoniumpropane (DODAP); 1,2-diacyloxy-3-dimethylammoniumpropane; 1,2-dialkyloxy-3-dimethylammoniumpropane; dioctadecyldimethylammonium chloride (DODAC), 2,3-di(tetradecoxy)propane These include, but are not limited to, pyr-(2-hydroxyethyl)-dimethylazanium (DMRIE), 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC), 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), 1,2-dioleyloxypropyl-3-dimethylhydroxyethylammonium bromide (DORIE), and 2,3-dioleoyloxy-N-[2(sperminecarboxamide)ethyl]-N,N-dimethyl-1-propanamium trifluoroacetate (DOSPA). DOTMA, DOTAP, DODAC, and DOSPA are preferred. In certain embodiments, the cationic lipid is DOTMA and / or DOTAP.

[0279] Further lipids may be incorporated to adjust the overall positive-to-negative charge ratio and physical stability of the RNA lipoplex particles. In certain embodiments, the further lipids are neutral lipids. As used herein, “neutral lipids” refers to lipids having a net charge of zero. Examples of neutral lipids include, but are not limited to, 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramides, sphingomyelin, cephalin, cholesterol, and cerebrosides. In certain embodiments, the further lipids are DOPE, cholesterol, and / or DOPC.

[0280] In certain embodiments, the RNA lipoplex particles include both cationic lipids and further lipids. In exemplary embodiments, the cationic lipid is DOTMA and the further lipid is DOPE.

[0281] In some embodiments, the molar ratio of at least one cationic lipid to at least one further lipid is about 10:0 to about 1:9, about 4:1 to about 1:2, or about 3:1 to about 1:1. In certain embodiments, the molar ratio may be about 3:1, about 2.75:1, about 2.5:1, about 2.25:1, about 2:1, about 1.75:1, about 1.5:1, about 1.25:1, or about 1:1. In an exemplary embodiment, the molar ratio of at least one cationic lipid to at least one further lipid is about 2:1.

[0282] In one embodiment, the RNA lipoplex particles described herein have an average diameter in the range of about 200 nm to about 1000 nm, about 200 nm to about 800 nm, about 250 nm to about 700 nm, about 400 nm to about 600 nm, about 300 nm to about 500 nm, or about 350 nm to about 400 nm. In certain embodiments, RNA lipoplex particles have an average diameter of approximately 200 nm, approximately 225 nm, approximately 250 nm, approximately 275 nm, approximately 300 nm, approximately 325 nm, approximately 350 nm, approximately 375 nm, approximately 400 nm, approximately 425 nm, approximately 450 nm, approximately 475 nm, approximately 500 nm, approximately 525 nm, approximately 550 nm, approximately 575 nm, approximately 600 nm, approximately 625 nm, approximately 650 nm, approximately 700 nm, approximately 725 nm, approximately 750 nm, approximately 775 nm, approximately 800 nm, approximately 825 nm, approximately 850 nm, approximately 875 nm, approximately 900 nm, approximately 925 nm, approximately 950 nm, approximately 975 nm, or approximately 1000 nm. In one embodiment, RNA lipoplex particles have an average diameter in the range of approximately 250 nm to approximately 700 nm. In another embodiment, the RNA lipoplex particles have an average diameter in the range of about 300 nm to about 500 nm. In an exemplary embodiment, the RNA lipoplex particles have an average diameter of about 400 nm.

[0283] The charge of the RNA lipoplex particles of this disclosure is the sum of the charges present in at least one cationic lipid and the charges present in the RNA. The charge ratio is the ratio of the positive charges present in at least one cationic lipid to the negative charges present in the RNA. The charge ratio of the positive charges present in at least one cationic lipid to the negative charges present in the RNA is calculated by the following formula: Charge ratio = [(concentration of cationic lipid (mol)) * (total number of positive charges in cationic lipid)] / [(concentration of RNA (mol)) * (total number of negative charges in RNA)].

[0284] Cytokines, such as extended PK cytokines, and in particular extended PK interleukins as described herein, may be delivered to a subject by administering RNA encoding the cytokine in a formulation for selective delivery of RNA to the liver or liver tissue. Such delivery of RNA to a target organ or tissue is preferred, in particular, when it is desirable to express a large amount of cytokine and / or when systemic presence of cytokine, especially in significant amounts, is desired or required.

[0285] RNA delivery systems have a unique selectivity for the liver. This is related to lipid-based particles, cationic and neutral nanoparticles, and especially lipid nanoparticles such as liposomes, nanomicelles, and lipophilic ligands in bioconjugates. Hepatic accumulation is caused by the discontinuous nature of the hepatic vascular system or lipid metabolism (liposomes and lipid or cholesterol conjugates).

[0286] For in vivo delivery of RNA to the liver, drug delivery systems can be used to transport RNA to the liver by preventing its degradation. For example, polyplex nanomicelles, consisting of a poly(ethylene glycol) (PEG) coated surface and an mRNA-containing core, are a useful system because the nanomicelles provide excellent in vivo stability of RNA under physiological conditions. Furthermore, the stealth properties provided by the polyplex nanomicelle surface, composed of dense PEG palisades, effectively evade the host's immune defenses.

[0287] Pharmaceutical composition The agents described herein may be administered as pharmaceutical compositions or medicinal products, or in the form of any suitable pharmaceutical composition.

[0288] In one embodiment of all aspects of the present invention, components described herein, such as nucleic acids encoding cytokines (IL2) or antibodies together or separately, may be administered in a pharmaceutical composition that may include a pharmaceutically acceptable carrier and optionally include one or more adjuvants, stabilizers, etc. In one embodiment, the pharmaceutical composition is for therapeutic or prophylactic treatment, for example, for use in the treatment or prevention of antigen-related diseases such as cancer, as described herein.

[0289] The term "pharmaceutical composition" relates to a formulation comprising a therapeutically effective agent, preferably together with a pharmaceutically acceptable carrier, diluent, and / or excipient. The pharmaceutical composition is useful for treating, preventing, or reducing the severity of a disease or disorder by administering the pharmaceutical composition to a subject. Pharmaceutical compositions are also known in the art as pharmaceutical formulations.

[0290] The pharmaceutical compositions of this disclosure may comprise one or more adjuvants, or may be administered together with one or more adjuvants. The term “adjuvant” relates to a compound that prolongs, enhances, or accelerates an immune response. Adjuvants include a group of heterogeneous compounds such as oil emulsions (e.g., Freund’s adjuvants), inorganic compounds (e.g., alum), bacterial products (e.g., Bordetella pertussis toxin), or immune stimuli complexes. Examples of adjuvants include, but are not limited to, LPS, GP96, CpG oligodeoxynucleotides, growth factors, and cytokines such as monokines, lymphokines, interleukins, and chemokines. Cytokines may include IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL12, IL18, IFNα, IFNγ, GM-CSF, and LT-a. Further known adjuvants include aluminum hydroxide, Freund's adjuvant, or oils such as Montanide® ISA51. Other suitable adjuvants for use in this disclosure include lipopeptides such as Pam3Cys.

[0291] The pharmaceutical compositions described herein are generally applied in "pharmaceutically effective amounts" and "pharmaceutically acceptable formulations."

[0292] The term "pharmaceutically acceptable" refers to a non-toxic substance that does not interact with the action of the active ingredient in a pharmaceutical composition.

[0293] The terms “pharmaceutically effective amount” or “therapeutably effective amount” refer to the amount, alone or in combination with additional doses, that achieves the desired response or effect. In the case of treating a particular disease, the desired response preferably relates to inhibiting the course of the disease. This includes slowing the progression of the disease, in particular interrupting or reversing its progression. The desired response in the treatment of a disease may also be the delay or prevention of the onset of the disease or condition. The effective amount of the composition described herein depends on the individual parameters of the patient, including the condition being treated, the severity of the disease, age, physiological state, size and weight, the duration of treatment, the type of accompanying treatment (if any), the specific route of administration, and similar factors. Therefore, the dosage of the composition described herein may depend on such various parameters. If the patient’s response is insufficient with the initial dose, a higher dose (or an effectively higher dose achieved by a different, more localized route of administration) may be used.

[0294] The pharmaceutical compositions of this disclosure may comprise salts, buffers, preservatives, and optionally other therapeutic agents. In one embodiment, the pharmaceutical composition of this disclosure comprises one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0295] Suitable preservatives for use in the pharmaceutical compositions of this disclosure include, but are not limited to, benzalkonium chloride, chlorobutanol, parabens, and thimerosal.

[0296] As used herein, the term “excipient” refers to a substance that may be present in the pharmaceutical compositions of this disclosure but is not an active ingredient. Examples of excipients include, but are not limited to, carriers, binders, diluents, lubricants, thickeners, surfactants, preservatives, stabilizers, emulsifiers, buffers, flavoring agents, or colorants.

[0297] The term “diluent” refers to a substance used to dilute and / or reduce an agent. Furthermore, the term “diluent” includes one or more fluids, liquids, or solid suspensions and / or mixtures. Examples of suitable diluents include ethanol, glycerol, and water.

[0298] The term "carrier" refers to a component that may be natural, synthetic, organic, or inorganic, to which the active ingredient is combined to facilitate, enhance, or enable the administration of the pharmaceutical composition. As used herein, carriers may be one or more suitable solid or liquid fillers, diluents, or encapsulants suitable for administration to a target. Suitable carriers include, but are not limited to, sterile water, Ringer's solution, Ringer's lactate solution, sterile sodium chloride solution, isotonic saline, polyalkylene glycol, hydrogenated naphthalene, and in particular biocompatible lactide polymers, lactide / glycolide copolymers, or polyoxyethylene / polyoxypropylene copolymers. In one embodiment, the pharmaceutical composition of this disclosure contains isotonic saline.

[0299] Pharmacopoeia-acceptable carriers, excipients, or diluents for therapeutic use are well known in the pharmaceutical field and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (AR Gennaro edit. 1985).

[0300] The pharmaceutical carrier, excipient, or diluent may be selected in relation to the intended route of administration and standard pharmaceutical practices.

[0301] In one embodiment, the pharmaceutical composition described herein may be administered intravenously, intra-arterially, subcutaneously, intradermally, or intramuscularly. In certain embodiments, the pharmaceutical composition is formulated for topical or systemic administration. Systemic administration may include enteral administration, including absorption through the gastrointestinal tract, or parenteral administration. As used herein, “parenteral administration” refers to administration by any method other than through the gastrointestinal tract, such as intravenous injection. In a preferred embodiment, the pharmaceutical composition is formulated for systemic administration. In another preferred embodiment, systemic administration is by intravenous administration.

[0302] As used herein, the term “simultaneous administration” means the process of administering different compounds or compositions (e.g., RNA encoding an IL2 polypeptide and an antibody) to the same patient. The different compounds or compositions may be administered simultaneously, essentially simultaneously, or sequentially. In one embodiment, the IL2 polypeptide or nucleic acid encoding the IL2 polypeptide is administered first, followed by the antibody.

[0303] treatment The agents, compositions, and methods described herein can be used to treat subjects having diseases, for example, diseases characterized by the presence of disease cells expressing antigens. Particularly preferred diseases are cancerous diseases, in particular cancerous diseases in which cancer cells express tumor antigens.

[0304] The term "disease" refers to an abnormal condition affecting an individual's body. A disease is often interpreted as a medical condition associated with specific symptoms and signs. Diseases can be caused by external factors, such as infections, or by internal dysfunctions, such as autoimmune diseases. In humans, "disease" is often more broadly used to refer to a condition that causes pain, impairment, suffering, social problems, or death in the affected individual, or similar problems in those in contact with the individual. In this broader sense, disease sometimes includes injury, helplessness, disability, syndrome, infection, solitary symptoms, deviant behavior, and atypical changes in structure and function, although in other contexts and for other purposes, these may be considered distinct categories. Many diseases, and living with them, can alter one's worldview and personality, so diseases usually affect individuals not only physically but also emotionally.

[0305] In this context, the terms “treatment,” “to treat,” or “therapeutic intervention” refer to the management and care of an individual aimed at combating a condition such as a disease or disorder. The term is intended to encompass all forms of treatment for a given condition in which an individual is afflicted, including the administration of therapeutically effective compounds to alleviate symptoms or complications, to slow the progression of a disease, disorder or condition, to alleviate or reduce symptoms and complications, and / or to cure or eliminate a disease, disorder or condition, and to prevent the condition, where prevention should be understood as the management and care of an individual aimed at combating a disease, condition or disorder, and includes the administration of active compounds to prevent the onset of symptoms or complications.

[0306] The term “therapeutic treatment” refers to any treatment that improves the health of an individual and / or extends (increases) their lifespan. Such treatment may eliminate a disease in an individual, stop or delay the onset of a disease in an individual, inhibit or delay the onset of a disease in an individual, reduce the frequency or severity of a disease in an individual, and / or reduce recurrence in an individual who currently has or has previously had a disease.

[0307] The terms “preventive measures” or “preventive measures” refer to any treatment intended to prevent the development of disease in an individual. The terms “preventive measures” and “preventive measures” are used interchangeably herein.

[0308] The terms “individual” and “subject” are used interchangeably herein. They refer to a human or other mammal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate) that is susceptible to, but may or may not have, a disease or disorder (e.g., cancer). In many embodiments, the individual is a human. Unless otherwise specified, the terms “individual” and “subject” do not indicate a specific age and therefore encompass adults, the elderly, children, and newborns. In embodiments of this disclosure, the “individual” or “subject” is a “patient.”

[0309] The term "patient" means an individual or subject for treatment, in particular an individual or subject that is afflicted.

[0310] As used herein, “immune response” refers to the integrated bodily response to an antigen or an antigen-expressing cell, and includes cellular and / or humoral immune responses.

[0311] The terms "cell-mediated immunity," "cellular immunity," "cellular immune response," or similar terms are intended to include cellular responses directed towards cells characterized by antigen expression, particularly those characterized by antigen presentation by class I or class II MHC. The cellular response relates to cells called T cells or T lymphocytes that act as either "helper" or "killer" cells. Helper T cells (CD4 + T cells (also called T cells) play a central role in regulating the immune response, and killer cells (cytotoxic T cells, cytolytic T cells, CD8) + T cells (also known as CTLs) kill disease cells such as cancer cells and prevent the production of further disease cells.

[0312] The term "immunotherapy" refers to the treatment of a disease or condition by inducing or enhancing an immune response. The term "immunotherapy" includes antigen immunization or antigen vaccination.

[0313] The terms "immunization" or "vaccination" refer to the process of administering an antigen to an individual for the purpose of inducing an immune response, for example, for therapeutic or preventive reasons.

[0314] The term "macrophage" refers to a subgroup of phagocytic cells produced by the differentiation of monocytes. Activated by inflammation, immune cytokines, or microbial products, macrophages nonspecifically engulf foreign pathogens within the macrophage and kill them through hydrolytic and oxidative attacks that lead to the breakdown of pathogens. Peptides from the degraded proteins are displayed on the surface of macrophage cells, which can be recognized by T cells and directly interact with antibodies on the surface of B cells, leading to the activation of T and B cells and further stimulation of the immune response. Macrophages belong to the class of antigen-presenting cells. In one embodiment, the macrophage is a splenic macrophage.

[0315] The term “dendritic cell” (DC) refers to another subtype of phagocytic cell belonging to the class of antigen-presenting cells. In one embodiment, dendritic cells originate from hematopoietic bone marrow progenitor cells. These progenitor cells first differentiate into immature dendritic cells. These immature cells are characterized by high phagocytic activity and low T-cell activation ability. Immature dendritic cells constantly sample the surrounding environment for pathogens such as viruses and bacteria. When they come into contact with presentable antigens, they are activated and become mature dendritic cells, and begin to migrate to the spleen or lymph nodes. Immature dendritic cells phagocytose pathogens, breaking down their proteins into small fragments, and upon maturation, they use MHC molecules to present these fragments on their cell surface. At the same time, they upregulate cell surface receptors that act as co-receptors in T-cell activation, such as CD80, CD86, and CD40, greatly enhancing their ability to activate T cells. They also upregulate CCR7, a chemotactic receptor that induces dendritic cells to migrate through the bloodstream to the spleen or through the lymphatic system to the lymph nodes. Here, they act as antigen-presenting cells, activating helper T cells, killer T cells, and B cells by presenting antigens along with non-antigen-specific costimulatory signals. Therefore, dendritic cells can actively induce immune responses related to T cells or B cells. In one embodiment, the dendritic cells are splenic dendritic cells.

[0316] The term "antigen-presenting cell" (APC) refers to one of the various cells that can display, acquire, and / or present at least one antigen or antigen fragment on (or on) its cell surface. Antigen-presenting cells can be distinguished into professional antigen-presenting cells and non-professional antigen-presenting cells.

[0317] The term "professional antigen-presenting cells" refers to antigen-presenting cells that constitutively express major histocompatibility complex class II (MHC class II) molecules necessary for interaction with naive T cells. When T cells interact with the MHC class II molecular complex on the membrane of antigen-presenting cells, the antigen-presenting cells produce costimulatory molecules that induce T cell activation. Professional antigen-presenting cells include dendritic cells and macrophages.

[0318] The term "non-professional antigen-presenting cells" refers to antigen-presenting cells that do not constitutively express MHC class II molecules but express them in response to stimulation by certain cytokines, such as interferon-gamma. Exemplary non-professional antigen-presenting cells include fibroblasts, thymic epithelial cells, thyroid epithelial cells, glial cells, pancreatic beta cells, or vascular endothelial cells.

[0319] "Antigen processing" refers to the breakdown of an antigen into processing products which are fragments of the antigen (e.g., breakdown of a protein into peptides), and the association (e.g., by binding) of an MHC molecule with one or more of these fragments for presentation to specific T cells by a cell such as an antigen-presenting cell.

[0320] The term "antigen-related disease" refers to any disease that involves an antigen, such as a disease characterized by the presence of an antigen. An antigen-related disease may be a cancerous disease or simply cancer. As described above, the antigen may be a disease-related antigen, such as a tumor-related antigen. In one embodiment, an antigen-related disease is preferably a disease involving cells that express the antigen on their cell surface.

[0321] The terms “cancer disease” or “cancer” refer to or represent a physiological condition of an individual typically characterized by uncontrolled cell proliferation. Examples of cancer include, but are not limited to, carcinomas, lymphomas, blastomas, sarcomas, and leukemias. More specifically, examples of such cancers include bone cancers, hematological cancers, lung cancers, liver cancers, pancreatic cancers, skin cancers, head and neck cancers, cutaneous or intraocular melanomas, uterine cancers, ovarian cancers, rectal cancers, anal cancers, gastric cancers, colon cancers, breast cancers, prostate cancers, uterine cancers, genital and reproductive cancers, Hodgkin's disease, esophageal cancers, small intestine cancers, endocrine cancers, thyroid cancers, parathyroid cancers, adrenal cancers, soft tissue sarcomas, bladder cancers, kidney cancers, renal cell carcinomas, renal pelvis cancers, neoplasms of the central nervous system (CNS), neuroectodermal carcinomas, spinal axial tumors, gliomas, meningiomas, and pituitary adenomas. The term “cancer” as used in this disclosure also includes cancer metastases.

[0322] The references to documents and tests made herein are not intended to constitute an acknowledgment that any of the foregoing constitutes relevant prior art. All statements relating to the contents of these documents are based on information available to the applicant and do not constitute an acknowledgment of the accuracy of the contents of these documents.

[0323] The following description is provided to enable those skilled in the art to create and use various embodiments. Specific descriptions of apparatus, techniques, and applications are provided only as examples. Various modifications to the examples described herein will be readily apparent to those skilled in the art, and the general principles defined herein may be applied to other examples and applications without departing from the spirit and scope of the various embodiments. Therefore, the various embodiments are not intended to be limited to the examples described and shown herein, but should be given a scope consistent with the claims. [Examples]

[0324] Example 1: Selection and creation of mouse tumor models lacking MHC class I or IFN signaling. The inventors' first objective was to analyze how the loss of MHC class I affects the interaction between tumor cells and the immune system. The inventors investigated the CD8 of tumor cells.+ Since T cell recognition is strictly dependent on MHC class I, CD8 + Assuming that T cells can play a major role in this regard, CD8 in different mouse tumor models + T cell infiltration was compared. 5 × 10⁶ mice were inoculated into Balb / c mice (Balb / c JRj, Janvier Labs) (n=8). 5 Individual CT26 cells were subcutaneously inoculated (sc) and 5 × 10¹⁶ cells were injected into C57Bl / 6 mice (C57Bl / 6 JOlaHsd, Jackson Laboratory) (n=8 per cell line). 5 MC38 cells, 3 × 10 5 individual B16F10 cells or 1 × 10 5 TC1 cells were sc-inoculated. Twenty days after tumor inoculation, mice were sacrificially killed by cervical dislocation and the tumors were excised. The tumors were shredded into small pieces and digested using the Tumor Dissociation Kit, mouse (Miltenyi Biotec, catalog no. 130-096-730) according to the manufacturer's instructions. The samples were treated with single-cell suspension and stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with eF780 (ebioscience, catalog no. 65-0865-14). Antibodies against CD45 (BD, catalog no. 564279) and CD8 (BD, catalog no. 563046 or catalog no. 553031) were used. Flow cytometry analysis was performed using a BD LSRFortessa™ flow cytometer (Becton Dickinson GmbH), and the acquired data was analyzed using FlowJo software version 10 (TreeStar).

[0325] The inventors have found that different proportions of CD8 in all living cells across different tumor models + Observe T cells and infiltration, and high levels (CD8) in CT26 and MC38. high ), B16F10 is intermediate (CD8 int ), TC1 is low (CD8 lowIt was classified as (Figure 1A). CD8 + The proportion of T cells generally showed high infiltration by immune cells in CT26 and MC38, moderate infiltration in B16F10, and low infiltration in TC1, so the total CD45 in all living cells + This correlated with the proportion of immune cells (Figure 1B).

[0326] To genetically knock out MHC class I in tumor cell lines, we generated a single guide RNA (sgRNA) targeting B2m using publicly available tools (CT26, B16F10, TC1:CATGGCTCGCTCGGTGACCC;MC38:GACAAGCACCAGAAAGACCA). Tumor cells were transiently transfected with sgRNA and mRNA encoding Cas9, as well as mRNA encoding E3 and B18 (to inhibit the cellular response to dsRNA), by lipofection with RNAiMAX (Invitrogen, catalog no. 13778030) or by electroporation in a 4 mm cuvette (VWR, catalog no. 732-1137). Single clones were obtained by limiting dilution, grown, and the success of B2m knockout was confirmed by the absence of MHC class I on the cell surface, analyzed by flow cytometry (Figures 2 and 3). Since B16F10 cells express very small amounts of MHC class I in vitro, we cultured the cells in a 6-well plate at 37°C and 5% CO2 in the presence of 25 ng / mL of IFNγ (Peprotech, catalog no. 315-05) for 24 hours to induce upregulation of MHC class I.

[0327] Considering that defects in the IFN signaling pathway are another clinically relevant mechanism for resistance to cancer immunotherapy, we also created a B16F10-derived tumor cell line lacking the IFN response. To achieve this, Jak1, a central IFN signaling molecule, was knocked out with Jak1-targeted sgRNA (TGGCGTTCTGTGCTAAAATG) using the CRISPR / Cas9 system described above. Parental B16F10 cells were seeded in 6-well plates and cultured for 24 hours at 37°C and 5% CO2 in the presence of 1000 U / mL IFNα (PBL, catalog no. 12100-1), or cultured without IFN (control). Subsequently, cells were subjected to flow cytometry analysis to determine the expression levels of PD-L1 and MHC class I. B16F10 cells showed strong upregulation of both IFN-inducible markers (Figure 4). B16F10-Jak1 - / - Similar treatments failed to result in any detectable upward control of any marker, confirming a defect in the IFN response pathway (Figure 5).

[0328] Example 2: Loss of MHC class I affects tumor progression and the composition of the tumor microenvironment. To investigate whether MHC class I deficiency affects tumor progression, mice were given wild-type or B2m-deficient mice as described in Example 1 (B2m - / - Tumor cells were inoculated (CT26, MC38: n=5 / group; B16F10, TC1: n=10 / group).

[0329] B2m - / - Tumor growth was compared to the growth of a corresponding control tumor. CT26-B2m - / - and MC38-B2m - / - Both tumors showed significantly enhanced tumor growth (Figure 6), B16F10-B2m - / - and TC1-B2m - / - No significant difference was observed regarding tumors (Figure 7).

[0330] The inventors of this invention have discovered the voluntary CD8 + T cell response untreated CD8 highWe concluded that this likely controls tumor model growth and leads to enhanced growth of induced MHC class I-deficient tumors. We further hypothesized that the lack of spontaneous antigen recognition in induced MHC class I-deficient tumor models could also affect the immune cell composition of the tumor microenvironment (TME). To investigate this, we introduced mice with normal or B2m mice as described in Example 1. - / - Tumor cells were inoculated (n=8 mice / group). Twenty days after tumor inoculation, the tumors were excised and digested as described in Example 1. The samples were treated with single-cell suspension and stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with eF780 (ebioscience, catalog no. 65-0865-14) or Fixable Yellow Dead Cell Stain (Life technologies, catalog no. L34967). CD3 (BD, catalog no. 100227), CD4 (BD, catalog no. 564298), CD8 (BD, catalog no. 563046 or catalog no. 553031), CD11b (BD, catalog no. 553310), CD11c (Miltenyi Antibodies against Biotec (catalog no. 130-102-493), CD25 (BD, catalog no. 564023), CD45 (BD, catalog no. 564279), CD49b (BD, catalog no. 740133), CD103 (ebioscience, catalog no. 12-1031-83), F4 / 80 (BD, catalog no. 123146), GR-1 (BD, catalog no. 108423), NK1.1 (Biolegend, catalog no. 108738), XCR1 (Biolegend, catalog no. 148220), and FoxP3 (ebioscience, catalog no. 12-5773-82) were used. Flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH), and the acquired data were analyzed using FlowJo software version 10 (TreeStar).

[0331] B2m - / - The immune cell infiltration of the tumor was compared to that of the corresponding control tumor. CT26-B2m - / - and MC38-B2m - / - Both tumors are CD8 + It showed a significant reduction in infiltration by T cells, NK cells, and cross-presenting dendritic cells (cDC1) (Figures 8 and 10). Furthermore, MC38-B2m - / - The tumor showed a significant reduction in macrophage and monocyte infiltration. CT26 and CT26-B2m - / - No differences were observed in the cellular composition of tumor drainage lymph nodes (TDLNs) in tumor-bearing mice (Figure 9). MC38-B2m - / - In the model, CD8 + A slight increase in the amount of T cells and Tregs, as well as cDC1 and CD11b in TDLN. + A decrease in the number of DCs was observed. B16F10-B2m - / - The tumor is CD8 + While no difference was observed in infiltration by T cells, NK cells, and cDC1, there was an increase in the number of CD4 Th cells, as well as macrophages, monocytes, and CD11b cells. + A decrease in the number of DCs was observed (Figure 12). B16F10-B2m - / - The number of cDC1s in the TDLN of tumor-bearing mice increased (Figure 13). TC1-B2m - / - The tumors did not show any detectable differences in the immune cell composition of either the tumor or the TDLN (Figures 14 and 15). Changes in immune cell infiltration observed across different tumor models were CD8 + It correlates well with the classification of T cell infiltration, and CD8 high The greatest difference was observed in the tumor model. This was due to the spontaneous CD8 activity of tumor cells. + This suggests that T cell recognition largely determines the attraction of immune cells to TME. Since the changes observed in TDLN did not correlate with TME and were far less significant, the effects of MHC class I loss appear to be primarily limited to TME. Importantly, CT26-B2m - / - and MC38-B2m - / -While the reduced immune cell subsets in tumors are considered essential for anti-tumor immunity, the immunosuppressive subsets remained unaffected, with the exception of macrophages in the MC38 model. This suggests that active inflammatory TMEs can become immunosuppressive TMEs upon MHC class I loss.

[0332] The inventors' next objective is to compare B2m with the corresponding control tumor. - / - The goal was to analyze whether there were differences in the active migration of immune cells to TME. The CT26 model had the highest CD8 + The CT26 model was selected for this characterization because it exhibits T cell infiltration. As described in Example 1, normal or induced B2m mice were introduced. - / - Tumor cells were inoculated (n=5 mice / group / time point). Tumors were excised at different time points (8, 12, 20, and 26 days after inoculation) and digested as described in Example 1. Samples were treated with single-cell suspension and stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with eF780 (ebioscience, catalog no. 65-0865-14). Antibodies against CD45 (BD, catalog no. 564279), CD3 (Biolegend, catalog no. 100233), and CD49b (BD, catalog no. 553875) were used. Cells were transferred to Absolute Counting Tubes and flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH). The acquired data were analyzed using FlowJo software version 10 (TreeStar).

[0333] Tumor-infiltrated CD3 + The number of T cells and NK cells did not show any difference up to day 8 after tumor inoculation. However, the CT26 tumor showed increased infiltration by both cell types over time (Figure 16). CT26-B2m - / - In tumors, there is no such observable increase, CD3+ T cells and NK cells are actively attracted to CT26, but CT26-B2m - / - It was demonstrated that tumor cells are not attracted to TMEs. These data further support the idea that when tumor cells lose MHC class I expression, the actively progressing inflammation in TMEs that leads to immune cell infiltration is impaired.

[0334] The described observations suggest that CD8 is involved in the formation of TMEs in MHC class I-expressing tumors. + Since the role of T cells is emphasized, CD8 + We analyzed antigen encounter markers expressed by T cells. In this experiment, CD8 was used for comparison. + The TC1 model was included as the model with the lowest T cell infiltration. As described in Example 1, normal or induced B2m mice were introduced. - / -Tumor cells were inoculated (n=8 mice / group). Twenty days after tumor inoculation, the tumors were excised and digested as described in Example 1. The samples were treated with single-cell suspension and stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with eF780 (ebioscience, catalog no. 65-0865-14) or Fixable Yellow Dead Cell Stain (Life technologies, catalog no. L34967). Antibodies against CD8 (BD, catalog number 563046), CD11b (BD, catalog number 553310), CD45 (BD, catalog number 564279), F4 / 80 (BD, catalog number 123146), MHC class II (BD, catalog number 742894), PD-1 (ebioscience, catalog number 46-9981-82), and PD-L1 (Biolegend, catalog number 124333), as well as gp70 tetramer (MBl, catalog number MBL-TB-M521-7), were used. Flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH), and the acquired data were analyzed using FlowJo software version 10 (TreeStar).

[0335] B2m - / - Tumor-derived CD8 + The phenotype of T cells was compared to that of the corresponding control tumor. gp70 is the virus CD8 expressed by CT26 cells. + CD8 is a T cell antigen. + T cells showed a significantly lower proportion of gp70 antigen-specific cells (Figure 17A). Furthermore, PD-1 + CD8 + The percentage of T cells is CT26-B2m - / - The levels were significantly lower in tumors (Figure 17B). TC1-B2m - / - In tumors, PD-1 + CD8 +A low percentage of T cells was also observed (Figure 17C). gp70 is a measure of antigen specificity, and PD-1 is CD8 + Since it is a marker for T cell activation and antigen encounter, CD8 + The difference in T cell phenotype is CT26-B2m - / - This suggests a decrease in antigen recognition in TME. The magnitude of the difference in the TC1 model was slight compared to the CT26 model, and spontaneous CD8 in TC1 tumor cells. + This indicates less T cell recognition in CD8 in MHC class I functionally normal tumors. + We searched for evidence that T cell antigen recognition directly affects other immune cells located in the TME. CT26-B2m - / - And IFNγ (CD8 released upon antigen encounter) expressed by tumor-associated macrophages (TAMs) and tumor cells in CT26 tumors + Analysis of T cell signature cytokine-inducible markers revealed a significant decrease in PD-L1 and MHC class II expression by TAMs, as well as a substantial decrease in PD-L1 expression by tumor cells (Figure 18). Analysis of the same markers in the TC1 model did not reveal any difference in MHC class II expression by TAMs (Figure 19A). While PD-L1 expression by TAMs and tumor cells was significantly reduced, the magnitude of this reduction was similar to that of CD8. + T cells mediated by PD-1 + Consistent with the magnitude of the expression difference, it was again lower compared to the CT26 model (Figure 19C and D). These data are consistent with spontaneous CD8 + T cell recognition is CD8 high This results in a strong IFNγ signature in CT26 TME, which is linked to CT26-B2m - / - TME suggests that it will be compromised. On the other hand, CD8 low In the TC1 model, the spontaneous immune response to tumor cells, and therefore the IFNγ signature, does not appear to reach the threshold required to induce inflammatory TME. For this reason, TME is CD8 high Unlike the model, it is not affected by the loss of MHC class I.

[0336] Our final objective is to recognize the antigen CD8 + The absence of IFNγ released by T cells is associated with the attraction of antitumor immune cells (CD8) to the TME of CT26 and MC38 tumors after loss of MHC class I expression. + The goal was to confirm that the reason for the lower levels of T cells, NK cells, and cDC1s was to introduce normal or induced B2m cells into mice, as described in Example 1. - / -Tumor cells were inoculated (CT26: n=3 mice / group, MC38: n=5 mice / group). Nineteen days after tumor inoculation, the tumors were excised and rapidly frozen in liquid nitrogen. Total RNA was extracted from the tumors using the RNeasy Mini Kit (Qiagen, catalog number 74106) according to the manufacturer's instructions, and RNA concentration and integrity were determined using a NanoDrop 200c (Thermo Fisher) and Fragment Analyzer capillary gel electrophoresis system (Agilent Advanced Analytical). 1 μg of RNA per sample was used as a template for reverse transcription using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, catalog number RR047A). The obtained cDNA was used for quantitative real-time PCR (qRT-PCR) analysis using SsoAdvanced Universal SYBR Green Supermix (Biorad, catalog number 1725271) according to the manufacturer's instructions for the CFX384 Touch Real-Time PCR Detection System (BioRad). A two-step PCR was performed for 40 cycles with an annealing temperature of 60°C, a reaction volume of 15 μL containing 1.25 μL of cDNA per reaction, and a final primer concentration of 333 nM per primer. The Ct value was determined using CFX Manager 3.1 software (Biorad), and the ΔΔCt value was calculated by computer by normalization against the HPrt reference gene to determine the relative gene expression value. For reliability reasons, a cutoff was used to exclude Ct values ​​> 35.Primer sequences: HPRT forward primer (CCCTGGTTAAGCAGTACAGC), HPRT reverse primer (CTCATTATAGTCAAGGGCATATCC); Ifng forward primer (CT26) (TTCTTCAGCAACAGCAAGGCG); Ifng reverse primer (CT26) (TGGACCACTCGGATGAGCT); Ifng forward primer (MC38) (GAGGAACTGGCAAAAGGATGG), Ifng reverse primer (MC38) (GCCTTGCTGTTGCTGAAGAAG); Cxcl9 forward primer (GCAACAAAACTGAAATCATTGCTAC), Cxcl9 reverse primer (GTTTTTCATGTTCTTT) TGATGTTTTTTCC); Cxcl10 forward primer (GAGTGGGACTCAAGGGATC), Cxcl10 reverse primer (TTCTTTTTCATCGTGGCAATGATCTC); Cxcl11 forward primer (GCGACAAAGTTGAAGTGATTGTTAC), Cxcl11 reverse primer (AGTCAGACGTTCCCAGGATG); Ccl5 forward primer (GGAGTATTTCTACACCAGCAGC), Ccl5 reverse primer (CAGAATCAAGAAACCCTCTATCC); Xcl1 forward primer (ATGGGTTGTGGAAGGTGTGG), Xcl1 reverse primer (CCATTTGGCTTCTGGATCAGC).

[0337] B2m - / - The gene expression levels of tumor-derived Ifng and IFN-inducible chemokines Cxcl9, Cxcl10, and Cxcl11 (CXCR3 ligands) were compared to those of corresponding control tumors. Ifng expression was decreased in both tumor models (Figures 20A and 21A). Similarly, the expression levels of CXCR3 ligands, which are essential for the recruitment of T cells and NK cells to TMEs, were decreased in both tumor models (Figures 20B, 20C, 20D, and 21B, 21C, 21D) (Nagarsheth et al. Nat Rev Immunol 17, 559-72 (2017)). These observations were originally related to CD8 highWe confirmed the decrease in IFNγ signature in MHC class I-deficient tumors. CD8 + T cell-derived IFNγ-induced induction of CXCR3 ligand is lost by MHC class I-deficient counterparts, CD8 high Further CD3 to tumor TME + This explains the successive attraction of T cells and NK cells. Furthermore, the expression levels of cDC1, which attracts chemokines Ccl5 and Xcl1, were reduced (Figures 20E, 20F and 21E, 21F). NK cells are known to be the primary producers of these chemokines, and impaired invasiveness of NK cells may explain the decreased chemokine expression and, consequently, the reduced infiltration by cDC1 (Bottcher et al. Cell 172, 1022-37 (2018)).

[0338] Our results indicate the spontaneous CD8 activity of tumor antigens. + This means that T cell recognition controls the growth of MHC class I-expressing tumors to some extent, maintains inflammatory TMEs, and triggers a chain reaction of chemokine induction, which in turn attracts further anti-tumor immune cells. In summary, it has been shown that loss of MHC class I makes originally inflammatory tumors highly immunosuppressive, which has unexpected effects on TMEs.

[0339] Example 3: Loss of MHC class I is a comprehensive mechanism of resistance to immunotherapy and classical cancer treatments. After characterizing untreated MHC class I-deficient tumor models, we began analyzing their resistance to cancer treatment. This included CT26-B2m agonist antibodies against ICB antibodies blocking PD-1 and CTLA4, as well as agonist antibodies against 4-1BB. - / - and MC38-B2m - / - We began by testing tumor resistance. As described in Example 1, mice were given either normal or B2m - / - Tumor cells were inoculated (n=10 / group for tumor growth, n=5-7 / group for flow cytometry), and tumors measuring 32-36 mm were observed. 3After reaching the mean volume, 200 μg of anti-PD-1 (Bioxcell, catalog number BE0146), anti-CTLA (Bioxcell, catalog number BE0164), or anti-4-1BB (Bioxcell, catalog number BE0239) antibody was administered intraperitoneally (ip) on days 0, 3, 7, and 10 (MC38: two further treatments on days 14 and 17). The control group was injected with an unrelated antibody (Bioxcell, catalog number 0089). Antitumor effect was determined as inhibition of tumor growth in the test group compared to the control group. CT26 and CT26-B2m - / - Tumors were excised and digested 7 days (anti-4-1BB) or 10 days (anti-PD1 and anti-CTLA4) after the initial treatment, as described in Example 1. Samples were treated with single-cell suspension and stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with eF780 (ebioscience, catalog no. 65-0865-14). Antibodies against CD8 (BD, catalog no. 563046) and CD45 (BD, catalog no. 564279) were used. Cells were transferred to Absolute Counting Tubes and flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH), and the acquired data were analyzed using FlowJo software version 10 (TreeStar).

[0340] The tested treatment resulted in significant inhibition of CT26 and MC38 tumor growth compared to the control group (Figures 22A and 24A). Treated CT26-B2m - / - and MC38-B2m - / - The tumors grew with similar dynamics to the control group, and no significant inhibition of growth was detected (Figures 22B and 24B). CD8 after different treatments + Analysis of T cell infiltration showed CD8 in treated CT26 tumors compared to the control group. +An increase in T cell count was observed (Figures 23A and B), reaching statistical significance after anti-CTLA4 or anti-4-1BB treatment. In contrast, CT26-B2m showed an increase after either of the treatments tested. - / - CD8 + T cell counts did not increase. These results confirm that loss of MHC class I confers complete resistance to antibody-based immunotherapy and that the intratumoral immune response is limited to responsive tumor models expressing functional MHC class I.

[0341] Subsequently, CT26-B2m - / - and TC1-B2m - / - We tested whether the tumors would become resistant to therapeutic RNA vaccination. As described in Example 1, mice were given either normal or B2m - / - Tumor cells were inoculated (n=10 / group for tumor growth, n=5 / group for flow cytometry). CT26 and CT26-B2m - / - Supporting mice were intravenously (iv) vaccinated with 40 μg of RNA-LPX encoding gp70 (SPSAYAHQF) on days 5, 8, 12, and 19 after tumor inoculation, as described in Kranz et al. (Kranz, L M et al. Nature 534, 396-401 (2016)), and TC1 or TC1-B2m - / - The tumor in the support mouse was approximately 20 mm. 3 After reaching an average volume, 40 μg of RNA-LPX encoding E7(RAHYNIVTF) was administered intravenously (iv) on days 0 and 7. E7 is the virus CD8 expressed by TC1 cells. + These are T cell antigens. Further groups were vaccinated with RNA-LPX (which codes for no antigen), while the control group remained untreated. Antitumor effect was determined as inhibition of tumor growth in the test group compared to the control group. As described in Example 1, CT26 and CT26-B2m were used. - / - The tumor was excised 17 days after the initial treatment, and TC1 and TC1-B2m - / -The tumor was excised and digested 9 days after the initial treatment. The sample was treated with a single-cell suspension and stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with eF780 (ebioscience, catalog no. 65-0865-14). Antibodies against CD8 (BD, catalog no. 563046 or Invitrogen, catalog no. 1825015) and CD45 (BD, catalog no. 564279), as well as gp70 tetramer (MBl, catalog no. MBL-TB-M521-7) or E7 dextramer (Immudex, catalog no. JA2195-PE) were used. Cells were transferred to Absolute Counting Tubes, and flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH). The acquired data was analyzed using FlowJo software version 10 (TreeStar).

[0342] Vaccination with antigen-encoding RNA-LPX resulted in significant inhibition of CT26 and TC1 tumor growth, while unrelated RNA-LPX did not significantly affect tumor growth compared to the control group (Figures 25A and 27A). Vaccination with antigen-encoding or unrelated RNA-LPX induced B2m - / - It did not inhibit tumor growth (Figures 25B and 27B). CD8 + Analysis of T cell infiltration and antigen specificity did not reveal a significant effect of unrelated RNA-LPX in any tumor model (Figures 26 and 28). Vaccination with antigen-encoding RNA-LPX was found to be effective in B2m - / - and CD8 to control tumors + This resulted in a significant enhancement of T cell infiltration. In association with the increased infiltration, the antigen-encoding RNA-LPX was found to be B2m - / - Antigen-specific CD8 in both the and control tumors + It increased the frequency of T cells. This is because vaccination infiltrates different tumor models, even if CD8 cells are MHC class I negative.+ This demonstrates priming and expansion of T cells. Nevertheless, antigen-specific CD8 + T-cell infiltration does not affect the proliferation of MHC class I-deficient tumors, confirming their resistance to therapeutic vaccination.

[0343] Recent reports have shown that the immune system plays a crucial role in the response to chemotherapy or radiotherapy (classic cancer treatments) (Galluzzi et al. Cancer Cell 28, 690-714 (2015), Weichselbaum et al. Nat Rev Clin Oncol 14, 365-379 (2017)). We hypothesized that silencing inflammatory tumors via MHC class I loss may also affect the effectiveness of classic cancer treatments. To test this hypothesis, we introduced CT26 or CT26-B2m into mice as described in Example 1. - / - Tumor cells were inoculated (n=9-10 / group for tumor growth, n=5 / group for flow cytometry). For chemotherapy, the tumor was approximately 6mm in size. 3 On days 0, 7, and 14, after reaching an average tumor volume, mice were intraperitoneally (ip) injected with 5 mg / kg of oxaliplatin (OX) (Medac, Medoxa) and intravenously (iv) injected with 60 mg / kg of 5-fluorouracil (5-FU) (Medac, 5-FU medac). The control group received a vehicle. In radiotherapy, the tumor was approximately 30 mm in size. 3After reaching an average volume, the tumor was locally irradiated with 12 Gy using X-RAD 320 (Precision X-Ray Instruments). The control group was untreated. Antitumor effect was determined as inhibition of tumor growth in the test group compared to the control group, and survival rate during the 100-day observation period. Tumors were resected and digested 13 days (chemotherapy) or 8 days (radiotherapy) after the initial treatment, as described in Example 1. Samples were treated with single-cell suspension and stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with eF780 (ebioscience, catalog number 65-0865-14). Antibodies against CD8 (BD, catalog number 553031) and CD45 (BD, catalog number 564279), as well as gp70 tetramer (MBl, catalog number MBL-TB-M521-7), were used. Cells were transferred to Absolute Counting Tubes, and flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH). The acquired data were analyzed using FlowJo software version 10 (TreeStar).

[0344] Treatment with chemotherapy or radiotherapy is performed on CT26 and CT26-B2m. - / - The treatment significantly inhibited tumor growth and greatly improved survival rates in all treatment groups compared to the control group (Figures 29 and 31). After both chemotherapy and / or radiotherapy, 3 out of 10 (30%) of CT26 tumor-bearing mice showed complete response, resulting in tumor rejection and long-term survival up to 100 days after tumor inoculation, whereas all control animals had to be euthanized due to tumor progression. In contrast, CT26-B2m - / - Tumor-carrying mice did not show a complete response after any treatment, and all mice had to be euthanized by day 100. CD8 in CT26 tumors + Analysis of T cell infiltration and antigen specificity was performed on CD8 cells after chemotherapy or radiotherapy compared to a control group. +We revealed an increase in T cell count and a trend toward higher gp70 antigen specificity after chemotherapy (Figures 30A and 30C, and 32A and 32C). Infiltrating CD8 + The same trend in the number of T cells is observed in CT26-B2m - / - Observable in the tumor, and after treatment of both, invasive CD8 + A significant increase in T cell antigen specificity was detected (Figures 30B and 30D, as well as 32B and 32D). These data suggest that classical cancer therapies can mediate complete responses resulting in rejection of MHC class I-expressing tumors. + This suggests that it may lead to priming of the T cell response. Therefore, MHC class I-deficient tumors may be able to evade immune-mediated complete responses to classical cancer treatments.

[0345] Example 4: Combination immunotherapy with antibodies and IL2 induces inflammation in TMEs and results in a therapeutic immune response against MHC class I-deficient tumors. Next, we attempted to identify therapeutic regimens that would enable a therapeutic immune response against MHC class I-deficient tumors. The adaptive immune system selectively recognizes tumor cells via antigens presented on MHC class I. Since this is no longer possible in MHC class I-deficient tumors, it is necessary to re-establish antigen-specific recognition of tumors by alternative methods. To achieve this, we based regimens on antibodies that bind to tumor-associated antigens (TAAs) to mark tumor cells as foreign cells. Innate immune cells (e.g., NK cells or macrophages) can recognize antibody-opsonized tumor cells via the Fcγ receptor (FcγR) and eliminate the cells antigen-specifically by antibody-dependent cell-mediated cytotoxicity (ADCC) or phagocytosis (ADCP). Furthermore, we hypothesized that a second compound acting as an adjuvant is necessary to activate and license immune cells at FcγR for tumor cell elimination. For this purpose, the cytokine IL2 was selected because it is a potent activator of both innate and adaptive immunity. IL2 activates NK cells and enhances IFNγ production (Weigent et al. Infect Immun 41, 992-7 (1983)). As a secondary effect, IFNγ released by NK cells during TME can induce the expression of several chemokines, leading to an influx of immune cells and activating macrophages as potent ADCP effector cells (Shi et al. J Immunol 194, 4379-86 (2015)). As described in Example 1, B16F10 and induced B2m were introduced into mice. - / -Tumor cells were inoculated (n=9-10 / group). Mice were intraperitoneally (ip) injected with 200 μg of anti-Trp1 antibody (TA99) or an isotype control on days 5, 8, 12, 15, 19, 22, and 26 after tumor inoculation, and intravenously (iv) injected 1 μg of RNA encoding mAlb (which does not encode any cytokine) as a control formulated with mAlb-mIL2 or TransIT® (Mirus, catalog number MIR2255) on days 5, 12, 19, and 26 after tumor inoculation. mAlb-mIL2 is a fusion protein in which albumin is ligated to the N-terminus of IL2 to extend the serum half-life of IL2 and enrich the protein in tumors by enhancing permeability and retention (EPR) effects. This protein is encoded by N1-methylpsoiduridine modified mRNA, which results in high protein expression in the liver over several days. The control group was treated with isotype and mAlb RNA. The antitumor effect was determined by inhibition of tumor growth in the test group compared to the control group, and by survival rate during the 100-day observation period. Further mice were given B16F10-B2m as described in Example 1. - / -The tumors were inoculated (n=7-8 / group), and the above treatment was initiated 9 days after tumor inoculation. As described in Example 1, the tumors were excised and digested 11 days after the initial treatment. The samples were treated with single-cell suspension and stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with eF780 (ebioscience, catalog no. 65-0865-14), Fixable Yellow Dead Cell Stain (Life Technologies, catalog no. L34967), or Fixable Red Dead Cell Stain (Life Technologies, catalog no. L34971). CD3 (Biolegend, catalog number 100227), CD4 (BD, catalog number 564298), CD8 (BD, catalog number 553031), CD11b (BD, catalog number 553310), CD11c (Miltenyi, catalog number 130-102-493), CD25 (BD, catalog number 564023), CD45 (BD, catalog number 564279), CD103 (ebi Antibodies were used against ebioscience (catalog no. 12-1031-83), F4 / 80 (Biolegend, catalog no. 123132 and 123146), FoxP3 (ebioscience, catalog no. 12-5773-82), FcγRI (BD, catalog no. 740622), FcγRII / III (BD, catalog no. 558636), FcγRIV (BD, catalog no. 742564), TCR γδ (BD, catalog no. 563993), Ly6C (BD, catalog no. 553104), Ly6G (BD, catalog no. 551461), NK1.1 (BD, catalog no. 108738), SiglecF (BD, catalog no. 565183), and XCR1 (Biolegend, catalog no. 148220).Cells were transferred to Absolute Counting Tubes, and flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH). The acquired data was analyzed using FlowJo software version 10 (TreeStar).

[0346] TA99 or mAlb-mIL2 RNA monotherapy did not have a significant effect on B16F10 tumor growth (Figure 33A). mAlb-mIL2 monotherapy was effective in B16F10-B2m - / - It significantly inhibited tumor growth (Figure 33B). Combination therapy with TA99 and mAlb-mIL2 significantly inhibited B16F10 and B16F10-B2m - / - Both tumor growths were significantly inhibited. Tumor growth inhibition was reflected in statistically improved survival rates in mice treated with TA99 and mAlb-mIL2 therapy compared to the control group in both tumor models (Figure 34). B16F10 and B16F10-B2m in the control group or the mAlb-mIL2 monotherapy group. - / - All mice carrying tumors had to be euthanized to allow the tumors to progress. TA99 monotherapy was effective in 1 / 10 of mice (10%) in the B16F10 model and in the B16F10-B2m model. - / - In the model, complete tumor rejection and survival up to day 100 was achieved in 2 out of 10 mice (20%). Combination therapy with TA99 and mAlb-mIL2 was superior to monotherapy in both models, with 3 out of 10 mice (30%) and B16F10-B2m being superior in the B16F10 model. - / - In the model, complete tumor rejection was induced in 6 out of 10 mice (60%).

[0347] B16F10-B2m after monotherapy and combination therapy of TA99 and mAlb-mIL2 - / - We analyzed the infiltration of several immune cell subsets in tumors and compared them to a control group. mAlb-mIL2 monotherapy was effective against CD4 + Th cells, Treg cells, CD8 +T cells, γδ T cells, NK cells, NKT cells, macrophages, eosinophils, and CD11b + DA99 significantly enhanced DC infiltration (Figures 35, 36, 37, and 38). cDC1, monocytes, and neutrophils were slightly enhanced, but not statistically significant. TA99 monotherapy did not have a detectable effect on immune infiltration, but tumor infiltration after TA99 and mAlb-mIL2 combination therapy was similar to mAlb-mIL2 monotherapy in all cases. Furthermore, FcγR expression by macrophages and monocytes after monotherapy and TA99 and mAlb-mIL2 combination therapy was analyzed and compared to the control group. mAlb-mIL2 monotherapy enhanced FcγRI, FcγRII / III, and FcγRVI expression by intratumor macrophages and monocytes, while TA99 monotherapy did not (Figures 39 and 40). FcγR expression was lower in the group treated with TA99 and mAlb-mIL2 combination therapy compared to the group treated with mAlb-mIL2 monotherapy, which is likely due to TA99-induced internalization of FcγR.

[0348] To identify cell types important for antitumor effects against MHC class I-deficient tumor cells, mice (n=8-15 / group) were subjected to 3 × 10⁶ injections. 5 B16F10-B2m - / -Cells were subcutaneously inoculated (sc) and treated with anti-Trp1 (TA99) antibody on days 5, 8, 12, 15, 19, and 22 post-inoculation, and with mAlb-mIL2 encoding RNA on days 5, 12, and 19 post-inoculation, as shown in Figure 33. The control group was administered isotype control antibodies and mAlb-encoding RNA (which does not encode any cytokines). Depletion antibodies against NK1.1 (Bioxcell, catalog number BE0036), CSF1R (Bioxcell, catalog number BE0213), or Ly6G (Bioxcell, catalog number BE0075-1), or an unrelated control antibody (non-depletion) (Bioxcell, catalog number BE0089), were administered intraperitoneally (ip) at a loading dose of 400 μg on day 4 after tumor inoculation, and at subsequent doses of 200 μg (unrelated antibody, NK1.1, or Ly6G) or 300 μg (CSF1R) on days 7, 11, 14, 18, and 20 after tumor inoculation. The survival rates of the group injected with the depletion antibody were compared with those of the group injected with the unrelated antibody to determine the difference in therapeutic effect against immune cell depletion. The success of NK cell and neutrophil depletion was confirmed by flow cytometry analysis of blood samples stained with antibodies against CD3 (Biolegend, catalog number 100227), CD11b (BD, catalog number 550993), CD45 (BD, catalog number 564279), Ly6C (BD, catalog number 553104), Ly6G (BD, catalog number 551461), and NK1.1 (Biolegend, catalog number 108720) (stained as described in Kranz et al. (Kranz, L M et al. Nature 534, 396-401 (2016))). Flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH), and the acquired data were analyzed using FlowJo software version 10 (TreeStar).

[0349] No significant effect of NK cell (NK1.1), macrophage (CSF1R), or neutrophil (Ly6G) depletion on the survival of mice treated with TA99 and mAlb-mIL2 combination therapy was observed (Figure 41). However, after macrophage depletion, several mice had to be euthanized earlier, and only 4 out of 13 mice (30.8%) survived to day 100 compared to 8 out of 15 mice (53.3%), suggesting a tendency for the antitumor effect to weaken after macrophage depletion. It should be noted that flow cytometry analysis of stained blood samples confirmed the depletion of NK cells and neutrophils (Figure 42). Successful macrophage depletion was not confirmed in this experiment, and the fairly small difference in survival rates may be due to incomplete macrophage depletion. Therefore, the experiment will be repeated after complete macrophage depletion is confirmed, and the mice will be handed over at a later date.

[0350] In summary, combination therapy with anti-TAA antibodies and IL2 was identified as an efficient treatment for MHC class I-deficient mouse tumor models. The antibody mediated antigen-specific immune recognition by tumor cells, while IL2 induced inflammation in the TME, resulting in a broad influx of immune cells. Furthermore, macrophages and monocytes capable of eliminating opsonized target cells via ADCP strongly upregulated FcγR in response to IL2, suggesting that IL2 makes innate immune cells available for use in antibody effector mechanisms. The combination therapy resulted in complete rejection of MHC class I-deficient tumors. CD8 in the antitumor effect of tumor-targeting antibodies, particularly the combination of antibodies and IL2, in mouse tumor models. +This finding is particularly striking given the presumed crucial role of T-cell immunity (Park et al. Cancer Cell 18,160-70 (2010), Yang et al. Mol Ther 21,91-100 (2013), Zhu et al. Cancer Cell 27,489-501 (2015), Kwan et al. J Exp Med 214,1679-90 (2017)). Nevertheless, our data clearly demonstrate the unexpected suitability of antibody-IL2 combination therapy for MHC class I-deficient tumors through the re-establishment of antigen-specific tumor cell recognition by innate immune cells and the induction of inflammation in TMEs.

[0351] Example 5: Classical cancer therapy enhances control of MHC class I-deficient tumors with antibody- and IL-2 combination immunotherapy. The inventors' final objective was to investigate whether the control of MHC class I-deficient tumors could be further enhanced by classical cancer treatments. Mice (n=12-13 / group) were given 3 × 10⁻¹⁰ 5 B16F10-B2m - / - Cells were inoculated subcutaneously (sc), and 200 mg / kg of cyclophosphamide (CTX) (Baxter, Endoxan) or a control vehicle was administered intraperitoneally (ip) on day 6 post-tumor inoculation. Subsequently, as described in Example 4, the cells were treated with or without anti-Trp1 (TA99) antibody and mAlb-mIL2 encoding RNA on days 7, 10, 14, 17, and 21 post-tumor inoculation. The control group was treated with an isotype control antibody or mAlb-encoding RNA (which does not encode any cytokines). Antitumor effect was determined as inhibition of tumor growth in the group treated with CTX, TA99, and mAlb-mIL2 combination therapy compared to the groups treated with CTX monotherapy, TA99 and mAlb-mIL2 combination therapy, or the control.

[0352] Comparison of tumor growth showed that treatment with CTX, followed by combination therapy with TA99 and mAlb-mIL2, nearly completely inhibited tumor progression (Figure 43). Growth inhibition was significantly improved compared to CTX monotherapy or combination therapy with TA99 and mAlb-mIL2. In conclusion, classical cancer therapies, when combined with antibody and IL2 combination therapy, result in synergistic antitumor control of MHC class I-deficient tumors.

[0353] Example 6: Combination immunotherapy with antibodies and IL2 elicits a therapeutic immune response against IFN signaling-deficient tumors. In addition to the loss of MHC class I, deficiency in IFN signaling is another way tumors evade T-cell elimination and is frequently observed in patients (Gao et al. Cell 167, 397-404 (2016)). Our goal was to identify therapies applicable to T-cell resistant tumors regardless of specific resistance mechanisms. For this reason, we also investigated whether therapies are effective against tumors lacking the IFN signaling pathway via Jak1 mutations. 3 × 10⁶ mice (n=10 / group) were subjected to the study. 5 B16F10-Jak1 - / - Cells were subcutaneously inoculated (sc) and treated with anti-Trp1 (TA99) antibody on days 5, 8, 12, 15, and 19 post-inoculation, and with mAlb-mIL2 encoding RNA on days 5, 12, and 19 post-inoculation, as shown in Figure 33. The control group was administered isotype control antibodies and mAlb-encoding RNA (which does not encode any cytokines).

[0354] TA99 monotherapy is B16F10-Jak1 - / - Tumor growth was significantly delayed, but mAlb-mIL2 RNA monotherapy did not, while combination therapy with TA99 and mAlb-mIL2 resulted in complete inhibition of tumor growth (Figure 44A). Tumor growth inhibition was reflected in statistically improved survival rates in mice treated with TA99 monotherapy or TA99 and mAlb-mIL2 combination therapy compared to the control group (Figure 44B). 2 / 10 (20%) of the control group had B16F10-Jak1 - / -The tumors spontaneously regressed, with mAlb-mIL2 monotherapy resulting in tumor regression in 5 / 10 (50%) of mice. TA99 monotherapy resulted in complete tumor rejection and survival up to day 100 in 8 / 10 (80%) of mice, and combination therapy with TA99 and mAlb-mIL2 induced complete tumor rejection in 10 / 10 (100%) of mice. In summary, combination therapy with antibodies and IL2 resulted in a therapeutic immune response against IFN signaling-deficient tumors. In conclusion, this treatment regimen addresses CD8 signaling deficiency via MHC class I loss or IFN signaling impairment. + This is a general approach to treating tumors that have acquired resistance to T-cell elimination.

[0355] Example 7: Combination immunotherapy of antibody and IL2 targets macrophages and CD8 + T cells and IFNγ are required Considering that macrophage depletion tended to weaken the antitumor effect of the antibody and mAlb-mIL2 combination therapy, as described in Example 4, an improved protocol for macrophage depletion was established using higher antibody doses to demonstrate these results. C57Bl / 6 mice (n=6) were given 3 × 10⁶ antibodies as described in Example 1. 5 B16F10-B2m - / -Cells were inoculated subcutaneously (sc). Antibodies against CSF1R (Bioxcell, catalog number BE0213) were intraperitoneally (ip) injected into five mice at doses of 600 μg on day 10 and 350 μg on day 12 after tumor inoculation, with one mouse left untreated as a control. Tumors were excised 13 days after tumor inoculation and digested as described in Example 1. Samples were treated with single-cell suspension and stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with Fixable Yellow Dead Cell Stain (Life Technologies, catalog number L34967). Antibodies against CD11b (BD, catalog number 553310), CD45 (BD, catalog number 564279), F4 / 80 (Biolegend, catalog number 123132), and GR-1 (Biolegend, catalog numbers 123132 and 123146) were used. Flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH), and the acquired data were analyzed using FlowJo software version 10 (TreeStar).

[0356] Clear CD11b in untreated control tumors + F4 / 80 + While the macrophage population remained observable, injection of anti-CSF1R resulted in a reduction of the macrophage population in 4 out of 5 mice (Figure 45). Therefore, high-dose injection of anti-CSF1R can deplete macrophages within 3 days.

[0357] To obtain valid data on the importance of macrophages for antibody and mAlb-mIL2 combination therapy and to investigate the role of lymphocytes, C57Bl / 6 mice (n=10-15 / group) were subjected to 3 × 10⁶ treatments using an improved macrophage depletion protocol. 5 B16F10-B2m - / -Cells were inoculated subcutaneously (sc) and treated with anti-Trp1 (TA99) antibody on days 5, 8, 12, 15, and 19 post-tumor inoculation, and with mAlb-mIL2 encoding RNA on days 5, 12, and 19, as shown in Figure 33. The control group remained untreated. Depletion antibodies against CD4 (Bioxcell, catalog number BE0119) and CD90.2 (Bioxcell, catalog number BE0066) or unrelated control antibodies (non-depleted) (Bioxcell, catalog number BE0089) were administered intraperitoneally (ip) at a loading dose of 400 μg on day 3 post-tumor inoculation, and at a subsequent dose of 200 μg on days 7, 10, 14, and 20 (control and anti-CD4 only on day 20). An antibody against CSF1R (Bioxcell, catalog number BE0213) was administered intraperitoneally (ip) as a loading dose of 600 μg on day 2 after tumor inoculation, and as a follow-up dose of 350 μg on days 5, 7, 10, 12, and 14. The survival rate of the group injected with the depletion antibody was compared with the survival rate of the group injected with an unrelated antibody to determine the difference in therapeutic effect against immune cell depletion. CD4 + T cells and total CD90.2 + The success of lymphocyte depletion was confirmed by flow cytometry analysis of blood samples stained with antibodies against CD4 (BD, catalog no. 564298), CD45 (BD, catalog no. 564279), and CD90.2 (BD, catalog no. 553003) (stained as described in Kranz et al. (Kranz, L.M. et al. Nature 534, 396-401 (2016))). Flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH), and the acquired data were analyzed using FlowJo software version 10 (TreeStar).

[0358] CD4 during anti-CD4 injection + Successful depletion of T cells and total lymphocytes upon injection of anti-CD90.2 was confirmed in mouse blood at the time of initiation of antibody and mAlb-mIL2 treatment (Figure 46). CD4 +T cell depletion did not affect the antitumor activity of the antibody and mAlb-mIL2 combination therapy, but the significant decrease in survival rate during total lymphocyte depletion suggested that the lymphocyte population must be necessary for the antitumor effect (Figure 47). Macrophage depletion almost completely inhibited the antitumor activity, confirming that macrophages are essential for therapeutic activity.

[0359] NK cells or CD4 + Considering that T cell depletion did not affect the antitumor activity of the combination therapy of antibodies and mAlb-mIL2, CD8 + We investigated whether the lymphocyte population required T cells was CD8. + Considering that IFNγ secreted by T cells polarizes macrophages into a pro-inflammatory antitumor phenotype (Gubin et al. Cell 175(4), 1014-30 (2018)) and that IFNγ activation of macrophages enhances the elimination of antibody-opsonized tumor cells via ADCP (Shi et al. J Immunol 194, 4379-86 (2015)), we further investigated whether IFNγ is necessary for the antitumor activity of combination therapy with antibodies and mAlb-mIL2 against MHC class I-deficient tumors. 3 × 10⁶ mice (n=8~15 / group) were given 10⁶ doses. 5 B16F10-B2m - / -Cells were subcutaneously inoculated (sc) and treated with anti-Trp1 (TA99) antibody on days 5, 8, 12, 15, and 19 post-inoculation, and with RNA encoding mAlb-mIL2 on days 5, 12, and 19 post-inoculation, as shown in Figure 33. The control group remained untreated. A CD8 depletion antibody (Bioxcell, catalog number BE0117) or a neutralizing antibody against IFNγ (Bioxcell, catalog number BE0055) or an unrelated control antibody (non-depleted) (Bioxcell, catalog number BE0088) was administered intraperitoneally (ip) as a loading dose of 400 μg on day 3 post-inoculation, followed by 200 μg of anti-CD8 on days 7 and 10, or 250 μg of control antibody or anti-IFNγ on days 5, 7, and 10. The survival rate of the group injected with depletion antibodies was compared with the survival rate of the group injected with unrelated antibodies to determine the difference in therapeutic effect against immune cell depletion. CD8 + Successful T-cell depletion was confirmed by flow cytometry analysis of blood samples stained with antibodies against CD8 (BD, catalog number 553032) and CD45 (BD, catalog number 564279) (stained as described in Kranz et al. (Kranz, L. et al. Nature 534, 396-401 (2016))). Flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH), and the acquired data were analyzed using FlowJo software version 10 (TreeStar).

[0360] CD8 during anti-CD8 injection + Successful T cell depletion was confirmed in mouse blood at the time of initiation of antibody and mAlb-mIL2 treatment (Figure 48). CD8 + T cell depletion or IFNγ neutralization similarly inhibits the antitumor activity of antibodies and mAlb-mIL2 therapy, and CD8 + This study demonstrated that T cells are a necessary lymphocyte population and suggested that these cells contribute through IFNγ secretion (Figure 49).

[0361] The next objective is to analyze whether pro-inflammatory polarization of macrophages occurs during treatment with combination therapy of antibodies and mAlb-mIL2, and to study macrophages and CD8 + The objective was to confirm the direct relationship between T cells and IFNγ. 3 × 10⁶ mice were used in C57Bl / 6 mice (n=7~8 / group). 5 B16F10-B2m - / -Cells were subcutaneously inoculated (sc) and treated with anti-Trp1 (TA99) antibody on days 9, 12, and 16 post-tumor inoculation, and with mAlb-mIL2 encoding RNA on days 9 and 16 post-tumor inoculation, as shown in Figure 33. The control group was administered isotype control antibodies and mAlb-encoding RNA (which does not encode any cytokines). Tumors were excised 11 days after the initial treatment. In the second experiment, C57Bl / 6 mice (n=15 / group) were inoculated and treated in the same manner, and further administered intraperitoneally (ip) with a loading dose of 400 μg of CD8-depleting antibody (Bioxcell, catalog number BE0117) or IFNγ-neutralizing antibody (Bioxcell, catalog number BE0055) or unrelated control antibody (non-depleted) (Bioxcell, catalog number BE0088) on day 7 after tumor inoculation, followed by subsequent doses of 200 μg of anti-CD8 or CD9 on days 11 and 14, and 250 μg of control antibody or anti-IFNγ on days 11 and 14. Tumors were resected 9 days after the initial treatment. All tumors were digested as described in Example 1. Samples were treated with single-cell suspension and stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with Fixable Yellow Dead Cell Stain (Life Technologies, catalog number L34967). Antibodies against CD11b (BD, catalog number 562127), CD45 (BD, catalog number 564279), CD206 (Biolegend, catalog number 141720), GR-1 (Biolegend, catalog number 108423), F4 / 80 (Biolegend, catalog number 123132), and MHC II (BD, catalog number 551799) were used. Flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH), and the acquired data were analyzed using FlowJo software version 10 (TreeStar).

[0362] To determine the pro-inflammatory state of tumor-infiltrating macrophages, pro-inflammatory M1-like macrophages (MHC II) are used. high CD206 low ) and anti-inflammatory M2-like macrophages (MHC II low CD206 high The proportion of ) was quantified by flow cytometry, and the M1 / M2 ratio was calculated. Antibody therapy alone did not significantly change the M1 / M2 ratio, but mAlb-mIL2 as monotherapy or mAlb-mIL2 in combination with TA99 significantly increased the M1 / M2 ratio, indicating pro-inflammatory remodeling of the macrophage compartment (Figure 50A). Pro-inflammatory polarization of macrophages is associated with CD8 + CD8 is similarly suppressed during T cell depletion or IFNγ neutralization. + This demonstrates that T cells and IFNγ shape the macrophage phenotype in response to mAlb-mIL2, and CD8 + We emphasize that the importance of T cells is most likely dependent on IFNγ production, but not on direct elimination of tumor cells (Figure 50B).

[0363] In conclusion, these results suggest that CD8 is involved in the control of tumors that evade direct T cell recognition due to the absence of MHC class I. + This highlights previously unrecognized roles of T cells. Given that macrophages are the only FcγR-expressing cell type identified as essential for the therapeutic activity of antibody and mAlb-mIL2 therapies, they are most likely involved in the elimination of antibody-opsonized tumor cells. CD8 + T cells activate macrophages via IFNγ to enable efficient elimination of tumor cells.

[0364] Example 8: Antibody and mAlb-mIL2 therapy prevent acquired resistance during the course of ICB. A significant proportion of tumor patients treated with ICB experience relapse after initial disease control due to the development of acquired resistance resulting from the proliferation of a small number of early MHC class I-deficient tumor cell clones that evade T cell recognition (Schoenfeld et al. Cancer Cell 37(4),443-55(2020)) (Zaretsky et al. N Engl J Med 375,819-29(2016)). To model acquired resistance, C57Bl / 6 mice (n=15 / group) were introduced with 75% B16F10 and 25% B16F10-B2m - / - 3 × 10 of the mixture containing cells 5The cells were subcutaneously (sc) inoculated. Mice were treated with anti-Trp1 (TA99) antibody on days 3, 7, 10, 14, and 17 after tumor inoculation, and with mAlb-mIL2 encoding RNA on days 3, 10, and 17, as shown in Figure 33. Isotype antibodies and mAlb-encoding RNA (which does not encode any cytokines) were used as controls. In addition, mice were intraperitoneally (ip) injected with 200 μg of anti-PD-1 (Bioxcell, catalog number BE0146) on days 3, 7, 10, 14, and 17, in combination with a loading dose of 200 μg on day 3 and a subsequent dose of 100 μg of anti-CTLA4 (Bioxcell, catalog number BE0131) on days 7, 10, 14, and 17. Isotype antibodies (Bioxcell, catalog numbers BE0089 and BE0087) were used as controls. The survival of the group administered anti-PD-1 and anti-CTLA4 was compared with the group administered anti-PD-1, anti-CTLA4, TA99, and mAlb-mIL2 to determine whether the addition of tumor-binding antibodies and mAlb-mIL2 enhanced the antitumor activity of ICB. Tumors were excised when mice reached the endpoint criteria and digested as described in Example 1. Samples were treated with single-cell suspensions, and the single-cell suspensions were stimulated with IFNγ as described in Example 1, and then stained as described in Grunwitz et al. (Grunwitz, C. et al. Oncoimmunology 8, published online (2019)). Dead cells were stained with Fixable Yellow Dead Cell Stain (Life Technologies, catalog number L34967). CD45 (BD, catalog number 564279), H2-K b (BD, catalog number 553570) and H2-D bAntibodies against (BD, catalog number 553574) were used. Flow cytometry analysis was performed using a BD LSRFortessa® flow cytometer (Becton Dickinson GmbH), and the acquired data were analyzed using FlowJo software version 10 (TreeStar). The percentage of MHC class I-positive tumor cells was compared across different groups to determine whether ICB resulted in positive selection of resistant MHC class I-deficient cells and whether combination therapy with antibody and mAlb-mIL2 could prevent positive selection.

[0365] Anti-PD-1 and anti-CTLA4 ICBs resulted in delayed tumor growth, with tumors subsequently growing in 80% (12 / 15) of mice, while 20% (3 / 15) of mice rejected the tumor, likely due to bystander elimination of MHC class I-deficient cells (Spiotto et al. Nat Med 10(3),294-8(2004)) (Figure 51). TA99 and mAlb-mIL2 therapy without ICBs resulted in tumor rejection in 33.3% (5 / 15) of mice, and the combination of TA99 and mAlb-mIL2 with ICBs resulted in superior tumor rejection, considering that 60% (9 / 15) of mice were tumor-free at the end of the observation period. This was reflected in significantly improved survival rates compared to the group treated with ICBs alone.

[0366] Analysis of the proportion of MHC class I-positive tumor cells in the tumors showed that the tumor cell ratio remained stable in the control-only treatment group, while ICB resulted in a very significant enrichment of MHC class I-deficient tumor cells. This indicated selective depletion of T-cell-sensitive tumor cells, followed by proliferation of ICB-resistant tumor cells, leading to acquired resistance and tumor recurrence. The addition of TA99 and mAlb-mIL2 completely prevented the selective enrichment of MHC class I-deficient cells.

[0367] In conclusion, the addition of antibody-mediated immunotherapy with mAlb-mIL2 can prevent the emergence of acquired resistance by undermining the selective advantage of T-cell-resistant tumor cells during the course of immunotherapy that induces an MHC class I-dependent T-cell response.

[0368] Example 9: Combination immunotherapy of antibody and mAlb-mIL2 is MC38-Her2-B2m - / - It is effective against tumors and restores the complete response of MHC class I-deficient tumors to classical cancer treatments. To investigate the efficacy of antibody and mAlb-mIL2 therapy against a second MHC class I deficiency tumor model, we used MC38-B2m - / - The cells were transduced using a lent...

Claims

1. A method for treating a subject with cancer that is at least partially resistant to the MHC-dependent T cell response, a. Polynucleotides encoding IL2 or functional variants thereof, or polypeptides containing IL2 or functional variants thereof; and b. Immunotherapy based on antibodies against cancer A method comprising administering the above to the subject.

2. If the cancer is caused by MHC-dependent T cells, especially CD8 + The method according to claim 1, which does not respond well to T cell-based therapy, such as T cell therapy.

3. The method according to claim 1 or 2, wherein the cancer is deficient in antigen processing and / or presentation.

4. The method according to any one of claims 1 to 3, wherein the cancer is MHC-I deficient.

5. The method according to any one of claims 1 to 4, wherein the MHC-I deficiency is due to a mutation or partial or complete loss of an MHC-I allele such as β2-microglobulin (B2M).

6. The method according to any one of claims 1 to 5, wherein the cancer lacks T-cell stimulating ability.

7. The method according to any one of claims 1 to 6, wherein the cancer is deficient in IFN signaling, such as type I IFN or IFNγ signaling.

8. A method for preventing cancer from developing resistance to the MHC-dependent T cell response in subjects with cancer, a. Polynucleotides encoding IL2 or functional variants thereof, or polypeptides containing IL2 or functional variants thereof; and b. Immunotherapy based on antibodies against cancer A method comprising administering the above to the subject.

9. The resistance may be due to the fact that the cancer is a + The method according to claim 8, which includes not responding adequately to T cell-based therapy, such as T cells.

10. The method according to claim 8 or 9, wherein the resistance comprises the cancer being deficient in antigen processing and / or presentation.

11. The method according to any one of claims 8 to 10, wherein the resistance includes the cancer being MHC-I deficient.

12. The method according to any one of claims 8 to 11, wherein the MHC-I deficiency is due to a mutation or partial or complete loss of an MHC-I allele such as β2-microglobulin (B2M).

13. The method according to any one of claims 8 to 12, wherein the resistance comprises the cancer lacking T-cell stimulating ability.

14. The method according to any one of claims 8 to 13, wherein the resistance comprises the cancer being deficient in IFN signaling such as type I IFN or IFNγ signaling.

15. The method according to any one of claims 1 to 14, wherein the polynucleotide encoding the polypeptide containing IL2 or a functional variant thereof is RNA.

16. The method according to any one of claims 1 to 15, wherein the immunotherapy based on the antibody against cancer comprises administering a therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer.

17. The method according to claim 16, wherein the therapeutic antibody against the cancer is against a tumor antigen expressed by cancer cells.

18. The method according to claim 16 or 17, wherein the polynucleotide encoding the therapeutic antibody against the cancer is RNA.

19. a. RNA encoding a polypeptide containing IL2 or a functional variant thereof; and b. Antibodies used for the treatment of cancer The method according to any one of claims 1 to 18, comprising administering to the subject.

20. The method according to any one of claims 1 to 19, wherein the cancer is related to the expression or increased expression of an antigen.

21. The method according to claim 20, wherein the antigen is a tumor antigen.

22. The method according to claim 20 or 21, wherein the immunotherapy based on an antibody against the cancer is against the antigen.

23. The method according to any one of claims 1 to 22, wherein the polypeptide comprising IL2 or a functional variant thereof is extended pharmacokinetic (PK) IL2.

24. The method according to claim 23, wherein the extended PK IL2 comprises a fusion protein.

25. The method according to claim 24, wherein the fusion protein comprises a portion of IL2 or a functional variant thereof and a portion selected from the group consisting of serum albumin, immunoglobulin fragments, transferrin, Fn3, and variants thereof.

26. The method according to claim 25, wherein the serum albumin comprises mouse serum albumin or human serum albumin.

27. The method according to claim 25, wherein the immunoglobulin fragment comprises an immunoglobulin Fc domain.

28. a. A polypeptide containing IL2 or a functional variant thereof, or a polynucleotide encoding IL2 or a polypeptide containing a functional variant thereof; b. A therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer; and c. Instructions for use of pharmaceutical formulations for treating or preventing cancer that is at least partially resistant to the MHC-dependent T cell response. A pharmaceutical preparation containing [the specified ingredient].

29. For treating or preventing cancers that are at least partially resistant to the MHC-dependent T cell response, a. Polynucleotides encoding IL2 or functional variants thereof, or polypeptides containing IL2 or functional variants thereof; and b. A therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer. A pharmaceutical preparation containing [the specified ingredient].

30. a. A polypeptide containing IL2 or a functional variant thereof, or a polynucleotide encoding IL2 or a polypeptide containing a functional variant thereof; b. A therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer; and c. Instructions for use of pharmaceutical formulations for preventing cancer from developing resistance to the MHC-dependent T cell response. A pharmaceutical preparation containing [the specified ingredient].

31. To prevent cancer from developing resistance to the MHC-dependent T cell response, a. Polynucleotides encoding IL2 or functional variants thereof, or polypeptides containing IL2 or functional variants thereof; and b. A therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer. A pharmaceutical preparation containing [the specified ingredient].

32. A pharmaceutical preparation according to any one of claims 28 to 31, which is a kit.

33. A pharmaceutical preparation according to any one of claims 28 to 32, comprising a polypeptide containing IL2 or a functional variant thereof, or a polynucleotide encoding a polypeptide containing IL2 or a functional variant thereof, and a therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer, in separate containers.

34. A pharmaceutical composition, the pharmaceutical preparation according to any one of claims 28 to 31.

35. The pharmaceutical formulation according to claim 34, wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers, diluents and / or excipients.

36. Polynucleotides encoding polypeptides containing IL2 or functional variants thereof, or polypeptides containing IL2 or functional variants thereof, for treating or preventing cancer that is at least partially resistant to the MHC-dependent T cell response, and which are to be administered together with a therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer.

37. A polynucleotide encoding a therapeutic antibody against cancer or a therapeutic antibody against cancer for the treatment or prevention of cancer that is at least partially resistant to the MHC-dependent T cell response, which is to be administered together with a polypeptide comprising IL2 or a functional variant thereof or a polynucleotide encoding a polypeptide comprising IL2 or a functional variant thereof.

38. Polynucleotides encoding polypeptides containing IL2 or functional variants thereof, or polypeptides containing IL2 or functional variants thereof, for the purpose of preventing cancer from developing resistance to the MHC-dependent T cell response, and which are to be administered together with a therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer.

39. A therapeutic antibody against cancer or a polynucleotide encoding a therapeutic antibody against cancer, for the purpose of preventing cancer from developing resistance to the MHC-dependent T cell response, wherein the polynucleotide is to be administered together with a polypeptide containing IL2 or a functional variant thereof or a polynucleotide encoding a polypeptide containing IL2 or a functional variant thereof.