Epitope engineering of the CD38 cell surface receptor
Genetically engineered HSPCs and T cells with edited CD38 genes address the limitations of current immunotherapies by reducing antibody binding and enhancing targeted therapy for hematological malignancies.
Patent Information
- Application Number
- JP2025539804
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-08-01
- Filing Date
- 2024-01-05
- Publication Date
- 2026-01-16
AI Technical Summary
Current immunotherapies for hematological malignancies like acute myeloid leukemia (AML) and multiple myeloma face challenges due to the lack of leukemia-restricted targets, leading to immunosuppression and toxicity, and chimeric antigen receptor T-cell (CAR-T) therapy is limited by target protein expression on both cancer and healthy cells.
Genetically engineered hematopoietic stem/progenitor cells (HSPCs) and T cells with edited CD38 genes, using CRISPR-based gene editing to reduce binding to anti-CD38 antibodies, allowing targeted therapy with reduced toxicity.
The engineered cells provide effective treatment for hematological conditions by minimizing damage to normal cells while targeting cancer cells, enhancing therapeutic efficacy and reducing resistance.
Smart Images

Figure 2026501725000005 
Figure 2026501725000006 
Figure 2026501725000007
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 437,326, filed January 5, 2023, and U.S. Provisional Patent Application No. 63 / 530,217, filed August 1, 2023, each of which is incorporated by reference herein in its entirety. [Background technology]
[0002] Allogeneic hematopoietic stem / progenitor cell (HSPC) transplantation (HSCT) is currently used, at least in clinical settings, to treat high-risk forms of acute leukemia or myelodysplastic syndromes, but it results in long-term relapse-free survival of only 15–20%. Furthermore, despite recent successes of immunotherapies, their application to acute myeloid leukemia (AML) is hindered by the lack of leukemia-restricted targets. The most suitable candidates often possess affinity for targets exhibited by both diseased cells and healthy HSPCs. Therefore, the use of such candidates in AML therapy can result in immunosuppression and life-threatening hematopoietic toxicity. Finally, anti-myeloid / stem cell CAR-T-induced toxicity limits the applicability of these particular immunotherapies as salvage therapy in the limited time frame before HSCT, which may be insufficient for disease eradication.
[0003] Multiple myeloma (MM) is the second most common hematologic malignancy in adults. Despite the approval of several new therapeutic agents that have extended patient survival, MM remains largely incurable. Similar to AML, the development of immunotherapies for MM (e.g., CD38-targeted CAR-T) is limited by the fact that many surface targets are also widely expressed on hematopoietic cells.
[0004] There is a need for effective therapeutic agents that target cells of interest, such as cancer cells or host-affected hematopoietic stem cells. Most advantageously, such therapeutic agents would cause minimal damage to normal cell populations. Summary of the Invention
[0005] The present disclosure generally relates to genetically engineered hematopoietic cells, such as hematopoietic stem cells, progenitor cells, or T cells, with one or more gene-edited genes for cell surface proteins and chimeric antigen receptors capable of targeting the same cell surface proteins. In certain embodiments, the genetically engineered cells are human hematopoietic stem cells (HSCs).
[0006] Provided herein are engineered hematopoietic stem / progenitor cells (HSPCs) or T cells comprising an engineered CD38 gene, wherein the engineered CD38 gene has been engineered such that the encoded protein has reduced binding to a therapeutic anti-CD38 antibody (e.g., daratumumab). In some embodiments, the engineered HSPCs or T cells contain at least one mutation in the engineered CD38 gene that results in a polypeptide having a mutation at position S274. In some embodiments, the mutation at position S274 is S274F. In some embodiments, the therapeutic anti-CD38 antibody has the same six complementarity-determining regions (CDRs) as daratumumab or is otherwise capable of competing with daratumumab for the CD38-binding site.
[0007] Populations of such genetically engineered cells are also provided, as are compositions and kits containing such cells.
[0008] Cells can be genetically engineered using CRISPR system.CRISPR system comprises guide nucleic acid, particularly guide RNA, and nuclease.CRISPR system can be a base editing system that utilizes simple guide RNA.Provided herein is a suitable polynucleotide that functions as guide RNA for use in base editing system.
[0009] In some embodiments of the CRISPR system used to generate the genetically modified gene, the nuclease is Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus (SaCas9), Lachnospiraceae bacterium Cas12a (LbCas12a), or Acidaminococcus sp. BV3L6 (AsCas12a). In some embodiments, the CRISPR system comprises an SpCas9 nuclease. In some embodiments, the nuclease is a catalytically impaired SpCas9 nuclease linked to a base editor enzyme. In some embodiments, the base editor enzyme is a nucleotide deaminase. In some embodiments, the nucleotide deaminase is a cytidine deaminase or an adenosine deaminase.
[0010] Also provided are methods for treating hematological conditions (e.g., multiple myeloma, acute leukemia, or myelodysplastic syndrome, or other lymphoid and myeloid malignancies) comprising administering to a human subject (a) a population of genetically engineered hematopoietic stem / progenitor cells described herein and (b) a therapeutically effective amount of at least one agent comprising an antibody binding domain or an antibody or antibody fragment comprising the antibody binding domain.
[0011] In some embodiments of the therapeutic method using genetically engineered cells comprising a genetically engineered CD38 gene, the antibody is an anti-CD38 antibody. In some embodiments, the agent comprises a chimeric antigen receptor-T (CAR-T) cell comprising an anti-CD38 binding domain. In some such embodiments, the hematological condition is multiple myeloma, acute leukemia, or myelodysplastic syndrome, or other myeloid and lymphoid malignancies. Chimeric antigen receptors (CARs) comprising the polypeptide are also provided. In some embodiments, the polypeptide comprises (a) one or more epitope-binding fragments that bind to epitopes of one or more cell surface lineage-specific proteins, (b) a hinge domain, (c) a transmembrane domain, (d) a costimulatory domain, and (e) a cytoplasmic signaling domain, wherein one of the cell surface lineage-specific proteins is CD38.
[0012] Also provided herein are cells expressing any one of the CARs described herein. In some embodiments, the cells are immune cells. In some embodiments, the immune cells are T cells. Compositions and kits containing such cells are also provided.
[0013] Also provided herein are methods of treating a hematological condition, particularly multiple myeloma, comprising administering to a human subject (a) a population of genetically engineered hematopoietic stem / progenitor cells or T cells described herein, and (b) cells expressing any one of the CARs described herein.
[0014] Polypeptides formed from the engineered genes described herein are also provided, as are nucleic acids encoding the polypeptides, vectors containing the nucleic acids, and cells containing the nucleic acids or vectors. The disclosure also provides methods of making the polypeptides, comprising culturing cells under conditions that allow expression of the polypeptide, and optionally isolating the polypeptide.
[0015] definition As used herein, the terms "identity" and "identical" refer to the sequence identity between two amino acid sequences or two nucleic acid sequences. The phrases "percent identity" and "percent identical," as well as simply "identity," refer to the percentage of sequence identity found in a comparison of two or more amino acid or nucleic acid sequences. Two or more sequences can be anywhere from 0 to 100% identical, or any value therebetween. Identity can be determined by comparing positions in each sequence, which can be aligned for purposes of comparison with a reference sequence. If a position in a compared sequence is occupied by the same nucleotide base or amino acid, the molecules are identical at that position. The degree of identity between amino acid sequences is a function of the number of identical amino acids at positions shared by the amino acid sequences. The degree of identity between nucleic acid sequences is a function of the number of identical or matching nucleotides at positions shared by the nucleic acid (i.e., polynucleotide) sequences.
[0016] Methods for aligning sequences for comparison are well known in the art. Typically, one sequence serves as a reference sequence, and the test sequence is compared by aligning the residues of two sequences (for example, a candidate polypeptide or polynucleotide and a reference polypeptide or polynucleotide of a specific sequence) to optimize the number of identical amino acids or nucleotides along the length of the sequences. Gaps in either or both sequences are allowed when aligning to optimize the number of identical amino acids, but the amino acids or nucleotides in each sequence must still remain in their proper order. The amino acid residues or nucleotides at corresponding amino acid or nucleotide positions are then compared. For example, pairwise comparison analysis of sequences can be performed using the BESTFIT algorithm in the GCG package (version 10.2, Madison, WI). Alternatively, sequences can be compared using the BLAST 2 search algorithm of the Blastp program, as described by Tatiana et al. (FEMS Microbiol. Lett., 174, 247-250 (1999)) and available on the National Center for Biotechnology Information (NCBI) website. Default values for all BLAST2 search parameters can be used, including matrix=BLOSUM62, open gap penalty=11, extended gap penalty=1, gap x_dropoff=50, expectation=10, word size=3, and filter on.
[0017] As used herein, the term "epitope" refers to the amino acid sequence (linear or conformational) of a protein, such as a cell surface antigen, that is bound by a complementarity determining region (CDR) of an antibody.
[0018] As used herein, "subject," "individual," and "patient" are used interchangeably and refer to a human.
[0019] As used herein, the term "effective amount" can be used interchangeably with the term "therapeutically effective amount" and refers to an amount of a cytotoxic agent, genetically engineered cell population, or pharmaceutical composition (e.g., a composition comprising a cytotoxic agent and / or genetically engineered cells) that, upon administration to a subject in need thereof, is sufficient to produce a desired activity, e.g., delay the onset of, halt the progression of, or improve, relieve, reduce, alleviate, or alleviate at least one symptom of a disorder.
[0020] As used herein, terms such as "a," "an," and "the" are not intended to refer to only a single entity, but include general classes for which specific examples may be used for illustration. The terms "a," "an," and "the" are used interchangeably with the term "at least one." The phrases "at least one of" and "including at least one of" followed by a list refer to any one of the items in the list and any combination of two or more items in the list.
[0021] As used herein, the term "or" is generally used in its ordinary sense, including "and / or," unless the context clearly dictates otherwise. The term "and / or" means one or all of the listed elements or a combination of any two or more of the listed elements.
[0022] Unless otherwise indicated, all numbers expressing quantities of ingredients, molecular weights, and the like used in the specification and claims should be understood to be modified in all instances by the term "about." Accordingly, unless specifically indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits by applying ordinary rounding techniques.
[0023] Also herein, the recitation of numerical ranges by endpoints includes all numbers subsumed within that range, as well as the endpoints (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.), and any subranges (e.g., 1 to 5 includes 1 to 4, 1 to 3, 2 to 4, etc.).
[0024] In the foregoing description, for clarity, certain embodiments may be described in isolation. Throughout this specification, references to "one embodiment," "an embodiment," "certain embodiments," or "some embodiments" mean that a particular feature, structure, composition, or characteristic described in connection with an embodiment is included in at least one embodiment of the present disclosure. Thus, the appearance of such phrases in various places throughout this specification does not necessarily refer to the same embodiment of the present disclosure. Furthermore, particular features, structures, compositions, or characteristics may be combined in any suitable manner in one or more embodiments. Thus, features described in the context of one embodiment may be combined with features described in the context of a different embodiment, unless the features are necessarily mutually exclusive.
[0025] The polynucleotide sequences described herein are described using DNA or RNA. Complements, reverse sequences, and reverse complements of DNA and RNA sequences can be easily determined by those skilled in the art and are understood to be within the scope of the present disclosure. It is also understood that sequences disclosed herein as DNA sequences can be converted from DNA sequences to RNA sequences by replacing each thymidine nucleotide (T) with a uridine nucleotide (U). When describing RNA (e.g., a guide RNA) using a DNA sequence, it is understood that the corresponding RNA sequence is a DNA sequence in which each thymidine nucleotide (T) or thymine nucleobase is replaced with a uridine nucleotide (U) or uracil nucleobase. For example, a guide RNA with the DNA sequence GCGTATAG has an RNA sequence of GCGUAUAG. The substituted nucleotide or substituted nucleotide may be modified (e.g., modified sugar, modified internucleoside linkage, etc.).
[0026] Polynucleotide and / or polypeptide or protein sequences may include one or more forms of typographical emphasis (e.g., underlined text, bold text, italicized text). Typographical emphasis is understood to be non-limiting. Sequences presented with typographical emphasis include sequences presented without typographical emphasis. Typographical emphasis may or may not indicate modified nucleotide bases or bonds, modified sequences relative to the presented sequence, spacers, specific codons or codons, specific amino acids or amino acids, the location of features such as primer binding sites, mutation sites, retrotranscriptase templates, complementarity-determining regions, or any combination thereof. Additionally, polynucleotide sequences may be presented in uppercase, lowercase, or a combination thereof. While letters in polynucleotide sequences may be used to distinguish portions of the sequence, the case of letters is non-limiting. Unless otherwise specified, lowercase and uppercase letters indicate the identity of nucleobases.
[0027] The above summary is not intended to describe each disclosed embodiment or every implementation thereof. The following description more particularly exemplifies exemplary embodiments. In several places throughout this application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.
[0028] In several places throughout this application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list. It is understood that the specific examples, materials, amounts, and procedures are to be broadly construed in accordance with the scope and spirit of the invention as set forth herein.
[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the corresponding art. Methods and materials are described herein; other suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Other features and advantages of the present invention will become apparent from the following detailed description, drawings, and claims. [Brief explanation of the drawings]
[0030] [Figure 1A] Crystal structure showing that one orthologous mutation from Macaca Fascicularis to human CD38 protein can efficiently impair binding of the antibody daratumumab on the CD38 glycoprotein (reproduced from Protein Data Bank no. 7dha). [Figure 1B]Binding curves showing that the S274F mutation impairs binding of the antibody daratumumab to the CD38 glycoprotein, while binding of other competing group 3 Abs was unaffected (EC50 values: HM-025, 15 nanograms per milliliter (ng / mL); HM-028, 15 nanograms per liter (ng / L); HM-034, 17 ng / mL) (Reproduced from Michel de Weers et al. in J. Immunol., 186(3):1840-1848 (2011)). [Figure 1C] Schematic diagram showing the genetic engineering of CD38 (top) and the gRNAs used (bottom). [Figure 1D] 10A-10C are various fluorescence-activated cell sorting (FACS) analyses showing that K562 cells were genetically modified. [Figure 1E] 10A-10C are various fluorescence-activated cell sorting (FACS) analyses showing that K562 cells were genetically modified. [Figure 1F] 10A-10C are various fluorescence-activated cell sorting (FACS) analyses showing that K562 cells were genetically modified. [Figure 2A] FIG. 1 is a schematic diagram of daratumumab-based anti-CD38 CAR-1 and anti-CD38 CAR-2. [Figure 2B] T cells were activated via anti-CD3 / CD28 beads (Figure 2A) and cultured in IMDM + IL7-IL15 (Figure 2B). The FACS histogram (Figure 2D) shows the expression of the CD38 marker on day 3 (D3) of stimulation (before CAR transduction). [Figure 2C] T cells were activated via anti-CD3 / CD28 beads (Figure 2A) and cultured in IMDM + IL7-IL15 (Figure 2B). The FACS histogram (Figure 2D) shows the expression of the CD38 marker on day 3 (D3) of stimulation (before CAR transduction). [Figure 2D] T cells were activated via anti-CD3 / CD28 beads (Figure 2A) and cultured in IMDM + IL7-IL15 (Figure 2B). The FACS histogram (Figure 2D) shows the expression of the CD38 marker on day 3 (D3) of stimulation (before CAR transduction). [Figure 2E] CD38 expression at day 7 (D7) of stimulation for different CAR-T cells (anti-CD38 CAR-1 (Figure 2E), anti-CD38 CAR-2 (Figure 2F), anti-cKIT CAR-1 (Figure 2G), and anti-cKIT CAR-2 (Figure 2H)) is shown. Both anti-CD38 CAR-T cells lost CD38 expression, whereas anti-cKIT CAR-T cells retained CD38 expression. An untransduced control (UT) was included (Figure 2I). [Figure 2F] CD38 expression at day 7 (D7) of stimulation for different CAR-T cells (anti-CD38 CAR-1 (Figure 2E), anti-CD38 CAR-2 (Figure 2F), anti-cKIT CAR-1 (Figure 2G), and anti-cKIT CAR-2 (Figure 2H)) is shown. Both anti-CD38 CAR-T cells lost CD38 expression, whereas anti-cKIT CAR-T cells retained CD38 expression. An untransduced control (UT) was included (Figure 2I). [Figure 2G] CD38 expression at day 7 (D7) of stimulation for different CAR-T cells (anti-CD38 CAR-1 (Figure 2E), anti-CD38 CAR-2 (Figure 2F), anti-cKIT CAR-1 (Figure 2G), and anti-cKIT CAR-2 (Figure 2H)) is shown. Both anti-CD38 CAR-T cells lost CD38 expression, whereas anti-cKIT CAR-T cells retained CD38 expression. An untransduced control (UT) was included (Figure 2I). [Figure 2H] CD38 expression at day 7 (D7) of stimulation for different CAR-T cells (anti-CD38 CAR-1 (Figure 2E), anti-CD38 CAR-2 (Figure 2F), anti-cKIT CAR-1 (Figure 2G), and anti-cKIT CAR-2 (Figure 2H)) is shown. Both anti-CD38 CAR-T cells lost CD38 expression, whereas anti-cKIT CAR-T cells retained CD38 expression. An untransduced control (UT) was included (Figure 2I). [Figure 2I]CD38 expression at day 7 (D7) of stimulation for different CAR-T cells (anti-CD38 CAR-1 (Figure 2E), anti-CD38 CAR-2 (Figure 2F), anti-cKIT CAR-1 (Figure 2G), and anti-cKIT CAR-2 (Figure 2H)) is shown. Both anti-CD38 CAR-T cells lost CD38 expression, whereas anti-cKIT CAR-T cells retained CD38 expression. An untransduced control (UT) was included (Figure 2I). [Figure 2J] Anti-CD38 CAR-T cells show a lack of expansion (bottom two lines), while anti-cKIT CAR-T cells (produced as a positive control) show a fold expansion comparable to the untransduced control (UT). [Figure 2K] Figure 1 shows enrichment of CD38 knockout (KO) T cells in the presence of an anti-CD38 CAR, consistent with the fratricidal effect on CD38-expressing T cells. KO was performed using CD38 gRNA in combination with Cas9 protein. [Figure 3A] The percentage of viable target cells (K562 overexpressing CD38) after 4 hours of co-culture with untransduced (UT) cells or anti-CD38 CAR-T cells at different effector:target ratios is shown. Readout was obtained by flow cytometry after apoptosis staining (7AAD-Annexin). [Figure 3B] Shown is the percentage of viable target cells K562 wild-type (WT) (negative for CD38) after 4 hours of co-culture with anti-CD38 CAR-T cells at different effector:target ratios. Readout was obtained by flow cytometry after apoptosis staining (7AAD-Annexin). DETAILED DESCRIPTION OF THE INVENTION
[0031] Identifying proteins suitable for targeted cancer therapy is extremely challenging. Many potential target proteins are present on both the cell surface of cancer cells and normal, non-cancerous cells, and may be involved in the development and / or survival of a subject. Many target proteins contribute to the functionality of such cells. Therefore, treatments targeting these proteins may result in adverse effects in subjects, such as significant toxicity and / or other side effects. Furthermore, resistance to chimeric antigen receptor T-cell (CAR-T) therapy remains a challenge in the treatment of hematopoietic malignancies, such as acute myeloid leukemia (AML) and multiple myeloma (MM), due to evasion of CAR-T therapy due to switching of cancer antigens on the cancer cells. In one aspect of the present disclosure, replacement of cancer cells with a modified population of normal cells is performed using normal cells engineered to prevent the cells from binding to cytotoxic drugs.
[0032] Thus, the present disclosure provides methods, cells, compositions, and kits. The methods, cells, compositions, and kits described herein can be administered to a subject suffering from a hematological condition (e.g., a malignant tumor). The methods, cells, compositions, and kits described herein can provide effective treatment for hematological conditions, particularly malignant tumors, by targeting one or more cell surface proteins present not only on cancer cells but also on cells essential for their development and / or survival in the subject. In some cases, described herein are genetically engineered cells (e.g., HSPCs or T cells), such as hematopoietic stem / progenitor cells (HSPCs) with gene edits in one or more genes encoding cell surface proteins, e.g., CD38; methods of producing the same, e.g., using a nucleotide-guided gene editor (CRISPR) approach with specific guide RNAs; methods of treating hematopoietic conditions, particularly malignancies, using the engineered hematopoietic cells, alone or in combination with one or more cytotoxic agents (e.g., CAR-T cells) that target wild-type cell surface antigens but not those encoded by edited genes in the engineered hematopoietic cells; and kits comprising the engineered hematopoietic cells.
[0033] I. Genetically Engineered Cells (e.g., HSPCs and / or T Cells) In some embodiments, the genetically engineered cells (e.g., HSPCs or T cells) have an edited CD38 gene. In some embodiments, one or more of these genes are mutated. In some cases, the mutated CD38 gene contains mutations or deletions in one or more non-essential epitopes such that the biological activity of the CD38 gene is retained (in whole or in part).
[0034] i.Hematopoietic stem / progenitor cells (HSPC) In some embodiments, the hematopoietic cells described herein are hematopoietic stem / progenitor cells. Hematopoietic stem / progenitor cells (HSPCs) can give rise to both myeloid and lymphoid progenitor cells, which further give rise to myeloid cells (e.g., monocytes, macrophages, neutrophils, basophils, dendritic cells, erythrocytes, platelets, etc.) and lymphoid cells (e.g., T cells, B cells, NK cells), respectively. HSPCs are characterized by expression of the cell surface marker CD34 (e.g., CD34+), which can be used to identify and / or isolate HSPCs.
[0035] In some embodiments, the HSPCs are obtained from a human subject. In some embodiments, the human subject is a non-human primate, rodent (e.g., mouse or rat), cow, pig, horse, or livestock. In some embodiments, the HSPCs are obtained from a human patient, such as a human patient suffering from a hematopoietic malignancy. In some embodiments, the HSPCs are obtained from a healthy donor. In some embodiments, the HSPCs are obtained from a donor not suffering from a hematopoietic malignancy. In some embodiments, the HSPCs are obtained from a subject to whom the genetically engineered HSPCs will subsequently be administered. HSPCs administered to the same subject from which the cells were obtained are referred to as autologous cells. HSPCs obtained from a subject other than the subject to whom the cells will be administered are referred to as allogeneic cells. In embodiments in which the cells are allogeneic cells, the method can be modified to reduce the incidence of rejection. Methods for reducing the incidence of rejection are standard and well known in the art.
[0036] HSPCs can be obtained from any suitable source using conventional means known in the art. In some embodiments, HSPCs are obtained from a sample from a subject (or donor), such as bone marrow, blood (e.g., peripheral blood mononuclear cells (PBMCs)), and / or umbilical cord (i.e., cord blood cells). Generally, bone marrow cells can be obtained from the iliac eminence, femur, tibia, spine, ribs, or other medullary cavity of a subject (or donor). Bone marrow can be harvested from a patient and isolated through various separation and purification procedures known in the art.
[0037] HSPCs are usually present in bone marrow, but can be mobilized into the circulating blood by administering a mobilization agent to collect HSPCs from peripheral blood. In some embodiments, the subject (or donor) from which HSPCs are obtained is administered a mobilization agent such as granulocyte colony-stimulating factor (G-CSF). The number of HSPCs collected after mobilization using a mobilization agent is typically greater than the number of cells obtained without using a mobilization agent.
[0038] In some embodiments, a sample is obtained from a subject (or donor) and then enriched for a desired cell type (e.g., CD34+, CD34+CD38-, CD133+, CD90+, CD49f+). For example, PBMCs and / or CD34+ hematopoietic cells can be isolated from blood. Cells can also be isolated from other cells, for example, by isolation and / or activation with an antibody that binds to an epitope on the cell surface of the desired cell type. Another method that can be used includes negative selection using antibodies against cell surface markers that selectively enrich for a particular cell type without activating the cells by receptor binding.
[0039] ii.T cells T cells are typically immune cells of the lymphoid system. T cells express a T cell receptor (TCR), with most cells expressing alpha and beta chains, and a smaller population expressing gamma and delta chains. T cells useful as immune cells can be CD4+ or CD8+ and include T helper cells (CD4+), cytotoxic T cells (cytotoxic T lymphocytes, CTLs; also called CD8-T cells), and memory T cells (central memory T cells (TCM), stem memory T cells (TSCM), stem cell-like memory T cells (or stem-like memory T cells), and effector memory T cells, e.g., T cell and T cell RA (CD45RA+) cells, effector T cells, Th1 cells, Th2 cells, etc. These may include, but are not limited to, Th9 cells, Th17 cells, Th22 cells, Tfh (follicular helper) cells, T regulatory cells, natural killer T cells, mucosal-associated invariant T cells (MAIT), and gamma / delta T cells. The major T cell subtypes include TN (naive), TSCM (stem cell memory), TCM (central memory), TTM (transitional memory), TEM (effector memory), and TTE (terminal effector). In one embodiment, the T cells are , immunostimulatory cells, i.e., cells that mediate an immune response. Exemplary T cells that are immunostimulatory include T helper cells (CD4+), cytotoxic T cells (cytotoxic T lymphocytes, CTLs; also called CD8- T cells), and memory T cells (central memory T cells (TCM), stem memory T cells (TSCM), stem cell-like memory T cells (or stem-like memory T cells), and effector memory T cells, e.g., TEM cells and TEMRA (CD45RA+) cells, effector T cells, and effector T cells. Examples of T cells include, but are not limited to, T cell, Th1 cell, Th2 cell, Th9 cell, Th17 cell, Th22 cell, Tfh (follicular helper) cell, natural killer T cell, mucosal-associated invariant T cell (MAIT), and gamma / delta T cell. In another embodiment, the T cell is an immunoinhibitory cell, i.e., a cell that inhibits an immune response. Exemplary T cells that are immunoinhibitory include regulatory T cells (T regulatory cells, Treg) and follicular regulatory T cells (Tfh) cells.T cells can optionally be generated from embryonic stem cells or induced pluripotent stem cells (iPSCs) (e.g., Themeli et al., Nat. Biotechnol. 31(10):928-933(2013)).
[0040] The type of T cell selected typically depends on whether it is desired to stimulate an immune response or inhibit an immune response. For example, regulatory T cells (CD4+CD25highFoxpP3+) are used to treat subjects who need an inhibited immune response, such as those with autoimmune diseases, and CD4+ (excluding Treg) / CD8+ T cells are used to treat subjects who need an stimulated immune response, such as those with cancer.
[0041] T cells can be isolated by methods well known in the art, including commercially available isolation methods. Sources of T cells include, but are not limited to, peripheral blood, umbilical cord blood, bone marrow, or other sources of hematopoietic cells. Various techniques can be used to separate cells to isolate or enrich for desired immune cells, such as T cells. For example, negative selection methods can be used to remove cells that are not desired immune cells. In addition, positive selection methods can be used to isolate or enrich for desired T cells, or a combination of positive and negative selection methods can be used. Monoclonal antibodies (MAbs) are particularly useful for identifying markers associated with specific cell lineages and / or differentiation stages for both positive and negative selection. When isolating specific types of T cells, various cell surface markers or combinations of markers can be used to separate cells, including, but not limited to, CD3, CD4, CD8, CD34 (for hematopoietic stem and progenitor cells), as is well known in the art.
[0042] T cells can be autologous or non-autologous to the subject to whom they are administered in the therapeutic methods disclosed herein. Optionally, the cells can be obtained by leukocyte transplantation, in which leukocytes are selectively removed from extracted blood, recombinant cells are generated, and then the cells are returned to the donor. Alternatively, allogeneic cells from a non-autologous donor other than the subject can be used. In the case of a non-autologous donor, the cells are typed and human leukocyte antigen (HLA) matched to determine the appropriate level of compatibility, as is well known in the art. For both autologous and non-autologous cells, the cells can optionally be cryopreserved using methods well known in the art until ready to be used for genetic manipulation and / or administration to the subject.
[0043] iii. Mutant cell surface antigens In some embodiments, the hematopoietic stem / progenitor cells (HSPCs) or T cells described herein may contain an edited gene encoding one or more cell surface proteins of interest (e.g., CD38) in a mutated form (mutant or variant, used interchangeably herein). The variant may have reduced or no binding to a cytotoxic agent (e.g., an anti-CD38 antibody) described herein. The variant may include one or more mutations in the epitope to which the cytotoxic agent binds (e.g., the nucleotide sequence encoding the epitope and the amino acid sequence of the epitope), such that binding to the cytotoxic agent is reduced or eliminated compared to the native or wild-type cell surface protein counterpart. Such variants may be preferred to maintain substantially similar biological activity as the wild-type counterpart.
[0044] As used herein, the term "reduced binding" refers to binding that is reduced by at least 25%. The level of binding can refer to the amount of binding of a cytotoxic agent to hematopoietic stem cells, progenitor cells, or T cells, or the amount of binding of a cytotoxic agent to a cell surface protein, when compared to the wild-type (i.e., unengineered, unmutated) protein. In some embodiments, binding is reduced by at least 25%, at least 30%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%. In some embodiments, binding is reduced such that there is substantially no detectable binding in conventional assays. As used herein, "no binding" refers to substantially no binding, e.g., no detectable binding, or only baseline binding as determined in conventional binding assays. Binding and reduced binding can be measured using quantitative fluorescence reduction, e.g., by performing fluorescence-activated cell sorting (FACS) titration.
[0045] In some cases, the variant (mutant) contains one or more amino acid residue substitutions (e.g., 1, 2, 3, 4, 5, or more) within the epitope of interest, such that the cytotoxic agent does not bind to the mutated epitope or has reduced binding to the mutated epitope. Such variants may have substantially reduced binding affinity to the cytotoxic agent (e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% lower binding affinity than their wild-type counterparts) or may have abolished binding activity to the cytotoxic agent. In other cases, the variant contains a deletion of a region containing the epitope of interest. Such a region may be encoded by an exon. In some embodiments, the region is a domain of the cell surface protein of interest that encodes the epitope. In one example, the variant has only the epitope deleted. The length of the deleted region can range from 3 to 60 amino acids, for example, 5 to 50, 5 to 40, 10 to 30, 10 to 20, 5 to 10, etc.
[0046] In some embodiments, the cytotoxic agent binds to one or more (e.g., at least 2, at least 3, at least 4, at least 5, or more) epitopes of the cell surface antigen. In some embodiments, the cytotoxic agent binds to multiple epitopes of the cell surface antigen, and the cell (e.g., HSPC or T cell) is engineered so that each of the epitopes is absent and / or unavailable for binding by the cytotoxic agent.
[0047] The mutation(s) or deletion(s) in the variant of the cell surface antigen may be within or surrounding a non-essential epitope such that the mutation(s) or deletion(s) do not substantially affect the biological activity of the protein.
[0048] In some embodiments, the genetically engineered cells (e.g., HSPCs or T cells) described herein have one or more edited genes for a cell surface antigen, such that the edited genes express a mutant cell surface antigen with mutations in one or more non-essential epitopes. A "non-essential epitope" (or a fragment containing it) refers to a domain within a cell surface protein / antigen, the mutation of which is unlikely to substantially affect the biological activity of the cell surface protein. For example, when engineered cells (e.g., HSPCs or T cells) contain deletions or mutations in non-essential epitopes of a cell surface antigen, such engineered cells can proliferate and / or undergo erythroid differentiation to a similar level as cells expressing the wild-type cell surface antigen. Methods for identifying and / or validating non-essential epitopes in cell surface antigens are well known. Furthermore, methods for assessing cell surface antigens and functionality of engineered cells are known in the art and include, for example, proliferation assays, differentiation assays, colony formation, expression analysis (e.g., gene and / or protein), protein localization assays, intracellular signaling assays, functional assays, and studies in humanized mouse models.
[0049] iv. Preparation of genetically engineered cells (e.g., HSPCs or T cells) Any of the genetically engineered cells (e.g., HSPCs or T cells) encoding one or more cell surface antigens can be prepared by conventional methods or by the methods described herein. In some embodiments, the genetic engineering is performed using genome editing. As used herein, "genome editing" refers to a method of modifying a genome, including any protein-coding or non-coding nucleotide sequence of an organism, to alter the expression of a target gene. Generally, genome editing methods involve the use of endonucleases capable of cleaving nucleic acids in the genome. For example, endonucleases can cleave nucleic acid sequences in the genome at target nucleotide sequences. In some cases, genome editing methods involve the use of nucleases that are catalytically "dead" nucleases or nickases. Repair of double-strand breaks in the genome often introduces mutations and / or introduces exogenous nucleic acids into the target site. In some cases, genome editing methods involve the use of catalytically inactive or partially inactive endonucleases fused to functional domains, such as, in the case of base editors, an adenine or cytidine deaminase domain. Other functional domains include reverse transcriptases, RNA-binding proteins, transcription factors, DNA repair machinery, prime editors, CRISPR-Cas activators or repressors, etc.
[0050] Genome editing methods are generally classified based on the type of endonuclease involved in generating double-strand breaks in target nucleic acids. Genome editing methods include the use of zinc finger enzymes (ZFNs), transcription activator-like effector-based nucleases (TALENs), meganucleases, and clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) protein systems. Modifications (editing) can include deletion or mutation of epitopes of specific cell surface proteins using CRISPR / Cas systems, such as CRISPR / Cas9.
[0051] v. CRISPR-Cas system In some embodiments, engineered HSPCs are engineered using the CRISPR system. The CRISPR system includes a guide nucleic acid and a nuclease. Cas nucleases can be easily programmed to cleave target DNA sequences for genome editing in various organisms. One class of these nucleases, called Cas9 protein or Cas9 nuclease, forms a complex with two short RNAs: crRNA and transactivating crRNA (tracrRNA). The crRNA and tracrRNA typically hybridize to form a guide RNA (gRNA). The most commonly used Cas9 ortholog, S. pyogenes cas9 (SpCas9), uses a crRNA with a 20-nucleotide (nt) "spacer" region at its 5' end that is complementary to the strand opposite the "protospacer" region of the target DNA site. SpCas9 recognizes a protospacer adjacent motif (PAM) for efficient cleavage. The crRNA and tracrRNA sequences can be joined to form a single, approximately 100-nt, single guide RNA (sgRNA, a type of gRNA) that directs the DNA cleavage activity of SpCas9. A Cas protein called Cpf1 (also called Cas12a) has been identified that can also be programmed to cleave target DNA sequences. Unlike SpCas9, Cpf1 does not contain a tracrRNA sequence but instead uses a single 42-nt crRNA, which has 23 nt at its 3' end that is complementary to the protospacer of the target DNA sequence.
[0052] In some embodiments, the Cas endonuclease is a Cas9 nuclease or a variant thereof that cleaves both strands of double-stranded DNA of the target nucleic acid, resulting in blunt ends. In some embodiments, the Cas endonuclease is a Cpf1 nuclease or a variant thereof that cleaves both strands of double-stranded DNA of the target nucleic acid, resulting in shifting of the ends of the nucleic acid.
[0053] CRISPR-Cas9 system In some embodiments, the Cas endonuclease is a Cas9 enzyme or a variant thereof. In some embodiments, the Cas9 endonuclease is derived from Streptococcus pyogenes (SpCas9) having a known (wild-type) sequence (see uniprot.org / uniprotkb / Q99ZW2 / entry, accession number AAK33936.1) or has a sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of the wild-type SpCas9 endonuclease, e.g., with at most 5%, at most 10%, at most 15%, or at most 20% difference in residues replaced with conservative mutations. In some embodiments, the Cas9 endonuclease is derived from Staphylococcus aureus (SaCas9) having a known (wild-type) sequence (see uniprot.org / uniprotkb / J7RUA5 / entry, accession number CCK74173.1) or has a sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to the amino acid sequence of wild-type SaCas9, e.g., with up to 5%, up to 10%, up to 15%, or up to 20% difference, e.g., of residues replaced with conservative mutations. In preferred embodiments, the endonuclease retains the desired activity of the parent, e.g., nuclease activity (unless the parent is a nickase or death Cas9), and / or the ability to interact with guide RNA and target DNA.
[0054] As used herein, in the context of amino acid sequences, "conservative" variations (i.e., conservative substitutions) of amino acids in endonucleases or other polypeptides described herein can be selected from other members of the class to which the amino acid belongs. For example, in the field of protein biochemistry, it is well known that an amino acid belonging to a group of amino acids having a particular size or property (such as charge, hydrophobicity, and hydrophilicity) can be substituted for another amino acid without altering the activity of the protein, particularly in regions of the protein not directly related to biological activity. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, or glutamine. Positively charged (basic) amino acids include arginine, lysine, or histidine. Negatively charged (acidic) amino acids include aspartic acid or glutamic acid. Conservative substitutions include, for example, Lys for Arg or vice versa to maintain a positive charge, Glu for Asp or vice versa to maintain a negative charge, Ser for Thr or vice versa to maintain a free -OH, Gln for Asn or vice versa to maintain a free -NH2. Similarly, biologically active analogs of polypeptides containing one or more consecutive or non-consecutive amino acid deletions or additions that do not eliminate the functional activity of the polypeptide are also contemplated.
[0055] Generally, the target nucleic acid is flanked on the 3' or 5' side by a protospacer adjacent motif (PAM), which can interact with the endonuclease and further participate in targeting the endonuclease activity to the target nucleic acid. Generally, the PAM sequence flanking the target nucleic acid is believed to depend, at least in part, on the endonuclease and the source from which the endonuclease is derived. For example, in the case of the Cas9 endonuclease derived from Streptococcus pyogenes, the PAM sequence is NGG, although the PAM sequences NAG and NGA can be recognized with lower efficiency (N is A, C, G, or T). In the case of the Cas9 endonuclease derived from Staphylococcus aureus, the PAM sequence is NNGRRT (N is A, C, G, or T, and R is A or G).
[0056] Thus, in some embodiments, an endonuclease is engineered / modified to recognize one or more PAM sequences. In some embodiments, the endonuclease is engineered / modified to recognize one or more PAM sequences that are different from the PAM sequences that the endonuclease recognizes without engineering / modification. In some embodiments, the endonuclease may be modified to recognize PAM sequences that lack guanine. In some embodiments, the endonuclease may be modified to recognize PAM sequences that include "ACA," "AGC," or "AAA." In some embodiments, the endonuclease is engineered / modified to reduce the off-target activity of the enzyme. In some embodiments, the nucleotide sequence encoding the endonuclease is modified to alter the PAM recognition of the endonuclease. For example, a Cas endonuclease (e.g., SpCas9) has mutations at one or more of positions A61, L1111, D1135, S1136, G1218, E1219, N1317, A1322, R1333, R1335, and T1337. See, e.g., International Patent Application Publication Nos. WO2016 / 141224 and WO2017 / 040348, and U.S. Patent Application Publication No. 2021 / 0284978A1.
[0057] In some embodiments, the Cas9 endonuclease is a catalytically inactive (i.e., catalytically impaired) Cas9. For example, dCas9 contains mutations at catalytically active residues (D10, E762, D839, H983, or D986, and / or H840 or N863) and has no nuclease activity. For example, the mutations are (i) D10A or D10N and / or (ii) H840A, H840N, or H840Y. In some embodiments, the catalytically impaired SpCas9 contains a mutation at position D10A. In some embodiments, the catalytically impaired SpCas9 contains a mutation D10N. In some embodiments, the catalytically impaired SpCas9 contains a mutation at position K918. In one or more embodiments, the catalytically impaired SpCas9 contains a mutation K918N.
[0058] In some embodiments, the nucleotide sequence encoding the Cas9 endonuclease is further modified to alter the activity of the protein. In some embodiments, the Cas9 endonuclease is modified to inactivate one or more catalytic residues of the endonuclease. In some embodiments, the Cas9 endonuclease is modified to inactivate one of the catalytic residues of the endonuclease, referred to as "nickase" or "Cas9n." The Cas9 nickase endonuclease cleaves one DNA strand of the target nucleic acid.
[0059] In some embodiments, the catalytically impaired SpCas9 is NG-SpCas9 or SpRY-SpCas9. The endonuclease NG-SpCas9 nickase has the following mutations relative to wild-type SpCas0: D10A, L1111R, D1135V, G1218R, E1219F, A1322R, R1335V, and T1337R. The endonuclease SpRY-Cas9 nickase has the following mutations relative to wild-type SpCas9: D10A, A61R, L1111R, D1135L, S1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, and T1337R.
[0060] CRISPR Cpf1 (Cas12a) In some embodiments, the Cas endonuclease is Cpf1 nuclease (also referred to as Cas12a) or a variant thereof. Cpf1 endonuclease generally recognizes a PAM sequence located at the 5' end of the target nucleic acid. For Cpf1 nuclease, the PAM sequence is TTTN (where N is A, C, G, or T). In some embodiments, the host cell expresses a Cpf1 nuclease from Lachnospiraceae bacterium (LbCpf1), Acidaminococcus sp. (AsCpf1), or Francisella tularensis (FnCpf1). The wild-type sequences of each are known: Type V CRISPR-associated protein Cpf1 (Lachnospiraceae bacterium ND2006), GenBank accession number WP_051666128.1; Type V CRISPR-associated protein Cpf1 [Acidaminococcus sp. BV3L6], NCBI reference sequence: WP_021736722.1; and Type V CRISPR-associated protein Cpf1 (Francisella tularensis), GenBank accession number WP_003040289.1.
[0061] In some embodiments, the Cpfl endonuclease is a wild-type version of a nuclease. In some embodiments, the Cpfl endonuclease is at least 80%, at least 85%, at least 90%, or at least 95% identical in amino acid sequence to the wild-type sequence, e.g., with up to 5%, up to 10%, up to 15%, or up to 20% of the residues replaced, e.g., by conservative mutations. In some embodiments, the endonuclease retains the desired activity of the parent, e.g., nuclease activity (unless the parent is a nickase or death Cas9), and / or the ability to interact with a guide RNA and target DNA.
[0062] In some embodiments, the Cas12a endonuclease is a catalytically inactive variant, which may be referred to as dCas12a.
[0063] Cas endonuclease functional domains and the CRISPR base editing system Alternatively, or in addition, a Cas endonuclease (i.e., Cas9 or Cas12a) can be fused to another protein or portion thereof, e.g., a heterologous functional domain. In some embodiments, the heterologous functional domain is a transcriptional activation domain (e.g., VP64 or NF-KB p65). In some embodiments, the heterologous functional domain is a transcriptional silencer or transcriptional repression domain (e.g., a transcriptional repression domain is a Kruppel-associated box (KRAB) domain, an ERF repressor domain (ERD), or an mSin3A-interacting domain (SID), and a transcriptional silencer is heterochromatin protein 1 (HP1)). In some embodiments, the heterologous functional domain is an enzyme that modifies the methylation state of DNA (e.g., a DNA methyltransferase (DNMT) or a TET protein (such as TET1)). In some embodiments, the heterologous functional domain is an enzyme that modifies a histone subunit (e.g., a histone acetyltransferase (HAT), a histone deacetylase (HDAC), a histone methyltransferase (HMT), or a histone demethylase). In some embodiments, the heterologous functional domain is a biological tether (e.g., MS2, Csy4, or lambda N). In some embodiments, the heterologous functional domain is FokI.
[0064] In some embodiments, the heterologous functional domain and endonuclease form a base editor. In some such embodiments, the heterologous functional domain can be a deaminase that modifies cytosine DNA bases, such as a cytidine deaminase from apolipoprotein B mRNA editing enzyme, the catalytic polypeptide-like (APOBEC) family of deaminases (including APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D / E, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4), activation-induced cytidine deaminase (AID), cytosine deaminase 1 (CDA1), and CDA2, and cytosine deaminase acting on tRNA (CDAT). Specific examples of base editors include evoAPOBEC1-BE4max, eA3A-BE5, EA-BE4max, or the deaminases disclosed in Neugebauer, Monica, et al., Nat. Biotechnol. 1-13 (2022) and Nat. Biotechnol., 41, 673-685 (2023).
[0065] In some embodiments, the heterologous functional domain is a deaminase that modifies adenosine DNA bases, for example, the deaminase is adenosine deaminase 1 (ADA1), ADA2; adenosine deaminase acting on RNA1 (ADAR1), ADAR2; adenosine deaminase acting on ADAR3; adenosine deaminase acting on tRNA1 (ADAT1), ADAT2, ADAT3; and naturally occurring or engineered tRNA-specific adenosine deaminase (TadA). For example, ABE8e-TadA-8e. In some embodiments, the TadA adenosine deaminase domain comprises the V106W mutation.
[0066] In some embodiments, the endonuclease is a base editor. The base editor endonuclease generally comprises a catalytically inactive Cas endonuclease fused to a base editor. For example, the endonuclease is SpCas9 with mutations at D10, E762, D839, H983, or D986, and / or H840 or N863, fused to a base editor, such as those described above.
[0067] Base editors can be used in CRISPR base editing methodologies, which can directly introduce point mutations into cellular DNA without inducing double-stranded DNA breaks. For example, cytosine base editors are targeted to specific gene loci by guide RNAs, converting cytidine to uridine, which is then converted to thymidine via base excision repair, resulting in a C to T change (or a G to A change on the opposite strand). Adenine base editors convert adenosine to inosine, which is treated like guanosine by cells, resulting in an A to G (or a T to C) change. In general, base editing techniques edit targeted nucleotides without causing double-stranded breaks or relying on homology-directed repair. Such systems are commercially available (e.g., addgene.org) and are described, for example, in A.C. Komor et al., Nature, 533:420-424 (2016).
[0068] In some embodiments, the heterologous functional domain is an enzyme, domain, or peptide that inhibits or enhances endogenous DNA repair or base excision repair (BER) pathways, e.g., uracil DNA glycosylase inhibitor (UGI), which inhibits uracil DNA glycosylase (UDG, also known as uracil N-glycosylase or UNG)-mediated excision of uracil to initiate BER, or a DNA end-binding protein such as Gam from bacteriophage Mu.
[0069] In some cases, the endonuclease (Cas9 or Cas12a) is fused to one or more of a nuclear localization sequence, a cell-penetrating peptide sequence, an affinity tag, and / or a fluorescent protein. For example, the nuclear localization sequence is the SV40 large T antigen nuclear localization sequence (PKKKRKV, SEQ ID NO: 1), the nucleoplasmin nuclear localization sequence (KRPAATKKAGQAKKKK, SEQ ID NO: 2), or the c-Myc nuclear localization sequence (PAAKRVKLD, SEQ ID NO: 3). For example, the nuclear localization sequence(s) are fused to the N-terminus and / or C-terminus of the Cas9 or Cas12a protein. In some embodiments, when a heterologous functional domain is fused to the N-terminus and / or C-terminus of the Cas9 or Cas12a protein, the nuclear localization sequence(s) are inserted at the N-terminus and / or C-terminus of the heterologous functional domain-Cas protein complex, or between the heterologous functional domain and the Cas protein.
[0070] Exemplary Cas endonuclease sequences are provided below: SEQ ID NO:4 - Amino acid sequence of SpRY-ABE8e-V106W 3×NLS adenine base editor: SEQ ID NO:5 - Amino acid sequence of SpRY-ABE8e 3×NLS adenine base editor: SEQ ID NO:6 - Amino acid sequence of SpRY-evoAPOBEC1-BE4 3×NLS adenine base editor: SEQ ID NO:7 - Amino acid sequence of SpRY-K918N-ABE8e-V106W 3xNLS adenine base editor: SEQ ID NO:8 - Nucleotide sequence of SpRY-ABE8e-V106W 3xNLS adenine base editor: SEQ ID NO:9 - Nucleotide sequence of SpRY-evoAPOBEC1-BE4 3xNLS adenine base editor: gagaatgtgatgctgctgacctctgacgcccccgagtataagccttgggccctggtcatccaggattctaacggcgagaataagatcaagatgctgagcggaggatccggaggatctggaggcagc accaacctgtctgacatcatcgagaaggagacaggcaagcagctggtcatccaggagagcatcctgatgctgcccgaagaagtcgaagaagtgatcggaaacaagcctgagagcgatatcctggtcc ataccgcctacgacgagagtaccgacgaaaatgtgatgctgctgacatccgacgccccagagtataagccctgggctctggtcatccaggattccaacggagagaacaaaatcaaaatgctgtctgg cggctcaaaaagaaccgccgacggcagcgaattcgagcccaagaagaagaggaaagtcggcagcggaagcaaaaggccggcggccacgaaaaaggccggccaggcaaaaaagaaaaagctcgagtaa SEQ ID NO:10 - Nucleotide sequence of SpRY-K918N-ABE8e-V106W 3xNLS adenine base editor:
[0071] CRISPR guide RNA The terms "gRNA," "guide RNA," and "CRISPR guide sequence" are used interchangeably throughout and refer to a nucleic acid comprising a sequence that determines the specificity of the Cas DNA-binding protein of a CRISPR / Cas system. A gRNA hybridizes (e.g., is either partially or fully complementary to) a target nucleic acid sequence within the genome of a host cell and facilitates the specific association or targeting of an RNA-guided nuclease, such as Cas9 or Cpfl, to the target sequence. A gRNA can be unimolecular (comprising a single RNA molecule, alternatively referred to as a chimera or sgRNA) or modular (comprising multiple, typically two separate RNA molecules, such as a CRISPR RNA (crRNA) and a trans-activating CRISPR RNA (tracrRNA), which are usually associated with each other, e.g., by duplexing or hybridization). Thus, in some cases, gRNA refers collectively to both crRNA and tracrRNA (e.g., when a Cas9 nuclease is used, in those cases the guide RNA may be referred to as a single guide RNA, i.e., sgRNA). In other cases, gRNA refers to only the crRNA (e.g., when Cpf1 endonuclease is used).
[0072] Guide RNAs, whether unimolecular or modular, contain a "targeting domain" that is fully or partially complementary to a target domain within a target sequence. Targeting domains are referred to by various names in the literature, including, but not limited to, "guide sequence," "complementarity region," "spacer," and generally, "crRNA." The gRNA, or portion thereof, that hybridizes to the target nucleic acid can be 15-25 nucleotides in length, 18-22 nucleotides in length, or 19-21 nucleotides in length. In some embodiments, the gRNA sequence that hybridizes to the target nucleic acid is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the gRNA sequence that hybridizes to the target nucleic acid is 10-30 nucleotides in length, or 15-25 nucleotides in length. In some embodiments, the gRNA sequence is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target nucleic acid.
[0073] In addition to the targeting domain, gRNAs typically (but not necessarily) contain multiple domains that can affect the formation or activity of the Cas9 / gRNA complex. This includes, for example, one or more polyA tracts that can be recognized by RNA polymerase as termination signals, and two or more additional double-stranded regions involved in nuclease activity in vivo, but not necessarily in vitro. While this description focuses on gRNAs for use with Cas9, there are other RNA-guided nucleases that utilize gRNAs that differ in some ways from those described herein. Other gRNA designs are further described, for example, in International Publication No. WO2019 / 084168.
[0074] Those skilled in the art will understand that while structural differences may exist between gRNAs derived from different prokaryotic species, or between Cpfl and Cas9 gRNAs, the principles by which gRNAs operate are generally consistent. Because of this consistency of operation, gRNAs may be broadly defined by their targeting domain sequence, and those skilled in the art will understand that a given targeting domain sequence can be incorporated into any suitable gRNA, including monomolecular or chimeric gRNAs, or gRNAs containing one or more chemical and / or sequential modifications (substitutions, additional nucleotides, truncations, etc.). Therefore, for economy of presentation in this disclosure, gRNAs will be described only in terms of their targeting domain sequence.
[0075] Exemplary guide crRNAs for editing the CD38 gene are shown in Table 1 below. As is well known, the selection of a gRNA sequence can depend on factors such as the number of predicted on-target and / or off-target binding sites. In some embodiments, the gRNA sequence is selected to maximize potential on-target sites and minimize potential off-target sites.
[0076] In some embodiments, multiple gRNAs are introduced into cells. In some embodiments, two or more guide RNAs are transfected into cells in equimolar amounts. In some embodiments, two or more guide RNAs are provided in non-equimolar amounts. In some embodiments, two or more guide RNAs are provided in amounts that are optimized to ensure that editing of each target occurs at equal frequency. In some embodiments, two or more guide RNAs are provided in amounts that are optimized to ensure that editing of each target occurs at optimal frequency.
[0077] Provided herein are polynucleotides suitable for use as guide spacer sequences having sequences at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequences set forth in Table 1 (SEQ ID NOS: 11-13). Each of these polynucleotides is suitable for use as a crRNA segment in a guide RNA forming a genetically modified CD38 gene resulting in a polypeptide with a mutation at position S274. [Table 1]
[0078] vi. Genetically engineered cells (e.g., HSPCs and / or T cells) Provided herein are "genetically engineered cells," which refer to cells that contain a polynucleotide not naturally possessed by the cell. Also provided herein are methods of producing the genetically engineered cells described herein (e.g., HSPCs and / or T cells) that contain edited genes to express one or more cell surface antigens in a mutant form.
[0079] Methods for producing a genetically engineered cell can include providing a cell and introducing into the cell cellular components of a nucleotide-guided gene editing system for genome editing. In some embodiments, a nucleic acid comprising a gRNA that hybridizes, or is predicted to hybridize, to a portion of a nucleotide sequence encoding a cell surface antigen is introduced into the cell. In some embodiments, the gRNA is introduced into the cell on a vector. In some embodiments, a Cas endonuclease is introduced into the cell. In some embodiments, the Cas endonuclease is introduced into the cell as a nucleic acid encoding the Cas endonuclease. In some embodiments, the gRNA and the nucleotide sequence encoding the Cas endonuclease are introduced into the cell on the same nucleic acid (e.g., the same vector). In some embodiments, the Cas endonuclease is introduced into the cell in the form of a protein. In some embodiments, the Cas endonuclease and gRNA are preformed in vitro and introduced into the cell as a ribonucleoprotein complex.
[0080] Genetically engineered cells expressing mutant CD38 In some embodiments, the cell surface protein is CD38. The amino acid sequence of wild-type CD38 is known (uniprot.org / uniprotkb / P28907 / entry) (accession number AAA68482.1).
[0081] In some embodiments, the methods described herein involve genetically engineering a population of cells (e.g., HSPCs or T cells) using a nucleotide-guided gene editing system, such as a Cas nuclease (or a variant thereof). In some embodiments, the methods described herein involve genetically engineering a gene encoding a cell surface antigen in a population of cells (e.g., HSPCs or T cells) using a Cas nuclease or a variant thereof (e.g., SpCas9 or AsCpf1). In some embodiments, the methods described herein involve genetically modifying or editing the CD38 gene in a population of cells (e.g., HSPCs or T cells) using a Cas nuclease. In some embodiments, the methods described herein involve genetically engineering CD38 by mutating position S274 of the amino acid sequence of CD38 in a population of HSPCs or T cells using a nucleotide-guided gene editing system. In some embodiments, the methods described herein involve genetically engineering a mutant CD38 gene in a population of HSPCs or T cells using a nucleotide-guided gene editing system comprising a guide sequence provided by any one of SEQ ID NOs: 11-13.
[0082] In some embodiments, the engineered HSPCs or T cells comprise an engineered CD38 gene, wherein the engineered CD38 gene encodes a protein with reduced binding to a therapeutic anti-CD38 antibody (e.g., daratumumab). In some embodiments, the engineered CD38 gene encodes a protein with a mutation at position S274 of CD38. In some cases, the mutation at position S274 is S274F. The amino acid sequence of the engineered CD38 is shown below:
[0083] SEQ ID NO: 52 (CD38 polypeptide with mutation at S274F): MANCEFSPVSGDKPCCRLSRRAQLCLGVSILVLILVVVLAVVVPRWRQQWSGPGTTKRFPETVLARCVKYTEIHPEMRHVDCQSVWDAFKGAFISKHPCNITEEDYQPLMKLGTQTVPCNKILLWSRIKDLAHQFTQVQRDMFTLEDTLLGYLADDLTWCGEFNTSKINYQSCPDWRKDCSNNPVSVFWKTVSRRFAEAACDVVHVMLNGSRSKIFDKNSTFGSVEVHNLQPEKVQTLEAWVIHGGREDSRDLCQDPTIKELESIISKRNIQFFCKNIYRPDKFLQCVKNPEDSSCTSEI
[0084] In some embodiments, provided herein is a polypeptide sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO: 52, wherein the polypeptide sequence comprises a mutation at S274F, and the polypeptide sequence has reduced binding to a therapeutic anti-CD38 antibody (e.g., daratumumab). Also provided herein are nucleic acids encoding the polypeptide sequences, vectors comprising the nucleic acids, cells comprising the nucleic acids or the vectors, and methods of making the polypeptides, the methods comprising culturing cells under conditions that allow expression of the polypeptide and, optionally, isolating the polypeptide.
[0085] Genetically engineered cells expressing multiple systems (e.g., HSPCs) In some embodiments, the cell surface protein CD38 may be combined with other genetic engineering strategies, such as: i) other epitope editing for other target proteins; ii) other therapeutic base or prime editing approaches (e.g., BCL11A erythroid enhancer); and iii) traditional gene therapy using integrating vectors. For example, in some embodiments, this can be achieved by co-transfecting two or more guide RNAs for different target surface proteins with each other. In some embodiments, the two or more guide RNAs are provided sequentially or consecutively, i.e., in two or more separate transfections.
[0086] II. Immunotherapeutic agents specific to cell surface antigens Cytotoxic agents that target cells expressing a cell surface antigen (e.g., cancer cells) can be used in combination with genetically engineered cells (e.g., HSPCs or T cells) as described herein. As used herein, the term "cytotoxic agent" refers to any agent that can directly or indirectly induce cytotoxicity in target cells expressing a specific cell surface antigen (e.g., target cancer cells). Such cytotoxic agents can include protein-binding fragments that bind to and target epitopes of specific cell surface antigens.
[0087] i. Therapeutic antibodies / antibody-drug conjugates As used herein, the engineered gene is engineered so that its encoded protein has reduced binding to a therapeutic antibody. In this context, a "therapeutic" antibody refers to an antibody that ameliorates one or more existing symptoms or clinical signs associated with a condition, such as a hematological condition. An "antibody" refers to a molecule containing at least one antigen-binding site that immunospecifically binds to a specific antigen target of interest. Thus, the term "antibody" includes, but is not limited to, full-length antibodies and / or variants thereof, fragments thereof, peptibodies and variants thereof, monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, at least two intact antibodies, human antibodies, humanized antibodies, and multispecific antibodies (e.g., bispecific antibodies) formed from antibody mimetics that mimic the structure and / or function of an antibody or specified fragment or portion thereof, including single-chain antibodies and fragments thereof. Thus, as used herein, the term "antibody" encompasses antibody fragments capable of binding to a biological molecule (such as an antigen or receptor) or portion thereof, including, but not limited to, Fab, Fab' and F(ab')2, pFc', Fd, single domain antibodies (sdAbs), variable fragments (Fv), single-chain variable fragments (scFv) or disulfide-linked Fvs (sdFv), diabodies or bivalent diabodies, linear antibodies, single-chain antibody molecules, and multispecific antibodies formed from antibody fragments.
[0088] In some embodiments, the cytotoxic agent includes a therapeutic antibody, which can be conjugated to a drug (e.g., an anti-cancer drug) to form an antibody-drug conjugate (ADC). In some embodiments, the agent is an antibody-drug conjugate. In some embodiments, the antibody-drug conjugate comprises an epitope-binding fragment and a toxin or drug that induces cytotoxicity in target cells.
[0089] In some embodiments, the therapeutic anti-CD38 antibody is daratumumab.
[0090] Toxins or drugs suitable for use in antibody-drug conjugates are well known in the art and will be apparent to those skilled in the art. See, e.g., Peters et al. Biosci. Rep. (2015) 35(4):e00225, Beck et al. Nature Reviews Drug Discovery (2017) 16:315-337, Marin-Acevedo et al. J. Hematol. Oncol. (2018) 11:8, Elgundi et al. Advanced Drug Delivery Reviews (2017) 122:2-19. In some embodiments, the antibody-drug conjugate may further comprise a linker (e.g., a peptide linker, such as a cleavable or non-cleavable linker) connecting the antibody and the drug molecule. Examples of antibody-drug conjugates include, but are not limited to, brentuximab vedotin, glentuximab vedotin / CDX-011, depatuximab mafodotin / ABT-414, PSMA ADC, polatuzumab vedotin / RG7596 / DCDS4501A, denintuzumab mafodotin / SGN-CD19A, AGS-16C3F, CDX-014, RG7841 / DLYE5953A, RG7882 / DMUC406A, RG7986 / DCDS0780A, SGN-LIV1A, enfortumab vedotin / ASG-22ME, AG-15ME, AGS67E, telisotuzumab vedotin / ABBV-399, ABBV-221, ABBV-085, GSK-2857916, tisotuzumab vedotin / HuMax-TF-ADC, HuMax-Axl-ADC, pinatuzumab vedotin dotin / RG7593 / DCDT2980S, rifastuzumab vedotin / RG7599 / DNIB0600A, indusatumab vedotin / MLN-0264 / TAK-264, bundutuzumab vedotin / RG7450 / DSTP3086S, sofituzumab vedotin / RG7458 / DMUC5754A, RG7600 / DMOT4039A, RG7336 / DEDN6526A, ME1547, PF-06263507 / ADC5T4, trastuzumab emtansine / T-DM1, mirvetuximab soravtansine / IMGN853, coltuximab ravtansine / SAR3419,Naratuximab emtansine / IMGN529, indatuximab ravtansine / BT-062, anetumab ravtansine / BAY94-9343, SAR408701, SAR428926, AMG224, PCA062, HKT288, LY3076226, SAR566658, lorvotuzumab mertansine / IMGN901, cantuzumab mertansine / SB-408075, cantuzumab ravtansine / IMGN242, laprituximab emtansine / IMGN289, IMGN388, bivatuzumab mertansine, AVE9633, BIIB015, MLN2704, AMG172, AMG595, LOP628, vadastuximab butarilin / SGN-CD33A, SGN-CD70A, SGN-CD19B, SGN-CD123A, SGN-CD352A, rovalpituzumab tesirin / SC16LD6.5, SC-002, SC-003, ADCT-301 / HuMax-TAC-PBD, ADCT-402, ME DI3726 / ADC-401, IMGN779, IMGN632, gemtuzumab ozogamicin, inotuzumab ozogamicin / CMC-544, PF-06647263, CMD-193, CMB-401, trastuzumab duocarmazine / SYD985, BMS-936561 / MDX-1203, sacituzumab govitecan / IMMU-132, labetuzumab govitecan / IMMU-130, DS-8201a, U3-1402, milatuzumab doxorubicin Examples of such drugs include rhetuzumab / IMMU-110 / hLL1-DOX, BMS-986148, RC48-ADC / hertuzumab-vc-MMAE, PF-06647020, PF-06650808, PF-06664178 / RN927C, rupartumab amadotin / BAY1129980, aprtuzumab ixadotin / BAY1187982, ARX788, AGS62P1, XMT-1522, AbGn-107, MEDI4276, and DSTA4637S / RG7861.
[0091] In some embodiments, binding of an antibody-drug conjugate to an epitope of a cell surface protein can induce internalization of the antibody-drug conjugate, releasing the drug (or toxin) intracellularly. In some embodiments, binding of an antibody-drug conjugate to an epitope of a cell surface protein can induce internalization of a toxin or drug, thereby allowing the toxin or drug to kill a cell expressing the cell surface protein (a target cell). In some embodiments, binding of an antibody-drug conjugate to an epitope of a cell surface protein can induce internalization of a toxin or drug, which can modulate the activity of a cell expressing the cell surface protein (a target cell). The type of toxin or drug used in the antibody-drug conjugates described herein is not limited to any particular type.
[0092] In some embodiments, two or more (e.g., two, three, four, five or more) epitopes of a cell surface antigen are modified, allowing two or more (e.g., two, three, four, five or more) different cytotoxic agents (e.g., two ADCs) to be targeted to the two or more epitopes. In some embodiments, toxins carried by the ADCs may act synergistically to enhance efficacy (e.g., target cell death). In some embodiments, two or more (e.g., two, three, four, five or more) epitopes of a cell surface protein are modified, allowing two or more (e.g., two, three, four, five or more) different cytotoxic agents (e.g., two ADCs) to target the two or more epitopes of a cell surface antigen. In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, or more) epitopes of a cell surface antigen are modified, one or more (e.g., 1, 2, 3, 4, 5, or more) epitopes of an additional cell surface protein are modified, allowing two or more (e.g., 2, 3, 4, 5, or more) different cytotoxic agents (e.g., two ADCs) to be targeted to an epitope of the cell surface antigen and an epitope of the additional cell surface antigen. In some embodiments, targeting multiple cell surface antigens, or a cell surface antigen and one or more additional cell surface proteins / antigens, can reduce recurrence of hematopoietic malignancies.
[0093] In some embodiments, the methods described herein involve administering an ADC that targets an epitope of a cell surface antigen that is mutated in a population of genetically engineered hematopoietic cells. In some embodiments, the methods described herein involve administering an ADC that targets an epitope of a cell surface antigen that is mutated in a population of genetically engineered cells (e.g., HSPCs or T cells) and one or more additional cytotoxic agents that may target one or more additional cell surface proteins. In some embodiments, the agents may act synergistically to enhance efficacy by targeting multiple cell surface proteins.
[0094] The ADCs described herein may be used as a follow-on treatment for subjects who have received the combination therapy described herein.
[0095] In some embodiments, the methods described herein comprise administering to a subject a population of genetically engineered cells lacking a nonessential epitope in a cell surface antigen (e.g., Type 1 or Type 2) and one or more immunotherapeutic agents (e.g., ADCs) that target cells expressing the cell surface antigen. In any of the embodiments described herein, the subject can be further administered one or more additional immunotherapeutic agents (e.g., targeting one or more additional epitopes and / or antigens), e.g., if the hematopoietic malignancy recurs.
[0096] ii. Immune cells expressing chimeric antigen receptors (CARs) In some embodiments, the cytotoxic agent that targets an epitope of a particular cell surface antigen described herein is an immune cell that expresses a chimeric receptor (CAR), where the CAR comprises an epitope-binding fragment (e.g., a single-chain antibody) that can bind to an epitope of a cell surface protein (e.g., CD38).
[0097] As used herein, a "chimeric antigen receptor" (CAR or simply chimeric receptor) refers to a molecule of non-natural origin that can be expressed on the surface of a host cell and contains a binding domain (e.g., an epitope-binding fragment that binds to an epitope of a cell surface lineage-specific protein) that provides the specificity of the CAR. Generally, a CAR contains at least two domains derived from different molecules.
[0098] Recognition of a target cell (e.g., a cancer cell) bearing a specific protein epitope on its cell surface by the epitope-binding fragment of the CAR transmits an activating signal to the signaling domain(s) of the CAR (e.g., a costimulatory signaling domain and / or a cytoplasmic signaling domain), which can activate effector functions in immune cells expressing the CAR.
[0099] In some embodiments, the immune cells express multiple CARs (e.g., two, three, four, five, or more), referred to as bispecific or multispecific immune cells. In some embodiments, the immune cells express multiple CARs, at least one of which targets an epitope of a cell surface antigen. In some embodiments, the immune cells express multiple CARs, each of which targets an epitope of a cell surface antigen. In some embodiments, the immune cells express multiple CARs, at least one of which targets an epitope of a cell surface antigen and at least one of which targets an epitope of an additional cell surface antigen. In some embodiments, targeting multiple cell surface proteins, or a cell surface protein and one or more additional cell surface proteins, can reduce the recurrence of hematopoietic malignancies. In some embodiments, the immune cells express a CAR that targets multiple epitopes (e.g., multiple epitopes of one antigen, or epitopes of multiple antigens), referred to as a bispecific CAR.
[0100] In some embodiments, epitopes of two or more lineage-specific cell surface proteins are targeted by a cytotoxic agent. In some embodiments, two or more CARs, e.g., bispecific chimeric receptors, are expressed on the same immune cells. Such cells can be used in any of the methods described herein. In some embodiments, cells expressing chimeric receptors are "pooled," i.e., two or more cell populations express two or more different CARs. Two or more cells expressing different CARs can be administered simultaneously or sequentially. In some embodiments, an epitope of CD38 is targeted by a cytotoxic agent. In some embodiments, CARs targeting CD38 are expressed on the same immune cells (i.e., bispecific immune cells). Such cells can be used in any of the methods described herein. In some embodiments, cells expressing chimeric receptors targeting CD38 are "pooled," i.e., two or more cell populations express two or more different CARs. Two or more cell populations expressing CARs targeting CD38 can be administered simultaneously or sequentially.
[0101] In addition to the epitope-binding fragments described herein, a CAR may further comprise one or more of the following: a hinge domain (e.g., a CD28 hinge, an IgG4 hinge, or a CD8 alpha hinge), a transmembrane domain (e.g., CD28 TM, CD8 alpha TM, 4-1BB TM), a costimulatory domain (e.g., CD28z, 4-1BB, ICOS, OX40), a cytoplasmic signaling domain (e.g., CD3z), and combinations thereof.
[0102] In some embodiments, a hinge domain may be located between the epitope-binding fragment and the transmembrane domain. A hinge domain is an amino acid segment typically found between two domains of a protein, allowing flexibility of the protein and movement of one or both of those domains relative to one another. Any amino acid sequence that provides such flexibility and movement of the epitope-binding fragment relative to another domain of the chimeric receptor may be used. The hinge domain may contain approximately 10 to 200 amino acids, e.g., 15 to 150 amino acids, 20 to 100 amino acids, or 30 to 60 amino acids. In some embodiments, the hinge domain can be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 amino acids in length.
[0103] In some embodiments, the hinge domain, or at least a portion thereof, is the hinge domain of a naturally occurring protein. In some embodiments, the transmembrane domain is derived from CD8alpha or CD28. In some embodiments, the hinge domain is a portion of the hinge domain of CD8alpha, e.g., a fragment of the hinge domain of CD8alpha or CD28 containing at least 15 (e.g., 20, 25, 30, 35, or 40) consecutive amino acids.
[0104] Hinge domains of antibodies, such as IgG, IgA, IgM, IgE, or IgD antibodies, are also compatible for use in the chimeric receptors described herein. In some embodiments, the hinge domain is the hinge domain joining the constant domains CH1 and CH2 of an antibody. In some embodiments, the hinge domain is of an antibody and comprises the hinge domain of the antibody and one or more constant regions of the antibody. In some embodiments, the hinge domain comprises the hinge domain of an antibody and the CH3 constant region of the antibody. In some embodiments, the hinge domain comprises the hinge domain of an antibody and the CH2 and CH3 constant regions of the antibody. In some embodiments, the antibody is an IgG, IgA, IgM, IgE, or IgD antibody. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgG1, IgG2, IgG3, or IgG4 antibody. In some embodiments, the hinge region comprises the hinge region and the CH2 and CH3 constant regions of an IgG1 antibody. In some embodiments, the hinge region comprises the hinge region and CH3 constant region of an IgG1 antibody.
[0105] In some embodiments, the CAR described herein can comprise one or more transmembrane domain(s), which can be any form known in the art.As used herein, "transmembrane domain" refers to any protein structure that is thermodynamically stable in a cell membrane, preferably a eukaryotic cell membrane.The transmembrane domain that is suitable for use in the CAR used herein can be obtained from naturally occurring proteins.Alternatively, it can be a synthetic non-naturally occurring protein segment, for example, a hydrophobic protein segment that is thermodynamically stable in a cell membrane.
[0106] Transmembrane domains are classified based on transmembrane domain topology, including the number of times the transmembrane domain passes through the membrane and the orientation of the protein. For example, a single-pass membrane protein traverses the cell membrane once, while a multi-pass membrane protein traverses the cell membrane at least twice (e.g., two, three, four, five, six, seven, or more times). In some embodiments, the transmembrane domain is a single-pass transmembrane domain. In some embodiments, the transmembrane domain is a single-pass transmembrane domain that orients the N-terminus of the chimeric receptor toward the extracellular side of the cell and the C-terminus of the chimeric receptor toward the intracellular side of the cell. In some embodiments, the transmembrane domain is derived from a single-pass membrane protein. In some embodiments, the transmembrane domain is derived from CD28 or 4-1BB or CD8alpha.
[0107] In some embodiments, the CAR described herein comprises one or more costimulatory signaling domains. As used herein, the term "costimulatory signaling domain" refers to at least a portion of a protein that mediates intracellular signal transduction to induce an immune response, such as an effector function. The costimulatory signaling domain of the chimeric receptor described herein can be a cytoplasmic signaling domain from a costimulatory protein that transduces signals and regulates responses mediated by immune cells, such as T cells, NK cells, macrophages, neutrophils, or eosinophils.
[0108] In some embodiments, the CARs described herein comprise multiple (at least two, at least three, at least four, or more) costimulatory signaling domains. In some embodiments, the chimeric receptor comprises multiple costimulatory signaling domains obtained from different costimulatory proteins. In some embodiments, the chimeric receptor does not comprise a costimulatory signaling domain.
[0109] Many immune effector cells require costimulation in addition to antigen-specific signal stimulation to promote cell proliferation, differentiation, and survival and activate cellular effector functions. Activation of a costimulatory signaling domain in a host cell (e.g., an immune cell) can induce the cell to increase or decrease cytokine production and secretion, phagocytosis, proliferation, differentiation, survival, and / or cytotoxicity. The costimulatory signaling domain of any costimulatory protein may be compatible for use in the CARs described herein. The type(s) of costimulatory signaling domain(s) are selected based on factors such as the type of immune cell in which the CAR will be expressed (e.g., primary T cells, T cell lines, NK cell lines) and the desired immune effector function (e.g., cytotoxicity). Examples of costimulatory signaling domains for use in CARs may be cytoplasmic signaling domains of costimulatory proteins, including, but not limited to, CD27, CD28ζ (CD28z), 4-1BB, OX40, CD30, ICOS, CD2, CD7, LIGHT, NKG2C, and B7-H3.
[0110] In some embodiments, the chimeric receptors described herein comprise one or more cytoplasmic signaling domain(s). Any cytoplasmic signaling domain may be used in the chimeric receptors described herein. Generally, the cytoplasmic signaling domain relays a signal, such as the interaction of an extracellular ligand-binding domain with its ligand, to stimulate a cellular response, such as inducing a cellular effector function (e.g., cytotoxicity). In some embodiments, the cytoplasmic signaling domain is derived from CD3zeta (CD3z).
[0111] In some embodiments, provided herein are CAR constructs that target CD38 or other gene(s) in addition to CD38. The constructs further comprise at least a hinge domain (e.g., from CD28, CD8alpha, or an antibody), a transmembrane domain (e.g., from CD28), one or more costimulatory domains (e.g., from one or more of CD28z), a cytoplasmic signaling domain (e.g., from CD3z), or a combination thereof. In some examples, the methods described herein involve administering to a subject a population of genetically engineered cells (e.g., HSPCs or T cells) (engineered to have mutant CD38 or other gene(s) in addition to CD38, such as those disclosed in WO2023 / 159136), and / or immune cells expressing a CAR that targets CD38 or other gene(s) in addition to CD38, respectively (which may further include at least a hinge domain (e.g., from CD28, CD8 alpha, or an antibody), a transmembrane domain (e.g., from CD28), one or more costimulatory domains (from one or more of CD28z), and a cytoplasmic signaling domain (e.g., from CD3z), or a combination thereof). In some embodiments, the administered immunotherapy product is a combination of immune cells expressing individual chimeric receptors that target CD38.
[0112] Any of the CARs described herein can be prepared by conventional methods, such as recombinant techniques. The method for preparing a chimeric receptor herein includes generating nucleic acids encoding polypeptides containing each of the domains of the chimeric receptor, including an epitope-binding fragment and, optionally, a hinge domain, a transmembrane domain, at least one costimulatory signaling domain, and a cytoplasmic signaling domain. In some embodiments, nucleic acids encoding the components of the chimeric receptor are linked using recombinant techniques.
[0113] Additionally, any CAR can be expressed in immune cells and administered to human subjects by conventional methods. For example, T cells can be derived from the T cells in the subject's own blood (autologous) or from the T cells of another healthy donor (allogeneic). Once isolated from the subject, these T cells are genetically engineered to express a specific CAR and are programmed to target antigens present on the surface of tumors. Then, CAR-T cells are routinely infused into the subject.
[0114] In some embodiments, the CAR is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of any one of SEQ ID NOs: 64 or 66, and the CAR retains the ability to bind to CD38.
[0115] In some embodiments, the CAR comprises one or more epitope-binding fragments, including one or more epitope-binding fragments from SEQ ID NO: 64 or 66.
[0116] In some embodiments, the cell surface lineage-specific protein is CD38 and the epitope-binding fragment comprises the following CDR sequences: VH CDR1: SFAMS (SEQ ID NO: 57), VH CDR2: AISGSGGGTYYADSVK (SEQ ID NO: 58), VH CDR3: DKILWFGEPVFDY (SEQ ID NO: 59), VL CDR1: RASQSVSSYLAW (SEQ ID NO: 60), VL CDR2: DASNRAT (SEQ ID NO: 61), VL CDR3: QQRSNWPPTF (SEQ ID NO: 62).
[0117] Exemplary CAR sequences are provided below. Anti-CD38 CAR-1 (CD8a hinge, CD28 TM, CD28z, CD3z) nucleotide sequence of SEQ ID NO: 63: Anti-CD38 CAR-1 (CD8a hinge, CD28 TM, CD28z, CD3z) amino acid sequence of SEQ ID NO: 64 (CDRs in bold): [ka]
[0118] Anti-CD38 CAR-2 (IgG4 hinge, CD28 TM, CD28z, CD3z) nucleotide sequence of SEQ ID NO: 65:
[0119] Anti-CD38 CAR-2 (IgG4 hinge, CD28 TM, CD28z, CD3z) amino acid sequence of SEQ ID NO: 66 (CDRs in bold): [ka]
[0120] III. Methods of Treating Subjects The genetically engineered cells (e.g., HSPCs or T cells) can be administered to a human subject in need of treatment either alone or in combination with one or more cytotoxic agents that target one or more cell surface antigens described herein. Because the cells have been genetically edited in the genes for one or more cell surface antigens, the cells and / or their progeny will express the one or more cell surface antigens in a mutant (e.g., functional) form such that they can avoid targeting by the cytotoxic agent, e.g., CAR-T cells.
[0121] Thus, the present disclosure provides methods for treating conditions that typically affect the wild-type morphology of engineered cells, the methods comprising administering to a human subject in need thereof (i) a population of genetically engineered cells (e.g., HSPCs or T cells) described herein and, optionally, (ii) a cytotoxic agent that targets a cell surface antigen, the gene of which has been gene-edited in the cells (e.g., CAR-T cells) such that the cytotoxic agent does not target the wild-type morphology of the engineered cells or their progeny. In embodiments in which both (i) and (ii) are administered, administration of (i) and (ii) may be simultaneous or in any order. In some embodiments, the cytotoxic agent and / or cells may be mixed with a pharmaceutically acceptable carrier to form a pharmaceutical composition, which is also within the scope of the present disclosure.
[0122] To carry out the methods described herein, an effective amount of genetically engineered cells (e.g., HSPCs or T cells) can be administered to a human subject in need of treatment. Optionally, the genetically engineered cells can be used in conjunction with a cytotoxic agent described herein. In some embodiments, the subject is a human patient with a hematopoietic malignancy.
[0123] As used herein, the term "effective amount" can be used interchangeably with the term "therapeutically effective amount." An effective amount, as recognized by one of ordinary skill in the art, will depend on the particular condition being treated, the severity of the condition, the age, health, size, sex, and weight, duration of treatment, the nature of concurrent therapy (if any), the particular route of administration, and similar factors within the knowledge and expertise of a medical professional.
[0124] As described herein, genetically engineered cells expressing chimeric receptors can be autologous to a subject; that is, the cells are obtained from a subject in need of treatment, engineered to prevent the cells from binding to cytotoxic agents, and then administered to the same subject. Administration of autologous cells to a subject can result in reduced host cell rejection compared to administration of non-autologous cells. For example, HSPCs or T cells are obtained from a biological sample from the subject, the HSPCs or T cells are genetically engineered, and the genetically engineered HSPCs or T cells are administered to the same subject. In some cases, the HSPCs or T cells are obtained from a biological sample, where the biological sample is bone marrow cells, blood, umbilical cord blood cells, or mobilized peripheral blood-derived CD34+ hematopoietic stem and progenitor cells.
[0125] Alternatively, the host cells are allogeneic (i.e., the cells are obtained from a first subject), genetically engineered, and then administered to a second subject of the same species but different from the first subject. For example, allogeneic immune cells can be derived from a human donor and administered to a human recipient different from the donor. In some embodiments, the engineered cells are further engineered to reduce the host-versus-graft effect. For example, in some embodiments, immune cells and / or engineered cells can be subjected to gene editing or silencing methods to reduce or eliminate the expression of one or more proteins involved in inducing a host immune response.
[0126] A typical amount of cells (i.e., immune cells or genetically engineered cells of the present disclosure) administered to a subject is, for example, 10 6 ~10 11 In some embodiments, the range is 10 6 It may be desirable to administer fewer than 10 cells to a subject. 11 It may be desirable to administer more than 10 cells to a subject. In some embodiments, one or more doses of cells comprise more than 10 6 cells ~ 10 11 cells, 10 7 cells ~ 10 10 cells, 10 8 cells ~ 10 9 cells, 10 6 cells ~ 10 8 cells, 10 7 cells ~ 10 9 cells, 10 7 cells ~ 10 10 cells, 10 7 cells ~ 10 11 cells, 10 8 cells ~ 10 10 cells, 10 8 cells ~ 10 11 cells, 10 9 cells ~ 10 10 cells, 10 9 cells ~ 10 11cells, or 10 10 cells ~ 10 11 Contains cells.
[0127] In some embodiments, the methods described herein involve administering to a subject a population of genetically engineered cells (e.g., HSPCs or T cells) and administering one or more immunotherapeutic agents (e.g., cytotoxic agents). As will be appreciated by one of skill in the art, the immunotherapeutic agents can be of the same type or different types (e.g., therapeutic antibodies, populations of immune cells expressing chimeric antigen receptor(s), and / or antibody-drug conjugates).
[0128] In some embodiments, the cytotoxic agent comprising an epitope-binding fragment that binds to an epitope of a cell surface protein (e.g., an immune cell expressing a CAR described herein) is administered prior to administration of the engineered cells, which can be at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, at least 3 months, at least 4 months, at least 5 months, at least 6 months or more prior to administration of the engineered cells.
[0129] Alternatively, in some embodiments, the engineered cells are administered prior to the administration of a cytotoxic agent (e.g., an immune cell expressing a CAR described herein) comprising an epitope-binding fragment that binds to an epitope of a cell surface protein. This can be at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, at least 12 weeks, at least 3 months, at least 4 months, at least 5 months, at least 6 months, or more prior to the administration of the cytotoxic agent comprising an epitope-binding fragment that binds to an epitope of a cell surface protein.
[0130] In some embodiments, the cytotoxic agent that targets a cell surface protein and the population of genetically engineered cells (HSPCs or T cells) are administered substantially simultaneously. In some embodiments, the cytotoxic agent that targets a cell surface protein is administered, the patient is evaluated for a period of time, and then the population of genetically engineered cells is administered. In some embodiments, the population of genetically engineered cells is administered, the patient is evaluated for a period of time, and then the cytotoxic agent that targets a cell surface protein is administered.
[0131] Also within the scope of the present disclosure are multiple administrations (e.g., doses) of cytotoxic agents and / or populations of genetically engineered cells. In some embodiments, the cytotoxic agents and / or populations of genetically engineered cells are administered to the subject once. In some embodiments, the cytotoxic agents and / or populations of genetically engineered cells are administered to the subject multiple times (e.g., at least two times, at least three times, at least four times, at least five times, or more). In some embodiments, the cytotoxic agents and / or populations of genetically engineered cells are administered to the subject at regular intervals, for example, every six months.
[0132] Examples of routes of administration include intravenous, infusion, intradermal, subcutaneous, oral (eg, inhalation), transdermal (topical), transmucosal, and rectal administration.
[0133] Any of the methods described herein can be for the treatment of a hematological malignancy in a subject. As used herein, the term "treat" or "treatment" or "treating" or "to treat" refers to a therapeutic measure aimed at alleviating, slowing the progression of, alleviating symptoms of, and / or halting the progression of a pathological condition or disorder. Thus, a person in need of treatment includes a person already with the disorder. As used herein, treating cancer includes stabilizing the progression of cancer, slowing the progression of cancer, stopping the progression of cancer, reducing the size of cancer, or extending the overall survival of a subject diagnosed with cancer. Methods for assessing cancer progression are known in the art and include, for example, evaluation of target lesions using imaging (e.g., X-ray, computed tomography scan, magnetic resonance imaging, caliper measurement, or positron emission tomography scan), cytology or histology, or expression of tumor marker(s).
[0134] In some embodiments, the human subject has a hematologic condition, such as a hematopoietic malignancy. As used herein, a hematopoietic malignancy refers to a malignant abnormality involving hematopoietic cells (e.g., blood cells, including progenitor cells and stem cells). Examples of hematopoietic malignancies include, but are not limited to, Hodgkin's lymphoma, non-Hodgkin's lymphoma, leukemia, or multiple myeloma. Exemplary leukemias include, but are not limited to, acute myeloid leukemia, acute lymphocytic leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia or chronic lymphoblastic leukemia, and chronic lymphocytic leukemia. Examples of hematologic conditions other than hematopoietic malignancies include, but are not limited to, hemoglobin disorders, such as sickle cell disease, thalassemia, or primary immunodeficiencies, such as SCID.
[0135] In some embodiments, the cells involved in the hematopoietic malignancy are resistant to conventional or standard therapeutic agents used to treat the malignancy. For example, the cells (e.g., cancer cells) may be resistant to chemotherapeutic agents and / or CAR-T cells used to treat the malignancy.
[0136] In some cases, the hematopoietic malignancy includes high-risk acute myeloid leukemia (AML) or multiple myeloma.
[0137] IV. Compositions and Kits Any of the immune cells expressing the chimeric receptors and / or genetically engineered cells (e.g., HSPCs or T cells) described herein can be administered as a pharmaceutical composition in a pharmaceutically acceptable carrier.
[0138] The phrase "pharmaceutically acceptable," when used in connection with compositions and / or cells of the present disclosure, refers to molecular entities and other components of such compositions that are physiologically tolerable and do not normally produce adverse reactions when administered to humans. Preferably, as used herein, the term "pharmaceutically acceptable" means approved by a federal or state regulatory agency or listed in the United States Pharmacopeia or other generally recognized pharmacopeia for use in humans. "Acceptable" means that the carrier is compatible with the active ingredients of the composition (e.g., nucleic acids, vectors, cells, or therapeutic antibodies) and does not adversely affect the subject to whom the composition(s) are administered. Any of the pharmaceutical compositions and / or cells used in the present methods may include pharmaceutically acceptable carriers, excipients, or stabilizers, whether in the form of a lyophilized formulation or an aqueous solution.
[0139] Pharmaceutically acceptable carriers, including buffers, are well known in the art and can include phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives; low molecular weight polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; amino acids; hydrophobic polymers; monosaccharides; disaccharides; and other carbohydrates; metal complexes; and / or non-ionic surfactants.
[0140] Kits for use in treating hematological conditions (e.g., hematopoietic malignancies) are also within the scope of the present disclosure. Such kits may include genetically engineered cells (e.g., HSPCs or T cells) and, optionally, one or more cytotoxic agents that target cell surface antigens, the genes of which have been edited in the hematopoietic cells. Such kits may include a container containing a first pharmaceutical composition comprising any of the genetically engineered cells (e.g., HSPCs or T cells) described herein, and, optionally, one or more additional containers containing one or more cytotoxic agents that target cell surface antigens also described herein (e.g., immune cells expressing a chimeric receptor described herein).
[0141] In some embodiments, the kit may include instructions for use in any of the methods described herein. The included instructions may include instructions for administering the genetically engineered cells (e.g., HSPCs or T cells) and, optionally, instructions for administering one or more cytotoxic agents to the subject to achieve the intended activity in the subject. The kit may further include instructions for selecting a suitable subject for treatment based on identifying whether the subject is in need of treatment. In some embodiments, the instructions include instructions for administering the genetically engineered cells (e.g., HSPCs or T cells) and, optionally, one or more cytotoxic agents to a subject in need of treatment.
[0142] The instructions associated with the use of the genetically engineered cells (e.g., HSPCs or T cells) and optionally cytotoxic agents described herein generally include information regarding the dosage, dosing regimen, and route of administration for the intended treatment. The containers may be unit doses, bulk packages (e.g., multi-dose packages), or subunit doses. The instructions accompanying the kits of the present disclosure are typically instructions set forth on a label or package insert. The label or package insert indicates that the pharmaceutical composition is used for treating, delaying the onset of, and / or alleviating a disease or disorder in a subject.
[0143] The kit provided herein is suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), etc. Packages for use in combination with specific devices, such as inhalers, nasal administration devices, or infusion devices, are also contemplated. The container holds or contains the formulation and may have a sterile access port (e.g., the container may be an intravenous solution bag or a vial with a stopper that can be pierced by a hypodermic injection needle). The container may also have a sterile access port. At least one active agent contained in the pharmaceutical composition is the chimeric receptor variant described herein.
[0144] Kits may optionally provide additional components such as buffers and interpretive information. Typically, kits include a container and a label or package insert(s) on or associated with the container. In some embodiments, the disclosure provides an article of manufacture comprising the contents of the above-described kit. [Example]
[0145] The following specific examples are for the purpose of illustrating the invention and should not be construed as limiting the scope of the claims. To the extent that specific materials are mentioned, they are for illustrative purposes only and are not intended to limit the invention. Those skilled in the art will be able to readily develop equivalent means or reactants that do not depart from the scope of the invention using ordinary inventive skills.
[0146] hCD38 base editing and anti-CD38 CAR-T production Example 1: Epitope editing of hCD38 Human CD38 is a type II transmembrane glycoprotein expressed by immature hematopoietic cells, lost by mature cells, and re-expressed on activated lymphocytes such as T cells, B cells, dendritic cells, and natural killer cells. Based on available data published by Michel de Weers et al. in J. Immunol., 186(3):1840-1848 (2011) (doi.org / 10.4049 / jimmunol.1003032), an orthologous mutation in the CD38 protein from cynomolgus monkeys (Macaca fascicularis) (replacing serine at position 274 with phenylalanine (S274F)) was identified that effectively impairs the binding of the antibody daratumumab to the CD38 glycoprotein (see Figures 1A and 1B).
[0147] We designed a genetic engineering strategy to induce the S274F mutation in human cells via a base editing approach. To test this hypothesis, we generated a reporter cell line overexpressing CD38 from the endogenous locus by integrating an artificial promoter upstream of the gene's translation start site using a homologous-mediated recombination approach (Figure 1C). We then tested the editing strategy by electroporating both CD38_gRNA_1 (SEQ ID NO: 11) and a plasmid expressing cytidine base editor 4 (available from Addgene, Cambridge, MA) into the reporter cell line (K562 cells) using the Lonza 4D-NUCLEOFECTORr System in SF solution according to the manufacturer's instructions (Lonza, Basel, Switzerland). The electroporation reaction contained 500 ng of the base editor expression plasmid and 300–360 pmol of sgRNA (available from Integrated DNA Technologies, Coralville, IA). The editing strategy generated CD38 variants that lacked recognition by the ALEXA FLUOR 488-conjugated daratumumab antibody (available from Selleckchem, Houston, TX) but retained surface expression as determined by staining with the phycoerythrin (PE)-conjugated control antibody OKT10 (available from Leinco Technologies, Fenton, MO) in a fluorescence-activated cell sorting (FACS) assay (Figures 1D, 1E, and 1F).
[0148] Example 2: Design and production of daratumumab-based anti-CD38 CAR-T Rationally designed anti-CD38 chimeric antigen receptors can confer potent antitumor efficacy. Figure 2A shows a schematic diagram of two second-generation chimeric antigen receptors targeting human CD38 (SEQ ID NOs: 63-66). Both constructs encode the variable heavy and variable light chains of daratumumab, assembled via a GGGSx3 linker (GGGSGGGSGGGS). The only difference between the two constructs is the hinge domain (CD8a and IgG4 for CAR1 and CAR2, respectively). Two generation III lentiviral constructs expressing second-generation CD38-specific chimeric antigen receptors under the constitutive hPGK promoter were cloned using synthetic dsDNA fragments (IDT gBlocks). An antisense cassette expressing a truncated variant of human EGFR cDNA under a minimal CMV promoter was included to serve as a marker for transduction and a safety switch for in vivo depletion using the anti-EGFR antibody cetuximab. VSV-G pseudotyped self-inactivating lentiviral particles (LV) were prepared by calcium-phosphate transient co-transfection of five plasmids (transfer vector, pMD2, pMDL-RRE, pREV, and pAdvantage plasmid) in HEK-293T (human embryonic kidney) cells according to published methods (epfl.ch / labs / tronolab / wp-content / uploads / 2019 / 06 / LV_production.pdf). The supernatant containing the viral particles was concentrated 500-fold by ultracentrifugation (20,000 rpm, 20°C for 2 hours) and resuspended in phosphate-buffered saline (PBS). The concentrated LV was titrated by transducing HEK-293T cells at different concentrations and calculating transduction efficiency by flow cytometry or droplet digital PCR (ddPCR).
[0149] Peripheral blood mononuclear cells (PBMCs) were isolated from whole blood by Ficoll gradient centrifugation. T cells were magnetically selected using a Human Pan T Cell Isolation Kit (available from Miltenyi Biotec, Cologne, Germany). Either freshly isolated or thawed T cells were incubated with CD3-CD28 DYNABEADS (Gibco 11131D, available from Thermofisher Scientific, Waltham, MA) at a 3:1 bead:T cell ratio and cultured at 1 μg / mL in IMDM (Iscove's Modified Dulbecco's Medium, available from Thermofisher Scientific, product number 12440053) supplemented with 10% fetal bovine serum (FBS), 1% penicillin / streptomycin (P / S), human IL-7 (5 ng / mL, available from PeproTech, Cedarbrook, NJ), and human IL-15 (5 ng / mL, available from PeproTech). Forty-eight hours (h) after the start of stimulation with DYNABEADS, T cells were transduced with lentiviral particles encoding the CAR of choice at a multiplicity of infection (MOI) of 5 to 10, depending on the experiment. On day 7 after the start of stimulation, DYNABEADS were removed from the cultures by magnetic separation, and T cells were expanded for an additional 5–7 days in IMDM supplemented with 10% FBS, 1% P / S, human IL-7 (5 ng / mL, Peprotech), and human IL-15 (5 ng / mL, Peprotech). T cell phenotype and transduction efficiency (by EGFR surface staining) were assessed periodically by flow cytometry. Expanded CAR-T cells or untransduced T cells were used for either killing assays, in vivo administration, or immediate freezing 12–14 days after the start of stimulation.
[0150] Figures 2B, 2C, and 2D show FACS plots of CD38 expression on activated T cells on day 3 of stimulation and before CAR transduction. All T cells uniformly expressed CD38 glycoprotein. The same assessment was performed 4 days later (D7 after CAR transduction; see Figures 2E, 2F, 2G, 2H, and 2I). While anti-cKIT CAR-T cells (produced in parallel as a positive control) and untransduced cells (UT) retained CD38 expression (see Figures 2G, 2H, and 2I), both anti-CD38 CAR-T cells completely lost surface marker expression (see Figures 2E and 2F). One hypothesis is that the loss of CD38 expression in the CAR-T cell production protocol is due to the fratricide effect. As shown in Figure 2J, anti-cKIT CAR-T cells showed growth curves and fold expansion comparable to the untransduced control (UT), whereas anti-CD38 CAR-T cells did not expand in culture. To test this hypothesis in a separate experiment, CD38_gRNA_1 (SEQ ID NO: 11) was used in combination with Cas9 protein (available from Syntego Corporation, Redwood City, CA) at two different doses (75-100 pmol) to perform knockout (KO) experiments. The ribonucleoprotein was delivered to CAR-T cells via electroporation the day after CAR transduction. After 15 days of culture, KO efficiency was quantified by tracking indels by decomposition (TIDE) analysis on Sanger traces (Figure 2K), demonstrating positive selection of KO cells in the presence of CAR compared to untransduced controls. Here, KO of CD38 was performed using CD38_gRNA_1. It is believed that CT base editing induced by the same gRNA may protect cells from the fratricide effect, thereby improving the growth and efficacy of daratumumab-based anti-CD38 CAR-T.
[0151] To test the efficacy of anti-CD38 CAR-T, K562 cells (either unmodified or overexpressing CD38 receptor variants after promoter replacement) were plated in 96-well plates (25,000 target cells / well). Anti-CD38 CAR-T or untransduced T cells were then co-plated in the same well at different effector:target ratios (E:T ratios), typically 5, 2.5, 1.25, and 0.625, and incubated at 37°C in a humidified incubator with 5% carbon dioxide. After 4 hours, culture volumes were harvested for flow cytometry analysis by staining with FcR blocking reagent (available from Miltenyi Biotech) at 2 / 100 microliters (uL), CD3 APCh7 (available from BioLegend, San Diego, CA) at 2 / 100, and CD38 BV510 (Biolegend). The staining mix included flow counting beads (Biolegend) to normalize cell number. Cells were then washed and resuspended in Annexin V binding buffer (Biolegend) supplemented with Annexin V FITC (Biolegend) 3 / 100 and 7AAD (available from BD Biosciences, San Jose, CA). Samples were analyzed on a 4-laser or 5-laser BD Fortessa flow cytometer.
[0152] Figure 3A shows the percentage of CD38-overexpressing viable cells (i.e., K562 cells overexpressing CD38) in 4-hour coculture with untransduced or anti-CD38-CAR-T cells to estimate CAR-T cell-mediated killing at different effector:target (E:T) ratios. Figure 3B shows the viability of control K562 wild-type (WT) cells (which do not express CD38), demonstrating the specificity of CAR-mediated killing.
[0153] These examples demonstrate that the S274F mutation in human cells can be efficiently introduced through a base editing approach, effectively abolishing binding of the well-known antibody daratumumab. Two different versions of the daratumumab-based CAR construct were designed and produced, and their efficacy was evaluated in an in vitro killing assay. To avoid the issue of fratricidality, the CD38_gRNA_1 sgRNA can be used to either 1) produce a knockout of CD38 expression (as shown in Figure 2K) or 2) introduce S274F into anti-CD38 CAR-T or other CAR-Ts, which could potentially be used in combination.
Claims
1. 1. A genetically engineered hematopoietic stem / progenitor cell (HSPC) or T cell comprising a genetically engineered CD38 gene, wherein the genetically engineered CD38 gene is engineered such that its encoded protein has reduced binding to a therapeutic anti-CD38 antibody.
2. 2. The genetically engineered HSPC or T cell of claim 1, wherein at least one mutation in the genetically engineered CD38 gene results in a polypeptide having a mutation at position S274.
3. 3. The genetically engineered HSPC or T cell of claim 2, wherein the mutation at position S274 is S274F.
4. 4. The genetically engineered HSPCs or T cells of any of claims 1 to 3, wherein the therapeutic anti-CD38 antibody is daratumumab or an antibody that has the same six complementarity-determining regions (CDRs) as daratumumab or is otherwise capable of competing with daratumumab for the CD38 binding site.
5. 5. The genetically engineered HSPC or T cell of claims 1 to 4, wherein the genetically engineered CD38 gene encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:52, or a polypeptide that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO:
52.
6. 6. The genetically engineered HSPC or T cell of any one of claims 1 to 5, wherein the genetically engineered HSPC is genetically engineered using a CRISPR system comprising a guide nucleic acid and a nuclease.
7. A population of genetically engineered hematopoietic stem / progenitor cells (HSPCs) or T cells, comprising the genetically engineered HSPCs or T cells of any one of claims 1 to 6.
8. A pharmaceutical composition comprising the genetically engineered population of hematopoietic stem / progenitor cells or T cells of claim 7 and a pharmaceutically acceptable carrier.
9. 10. A kit comprising the genetically engineered population of hematopoietic stem / progenitor cells or T cells of claim 7, and optionally one or more cytotoxic agents that target cell surface antigens whose genes have been edited in the hematopoietic stem / progenitor cells or T cells.
10. 1. A method of treating a hematological condition, the method comprising administering to a human subject: (a) a population of genetically engineered hematopoietic stem / progenitor cells or T cells according to claim 7, and (b) administering a therapeutically effective amount of at least one agent comprising an anti-CD38 antibody binding domain or an antibody or antibody fragment comprising an anti-CD38 binding domain.
11. 11. The method of claim 10, wherein the at least one agent comprises a chimeric antigen receptor-T (CAR-T) cell comprising the anti-CD38 antibody binding domain.
12. 12. The method of claim 10 or 11, wherein the hematological condition is multiple myeloma.
13. A chimeric antigen receptor (CAR) comprising a polypeptide, the polypeptide comprising: (a) one or more epitope-binding fragments that bind to epitopes of one or more cell surface lineage-specific proteins; (b) a hinge domain; (c) a transmembrane domain; (d) a costimulatory domain, and (e) comprises a cytoplasmic signaling domain; The chimeric antigen receptor (CAR), wherein one of the cell surface lineage-specific proteins is CD38.
14. The CAR of claim 13, wherein the CAR comprises the amino acid sequence of any one of SEQ ID NOs: 64 or 66, or a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 64 or 66.
15. A cell expressing the CAR according to claim 13 or 14.
16. The cell of claim 15 , wherein the cell is an immune cell.
17. The cell of claim 16 , wherein the immune cell is a T cell.
18. 1. A method of treating a hematological malignancy, said method comprising administering to a human subject: (a) a population of genetically engineered hematopoietic stem / progenitor cells or T cells, and (b) administering the cells according to any one of claims 15 to 17.
19. 19. The method of claim 18, wherein the hematological malignancy comprises multiple myeloma.
20. A pharmaceutical composition comprising the cells of any one of claims 15 to 17 and a pharmaceutically acceptable carrier.
21. 18. A kit comprising the cells of any one of claims 15 to 17 and, optionally, one or more cytotoxic agents that target cell surface antigens whose genes have been edited in hematopoietic stem / progenitor cells or T cells.
22. A polypeptide comprising an amino acid sequence that is at least 80% identical to the sequence set forth in SEQ ID NO: 52, wherein said polypeptide comprises a mutation at S274F, and said polypeptide has reduced binding to a therapeutic anti-CD38 antibody.
23. A nucleic acid encoding the polypeptide of claim 22.
24. A vector comprising the nucleic acid of claim 23.
25. 25. A cell comprising the nucleic acid of claim 23 or the vector of claim 24.
26. 26. A method for producing a polypeptide, comprising culturing the cell of claim 25 under conditions that allow expression of the polypeptide, and optionally isolating the polypeptide.
27. A polynucleotide comprising a segment having a crRNA sequence that is at least 75% identical to one or more of the sequences shown in the table below. Table 1
28. 28. The polynucleotide of claim 27, comprising a segment having one or more crRNA sequences of SEQ ID NOs: 11-13.