Antisense oligonucleotides for RNA editing and methods for using same
Antisense oligonucleotides with a structured sequence and cytosine mismatch enhance RNA editing specificity and efficiency, addressing low specificity and high costs in existing technologies, enabling effective therapeutic applications.
Patent Information
- Application Number
- JP2025541733
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-01-18
- Filing Date
- 2024-01-17
- Publication Date
- 2026-02-10
AI Technical Summary
Existing RNA editing technologies face challenges with low specificity, efficiency, high bystander off-target editing, and high production costs, limiting their therapeutic potential for diseases caused by genetic mutations.
The development of antisense oligonucleotides with a specific sequence structure (3'-A1-B-A2-D-A3-') that includes a cytosine mismatch with adenosine in the target sequence, combined with an internal loop, to enhance specificity and efficiency of RNA editing by recruiting ADAR enzymes.
The antisense oligonucleotides achieve highly specific and efficient RNA editing, reducing off-target effects and lowering production costs, making them suitable for therapeutic interventions in genetic disorders.
Smart Images

Figure 2026504887000001 
Figure 2026504887000002 
Figure 2026504887000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to antisense oligonucleotides and methods for using the same. In particular, the present invention relates to antisense oligonucleotides having the following elements: 3'-A1-B-A2-D-A3-5', where A1 is a nucleotide sequence 6 to 16 nucleotides in length; B is a cytosine nucleotide; A2 is a nucleotide sequence 33 to 37 nucleotides in length; D is an internal loop-forming nucleotide sequence 4 nucleotides in length; and A3 is a nucleotide sequence 10 to 20 nucleotides in length, wherein elements A1, A2, and A3 are contiguous nucleotide sequences complementary to a target nucleotide sequence, and the cytosine of element B forms a base pair mismatch with an adenosine in the target nucleotide sequence upon hybridization of elements A1, A2, and A3 with the target nucleotide sequence. Furthermore, the present invention relates to expression cassettes containing a promoter sequence driving expression of nucleotides encoding the antisense oligonucleotides. Additionally, the present invention relates to vectors containing nucleic acids encoding the antisense oligonucleotides or at least one of the expression cassettes. The present invention further contemplates the use of the antisense oligonucleotide, the expression cassette, or the vector for editing RNA in cultured cells or in vitro, and a method for editing RNA comprising contacting the RNA to be edited in cultured cells or in vitro. Furthermore, the present invention relates to pharmaceutical compositions comprising the antisense oligonucleotide, the expression cassette, or the vector. Furthermore, the present invention also encompasses antisense oligonucleotides, expression cassettes, or vectors for use in the treatment and / or prevention of diseases or disorders associated with mutant RNA. The present invention also refers to methods for the treatment and / or prevention of diseases associated with mutant RNA. [Background technology]
[0002] Recent studies have demonstrated that RNA undergoes various modifications in a manner similar to that of DNA. These modifications affect the function and stability of RNA and therefore play important roles in many cellular and biological processes, such as transcription, pre-mRNA splicing, RNA transport, mRNA translation, and RNA degradation. Among these modifications, RNA editing is unique because it not only alters the cellular fate of RNA molecules but also alters their sequence in a site-specific and precise manner compared to the genome, resulting in a significant increase in the repertoire of RNAs encoded by the genome (WO 2022 / 091100 A1). Examples of RNA editing include the conversion of adenosine to inosine (A to I) or cytidine to uridine (C to U) via enzymes called adenosine deaminase and cytidine deaminase, respectively.
[0003] The most studied form of RNA editing system in multicellular organisms is the adenosine deaminase (ADAR) gene family, which catalyzes the deamination of adenosine nucleotides to inosine. ADARs are multidomain proteins containing a recognition domain and a catalytic domain. The recognition domain recognizes specific double-stranded RNA sequences and / or conformations, and the catalytic domain converts adenosine in the target RNA to inosine by deaminating the nucleobase. Inosine is read as guanine by the cellular translation machinery. That is, if the edited adenosine is in the coding region of mRNA or pre-mRNA, it can recode the protein sequence. RNA editing occurs primarily in non-coding regions, with only a small percentage occurring in coding regions, resulting in amino acid changes. For example, in humans, A-to-I editing occurs mostly in introns and untranslated regions (UTRs) of protein-coding genes.
[0004] Unlike DNA editing, RNA editing is reversible. Therefore, the high therapeutic potential of nucleic acid editing has significantly increased interest in RNA editing, as it offers a safer option than DNA editing or gene therapy, as potential adverse effects and off-target editing must be reversible and dose-dependent. RNA editing-based platforms may have broad utility as therapeutic interventions and potential treatments for a wide range of diseases caused by genetic point mutations and other genetic lesions. In particular, ADAR-based RNA editing strategies may be preferable in therapeutic settings due to their ubiquitous nature and the ability to replace ectopic expression of engineered proteins with the administration of oligonucleotide drugs.
[0005] Various research groups have demonstrated remarkable achievements in RNA editing. For example, Merkle et al. (2019) described the engineering of chemically optimized antisense oligonucleotides that recruit endogenous human ADARs to edit endogenous transcripts and demonstrated the repair of clinically relevant PiZZ mutations that cause α1-antitrypsin deficiency. Qu et al. (2019) described engineered ADAR-recruiting RNAs that recruit natural ADAR enzymes and convert specific adenosines to inosines with increased efficiency.
[0006] However, despite significant progress in the study of ADAR mechanisms, the underlying rules that determine the precise location of editing, guide ADARs to that location, and the extent of editing remain poorly understood (Uzonyi et al., 2021). In addition, low specificity of delivery, low editing efficiency, high bystander off-target editing, and high production costs remain unresolved obstacles. Summary of the Invention [Problem to be solved by the invention]
[0007] Therefore, there is a need for nucleic acid molecules for highly specific and efficient RNA editing of target RNA sequences. [Means for solving the problem]
[0008] The technical problem underlying the present invention can be seen as providing means and methods that meet the above needs. This technical problem is solved by the claims and the embodiments characterized herein below.
[0009] The present invention relates to antisense oligonucleotides having the following elements: 3'-A1-B-A2-D-A3-5' [In the formula, A1 is a nucleotide sequence having a length of 6 to 16 nucleotides; B is the nucleotide cytosine; A2 is a nucleotide sequence having a length of 33 to 37 nucleotides; D is an internal loop-forming nucleotide sequence having a length of 4 nucleotides; and A3 is a nucleotide sequence having a length of 10 to 20 nucleotides, Elements A1, A2, and A3 are contiguous nucleotide sequences complementary to a target nucleotide sequence, and a cytosine of element B forms a base pair mismatch with an adenosine in the target nucleotide sequence when elements A1, A2, and A3 hybridize to the target nucleotide sequence.
[0010] It should be understood that, in this specification and claims, the words "a" or "an" can refer to one or more of the hereinafter referred to items, depending on the context in which it is used. Thus, for example, a reference to "an" item can mean that at least one of the item is available.
[0011] As used below, the terms "have," "comprise," or "include" are used in a non-exclusive manner. Thus, these terms may refer both to a situation in which the entity described in this context has no further features other than those introduced by these terms, and to a situation in which one or more further features are present. For example, the expressions "A has B," "A comprises B," and "A includes B" may refer both to a situation in which no other elements exist in A other than B (i.e., a situation in which A consists solely and exclusively of B), and to a situation in which one or more further elements exist in entity A other than B, such as element C, elements C and D, or even more elements.
[0012] The terms "particularly," "more particularly," "typically," "more typically," or similar terms are used in combination with additional and / or alternative features without limiting the alternative possibilities. Thus, features introduced by these terms are additional and / or alternative features and are not intended to limit the scope of the claims in any way. The present invention can be practiced using further alternative features, as one skilled in the art will recognize. Similarly, features introduced by "in embodiments of the invention" or similar phrases are intended to be additional and / or alternative features without any limitation on alternative embodiments of the invention, without any limitation on the scope of the invention, and without any limitation on the possibility of combining the features so introduced with other additional and / or alternative, or non-additional and / or non-alternative, features of the invention.
[0013] Furthermore, as used hereinafter, the terms "preferably," "more preferably," "most preferably," "particularly," "more particularly," "typically," and "more typically" are used in connection with a feature to indicate that the feature is a preferred feature, i.e., these terms indicate that alternative features may also be envisaged in accordance with the present invention.
[0014] Furthermore, it will be understood that the term "at least one" as used herein means that one or more of the items referenced following the term can be used in accordance with the present invention. For example, when the term indicates the use of at least one item, this can be understood as one item, or more than one item, i.e., two, three, four, five, or any other number. Depending on the items to which the term refers, one skilled in the art will understand the upper limit (if any) to which the term refers.
[0015] The term "about" as used herein means that for any number listed after said term, there is an interval of precision within which the technical effect can be achieved. Thus, the term "about" in the context of the present invention means ±20%, ±10%, ±5%, ±2%, or ±1% from the indicated parameter or value. This also takes into account normal variations caused by measurement techniques and the like.
[0016] The term "oligonucleotide" is generally understood by those skilled in the art as a molecule comprising two or more covalently linked nucleosides. Such covalently linked nucleosides are also referred to as nucleic acid molecules or oligomers. The oligonucleotides referred to in the present invention may be therapeutic oligonucleotides less than 200 nucleotides in length. Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention, include both natural and unnatural nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides, comprise a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups not present in nucleosides.
[0017] The term "nucleobase" includes the purine (eg, adenine and guanine) and pyrimidine (eg, uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides that form hydrogen bonds during nucleic acid hybridization.
[0018] The term "nucleobase" refers to both naturally occurring nucleobases, such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012). The terms "adenine," "guanine," "cytosine," "thymine," "uracil," and "hypoxanthine" refer to the nucleobase itself. The terms "adenosine," "guanosine," "cytidine," "thymidine," "uridine," and "inosine" refer to a nucleobase linked to a ribosyl sugar. Nucleobase moieties can be represented by the letter code of the corresponding nucleobase, for example, A, T, G, C, U, or I, and each letter may include modified nucleobases of equivalent function, as appropriate. Nucleobase moieties can be modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or pyrimidine. This is, for example, a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolocytosine, 5-propynylcytosine, 5-propynyluracil, 5-bromouracil, 5-thiazolauracil, 2-thiouracil, 2-thiothymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.
[0019] As used herein, "antisense oligonucleotides" (ASOs) refer to single-stranded DNA and / or RNA molecules that can interfere with DNA and / or RNA processing. Antisense oligonucleotides contain a nucleic acid sequence that is complementary to a specific RNA or DNA sequence.
[0020] The term "complementary" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Additionally, inosine (I) pairs with cytosine (C) in the Watson-Crick bond structure. It will be understood that oligonucleotides may contain nucleosides with modified nucleobases. For example, 5-methylcytosine is often used in place of cytosine. Thus, the term "complementary" encompasses Watson-Crick base pairing between unmodified and modified nucleobases.
[0021] Percentage of complementarity ("% complementarity") refers to the proportion (in percent) of nucleotides in a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that are complementary to a reference sequence (e.g., a target sequence or sequence motif) across the entire contiguous nucleotide sequence. Thus, percentage complementarity is calculated by counting the number of aligned (Watson-Crick base pairing) nucleobases that are complementary between two sequences (when aligned 5'-3' of the target sequence and 3'-5' of the oligonucleotide sequence), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, non-aligned (non-base-paired) nucleobases / nucleotides are referred to as mismatches. Insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence. In determining complementarity, chemical modifications of nucleobases are disregarded so long as the functional ability of the nucleobases to form Watson-Crick base pairs is maintained (e.g., 5'-methylcytosine is considered identical to cytosine for purposes of calculating percent identity). Furthermore, inosine is considered identical to guanine for purposes of calculating percent identity. Sequence identity can be determined using any protein or nucleic acid sequence alignment algorithm, such as Blast, ClustalW, or MUSCLE.
[0022] Typically, antisense oligonucleotides bind to their respective complementary oligonucleotides, DNA, or RNA in a sequence-specific manner, thereby interfering with DNA and / or RNA processing. It is known to those skilled in the art that antisense oligonucleotides can interfere with mRNA processing through RNase H-mediated degradation, translational arrest, modulation of splicing, or can act through steric hindrance of proteins. Means and methods for designing and synthesizing antisense oligonucleotides are well known in the art, including, for example, rational design, chemical modification, and design of antisense oligonucleotides containing locked nucleic acids (LNAs), as well as solid-phase chemical synthesis. Antisense oligonucleotides can be chemically synthesized or expressed in cells, for example, by introducing the respective recombinant DNA construct. Those skilled in the art will understand that such DNA constructs can contain, in addition to the nucleic acid sequence encoding the antisense oligonucleotide, regulatory elements such as enhancers, constitutive or inducible promoters, or terminators, as described in more detail elsewhere in this document. Preferably, antisense oligonucleotides have an overall length of at least 54, at least 56, at least 58, at least 60, at least 62, at least 64, at least 66, at least 68, at least 70, at least 72, at least 74, at least 76, at least 78, or more nucleotides. Antisense oligonucleotides can contain deoxyribonucleotides, ribonucleotides, or a combination of both.
[0023] The antisense oligonucleotide of the present invention comprises elements A1, A2, and A3. Element A1 can have a length of 6 to 16 nucleotides, i.e., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides. Element A2 can have a length of 33 to 37 nucleotides, i.e., 33, 34, 35, 36, or 37 nucleotides. Element A3 can have a length of 10 to 20 nucleotides, i.e., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. Preferably, elements A1, A2, and A3 are contiguous nucleotide sequences complementary to a target nucleotide sequence, i.e., nucleic acid sequences capable of forming a double-stranded structure by base pairing with another nucleic acid sequence. The target nucleotide sequence is typically a portion of the RNA encoded by the gene of interest. Therefore, the target RNA may be mRNA or regulatory RNA that is translated into protein. The length and percent complementarity can be routinely determined by those skilled in the art. For example, the antisense oligonucleotide or the contiguous nucleotide sequence is at least 90% complementary, at least 91% complementary, at least 92% complementary, at least 93% complementary, at least 94% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, or at least 99% complementary to the target nucleotide sequence. In some cases, the contiguous nucleotide sequence is completely complementary to the target nucleotide sequence.
[0024] However, the present invention contemplates that the antisense oligonucleotide sequence may contain less than 100% complementarity to the target nucleotide sequence. Specifically, it is contemplated that the antisense oligonucleotide of the present invention may contain at least one base pair mismatch with the target nucleotide sequence. As used herein, the term "base pair mismatch" refers to at least one nucleotide that does not have base pair complementarity with a given nucleotide, such as GA, GU, CA, UC, AA, GG, CC, or UU. Preferably, the mismatch (element B) is located downstream of element A1 and upstream of element A2 of the antisense oligonucleotide. More preferably, the base pair mismatch (represented by element B in the antisense oligonucleotide) is formed between the cytosine of the antisense oligonucleotide and the adenosine of the target nucleotide sequence. The mismatch results in disruption of the double-stranded structure formed upon hybridization of the antisense oligonucleotide with its target. As used herein, the term "hybridization" refers to the reaction of a nucleotide sequence, i.e., elements A1, A2, and A3 of an antisense oligonucleotide, with a target nucleotide sequence to form a complex stabilized by non-covalent bonds between the bases of the nucleotide residues, such as those formed by Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific method involving non-natural / synthetic nucleotides or bonds between them.
[0025] Examples of structural disruption include, but are not limited to, a bulge, an internal loop, a stem loop (hairpin loop), a junction, or a combination thereof. Preferably, the structural disruption is an internal loop. In certain instances, an internal loop may also be formed in the target nucleotide sequence. Preferably, the nucleotide sequence and the complementary target nucleotide sequence form a double-stranded structure both upstream and downstream of the disruption.
[0026] Internal loops are unpaired stretches of nucleotides located within one strand of a nucleic acid duplex formed by hydrogen-bonded bases, including classical Watson-Crick base pairs and non-classical base pairs. Internal loops can vary in size from a single unpaired residue to multiple nucleotides, frequently forming flexible protrusions from a pseudo-continuous double helix. Internal loops (internal loops) occur in RNA where the duplex separates due to a lack of Watson-Crick base pairing between nucleotides. Internal loops typically occur in the middle of a stretch of double-stranded RNA and can form symmetrical or asymmetrical structures, such as C-loops, docking elbows, K-turns, right angles, sarcin / ricin loops, twist-up motifs, and UAA / GAN internal loop motifs. Stem loops arise when two regions of the same RNA strand base-pair to form a double helix that terminates in an unpaired loop. A stem loop consists of a stem, a double helix, and a loop connecting the stem. Typically, the loop is 3 to 8 nucleotides in length. An RNA junction is a construct where two or more stems join together, usually containing mismatched bases.
[0027] The antisense oligonucleotide of the present invention comprises an internal loop-forming nucleotide sequence, element D, which has a length of 4 nucleotides.It should be understood that the internal loop-forming nucleotide sequence is a base pair mismatch of 4 nucleotides in length, thus forming a break of 4 nucleotides in length.Preferably, the internal loop is formed in the nucleotide sequence of the antisense oligonucleotide.In certain cases, the internal loop may also be formed in the target nucleotide sequence.Preferably, the mismatch (element D) is located downstream of element A2 and upstream of element A3 of the antisense oligonucleotide.
[0028] In one embodiment, antisense oligonucleotide can be or comprise a single-stranded antisense oligonucleotide.Preferably, the single-stranded antisense oligonucleotide is a single-stranded antisense RNA oligonucleotide.Oligonucleotide molecules are usually produced in laboratories by solid-phase chemical synthesis, followed by purification and isolation.Antisense oligonucleotides can also be delivered to cells using vectors, such as viral vectors (for example, lentivirus or adenovirus vectors, which are then transcribed to produce RNA antisense oligonucleotides).
[0029] When referring to the sequence of an oligonucleotide, reference is made to the sequence or order of the nucleobase moieties of the covalently linked nucleotides or nucleosides, or modifications thereof. Thus, oligonucleotides of the invention may contain one or more modified nucleosides or nucleotides.
[0030] The present invention contemplates RNA editing by using adenosine deaminase (ADAR) enzyme acting on RNA.The term "ADAR" refers to double-stranded RNA-specific adenosine deaminase, which catalyzes the hydrolytic deamination of adenosine to inosine in double-stranded RNA (dsRNA) (also referred to as A to I editing).Typically, ADARs share a common modular structure consisting of a variable N-terminal region, a double-stranded RNA binding domain, and a catalytic domain containing zinc.Preferably, ADAR is derived from human.ADAR may be ADAR1, ADAR2, or ADAR3.
[0031] The ADAR1, ADAR2, and ADAR3 proteins referred to in accordance with the present invention are preferably of human origin and have the amino acid sequences registered under UniProt accession numbers P55265, P52948, and Q9NS39, respectively. It will be understood that the terms "ADAR1," "ADAR2," and "ADAR3" also relate to variants of said proteins. Such variants have at least the same essential biological and immunological properties as the aforementioned ADAR1, ADAR2, and ADAR3 proteins. In particular, they share the same essential biological and immunological properties if they are detectable by the same specific assays referred to herein. It should be further understood that the variant referred to in accordance with the present invention has a different amino acid sequence due to at least one amino acid substitution, deletion and / or addition, and the amino acid sequence of the variant is still preferably at least 50%, 60%, 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% identical to the specific amino acid sequence of ADAR1, ADAR2, or ADAR3 protein, respectively, preferably over the entire length of said ADAR1, ADAR2, or ADAR3 protein. It should also be understood that ADAR has catalytic activity. For example, human ADAR1 and ADAR2 isoforms are known to have catalytic activity.
[0032] The ADAR may be an endogenous ADAR, an ADAR recombinantly expressed in the target cell, or an ADAR delivered to the target cell.
[0033] ADAR can be guided to the antisense oligonucleotide sequence / target nucleic acid sequence complex by a specific nucleic acid sequence or secondary structure present in the ASO. Thus, in one embodiment, the antisense oligonucleotide has a further element E following the 5' of element A3, where element E is a recruitment domain for recruiting deaminase. Preferably, the recruitment domain is for recruiting adenosine deaminase. More preferably, the recruitment domain is for recruiting adenosine deaminase acting on RNA (ADAR). Most preferably, the recruitment domain is for recruiting ADAR1 or ADAR2. The term "ADAR recruitment domain" refers to a nucleic acid sequence or structure that directly or indirectly mediates the binding of ADAR to a complementary nucleic acid sequence:target nucleic acid sequence complex. Exemplary ADAR recruitment domains include, but are not limited to, GluR-2, GluR-B (R / G), GluR-B(Q / R), GluR-6(R / G), 5HT2C, and FlnA(Q / R) domains (Aquino-Jarquin 2020). Typically, ADAR recruitment domains comprise a double-stranded RNA structure.
[0034] In one embodiment, the recruitment domain is capable of forming a stem-loop structure. Preferably, the recruitment domain has the nucleotide sequence set forth in SEQ ID NO:1 to 4. More preferably, the recruitment domain has the nucleotide sequence set forth in SEQ ID NO:1. The stem-loop structure may have at least two mismatches. The stem-loop structure may be formed from 10 to 100 nucleotides. Preferably, the stem-loop structure is formed from at least 20 to 80 nucleotides, 30 to 70 nucleotides, or 40 to 60 nucleotides. More preferably, the stem-loop structure is formed from 45 to 49 nucleotides.
[0035] In another embodiment, the antisense oligonucleotide has an additional element F linked to element A1 at its 3' end or to element A3 at its 5' end. It will be understood that element F can be linked to element A3 only when element E, i.e., the recruitment domain for recruiting ADAR, is absent. Preferably, element F is a nucleotide sequence capable of forming a secondary or tertiary structure. As used herein, secondary structure refers to a structure formed depending on how nucleotide bases form hydrogen bonds with each other. Tertiary structure refers to the three-dimensional shape of a nucleic acid polymer. Examples of secondary structures include, but are not limited to, stem-loop structures (hairpin loops), pseudoknots, and G-quadruplexes. A pseudoknot refers to a double hairpin structure with an extended, quasi-continuous double-helical stem region. A pseudoknot is formed when the outer base of the hairpin structure pairs with the base in the hairpin or internal loop. This plays an important role in the biological functions of RNA, such as ribosomal frameshifting. A G-quadruplex is a four-stranded nucleic acid secondary structure formed by guanosine-rich DNA and RNA sequences. Preferably, the secondary structure is a hairpin loop or pseudoknot structure and has the nucleotide sequence set forth in any one of SEQ ID NOs: 5 to 8. More preferably, the secondary structure is a pseudoknot structure having the nucleotide sequence set forth in SEQ ID NO: 5.
[0036] The present invention also relates to expression cassettes comprising a promoter sequence that drives expression of a nucleic acid encoding an antisense oligonucleotide described herein.
[0037] The term "expression cassette" refers to a separate component of vector DNA consisting of a gene and regulatory sequences that enable expression in prokaryotic or eukaryotic cells, or isolated compartments thereof. For example, an antisense oligonucleotide may be ligated into a nucleic acid expression construct (i.e., a vector) under the transcriptional control of appropriate cis-regulatory sequences to direct constitutive or inducible transcription of the nucleotide sequence in the cell. Typically, an expression cassette contains a promoter sequence, an open reading frame, and a 3' untranslated region (3' UTR). The untranslated region may also contain a polyadenylation site to enhance translation efficiency. Accurate and efficient polyadenylation requires two distinct sequence elements: a GU- or U-rich sequence located downstream of the polyadenylation site and a highly conserved hexanucleotide sequence, AAUAAA, located 11 to 30 nucleotides upstream of it.
[0038] The term "promoter" refers to a DNA sequence that initiates transcription of a single RNA transcript from DNA downstream of the promoter. Thus, as used herein, the term refers to DNA sequence elements necessary for transcription initiation, such as general transcription factor binding sites, such as the TATA box, required for recruitment of RNA polymerase. However, the term also encompasses enhancer binding sequences necessary for enhancing or promoting expression. Those skilled in the art are familiar with which promoters can be used and how they can be used to express a gene of interest. In one embodiment, the promoter sequence is selected from the group consisting of hU6-, H1-, and h7SK-promoters. In another embodiment, the expression cassette further comprises a poly-U terminator.
[0039] Antisense oligonucleotides can also be delivered to cells using vectors such as viral vectors (e.g., lentiviral or adenoviral vectors that are subsequently transcribed to produce RNA antisense oligonucleotides). Antisense oligonucleotides can also be produced chemically, i.e., without relying on cell-based expression from a plasmid or virus. Preferably, the oligonucleotides of the present invention are RNA antisense oligonucleotides that are transcribed from a vector upon entry into target cells.
[0040] Thus, the present invention also contemplates vectors comprising nucleic acids encoding the antisense oligonucleotides or at least one expression cassette described herein.
[0041] The term "vector" as used herein refers to a polynucleotide encoding a protein of interest. Preferably, the term "vector" encompasses phages, plasmids, cosmids, viral vectors, and artificial chromosomes, such as bacterial or yeast artificial chromosomes (YACs). Vectors can be incorporated into host cells by various techniques well known in the art. When introduced into a host cell, the vector may be present in the cytoplasm or integrated into the genome. In the latter case, it is understood that the vector may further comprise nucleic acid sequences that allow for homologous recombination or non-homologous insertion. Vectors can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection," conjugation, and transduction are intended to encompass a variety of prior art processes for introducing foreign nucleic acids (e.g., DNA) into host cells, including calcium phosphate, rubidium chloride, or calcium chloride coprecipitation, DEAE-dextran-mediated transfection, lipofection, f-mating, natural transformation competence, carbon-based cluster fusion, chemically mediated transfer, electroporation, or particle gun technology. Suitable methods for transforming or transfecting host cells, including plant cells, can be found in standard textbooks, such as Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Alternatively, plasmid vectors can be introduced by heat shock or electroporation techniques. If the vector is a virus, it can be packaged in vitro using an appropriate packaging cell line before application to host cells.
[0042] Preferably, the vector of the present invention is an expression vector. Such an expression vector is a vector containing a polynucleotide of the present invention having a nucleic acid sequence (also referred to as an "expression cassette") operably linked to an expression control sequence that enables expression in prokaryotic or eukaryotic cells, or isolated fractions thereof. Suitable expression vectors are well known in the art, such as pENTR (kindly provided by Dr. Joshua Rosenthal, University of Chicago), pLV (VectorBuilder), Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pCDM8, pRc / CMV, pcDNA1, pcDNA3 (Invitrogene), or pSPORT1 (GIBCO BRL). Further examples of typical fusion expression vectors include pGEX, pMAL (New England Biolabs, Beverly, MA), and pRIT5 (Pharmacia, Piscataway, NJ), in which glutathione S-transferase (GST), maltose E-binding protein, and protein A are fused to the recombinant target protein, respectively. Examples of suitable inducible non-fusion E. coli expression vectors include pTrc and pET11d, among others. Target gene expression in the pTrc vector relies on transcription from a hybrid trp-lac fusion promoter by the host RNA polymerase. Target gene expression in the pET11d vector relies on transcription from a T7-gn10-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gn1). This viral polymerase is provided by the host strains BL21(DE3) or HMS174(DE3) from a resident lambda prophage harboring a T7 gn1 gene under the transcriptional control of the lacUV 5 promoter.Those skilled in the art are familiar with other vectors suitable for prokaryotes: for example, pBR series such as pLG338, pACYC184, pBR322, pUC series such as pUC18 or pUC19, M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III113-B1, lambdagt11 or pBdCl in E. coli, plJ101, plJ364, plJ702 or plJ361 in Streptomyces, pUB110, pC194 or pBD214 in Bacillus, and pSA77 or pAJ667 in Corynebacterium. Examples of vectors for expression in the yeast S. cerevisiae include pYepSec1, pMFa, pJRY88, and pYES2 (Invitrogen Corporation, San Diego, Calif.). Suitable vectors and vector construction processes for use in other fungi, such as filamentous fungi, are described in detail in standard textbooks, such as van den Hondel, C.A.M.J., & Punt, P.J. (1991) "Gene transfer systems and vector development for filamentous fungi," Applied Molecular Genetics of fungi, J.F. Peberdy et al., Eds., pp. 1-28, Cambridge University Press: Cambridge, or More Gene Manipulations in Fungi (J.W. Bennett & L.L. Lasure, Eds., pp. 396-428: Academic Press: San Diego). Further suitable yeast vectors include, for example, pAG-1, YEp6, YEp13, or pEMBLYe23. Alternatively, the polynucleotides of the present invention can also be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors that can be used for protein expression in cultured insect cells, such as Sf9 cells, include the pAc and pVL series.
[0043] In one embodiment, the vector of the present invention comprises at least two expression cassettes, and the expression control sequences in the at least two expression cassettes are different from each other. As used herein, the expression control sequence refers to a promoter, such as a pU6-, H1-, or h7SK promoter, and the like. Preferably, when multiple expression cassettes are present, the expression control sequences are different from each other. For example, in the vector of the present invention, one expression cassette may comprise an hU6 promoter, and a second expression cassette may comprise an h7SK promoter. In a specific example, the vector may also comprise two expression cassettes, and the promoters may not be different from each other, for example, both the first and second expression cassettes may comprise an hU6 promoter.
[0044] The present invention further relates to the use of the antisense oligonucleotide, expression cassette, or vector of the present invention for RNA editing in cultured cells or in vitro. RNA editing is preferably carried out in eukaryotic cells, preferably cells of multicellular organisms, more preferably animal cells or plant cells. Preferably, RNA editing is used in mammalian cells, most preferably human cells. Cells from any organ or tissue may be used, such as skin, lung, heart, kidney, liver, pancreas, intestine, muscle, gland, eye, brain, blood, and the like.
[0045] Cells targeted for RNA editing may have genetic mutations. The mutations may be heterozygous or homozygous. For example, RNA editing as used herein can be used to modify point mutations, such as an N to A mutation where N is G, C, or U / T, or an N to C mutation where N is A, G, or U / T. However, it is also contemplated that RNA editing can be used in the reverse manner, i.e., to introduce mutations into cells and generate novel epitopes (also referred to as "neoepitopes"). The targeted mutations modified by RNA editing can occur in chromosomes or other forms of DNA, such as mitochondrial DNA, or at the level of RNA, including pre-mRNA, ribosomal RNA, or mitochondrial RNA. The targeted changes made can be in target RNA of a cell or pathogen (including fungi, yeast, parasites, kinetoplasts, bacteria, phages, viruses, and the like) infecting the cell or subject. Editing can then be performed at the RNA level on target sequences inside such cells or pathogens.
[0046] The present invention also relates to a method of RNA editing, comprising contacting the RNA to be edited in cultured cells or in vitro with an antisense oligonucleotide according to the present invention.
[0047] The present invention further relates to a pharmaceutical composition comprising an antisense oligonucleotide, an expression cassette or a vector according to the invention.
[0048] The term "pharmaceutical composition" as used herein refers to a composition comprising an antisense oligonucleotide, expression cassette, or vector of the present invention, and preferably one or more pharmaceutically acceptable carriers. Pharmaceutical compositions are preferably administered systemically. Suitable administration routes customarily used for drug administration include oral, intravenous, subcutaneous, or parenteral administration, as well as inhalation. However, depending on the nature and mechanism of action of the compound, pharmaceutical compositions can also be administered by other routes. Furthermore, the antisense oligonucleotide, expression cassette, or vector of the present invention can be administered in combination with other drugs in a common pharmaceutical composition or in separate pharmaceutical compositions, which may be provided in the form of a kit.
[0049] The pharmaceutical compositions of the present invention are preferably administered in conventional dosage forms prepared by combining the drug with standard pharmaceutical carriers according to conventional procedures. These procedures may involve mixing, granulating, and compressing or dissolving the ingredients, as appropriate to the desired preparation. It will be understood that the form and character of the pharmaceutically acceptable carrier or diluent will be determined by the amount of active ingredient with which it is to be combined, the route of administration, and other well-known variables.
[0050] The carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation and not harmful to the recipient. The pharmaceutical carrier used may be, for example, a solid, gel, or liquid. Examples of solid carriers include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, stearic acid, degradable polymers such as PLGA (DeYoung et al. (2011), DIABETES TECHNOLOGY & THERAPEUTICS 13:1145; Ramazani et al., (2016), Int J Pharm. 499(1-2): 358-367), and the like. Exemplary liquid carriers include phosphate buffered saline, syrup, oils such as peanut oil and olive oil, water, emulsions, various wetting agents, sterile solutions, and the like. Similarly, the carrier or diluent may include time delay material well known in the art, such as glycerol monostearate or glycerol distearate, alone or with a wax. Suitable carriers include those mentioned above and others well known in the art. See, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania.
[0051] The diluent(s) are selected so as not to affect the biological activity of the compound or compounds. Examples of such diluents include distilled water, physiological saline, Ringer's solution, dextrose solution, Hank's solution, etc. In addition, the pharmaceutical composition or formulation may also include other carriers, adjuvants, or nontoxic, nontherapeutic, nonimmunogenic stabilizers, active oxygen scavengers, and the like.
[0052] Pharmaceutical compositions are preferably administered with standard pharmaceutical carriers according to conventional procedures. These procedures may involve mixing or dissolving the ingredients as appropriate to achieve the desired preparation. It will be understood that the form and character of the pharmaceutically acceptable carrier or diluent will be determined by the amount of the antisense oligonucleotide, expression cassette, or vector of the present invention with which it is to be combined, the route of administration, and other well-known variables. Similarly, the carrier or diluent may include time-delay materials well known in the art, such as glycerol monostearate or glycerol distearate, alone or with a wax. A therapeutically effective dose refers to the amount of the antisense oligonucleotide, expression cassette, or vector of the present invention used in the pharmaceutical composition of the present invention that provides the effects referred to herein. The therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED 50 (the dose that is therapeutically effective in 50% of the population) and LD 50 (the dose that is lethal in 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index, and the LD 50 / ED 50 The dosage regimen is determined by the attending physician and other clinical factors. As is well known in the medical field, the dosage for an individual patient will depend on many factors, including the patient's size, body surface area, age, the particular compound being administered, sex, timing and route of administration, general health, and other drugs being administered concomitantly. Progress can be monitored by periodic assessment. Typical dosages may be, for example, in the range of 1 μg to 1000 mg, although dosages below or above this exemplary range are also contemplated, particularly considering the aforementioned factors.
[0053] The present invention also relates to an antisense oligonucleotide, an expression cassette or a vector according to the invention for use in the treatment and / or prevention of a disease or disorder associated with mutant RNA.
[0054] The term "treatment" as used herein refers to ameliorating and / or curing a disease or disorder associated with a mutant RNA, preventing the progression of the disease, and / or causing the reduction, remission, or regression of the disease or disorder. As used herein, treatment also encompasses overall restoration of health associated with a disease or disorder associated with a mutant RNA. It will be understood that the treatments referred to herein will not, in most cases, be successful in all treated subjects. However, it is envisioned that the treatment will be effective in at least a statistically significant proportion of treated subjects. Whether a statistically significant proportion (e.g., of a cohort of subjects) is successfully treated may be determined preferably by statistical testing using, for example, well-known statistical evaluation tools (e.g., determining a confidence interval, determining a p-value, a Student's t-test, a Mann-Whitney test, etc.). Preferably, the treatment is effective in at least 10%, at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the subjects in a given cohort or population.
[0055] The term "prevention" refers to maintaining the health of a subject with respect to a disease or disorder associated with a mutant RNA for a certain period of time. It will be understood that this period may depend on the treatment used and the amount of the antisense oligonucleotide, expression cassette, or vector of the present invention administered. It should be understood that prevention may not be effective in all subjects administered with the antisense oligonucleotide, expression cassette, or vector of the present invention. However, the term preferably requires that a statistically significant proportion of subjects in a cohort or population is effectively prevented from contracting a disease or disorder associated with the mutant RNA. Whether or not this proportion is statistically significant can be quickly determined by one of skill in the art using various well-known statistical evaluation tools, discussed elsewhere herein.
[0056] Preferably, said diseases or disorders associated with mutant RNA include: cystic fibrosis, familial hypercholesterolemia, hemophilia B, Tay-Sachs disease, ataxia-telangiectasia, albinism, alpha-1 antitrypsin deficiency, Alzheimer's disease, amyotrophic lateral sclerosis, asthma, beta-thalassemia, Cadasil syndrome, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, dystrophic epidermolysis bullosa, epidermolysis bullosa, Fabry disease, Factor V Leiden-related disorder, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hematochromatosis, Hunter syndrome, Huntington's disease, Hurler syndrome, inflammatory bowel disease (IBD). IBD), hereditary hemagglutination syndrome, Leber's congenital amaurosis, Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidoses, muscular dystrophies, myotonic dystrophy types 1 and 2, neurofibromatosis, Niemann-Pick disease types A, B, and C, NY-esol-associated cancers, Parkinson's disease, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary diseases, prothrombin mutation-related diseases such as prothrombin G20210A mutation, pulmonary hypertension, retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome, X-linked immunodeficiency, various forms of cancer (e.g., BRCAI and 2-linked breast and ovarian cancer), and the like.
[0057] Preferably, the disease or disorder associated with mutant RNA is cancer. Preferably, the cancer that can be treated by the antisense oligonucleotide of the present invention includes cancer that overexpresses ADAR1. Cancer that overexpresses ADAR1 includes, but is not limited to, melanoma, liver cancer, esophageal cancer, chronic myeloid leukemia, ovarian cancer, and breast cancer.
[0058] The present invention also relates to a method for treating and / or preventing a disease associated with mutant RNA, comprising administering to a subject in need thereof a therapeutically effective amount of an antisense oligonucleotide, expression cassette, or vector according to the present invention.
[0059] The term "subject" as used herein refers to an animal, preferably a vertebrate, more preferably a mammal. Thus, the means and methods provided herein are applicable to both human therapy and veterinary use. Preferably, the mammal referred to herein is a pet (such as a dog, cat, or horse), or livestock (such as a cow, sheep, goat, or pig), or a laboratory animal (such as a rodent, preferably a mouse or rat). Preferably, the mammal or laboratory animal referred to herein is a monkey. More preferably, the mammal referred to herein is a human.
[0060] A "therapeutically effective amount," as referred to herein, refers to an amount of an antisense oligonucleotide of the present invention that prevents or treats a disease or disorder associated with mutant RNA. The therapeutic efficacy and toxicity of antisense oligonucleotides can be determined by standard pharmaceutical procedures in cell culture or experimental animals, e.g., ED. 50 (the dose that is therapeutically effective in 50% of the population) and LD 50 (the dose that is lethal in 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index, and the LD 50 / ED 50 The dosage regimen will be determined by the attending physician and other clinical factors, preferably according to any of the methods described above.
[0061] The explanations and definitions of terms set forth above apply mutatis mutandis to the following embodiments.
[0062] The following embodiments are particularly preferred embodiments according to the present invention.
[0063] Embodiment 1: An antisense oligonucleotide having the following elements: 3'-A1-B-A2-D-A3-5' [In the formula, A1 is a nucleotide sequence having a length of 6 to 16 nucleotides; B is the nucleotide cytosine; A2 is a nucleotide sequence having a length of 33 to 37 nucleotides; D is an internal loop-forming nucleotide sequence having a length of 4 nucleotides; and A3 is a nucleotide sequence having a length of 10 to 20 nucleotides, Elements A1, A2, and A3 are contiguous nucleotide sequences complementary to a target nucleotide sequence, and a cytosine of element B forms a base pair mismatch with an adenosine in the target nucleotide sequence when elements A1, A2, and A3 hybridize to the target nucleotide sequence.
[0064] Embodiment 2: The antisense oligonucleotide of embodiment 1, wherein the antisense oligonucleotide is a single-stranded antisense oligonucleotide, preferably a single-stranded antisense RNA oligonucleotide.
[0065] Embodiment 3: The antisense oligonucleotide of embodiment 1 or 2, having a further element E following the 5' of element A3, wherein element E is a recruitment domain for recruiting a deaminase, preferably an ADAR1 recruitment domain or an ADAR2 recruitment domain.
[0066] Embodiment 4: The antisense oligonucleotide of embodiment 3, wherein the recruitment domain is capable of forming a stem-loop structure and has a nucleotide sequence as set forth in SEQ ID NOs: 1-4.
[0067] Embodiment 5: The antisense oligonucleotide according to any one of embodiments 1 to 4, having an additional element F linked to element A1 at its 3' end or linked to element A3 at its 5' end if element E is not present, wherein element F is a nucleotide sequence capable of forming a secondary or tertiary structure.
[0068] Embodiment 6: The antisense oligonucleotide of embodiment 5, wherein the secondary structure is a hairpin loop or a pseudoknot structure and has a nucleotide sequence as set forth in any of SEQ ID NOs: 5 to 8.
[0069] Embodiment 7: An expression cassette comprising a promoter sequence driving expression of a nucleic acid encoding the antisense oligonucleotide of any of embodiments 1 to 6.
[0070] Embodiment 8: The expression cassette of embodiment 7, wherein the promoter sequence is selected from the group consisting of hU6-, H1-, and h7SK-promoters.
[0071] Embodiment 9: The expression cassette of embodiment 7 or 8, wherein the expression cassette further comprises a polyU terminator.
[0072] Embodiment 10: A vector comprising a nucleic acid encoding an antisense oligonucleotide according to any one of embodiments 1 to 6 or at least one expression cassette according to any one of embodiments 7 to 9.
[0073] Embodiment 11: The vector of embodiment 10, wherein the vector comprises at least two expression cassettes of any of embodiments 7 to 9, and the expression control sequences in the at least two expression cassettes are different from each other.
[0074] Embodiment 12: Use of an antisense oligonucleotide according to any one of embodiments 1 to 6, an expression cassette according to any one of embodiments 7 to 9, or a vector according to embodiment 10 or 11 for editing RNA in cultured cells or in vitro.
[0075] Embodiment 13: A method of editing RNA, comprising contacting RNA to be edited in a cultured cell or in vitro with the antisense oligonucleotide of any of embodiments 1 to 6.
[0076] Embodiment 14: A pharmaceutical composition comprising an antisense oligonucleotide according to any one of embodiments 1 to 6, an expression cassette according to any one of embodiments 7 to 9, or a vector according to any one of embodiments 10 or 11.
[0077] Embodiment 15: An antisense oligonucleotide according to any one of embodiments 1 to 6, an expression cassette according to any one of embodiments 7 to 9, or a vector according to embodiment 10 or 11, for use in the treatment and / or prevention of a disease or disorder associated with mutant RNA.
[0078] Embodiment 16: The antisense oligonucleotide, expression cassette, or vector for use in embodiment 15, wherein the disease associated with mutant RNA is cancer.
[0079] Embodiment 17: A method for treating and / or preventing a disease associated with mutant RNA, comprising administering to a subject in need thereof a therapeutically effective amount of the antisense oligonucleotide of any of embodiments 1 to 6, the expression cassette of any of embodiments 7 to 9, or the vector of any of embodiments 10 or 11.
[0080] Embodiment 18: The method of embodiment 17, wherein the disease associated with mutant RNA is cancer.
[0081] All references cited throughout this specification are incorporated by reference in their entirety, not just for the disclosure content specifically cited. [Brief explanation of the drawings]
[0082] [Figure 1]Flow cytometry analysis to assess ASO-dependent RNA editing. (A) Schematic diagram of the reporter cell line used in this study. The ASO binds to mcherry-eGFP mRNA, generates dsRNA, and recruits ADAR1. ADAR1 editing leads to eGFP activation, and the efficiency of this process can be measured via flow cytometry by counting the number of mCherry+-eGFP+ cells. (B) Direct comparison of three previously reported ASOs. The left is a histogram showing the results of flow cytometry analysis, and the right is a schematic diagram showing the structures of the three ASOs. (C) Optimization of ASO number 3, represented in general form at the top of the panel. Two histograms (bottom left and bottom right) show the change in editing efficiency (measured as % of GFP+ cells) by reducing the length of the 3' and 5' ends of the ASO. Each bar graph: median = mean, error bars = standard deviation, n = 3. [Figure 2] The position of the internal loop-forming nucleotide sequence affects editing efficiency. (A) Schematic of the ASO used in this experiment. (B) Bar graph showing the change in editing efficiency (measured as % of GFP+ cells) by increasing the length of fragment A2 and, therefore, the position of the internal loop-forming nucleotide sequence. For each bar: median = mean, error bars = standard deviation, n = 3. [Figure 3] Shorter ASOs are more efficient and precise. (A) Experimental flowchart. (B) Schematic of the general structure of the ASOs tested in C and D. (C) Bar graph of on-target editing efficiency measured by Sanger sequencing for each ASO. Center = mean, error bars = standard deviation, n = 3. (D) Quantification of editing for each ASO based on sequences from bacterial colonies. Each point on the x-axis is an A within an amplicon sequenced for eGFP (n = 20). [Figure 4]The expression and stability of ASOs affect their editing efficiency. (A) Schematic of the ASOs used in sections B–D. (B) Bar graph showing the editing efficiency using the same ASO but under the control of three different PolIII promoters (top shows a schematic of the plasmids used). (C) Bar graph measuring the editing efficiency using increasing numbers of cassettes per plasmid. The first four samples from the left used only hU6 as the promoter, while the last three samples contained cassettes whose expression was driven by either hU6 or h7SK. (D) Bar graph showing the editing efficiency of ASOs with different RNA structures at their 3' ends: histone 3'UTR mutant stem-loop (SLmt); histone 3'UTR stem-loop (SL); a shortened and modified version of the prequeosin 1-1 riboswitch aptamer (teQ1); and a pseudoknot from Moloney murine leukemia virus (tmp). For each bar graph: median = mean, error bars = standard deviation, n = 3. DETAILED DESCRIPTION OF THE INVENTION
[0083] array In this application, reference is made to the following sequences: SEQ ID NO: 1: Nucleic acid sequence of DDX58 loop 48nt v1. SEQ ID NO: 2: Nucleic acid sequence of DDX58 loop 48nt v2. SEQ ID NO: 3: Nucleic acid sequence of GluR loop v1. SEQ ID NO: 4: Nucleic acid sequence of GluR loop v9.4. SEQ ID NO: 5: Nucleic acid sequence of histone 3'UTR mutated stem loop (SLmt). SEQ ID NO: 6: Nucleic acid sequence of histone 3'UTR stem loop (SL). SEQ ID NO: 7: Nucleic acid sequence of a shortened and modified version of the prequeosin 1-1 riboswitch aptamer (teQ1). SEQ ID NO: 8: Nucleic acid sequence of a frameshift pseudoknot (tmp) from Moloney murine leukemia virus. [Example]
[0084] The examples are merely illustrative of the present invention and are not to be construed as limiting the scope in any way.
[0085] Materials and Methods cell line HEK293T cells (DKFZ, ATCC, Cat# CRL-3216, RRID: CVCL_0063) were cultured in high-glucose DMEM (Sigma-Aldrich, Cat# D6429) supplemented with 10% FBS (PAN Biotech, Cat# P40-37100) and 1% penicillin / streptomycin (Sigma-Aldrich, Cat# P4333) at 37°C and 5% CO2. The cell line was authenticated using Multiplex Cell Authentication from Multiplexion (Heidelberg, Germany). Additionally, the purity of the cell line was verified using the Multiplex cell Contamination Test from Multiplexion (Heidelberg, Germany). No mycoplasma, SMRV, or cross-species contamination was detected.
[0086] Plasmid The mCherry-T2A-eGFP W58X and U6 pENTR gRNA vectors were kindly provided by Dr. Joshua Rosenthal (University of Chicago) (Montiel-Gonzalez et al. 2016). mCherry-T2A-eGFP W58X was modified by inserting a puromycin resistance cassette into the BglII restriction site. All ASO-encoding plasmids were generated using the U6 pENTR gRNA vector as the backbone, substituting the gRNA with different ASOs. When different promoters were used, the U6 sequence was replaced with that of the other promoter (H1 or h7SK) (Figure 4).
[0087] Example 1: Generation of HEK293T mCherry-T2A-eGFP W58X reporter cell line and transfection with a plasmid encoding an ASO HEK293T cells were seeded into 24-well plates (approximately 150,000 cells per well) and allowed to reach 70-90% confluence the following day. 24 hours later, cells were transfected with 2 μg of the mCherry-T2A-eGFP W58X reporter plasmid using Lipofectamine 2000. 48 hours after transfection, cells were diluted into 96-well plates and selected with puromycin (1.5 μg / ml) for 2 weeks. Clonality was verified by visual inspection under a microscope, and clones were then screened for the presence of mCherry by flow cytometry analysis.
[0088] The cell lines were then transfected to evaluate the efficiency of the ASO in mobilizing endogenous ADARs. HEK293T mCherry-T2A-eGFP W58X cells were seeded in 24-well plates (approximately 150,000 cells per well). 24 hours later, cells were transfected with 1.5 μg of the ASO-encoding plasmid using Lipofectamine 2000. The ADAR mobilization efficiency was evaluated by transfecting mCherry with the ASO. + -eGFP + Cells were measured at 24, 48, and 72 hours by flow cytometry analysis.
[0089] Example 2: On-target and off-target analysis of ASO-dependent RNA editing (Figure 3) To assess on- and off-target ASO-dependent editing of eGFP, HEK293T cells were transfected with 25 ng of the mCherry-T2A-eGFP W58X reporter plasmid and 1.5 μg of the ASO-encoding plasmid using Lipofectamine 2000. Forty-eight hours after transfection, RNA was extracted using an RNeasy Plus Mini Kit (Qiagen, Cat# 74134) and treated with DNase (Invitrogen, Cat# AM1907). Following RNA extraction, RT-PCR was performed using gene-specific primers (forward: AACTTCAGCCTGCTCAAACAAGCC, reverse: CAGCCCTGGTCTTGTAGTTG) and a One-step RT-PCR kit (Qiagen, Cat# 210212). PCR products were gel extracted, purified (Macherey-Nagel, Cat# 740609), and analyzed by Sanger sequencing. As shown in Figure 2C, editing was quantified directly from Sanger traces using MultiEditR (Kluesner et al. 2021). Alternatively, PCR products were cloned using the CloneJET PCR Cloning Kit (Thermo Scientific, Cat# K1232) according to the manufacturer's instructions and transformed into DH5a bacteria (NEB, Cat# C2987). Ten to fifty resulting bacterial colonies were sent for sequencing to determine the editing and frequency of target regions, as shown in Figure 2D. To assess the accuracy of each ASO, the amplicon editing index (AmEI) was calculated as the ratio of the number of edited A's to the total number of A's in the amplicon. Thus, AmEI measures the total amount of editing (on-target and off-target) in each amplicon. Finally, to assess the accuracy of each ASO, the on-target editing index was generated as the ratio of the number of on-target edited A's to AmEI. This index, which takes into account both on-target and off-target editing, allows for quantitative evaluation of the accuracy of ASOs.
[0090] result The presence of an internal loop-forming sequence within an ASO enhances editing The ability of plasmid-encoded ASOs to recruit endogenous ADARs was tested in a HEK293T reporter cell line stably expressing mCherry and an inactive eGFP mutant (W58X) in which a tryptophan was mutated to a stop codon. This eGFP mutation can be reverted to its wild-type form by ASO-dependent ADAR editing, and eGFP intensity allows for quantification of RNA editing efficiency. In addition, the presence of mCherry allows for confirmation of potential, undesired RNA interference effects on the transcript upon ASO binding (Figure 1A). Using this system, initial experiments compared three previously reported ASOs (Qu et al., 2019; Uzonyi et al., 2021) for their ability to recruit endogenous ADARs (Figure 1B). ASOs 1 and 2 are fully complementary to the eGFP mRNA target, except for the A:C mismatch that determines the target A. In contrast, ASO 3 contains another four-base mismatch centered at position -35 compared to the A:C mismatch, generating an internal loop structure between the mRNA target and the ASO. Finally, ASO 1 is 70 bases long, while ASOs 2 and 3 are 151 bases long (Figure 1B, right). ASO 3 was the most efficient at recruiting endogenous ADARs and resulted in the highest number of GFP+ cells (Figure 1B, left). Considering that the only difference between ASOs 2 and 3 is the presence of an internal loop-forming sequence, these results demonstrate how important this feature is for efficiently recruiting ADARs in an ASO-dependent manner.
[0091] Considering that long ASOs also result in undesired off-target editing of mRNA targets, we tested whether the length of the ASO could be further reduced without reducing editing efficiency. Notably, shortening both the 5' and 3' ends of the ASO to reduce its size to 74 nt resulted in increased editing efficiency (Figure 1C, left). While shortening the 5' end of the ASO resulted in increased editing when segment A1 was 20 or 15 nt long, shortening it to 10 nt resulted in an approximately three-fold decrease in editing efficiency (Figure 1C, left). Therefore, a 20 nt length was used for the 5' end. Additionally, we also tested whether the length of ASO fragment A2 affected editing efficiency. Because lengths of 33 or 34 nt resulted in higher editing efficiency, we used a length of 33 nt (Figure 2).
[0092] Finally, we tested whether the 3' end length of the ASO could be further reduced (from 16 to 6 nt). However, a ~10% decrease in the percentage of GFP+ cells was observed with ASOs shorter than 16 nt (Figure 1C). Therefore, a 16 nt 3' end length was used. Finally, the resulting optimized ASO was designated ASO 4.
[0093] Short ASO is more efficient and accurate To quantify the efficiency and precision of the optimized short ASO (ASO 4), the first step was to assess the editing efficiency of the targeted base (on-target editing), and the second step was to evaluate the presence of potential undesired editing sites (off-target editing) in the same transcript. With this goal in mind, HEK293T cells were transfected with the mCherry-T2A-eGFP W58X reporter plasmid and plasmids encoding ASOs 1–4. 48 h after transfection, RNA was extracted, RT-PCR was performed on eGFP, and the amplicons were Sanger sequenced. While on-target editing was assessed directly from Sanger traces, off-target editing was assessed by first introducing the PCR products into bacteria and then sequencing single bacterial colonies using Sanger sequencing. Alignment with an unedited reference plasmid allowed us to easily count edited sites in the presence of different ASOs and evaluate on-target and off-target editing efficiencies. ASO 4 had the highest on-target editing as measured by Sanger sequencing (Figure 3C) and directly from bacterial colonies (Figure 3D). Notably, ASO 4 also had the highest measured on-target editing index value, a 1.6-fold increase compared to ASO 1, and the lowest level of off-target editing (Figure 3D).
[0094] ASO expression and stability affect editing efficiency The steady-state level of any RNA in a cell at a given time is dictated by its synthesis and degradation rates. Based on this principle, we tested whether changes in the expression level or stability of an ASO affect its ability to recruit ADARs and, therefore, its editing efficiency. To test this aspect, we used an ASO developed in our laboratory, consisting of a short specificity domain (a region complementary to the mRNA target) and a recruitment domain at the 5' end of the ASO (Figure 4A). This ASO is an optimized version of the recently reported RESTORE design (Merkle et al. 2019), but without chemical modifications, and is encoded in a plasmid. We first tested different Pol III promoters to drive ASO expression. While hU6 yielded the highest editing efficiency, the h7SK promoter also yielded good editing levels (Figure 4B). To achieve higher ASO expression levels, we increased the number of ASO expression cassettes present within a single plasmid. We tested up to six cassettes per plasmid, with expression driven by hU6 alone or hU6 and h7SK. Interestingly, the best editing was obtained when there were four or six cassettes per plasmid, with half of the cassettes containing hU6 and the other half containing h7SK.
[0095] Finally, a recent paper demonstrated that an RNA structure at the 3' end of the gRNA used for Cas9 prime editing reduces gRNA degradation and subsequently increases DNA editing (Nelson et al. 2022). Based on these findings, we tested whether the presence of an RNA structure at the 3' end of the ASO increases editing efficiency. Three of the four RNA structures improved ASO-dependent editing efficiency, with a mutant version of the histone 3' UTR stem-loop motif achieving the highest editing efficiency (Figure 4D).
[0096] Cited literature Battle DJ, Doudna JA. “The stem-loop binding protein forms a highly stable and specific complex with the 3' stem-loop of histone mRNAs”. RNA2001 Jan;7(1):123-32. doi: 10.1017 / s1355838201001820 Merkle T, Merz S, Reautschnig P et al. “Precise RNA editing by recruiting endogenous ADARs with antisense oligonucleotides”. Nat Biotechnol 37, 133-138 (2019). https: / / doi.org / 10.1038 / s41587-019-0013-6 Qu L, Yi Z, Zhu S et al. “Programmable RNA editing by recruiting endogenous ADAR using engineered RNAs”. Nat Biotechnol 37, 1059-1069 (2019). https: / / doi.org / 10.1038 / s41587-019-0178-z Uzonyi A, Nir R, Shliefer P et al. “Deciphering the principles of the RNA editing code via large-scale systematic probing”. Molecular Cell, vol. 81, issue 11, 2374-2387 (2021). https: / / doi.org / 10.1016 / j.molcel.2021.03.024 WO 2022 / 091100 A1 Kluesner MG, Tasakis RN, Lerner T et al. “MultiEditR: The first tool for the detection and quantification of RNA editing from Sanger sequencing demonstrates comparable fidelity to RNA-seq”. Molecular Therapy Nucleic Acids (2021), vol. 25, DOI: https: / / doi.org / 10.1016 / j.omtn.2021.07.008 Montiel-Gonzalez MF, Vallecillo-Viejo IC, Rosenthal JJ. “An efficient system for selectively altering genetic information within mRNAs“. Nucleic Acids Res. 2016 Dec 1;44(21):e157. doi: 10.1093 / nar / gkw738 Hirao I, Kimoto M. “Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma”. Proc Jpn Acad Ser B Phys Biol Sci. 2012 Jul 25;88(7): 345-367. doi: 10.2183 / pjab.88.345 Aquino-Jarquin G. “Novel Engineered Prgrammable Systems for ADAR-Mediated RNA Editing”. Molecular Therapy Nucleic Acids, vol. 19, DOI:https: / / doi.org / 10.1016 / j.omtn. 2019.12.042
Claims
1. An antisense oligonucleotide having the following elements: 3’-A 1 -B-A 2 -D-A 3 -5’ [In the formula, A 1 is a nucleotide sequence having a length of 6 to 16 nucleotides; B is the nucleotide cytosine; A 2 is a nucleotide sequence having a length of 33 to 37 nucleotides; D is an internal loop-forming nucleotide sequence having a length of 4 nucleotides; and A 3 is a nucleotide sequence having a length of 10 to 20 nucleotides, Element A 1 , A 2 and A 3 is a contiguous nucleotide sequence complementary to the target nucleotide sequence, and the cytosine of element B is 1 , A 2 and A 3 When hybridized to a target nucleotide sequence, it forms a base pair mismatch with an adenosine in the target nucleotide sequence.
2. 2. The antisense oligonucleotide of claim 1, which is a single-stranded antisense oligonucleotide, preferably a single-stranded antisense RNA oligonucleotide.
3. Element A 3 3. The antisense oligonucleotide of claim 1 or 2, further comprising a further element E following 5' of said sequence, wherein element E is a recruitment domain for recruiting a deaminase, preferably an ADAR1 recruitment domain or an ADAR2 recruitment domain.
4. 4. The antisense oligonucleotide of claim 3, wherein the recruitment domain is capable of forming a stem-loop structure and has a nucleotide sequence as set forth in SEQ ID NOs: 1-4.
5. If element E is not present, element A at its 3' end 1 or element A at its 5' end 3 5. The antisense oligonucleotide of claim 1, further comprising a further element F linked to said element F, said element F being a nucleotide sequence capable of forming a secondary or tertiary structure.
6. The antisense oligonucleotide of claim 5, wherein the secondary structure is a hairpin loop or a pseudoknot structure and has a nucleotide sequence shown in any one of SEQ ID NOs: 5 to 8.
7. 7. An expression cassette comprising a promoter sequence that drives expression of a nucleic acid encoding the antisense oligonucleotide of any one of claims 1 to 6.
8. 8. The expression cassette of claim 7, wherein the promoter sequence is selected from the group consisting of hU6-, H1-, and h7SK-promoters.
9. 9. The expression cassette of claim 7 or 8, wherein the expression cassette further comprises a polyU terminator.
10. A vector comprising a nucleic acid encoding the antisense oligonucleotide of any one of claims 1 to 6 or at least one expression cassette of any one of claims 7 to 9.
11. 11. The vector according to claim 10, wherein the vector comprises at least two expression cassettes according to any one of claims 7 to 9, and the expression control sequences in at least two expression cassettes are different from each other.
12. Use of an antisense oligonucleotide according to any one of claims 1 to 6, an expression cassette according to any one of claims 7 to 9, or a vector according to claim 10 or 11 for editing RNA in cultured cells or in vitro.
13. 10. A method for editing RNA, comprising contacting the RNA to be edited in a cultured cell or in vitro with the antisense oligonucleotide of any one of claims 1 to 6.
14. A pharmaceutical composition comprising an antisense oligonucleotide according to any one of claims 1 to 6, an expression cassette according to any one of claims 7 to 9, or a vector according to any one of claims 10 or 11.
15. An antisense oligonucleotide according to any one of claims 1 to 6, an expression cassette according to any one of claims 7 to 9 or a vector according to claim 10 or 11 for treating and / or preventing a disease or disorder associated with mutant RNA, preferably cancer.
16. A method for treating and / or preventing a disease (preferably cancer) associated with mutant RNA, comprising the step of administering to a subject in need thereof a therapeutically effective amount of an antisense oligonucleotide described in any one of claims 1 to 6, an expression cassette described in any one of claims 7 to 9, or a vector described in any one of claims 10 or 11.
Citation Information
Patent Citations
Systems and methods for modulating RNA
JP2022516919A
Prime editing guide RNAS, compositions thereof, and methods of using the same
WO2022067130A2
Polynucleotides for RNA editing and methods of using same
WO2022091100A1
Methods and compositions for ADAR-mediated editing
WO2023278410A1