Cathepsin L inhibitors

Compounds inhibiting cathepsin L address CatL-associated diseases by reducing CatL activity, offering therapeutic benefits for various conditions including SARS, COVID-19, and other infections and diseases.

JP2026503247APending Publication Date: 2026-01-28BIOFRONT THERAPEUTICS (BEIJING) CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2025538680
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-04-21
Filing Date
2023-12-20
Publication Date
2026-01-28

AI Technical Summary

Technical Problem

There is a need for novel inhibitors of cathepsin L (CatL) to treat or prevent CatL-associated diseases such as tumor invasion, chronic inflammation, diabetes, cardiovascular disease, kidney disease, bone disease, neurodegenerative diseases, and viral infections.

Method used

Development of compounds represented by Formula (Ia) and listed in Table 1, which inhibit CatL activity and are used in a pharmaceutically effective amount to treat or prevent CatL-related diseases.

Benefits of technology

The compounds effectively reduce CatL activity, providing therapeutic benefits for diseases like severe acute respiratory syndrome (SARS), COVID-19, long-term effects of COVID-19, RSV infection, Ebola virus infection, MERS, herpes simplex virus infection, ARDS, AKI, liver injury, liver fibrosis, cancer, osteoporosis, inflammation, atherosclerosis, kidney disease, and diabetes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026503247000001_ABST
    Figure 2026503247000001_ABST
Patent Text Reader

Abstract

The present disclosure provides a plurality of compounds. The compounds can inhibit cathepsin L (CatL). Compositions comprising at least one of these compounds are also provided. Methods for treating or preventing one or more CatL-associated diseases in a subject are also provided. The method may include administering the composition to the subject.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to Chinese Patent Application No. 202211702259.1 filed on December 29, 2022, Chinese Patent Application No. 202310440959.6 filed on April 21, 2023, U.S. Provisional Patent Application No. 63 / 478,502 filed on January 5, 2023, and U.S. Non-Provisional Patent Application No. 18 / 194,609 filed on March 31, 2023, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Technical Field FIELD OF THE DISCLOSURE The present disclosure relates generally to inhibitors of proteases, in particular inhibitors of cathepsin L (CatL), and their pharmaceutical use for the treatment or prevention of CatL-associated diseases. [Background technology]

[0003] background Cathepsins are proteases that contain serine, cysteine, or aspartic acid residues as nucleophiles and are essential for digestion, coagulation, immune response, peptide synthesis, and other processes. There are three main families of cathepsins: serine proteases (cathepsins A and G), aspartic acid proteases (cathepsins D and E), and eleven cysteine ​​proteases (cathepsins B, C, F, H, K, L, O, S, V, X, and W). As a member of the cysteine ​​protease family of cathepsins, CatL is involved in multiple physiological processes, including apoptosis, antigen processing, and extracellular matrix modeling. It is also involved in pathological conditions, such as tumor invasion and metastasis, chronic inflammation, diabetes, cardiovascular disease, kidney disease, bone disease, neurodegenerative diseases, and viral infections. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] J Virol. 1990 Feb; 64(2): 941~943 [Non-patent document 2] Mucosal Immunol. 2015 Jan; 8(1): 161~175 [Non-patent document 3] Zhao, MM et al., Novel cleavage sites identified in SARS-CoV-2 spike protein reveal the mechanism for cathepsin L-facilitated viral infection and treatment strategies. Cell Discovery. 8: 53~70 (2022) Summary of the Invention [Problem to be solved by the invention]

[0005] It is therefore desirable to develop novel CatL inhibitors for therapeutic use in treating or preventing CatL-associated diseases. [Means for solving the problem]

[0006] overview According to one aspect of the present disclosure, a compound is provided, the compound having formula (Ia):

[0007] [ka]

[0008] wherein R1 and R2 may be independently selected from H, a -CH2- group, and an alkyl group. R1 and R2 may be unconnected or connected via a single bond. W may be CO or SO2. R3 may be an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, or a heterocyclic group, and R3 may be optionally substituted with one or more groups selected from halogens, hydroxyl groups, alkyl groups, fluoroalkyl groups, cycloalkyl groups, aryl groups, heterocyclic groups, and alkoxy groups. X1 may be a CH group or N. X2 may be O, S, or N-R4, and R4 may be selected from H, an alkyl group, an aryl group, and a heterocyclic group. X3 may be H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group, and X3 may be optionally substituted with one or more groups selected from halogens, hydroxyl groups, alkyl groups, fluoroalkyl groups, cycloalkyl groups, and alkoxy groups. Z1 may be a CH group, C-R5, or N. Z2 may be a CH group, C-R6, or N. Z3 may be a CH group, C-R7, or N. Z4 may be a CH group, C-R8, or N. R5-R8 may be independently selected from H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, —CN, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, and a heterocyclic group, and each of R5-R8 may be optionally substituted with one or more groups selected from a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, a heterocyclic group, a cycloalkyl group, an aryl group, and an alkoxy group.

[0009] According to another aspect of the present disclosure, there is provided a compound selected from Table 1. Table 1 is provided in the "Detailed Description" section.

[0010] According to yet another aspect of the present disclosure, there is provided a method for treating a disease in a subject. The method may include administering a composition to a subject suffering from the disease. The composition comprises a compound represented by formula (Ia):

[0011] [ka]

[0012] , its isomers, its enantiomers, its diastereomers, its racemates, its solvates, or pharmaceutically acceptable salts thereof, in a pharmaceutically effective amount. R1 and R2 may be independently selected from H, a -CH2- group, and an alkyl group. R1 and R2 may be unconnected or connected via a single bond. W may be CO or SO2. R3 may be an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, or a heterocyclic group, and R3 may be optionally substituted with one or more groups selected from halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an aryl group, a heterocyclic group, and an alkoxy group. X1 may be a CH group or N. X2 may be O, S, or N-R4, and R4 may be selected from H, an alkyl group, an aryl group, and a heterocyclic group. X3 may be H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group, and X3 may be optionally substituted with one or more groups selected from a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, and an alkoxy group. Z1 may be a CH group, C-R5, or N. Z2 may be a CH group, C-R6, or N. Z3 may be a CH group, C-R7, or N. Z4 may be a CH group, C-R8, or N. R5 to R8 may be independently selected from H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, —CN, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, and a heterocyclic group, and each of R5 to R8 may be optionally substituted with one or more groups selected from a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, a heterocyclic group, a cycloalkyl group, an aryl group, and an alkoxy group.The disease may include at least one of severe acute respiratory syndrome (SARS), coronavirus disease 19 (COVID-19), long-term effects of coronavirus (long COVID), post-acute sequelae of COVID-19 (PASC), respiratory syncytial virus (RSV) infection, Ebola virus infection, Middle East respiratory syndrome (MERS), herpes simplex virus infection, acute respiratory distress syndrome (ARDS), ARDS-induced multiple organ failure, acute kidney injury (AKI), liver injury, liver fibrosis, cancer, osteoporosis, inflammation, atherosclerosis, kidney disease, bone disease, or diabetes.

[0013] Additional features will be set forth in part in the description that follows, and in part will become apparent to those skilled in the art upon examination of the following and the accompanying drawings, or may be learned by the creation or operation of the examples. The features of the present disclosure can be realized and attained by practice or use of various aspects of the methodologies, instrumentalities, and combinations set forth in the detailed examples discussed below.

[0014] BRIEF DESCRIPTION OF THE DRAWINGS The present disclosure will now be further described in terms of exemplary embodiments. These exemplary embodiments will be described in detail with reference to the drawings. It should be noted that the drawings are not to scale. These embodiments are non-limiting exemplary embodiments, in which like reference numerals represent similar structures throughout the several views of the drawings. [Brief explanation of the drawings]

[0015] [Figure 1] FIG. 1 is a schematic illustrating an exemplary general procedure A for preparing compound A-7 according to some embodiments of the present disclosure. [Figure 2] FIG. 1 is a schematic illustrating an exemplary procedure B-1 for preparing compound A-8 based on compound A-7 according to some embodiments of the present disclosure. [Figure 3] FIG. 1 is a schematic illustrating an exemplary procedure B-2 for preparing compound A-8 based on compound A-7 according to some embodiments of the present disclosure. [Figure 4]FIG. 1 is a schematic illustrating an exemplary procedure B-3 for preparing compound A-8 based on compound A-7 according to some embodiments of the present disclosure. [Figure 5] FIG. 1 is a schematic illustrating an exemplary procedure for preparing intermediate I-1 according to some embodiments of the present disclosure. [Figure 6] FIG. 1 is a schematic illustrating an exemplary procedure for preparing intermediate I-2 according to some embodiments of the present disclosure. [Figure 7] FIG. 1 is a schematic illustrating an exemplary procedure for preparing intermediate I-3 according to some embodiments of the present disclosure. [Figure 8] FIG. 1 is a schematic illustrating an exemplary procedure for preparing intermediate I-4 according to some embodiments of the present disclosure. [Figure 9] FIG. 1 is a schematic illustrating an exemplary procedure for preparing intermediate I-5 according to some embodiments of the present disclosure. [Figure 10] FIG. 1 is a schematic illustrating an exemplary procedure for preparing intermediate I-6 according to some embodiments of the present disclosure. [Figure 11] FIG. 1 is a schematic illustrating an exemplary procedure for preparing intermediate I-7 according to some embodiments of the present disclosure. [Figure 12] FIG. 1 is a schematic illustrating an exemplary procedure for preparing intermediate I-8 according to some embodiments of the present disclosure. [Figure 13] FIG. 1 is a schematic illustrating an exemplary procedure for preparing intermediate I-9 according to some embodiments of the present disclosure. [Figure 14] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 1 according to some embodiments of the present disclosure. [Figure 15] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 2 according to some embodiments of the present disclosure. [Figure 16] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 3 according to some embodiments of the present disclosure. [Figure 17] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 4 according to some embodiments of the present disclosure. [Figure 18] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 5 according to some embodiments of the present disclosure. [Figure 19] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 6 according to some embodiments of the present disclosure. [Figure 20] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 7 according to some embodiments of the present disclosure. [Figure 21] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 8 according to some embodiments of the present disclosure. [Figure 22] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 9 according to some embodiments of the present disclosure. [Figure 23] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 10 according to some embodiments of the present disclosure. [Figure 24] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 11 according to some embodiments of the present disclosure. [Figure 25] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 12 according to some embodiments of the present disclosure. [Figure 26] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 13 according to some embodiments of the present disclosure. [Figure 27] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 14 according to some embodiments of the present disclosure. [Figure 28] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 15 according to some embodiments of the present disclosure. [Figure 29] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 16 according to some embodiments of the present disclosure. [Figure 30] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 17 according to some embodiments of the present disclosure. [Figure 31] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 18 according to some embodiments of the present disclosure. [Figure 32] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 19 according to some embodiments of the present disclosure. [Figure 33] FIG. 2 is a schematic illustrating an exemplary procedure for preparing compound 20 according to some embodiments of the present disclosure. [Figure 34] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 21 according to some embodiments of the present disclosure. [Figure 35] FIG. 2 is a schematic illustrating an exemplary procedure for preparing compound 22 according to some embodiments of the present disclosure. [Figure 36] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 23 according to some embodiments of the present disclosure. [Figure 37] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 24 according to some embodiments of the present disclosure. [Figure 38] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 25 according to some embodiments of the present disclosure. [Figure 39] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 26 according to some embodiments of the present disclosure. [Figure 40] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 27 according to some embodiments of the present disclosure. [Figure 41] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 28 according to some embodiments of the present disclosure. [Figure 42] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 29 according to some embodiments of the present disclosure. [Figure 43] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 30 according to some embodiments of the present disclosure. [Figure 44] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 31 according to some embodiments of the present disclosure. [Figure 45]FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 32 according to some embodiments of the present disclosure. [Figure 46] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 33 according to some embodiments of the present disclosure. [Figure 47] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 34 according to some embodiments of the present disclosure. [Figure 48] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 35 according to some embodiments of the present disclosure. [Figure 49] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 36 according to some embodiments of the present disclosure. [Figure 50] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 37 according to some embodiments of the present disclosure. [Figure 51] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 38 according to some embodiments of the present disclosure. [Figure 52] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 39 according to some embodiments of the present disclosure. [Figure 53] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 40 according to some embodiments of the present disclosure. [Figure 54] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 41 according to some embodiments of the present disclosure. [Figure 55] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 42 according to some embodiments of the present disclosure. [Figure 56] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 43 according to some embodiments of the present disclosure. [Figure 57] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 44 according to some embodiments of the present disclosure. [Figure 58] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 45 according to some embodiments of the present disclosure. [Figure 59] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 46 according to some embodiments of the present disclosure. [Figure 60] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 47 according to some embodiments of the present disclosure. [Figure 61] FIG. 1 is a schematic illustrating an exemplary procedure for preparing compound 48 according to some embodiments of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION

[0016] Detailed Description The following description is presented to enable any person skilled in the art to make and use the present disclosure, and is provided in the context of a particular application and its requirements. Various modifications to the disclosed embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the disclosure. Thus, the present disclosure is not limited to the embodiments shown, but is to be accorded the widest scope consistent with the claims.

[0017] The terminology used herein is for the purpose of describing particular example embodiments only and is not intended to be limiting. As used herein, the singular forms "a," "an," and "the" may be intended to include the plural forms as well, unless the context clearly dictates otherwise. It will be further understood that the terms "comprises," "comprising," "includes," and / or "including," when used in this specification, define the presence of stated features, integers, steps, operations, elements, and / or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0018] These and other features and characteristics of the present disclosure, as well as the method of operation and function of the associated elements of construction and combination of parts, and economies of manufacture, will become more apparent from a consideration of the following description, with reference to the accompanying drawings, all of which form a part of this specification. It is to be expressly understood, however, that the drawings are for purposes of illustration and description only and are not intended to limit the scope of the present disclosure. It is understood that the drawings are not to scale.

[0019] According to some aspects of the present disclosure, a plurality of compounds are provided. The compounds can inhibit CatL and can be used to treat or prevent CatL-related diseases in subjects. As used herein, the term "inhibiting CatL" refers to reducing the activity of CatL and / or the content of CatL in a local area (e.g., in vitro and / or in vivo). For convenience, these compounds provided by the present disclosure are referred to herein as "compounds." In some embodiments, the compounds are represented by Formula (Ia):

[0020] [ka]

[0021] It can be expressed by:

[0022] In some embodiments, in formula (Ia), W can be CO or SO. When W is CO, the compound has formula (Ib):

[0023] [ka]

[0024] It can be expressed by:

[0025] When W is SO2, the compound has formula (Ic):

[0026] [ka]

[0027] It can be expressed by:

[0028] In some embodiments, R1 and R2 may be independently selected from H, a -CH2- group, and an alkyl group. In some embodiments, R1 and R2 may be unconnected or connected via a single bond.

[0029] In some embodiments, R3 can be an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, or a heterocyclic group, and R3 can be optionally substituted with one or more groups selected from a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an aryl group, a heterocyclic group, and an alkoxy group.

[0030] In some embodiments, X1 may be a CH group or N. In some embodiments, X2 may be O, S, or N-R4, where R4 may be selected from H, an alkyl group, an aryl group, and a heterocyclic group.

[0031] In some embodiments, X3 can be H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group, and X3 can be optionally substituted with one or more groups selected from a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, and an alkoxy group.

[0032] In some embodiments, Z1 can be a CH group, C-R5, or N. In some embodiments, Z2 can be a CH group, C-R6, or N. In some embodiments, Z3 can be a CH group, C-R7, or N. In some embodiments, Z4 can be a CH group, C-R8, or N. In some embodiments, R5-R8 can be independently selected from H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, —CN, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, and a heterocyclic group, and each of R5-R8 can be optionally substituted with one or more groups selected from a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, a heterocyclic group, a cycloalkyl group, an aryl group, and an alkoxy group.

[0033] In some embodiments, the compound has formula (II):

[0034] [ka]

[0035] It can be expressed by:

[0036] In some embodiments, the compound has formula (III):

[0037] [ka]

[0038] It can be expressed by:

[0039] In some embodiments, the compound has formula (IV):

[0040] [ka]

[0041] It can be expressed by:

[0042] In some embodiments, R can be H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group, and R can be optionally substituted with one or more groups selected from a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, and an alkoxy group.

[0043] In some embodiments, the compound has the formula (V):

[0044] [ka]

[0045] It can be expressed by:

[0046] In some embodiments, at least one of R5 through R8 is H. For example, R5 through R8 are H.

[0047] In some embodiments, at least one of R5-R8 is halogen or -CN, and the others of R5-R8 are H.

[0048] In some embodiments, at least one of R5-R8 is a pyrazole group, optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and the others of R5-R8 are H. For example, one of R5-R8 is represented by formula (VI-a):

[0049] [ka]

[0050] is a group represented by

[0051] In some embodiments, R can be H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group. 10 and R 11 may be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups. Formula (VI-a) may be connected to the benzoxazole group shown in Formula (II), Formula (III), Formula (IV), or Formula (V) through methyl. In such cases, the compound may be, for example, Formula (II-a), Formula (II-b), Formula (II-c), or Formula (II-d):

[0052] [ka]

[0053] It can be expressed by:

[0054] In some embodiments, R to R 10 is H, and the compound has, for example, the formula (II-a1):

[0055] [ka]

[0056] It can be expressed by:

[0057] In some embodiments, at least one of R5-R8 is a cycloalkyl group or a heterocyclic group, which is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and the others of R5-R8 are H. For example, one of R5-R8 is represented by formula (VI-b):

[0058] [ka]

[0059] is a group represented by

[0060] In some embodiments, X4 may be S, O, SO2, N, C, or C-L1. L1 may be selected from H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, and a heterocyclic group, and L1 may be optionally substituted with one or more groups selected from a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an aryl group, a heterocyclic group, and an alkoxy group. In some embodiments, X5 may be N or C. In some embodiments, R 12 is absent or selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and may be optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups. In some embodiments, R 13 ~R 16 may be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; R 13 ~R 16 Each of may be optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups.

[0061] Formula (VI-b) may be connected to the benzoxazole group of Formula (II), Formula (III), Formula (IV), or Formula (V) at X5. In some embodiments, X4 and X5 in Formula (VI-b) may both be N, and the compound may be, for example, Formula (II-e), Formula (II-f), Formula (II-g), or Formula (II-h):

[0062] [ka]

[0063] It can be expressed by:

[0064] In some embodiments, in formula (VI-b), X4 and X5 are both N, and R 12 is a methyl group, and R 13 ~R 16 is H, in such cases the compound may be, for example, of formula (II-g1):

[0065] [ka]

[0066] It can be expressed by:

[0067] As another example, one of R5 to R8 is a group represented by formula (VI-c):

[0068] [ka]

[0069] It may be a group represented by:

[0070] In some embodiments, X6 can be S, O, SO2, N, C, or C-L2. L2 can be selected from H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, and a heterocyclic group. L2 can be optionally substituted with one or more groups selected from a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an aryl group, a heterocyclic group, and an alkoxy group. In some embodiments, R 17is absent or selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and may be optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups. In some embodiments, R 18 ~R 21 may be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; R 18 ~R 21 Each of may be optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups.

[0071] Formula (VI-c) may be connected to the benzoxazole group of Formula (II), Formula (III), Formula (IV), or Formula (V) through a methyl. In some embodiments, X6 in Formula (VI-c) may be N, and the compound may be, for example, Formula (II-i), (II-j), (II-k), or (II-l):

[0072] [ka]

[0073] It can be expressed by:

[0074] In some embodiments, in Formula (VI-c), X6 is N and R 18 ~R 21 is H and R 17 is a methyl group, -CH2-CHF2, or -C2H4-OCH3, and in such cases the compounds may be, for example, compounds of formula (II-k1), formula (II-k2), and formula (II-k2):

[0075] [ka]

[0076] It can be expressed by:

[0077] As yet another example, one of R5 to R8 is a group represented by formula (VI-d):

[0078] [ka]

[0079] It may be a group represented by:

[0080] In some embodiments, R 22 may be H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group; R 22 is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, and alkoxy groups. 23 ~R 25 may be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups.

[0081] In such cases, the compound may be, for example, of formula (II-m), (II-n), (II-o), or (II-p):

[0082] [ka]

[0083] It can be expressed by:

[0084] In some embodiments, in formula (VI-d), R 22 is a methyl group, and R 23 ~R 25is H, in such a case the compound may be, for example, (II-o1):

[0085] [ka]

[0086] It can be expressed by:

[0087] In some embodiments, at least one of R5-R8 is a heteroaryl group, optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and the others of R5-R8 are H. For example, one of R5-R8 is represented by formula (VI-e):

[0088] [ka]

[0089] It may be a group represented by:

[0090] In some embodiments, R 26 ~R 29 is H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, a heterocyclic group, and NR 38 where R 38 may be selected from H, alkyl groups, aryl groups, heterocyclic groups, and ketone groups.

[0091] Formula (VI-e) may be connected to the benzoxazole group of Formula (II), Formula (III), Formula (IV), or Formula (V) via a methyl. In such cases, the compound may be, for example, Formula (II-q), Formula (II-r), Formula (II-s), or Formula (II-t):

[0092] [ka]

[0093] It can be expressed by:

[0094] In some embodiments, in formula (VI-e), R 27 ~R 29 is H and R 26 is a methyl group, -CHF2, or a cyclopropyl group, and therefore compounds can be represented, for example, by formula (II-r1), formula (II-r2), and formula (II-r3):

[0095] [ka]

[0096] It can be expressed by:

[0097] As another example, one of R5 to R8 is a group represented by formula (VI-f):

[0098] [ka]

[0099] It may be a group represented by:

[0100] In some embodiments, R 30 ~R 33 is H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, a heterocyclic group, and NR 38 where R 38 may be selected from H, alkyl groups, aryl groups, heterocyclic groups, and ketone groups.

[0101] Formula (VI-f) may be connected to the benzoxazole group of Formula (II), Formula (III), Formula (IV), or Formula (V) via a methyl. In such cases, the compound may be, for example, Formula (II-u), Formula (II-v), Formula (II-w), or Formula (II-x):

[0102] [ka]

[0103] It can be expressed by:

[0104] In some embodiments, in formula (VI-f), R 31 ~R 33 is H and R 30 is a methyl group, -NH, -NCH, -NHCOCH, or -NHCH, and therefore compounds can be represented, for example, by formula (II-v1), (II-v2), (II-v3), (II-v4), and (II-v5):

[0105] [ka]

[0106] It can be expressed by:

[0107] As yet another example, one of R5 to R8 is a group represented by formula (VI-g):

[0108] [ka]

[0109] It may be a group represented by:

[0110] In some embodiments, R 34 ~R 37 is H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, a heterocyclic group, and NR 38where R 38 may be selected from H, alkyl groups, aryl groups, heterocyclic groups, and ketone groups.

[0111] Formula (VI-g) may be connected to the benzoxazole group of formula (II), formula (III), formula (IV), or formula (V) via a methyl. In such cases, the compound may be, for example, a compound of formula (II-y):

[0112] [ka]

[0113] It can be expressed by:

[0114] In some embodiments, in formula (VI-g), R 35 ~R 37 is H and R 34 is a methyl group, and therefore the compound may be, for example, of the formula (II-y1):

[0115] [ka]

[0116] It can be expressed by:

[0117] In some embodiments, R3 can be an aryl group, optionally substituted with one or more groups selected from halogen, cycloalkyl, fluoroalkyl, methyl, ethyl, propyl, and butyl groups. For example, R3 can be a halogenated benzene.

[0118] In some embodiments, R3 can be a heterocyclic group, optionally substituted with one or more groups selected from halogen, cycloalkyl, fluoroalkyl, methyl, ethyl, propyl, and butyl groups. For example, R3 can be represented by formula (VII-a):

[0119] [ka]

[0120] is a group represented by

[0121] In some embodiments, R 39 ~R 42 is H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, a heterocyclic group, and NR 49 where R 49 is selected from H, an alkyl group, an aryl group, a heterocyclic group, and a ketone group. Formula (VII-a) may be connected to -CO- or -SO2- shown in Formula (II), Formula (III), Formula (IV), or Formula (V) by a methyl. In such a case, the compound may be, for example, a compound of Formula (II-aa):

[0122] [ka]

[0123] It can be expressed by:

[0124] In some embodiments, R 40 ~R 42 is H and R 39 is a methyl group, and therefore the compound may have the formula (II-aa1):

[0125] [ka]

[0126] It can be expressed by:

[0127] In some embodiments, R3 may be selected from an imidazole group, a pyrrole group, a pyrazole group, a triazole group, a piperidine group, a pyridine group, a pyrimidine group, and a pyridazine group, and R3 may be optionally substituted with one or more groups selected from a cycloalkyl group, a fluoroalkyl group, a methyl group, and a tertiary butyl group. For example, R3 may be represented by formula (VII-b):

[0128] [ka]

[0129] is a group represented by

[0130] In some embodiments, R 43 may be H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group. 44 and R 45 may be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; R 44 and R 45 Each of may be optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups. Formula (VII-b) may be connected to -CO- or -SO2- shown in Formula (II), Formula (III), Formula (IV), or Formula (V) via methyl. In such cases, the compound may be, for example, Formula (II-bb):

[0131] [ka]

[0132] It can be expressed by:

[0133] In some embodiments, R 45 is H and R43 is a methyl group, a cyclopropyl group, or

[0134] [ka]

[0135] and R 44 is a tert-butyl group, a cyclopropyl group, or

[0136] [ka]

[0137] is.

[0138] In another example, R3 is a group represented by formula (VII-c):

[0139] [ka]

[0140] is a group represented by

[0141] In some embodiments, R 46 may be H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group. 47 and R 48 may be independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; R 47 and R 48Each of these is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups. Formula (VII-c) may be connected to -CO- or -SO2- shown in Formula (II), Formula (III), Formula (IV), or Formula (V) via methyl. In such cases, the compound may be, for example, a compound of Formula (II-cc):

[0142] [ka]

[0143] It can be expressed by:

[0144] In some embodiments, R 48 is H and R 46 is a methyl group, -CHF2, or -CF3, and R 47 is a cyclopropyl group.

[0145] In some embodiments, R1 and R2 can be H. In some embodiments, R1 and R2 can be -CH2- groups connected via a single bond.

[0146] Some exemplary compounds provided by the present disclosure as CatL inhibitors are shown in Table 1.

[0147] [Table 1A]

[0148] [Table 1B]

[0149] [Table 1C]

[0150] [Table 1D]

[0151] [Table 1E]

[0152] It should be noted that the compounds listed above in Table 1 are provided for illustrative purposes only. Other compounds represented by the formulas presented in this disclosure (e.g., Formula (Ia), Formula (Ib), Formula (Ic), Formula (II), Formula (III), Formula (IV), and Formula (V)) are also within the scope of this disclosure.

[0153] According to another aspect of the present disclosure, there is provided a composition, which may comprise a pharmaceutically effective amount of at least one of the compounds described above, their isomers, their enantiomers, their diastereomers, their racemates, their solvates, or their pharmaceutically acceptable salts.

[0154] In some embodiments, the composition may further comprise a pharmaceutically acceptable carrier. For example, the carrier may comprise a coating layer, a capsule, a microcapsule, a nanocapsule, etc., or any combination thereof. It should be noted that the carrier may need to be non-toxic and may not have a significant effect on the activity of the main ingredient (e.g., the compound described above) in the pharmaceutical composition. In some embodiments, the carrier may protect the main ingredient from some undesirable conditions, such as oxidation, decomposition, or inactivation of the main ingredient. For example, enzymes or the relatively low pH in the stomach may cause the decomposition or inactivation of the main ingredient. By protecting the main ingredient in the pharmaceutical composition, the carrier may help maintain or increase the efficacy of the pharmaceutical composition. In some embodiments, the carrier may be used for controlled release of the main ingredient. Controlled release may include, but is not limited to, slow release, sustained release, targeted release, etc. For example, the carrier may comprise a hydrogel capsule, microcapsule, or nanocapsule made from collagen, gelatin, chitosan, alginate, polyvinyl alcohol, polyethylene oxide, starch, cross-linked starch, etc., or any combination thereof. In some embodiments, the carrier can facilitate the controlled release of a key ingredient (e.g., at least one of the compounds described above) in a pharmaceutical composition.

[0155] In some embodiments, the composition may be administered to a subject via oral administration, injection, inhalation, or topical administration. In some embodiments, injection administration may include subcutaneous injection, intramuscular injection, intravenous injection, etc. In some embodiments, injection administration may include injection of the composition into a tumor or an area adjacent to a tumor. In some embodiments, injection administration may include injection of the composition into the kidney, liver, heart, thyroid, or joint. In some embodiments, inhalation administration may include applying a composition dispersed via an aerosol spray, mist, or powder. In some embodiments, topical administration may include applying a composition to the skin to reduce cancer, such as skin cancer or lymphoma. In some embodiments, topical administration may include vaginal administration, rectal administration, intranasal administration, auricular administration, intramedullary administration, intraarticular administration, intrapleural administration, etc., or any combination thereof. In some embodiments, the composition may be administered to a subject via a combination of different administration means. In some embodiments, the method may include administering the composition to a subject three times a day, twice a day, once a day, once every two days, etc.

[0156] In some embodiments, a method of treating a disease in a subject is provided. The method can include administering to the subject a composition as described above.

[0157] In some embodiments, the subject is a human. In some embodiments, the subject is a non-human animal. In some embodiments, the subject is male. In some embodiments, the subject is female. In some embodiments, the subject is suffering from a disease or condition.

[0158] In some embodiments, the disease may be caused by a viral infection. The compounds provided by the present disclosure exhibit significant antiviral effects. Therefore, the compounds may be used to treat diseases associated with viral infection.

[0159] For example, the disease may include severe acute respiratory syndrome (SARS), severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1) infection, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, or coronavirus disease 19 (COVID-19). By way of example only, the compounds may be used to treat the long-term effects of coronavirus (long COVID) or post-acute sequelae (PASC) of COVID-19. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the coronavirus that has caused the coronavirus disease 2019 (COVID-19) pandemic over the past three years. It poses a significant threat to public health and socioeconomic systems worldwide. To date, most COVID-19 treatments have focused on targeting the viral spike protein (S protein) and viral proteases (primarily 3C-like proteases and papain-like proteases). These treatments have proven effective in preventing SARS-CoV-2 infection and severe COVID-19 symptoms. However, more immune-evasive and highly contagious SARS-CoV-2 variants continue to emerge and spread worldwide, calling for innovative strategies to develop new antiviral drugs to combat COVID-19.

[0160] As another example, the disease may include herpes simplex virus (HSV) infection. Infection with HSV, known as cold sores, is common worldwide. Several medications are available to reduce the severity and frequency of symptoms, but they cannot cure the infection. Cystatin C is a human cysteine ​​protease inhibitor present in extracellular fluid. Cystatin C and a tripeptide derivative (Z-LVG-CHN2) that mimics the protease binding center were tested for possible antiviral activity against HSV type 1 and poliovirus type 1 (J Virol. 1990 Feb; 64(2): 941-943). Thus, the compounds provided by the present disclosure may be used to treat HSV infection.

[0161] As yet another example, the disease may include respiratory syncytial virus (RSV) infection. Human RSV is a common cause of lower respiratory tract infections worldwide in all age groups. RSV infection is frequently reported in infants, the elderly, and immunocompromised patients. RSV is highly contagious and can be fatal. No vaccine is currently available to prevent RSV infection. Current antiviral drugs for the treatment of RSV infection have significant limitations. There is an urgent need to explore new pharmaceuticals that can meet clinical needs. RSV infection increases the expression and activity of several host proteases, including the MMP and cathepsin families of proteases. The induced host protease response can drive RSV infection and may play a key role in disease progression. Selective cathepsin L inhibitors, alone or in combination with inhibition of additional host proteases, have the potential to enhance RSV clearance and prevent RSV-induced airway hyperresponsiveness and allergic responses. It has been reported that the cathepsin inhibitor E64 or ribavirin prevents airway hyperresponsiveness and enhances viral clearance in RSV-infected mice (Mucosal Immunol. 2015 Jan; 8(1): 161-175). Therefore, the compounds provided by the present disclosure may be used to treat RSV infection.

[0162] As yet another example, the disease may include Ebola virus infection or Middle East Respiratory Syndrome (MERS).

[0163] In some embodiments, the disease may be acute respiratory distress syndrome (ARDS) or ARDS-induced multiple organ failure (e.g., pulmonary, renal, hepatic).

[0164] In some embodiments, the disease may be acute kidney injury (AKI). For example, AKI may be caused by anti-cancer drugs, microbial infections, parasites, etc.

[0165] In some embodiments, the disease may be liver injury or liver fibrosis.

[0166] In some embodiments, the disease may be cancer.

[0167] In some embodiments, the disease may be osteoporosis.

[0168] In some embodiments, the disease may be inflammation.

[0169] In some embodiments, the disease may be atherosclerosis.

[0170] In some embodiments, the disease may be a kidney disease or a bone disease.

[0171] In some embodiments, the disease may be diabetes.

[0172] In some embodiments, the method can include orally administering the composition to the subject, injecting the composition to the subject, or administering the composition to the subject via topical administration.

[0173] According to another aspect of the present disclosure, there is provided a method of inhibiting cathepsin L in a subject. The method may comprise administering to the subject a composition as described above.

[0174] In some embodiments, the step of administering the composition to the subject can include orally administering the composition to the subject, inhaling the composition to the subject, injecting the composition to the subject, or administering the composition to the subject via topical administration.

[0175] According to another aspect of the present disclosure, there is provided a use of the aforementioned compound for inhibiting cathepsin L in a subject. The use of the compound may include the steps mentioned in the method for inhibiting CatL.

[0176] According to yet another aspect of the present disclosure, there is provided the use of at least one of the aforementioned compounds for preparing a composition for treating a disease in a subject.

[0177] The present disclosure is further described by the following examples, which should not be construed as limiting the scope of the disclosure. [Example]

[0178] Example Abbreviation Å = Angstrom; Ac = acetyl; Ac2O = acetic anhydride; Boc2O = di-tert-butyl dicarbonate; DCM = dichloromethane; DIPEA = N,N-diisopropylethylamine or N-ethyl-N-isopropyl-propan-2-amine; DMAP = dimethylaminopyridine; DMA = dimethylacetamide; DME = dimethoxyethane; DMF = dimethylformamide; DMSO = dimethyl sulfoxide; EtOAc / EA = ethyl acetate; EtOH = ethanol; FA = formic acid; HATU = 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate; HOAc = acetic acid; KOAc = potassium acetate; LiHMDS = lithium bis(trimethylsilyl) (p-toluenesulfonyl)amide; MeMgBr = methylmagnesium bromide; MeOH = methanol; NaOAc = sodium acetate; NBS = N-bromosuccinimide; Pd(dppf)2Cl2 = [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II); PE = petroleum ether; PTSA = p-toluenesulfonic acid monohydrate; rt = room temperature (ambient temperature); T3P = 2,4,6-tripropyl-1,3,5,2,4,6-trioxatriphosphorinane-2,4,6-trioxide; TEA = triethylamine; TFA = trifluoroacetic acid; THF = tetrahydrofuran; TsCl = p-toluenesulfonyl chloride; UV = ultraviolet; X-Phos = 2-dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl.

[0179] Example 1 Inhibition of CatL by compounds In vitro biological data Human cathepsin L (CatL) enzyme assay Human cathepsin L enzyme assays were performed in assay buffer (50 mM MES pH 5.5, 2.5 mM DTT, 0.5 mM EDTA) to evaluate the inhibition of human CatL by test compounds. 60 μL of compound was added to a 384-well dilution plate. Compound solutions were serially diluted 1:3 in DMSO, with 10 points per column. 0.05 μL of diluted compound solution was added to each row of a 384-well assay plate (Corning 4514) using an Echo (LABCYTE 655), with each column containing two replicates. 5 μL of a working solution of human CatL enzyme (Abcam ab81780) was added to the 384-well assay plate and centrifuged at 1000 rpm for 1 minute. The mixture was incubated at 25°C for 15 minutes, and then 5 μL of a working solution of CatL substrate (Genscript C7360HB140_5) was added to initiate the reaction (CatL: 0.05 nM, substrate: 500 nM). The incubation was continued at 25°C for 30 minutes. Fluorescence signals were read at Ex 370 nm and Em 460 nm using a BMG Clariostar Plusaucu. Percent inhibition for each compound was calculated, and IC values ​​were obtained from nonlinear regression using XLfit 5.5.0. 50 The half-maximal inhibitory concentrations (HAIs) were fitted. The results of the CatL enzyme assay are shown in Table 2 below.

[0180] [Table 2]

[0181] This example demonstrates that the compounds provided by the present disclosure can be effectively used as CatL inhibitors. The results show that many of compounds 1-48 exhibit significant inhibitory potency against CatL. Specifically, the IC values ​​of compounds 1-4, 6-9, 13, 15, 19-22, 24-29, 31, and 44 for inhibiting CatL were 50 Furthermore, the IC values ​​of compounds 2, 3, 6, 13, 20-22, 24, 26, 27, 29, 33-35, 38-43, and 45-48 for inhibiting CatL were less than 50 nM. 50was less than 10 nM.

[0182] Example 2 Pseudovirus infection assay To infect a host, SARS-CoV-2 must enter the host cell for viral replication. This depends on proper cleavage and activation of the viral S protein by host cell proteases, primarily furin, TMPRSS2, and cathepsin L (also known as CatL or CTSL). TMPRSS2 and furin cleave the viral S protein at distinct sites to prepare the virus for entry into the host cell. CatL then cleaves the S protein into smaller fragments to facilitate fusion between the viral and endosomal membranes, allowing the release of the viral genome into the host cell for viral replication. The CatL cleavage site is highly conserved among all known SARS-CoV-2 variants. Therefore, inhibition of CatL, alone or in combination with inhibition of additional host proteases, will likely prevent proper processing of the S protein and infection by SARS-CoV-2 and its variants.

[0183] Pseudoviruses (PsVs), or mutants, incorporating the S protein from SARS-CoV-2 were constructed using published procedures. In this VSV-based PsV system, the backbone was provided by a VSV-G pseudotyped virus (G*ΔG-VSV), which encapsulates an expression cassette for firefly luciferase in place of VSV-G in the VSV genome. For PsV quantification, viral RNA was extracted using the QIAamp Viral RNA Mini Kit (Cat. No. 52906, QIAGEN), and reverse transcription was performed using the RevertAid™ First-Strand cDNA Synthesis Kit (Fermentas K1622) according to the manufacturer's instructions. Real-time qPCR was then performed on a LightCycler® 96 Real-Time PCR System (Roche) using SYBR Green I Master Mix Reagent (Roche). The VSV viral P protein gene was quantified, and viral copy numbers were calculated accordingly. The forward primer was TCTCGTCTGGATCAGGCGG (SEQ ID NO: 1), while the reverse primer was TGCTCTTCCACTCCATCCTCTTGG (SEQ ID NO: 2). All PsVs were normalized to the same amount as previously described (see Zhao, MM et al., Novel cleavage sites identified in SARS-CoV-2 spike protein reveal the mechanism for cathepsin L-facilitated viral infection and treatment strategies. Cell Discovery. 8: 53-70 (2022)).

[0184] Vero E6 cells were maintained in high-glucose Dulbecco's modified Eagle's medium (DMEM) (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Carlsbad, CA) and 100 units / mL penicillin-streptomycin (Gibco). All cells were maintained at 37°C in a humidified atmosphere containing 95% air and 5% CO.

[0185] To evaluate the antiviral effects of test compounds, Vero E6 cells were seeded into 96-well cell culture plates and then co-treated with different concentrations of test compounds and SARS-CoV-2 PsV (100 μL of normalized PsV was added to each well). After 24 hours of incubation at 37°C, firefly luciferase activity was measured in the cell lysates using luciferase substrate (PerkinElmer, Bright Light Plus 100 mL Kit, Catalog No. 6066761) according to the manufacturer's instructions. Luciferase activity was quantified using a luminometer (Promega). Infection rates were calculated from control reactions containing vehicle only. The results of the mock virus infection assay are shown in Table 3 below.

[0186] [Table 3]

[0187] This example demonstrates that compounds provided by the present disclosure can effectively protect cells from viral infection and can be used to treat or prevent diseases associated with viral infection (e.g., SARS-CoV-2). According to the results in Table 3, many of compounds 1-48 were able to protect cells from pseudoviral infection in a dose-dependent manner from 500 nM to 5 uM, and some compounds (e.g., compounds 29, 45, and 46) demonstrated nearly complete protection at 500 nM.

[0188] Example 3 Preparation of compounds 1-48 General Procedure A General Procedure A for preparing Compound A-7 is illustrated in Figure 1. As illustrated in Figure 1, General Procedure A may include steps A to D.

[0189] Step A. Benzoxazole ring formation Ethyl (tert-butoxycarbonyl)-L-asparaginate (A-1, 1 equivalent) was dissolved in 1,2-dichloroethane (0.2 M) and diluted with EtO +. BF4 - (1.2 equiv.) was added in small portions under nitrogen. The resulting mixture was stirred at RT (room temperature) for 24 h. A solution of (substituted) aminophenol (A-2, 1 equiv.) in 2 mL of ethanol (2 M) was transferred to the solution via syringe. The mixture was heated to 90 °C and stirred for 24 h. The reaction mixture was cooled to room temperature, saturated NaHCO3 (aq.) was added, and the aqueous layer was then extracted with dichloromethane. The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration and concentration, the crude product was purified by chromatography (EtOAc in PE, 25% to 50%) to give the desired product A-3.

[0190] Step B. Ester Hydrolysis A solution of ester A-3 (1 equivalent) in THF (0.1 M) and 1 N LiOH (aqueous, 3 equivalents) was stirred at room temperature for 3 hours. The reaction was adjusted to pH 7 with HCl (1 M) and then extracted with DCM / MeOH (v / v, 10:1). The combined organic layer was separated, dried (MgSO), and concentrated to give the desired product A-4.

[0191] Step C. Amide Coupling (C-Terminus) To a stirred solution of acid A-4 (1 equiv.), 1-aminocyclopropane-1-carbonitrile hydrochloride A-5 (1.2 equiv.), and T3P (50 wt. % solution in EA, 1.1 equiv.) in DCM (0.2 M) was added DIPEA (4 equiv.). The reaction mixture was stirred at room temperature under a N atmosphere for 3 h. The reaction mixture was concentrated and purified by chromatography (40% to 100% EtOAc in PE) to give the desired product A-6.

[0192] Step D. N-Boc deprotection A solution of protected amine A-6 in HCOOH (0.4 M) was stirred at 25° C. for 5 h. The mixture was blown to dryness with nitrogen at 20° C., basified with saturated NaHCO (aq), and extracted with EA. The combined organic layers were concentrated to give the desired product A-7.

[0193] General Procedure B-1 General procedure B-1 for preparing compound A-8 based on compound A-7 is illustrated in FIG.

[0194] A solution of amine A-7 (1 equiv.), acyl chloride (1.1 equiv.), and DIPEA (3 equiv.) in DCM (0.5 M) was stirred for 2 h at 25° C. The reaction mixture was concentrated, and the residue was purified by preparative high-performance liquid chromatography (HPLC) [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-HO (0.1% FA); 15%-80%)] to give the desired product A-8.

[0195] General Procedure B-2 General procedure B-2 for preparing compound A-8 based on compound A-7 is illustrated in FIG.

[0196] To a stirred solution of amine A-7, acid (1.2 equiv.), and DIPEA (4 equiv.) in DCM (0.1 M) was added T3P (50 wt % DMF solution, 1.2 equiv.) dropwise. The reaction was stirred at 25 °C for 3 h. The reaction mixture was quenched with water and extracted with DCM. The combined organic layers were dried over Na2SO4 and concentrated in vacuo to give the crude product, which was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-HO (0.1% FA); 15%-80%)] to give the desired product A-8.

[0197] General Procedure B-3 General procedure B-3 for preparing compound A-8 based on compound A-7 is illustrated in FIG.

[0198] To a stirred solution of amine A-7 (70 mg, 0.2 mmol) in DMF (0.2 M) was added acid (1 eq.), DIPEA (5 eq.), and HATU (3 eq.). The reaction mixture was stirred under N at room temperature for 2 h. After the reaction was completed, HO was added to the reaction mixture, which was then extracted with EA. The combined organic layer was washed with brine and dried over anhydrous NaSO. After filtration, the solution was concentrated in vacuo, and the residue was purified by preparative HPLC to give the desired product A-8.

[0199] Synthesis of intermediates Intermediate I-1: Preparation of 3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxylic acid FIG. 5 is a schematic illustrating an exemplary procedure for preparing intermediate I-1 according to some embodiments of the present disclosure.

[0200] Step 1. Preparation of ethyl 3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxylate To a solution of cyclopropylhydrazine hydrochloride (1.5 g, 0.0138 mol) in EtOH (40 mL), 5N aqueous NaOH (3 mL) was added and stirred at 0° C. for 10 minutes. The mixture was then added to an ethanol solution of ethyl 5,5-dimethyl-2,4-dioxohexanoate (4.14 g, 0.02 mol). The resulting mixture was stirred at 60° C. for 16 hours. The mixture was concentrated, and the residue was purified by flash column (PE / EA=50:1) to obtain the product as a colorless oil (1.79 g, 50.3%). The resulting compound was subjected to mass spectrometry analysis, and the test result was as follows: Mass (m / z): 237.1 [M+H] + .

[0201] Step 2. Preparation of 3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxylic acid To a solution of ethyl 3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxylate (1.79 g, 7.6 mmol) in THF (18 mL), HO (6 mL), and MeOH (6 mL) was added LiOH (3.19 g, 76 mmol) and stirred at room temperature for 5 hours. The solvent was removed under reduced pressure. The residue was dissolved in HO (20 mL) and adjusted to pH 7 by using 1N aqueous HCl. The mixture was then extracted with DCM (100 mL x 2). The combined organic layers were washed with brine (50 mL) and then dried over anhydrous NaSO. After filtration, the solution was concentrated under vacuum to give the product as a pale pink solid (1.45 g, 86%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 209.1 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 13.16 (s, 1H), 6.67 (s, 1H), 4.27 (d, J = 3.8 Hz, 1H), 1.21 (s, 9H), 1.11-1.04 (m, 2H), 0.95 (dd, J = 7.2, 2.4Hz, 2H).

[0202] Intermediate I-2: Preparation of 1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxylic acid FIG. 6 is a schematic illustrating an exemplary procedure for preparing intermediate I-2 according to some embodiments of the present disclosure.

[0203] Step 1. Preparation of ethyl 1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxylate To a solution of ethyl (Z)-2-(ethoxymethylene)-4,4,4-trifluoro-3-oxobutanoate (2 g, 8.3 mmol) in toluene (20 mL) at 0° C., cyclopropylhydrazine hydrochloride (0.54 g, 4.9 mmol) was added. The mixture was stirred under N2 at 50° C. for 16 hours. Upon completion, the mixture was concentrated under vacuum. The residue was purified by preparative TLC (PE:EA=4:1) to give the product as a white solid (500 mg, 22%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 249.2 [M+H] + .

[0204] Step 2. Preparation of 1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxylic acid A solution of ethyl 1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxylate (620 mg, 2.48 mmol) in 1N aqueous LiOH (5 mL) and THF (5 mL) was stirred at room temperature for 16 hours. The mixture was acidified to pH 3-4 with 5N aqueous HCl and extracted with EA (20 mL x 3). The combined organic layer was washed with brine (20 mL x 2) and dried over Na2SO4. The filtrate was then concentrated by filtration to give the product as a white solid (447 mg, 70%). The resulting compound was subjected to mass spectrometry analysis, and the results are as follows: Mass (m / z): 221.0 [M+H] + .

[0205] Intermediate I-3: Preparation of 1-cyclopropyl-3-(difluoromethyl)-1H-pyrazole-4-carboxylic acid FIG. 7 is a schematic illustrating an exemplary procedure for preparing intermediate I-3 according to some embodiments of the present disclosure.

[0206] Step 1. Preparation of ethyl (Z)-2-(ethoxymethylene)-4,4-difluoro-3-oxobutanoate A solution of ethyl 4,4-difluoro-3-oxobutanoate (5 g, 30 mmol) and (diethoxymethoxy)ethane (10 mL, 58 mmol) in acetic anhydride (30 mL) was stirred under N at 140 °C for 6 hours. After completion, the mixture was concentrated under vacuum to give the product as a pale yellow oil (5 g, 74%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): Mass (m / z): 222.0 [M+H] + .

[0207] Step 2. Preparation of ethyl 1-cyclopropyl-3-(difluoromethyl)pyrazole-4-carboxylate To a solution of ethyl (Z)-2-(ethoxymethylene)-4,4-difluoro-3-oxobutanoate (1.55 g, 0.45 mmol) in toluene (10 mL) at 0° C., cyclopropylhydrazine hydrochloride (0.46 g, 4.2 mmol) was added. The mixture was stirred under N2 at 50° C. for 16 hours. After completion, the mixture was concentrated under vacuum. The residue was purified by preparative TLC (PE:EA=5:1) to give the product as a pale yellow solid (210 mg, 11%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 231.0 [M+H] + .

[0208] Step 3. Preparation of 1-cyclopropyl-3-(difluoromethyl)-1H-pyrazole-4-carboxylic acid A solution of ethyl 1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxylate (210 mg, 0.9 mmol) in 1N aqueous LiOH (2 mL) and THF (2 mL) was stirred at room temperature for 16 hours. The mixture was acidified to pH 3-4 with 5N aqueous HCl and extracted with EA (20 mL x 3). The combined organic layer was washed with brine (20 mL x 2) and dried over Na2SO4. The filtrate was then concentrated by filtration to give the product as a white solid (150 mg, 77%). The resulting compound was subjected to mass spectrometry analysis, and the results are as follows: Mass (m / z): 203.1 [M+H]+ .

[0209] Intermediate I-4: Preparation of 3-(tert-butyl)-1-(oxetan-3-yl)-1H-pyrazole-5-carboxylic acid FIG. 8 is a schematic illustrating an exemplary procedure for preparing intermediate I-4 according to some embodiments of the present disclosure.

[0210] Step 1. Preparation of ethyl 3-(tert-butyl)-1-(oxetan-3-yl)-pyrazole-5-carboxylate To a solution of ethyl 3-(tert-butyl)-1H-pyrazole-5-carboxylate (1.6 g, 8 mmol) and K2CO3 (2.24 g, 16 mmol) in DMF (8 mL) was added 3-iodooxetane (1.3 mL, 12 mmol). The reaction was stirred at 75 °C for 24 hours. The reaction mixture was quenched with ice water and extracted with EtOAc (30 mL x 3). The combined organic layers were washed with water (30 mL x 3) and brine (30 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by flash chromatography (PE / EtOAc = 4:1) to give the product as a white solid (1.9 g, 94%). The resulting compound was subjected to mass spectrometry analysis, and the results were as follows: Mass (m / z): 253.2 [M+H]+.

[0211] Step 2. Preparation of 3-(tert-butyl)-1-(oxetan-3-yl)-pyrazole-5-carboxylic acid To a solution of ethyl 3-(tert-butyl)-1-(oxetan-3-yl)-pyrazole-5-carboxylate (500 mg, 2 mmol) in THF / HO (5:1, 10 mL) was added LiOH.HO (420 mg, 10 mmol). The reaction mixture was stirred at room temperature for 3 hours. The pH of the reaction solution was adjusted to 5-6 using 1N aqueous HCl. The mixture was then extracted with EtOAc (30 mL x 2). The combined organic layers were washed with brine (30 mL) and then dried over anhydrous NaSO. The mixture was filtered, and the filtrate was concentrated under vacuum to give the desired product (400 mg, 89%) as a white solid. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 225.1 [M+H] + .

[0212] Intermediate I-5: Preparation of 1,3-dicyclopropyl-1H-pyrazole-5-carbonyl chloride FIG. 9 is a schematic illustrating an exemplary procedure for preparing intermediate I-5 according to some embodiments of the present disclosure.

[0213] Step 1. Preparation of methyl 1,3-dicyclopropyl-1H-pyrazole-5-carboxylate To a solution of cyclopropylhydrazine dihydrochloride (2813 mg, 19.4 mmol) in EtOH (50 mL) was added 5N NaOH (3 mL). After stirring at 0° C. for 10 minutes, a solution of methyl 4-cyclopropyl-2,4-dioxobutanoate (2200 mg, 12.9 mmol) in EtOH (50 mL) was added, and the resulting mixture was stirred at 60° C. for 14 hours. The solvent was removed under reduced pressure, and the residue was purified by CombiFlash column (PE / EA = 0-50%) to give the product (800 mg, 27%) as a colorless oil. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 206.9 [M+H] + .

[0214] Step 2. Preparation of 1,3-dicyclopropyl-1H-pyrazole-5-carboxylic acid To a solution of methyl 1,3-dicyclopropyl-1H-pyrazole-5-carboxylate (170 mg, 0.82 mmol) in THF / HO (5:1, 6 mL) was added LiOH.HO (346 mg, 8.2 mmol). The reaction mixture was stirred at room temperature for 4 hours. The pH of the reaction solution was adjusted to 5-6 using 1N aqueous HCl. The mixture was then extracted with EA (20 mL x 2). The combined organic layers were washed with brine (30 mL) and then dried over anhydrous NaSO. The mixture was filtered, and the filtrate was concentrated under vacuum to give the compound product (140 mg, 79.5%) as a white solid. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 193.1 [M+H] + .

[0215] Step 3. Preparation of 1,3-dicyclopropyl-1H-pyrazole-5-carbonyl chloride To a solution of 1,3-dicyclopropyl-1H-pyrazole-5-carboxylic acid (140 mg, 0.73 mmol) in DCM (10 mL) was added oxalyl chloride (140 mg, 1.1 mmol) and DMF (0.05 ml). The reaction mixture was stirred at 0° C. for 1 hour. The solvent was removed under reduced pressure to give the crude product. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 207.1 [M-Cl+MeOH] + .

[0216] Intermediate I-6: Preparation of 1-cyclopropyl-3-methyl-1H-pyrazole-4-carbonyl chloride FIG. 10 is a schematic illustrating an exemplary procedure for preparing intermediate I-6 according to some embodiments of the present disclosure.

[0217] Step 1. Preparation of ethyl 1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxylate A solution of ethyl (Z)-2-(ethoxymethylene)-3-oxobutanoate (5 g, 0.02 mol) and cyclopropylhydrazine (1.94 g, 0.02 mol) in EA (50 mL) was stirred under reflux for 3 hours. The mixture was concentrated under reduced pressure, and the residue was purified by flash column (PE / EA=5:1) to obtain the product as an orange oil (0.53 g, 9.6%). The resulting compound was analyzed by mass spectrometry, and the test result was as follows: Mass (m / z): 195.1 [M+H] + .

[0218] Step 2. Preparation of 1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxylic acid To a solution of ethyl 1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxylate (0.53 g, 0.7 mmol) in 1N aqueous LiOH (10 mL) and THF (10 mL) was added. The reaction mixture was stirred at 25° C. for 24 hours. After completion, the mixture was concentrated under vacuum. The residue was dissolved in water (10 mL), the pH was adjusted to 7 with 1N aqueous HCl, and extracted with ethyl acetate (10 mL×2). The combined organic layers were washed with brine (10 mL), dried over Na2SO4, filtered, and concentrated under vacuum to give the product as a yellow solid (380 mg, 85.7%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 167.2 [M+H] + .

[0219] Step 3. Preparation of 1-cyclopropyl-3-methyl-1H-pyrazole-4-carbonyl chloride To a solution of 1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxylic acid (150 mg, 0.9 mmol) in DCM (2 mL) was added oxalyl dichloride (103 mg, 0.8 mmol) and a drop of DMF. The reaction mixture was stirred at 25° C. for 16 hours. The mixture was concentrated in vacuo to give the product as a yellow oil (150 mg, 81%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 181.0 [M-Cl+MeOH] + .

[0220] Intermediate I-7: Preparation of 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid FIG. 11 is a schematic illustrating an exemplary procedure for preparing intermediate I-7 according to some embodiments of the present disclosure.

[0221] Step 1. Preparation of ethyl 4-(1-methylcyclopropyl)-2,4-dioxobutanoate To a mixture of 1-(1-methylcyclopropyl)ethenone (3.00 g, 30.6 mmol) and diethyl oxalate (4.47 g, 30.6 mmol) in THF (30.0 mL) was added LiHMDS (30.6 mL, 30.6 mmol). The reaction was stirred at -70 °C for 16 h. The reaction mixture was quenched with NH4Cl solution (100 mL) at 0 °C and then extracted with EA (100 mL × 3). The combined organic layers were washed with brine (100 mL × 3), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by flash column chromatography (PE:EA = 0-50%) to give the desired product, ethyl 4-(1-methylcyclopropyl)-2,4-dioxobutanoate, as a brown oil (2.80 g, 42%). The resulting compound was subjected to mass spectrometry and the results were as follows: Mass (m / z): 199.1 [M+H] + .

[0222] Step 2. Preparation of ethyl 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylate A mixture of ethyl 4-(1-methylcyclopropyl)-2,4-dioxobutanoate cyclopropylhydrazine (3.07 g, 21.1 mmol) in EtOH (10.0 mL) was adjusted to pH 10 with aqueous NaOH (5 N) at 0 °C. The mixture was then added to a solution of ethyl 4-(1-methylcyclopropyl)-2,4-dioxobutanoate (2.80 g, 14.1 mmol) in EtOH (20.0 mL) at 0 °C. The reaction was stirred at 60 °C for 16 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by flash column (PE:EA = 0-5%) to give the product, ethyl 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylate, as a colorless oil (2.20 g, 60%). The resulting compound was subjected to mass spectrometry and the results were as follows: Mass (m / z): 235.1 [M+H] + .

[0223] Step 3. Preparation of 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid To a mixture of ethyl 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylate (2.20 g, 9.40 mmol) in THF / HO (3:1, 24.0 mL) was added LiOH (680 mg, 28.2 mmol). The reaction was stirred at room temperature for 16 hours. The reaction mixture was concentrated under reduced pressure. The residue was diluted with water (50 mL), and then the pH was adjusted to 4 with aqueous HCl (2 M). The mixture was extracted with EA (100 mL × 3), washed with brine (100 mL), dried over NaSO, and concentrated under reduced pressure to give the product, 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid, as a white solid (1.20 g, 55%). The resulting compound was subjected to mass spectrometry analysis, and the results are as follows: Mass (m / z): 207.1 [M+H] + .

[0224] Intermediate I-8: Preparation of (S)-3-(6-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propanoic acid FIG. 12 is a schematic illustrating an exemplary procedure for preparing intermediate I-8 according to some embodiments of the present disclosure.

[0225] Step 1. Preparation of ethyl (S)-3-(6-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propanoate To a solution of ethyl (tert-butoxycarbonyl)-L-asparaginate (20.7 g, 79.78 mmol) in DCE (300 mL) was added triethyloxonium tetrafluoroborate (15.1 g, 79.78 mmol). The reaction mixture was stirred at 25° C. under N for 16 h. To the resulting mixture was added 2-amino-5-bromophenol (15 g, 79.78 mmol). The reaction mixture was stirred at 85° C. under N for 16 h. The mixture was diluted with water (500 mL) and extracted with DCM (300 mL × 2). The organic phase was evaporated, and the residue was purified by silica gel column chromatography (PE:EA = 5:1) to give the product as a black oil (19 g, 46%). Mass spectrometry was performed on the resulting compound, and the results were as follows: Mass (m / z): 413.0 415.0 [M+H] + .

[0226] Step 2. Preparation of (S)-3-(6-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propanoic acid To a solution of ethyl (S)-3-(6-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propanoate (6 g, 14.52 mmol) in THF (45 mL) and HO (15 mL) was added LiOH. .HO (914 mg, 21.78 mmol) was added. The reaction mixture was stirred under N at 25 °C for 2 h. The mixture was adjusted to pH 6-7 with 2N HCl aqueous solution. The mixture was washed with water (50 mL), and the mixture was extracted with EA (50 mL x 3). The organic phase was washed with brine (50 mL x 2), dried over NaSO, and evaporated to give the product as a black oil (5.2 g, 74%). Mass spectrometry analysis of the resulting compound was performed, and the results are as follows: Mass (m / z): 385.0 387.0 [M+H] + .

[0227] Intermediate I-9: Preparation of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-[(3-chlorophenyl)formamido]-N-(1-cyanocyclopropyl)propanamide FIG. 13 is a schematic illustrating an exemplary procedure for preparing intermediate I-9 according to some embodiments of the present disclosure.

[0228] Step 1. Preparation of tert-butyl N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(1-cyanocyclopropyl)carbamoyl]ethyl]carbamate To a solution of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-{[(tert-butoxy)carbonyl]amino}propanoic acid (3.3 g, 0.0086 mol) in DMF (30 mL) was added DIEA (3.33 g, 0.0258 mol), HATU (4.10 g, 0.0129 mol), and 1-aminocyclopropane-1-carbonitrile (1.06 g, 0.0129 mol). The solution was stirred under N at 25 °C for 2 h. Water (50 mL) was added, and the mixture was extracted with EA (40 mL × 3). The combined organic layer was washed with brine (30 mL × 3) and then dried over anhydrous NaSO. After filtration, the solution was concentrated under vacuum, and the crude product was purified by Combiflash (EA / PE=20%-25%) to give tert-butyl N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(1-cyanocyclopropyl)carbamoyl]ethyl]carbamate as a yellow solid (1.6 g, 39.53%). Mass spectrometry analysis of the resulting compound was performed, and the test result was as follows: Mass (m / z): 449.3 [M+H] + .

[0229] Step 2. Preparation of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propanamide A solution of tert-butyl N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(1-cyanocyclopropyl)carbamoyl]ethyl]carbamate (1.6 g, 0.0036 mmol) in FA (10 mL) was stirred at 25° C. for 1 hour. The product was concentrated under vacuum to give (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propanamide as a yellow solid (900 mg, 69%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 349.1 [M+H] + .

[0230] Step 3. Preparation of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-[(3-chlorophenyl)formamido]-N-(1-cyanocyclopropyl)propanamide To a solution of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (600 mg, 1.71 mmol) in DMF (6 mL) was added 3-chlorobenzoic acid (349 mg, 2.23 mmol), HATU (820 mg, 2.23 mmol), and DIEA (666 mg, 5.15 mmol). The solution was stirred under N at 25 °C for 2 h. Water (50 mL) was added, and the mixture was extracted with EA (40 mL × 3). The combined organic layer was washed with brine (30 mL × 3) and then dried over anhydrous NaSO. After filtration, the solution was concentrated under vacuum, and the crude product was purified by Combiflash (EA / PE=25%-30%) to give (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-[(3-chlorophenyl)formamido]-N-(1-cyanocyclopropyl)propanamide as a yellow solid (450 mg, 51%). Mass spectrometry analysis of the resulting compound was performed, and the test result was as follows: Mass (m / z): 487.2 [M+H] + .

[0231] Example 3.1 Preparation of Compound 1 ((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide) FIG. 14 is a schematic illustrating an exemplary procedure for preparing compound 1 according to some embodiments of the present disclosure.

[0232] According to the general procedure A, (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide was obtained as a yellow solid from 2-aminophenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 271.0 [M+H]+ .

[0233] Following General Procedure B-1, the desired product, Compound 1, was obtained as a white solid (25 mg, 33%) from (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (50 mg). Mass spectrometry analysis of the resulting compound revealed the following results: Mass (m / z): 409.0 [M+H] + . 1 H NMR (400 MHz, CDCl3) δ 8.34 (d, J = 7.1 Hz, 1H), 8.17 (s, 1H), 7.87 (t, J = 1.7 Hz, 1H), 7.74 (d, J = 7.8 Hz, 1H), 7.68 (m, 1H), 7.54 (m, 2H), 7.42 (t, J = 7.9 Hz, 1H), 7.36 (m, 2H), 5.16 (td, J = 7.0, 4.4 Hz, 1H), 3.69 (dd, J = 16.6, 4.3 Hz, 1H), 3.37 (dd, J = 16.6, 6.9 Hz, 1H), 1.51 (m, 2H), 1.24 (m, 2H).

[0234] Example 3.2 Preparation of Compound 2 ((S)-N-(3-(4-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide) FIG. 15 is a schematic illustrating an exemplary procedure for preparing compound 2 according to some embodiments of the present disclosure.

[0235] According to the general procedure A, (S)-2-amino-3-(4-bromobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide was obtained as a yellow solid from 2-amino-3-bromophenol. Mass spectrometry analysis of the resulting compound gave the following results: Mass (m / z): 349.02, 351.02 [M+H] + .

[0236] Following General Procedure B-1, the desired product, Compound 2, was obtained as a white solid (4 mg, 7%) from (S)-2-amino-3-(4-bromobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (40 mg). Mass spectrometry analysis of the resulting compound revealed the following results: Mass (m / z): 487.01, 489.01 [M+H]. + .1H NMR (400 MHz, DMSO-d6) δ 9.09 (s, 1H), 9.03 (d, J = 7.9 Hz, 1H), 7.85 (t, J = 1.8 Hz, 1H), 7.76-7.71 (m, 1H), 7.64 (dd, J = 7.9, 0.9 Hz, 1H), 7.60-7.52 (m, 2H), 7.47 (t, J = 7.9 Hz, 1H), 7.25 (t, J = 8.0 Hz, 1H), 4.96-4.89 (m, 1H), 3.49 (dd, J = 15.6, 5.6 Hz, 1H), 3.36 (d, J = 8.9 Hz, 1H), 1.44 (m, 2H), 1.08 (m, 2H).

[0237] Example 3.3 Preparation of Compound 3 ((S)-N-(3-(7-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide) FIG. 16 is a schematic illustrating an exemplary procedure for preparing compound 3 according to some embodiments of the present disclosure.

[0238] According to the general procedure A, (S)-2-amino-3-(7-bromobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide was obtained as a yellow solid from 2-amino-6-bromo-phenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 349.1 [M+H] + .

[0239] According to the general procedure B-1, the desired product, Compound 3, was obtained as a white solid (17.2 mg, 35%) from 2-amino-6-bromo-phenol, (S)-2-amino-3-(7-bromobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (35 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 486.8 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.11 (s, 1H), 9.05 (d, J = 7.9 Hz, 1H), 7.90 (t, J = 1.8 Hz, 1H), 7.79 (d, J = 7.8 Hz, 1H), 7.67 (m, 1H), 7.61 (m, 2H), 7.51 (t, J = 7.9 Hz, 1H), 7.29 (t, J = 8.0 Hz, 1H), 4.97 (td, J = 8.5, 5.6 Hz, 1H), 3.54 (dd, J = 15.6, 5.5 Hz, 1H), 3.39 (dd, J = 12.5, 5.7Hz, 1H), 1.48 (m, 2H), 1.13 (m, 2H).

[0240] Example 3.4 Preparation of Compound 4 ((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-fluorobenzo[d]oxazol-2-yl)-1-oxopropan-2-yl)benzamide) FIG. 17 is a schematic illustrating an exemplary procedure for preparing compound 4 according to some embodiments of the present disclosure.

[0241] According to the general procedure A, (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-fluorobenzo[d]oxazol-2-yl)propenamide was obtained as a yellow solid from 2-amino-5-fluorophenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 289.0 [M+H] +.

[0242] Following General Procedure B-1, the desired product, Compound 4, was obtained as a white solid (20.2 mg, 23%) from (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-fluorobenzo[d]oxazol-2-yl)propenamide (60 mg). Mass spectrometry analysis of the resulting compound revealed the following results: Mass (m / z): 427.0 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.10 (s, 1H), 9.04 (d, J = 7.9 Hz, 1H), 7.89 (s, 1H), 7.78 (d, J = 7.8 Hz, 1H), 7.66 (m, 3H), 7.50 (d, J = 7.9 Hz, 1H), 7.24-7.18 (m, 1H), 4.95 (dd, J = 14.0, 8.3 Hz, 1H), 3.48 (dd, J = 15.6, 5.9 Hz, 2H), 1.46 (t, J = 6.0 Hz, 2H), 1.13-1.03 (m, 2H).

[0243] Example 3.5 Preparation of Compound 5 ((S)-3-chloro-N-(3-(7-cyanobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)benzamide) FIG. 18 is a schematic illustrating an exemplary procedure for preparing compound 5 according to some embodiments of the present disclosure.

[0244] According to the general procedure A, (S)-2-amino-3-(7-cyanobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide was obtained as a pale yellow solid from 3-amino-2-hydroxybenzonitrile. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 296.0 [M+H] + .

[0245] Following General Procedure B-1, the desired product, Compound 5, was obtained as a white solid (12.5 mg, 16%) from (S)-2-amino-3-(7-cyanobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (52 mg). Mass spectrometry analysis of the resulting compound revealed the following results: Mass (m / z): 434.1 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.09 (s, 1H), 9.04 (d, J = 8.0 Hz, 1H), 8.02 (dd, J = 8.0, 1.0 Hz, 1H), 7.87-7.80 (m, 2H), 7.74 (m, 1H), 7.62-7.56 (m, 1H), 7.48 (m, 2H), 4.95 (td, J = 8.4, 5.8 Hz, 1H), 3.54 (dd, J = 15.5, 5.8 Hz, 1H), 3.39 (dd, J = 15.5, 8.7 Hz, 1H), 1.48-1.36 (m, 2H), 1.15-0.98 (m, 2H).

[0246] Example 3.6 Preparation of Compound 6 ((S)-3-chloro-N-(3-(7-chlorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)benzamide) FIG. 19 is a schematic illustrating an exemplary procedure for preparing compound 6 according to some embodiments of the present disclosure.

[0247] According to the general procedure A, (S)-2-amino-3-(7-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide was obtained as a yellow solid from 2-amino-6-chlorophenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 305.0 [M+H] + .

[0248] Following General Procedure B-1, the desired product, Compound 6, was obtained as a white solid (68.9 mg, 82%) from (S)-2-amino-3-(7-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (58 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 443.0 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.11 (s, 1H), 9.06 (d, J = 7.9 Hz, 1H), 7.89 (t, J =1.9 Hz, 1H), 7.79-7.77 (m, 1H), 7.67-7.64 (m, 1H), 7.64-7.61 (m, 1H), 7.51 (t, J = 7.9 Hz, 1H), 7.48-7.46 (m, 1H), 7.35 (t, J = 8.0 Hz, 1H), 5.01-4.90 (m, 1H), 3.58-3.49 (m, 1H), 3.45-3.36 (m, 1H), 1.52-1.41 (m, 2H), 1.20-1.05 (m, 2H).

[0249] Example 3.7 Preparation of Compound 7 ((S)-3-chloro-N-(3-(4-chlorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)benzamide) FIG. 20 is a schematic illustrating an exemplary procedure for preparing compound 7 according to some embodiments of the present disclosure.

[0250] According to the general procedure A, (S)-2-amino-3-(4-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide was obtained as a pale yellow solid from 2-amino-3-chloro-phenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 305.0 [M+H] + .

[0251] According to the general procedure B-1, the desired product, Compound 7, was obtained as a white solid (29 mg, 40%) from (S)-2-amino-3-(4-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propanamide (50 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 443.0 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.11 (s, 1H), 9.06 (d, J = 8.0 Hz, 1H), 7.89 (t, J = 1.7 Hz, 1H), 7.78 (d, J = 7.8 Hz, 1H), 7.64 (m, 2H), 7.51 (t, J = 7.9 Hz, 1H), 7.44 (dd, J = 8.0, 0.9 Hz, 1H), 7.38 (t, J = 8.0 Hz, 1H), 4.97 (dd, J = 14.2, 8.1 Hz, 1H), 3.57-3.50 (m, 1H), 3.42-3.36 (m, 1H), 1.46 (m, 2H), 1.17-1.04 (m, 2H).

[0252] Example 3.8 Preparation of Compound 8 ((S)-3-chloro-N-(3-(5-chlorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)benzamide) FIG. 21 is a schematic illustrating an exemplary procedure for preparing compound 8 according to some embodiments of the present disclosure.

[0253] According to the general procedure A, (S)-2-amino-3-(5-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide was obtained as a pale yellow solid from 2-amino-4-chloro-phenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 305.0 [M+H] + .

[0254] Following General Procedure B-1, the desired product, Compound 8, was obtained as a white solid (28.9 mg, 33%) from (S)-2-amino-3-(5-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propanamide (60 mg). Mass spectrometry analysis of the resulting compound revealed the following results: Mass (m / z): 442.9 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.14 (s, 1H), 9.08 (d, J = 7.9 Hz, 1H), 7.92-7.86 (m, 1H), 7.79 (dd, J = 4.9, 2.7 Hz, 2H), 7.71 (d, J = 8.7 Hz, 1H), 7.62 (dd, J = 8.0, 1.1 Hz, 1H), 7.52 (q, J = 7.5 Hz, 1H), 7.41 (dd, J = 8.7, 2.1 Hz, 1H), 5.04-4.89 (m, 1H), 3.50 (m, 1H), 3.39 (d, J = 8.7 Hz, 1H), 1.53-1.41 (m, 2H), 1.17-1.02 (m, 2H).

[0255] Example 3.9 Preparation of Compound 9 ((S)-3-chloro-N-(3-(6-chlorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)benzamide) FIG. 22 is a schematic illustrating an exemplary procedure for preparing compound 9 according to some embodiments of the present disclosure.

[0256] According to the general procedure A, (S)-2-amino-3-(6-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide was obtained as a pale yellow solid from 2-amino-5-chlorophenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 305.0 [M+H] + .

[0257] Following General Procedure B-1, the desired product, Compound 9, was obtained as a white solid (30.1 mg, 42%) from (S)-2-amino-3-(6-chlorobenzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (55 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 442.9 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.10 (s, 1H), 9.04 (d, J = 7.9 Hz, 1H), 7.88 (m, 2H), 7.78 (d, J = 7.8 Hz, 1H), 7.68 (d, J = 8.5 Hz, 1H), 7.62 (m, 1H), 7.51 (t, J = 7.9 Hz, 1H), 7.39 (dd, J = 8.5, 1.9 Hz, 1H), 4.96 (dd, J = 14.0, 8.2 Hz, 1H), 3.50 (dd, J = 15.6, 5.9 Hz, 1H), 3.37 (d, J = 8.7 Hz, 1H), 1.46 (m, 2H), 1.09 (m, 2H).

[0258] Example 3.10 Preparation of Compound 10 ((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(5-(trifluoromethyl)benzo[d]oxazol-2-yl)propan-2-yl)benzamide) FIG. 23 is a schematic illustrating an exemplary procedure for preparing compound 10 according to some embodiments of the present disclosure.

[0259] According to the general procedure A, (S)-2-amino-N-(1-cyanocyclopropyl)-3-(5-(trifluoromethyl)benzo[d]oxazol-2-yl)propenamide was obtained as a pale yellow solid from 2-amino-4-trifluoromethyl-phenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 339.0 [M+H] + .

[0260] According to the general procedure B-1, the desired product, Compound 10, was obtained as a white solid (30.8 mg, 36%) from (S)-2-amino-N-(1-cyanocyclopropyl)-3-(5-(trifluoromethyl)benzo[d]oxazol-2-yl)propanamide (60 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 477.0 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.07 (s, 1H), 9.02 (d, J = 7.8 Hz, 1H), 8.08-8.04 (m, 1H), 7.89-7.83 (m, 2H), 7.73 (dd, J = 6.8, 5.4 Hz, 2H), 7.62-7.56 (m, 1H), 7.47 (t, J = 7.9 Hz, 1H), 4.96 (td, J = 8.3, 5.9 Hz, 1H), 3.55-3.32 (m, 2H), 1.43 (m, 2H), 1.06 (m, 2H).

[0261] Example 3.11 Preparation of Compound 11 ((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(trifluoromethyl)benzo[d]oxazol-2-yl)propan-2-yl)benzamide) FIG. 24 is a schematic illustrating an exemplary procedure for preparing compound 11 according to some embodiments of the present disclosure.

[0262] According to the general procedure A, (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-(trifluoromethyl)benzo[d]oxazol-2-yl)propanamide was obtained as a pale yellow solid from 2-amino-5-trifluoromethyl-phenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 339.0 [M+H] + .

[0263] According to the general procedure B-1, the desired product, Compound 11, was obtained as a white solid (25 mg, 51%) from (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-(trifluoromethyl)benzo[d]oxazol-2-yl)propanamide (35 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 477.0 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.08 (s, 1H), 9.03 (d, J = 7.9 Hz, 1H), 8.16-8.10 (m, 1H), 7.84 (m, 2H), 7.76-7.71 (m, 1H), 7.67 (m, 1H), 7.58 (m, 1H), 7.47 (t, J = 7.9 Hz, 1H), 4.96 (td, J = 8.3, 6.0 Hz, 1H), 3.52 (m, 1H), 3.41-3.32 (m, 1H), 1.47-1.34 (m, 2H), 1.13-1.05 (m, 2H).

[0264] Example 3.12 Preparation of Compound 12 ((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(7-(trifluoromethyl)benzo[d]oxazol-2-yl)propan-2-yl)benzamide) FIG. 25 is a schematic illustrating an exemplary procedure for preparing compound 12 according to some embodiments of the present disclosure.

[0265] According to the general procedure A, (S)-2-amino-N-(1-cyanocyclopropyl)-3-(7-(trifluoromethyl)benzo[d]oxazol-2-yl)propenamide was obtained as a pale yellow solid from 2-amino-6-trifluoromethyl-phenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 339.0 [M+H] + .

[0266] Following General Procedure B-1, the desired product, Compound 12, was obtained as a white solid (35.4 mg, 42%) from (S)-2-amino-N-(1-cyanocyclopropyl)-3-(7-(trifluoromethyl)benzo[d]oxazol-2-yl)propenamide (60 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 476.9 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.11 (s, 1H), 9.05 (d, J = 8.0 Hz, 1H), 8.01 (d, J = 7.8 Hz, 1H), 7.87 (d, J = 1.8 Hz, 1H), 7.74 (m, 2H), 7.65-7.59 (m, 1H), 7.52 (m, 2H), 4.99 (dd, J = 13.5, 8.7 Hz, 1H), 3.58 (dd, J = 15.7, 5.4 Hz, 1H), 3.41 (dd, J = 15.7, 9.0 Hz, 1H), 1.48 (m, 2H), 1.14 (m, 2H).

[0267] Example 3.13 Preparation of Compound 13 ((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-(tert-butyl)-1-methyl-1H-pyrazole-5-carboxamide) FIG. 26 is a schematic illustrating an exemplary procedure for preparing compound 13 according to some embodiments of the present disclosure.

[0268] Following General Procedure B-2, the desired product, Compound 13, was purified from (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (50 mg) by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-HO (0.1% FA); 15% to 80%)] to give a white solid (15 mg, 19%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 435.1 [M+H] + . 1 H NMR (400 MHz, CDCl3) δ 8.19 (s, 1H), 7.99 (d, J = 6.9 Hz, 1H), 7.67 (m, 1H), 7.54 (s, 1H), 7.38 (m, 2H), 6.55 (s, 1H), 5.06 (td, J = 7.2, 4.0 Hz, 1H), 4.13 (s, 3H), 3.68 (dd, J = 16.9, 3.9 Hz, 1H), 3.32 (dd, J = 16.9, 7.4 Hz, 1H), 1.55 (s, 2H), 1.34 (d, J = 7.1 Hz, 9H), 1.22 (m, 2H).

[0269] Example 3.14 Preparation of Compound 14 ((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-6-methylpicolinamide) FIG. 27 is a schematic illustrating an exemplary procedure for preparing compound 14 according to some embodiments of the present disclosure.

[0270] Following General Procedure B-2, the desired product, Compound 14, was purified from (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (50 mg) by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-HO (0.1% FA); 15% to 80%)] to give a white solid (6.1 mg, 9%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 390.1 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.18 (s, 1H), 8.97 (d, J = 8.3 Hz, 1H), 7.84 (t, J = 7.6 Hz, 1H), 7.78 (d, J = 7.3 Hz, 1H), 7.62 (m, 2H), 7.45 (d, J = 7.5 Hz, 1H), 7.35-7.26 (m, 2H), 4.95 (dd, J = 14.5, 6.4 Hz, 1H), 3.52-3.39 (m, 2H), 2.52 (s, 3H), 1.47-1.38 (m, 2H), 1.11-0.99 (m, 2H).

[0271] Example 3.15 Preparation of Compound 15 ((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((cyanomethyl)amino)-1-oxopropan-2-yl)-1,3-dicyclopropyl-1H-pyrazole-5-carboxamide) FIG. 28 is a schematic illustrating an exemplary procedure for preparing compound 15 according to some embodiments of the present disclosure.

[0272] Step 1. Preparation of ethyl (S)-3-(benzo[d]oxazol-2-yl)-2-(1,3-dicyclopropyl-1H-pyrazole-5-carboxamido)propanoate To a solution of 1,3-dicyclopropyl-1H-pyrazole-5-carbonyl chloride (150 mg, 0.73 mmol) and ethyl (2S)-2-amino-3-(1,3-benzoxazol-2-yl)propanoate (170 mg, 0.73 mmol) in DCM (30 mL) was added DIPEA (282 mg, 2.2 mmol). The reaction mixture was stirred at 0° C. for 1 hour. The solvent was removed under reduced pressure, and the residue was purified by preparative thin-layer chromatography (TLC) (PE / EA=3 / 1) to obtain the product (170 mg, 56%) as a white solid. The resulting compound was analyzed by mass spectrometry, and the test result was as follows: Mass (m / z): 408.9 [M+H] + .

[0273] Step 2. Preparation of (S)-3-(benzo[d]oxazol-2-yl)-2-(1,3-dicyclopropyl-1H-pyrazole-5-carboxamido)propanoic acid To a solution of ethyl (S)-3-(benzo[d]oxazol-2-yl)-2-(1,3-dicyclopropyl-1H-pyrazole-5-carboxamido)propanoate (170 mg, 0.42 mmol) in THF / HO (5:1, 12 mL) was added LiOH.HO (175 mg, 4.2 mmol). The reaction mixture was stirred at room temperature for 1 hour. The pH of the reaction solution was adjusted to 5-6 using 1N aqueous HCl. The mixture was then extracted with EA (20 mL × 2). The combined organic layers were washed with brine (10 mL) and then dried over anhydrous NaSO. The mixture was filtered, and the filtrate was concentrated under vacuum to give the desired product (150 mg, 90%) as a yellow oil. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 381.2 [M+H] + .

[0274] Step 3. Preparation of (S)—N-(3-(benzo[d]oxazol-2-yl)-1-((cyanomethyl)amino)-1-oxopropan-2-yl)-1,3-dicyclopropyl-1H-pyrazole-5-carboxamide To a solution of (S)-3-(benzo[d]oxazol-2-yl)-2-(1,3-dicyclopropyl-1H-pyrazole-5-carboxamido)propanoic acid (150 mg, 0.39 mmol) and 2-aminoacetonitrile hydrochloride (40 mg, 0.44 mmol) in DCM (15 mL) was added DIPEA (255 mg, 2.0 mmol). After stirring at 0 °C for 10 min, T3P (50% in EA, 753 mg, 1.2 mmol) was added, and the mixture was stirred at room temperature for 4 h. The solvent was removed under reduced pressure, and the residue was purified by Combiflash (PE / EA = 0-50%) to give the desired product, compound 15 (35.7 mg, 22%), as a white solid. Mass spectrometry analysis of the resulting compound revealed the following results: Mass (m / z): 419.2 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 8.89-8.75 (m, 2H), 7.73-7.62 (m, 2H), 7.43-7.28 (m, 2H), 6.47 (s, 1H), 5.10-5.01 (m, 1H), 4.28-4.13 (m, 3H), 3.54 (dd, J = 15.6, 5.2 Hz, 1H), 3.37 (s, 1H), 3.30 (s, 1H), 1.86-1.77 (m, 1H), 1.03-0.76 (m, 6H), 0.59-0.50 (m, 2H).

[0275] Example 3.16 Preparation of Compound 16 ((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamide) FIG. 29 is a schematic illustrating an exemplary procedure for preparing compound 16 according to some embodiments of the present disclosure.

[0276] Step 1. Preparation of ethyl (S)-3-(benzo[d]oxazol-2-yl)-2-(1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamido)propanoate To a solution of ethyl (S)-2-amino-3-(benzo[d]oxazol-2-yl)propanoate (190 mg, 0.81 mmol) and DIPEA (410 mg, 4.06 mmol) in DCM (5 mL) was added 1-cyclopropyl-3-methyl-1H-pyrazole-4-carbonyl chloride (150 mg, 0.81 mmol). The reaction mixture was stirred at 25° C. for 16 hours. The mixture was concentrated under reduced pressure to give the crude product as a yellow oil (210 mg, 54%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 383.1 [M+H] + .

[0277] Step 2. Preparation of (S)-3-(benzo[d]oxazol-2-yl)-2-(1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamido)propanoic acid A solution of ethyl (S)-3-(benzo[d]oxazol-2-yl)-2-(1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamido)propanoate (230 mg, 0.6 mmol) in THF (2 mL) and 1N aqueous LiOH (2 mL) was stirred at 25° C. for 2 hours. After completion, the mixture was concentrated in vacuo. The residue was dissolved in water (10 mL), the pH was adjusted to 7 with 1N aqueous HCl, and extracted with ethyl acetate (10 mL×2). The combined organic layers were washed with brine (10 mL), dried over NaSO, filtered, and concentrated in vacuo to give the desired product as a yellow oil (140 mg, 52.56%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 355.1 [M+H] + .

[0278] Step 3. Preparation of (S)—N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamide A solution of (S)-3-(benzo[d]oxazol-2-yl)-2-(1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamido)propanoic acid (140 mg, 0.39 mmol), 1-aminocyclopropane-1-carbonitrile (70 mg, 0.59 mmol), T3P (50% in EA, 754 mg, 2.37 mmol), and DIPEA (255 mg, 1.97 mmol) in DCM (5 mL) was stirred for 16 h at 25° C. The residue was diluted with NaHCO3 (10 mL) and extracted with DCM (10 mL × 2). The combined organic layers were washed with brine (10 mL), dried over NaSO, filtered, concentrated in vacuo, and the residue was purified by preparative HPLC [Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-HO (0.1% TFA), 30-50] to give the desired product, Compound 16, as a white solid (38.4 mg, 22%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 419.1 [M+H] + . 1 HNMR (400 MHz, DMSO-d6) δ 8.05 (s, 1H), 7.67-7.46 (m, 2H), 7.45-7.30 (m, 2H), 4.98 (dd, J = 7.8, 6.2 Hz, 1H), 3.62-3.46 (m, 2H), 3.37 (dd, J = 15.4, 7.8 Hz, 1H), 3.28 (dt, J = 3.2, 1.6 Hz, 3H), 1.44 (dd, J = 6.2, 3.4 Hz, 2H), 1.15 (dd, J = 18.2, 1.6 Hz, 2H), 1.02-0.99 (m, 4H).

[0279] Example 3.17 Preparation of Compound 17 ((S)-N-(1-((1-cyanocyclopropyl)amino)-3-(5,6-difluorobenzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-methyl-1H-pyrazole-4-carboxamide) FIG. 30 is a schematic illustrating an exemplary procedure for preparing compound 17 according to some embodiments of the present disclosure.

[0280] According to the general procedure A, (S)-2-amino-N-(1-cyanocyclopropyl)-3-(5,6-difluorobenzo[d]oxazol-2-yl)propanamide was obtained as a pale yellow solid from 2-amino-4,5-difluorophenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 306.8 [M+H] + .

[0281] According to the general procedure B-1, the desired product, Compound 17, was obtained as a white solid (10 mg, 8%) from (S)-2-amino-N-(1-cyanocyclopropyl)-3-(5,6-difluorobenzo[d]oxazol-2-yl)propanamide (83 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 454.8 [M+H] + . 1 H NMR (400 MHz, MeOD) δ 8.10 (s, 1H), 7.61 (ddd, J = 17.4, 9.6, 7.2 Hz, 2H), 5.02 (d, J = 6.2 Hz, 1H), 3.61 (d, J = 5.4 Hz, 1H), 3.55 (dd, J = 15.4, 6.2 Hz, 1H), 3.40 (dd, J = 15.6, 7.8 Hz, 1H), 2.33 (s, 3H), 1.50 (d, J = 2.2 Hz, 2H), 1.23 (dd, J = 8.2, 2.2 Hz, 2H), 1.06 (d, J = 5.6 Hz, 4H).

[0282] Example 3.18 Preparation of Compound 18 ((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(trifluoromethyl)-1H-pyrazole-4-carboxamide) FIG. 31 is a schematic illustrating an exemplary procedure for preparing compound 18 according to some embodiments of the present disclosure.

[0283] Following General Procedure B-2, the desired product, Compound 18, was obtained as a white solid (38 mg, 22%) from (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (81 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 473.1 [M+H] + . 1 HNMR (400 MHz, DMSO-d6) δ 8.24 (s, 1H), 7.60 (s, 1H), 7.54 (d, J = 0.8 Hz, 1H), 7.39-7.27 (m, 2H), 4.97 (d, J = 1.0 Hz, 1H), 3.80-3.67 (m, 1H), 3.49 (d, J = 6.4 Hz, 1H), 3.40 (d, J = 7.8 Hz, 1H), 1.44 (d, J = 3.0 Hz, 2H), 1.18-1.04 (m, 6H).

[0284] Example 3.19 Preparation of Compound 19 ((S)-N-(3-(benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(difluoromethyl)-1H-pyrazole-4-carboxamide) FIG. 32 is a schematic illustrating an exemplary procedure for preparing compound 19 according to some embodiments of the present disclosure.

[0285] Following General Procedure B-2, the desired product, Compound 19, was obtained as a white solid (14.5 mg, 17%) from (S)-2-amino-3-(benzo[d]oxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (50 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 455.1 [M+H]+ . NMR (400 MHz, DMSO-d6) δ 8.22 (s, 1H), 7.62-7.51 (m, 2H), 7.38-7.29 (m, 2H), 7.02 (t, J = 54.0 Hz, 1H), 4.99 (s, 1H), 3.76-3.68 (m, 1H), 3.50 (d, J = 6.2 Hz, 1H), 3.40 (d, J = 7.8 Hz, 1H), 1.44 (s, 2H), 1.19-1.02 (m, 6H).

[0286] Example 3.20 Preparation of Compound 20 ((S)-3-(tert-butyl)-N-(3-(7-chlorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-1H-pyrazole-5-carboxamide) FIG. 33 is a schematic illustrating an exemplary procedure for preparing compound 20 according to some embodiments of the present disclosure.

[0287] Following General Procedure B-3, the desired product, Compound 20, was obtained as a white solid (37 mg, 19%) from (2S)-2-amino-3-(7-chloro-5-fluoro-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (200 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 495.2 [M+H] + . 1H NMR (400 MHz, MeOD) δ 7.58 (dd, J = 7.8, 1.2 Hz, 1H), 7.39 (dd, J = 8.0, 1.2 Hz, 1H), 7.33 (t, J = 7.8 Hz, 1H), 6.62 (s, 1H), 5.05 (dd, J = 8.6, 5.6 Hz, 1H), 3.98-3.91 (m, 1H), 3.62 (dd, J = 15.6, 5.8 Hz, 1H), 3.45 (dd, J = 15.4, 8.6 Hz, 1H), 1.49 (t, J = 5.6 Hz, 2H), 1.28 (s, 1H), 1.25 (s, 9H), 1.23 (d, J = 2.6 Hz, 1H), 1.06 (dd, J = 6.4, 3.8 Hz, 1H), 1.00-0.95 (m, 1H), 0.92-0.82 (m, 2H).

[0288] Example 3.21 Preparation of Compound 21 ((S)-3-(tert-butyl)-N-(3-(7-chloro-5-fluorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-1H-pyrazole-5-carboxamide) FIG. 34 is a schematic illustrating an exemplary procedure for preparing compound 21 according to some embodiments of the present disclosure.

[0289] According to the general procedure A, (2S)-2-amino-3-(7-chloro-5-fluoro-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propanamide was obtained as a yellow oil from 2-amino-6-chloro-4-fluorophenol. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 323.2 [M+H] + .

[0290] According to the general procedure B-3, the desired product, Compound 21, was obtained as a white solid (4.7 mg, 3%) from (2S)-2-amino-3-(7-chloro-5-fluoro-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (49 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 513.0 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.12 (s, 1H), 8.80 (d, J = 8.0 Hz, 1H), 7.64 (dd, J = 8.4, 2.2 Hz, 1H), 7.55 (dd, J = 9.4, 2.0 Hz, 1H), 6.69 (s, 1H), 4.92 (d, J = 5.8 Hz, 1H), 4.19 (dd, J = 7.4, 3.8 Hz, 1H), 3.53 (dd, J = 15.4, 5.4 Hz, 1H), 1.48 (t, J = 4.1 Hz, 2H), 1.37-1.08 (m, 12H), 1.04 (dd, J = 10.0, 6.2 Hz, 1H), 0.94 (dd, J = 9.8, 5.8 Hz, 1H), 0.90-0.75 (m, 2H).

[0291] Example 3.22 Preparation of Compound 22 ((S)-3-(tert-butyl)-N-(3-(7-chloro-5-fluorobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-(oxetan-3-yl)-1H-pyrazole-5-carboxamide) FIG. 35 is a schematic illustrating an exemplary procedure for preparing compound 22 according to some embodiments of the present disclosure.

[0292] According to the general procedure B-3, the desired product, Compound 22, was obtained as a white solid (6 mg, 4%) from (2S)-2-amino-3-(7-chloro-5-fluoro-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (100 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 529.2 [M+H] + . 1 HNMR (400 MHz, DMSO-d6) δ 9.15 (s, 1H), 8.96 (d, J = 4.8 Hz, 1H), 7.65-7.55 (m, 2H), 6.85 (s, 1H), 5.88-5.79 (m, 1H), 4.75-4.95 (m, 5H), 3.55-3.48 (m, 1H), 1.55-1.42 (m, 2H), 1.38-1.55 (m, 10H), 1.19-1.05 (m, 2H).

[0293] Example 3.23 Preparation of Compound 23 ((S)-N-(3-(4-(1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide) FIG. 36 is a schematic illustrating an exemplary procedure for preparing compound 23 according to some embodiments of the present disclosure.

[0294] Step 1. Preparation of tert-butyl (S)-4-(2-(2-((tert-butoxycarbonyl)amino)-3-ethoxy-3-oxopropyl)benzo[d]oxazol-4-yl)-1H-pyrazole-1-carboxylate A solution of ethyl (S)-3-(4-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propanoate (450 mg, 1.09 mmol), tert-butyl 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole-1-carboxylate (384 mg, 1.31 mmol), PdCl(dppf) (70.65 mg, 0.10 mmol), and NaCO (231 mg, 2.18 mmol) in 1,4-dioxane / HO (12 mL / 2 mL) was stirred at 90° C. for 1 h. The reaction mixture was quenched with water and extracted with EA (60 mL × 3). The combined organic layers were dried over NaSO and concentrated in vacuo to give the crude product, which was purified by flash chromatography (MeOH in DCM, 2% to 10%) to give the desired product (200 mg, 74%) as a pale solid. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 501.1 [M+H] + .

[0295] Step 2. Preparation of (S)-3-(4-(1-(tert-butoxycarbonyl)-1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propanoic acid A solution of tert-butyl (S)-4-(2-(2-((tert-butoxycarbonyl)amino)-3-ethoxy-3-oxopropyl)benzo[d]oxazol-4-yl)-1H-pyrazole-1-carboxylate (350 mg, 0.7 mmol), LiOH (19.06 mg, 0.80 mmol) in THF / HO (15 mL / 4 mL) was stirred at 25 °C for 1 h. The reaction mixture was quenched with water and extracted with EA (60 mL × 3). The combined organic layers were dried over NaSO and concentrated in vacuo to give the desired product (280 mg, 85%) as a pale yellow solid. Mass spectrometry of the resulting compound was performed and the result was as follows: Mass (m / z): 473.1 [M+H] + .

[0296] Step 3. Preparation of tert-butyl (S)-4-(2-(2-((tert-butoxycarbonyl)amino)-3-((1-cyanocyclopropyl)amino)-3-oxopropyl)benzo[d]oxazol-4-yl)-1H-pyrazole-1-carboxylate A solution of (S)-3-(4-(1-(tert-butoxycarbonyl)-1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propanoic acid (280 mg, 0.59 mmol), A-5 (84 mg, 0.71 mmol), DIPEA (228 mg, 1.77 mmol), and T3P (50% in EA, 402 mg, 0.63 mmol) in DCM (5 mL) was stirred at 25 °C under N for 3 h. The reaction mixture was quenched with water and extracted with DCM (30 mL × 3). The combined organic layers were dried over NaSO and concentrated in vacuo to give the crude product, which was purified by flash chromatography (MeOH in DCM, 2% to 10%) to give the desired product (130 mg, 41%) as a pale solid. The resulting compound was subjected to mass spectrometry and the results were as follows: Mass (m / z): 537.1 [M+H] + .

[0297] Step 4. Preparation of (S)-3-(4-(1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-2-amino-N-(1-cyanocyclopropyl)propanamide A solution of tert-butyl (S)-4-(2-(2-((tert-butoxycarbonyl)amino)-3-((1-cyanocyclopropyl)amino)-3-oxopropyl)benzo[d]oxazol-4-yl)-1H-pyrazole-1-carboxylate (130 mg, 0.24 mmol) in FA (2 mL) was stirred at 25° C. for 3 hours. The mixture was concentrated under reduced pressure to give a residue. The residue was quenched with saturated NaHCO and extracted with EtOAc (60 mL×3). The combined organic layers were dried over NaSO and concentrated under vacuum to give the crude desired product (30 mg, 37%) as a pale yellow solid. The resulting compound was subjected to mass spectrometry analysis and tested as follows: Mass (m / z): 437.1 [M+H] + .

[0298] Step 5. Preparation of (S)—N-(3-(4-(1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide To a solution of (S)-3-(4-(1H-pyrazol-4-yl)benzo[d]oxazol-2-yl)-2-amino-N-(1-cyanocyclopropyl)propenamide (30 mg, 0.09 mmol) and KCO (24.66 mg, 0.18 mmol) in EA (2 mL) and HO (3 mL) was added dropwise a solution of 3-chlorobenzoyl chloride (18.73 mg, 0.11 mmol) in EA (0.5 mL). After the addition, the reaction mixture was stirred at 25 °C for 0.5 h. Then the reaction mixture was quenched with water and extracted with EA (20 mL × 3). The combined organic layers were dried over NaSO and concentrated in vacuo to give the crude product, which was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-HO (0.1% FA); 15%-95%)] to give the desired product, Compound 23 (4.1 mg, 10%) as a white solid. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 475.1 [M+H] + . 1H NMR (400 MHz, DMSO-d6) δ 13.18 (s, 1H), 9.15 (s, 1H), 9.10 (d, J = 7.8 Hz, 1H), 8.43 (s, 2H), 8.19-8.12 (m, 1H), 7.86 (s, 1H), 7.76 (d, J = 8.0 Hz, 1H), 7.64 (d, J = 6.7 Hz, 1H), 7.58 (d, J = 9.1 Hz, 1H), 7.45 (s, 1H), 7.31 (t, J = 7.8 Hz, 1H), 5.06 (d, J = 4.1 Hz, 1H), 3.55 (d, J = 4.2 Hz, 1H), 3.45 (s, 1H), 1.47 (m, 2H), 1.17-1.06 (m, 2H).

[0299] Example 3.24 Preparation of Compound 24 ((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)benzamide) FIG. 37 is a schematic illustrating an exemplary procedure for preparing compound 24 according to some embodiments of the present disclosure.

[0300] Step 1. Preparation of ethyl (S)-2-((tert-butoxycarbonyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanoate A mixture of ethyl (S)-3-(6-bromobenzo[d]oxazol-2-yl)-2-((tert-butoxycarbonyl)amino)propanoate (50 mg, 0.73 mmol), 1-methylpiperazine (73 mg, 0.73 mmol), CsCO (474.5 mg, 1.46 mmol), and RuPhos-Pd-G (57 mg, 0.073 mmol) in toluene (5 mL) under nitrogen was stirred at 110 °C for 18 h. The reaction mixtures were cooled to room temperature, combined, and concentrated in vacuo to give the crude product. The crude product was then purified on silica gel eluting with MeOH (5% to 10%) in DCM to give the desired product (180 mg, 57%) as a light brown oil. The resulting compound was subjected to mass spectrometry and the results were as follows: Mass (m / z): 433.1 [M+H] + .

[0301] Step 2. Preparation of (S)-2-((tert-butoxycarbonyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanoic acid Under nitrogen, a solution of ethyl (S)-2-((tert-butoxycarbonyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanoate (160 mg, 0.37 mmol) and MeSnOH (134 mg, 0.74 mmol) in DCE (6 mL) was heated to 80° C. and stirred for 3 h. After concentration, the crude product was then purified on silica gel and eluted with MeOH (5% to 10%) in DCM to give the desired product (80 mg, 53.3%) as a light brown solid. The resulting compound was subjected to mass spectrometry analysis and tested as follows: Mass (m / z): 405.1 [M+H] + .

[0302] Step 3. Preparation of tert-butyl (S)-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)carbamate A solution of (S)-2-((tert-butoxycarbonyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanoic acid (70 mg, 0.17 mmol), A-5 (25 mg, 0.21 mmol), HATU (97 mg, 0.26 mmol), and DIPEA (66 mg, 0.51 mmol) in DMF (3 mL) was stirred under nitrogen at 25 °C for 3 h. The reaction mixture was quenched with water (10 mL) and extracted with EA (35 mL × 3). The combined organic layers were dried over NaSO and concentrated to dryness, then purified on silica gel eluted with MeOH (5% to 10%) in DCM to give the desired product (60 mg, 75%) as a white solid. The resulting compound was subjected to mass spectrometry and the results were as follows: Mass (m / z): 469.1 [M+H] + .

[0303] Step 4. Preparation of (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanamide A solution of tert-butyl (S)-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)carbamate (60 mg, 0.13 mmol) in FA (2 mL) was stirred under nitrogen at 25° C. for 5 h. The mixture was blown to dryness with nitrogen at 20° C. The residue was then basified with saturated sodium bicarbonate and extracted with EA (20 mL×3). The combined organic layers were concentrated to dryness to give the desired product (30 mg, 63.8%) as a pale white solid. The resulting compound was subjected to mass spectrometry analysis, which showed the following results: Mass (m / z): 369.1 [M+H] + .

[0304] Step 5. Preparation of (S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)benzamide To a solution of (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanamide (30 mg, 0.08 mmol) in EA (3 mL) was added KCO (22 mg, 0.16 mmol) in water (0.5 mL) followed by 3-chlorobenzoyl chloride (14 mg, 0.08 mmol) in EA (1 mL) dropwise, and after the addition, the reaction mixture was stirred at 25° C. for 1 h. The reaction mixture was quenched with water (5 mL) and extracted with EA (15 mL × 3). The combined organic layers were concentrated to dryness, and the residue was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-HO (0.1% FA); 15% to 95%)] to give the desired product, Compound 24 (4.9 mg, 12%) as a white solid. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 507.1 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.08 (s, 1H), 9.00 (d, J = 7.9 Hz, 1H), 7.89 (t, J = 1.8 Hz, 1H), 7.78 (d, J = 7.8 Hz, 1H), 7.64-7.59 (m, 1H), 7.51 (t, J = 7.9 Hz, 1H), 7.44 (d, J = 8.8 Hz, 1H), 7.14 (d, J = 2.2 Hz, 1H), 6.97 (dd, J = 8.8, 2.3 Hz, 1H), 4.94-4.88 (m, 1H), 3.43 (d, J = 5.7 Hz, 1H), 3.26 (d, J = 8.8 Hz, 1H), 3.17-3.11 (m, 4H), 2.48-2.43 (m, 4H), 2.22 (s, 3H), 1.46-1.47 (m, 2H), 1.13-1.02 (m, 2H).

[0305] Example 3.25 Preparation of Compound 25 ((S)-N-(1-((cyanomethyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1,3-dicyclopropyl-1H-pyrazole-5-carboxamide) FIG. 38 is a schematic illustrating an exemplary procedure for preparing compound 25 according to some embodiments of the present disclosure.

[0306] Step 1. Preparation of tert-butyl (S)-(1-((cyanomethyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)carbamate To a solution of (S)-2-((tert-butoxycarbonyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanoic acid (500 mg, 1.24 mmol) in DMF (20 mL) was added DIPEA (798 mg, 6.2 mmol), HATU (1410 mg, 3.72 mmol), and 2-aminoacetonitrile (114 mg, 1.86 mmol). The reaction mixture was stirred at room temperature for 2 h. After the reaction was completed, HO (30 mL) was added to the reaction mixture, which was then extracted with EA (30 mL × 3). The combined organic layer was washed with brine (50 mL × 3) and then dried over anhydrous NaSO. After filtration, the solution was concentrated under vacuum, and the residue was purified by Combiflash (DCM / MeOH = 0-10%) to give the product tert-butyl (S)-(1-((cyanomethyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)carbamate as a yellow oil (310 mg, 56%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 442.9 [M+H] + .

[0307] Step 2. Preparation of (S)-2-amino-N-(cyanomethyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanamide A solution of tert-butyl (S)-(1-((cyanomethyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)carbamate (310 mg, 0.7 mmol) in FA (5 mL) was stirred at room temperature for 3 hours. The resulting mixture was blown dry with compressed air to give the product (S)-2-amino-N-(cyanomethyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanamide as a brown oil (160 mg, 66%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 343.1 [M+H] + .

[0308] Step 3. Preparation of (S)—N-(1-((cyanomethyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1,3-dicyclopropyl-1H-pyrazole-5-carboxamide Following General Procedure B-3, the desired product, Compound 25, was obtained as a white solid (5 mg, 4%) from (S)-2-amino-N-(cyanomethyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanamide (70 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 517.3 [M+H] + . 1H NMR (400 MHz, MeOD) δ 7.55 (d, J = 8.8 Hz, 1H), 7.26 (d, J = 2.2 Hz, 1H), 7.12 (dd, J = 8.8, 2.4 Hz, 1H), 6.39 (s, 1H), 5.16 (dd, J = 8.8, 5.6 Hz, 1H), 4.21 (s, 2H), 3.93 (ddd, J =11.2, 7.4, 4.0 Hz, 2H), 3.62 (dd, J = 15.6, 5.6 Hz, 2H), 3.39 (dd, J = 15.4, 8.8 Hz, 2H), 3.00 (s, 3H), 1.87 (ddd, J = 13.4, 8.6, 5.0 Hz, 1H), 1.05 (dd, J = 9.0, 4.8 Hz, 1H), 0.98-0.78 (m, 6H), 0.65 (dt, J = 6.2, 4.2 Hz, 2H).

[0309] Example 3.26 Preparation of Compound 26 ((S)-3-(tert-butyl)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-1H-pyrazole-5-carboxamide) FIG. 39 is a schematic illustrating an exemplary procedure for preparing compound 26 according to some embodiments of the present disclosure.

[0310] Following General Procedure B-3, the desired product, Compound 26, was obtained as a white solid (14 mg, 11%) from (S)-2-amino-N-(1-cyanocyclopropyl)-3-(6-(4-methylpiperazin-1-yl)benzo[d]oxazol-2-yl)propanamide (80 mg). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 559.3 [M+H] + . 1H NMR (400 MHz, MeOD) δ 7.43 (d, J = 8.8 Hz, 1H), 7.14 (d, J = 2.2 Hz, 1H), 7.01 (dd, J = 8.8, 2.4 Hz, 1H), 6.50 (s, 1H), 4.91 (dd, J = 8.2, 6.0 Hz, 1H), 3.88-3.79 (m, 1H), 3.45 (dd, J = 15.4, 6.2 Hz, 2H), 3.29 (d, J = 8.2 Hz, 4H), 2.83 (s, 3H), 1.39 (d, J = 2.6 Hz, 2H), 1.19 (d, J = 1.6 Hz, 2H), 1.15 (s, 9H), 1.14-1.09 (m, 2H), 1.02-0.69 (m, 6H).

[0311] Example 3.27 Preparation of Compound 27 ((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-methyl-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)benzamide) FIG. 40 is a schematic illustrating an exemplary procedure for preparing compound 27 according to some embodiments of the present disclosure.

[0312] To a solution of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide (100 mg, 0.20 mmol) in dioxane / HO (10:1, 5 mL) was added 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine (91 mg, 0.41 mmol), KPO (87 mg, 0.411 mmol), and Pd(dppf)Cl (15 mg, 0.02 mmol). The solution was stirred at 80° C. under N for 2 h. After filtration, the solution was concentrated under vacuum and the crude product was purified by flash chromatography to give the desired product, Compound 27 (18.6 mg, 17.27%), as a white solid. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 504.2 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.09 (s, 1H), 9.03 (d, J = 7.8 Hz, 1H), 7.89 (t, J = 1.8 Hz, 1H), 7.78 (d, J = 7.9 Hz, 1H), 7.67 (d, J = 1.3 Hz, 1H), 7.64-7.60 (m, 1H), 7.58 (d, J = 8.3 Hz, 1H), 7.52 (d, J = 7.9 Hz, 1H), 7.43 (dd, J = 8.4, 1.6 Hz, 1H), 6.21 (s, 1H), 4.96 (dd, J = 14.0, 8.3 Hz, 1H), 3.51-3.35 (m, 4H), 3.02 (d, J = 3.0 Hz, 2H), 2.57 (d, J = 4.8 Hz, 2H), 2.28 (s, 3H), 1.47 (d, J = 2.8 Hz, 2H), 1.12-1.06 (m, 2H).

[0313] Example 3.28 Preparation of Compound 28 ((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)benzamide) FIG. 41 is a schematic illustrating an exemplary procedure for preparing compound 28 according to some embodiments of the present disclosure.

[0314] To a solution of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide (130 mg, 0.47 mmol) in dioxane / HO (10 / 1, 10 mL) was added 1-(2,2-difluoroethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,2,3,6-tetrahydropyridine (84 mg, 0.57 mmol), KPO (113 mg, 0.94 mmol), and Pd(dppf)Cl (20 mg, 0.05 mmol). The reaction mixture was stirred at 100° C. under N for 16 h. The solvent was removed under reduced pressure, and the residue was purified by Combiflash (DCM / MeOH=0-10%) to give the desired product, Compound 28, as a yellow solid (35 mg, 13%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 554.2 [M+H] + . 1H NMR (400 MHz, MeOD) δ 7.83 (t, J = 1.8 Hz, 1H), 7.75-7.71 (m, 1H), 7.62 (d, J = 1.4 Hz, 1H), 7.58-7.53 (m, 2H), 7.49-7.43 (m, 2H), 6.18 (d, J = 5.6 Hz, 1H), 6.04 (s, 1H), 5.05 (dd, J = 8.2, 6.4 Hz, 1H), 4.91 (d, J = 1.8 Hz, 1H), 4.85 (s, 1H), 3.59 (dd, J = 15.4, 6.4 Hz, 1H), 3.44 (dd, J = 15.4, 8.2 Hz, 1H), 3.33 (d, J = 3.4 Hz, 2H), 2.95-2.86 (m, 4H), 1.48 (dd, J = 5.2, 2.2 Hz, 2H), 1.19 (dd, J = 17.0, 2.4 Hz, 2H).

[0315] Example 3.29 Preparation of Compound 29 ((S)-3-(tert-butyl)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-1H-pyrazole-5-carboxamide) FIG. 42 is a schematic illustrating an exemplary procedure for preparing compound 29 according to some embodiments of the present disclosure.

[0316] Step 1. Preparation of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxamide To a solution of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (1.6 g, 4.58 mmol) and 5-tert-butyl-2-cyclopropylpyrazole-3-carboxylic acid (954 mg, 4.58 mmol) in DCM (20 mL) was added T3P (50% in EA, 5.83 g, 9.16 mmol) and DIPEA (1.18 g, 9.16 mmol). The reaction mixture was stirred under N2 at 25 °C for 3 hours. The reaction mixture was concentrated, and the residue was purified by silica gel column chromatography (PE:EA = 1:1) to obtain the product as a yellow solid (1.3 g, 47%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 539.1 541.1 [M+H] + .

[0317] Step 2. Preparation of (S)-3-(tert-butyl)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-1H-pyrazole-5-carboxamide To a solution of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-[(5-tert-butyl-2-cyclopropylpyrazol-3-yl)formamide]-N-(1-cyanocyclopropyl)propenamide (150 mg, 0.28 mmol) and 1-(2,2-difluoroethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine (114 mg, 0.42 mmol) in dioxane (3 mL) and HO (0.3 mL) was added KPO (118 mg, 0.56 mmol) and Pd(dppf)Cl (20 mg, 0.028 mmol). The reaction mixture was stirred at 90 °C under N for 16 h. The reaction mixture was concentrated, and the residue was purified by pre-HPLC [Gemini-C18 150 × 21.2 mm, 5 μm, mobile phase: ACN-HO (0.1% FA), gradient: 20-40] to give the desired product, Compound 29, as a white solid (30 mg, 19%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 606.3 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.13 (s, 1H), 8.79 (d, J = 8.0 Hz, 1H), 7.73 (s, 1H), 7.62 (d, J = 8.2 Hz, 1H), 7.47 (d, J = 8.4 Hz, 1H), 6.69 (s, 1H), 6.23 (s, 1H), 4.99-4.88 (m, 1H), 4.23-4.15 (m, 1H), 3.49 (dd, J = 15.4, 5.8 Hz, 1H), 3.39-3.29 (m, 6H), 3.09-2.56 (m, 4H), 1.53-1.40 (m, 2H), 1.24-1.17 (m, 9H), 1.16-1.07 (m, 2H), 1.06-1.01 (m, 1H), 0.97-0.91 (m, 1H), 0.87-0.78 (m, 2H).

[0318] Example 3.30 Preparation of Compound 30 ((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(4-methyl-2-oxopiperazin-1-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)benzamide) FIG. 43 is a schematic illustrating an exemplary procedure for preparing compound 30 according to some embodiments of the present disclosure.

[0319] To a mixture of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide (200 mg, 0.4 mmol) in dioxane (10.0 mL) was added KCO (113 mg, 0.8 mmol), 4-methylpiperazin-2-one (93 mg, 0.8 mmol), CuI (15 mg, 0.08 mmol), and DMEDA (7 mg, 0.08 mmol). The reaction mixture was degassed with N and stirred at 110° C. for 16 h. The reaction mixture was concentrated under reduced pressure, and the residue was purified by preparative HPLC [Gemini-C18 150 × 21.2 mm, 5 μm; mobile phase: MeCN / HO (0.1% FA); ratio: 10-25] to give the desired product, Compound 30 (12 mg, 6%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 521.1 [M+H] + . 1H NMR (400 MHz, MeOD) δ 7.84 (t, J = 1.8 Hz, 1H), 7.75-7.72 (m, 1H), 7.68 (d, J = 8.5 Hz, 1H), 7.59 (d, J = 1.6 Hz, 1H), 7.57-7.54 (m, 1H), 7.45 (t, J = 7.8 Hz, 1H), 7.29 (dd, J = 8.4, 1.8 Hz, 1H), 5.06 (dd, J = 8.2, 6.2 Hz, 1H), 3.79-3.76 (m, 2H), 3.61 (dd, J = 15.4, 6.2 Hz, 1H), 3.47 (dd, J = 15.4, 8.2 Hz, 1H), 3.29 (s, 2H), 2.89 (t, J = 5.4 Hz, 2H), 2.44 (s, 3H), 1.52-1.44 (m, 2H), 1.26-1.16 (m, 2H).

[0320] Example 3.31 Preparation of Compound 31 ((S)-N-(3-(benzo[d]thiazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide) FIG. 44 is a schematic illustrating an exemplary procedure for preparing compound 31 according to some embodiments of the present disclosure.

[0321] Step 1. Preparation of allyl (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-(benzo[d]thiazol-2-yl)propanoate To a solution of (S)-3-((((9H-Fluoren-9-yl)methoxy)carbonyl)amino)-4-(allyloxy)-4-oxobutanoic acid (1 g, 2.53 mmol), (COCl) (0.38 g, 3.0 mmol) in DCM (25 mL) was added one drop of DMF, and the reaction mixture was stirred at 25 °C under N for 2 h. The solvent was then removed under vacuum to give a residue, which was dissolved in anhydrous toluene (15 mL). 2-Aminobenzenethiol (0.33 g, 2.6 mmol) and DIPEA (0.97 g, 7.5 mmol) were then added, and the reaction mixture was heated to 40 °C and stirred for 2 h. After cooling to room temperature, the reaction mixture was taken out, then quenched with water (30 mL), and extracted with DCM (120 mL × 3). The combined organic layers were dried over NaSO and concentrated in vacuo to give the crude desired product, which was purified by flash chromatography (EA in PE, 30% to 50%) to give the desired product (0.47 g, 32%) as a white solid. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 485.1 [M+H] + .

[0322] Step 2. Preparation of (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-(benzo[d]thiazol-2-yl)propanoic acid To a solution of allyl (S)-2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-(benzo[d]thiazol-2-yl)propanoate (470 mg, 0.96 mmol) in DCM (12 mL) was added phenylsilane (215.43 mg, 2.9 mmol) followed by tetrakis(triphenylphosphine)palladium (559.23 mg, 0.48 mmol) under nitrogen protection. After the addition, the reaction mixture was stirred at 25° C. for 3 hours. The solvent was removed under vacuum to give the crude product, which was purified by flash chromatography (MeOH in DCM, 2% to 10%) to obtain the desired product (350 mg, 81%) as a pale solid. The resulting compound was subjected to mass spectrometry analysis, and the results were as follows: Mass (m / z): 445.1 [M+H] + .

[0323] Step 3. Preparation of (9H-fluoren-9-yl)methyl (S)-(3-(benzo[d]thiazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)carbamate A solution of (S)-2-((((9H-Fluoren-9-yl)methoxy)carbonyl)amino)-3-(benzo[d]thiazol-2-yl)propanoic acid (350 mg, 0.78 mmol), 1-aminocyclopropane-1-carbonitrile hydrogen chloride (67.73 mg, 0.82 mmol), DIPEA (203.06 mg, 0.57 mmol), and HATU (358.45 mg, 0.45 mmol) in DMF (5 mL) was stirred at 25 °C under N for 3 h. The reaction mixture was quenched with water and extracted with EA (30 mL × 3). The combined organic layers were dried over NaSO and concentrated in vacuo to give the crude product, which was purified by flash chromatography (MeOH in DCM, 2% to 10%) to give the desired product (90 mg, 20%) as a pale solid. The resulting compound was subjected to mass spectrometry and the results were as follows: Mass (m / z): 509.1 [M+H] + .

[0324] Step 4. Preparation of (S)-2-amino-3-(benzo[d]thiazol-2-yl)-N-(1-cyanocyclopropyl)propanamide To a solution of (9H-fluoren-9-yl)methyl (S)-(3-(benzo[d]thiazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)carbamate (90 mg, 0.17 mmol) in MeCN (5 mL) was added EtNH (1 mL). The reaction mixture was stirred under N at 25 °C for 3 hours. The mixture was concentrated under reduced pressure to give a residue. The residue was purified by preparative HPLC [(Gemini-C, 150 × 21.2 mm, 5 um; ACN-HO (0.1% FA); 15-90)] to give the desired product (26 mg, 54%) as a white solid. The resulting compound was subjected to mass spectrometry analysis and tested as follows: Mass (m / z): 287 [M+H] + .

[0325] Step 5. Preparation of (S)—N-(3-(benzo[d]thiazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-chlorobenzamide To a solution of (S)-2-amino-3-(benzo[d]thiazol-2-yl)-N-(1-cyanocyclopropyl)propanamide and DIPEA (16.25 mg, 0.12 mmol) in DCM (1 mL) was added dropwise a solution of 3-chlorobenzoyl chloride (7.7 mg, 0.04 mmol) in DCM (0.5 mL). After the addition, the reaction mixture was stirred at 25 °C for 0.5 h. The reaction mixture was then quenched with water and extracted with DCM (20 mL × 3). The combined organic layers were dried over NaSO and concentrated in vacuo to give the crude product, which was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-HO (0.1% FA); 15%-90%)] to give the desired product, Compound 31 (11.2 mg, 31%), as a white solid. The resulting compound was subjected to mass spectrometry and the test results were as follows: Mass (m / z): 425.0 [M+H] + . 1H NMR (400 MHz, DMSO-d6) δ 8.63 (d, J = 6.4 Hz, 1H), 8.24 (s, 1H), 8.01-7.97 (m, 1H), 7.92 (t, J = 1.8 Hz, 1H), 7.88 (d, J = 7.8 Hz, 1H), 7.80-7.77 (m, 1H), 7.55-7.49 (m, 2H), 7.41 (m, 2H), 5.03 (m, 1H), 3.83 (m, 1H), 3.49-3.43 (m, 1H), 1.53-1.47 (m, 2H), 1.23-1.13 (m, 2H).

[0326] Example 3.32 Preparation of Compound 32 ((S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)-1-oxopropan-2-yl)benzamide) FIG. 45 is a schematic illustrating an exemplary procedure for preparing compound 32 according to some embodiments of the present disclosure.

[0327] Step 1. Preparation of methyl (S)-2-((tert-butoxycarbonyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propanoate (S)-3-((tert-butoxycarbonyl)amino)-4-methoxy-4-oxobutanoic acid (1.3 g, 5.26 mmol), N 1A mixture of 1,2-methylbenzene-1,2-diamine (284 mg, 5.26 mmol), HOBt (858 mg, 6.31 mmol), EDCI (1.21 g, 6.31 mmol), and EtN (1.59 g, 15.78 mmol) was stirred at 25 °C for 18 h. The reaction mixture was quenched with 15 mL of water and extracted with DCM (30 mL × 3). The combined organic layers were dried over NaSO, concentrated in vacuo, and purified on silica gel (EtOAc in PE, 50% to 100%) to give a mixture of NH and NMe-amide as a light brown oil. Under nitrogen, this mixture (1.18 mg, 3.4 mmol) in AcOH (10 mL) was heated to 60 °C and stirred for 18 h. The reaction was cooled to room temperature, and the solvent was removed to give a residue that was dissolved in EtOAc (30 mL) and basified with saturated NaHCO (20 mL). The organic layer was separated, and the aqueous layer was extracted with EtOAc (30 mL x 3). The combined organic layers were washed with brine and dried over anhydrous NaSO. After filtration and concentration, the crude product was then purified on silica gel and eluted with EtOAc in petroleum ether (35% to 100%) to give the desired product (700 mg, 62.5%) as a pale yellow oil. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 334.1 [M+H] + .

[0328] Step 2. Preparation of (S)-2-((tert-butoxycarbonyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propanoic acid To a solution of methyl (S)-2-((tert-butoxycarbonyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propanoate (500 mg, 1.50 mmol) in THF (8 mL) was slowly added a solution of LiOH (72 mg, 3.0 mmol) in water (1.5 mL). After the addition, the reaction mixture was stirred for 5 hours. The reaction mixture was then acidified to pH = 3 with HCl (1 M) and extracted with EtOAc (30 mL x 3). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. The solvent was removed under vacuum to give the crude product (330 mg, 69%) as a light brown solid. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 320.1 [M+H] + .

[0329] Step 3. Preparation of tert-butyl (S)-(1-((1-cyanocyclopropyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)-1-oxopropan-2-yl)carbamate A solution of (S)-2-((tert-butoxycarbonyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propanoic acid (330 mg, 1.03 mmol), A-5 (147 mg, 1.24 mmol), HATU (471 mg, 1.24 mmol), and DIPEA (401.7 mg, 3.09 mmol) in DMF (5 mL) was stirred under nitrogen at 25 °C for 3 h. The reaction mixture was quenched with water (10 mL) and extracted with EA (35 mL × 3). The combined organic layers were dried over NaSO and concentrated to dryness, then purified on silica gel eluted with EA in PE (30% to 100%) to give the desired product (250 mg, 63.4%) as a white solid. The resulting compound was subjected to mass spectrometry and the results were as follows: Mass (m / z): 384.1 [M+H] + .

[0330] Step 4. Preparation of (S)-2-amino-N-(1-cyanocyclopropyl)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propanamide A solution of tert-butyl (S)-(1-((1-cyanocyclopropyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)-1-oxopropan-2-yl)carbamate (70 mg, 0.18 mmol) in FA (2 mL) was stirred under nitrogen at 25° C. for 5 h. The mixture was blown to dryness with nitrogen at 20° C. The residue was then basified with saturated sodium bicarbonate and extracted with EA (20 mL×3). The combined organic layers were then concentrated to dryness to give the desired product (22 mg, 43%) as a pale solid. The resulting compound was subjected to mass spectrometry analysis, which showed the following results: Mass (m / z): 284.1 [M+H] + .

[0331] Step 5. Preparation of (S)-3-chloro-N-(1-((1-cyanocyclopropyl)amino)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)-1-oxopropan-2-yl)benzamide To a solution of (S)-2-amino-N-(1-cyanocyclopropyl)-3-(1-methyl-1H-benzo[d]imidazol-2-yl)propanamide (22 mg, 0.08 mmol) and DIPEA (20.64 mg, 0.16 mmol) in DCM (2 mL) was added a solution of 3-chlorobenzoyl chloride (14 mg, 0.08 mmol) in DCM (0.5 mL) dropwise, and after the addition, the reaction mixture was stirred for 1 h at 25° C. The reaction mixture was quenched with water (5 mL) and extracted with DCM (15 mL × 3). The combined organic layers were concentrated to dryness, and the residue was purified by preparative HPLC [(Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-HO (0.1% FA); 15% to 95%)] to give the desired product, Compound 32 (4.2 mg, 12.4%) as a white solid. Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 422.0 [M+H] + . 1H NMR (400 MHz, DMSO-d6) δ 9.01 (s, 1H), 8.98 (d, J = 7.6 Hz, 1H), 7.91 (s, 1H), 7.79 (d, J = 7.9 Hz, 1H), 7.61 (d, J = 9.0 Hz, 1H), 7.51 (t, J = 7.8 Hz, 2H), 7.17 (m, 2H), 4.96 (dd, J = 14.3, 7.6 Hz, 1H), 3.78 (s, 3H), 3.37 (dd, J = 16.5, 6.6 Hz, 2H), 1.47-1.36 (m, 2H), 1.02 (m, 2H).

[0332] Example 3.33 Preparation of Compound 33 (S)-N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxamide FIG. 46 is a schematic illustrating an exemplary procedure for preparing compound 33 according to some embodiments of the present disclosure.

[0333] To a solution of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (1.6 g, 4.58 mmol) and 5-tert-butyl-2-cyclopropylpyrazole-3-carboxylic acid (954 mg, 4.58 mmol) in DCM (20 mL) was added T3P (50% in EA, 5.83 g, 9.16 mmol) and DIEA (1.18 g, 9.16 mmol). The reaction mixture was stirred under N at 25 °C for 3 h. The reaction mixture was concentrated, and the residue was purified by silica gel column chromatography (PE:EA = 1:1) to obtain the desired product, Compound 33, as a yellow solid (1.3 g, 47%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 539.1 541.1 [M+H] + . 1H NMR (400 MHz, DMSO-d6) δ 9.17 (s, 1H), 8.84 (d, J = 8.0 Hz, 1H), 8.00 (d, J = 1.7 Hz, 1H), 7.64 (d, J = 8.4 Hz, 1H), 7.52 (dd, J = 8.4, 1.8 Hz, 1H), 6.68 (s, 1H), 4.99-4.88 (m, 1H), 4.26-4.13 (m, 1H), 3.49 (dd, J = 15.4, 5.8 Hz, 1H), 3.34-3.29 (m, 1H), 1.55-1.39 (m, 2H), 1.20 (s, 9H), 1.13-0.80 (m, 6H).

[0334] Example 3.34 Preparation of Compound 34 (S)—N-(3-(6-(6-aminopyridin-3-yl)benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxamide FIG. 47 is a schematic illustrating an exemplary procedure for preparing compound 34 according to some embodiments of the present disclosure.

[0335] To a solution of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-3-(tert-butyl)-1-cyclopropyl-1H-pyrazole-5-carboxamide (150 mg, 0.28 mmol) and (6-aminopyridin-3-yl)boronic acid (58 mg, 0.42 mmol) in dioxane (3 mL) and HO (0.3 mL) was added KPO (118 mg, 0.56 mmol) and Pd(dppf)Cl (20 mg, 0.028 mmol). The reaction mixture was stirred at 90° C. under N for 10 h. The reaction mixture was concentrated, and the residue was purified by pre-TLC (DCM:MeOH=20:1) to give the desired product, Compound 34, as a brown solid (120 mg, 72%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 553.3 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.08 (s, 1H), 8.75 (d, J = 8.0 Hz, 1H), 8.25 (d, J = 2.2 Hz, 1H), 7.80 (d, J = 1.2 Hz, 1H), 7.71 (dd, J = 8.6, 2.4 Hz, 1H), 7.62 (d, J = 8.2 Hz, 1H), 7.50 (dd, J = 8.2, 1.6 Hz, 1H), 6.65 (s, 1H), 6.49 (d, J = 8.6 Hz, 1H), 6.07 (s, 2H), 4.96-4.85 (m, 1H), 4.21-4.13 (m, 1H), 3.45 (dd, J = 15.6, 5.8 Hz, 1H), 3.30-3.24 (m, 1H), 1.49-1.38 (m, 2H), 1.16 (s, 9H), 1.12-1.05 (m, 2H), 1.01-0.96 (m, 1H), 0.93-0.88 (m, 1H), 0.83-0.76 (m, 2H).

[0336] Example 3.35 Compound 35 Preparation of (S)-N-(1-((cyanomethyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide FIG. 48 is a schematic illustrating an exemplary procedure for preparing compound 35 according to some embodiments of the present disclosure.

[0337] Step 1. Preparation of tert-butyl N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(cyanomethyl)carbamoyl]ethyl]carbamate To a mixture of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-2-{[(tert-butoxy)carbonyl]amino}propanoic acid (2.90 g, 7.5 mmol) in DMF (30.0 mL) was added 2-aminoacetonitrile (0.69 g, 7.5 mmol), DIEA (2.91 g, 22.5 mmol), and HATU (5.70 g, 15 mmol). The reaction was stirred at room temperature for 2 hours. Water (100 mL) was added, and the reaction mixture was extracted with EA (100 mL × 3). The combined organic layers were washed with brine (100 mL × 3), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by flash column chromatography (PE:EA = 0-50%) to give the desired product, tert-butyl N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(cyanomethyl)carbamoyl]ethyl]carbamate, as a white solid (2.7 g, 76%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 423.0 [M+H] + .

[0338] Step 2. Preparation of tert-butyl (S)-(1-((cyanomethyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)carbamate To a solution of tert-butyl (S)-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((cyanomethyl)amino)-1-oxopropan-2-yl)carbamate (1400 mg, 3.31 mmol) in dioxane / HO (10 / 1, 30 mL) was added (2-methylpyridin-4-yl)boronic acid (679 mg, 4.96 mmol), KPO (2103 mg, 9.92 mmol), and 1,1-bis(diphenylphosphino)ferrocenepalladium dichloride (242 mg, 0.33 mmol). The reaction mixture was stirred at 90 °C under N for 16 h. The solvent was removed under reduced pressure, and the residue was purified by Combiflash (PE / EA = 0-80%) to give the product as a brown solid (840 mg, 58%). The resulting compound was subjected to mass spectrometry and the results were as follows: Mass (m / z): 436.1 [M+H] + .

[0339] Step 3. Preparation of (S)-2-amino-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propanamide To a solution of (S)-(1-((cyanomethyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)carbamate (790 mg, 1.81 mmol) in MeCN (15 mL) was added TMSI (907 mg, 4.54 mmol). The reaction mixture was stirred under N at room temperature for 0.5 h. HO (50 mL) was added to the reaction mixture, which was then adjusted to pH 8 by using saturated NaHCO and extracted with EA (50 mL × 3). The combined organic layer was washed with brine (30 mL × 2) and then dried over anhydrous NaSO to give the product as a yellow solid (550 mg, 58%). Mass spectrometry analysis of the resulting compound was performed, and the test result was as follows: Mass (m / z): 336.2 [M+H] + .

[0340] Step 4. Preparation of (S)—N-(1-((cyanomethyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide To a solution of (S)-2-amino-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propanamide (130 mg, 0.39 mmol) in DMF (10 mL) was added 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid (80 mg, 0.39 mmol), DIEA (250 mg, 1.94 mmol), and HATU (370 mg, 1.16 mmol). The reaction mixture was stirred at room temperature under N for 2 hours. After the reaction was completed, HO (30 mL) was added to the reaction mixture, which was then extracted with EA (30 mL × 3). The combined organic layer was washed with brine (50 mL × 2) and then dried over anhydrous NaSO. After filtration, the solution was concentrated under vacuum, and the residue was purified by Combiflash (DCM / MeOH=0-10%) to give the desired product, Compound 35, as a white solid (140 mg, 68%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 523.9 [M+H] + . 1H NMR (400 MHz, DMSO-d6) δ 8.86 (t, J = 6.8 Hz, 2H), 8.51 (d, J = 5.4 Hz, 1H), 8.14 (s, 1H), 7.78 (s, 2H), 7.67 (s, 1H), 7.58 (d,J = 5.2 Hz, 1H), 6.61 (s, 1H), 5.09 (d, J = 5.4 Hz, 1H), 4.21 (dd, J = 7.6, 3.8 Hz, 1H), 4.17 (dd, J = 5.6, 2.0 Hz, 2H), 3.59 (dd, J = 15.6, 5.4 Hz, 1H), 3.42-3.36 (m, 1H), 2.54 (s, 3H), 1.33 (s, 3H), 1.01 (dd, J = 6.3, 3.8 Hz, 1H), 0.91 (dd, J = 10.0, 6.2 Hz, 1H), 0.85-0.74 (m, 4H), 0.68 (dd, J = 6.2, 3.8 Hz, 2H).

[0341] Example 3.36 Preparation of Compound 36 (S)-2-((3-bromophenyl)sulfonamido)-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propanamide FIG. 49 is a schematic illustrating an exemplary procedure for preparing compound 36 according to some embodiments of the present disclosure.

[0342] To a solution of (S)-2-amino-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propanamide (80 mg, 0.24 mmol) in DCM (5 mL) was added 3-bromobenzenesulfonyl chloride (60 mg, 0.24 mmol) and TEA (73 mg, 0.72 mmol) at 0 °C. The reaction mixture was stirred at room temperature under N for 3 h. The resulting mixture was concentrated. The residue was purified via preparative TLC (DCM / MeOH = 20 / 1) to give the desired product, Compound 36 (S)-2-((3-bromophenyl)sulfonamido)-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propanamide, as a white solid (20 mg, 15%). The resulting compound was subjected to mass spectrometry and the test results were as follows: Mass (m / z): 554.0 [M+H] + . 1 H NMR (400 MHz, MeOD) δ 8.48 (d, J = 5.4 Hz, 1H), 7.88-7.83 (m, 2H), 7.74 (dd, J = 8.2, 1.6 Hz, 1H), 7.69-7.62 (m, 3H), 7.59 (d, J = 5.4 Hz, 1H), 7.42-7.38 (m, 1H), 7.16 (t, J = 7.8 Hz, 1H), 4.49 (dd, J = 9.6, 5.0 Hz, 1H), 4.14 (s, 2H), 3.41 (dd, J = 15.4, 5.0 Hz, 1H), 3.21 (dd, J = 15.4, 9.6 Hz, 1H), 2.63 (s, 3H). ).

[0343] Example 3.37 Preparation of Compound 37 (S)-2-((3-chlorophenyl)sulfonamido)-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propanamide FIG. 50 is a schematic illustrating an exemplary procedure for preparing compound 37 according to some embodiments of the present disclosure.

[0344] To a solution of (S)-2-amino-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propanamide (80 mg, 0.24 mmol) in DCM (5 mL) was added 3-chlorobenzenesulfonyl chloride (50 mg, 0.24 mmol) and TEA (73 mg, 0.72 mmol) at 0 °C. The reaction mixture was stirred at room temperature under N for 3 h. The resulting mixture was concentrated. The residue was purified via preparative TLC (DCM / MeOH = 20 / 1) to give the desired product, compound 37 (S)-2-((3-chlorophenyl)sulfonamido)-N-(cyanomethyl)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)propanamide, as a white solid (30 mg, 20%). The resulting compound was subjected to mass spectrometry and the test results were as follows: Mass (m / z): 510.0 [M+H] + . 1 H NMR (400 MHz, MeOD) δ 8.48 (d, J = 5.4 Hz, 1H), 7.86 (d, J = 1.2 Hz, 1H), 7.75-7.69 (m, 2H), 7.66 (d, J = 8.4 Hz, 2H), 7.60 (dt, J = 10.6, 2.8 Hz, 2H), 7.25 (t, J = 4.6 Hz, 2H), 4.49 (dd, J = 9.4, 5.0 Hz, 1H), 4.13 (s, 2H), 3.41 (dd, J = 15.4, 5.0 Hz, 1H), 3.21 (dd, J = 15.4, 9.4 Hz, 2H), 2.63 (s, 3H).

[0345] Example 3.38 Preparation of Compound 38 (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide FIG. 51 is a schematic illustrating an exemplary procedure for preparing compound 38 according to some embodiments of the present disclosure.

[0346] Step 1. Preparation of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamido}propenamide To a mixture of (2S)-2-amino-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)propenamide (454 mg, 1.30 mmol) and 2-cyclopropyl-5-(1-methylcyclopropyl)pyrazole-3-carboxylic acid (295 mg, 1.43 mmol) in DCM (10.0 mL) was added DIEA (504 mg, 3.90 mmol) and T3P (50% in EA, 1.65 g, 2.60 mmol). The reaction was stirred at room temperature for 16 hours. The reaction mixture was diluted with water (100 mL) and extracted with EA (100 mL × 3). The combined organic layers were washed with NaHCO3 (100 mL × 3), brine (100 mL), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by flash column (PE:EA=0-60%) to give the product (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}propanamide as a white solid (360 mg, 49%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 537.1 [M+H] + . 1H NMR (400 MHz, MeOD) δ 7.83 (d, J = 1.6 Hz, 1H), 7.54 (dt, J = 8.4, 5.2 Hz, 2H), 6.51 (s, 1H), 5.04 (dd, J = 8.2, 6.2 Hz, 1H), 4.01-3.89 (m, 1H), 3.59 (dd, J = 15.4, 6.2 Hz, 1H), 3.43 (dd, J = 15.4, 8.2 Hz, 1H), 1.57-1.46 (m, 2H), 1.40 (s, 3H), 1.23 (td, J = 12.6, 4.6 Hz, 2H), 1.11-1.05 (m, 1H), 1.02-0.80 (m, 5H), 0.70 (q, J = 4.0 Hz, 2H).

[0347] Step 2. Preparation of (S)—N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide To a solution of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (300 mg, 0.56 mmol) in dioxane / HO (10 / 1, 15 mL) was added (2-methylpyridin-4-yl)boronic acid (77 mg, 0.56 mmol), KPO (237 mg, 1.12 mmol), and 1,1′-bis(diphenylphosphino)ferrocenepalladium dichloride (45 mg, 0.06 mmol). The reaction mixture was stirred at 90° C. under N for 16 h. The resulting mixture was concentrated. The residue was purified via preparative TLC (DCM / MeOH=20 / 1) to obtain the desired product, compound 38 (S)—N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-methylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide, as a white solid (208 mg, 68%). The resulting compound was subjected to mass spectrometry analysis, and the results were as follows: Mass (m / z): 550.2 [M+H] + . 1 H NMR (400 MHz, MeOD) δ 8.46 (d, J = 5.2 Hz, 1H), 8.00 (s, 1H), 7.76 (d, J = 0.9 Hz, 2H), 7.65 (s, 1H), 7.56 (d, J = 5.2 Hz, 1H), 6.51 (s, 1H), 5.15-5.01 (m, 1H), 3.97-3.94 (m, 1H), 3.65 3.60 (m, 1H), 3.49-3.43 (m, 1H), 2.61 (s, 3H), 1.50 (d, J = 3.0 Hz, 2H), 1.38 (s, 3H), 1.26-1.19 (m, 2H), 1.09-1.02 (m, 1H), 0.96-0.93 (m, 1H), 0.90-0.79 (m, 4H), 0.68 (q, J = 4.0 Hz, 2H).

[0348] Example 3.39 Preparation of Compound 39: (2S)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamido}-3-{6-[6-(dimethylamino)pyridin-3-yl]-1,3-benzoxazol-2-yl}propanamide FIG. 52 is a schematic illustrating an exemplary procedure for preparing compound 39 according to some embodiments of the present disclosure.

[0349] To a solution of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (80 mg, 0.1489 mmol) in dioxane / HO (10 / 1, 2 mL) was added (6-(dimethylamino)pyridin-3-yl)boronic acid (37 mg, 0.223 mmol), KPO (63 mg, 0.297 mmol), and 1,1′-bis(diphenylphosphino)ferrocenepalladium dichloride (7 mg, 0.089 mmol). The reaction mixture was stirred at 90° C. under N for 16 h. The solvent was removed under reduced pressure, and the residue was purified by preparative HPLC [Gemini-C18, 150 x 21.2 mm, 5 μm; ACN-HO (0.1% FA), 25-50] to give the desired product, Compound 39, as a white solid (25 mg, 27%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 579.0 [M+H] + . 1H NMR (400 MHz,DMSO-d6) δ 9.12 (s, 1H), 8.77 (d, J = 7.8 Hz, 1H), 8.48 (d, J = 2.2 Hz, 1H), 7.90 (s, 1H), 7.68 (d, J = 8.2 Hz, 1H), 7.59 (d, J = 8.2 Hz, 1H), 6.75 (d, J = 8.6 Hz, 1H), 6.61 (s, 1H), 4.94 (dd, J = 14.0, 8.2 Hz, 1H), 4.24-4.12 (m, 1H), 3.48 (dd, J = 15.4, 5.6 Hz, 1H), 3.07 (d, J = 9.8 Hz, 6H), 1.48 (d, J = 2.4 Hz, 2H), 1.34 (s, 3H), 1.23 (s, 1H), 1.11 (q, J = 10.6 Hz, 2H), 1.04-0.97 (m, 1H), 0.97-0.89 (m, 1H), 0.85-0.77 (m, 4H), 0.68 (dd, J = 6.0, 3.8 Hz, 2H).

[0350] Example 3.40 Preparation of Compound 40 (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide FIG. 53 is a schematic illustrating an exemplary procedure for preparing compound 40 according to some embodiments of the present disclosure.

[0351] To a solution of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (100 mg, 0.18 mmol) in dioxane / HO (10 / 1, 10 mL) was added 1-(2,2-difluoroethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,2,3,6-tetrahydropyridine (51 mg, 0.18 mmol), KPO (76 mg, 0.36 mmol), and 1,1′-bis(diphenylphosphino)ferrocenepalladium dichloride (16 mg, 0.02 mmol). The reaction mixture was stirred under N2 at 90 °C for 16 hours. The resulting mixture was concentrated. The residue was purified by preparative TLC (DCM / MeOH = 10 / 1) to obtain the desired product, compound 40 (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide, as a white solid (8 mg, 7%). The resulting compound was subjected to mass spectrometry analysis, and the results were as follows: Mass (m / z): 604.1 [M+H] + . 1H NMR (400 MHz, MeOD) δ 7.64 (s, 1H), 7.59 (d, J = 8.4 Hz, 1H), 7.49 (d, J = 8.4 Hz, 1H), 6.51 (s, 1H), 6.20 (d, J = 4.2 Hz, 1H), 5.99 (dt, J = 55.8, 4.2 Hz, 1H), 5.04 (dd, J = 8.2, 6.2 Hz, 1H), 3.94 (td, J = 7.4, 3.8 Hz, 1H), 3.59 (dd, J = 15.2, 6.2 Hz, 1H), 3.43 (dd, J = 15.2, 8.4Hz, 1H), 3.37-3.34 (m, 2H), 2.99-2.87 (m, 3H), 2.65 (s, 2H), 1.49 (t, J = 8.2 Hz, 2H), 1.40 (s, 3H), 1.31 (s, 1H), 1.30-1.15 (m, 2H), 1.06 (dt, J = 8.2, 5.2 Hz, 1H), 1.00-0.77 (m, 5H), 0.70 (q, J = 3.8 Hz, 2H).

[0352] Example 3.41 Preparation of Compound 41 (2S)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}-3-[6-(6-acetamidopyridin-3-yl)-1,3-benzoxazol-2-yl]propanamide FIG. 54 is a schematic illustrating an exemplary procedure for preparing compound 41 according to some embodiments of the present disclosure.

[0353] Step 1. Preparation of (S)—N-(3-(6-(6-aminopyridin-3-yl)benzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide To a solution of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (300 mg, 0.56 mmol) in dioxane / HO (10 / 1, 15 mL) was added (6-aminopyridin-3-yl)boronic acid (77 mg, 0.56 mmol), KPO (237 mg, 1.12 mmol), and 1,1′-bis(diphenylphosphino)ferrocenepalladium dichloride (45 mg, 0.06 mmol). The reaction mixture was stirred at 90° C. under N for 16 h. The resulting mixture was concentrated. The residue was purified by preparative TLC (DCM:MeOH=10:1) to give the product as a white solid (140 mg, 45%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 551.0 [M+H] + . 1 H NMR (400 MHz, DMSO-d6) δ 9.12 (s, 1H), 8.76 (d, J = 8.0 Hz, 1H), 8.29 (d, J = 2.4 Hz, 1H), 7.85 (s, 1H), 7.77 (dd, J = 8.6, 2.4 Hz, 1H), 7.66 (d, J = 8.2 Hz, 1H), 7.54 (dd, J = 8.4, 1.4 Hz, 1H), 6.61 (s, 1H), 6.55 (d, J = 8.6 Hz, 1H), 6.17 (s, 2H), 4.93 (dd, J = 14.2, 8.4 Hz, 1H), 4.26-4.12 (m, 1H), 3.48 (dd, J = 15.6, 5.8 Hz, 1H), 3.29 (s, 1H), 1.51-1.44 (m, 2H), 1.34 (s, 3H), 1.12-1.07 (m, 2H), 1.04-0.98 (m, 1H), 0.95-0.89 (m, 1H), 0.88-0.75 (m, 4H).

[0354] Step 2. Preparation of (2S)—N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}-3-[6-(6-acetamidopyridin-3-yl)-1,3-benzoxazol-2-yl]propanamide To a mixture of (2S)-3-[6-(6-aminopyridin-3-yl)-1,3-benzoxazol-2-yl]-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamido}propenamide (45 mg, 0.081 mmol) in pyridine (1 mL) was added acetyl acetate (16 mg, 0.163 mmol). The reaction was stirred at room temperature under N for 18 hours. The solvent was removed under reduced pressure, and the residue was purified by preparative HPLC [Gemini-C18, 150 × 21.2 mm, 5 μm; ACN-HO (0.1% FA), 15-40] to give the desired product, compound 41, as a white solid (15 mg, 29%). The resulting compound was subjected to mass spectrometry and the test results were as follows: Mass (m / z): 593.0 [M+H] + . 1H NMR (400 MHz, DMSO-d6) δ 10.58 (s, 1H), 9.08 (s, 1H), 8.73 (d, J = 8.0 Hz, 1H), 8.65 (d, J = 1.8 Hz, 1H), 8.11 (d, J = 2.4 Hz, 2H), 8.00 (d, J = 1.4 Hz, 1H), 7.67 (dt, J = 8.4, 5.0 Hz, 2H), 6.57 (s, 1H), 4.91 (td, J = 8.2, 5.8 Hz, 1H), 4.26-4.04 (m, 1H), 3.51-3.42 (m, 1H), 3.30 (dd, J = 15.6, 8.8 Hz, 1H), 2.08 (s, 3H), 1.47-1.41 (m, 2H), 1.30 (s, 3H), 1.23-1.19 (m, 3H), 1.14-1.02 (m, 2H), 0.99-0.94 (m, 1H), 0.91-0.86 (m, 1H), 0.84-0.72 (m, 5H), 0.64 (dd, J = 6.2, 3.8 Hz, 2H).

[0355] Example 3.42 Preparation of Compound 42 (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-methylpyridin-3-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide FIG. 55 is a schematic illustrating an exemplary procedure for preparing compound 42 according to some embodiments of the present disclosure.

[0356] To a solution of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (150 mg, 0.28 mmol) in dioxane / HO (10:1, 10 mL) was added (6-methylpyridin-3-yl)boronic acid (57 mg, 0.42 mmol), KPO (118 mg, 0.56 mmol), and 1,1′-bis(diphenylphosphino)ferrocenepalladium dichloride (20 mg, 0.03 mmol). The reaction mixture was stirred at 90° C. under N for 16 h. The resulting mixture was concentrated to give the crude product. The residue was purified via preparative TLC (DCM / MeOH=20 / 1) to obtain the desired product, compound 42 (S)—N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-methylpyridin-3-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide, as a white solid (70 mg, 45%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 550.2 [M+H] + . 1H NMR (400 MHz, DMSO-d6) δ 9.12 (s, 1H), 8.80 (dd, J = 14.0, 5.2 Hz, 2H), 8.06-8.00 (m, 2H), 7.76 (d, J = 8.4 Hz, 1H), 7.68 (dd, J = 8.4, 1.6 Hz, 1H), 7.36 (d, J = 8.2 Hz, 1H), 6.61 (s, 1H), 4.95 (d, J = 5.8 Hz, 1H), 4.19 (d, J = 3.8 Hz, 1H), 3.49 (d, J = 5.8 Hz, 1H), 3.37 (d, J = 8.8 Hz, 1H), 1.48 (d, J = 2.4 Hz, 2H), 1.34 (s, 3H), 1.12 (d, J = 10.8 Hz, 2H), 1.00 (s, 1H), 0.93 (s, 1H), 0.80 (dd, J = 5.6, 3.8 Hz, 4H), 0.68 (dd, J = 6.2, 3.8 Hz, 2H).

[0357] Example 3.43 Preparation of Compound 43 (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-(ethylamino)pyridin-3-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide FIG. 56 is a schematic illustrating an exemplary procedure for preparing compound 43 according to some embodiments of the present disclosure.

[0358] Step 1. Preparation of (6-(ethylamino)pyridin-3-yl)boronic acid To a solution of 5-bromo-N-ethylpyridin-2-amine (100 mg, 0.5 mmol) in dioxane (10 mL) was added 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (190 mg, 0.75 mmol), KOAc (98 mg, 1 mmol), and Pd(dppf)Cl (40 mg, 0.05 mmol). The reaction mixture was stirred under N at 90 °C for 16 h. The solvent was removed under reduced pressure to give the crude product (6-(ethylamino)pyridin-3-yl)boronic acid as a yellow oil (90 mg, purity: 60%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 167.3 [M+H] + .

[0359] Step 2. Preparation of (S)—N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-(ethylamino)pyridin-3-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide To a solution of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (100 mg, 0.19 mmol) in dioxane / HO (10:1, 10 mL) was added (6-(ethylamino)pyridin-3-yl)boronic acid (46 mg, 0.28 mmol), KPO (79 mg, 0.38 mmol), and Pd(dppf)Cl (14 mg, 0.02 mmol). The reaction mixture was stirred at 90° C. under N for 16 h. The solvent was removed under reduced pressure, and the residue was purified by Combiflash column (DCM / MeOH=0-10%) to obtain the desired product, compound 43 (S)—N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-(ethylamino)pyridin-3-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide, as a white solid (43 mg, 39%). The resulting compound was subjected to mass spectrometry analysis, and the results were as follows: Mass (m / z): 579.2 [M+H] + . 1H (400 MHz, MeOD) δ 8.23 ​​(d, J = 2.2 Hz, 1H), 7.78-7.72 (m, 2H), 7.67 (d, J = 8.4 Hz, 1H), 7.54 (dd, J = 8.2, 1.6 Hz, 1H), 6.63 (d, J = 8.8 Hz, 1H), 6.52 (s, 1H), 5.06 (dd, J = 8.4, 6.0 Hz, 1H), 4.00-3.92 (m, 1H), 3.61 (dd, J = 15.2, 6.2 Hz, 1H), 3.45 (dd, J = 15.4, 8.4 Hz, 1H), 3.40-3.35 (m, 2H), 1.51 (d, J = 2.8 Hz, 2H), 1.39 (s, 3H), 1.28 (d, J = 7.2 Hz, 3H), 1.25-1.16 (m, 2H), 1.10-1.03 (m, 1H), 0.97 (dd, J = 10.0, 6.0 Hz, 1H), 0.88 (ddd, J = 13.6, 8.6, 4.0 Hz, 4H), 0.69 (q, J = 4.0 Hz, 2H).

[0360] Example 3.44 Preparation of Compound 44 (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-methylpyridin-2-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide FIG. 57 is a schematic illustrating an exemplary procedure for preparing compound 44 according to some embodiments of the present disclosure.

[0361] Step 1. Preparation of (S)—N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzo[d]oxazol-2-yl)propan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide To a solution of (S)—N-(3-(6-bromobenzo[d]oxazol-2-yl)-1-((1-cyanocyclopropyl)amino)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (500 mg, 0.93 mmol) in dioxane (15 mL) was added 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3,2-dioxaborolane (354 mg, 1.39 mmol), KOAc (183 mg, 1.86 mmol), and Pd(dppf)Cl (68 mg, 0.09 mmol). The reaction mixture was stirred at 90° C. under N for 16 h. The solvent was removed under reduced pressure, and the residue was purified by Combiflash column (DCM / MeOH=0-5%) to give the product (S)—N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzo[d]oxazol-2-yl)propan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide as a brown oil (400 mg, 73%). The resulting compound was subjected to mass spectrometry analysis, and the result was as follows: Mass (m / z): 585.3 [M+H] + .

[0362] Step 2. Preparation of (S)—N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-methylpyridin-2-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide To a solution of (S)—N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzo[d]oxazol-2-yl)propan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (40 mg, 0.07 mmol) in dioxane / HO (10:1, 5 mL) was added 2-bromo-6-methylpyridine (13 mg, 0.07 mmol), KPO (33 mg, 0.14 mmol), and Pd(dppf)Cl (6 mg, 0.01 mmol). The reaction mixture was stirred at 90° C. under N for 16 h. The solvent was removed under reduced pressure, and the residue was purified by Combiflash column (DCM / MeOH=0-10%) to obtain the desired product, compound 44 (S)—N-(1-((1-cyanocyclopropyl)amino)-3-(6-(6-methylpyridin-2-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide, as a yellow solid (4 mg, 10%). The resulting compound was subjected to mass spectrometry analysis, and the results were as follows: Mass (m / z): 550.2 [M+H] + . 1H NMR (400 MHz, MeOD) δ 8.18 (d, J = 1.2 Hz, 1H), 7.97 (dd, J = 8.4, 1.6 Hz, 1H), 7.77 (d, J = 7.6 Hz, 1H), 7.70 (dd, J = 17.6, 8.2 Hz, 2H), 7.24 (d, J = 7.6 Hz, 1H), 6.51 (s, 1H), 5.06 (dd, J = 8.4, 6.2 Hz, 1H), 3.98-3.92 (m, 1H), 3.60 (s, 1H), 3.48 (d, J = 8.4 Hz, 1H), 2.61 (s, 3H), 1.49 (d, J = 2.8 Hz, 2H), 1.38 (s, 3H), 1.24-1.18 (m, 2H), 1.07-1.01 (m, 1H), 0.96 (dd, J = 10.0, 6.0 Hz, 1H), 0.88 (dt, J = 9.8, 5.2 Hz, 4H), 0.68 (q, J = 4.0 Hz, 2H).

[0363] Example 3.45 Preparation of Compound 45 (2S)-2-[(5-tert-butyl-2-cyclopropylpyrazol-3-yl)formamido]-N-(cyanomethyl)-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}propanamide FIG. 58 is a schematic illustrating an exemplary procedure for preparing compound 45 according to some embodiments of the present disclosure.

[0364] Step 1. Preparation of 1-(2-methoxyethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine To a mixture of 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,2,3,6-tetrahydropyridine (1.0 g, 4.07 mmol) in DMF (15.0 mL) was added DIEA (1.58 g, 12.2 mmol) and 1-bromo-2-methoxyethane (623 mg, 4.48 mmol). The reaction was stirred at 60° C. for 16 hours. The reaction mixture was diluted with water (50 mL) and then extracted with EA (50 mL×3). The combined organic layers were washed with brine (100 mL×3), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by flash column (DCM:MeOH=15:1) to obtain the desired product, 1-(2-methoxyethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine, as a colorless oil (1.5 g, 96.5%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 268.2 [M+H] + .

[0365] Step 2. Preparation of tert-butyl N-[(1S)-1-[(cyanomethyl)carbamoyl]-2-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}ethyl]carbamate To a mixture of 1-(2-methoxyethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine (196 mg, 0.732 mmol) in 1,4-dioxane / HO (10:1, 11.0 mL) was added tert-butyl N-[(1S)-2-(6-bromo-1,3-benzoxazol-2-yl)-1-[(cyanomethyl)carbamoyl]ethyl]carbamate (310 mg, 0.732 mmol), KCO (304 mg, 2.20 mmol), and Pd(dppf)Cl (59.8 mg, 0.0732 mmol). The reaction mixture was stirred at 90 °C under N for 6 h. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was diluted with water (20 mL) and then extracted with EA (20 mL × 3). The combined organic layers were washed with brine (50 mL × 2), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by flash column (DCM:MeOH = 20:1) to give the product tert-butyl N-[(1S)-1-[(cyanomethyl)carbamoyl]-2-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}ethyl]carbamate as a white solid (150 mg, 42%). The resulting compound was subjected to mass spectrometry analysis, and the test result was as follows: Mass (m / z): 484.2 [M+H] + .

[0366] Step 3. Preparation of (2S)-2-amino-N-(cyanomethyl)-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}propanamide To a mixture of tert-butyl N-[(1S)-1-[(cyanomethyl)carbamoyl]-2-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}ethyl]carbamate (150 mg, 0.310 mmol) in MeCN (5.0 mL) was added TMSI (155 mg, 0.776 mmol). The reaction was stirred at room temperature for 0.5 hours. The reaction mixture was concentrated under reduced pressure to give the product, (2S)-2-amino-N-(cyanomethyl)-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}propanamide, as a brown solid (100 mg, 75.7%). The resulting compound was subjected to mass spectrometry and the results were as follows: Mass (m / z): 384.2 [M+H] + .

[0367] Step 4. Preparation of (2S)-2-[(5-tert-butyl-2-cyclopropylpyrazol-3-yl)formamido]-N-(cyanomethyl)-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}propanamide To a mixture of (120 mg, 0.248 mmol) in DMF (5.0 mL) was added 5-tert-butyl-2-cyclopropylpyrazole-3-carboxylic acid (62 mg, 0.298 mmol), DIEA (96 mg, 0.745 mmol), and HATU (189 mg, 0.496 mmol). The reaction was stirred at room temperature for 2 hours. The reaction mixture was diluted with water (20 mL) and then extracted with EA (20 mL × 3). The combined organic layers were washed with brine (50 mL × 3), dried over Na2SO4, and concentrated under reduced pressure. The residue was purified by preparative TLC (DCM:MeOH=15:1) to obtain the desired product, compound 45 (2S)-2-[(5-tert-butyl-2-cyclopropylpyrazol-3-yl)formamide]-N-(cyanomethyl)-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}propanamide, as a white solid (15 mg, 10%). Mass spectrometry analysis of the resulting compound showed the following results: mass (m / z): 547.8 [M+H] +. 1 H NMR (400 MHz, CDCl3) δ 8.12 (d, J = 6.8 Hz, 1H), 8.01 (t, J = 5.6 Hz, 1H), 7.57 (d, J = 8.2 Hz, 1H), 7.51 (s, 1H), 7.39 (d, J = 8.4 Hz, 1H), 6.55 (s, 1H), 6.08 (s, 1H), 5.19 (dd, J = 11.0, 6.8 Hz, 1H), 4.18 (t, J = 4.6 Hz, 2H), 3.75-3.67 (m, 2H), 3.68 (d, J = 4.0 Hz, 1H), 3.53 (s, 2H), 3.39 (s, 3H), 3.33 (dd, J = 16.8, 6.8 Hz, 1H), 3.07 (s, 2H), 2.97 (s, 2H), 2.77 (s, 2H), 1.43-1.39 (m, 1H), 1.27 (d, J = 12.2 Hz, 9H), 1.01 (d, J = 8.0 Hz, 2H), 0.88 (t, J = 6.8 Hz, 2H).

[0368] Example 3.46 Preparation of Compound 46 (2S)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamido}-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}propanamide FIG. 59 is a schematic illustrating an exemplary procedure for preparing compound 46 according to some embodiments of the present disclosure.

[0369] To a mixture of (2S)-3-(6-bromo-1,3-benzoxazol-2-yl)-N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}propanamide (200 mg, 0.372 mmol) and 1-(2-methoxyethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine (249 mg, 0.931 mmol) in dioxane / HO (10:1, 11 mL) was added KPO (158 mg, 0.744 mmol) and Pd(dppf)Cl (30 mg, 0.037 mmol). The reaction was stirred at 90 °C under N for 16 h. The reaction mixture was filtered, and the filtrate was extracted with HO (100 mL) and EtOAc (50 × 3 mL). The combined organic layers were washed with brine (100 mL), dried over NaSO, and concentrated under reduced pressure. The crude product was purified by SFC [column: ChiralPak-AD; mobile phase: CO-IPA (DEA)] to obtain the desired product, compound 46 (2S)—N-(1-cyanocyclopropyl)-2-{[2-cyclopropyl-5-(1-methylcyclopropyl)pyrazol-3-yl]formamide}-3-{6-[1-(2-methoxyethyl)-3,6-dihydro-2H-pyridin-4-yl]-1,3-benzoxazol-2-yl}propenamide, as a white solid (25 mg, 11%). Mass spectrometry analysis of the resulting compound showed the following results: Mass (m / z): 598.2 [M+H]+ .1H NMR (400 MHz, DMSO-d6) δ 9.10 (s, 1H), 8.75 (d, J = 8.0 Hz, 1H), 7.70 (s, 1H), 7.61 (d, J = 8.4 Hz, 1H), 7.45 (d, J = 8.4 Hz, 1H), 6.59 (s, 1H), 6.22 (s, 1H), 4.92 (dd, J = 14.0, 8.2 Hz, 1H), 4.20-4.16 (m, 1H), 3.54 (s, 2H), 3.47 (dd, J = 15.6, 5.8 Hz, 1H), 3.28 (s, 3H), 3.33 (s, 3H), 2.79 (s, 3H), 2.59 (s, 2H), 1.49-1.45 (m, 2H), 1.34 (s, 3H), 1.14-0.98 (m, 3H), 0.94-0.89 (m, 1H), 0.86-0.77 (m, 4H), 0.68 (dd, J = 6.2, 3.8 Hz, 2H).

[0370] Example 3.47 Preparation of Compound 47 (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-(difluoromethyl)pyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide FIG. 60 is a schematic illustrating an exemplary procedure for preparing compound 47 according to some embodiments of the present disclosure.

[0371] To a solution of (S)—N-(1-((1-cyanocyclopropyl)amino)-1-oxo-3-(6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzo[d]oxazol-2-yl)propan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (100 mg, 0.17 mmol) in dioxane / HO (10:1, 10 mL) was added 4-bromo-2-(difluoromethyl)pyridine (43 mg, 0.17 mmol), KPO (73 mg, 0.34 mmol), and Pd(dppf)Cl (14 mg, 0.02 mmol). The reaction mixture was stirred at 90° C. under N for 16 h. The solvent was removed under reduced pressure, and the residue was purified by Combiflash column (DCM / MeOH = 0-10%) to obtain the desired product, compound 47 (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-(difluoromethyl)pyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide, as a white solid (7 mg, 7%). The resulting compound was subjected to mass spectrometry analysis, and the results are as follows: Mass (m / z): 586.1 [M+H] + . 1H NMR (400 MHz, DMSO-d6) δ 9.15 (s, 1H), 8.79 (dd, J = 19.8, 6.6 Hz, 2H), 8.26 (s, 1H), 8.06 (s, 1H), 7.98 (d, J = 4.8 Hz, 1H), 7.90-7.80 (m, 2H), 7.02 (t, J = 54.8 Hz, 1H), 6.61 (s, 1H), 4.97 (d, J = 6.0 Hz, 1H), 4.23-4.15 (m, 1H), 3.52 (d, J = 5.6 Hz, 1H), 3.41-3.35 (m, 1H), 1.48 (s, 2H), 1.33 (s, 3H), 1.12 (d, J = 10.4 Hz, 2H), 1.04-0.89 (m, 2H), 0.86-0.74 (m, 4H), 0.68 (dd, J = 6.2, 3.8 Hz, 2H).

[0372] Example 3.48 Preparation of Compound 48 (S)-N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-cyclopropylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide FIG. 61 is a schematic illustrating an exemplary procedure for preparing compound 48 according to some embodiments of the present disclosure.

[0373] To a solution of (S)—N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-cyclopropylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide (150 mg, 0.26 mmol) in dioxane / HO (10:1, 10 mL) was added 4-bromo-2-cyclopropylpyridine (51 mg, 0.26 mmol), KPO (109 mg, 0.51 mmol), and Pd(dppf)Cl (19 mg, 0.03 mmol). The reaction mixture was stirred at 90° C. under N for 16 h. The solvent was removed under reduced pressure, and the residue was purified by Combiflash column (DCM / MeOH=0-10%) to obtain the desired product, compound 48 (S)—N-(1-((1-cyanocyclopropyl)amino)-3-(6-(2-cyclopropylpyridin-4-yl)benzo[d]oxazol-2-yl)-1-oxopropan-2-yl)-1-cyclopropyl-3-(1-methylcyclopropyl)-1H-pyrazole-5-carboxamide, as a white solid (32 mg, 21%). The resulting compound was subjected to mass spectrometry analysis, and the results were as follows: Mass (m / z): 576.3 [M+H] + . 1H (400 MHz, MeOD) δ 8.40 (d, J = 5.2 Hz, 1H), 7.99 (s, 1H), 7.76 (d, J = 1.0 Hz, 2H), 7.54 (d, J = 1.2 Hz, 1H), 7.47 (dd, J = 5.2, 1.8 Hz, 1H), 6.51 (s, 1H), 5.06 (dd, J = 8.4, 6.2 Hz, 1H), 3.98-3.92 (m, 1H), 3.63 (dd, J = 15.4, 6.2 Hz, 1H), 3.46 (dd, J = 15.4, 8.4 Hz, 1H), 2.21-2.16 (m, 1H), 1.49 (t, J = 6.2 Hz, 2H), 1.38 (s, 3H), 1.24-1.18 (m, 2H), 1.09-1.05 (m, 2H), 1.03 (dd, J = 4.6, 2.8 Hz, 2H), 0.98-0.78 (m, 6H), 0.68 (q, J = 4.0 Hz, 2H).

[0374] With the basic concepts thus described, it may become somewhat apparent to those skilled in the art after reading this detailed disclosure that the foregoing detailed disclosure is intended to be presented by way of example only, and not by way of limitation. Various alterations, improvements, and modifications may occur and, although not expressly described herein, are contemplated by those skilled in the art. These alterations, improvements, and modifications are intended to be suggested by this disclosure and are within the spirit and scope of the exemplary embodiments of the disclosure.

[0375] Moreover, certain terminology has been used to describe embodiments of the present disclosure. For example, the terms "one embodiment," "an embodiment," and "some embodiments" mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Thus, it is emphasized and should be understood that references to "an embodiment" or "one embodiment" or "alternative embodiments" more than once in various parts of this specification do not necessarily all refer to the same embodiment. Furthermore, certain features, structures, or characteristics may be combined where suitable in one or more embodiments of the present disclosure.

[0376] Furthermore, the listed order of processing elements or sequences, or the use of numbers, letters, or other designations, therefore, are not intended to limit the claimed processes and methods to any order, except as may be defined in the claims. While the above disclosure discusses, through various examples, what are presently considered to be various useful embodiments of the present disclosure, it should be understood that such details are for this purpose only, and that the appended claims are not limited to the disclosed embodiments, but rather are intended to cover modifications and equivalent arrangements that are within the spirit and scope of the disclosed embodiments. For example, while implementations of the various components described above may be embodied in hardware devices, they may also be implemented as software-only solutions, such as installation on existing servers or mobile devices.

[0377] Similarly, in the foregoing description of embodiments of the present disclosure, it will be appreciated that various features are sometimes grouped together in a single embodiment, figure, or description thereof to simplify the disclosure and aid in understanding one or more of the various embodiments. This method of disclosure, however, should not be interpreted as reflecting an intention that the claimed subject matter requires more features than are expressly recited in each claim. Rather, claimed subject matter consists of fewer than all features of a single foregoing disclosed embodiment.

Claims

1. Formula (Ia): 【Chemistry 1】 A compound represented by [In the formula, R 1 and R 2 -H, -CH 2 - and alkyl groups; R 1 and R 2 are unconnected or connected via a single bond, W is CO or SO 2 and R 3 is an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, or a heterocyclic group, and R 3 is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; X 1 is a CH group or N, X 2 is O, S, or NR 4 where R 4 is selected from H, an alkyl group, an aryl group, and a heterocyclic group; X 3 is H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group, and X 3 is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, and alkoxy groups; Z 1 is a CH group, CR 5 , or N, Z 2 is a CH group, CR 6 , or N, Z 3 is a CH group, CR 7 , or N, Z 4 is a CH group, CR 8 , or N, where R 5 ~R 8 are independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, -CN, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; R 5 ~R 8 each of which is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, heterocyclic, cycloalkyl, aryl, and alkoxy groups.

2. Formula (II): 【Chemistry 2】 Formula (III): 【Transformation 3】 Formula (IV): 【Chemistry 4】 [In the formula, R 0 is H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group, and R 0 is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, and alkoxy groups; or Formula (V): 【Transformation 5】 2. The compound of claim 1, represented by:

3. R 5 ~R 8 3. The compound of claim 2, wherein is H.

4. R 5 ~R 8 at least one of is halogen or —CN; R 5 ~R 8 The rest of the groups are H.

3. The compound of claim 2.

5. R 5 ~R 8 One of them is Formula (VI-a) 【Transformation 6】 [In the formula, R 9 is H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group; R 10 and R 11 are independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; Formula (VI-b) 【Transformation 7】 [In the formula, X 4 is S, O, SO 2 , N, C, or CL 1 where L 1 is selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; L 1 is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; X 5 is N or C, R 12 is absent or selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; R 13 ~R 16 are independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; R 13 ~R 16 each of which is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; Formula (VI-c) 【Transformation 8】 [In the formula, X 6 is S, O, SO 2 , N, C, or CL 2 where L 2 is selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; L 2 is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; R 17 is absent or selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups, and is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; R 18 ~R 21 are independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; R 18 ~R 21 each of which is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; Formula (VI-d) 【Chemistry 9】 [In the formula, R 22 is H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group, and R 22 is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, and alkoxy groups; R 23 ~R 25 are independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; Formula (VI-e) 【Chemistry 10】 Formula (VI-f) 【Chemistry 11】 or Formula (VI-g) 【Chemistry 12】 [R 26 ~R 37 is H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, a heterocyclic group, and NR 38 are independently selected from, where R 38 is selected from H, an alkyl group, an aryl group, a heterocyclic group, and a ketone group.

3. The compound according to claim 2, wherein the group is represented by:

6. R 9 ~R 10 6. The compound of claim 5, wherein is H.

7. X 4 and X 5 However, both are N, R 12 is a methyl group, R 13 ~R 16 is H, 6. The compound of claim 5.

8. X 6 is N, R 18 ~R 21 is H, R 17 is a methyl group, -CH 2 -CHF 2 , or -C 2 H 4 -OCH 3 That is, 6. The compound of claim 5.

9. R 22 is a methyl group, and R 23 ~R 25 6. The compound of claim 5, wherein is H.

10. R 27 ~R 29 is H, R 26 is a methyl group, -CHF 2 or a cyclopropyl group; 6. The compound of claim 5.

11. R 31 ~R 33 is H, R 30 is a methyl group, -NH 2 , -NC 2 H 6 , -NHCOCH 3 , or -NHCH 3 That is, 6. The compound of claim 5.

12. R 35 ~R 37 is H, R 34 is a methyl group, 6. The compound of claim 5.

13. R 3 3. The compound of claim 2, wherein is a halogenated benzene.

14. R 3 but, Formula (VII-a) 【Chemistry 13】 [In the formula, R 39 ~R 42 is H, a halogen, a hydroxyl group, an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, a heterocyclic group, and NR 49 are independently selected from, where R 49 is selected from H, alkyl groups, aryl groups, heterocyclic groups, and ketone groups; or Formula (VII-b) 【Chemistry 14】 [In the formula, R 43 is H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group; R 44 and R 45 are independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; R 44 and R 45 each of which is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; or Formula (VII-c) 【Chemistry 15】 [In the formula, R 46 is H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group; R 47 and R 48 are independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; R 47 and R 48 each of which is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups.

3. The compound according to claim 2, wherein the group is represented by:

15. R 40 ~R 42 is H, R 39 is a methyl group, 15. The compound of claim 14.

16. R 45 is H and R 43 is a methyl group, a cyclopropyl group, or 【Chemistry 16】 and R 44 is a tert-butyl group, a cyclopropyl group, or 【Chemistry 17】 That is, 15. The compound of claim 14.

17. R 48 is H, R 46 is a methyl group, -CHF 2 , or -CF 3 and R 47 is a cyclopropyl group; 15. The compound of claim 14.

18. R 1 and R 2 is connected via a H or single bond -CH 2 -based, 3. The compound of claim 2.

19. A compound selected from Table 1. Table 1A Table 1B 【Table 1C】 【Table 1D】 Table 1E

20. 1. A method of treating a disease in a subject, comprising: The method comprises administering to a subject suffering from the disease a composition comprising a compound represented by formula (Ia): [Chemistry 18] , its isomer, its enantiomer, its diastereomer, its racemate, its solvate, or a pharmaceutically acceptable salt thereof, R 1 and R 2 -H, -CH 2 - and alkyl groups; R 1 and R 2 are unconnected or connected via a single bond, W is CO or SO 2 and R 3 is an alkyl group, a fluoroalkyl group, a cycloalkyl group, an alkoxy group, an aryl group, a heteroaryl group, or a heterocyclic group, and R 3 is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, aryl, heterocyclic, and alkoxy groups; X 1 is a CH group or N, X 2 is O, S, or NR 4 where R 4 is selected from H, an alkyl group, an aryl group, and a heterocyclic group; X 3 is H, an alkyl group, a cycloalkyl group, an aryl group, a heteroaryl group, or a heterocyclic group, and X 3 is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, and alkoxy groups; Z 1 is a CH group, CR 5 , or N, Z 2 is a CH group, CR 6 , or N, Z 3 is a CH group, CR 7 , or N, Z 4 is a CH group, CR 8 , or N, where R 5 ~R 8 are independently selected from H, halogen, hydroxyl, alkyl, fluoroalkyl, -CN, cycloalkyl, alkoxy, aryl, heteroaryl, and heterocyclic groups; R 5 ~R 8 each of which is optionally substituted with one or more groups selected from halogen, hydroxyl, alkyl, fluoroalkyl, cycloalkyl, heterocyclic, cycloalkyl, aryl, and alkoxy groups. in a pharmaceutically effective amount, the disease comprises at least one of severe acute respiratory syndrome (SARS), coronavirus disease 19 (COVID-19), long-term effects of coronavirus (long COVID), post-acute sequelae of COVID-19 (PASC), respiratory syncytial virus (RSV) infection, Ebola virus infection, Middle East respiratory syndrome (MERS), herpes simplex virus infection, acute respiratory distress syndrome (ARDS), ARDS-induced multiple organ failure, acute kidney injury (AKI), liver injury, liver fibrosis, cancer, osteoporosis, inflammation, atherosclerosis, kidney disease, bone disease, or diabetes; method.

Citation Information

Patent Citations

  • dipeptide nitrile

    JP2001522862A

  • Acetamide acetonitrile derivatives as inhibitors of cathepsin l and / or cathepsin s

    JP2002537293A