Engineered OMNI-50 nuclease variants

Engineered OMNI-50 nuclease variants address the limitations of current CRISPR systems by enhancing activity, specificity, and stability, achieving precise genome editing with reduced off-target effects, particularly in regions with heterozygous SNPs.

JP2026505389APending Publication Date: 2026-02-13EMENDOBIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025546070
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-07-05
Filing Date
2024-02-08
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

Current CRISPR nucleases face limitations in sequence specificity, expression, delivery, and on-target activity, leading to potential pre-existing immunity and off-target effects, which hinder their in vivo applicability and effectiveness in genome editing.

Method used

Engineered OMNI-50 nuclease variants with specific amino acid substitutions, enhancing activity, specificity, and stability, allowing for improved genome editing and reduced off-target effects, particularly in regions with heterozygous SNPs.

Benefits of technology

The engineered OMNI-50 nuclease variants exhibit increased on-target editing activity, reduced off-target effects, and enhanced allele-specific discrimination, improving the precision and efficacy of genome editing processes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026505389000001_ABST
    Figure 2026505389000001_ABST
Patent Text Reader

Abstract

The present invention provides compositions containing non-naturally occurring nuclease variants having at least 90% identity to the sequence set forth in SEQ ID NO:1 and comprising an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339 and S779 of the sequence set forth in SEQ ID NO:1.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application claims the benefit of (i) U.S. Provisional Application No. 63 / 483,851, filed February 8, 2023; (ii) U.S. Provisional Application No. 63 / 491,380, filed March 21, 2023; (iii) U.S. Provisional Application No. 63 / 511,795, filed July 3, 2023; and (iv) U.S. Provisional Application No. 63 / 511,927, filed July 5, 2023, the contents of which are incorporated herein by reference.

[0002] Throughout this application, various publications are referenced, including those within parentheses. The entire disclosures of all publications mentioned in this application are incorporated by reference into this application in their entireties to inform the reader of the technology that may be used in or to which the present invention pertains.

[0003] Reference to sequence listing This application was created on July 5, 2023 on an IBM PC machine using an operating system compatible with MS-Windows®, and incorporates by reference the nucleotide sequence in an XML file 462,633 bytes in size and filed as part of this application on February 8, 2024, with the file name "102322_040393_PCT_Eng_Omni_50_Variants.xml."

[0004] Technical Field This invention relates, inter alia, to compositions and methods for genome editing. [Background technology]

[0005] The clustered regularly interspaced short palindromic repeats (CRISPR) system in bacterial and archaeal adaptive immunity exhibits extreme diversity in protein composition and genomic locus structure. CRISPR systems have become important tools for research and genome engineering. Nevertheless, many details of CRISPR systems remain unknown, and the application of CRISPR nucleases may be limited by sequence specificity, expression, or delivery. Different CRISPR nucleases have diverse characteristics, including size, PAM site, on-target activity, specificity, cleavage patterns (e.g., blunt ends, sticky ends), and prominent patterns of indel formation after cleavage. Combinations of diverse properties may be useful for various applications. For example, some CRISPR nucleases can target specific genomic loci, while others cannot due to PAM site restrictions. Furthermore, some currently used CRISPR nucleases exhibit pre-existing immunity, potentially limiting their in vivo applicability. See Charlesworth et al., Nature Medicine (2019) and Wagner et al., Nature Medicine (2019). Therefore, the discovery, application, and refinement of novel CRISPR nucleases and the RNA molecules that activate and target them are important. Summary of the Invention

[0006] Disclosed herein are engineered and activity-enhanced clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated OMNI-50 nucleases and their uses in genome engineering, epigenome engineering, genome targeting, genome editing, and in vitro diagnostics.

[0007] Some aspects of the invention provide OMNI-50 nuclease variants with improved activity and / or specificity compared to wild-type OMNI-50 nuclease, as well as methods for using the improved variants. Advantageously, when the modified OMNI-50 nuclease variant is active in a CRISPR endonuclease system, the CRISPR endonuclease system exhibits increased on-target editing activity compared to the wild-type CRISPR endonuclease system in which the wild-type OMNI-50 nuclease is active. For example, the modified OMNI-50 nuclease variant may have improved nuclease activity in a target region containing a heterozygous SNP that is present only in the target allele and not in the non-target allele. In some embodiments, the modified OMNI-50 nuclease variant exhibits reduced off-target effects.

[0008] Some embodiments of the invention provide variants of the OMNI-50 nuclease protein that comprise a sequence that is at least 80% identical to the amino acid sequence of the wild-type OMNI-50 nuclease protein (SEQ ID NO: 1).

[0009] In some aspects, the invention provides compositions containing non-naturally occurring variants of OMNI-50 nuclease having at least 80%, 85%, 90%, 95%, or 97% identity to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino acid substitutions at positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, or S779 of the sequence set forth in SEQ ID NO: 1. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0010] In some aspects, the invention provides compositions containing non-naturally occurring variants of OMNI-50 nuclease having at least 80%, 85%, 90%, 95%, or 97% identity to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and comprising amino acid substitutions at least one, two, three, four, five, or six of the following positions: N300, G614, N698, E836, T939, and L1100 of the sequence set forth in SEQ ID NO: 1. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0011] In some aspects, the invention provides compositions containing non-naturally occurring variants of OMNI-50 nuclease having at least 80%, 85%, 90%, 95%, or 97% identity to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and comprising amino acid substitutions at least one, two, three, four, five, or six positions D252, D281, L302, N368, L1100, and S1339 of the sequence set forth in SEQ ID NO: 1. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0012] In some aspects, the invention provides compositions containing non-naturally occurring variants of OMNI-50 nuclease having at least 80%, 85%, 90%, 95%, or 97% identity to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and comprising amino acid substitutions at least 1, 2, 3, 4, 5, 6, 7, or 8 positions N300, G614, N698, S779, E836, T939, L1100, and S1339 of the sequence set forth in SEQ ID NO: 1. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0013] In some aspects, non-naturally occurring variants of OMNI-50 nuclease have improved activity fidelity and / or targeting compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some aspects, such variants comprise an amino acid substitution at position L1100 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise substitutions at at least one, two, three, four, or five of positions N300, G614, N698, E836, and T939 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise substitutions at at least one, two, three, four, or five of positions D252, D281, L302, N368, and S1339 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise substitutions at position S779 of the sequence set forth in SEQ ID NO: 1.

[0014] In some aspects, non-naturally occurring variants of OMNI-50 nuclease have increased specificity compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some aspects, such variants comprise an amino acid substitution at position S1339 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise substitutions at at least one, two, three, four, five, or six of positions N300, G614, N698, E836, T939, and L1100 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise substitutions at at least one, two, three, or four of positions D252, D281, L302, and N368 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise a substitution at position S779 of the sequence set forth in SEQ ID NO: 1.

[0015] In some embodiments, non-naturally occurring variants of OMNI-50 nuclease have increased stability compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some embodiments, such variants comprise an amino acid substitution at position S779 of the sequence set forth in SEQ ID NO: 1.

[0016] In some aspects, the invention provides non-naturally occurring variants of OMNI-50 nuclease having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and including at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve of the following amino acid substitutions relative to the sequence set forth in SEQ ID NO: 1: N300A, G614R, N698L, E836F, T939L, L1100F, D252Y, D281V, L302N, N368S, S1339R, and S779P. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0017] In some aspects, the invention provides non-naturally occurring variants of OMNI-50 nuclease having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and including at least one, two, three, four, five, or six of the following amino acid substitutions relative to the sequence set forth in SEQ ID NO: 1: N300A, G614R, N698L, E836F, T939L, and L1100F. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0018] In some aspects, the invention provides non-naturally occurring variants of OMNI-50 nuclease having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and including at least one, two, three, four, five, or six of the following amino acid substitutions relative to the sequence set forth in SEQ ID NO: 1: D252Y, D281V, L302N, N368S, L1100F, and S1339R. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0019] In some aspects, the invention provides non-naturally occurring variants of OMNI-50 nuclease having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and including at least one, two, three, four, five, six, seven, or eight of the following amino acid substitutions relative to the sequence set forth in SEQ ID NO: 1: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0020] An aspect of the invention provides a composition comprising a non-naturally occurring nuclease variant having at least 90% identity to the sequence set forth in SEQ ID NO:1 and comprising an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339 and S779 of the sequence set forth in SEQ ID NO:1. [Brief explanation of the drawings]

[0021] [Figures 1A-1D] V6552 and V6172 show increased activity and specificity in cell lines homozygous for the ELANE_g58Ref target site. Proteins were tested in HSCs homozygous for ELANE g58Ref. Total editing rates (%) at target and off-target sites were calculated by next-generation sequencing (NGS) as indel frequencies relative to all aligned reads. (A) On-target for g58Ref V6552 in WT OMNI-50. (B) On-target for g58Ref V6172 in WT OMNI-50. (C) Off-target for g58Ref V6552 in WT OMNI-50. (D) Off-target for g58Ref V6172 in WT OMNI-50. [Figures 2A-2C]V6552 and V6172 exhibit broad activity against various targets. (A) WT OMNI-50 and V6552 were tested against various targets in Jurkat cells (Table 5), and the total editing rate was calculated by NGS as the frequency of indels relative to all aligned reads. (B) WT OMNI-50 and V6552 were tested against ELANE_g38 in HSCs (Table 5), and the total editing rate was calculated by NGS as the frequency of indels relative to all aligned reads. (C) WT OMNI-50 and V6172 were tested against ELANE_g38 in Jurkat cells (Table 5), and the total editing rate was calculated by NGS as the frequency of indels relative to all aligned reads. [Figures 3A-3E] V6552 and V6172 show increased discrimination in cell lines heterozygous for the selected target site (ELANE_g58Ref). Proteins were tested in HSCs heterozygous for ELANE g58Ref or g58Alt. Total editing rates (%) at target and off-target sites were calculated by NGS as the frequency of indels relative to all aligned reads. Discrimination is determined by the reduction in the ratio of unedited target alleles to non-target alleles. (A) Percent unedited for each allele (Alt or Ref) and on-target editing of g58Ref or g58Alt by WT OMNI-50 and V6552. (B) Off-target editing of g58Ref by V6552 and WT OMNI-50. (C) Percent unedited for each allele (Alt or Ref) and on-target editing of g58Ref (C) or g58Alt (D) by WT OMNI-50 and V6172. (E) Off-target editing of g58Ref by V6172 and WT OMNI-50. The V6172-optimized nuclease variant is active and discriminatory, preserving the reference allele and reducing the alternative allele. [Figures 4A-4D]V6172 and V6552 also show increased discrimination in cell lines heterozygous for other target sites. Proteins were tested in HSCs heterozygous for ELANE_g62Ref. Total editing rates (%) at target and off-target sites were calculated by NGS as the frequency of indels relative to all aligned reads. (A) On-target editing of g62Ref by WT OMNI-50 and V6552. (B) Off-target editing of g62Ref by V6552 and WT OMNI-50. (C) On-target editing of g62Ref by WT OMNI-50 and V6172. (D) Off-target editing of g62Ref by V6172 and WT OMNI-50. [Figure 5A-5B] V6172 is more faithful than wild-type OMNI-50 at other sites tested. Proteins were tested in HSCs heterozygous for ELANE_g35. The total editing rate (%) at target and off-target sites was calculated by NGS as the frequency of indels relative to all aligned reads. (A) On-target editing of ELANE_g35 by WT OMNI-50 and V6172. (B) Off-target editing of ELANE_g35 by V6172 and WT OMNI-50. [Figures 6A-6B] A single V6552 mutation contributes to increased activity. Variants with only a single mutation in V6552 were tested in HSCs homozygous for ELANE_g58Ref. Next-generation sequencing (NGS) was used to calculate the level of editing at on-target (A) and off-target (B) sites as indel frequencies across all aligned reads. Mutations L1100F (V7896) and S1339R (V7101) significantly contribute to activity, and the activity of a variant containing these mutations (V7492) is similar to that of V6552. S1339R contributes to specificity, as indicated by the reduced off-target editing of V7101. [Figures 7A-7B]Removal of single mutations from V6552 and their contribution to activity and specificity. A variant carrying five of the six mutations in V6552 was tested in homozygous HSCs, ELANE_g58Ref, and the level of on-target (A) and off-target (B) editing was calculated as the indel frequency across all aligned reads using next-generation sequencing. Removal of L1100F or S1339R (V7257 and V7256, respectively) reduced activity compared to V6552, highlighting the importance of these mutations for activity. D252Y and L302N contribute to specificity, as indicated by increased off-target editing (B) when D252Y and L302N are removed (V7253 and V7255, respectively). [Figure 8A-8B] Single mutations in V6172 contribute to increased activity and fidelity. Variants with only a single mutation in V6172 were tested in HSCs homozygous for ELANE_g58Ref. Using next-generation sequencing (NGS), the level of on-target (A) and off-target (B) editing was calculated as the indel frequency across all aligned reads. The mutation L1100F appears to contribute most to activity. Other mutations further increase activity. The single mutations N300A (V7239), N698L (V7241), and T939L (V7243) reduced off-target editing levels, indicating their role in fidelity (Figure 8B). [Figure 9A-9B] Removal of single mutations from V6172 and their contribution to activity and specificity. A variant carrying five of the six mutations in V6172 was tested in homozygous HSCs, ELANE_g58Ref, and the level of on-target (A) and off-target (B) editing was calculated as the indel frequency across all aligned reads using next-generation sequencing. Removal of L1100F (V7143) reduced activity compared to V6172, highlighting the importance of this mutation to activity. Removal of only one mutation, N300A (V7138), N698L (V7140), and T939L (V7142), increased off-target editing compared to V6172 (B), demonstrating their contribution to fidelity. [Figure 10] Removal of single mutations from V6172 and their contribution to discrimination. A variant carrying five of the six mutations in V6172 was tested in heterozygous HSCs (ELANE_g58Alt). Next-generation sequencing (NGS) was used to calculate the level of on-target editing as the indel frequency across all aligned reads. Discrimination was determined by the reduction in the ratio of unedited target alleles relative to non-target alleles. The percentage of unedited alleles (Alt or Ref) and on-target editing of g58Alt for each variant are shown. When only one mutation was removed, N300A (V7138), N698L (V7140), and T939L (V7142) showed reduced discrimination compared to V6172, as indicated by the reduction in the non-edited ratio of the non-target allele (Ref). These data indicate that mutations also contribute to nuclease discrimination. [Figure 11] The S779P mutation increases the thermostability of OMNI-50. The S779P mutation was introduced into wild-type OMNI-50 (forming variant V7261) and variant V6552 (forming variant V7281). The thermostability of each protein was tested by incubating the proteins at 25°C and 44°C and measuring the percentage of remaining activity, as indicated by DNA cleavage at higher temperatures. [Figures 12A-12B] Variants V6552, V6172, and V7765 show increased activity in cell lines homozygous for RPE65 and VEGF_A3 targets. Proteins were tested in HSCs homozygous for RPE65_g13 and VEGF_A3_g10 targets. Total editing rates (%) at on-target and off-target sites were calculated by next-generation sequencing (NGS) as indel frequencies relative to all aligned reads. (A) On-target editing of RPE65 by V6552, V6172, V7765, and WT OMNI-50. (B) On-target editing of VEGF3 by V6552, V6172, V7765, and WT OMNI-50. [Figures 13A-13I]Variants V6552, V6172, and V7765 show increased activity and specificity in cell lines homozygous for other target sites (ELANE_g62Ref, ELANE_g58Ref, SARM1, and FANCF). Proteins were tested in HSCs homozygous for ELANE_g62Ref and ELANE_g58Ref and in SH-SY5Y cells harboring SARM1. Total editing rates (%) at target and off-target sites were calculated by next-generation sequencing (NGS) as indel frequencies relative to all aligned reads. (A) On-target editing of ELANE_g62Ref by V6552, V6172, V7765, and WT OMNI-50. (B) Off-target editing of ELANE_g62Ref by V6552, V6172, V7765, and WT OMNI-50. (C) Off-target editing of ELANE_g62Ref by V6552, V6172, V7765, and WT OMNI-50. (D) On-target editing of ELANE_g58Ref by V6552, V6172, V7765, and WT OMNI-50. (E) Off-target editing of ELANE_g58Ref by V6552, V6172, V7765, and WT OMNI-50. (F) On-target editing of SARM1 by V6552, V6172, V7765, and WT OMNI-50. (G) Off-target editing of SARM1 by V6552, V6172, V7765, and WT OMNI-50. (H) On-target editing of FANCF by V6552, V6172, V7765, and WT. (I) Off-target editing of FANCF by V6552, V6172, V7765, and WT OMNI-50. DETAILED DESCRIPTION OF THE INVENTION

[0022] Detailed Description of the Invention Disclosed herein are engineered variants of clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated OMNI-50 nuclease with altered and improved properties and their uses in genome engineering, epigenome engineering, genome targeting, genome editing and in vitro diagnostics.

[0023] Aspects of the invention provide compositions containing a non-naturally occurring nuclease variant having at least 90% identity to the sequence set forth in SEQ ID NO: 1, and comprising an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779 of the sequence set forth in SEQ ID NO: 1. In some aspects, the nuclease variant comprises an amino acid substitution at at least one of positions L1100, S1339, and / or S779.

[0024] In some embodiments, the nuclease variant comprises an amino acid substitution at position L1100.

[0025] In some embodiments, the nuclease variant comprises an amino acid substitution at position S1339.

[0026] In some aspects, the nuclease variant comprises amino acid substitutions at positions L1100 and S1339.

[0027] In some embodiments, the nuclease variant comprises an amino acid substitution at position S779.

[0028] In some aspects, the nuclease variant comprises an amino acid substitution at each of positions L1100, S1339 and S779.

[0029] In some aspects, the nuclease variant comprises an amino acid substitution at position L1100, wherein the amino acid substituting for the leucine is histidine (H), phenylalanine (F), tryptophan (W), or tyrosine (Y).

[0030] In some aspects, the nuclease variant comprises an amino acid substitution at position L1100, wherein the amino acid substituting the leucine is a phenylalanine (L1100F).

[0031] In some aspects, the nuclease variant comprises an amino acid substitution at position S1339, wherein the amino acid substituting the serine is arginine (R), lysine (K), or histidine (H).

[0032] In some aspects, the nuclease variant comprises an amino acid substitution at position S1339, wherein the amino acid substituting the serine is an arginine (S1339R).

[0033] In some aspects, the nuclease variant comprises an amino acid substitution at position S779, wherein the amino acid substituting the serine is glycine (G), alanine (A), valine (V), cysteine ​​(C), proline (P), leucine (L), isoleucine (I), methionine (M), tryptophan (W), phenylalanine (F), aspartic acid (D), asparagine (N), or histidine (H).

[0034] In some aspects, the nuclease variant comprises an amino acid substitution at position S779, wherein the amino acid substituting the serine is a proline (S779P).

[0035] In some aspects, the nuclease variant comprises an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, and L1100.

[0036] In some aspects, the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, E836F, T939L, and L1100F.

[0037] In some aspects, the nuclease variant comprises an amino acid substitution at at least one of positions D252, D281, L302, N368, L1100, and S1339.

[0038] In some aspects, the nuclease variant comprises at least one of the following amino acid substitutions: D252Y, D281V, L302N, N368S, L1100F, and S1339R.

[0039] In some aspects, the nuclease variant comprises an amino acid substitution at at least one of positions N300, G614, N698, S779, E836, T939, L1100, and S1339.

[0040] In some aspects, the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R.

[0041] In some aspects, the nuclease variant has the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1) containing an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779.

[0042] In some aspects, the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, E836F, T939L, L1100F, D252Y, D281V, L302N, N368S, S1339R, and S779P.

[0043] In some embodiments, the nuclease variant comprises any one of the amino acid sequences set forth in SEQ ID NOs: 2-30.

[0044] In some embodiments, the nuclease variant further comprises at least one nuclear localization sequence (NLS).

[0045] In some embodiments, the nuclease variant further comprises at least one affinity tag.

[0046] In some aspects, the nuclease variant is conjugated to another protein to form a fusion protein.

[0047] In some aspects, the nuclease variant is a nickase or lacks catalytic activity.

[0048] Aspects of the invention also provide compositions containing a polynucleotide encoding any one of the nuclease variants described herein, preferably wherein the polynucleotide is a DNA or RNA molecule, preferably an mRNA molecule.

[0049] In some embodiments, the composition further contains a single guide RNA (sgRNA) molecule, a crRNA molecule, and / or a tracrRNA molecule, or a DNA molecule encoding the single guide RNA (sgRNA) molecule, a crRNA molecule, and / or a tracrRNA molecule.

[0050] Aspects of the invention also provide methods of binding to and / or modifying a DNA target site in a cell or cell-free system, the methods comprising delivering any one of the compositions described herein to the cell or cell-free system.

[0051] In some embodiments, the conjugation and / or modification occurs inside a eukaryotic or prokaryotic cell.

[0052] In some aspects, the mammalian cells are human cells.

[0053] In some aspects, the DNA target site is located within or near a pathogenic allele of a gene.

[0054] In some aspects, the DNA target site is located in a gene selected from the group consisting of ELANE, CXCR4, EMX, RyR2, KNCQ1, KCNH2, SCN5a, GBA1, GBA2, rhodopsin, GUCY2D, IMPDH1, FGA, BEST1, PRPH2, KRT5, KRT14, ApoA1, STAT3, STAT1, ADA2, RPS19, SBDS, GATA2, RPE65, LDLR, ANGPTL3, B2M, TRAC, TCF4, TGFBi, PAX6, C3, LRRK2, SARM1, SAMD9, SAMD9L, HAVCR2, CD3E, APLP2, CISH, TIGIT, TNNT2, TNN, MYH7, and HLA-E.

[0055] In some embodiments, the DNA target is repaired with an exogenous donor molecule.

[0056] In some embodiments, the exogenous donor molecule is an RNA or DNA molecule.

[0057] In some embodiments, the off-target editing activity is at least 2-fold, 10 ... 2 double, 10 3 double, 10 4 double, 10 5 double or 10 6 Double decrease.

[0058] Aspects of the invention also provide modified cells obtained by any one of the methods described herein.

[0059] In some embodiments, the cells are transplantable.

[0060] In some aspects, the cells are capable of giving rise to progeny cells after transplantation.

[0061] In some aspects, the cells are capable of giving rise to progeny cells after autologous transplantation.

[0062] In some aspects, the cells are capable of producing progeny cells for at least 12 months or at least 24 months after transplantation.

[0063] In some aspects, the cells are selected from the group consisting of hematopoietic stem cells, progenitor cells, CD34+ hematopoietic stem cells, bone marrow cells, and peripheral mononuclear cells.

[0064] Aspects of this invention also provide compositions containing any one of the modified cells described herein and a pharmaceutically acceptable carrier.

[0065] Aspects of this invention also provide methods for producing the composition in vitro or ex vivo, comprising mixing cells with a pharmaceutically acceptable carrier.

[0066] In some aspects, OMNI-50 nuclease variants that have increased specificity, activity, and / or stability compared to wild-type OMNI-50 nuclease (SEQ ID NO: 1, which is encoded by the polynucleotide set forth in SEQ ID NO: 31), as well as methods of using the improved variants, are provided. In some aspects, the increased specificity is increased fidelity. In some aspects, the increased specificity is increased discrimination. For example, in some aspects, OMNI-50 nuclease variants have increased discrimination compared to wild-type OMNI-50 nuclease when targeting a mutant allele sequence rather than the corresponding functional allele. In some aspects, OMNI-50 nuclease variants that have increased activity compared to wild-type OMNI-50 nuclease, as well as methods of using the improved variants, are provided. In some aspects, OMNI-50 nuclease variants that have increased stability compared to wild-type OMNI-50 nuclease are provided. As used herein, the term "stability" refers to the stability of the variants of the invention as a function of time (e.g., the extent to which activity is retained when the variant is stored under various conditions), including storage stability and stability during use (e.g., during washing steps). Stability is affected by many factors (e.g., pH, temperature, the composition of the particular solution, detergent). Non-limiting examples of increased / improved stability include increased thermal stability (i.e., increased ability to withstand elevated temperatures without degradation), increased half-life under various conditions (various buffers, salt concentrations, pH), a protein that is less likely to aggregate in various buffers and salt concentrations, and higher yields when the protein is purified.

[0067] Advantageously, when the modified OMNI-50 nuclease variant is active in a CRISPR endonuclease system, the CRISPR endonuclease system exhibits increased stability, activity, and specificity compared to a wild-type CRISPR endonuclease system in which the wild-type OMNI-50 nuclease is active. In some embodiments, the increased specificity is increased fidelity, and the variant exhibits reduced off-target editing activity compared to a wild-type CRISPR endonuclease system in which the wild-type OMNI-50 nuclease is active. In some embodiments, the increased specificity is increased discrimination, and the variant exhibits increased allele-specific editing activity compared to a wild-type CRISPR endonuclease system in which the wild-type OMNI-50 nuclease is active. For example, the modified OMNI-50 nuclease variant may exhibit improved allele-specific discrimination (e.g., specific binding and activity) in a target region containing a heterozygous SNP that is present only in the targeted allele and not in non-targeted alleles.

[0068] In some aspects, variants of OMNI-50 nickases are provided that have increased stability and / or specificity and / or increased activity compared to wild-type OMNI-50 nickases. In some aspects, variants of inactivated OMNI-50 nucleases are provided that have increased stability and / or specificity and / or increased targeting activity compared to wild-type inactivated OMNI-50 nucleases. For example, the catalytic site of any one of the OMNI-50 nuclease variants of the present invention may be modified so that the variant has nickase activity and is capable of cleaving single-stranded DNA. Alternatively, the catalytic site of any one of the OMNI-50 nuclease variants of the present invention may be modified so that the variant does not have nuclease activity, i.e., is inactivated.

[0069] Some embodiments of the invention provide variants of the OMNI-50 nuclease protein that comprise a sequence that is at least 80% identical to the amino acid sequence of the wild-type OMNI-50 nuclease protein (SEQ ID NO: 1).

[0070] In some embodiments, the invention provides compositions containing non-naturally occurring variants of OMNI-50 nuclease that share at least 80%, 85%, 90%, 95%, or 97% identity with the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and contain amino acid substitutions at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 positions in the sequence set forth in SEQ ID NO: 1: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779. Each possibility represents a separate aspect of this disclosure and can be freely combined. Combinations of amino acids at these 12 positions may be substituted with other amino acids in the OMNI-50 nuclease variant. Amino acids at positions other than the above 12 positions may also be similarly substituted so that the variant of OMNI-50 nuclease has at least 80%, 85%, 90%, 95% or 97% identity with the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1).

[0071] In some aspects, the invention provides compositions containing non-naturally occurring variants of OMNI-50 nuclease having at least 80%, 85%, 90%, 95%, or 97% identity to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and comprising amino acid substitutions at least one, two, three, four, five, or six of the following positions: N300, G614, N698, E836, T939, and L1100 of the sequence set forth in SEQ ID NO: 1. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0072] In some aspects, the invention provides compositions containing non-naturally occurring variants of OMNI-50 nuclease having at least 80%, 85%, 90%, 95%, or 97% identity to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and comprising amino acid substitutions at least one, two, three, four, five, or six positions D252, D281, L302, N368, L1100, and S1339 of the sequence set forth in SEQ ID NO: 1. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0073] In some aspects, the invention provides compositions containing non-naturally occurring variants of OMNI-50 nuclease having at least 80%, 85%, 90%, 95%, or 97% identity to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and comprising amino acid substitutions at least 1, 2, 3, 4, 5, 6, 7, or 8 positions N300, G614, N698, S779, E836, T939, L1100, and S1339 of the sequence set forth in SEQ ID NO: 1. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0074] In some aspects, non-naturally occurring variants of OMNI-50 nuclease have improved activity fidelity and / or targeting compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some aspects, such variants comprise an amino acid substitution at position L1100 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise substitutions at at least one, two, three, four, or five of positions N300, G614, N698, E836, and T939 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise substitutions at at least one, two, three, four, or five of positions D252, D281, L302, N368, and S1339 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise substitutions at position S779 of the sequence set forth in SEQ ID NO: 1.

[0075] In some aspects, non-naturally occurring variants of OMNI-50 nuclease have increased specificity compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some aspects, such variants comprise an amino acid substitution at position S1339 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise substitutions at at least one, two, three, four, five, or six of positions N300, G614, N698, E836, T939, and L1100 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise substitutions at at least one, two, three, or four of positions D252, D281, L302, and N368 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants further comprise a substitution at position S779 of the sequence set forth in SEQ ID NO: 1.

[0076] In some embodiments, a non-naturally occurring variant of an OMNI-50 nuclease has increased thermostability compared to the wild-type OMNI-50 protein (SEQ ID NO: 1). In some embodiments, such a variant comprises an amino acid substitution at position S779 of the sequence set forth in SEQ ID NO: 1.

[0077] In some aspects, the invention provides non-naturally occurring variants of OMNI-50 nuclease having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and including at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve of the following amino acid substitutions relative to the sequence set forth in SEQ ID NO: 1: N300A, G614R, N698L, E836F, T939L, L1100F, D252Y, D281V, L302N, N368S, S1339R, and S779P. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0078] In some aspects, the invention provides non-naturally occurring variants of OMNI-50 nuclease having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and including at least one, two, three, four, five, or six of the following amino acid substitutions relative to the sequence set forth in SEQ ID NO: 1: N300A, G614R, N698L, E836F, T939L, and L1100F. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0079] In some aspects, the invention provides non-naturally occurring variants of OMNI-50 nuclease having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and including at least one, two, three, four, five, or six of the following amino acid substitutions relative to the sequence set forth in SEQ ID NO: 1: D252Y, D281V, L302N, N368S, L1100F, and S1339R. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0080] In some aspects, the invention provides non-naturally occurring variants of OMNI-50 nuclease having a sequence at least 80%, 85%, 90%, 95%, or 97% identical to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and including at least one, two, three, four, five, six, seven, or eight of the following amino acid substitutions relative to the sequence set forth in SEQ ID NO: 1: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R. Each possibility represents a separate aspect of this disclosure and can be freely combined.

[0081] Some embodiments of the invention provide non-naturally occurring variants of OMNI-50 nuclease that have at least 80%, 85%, 90%, 95%, or 97% identity to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1), and that contain an amino acid substitution at least one of positions N300, G614, N698, S779, E836, T939, L1100, and S1339 of the sequence set forth in SEQ ID NO: 1. In some embodiments, non-naturally occurring variants of OMNI-50 nuclease are provided that contain an amino acid substitution at least one, two, three, four, five, six, seven, or eight of positions N300, G614, N698, S779, E836, T939, L1100, and S1339 of the sequence set forth in SEQ ID NO: 1. Each possibility represents a separate aspect of the disclosure and can be freely combined.

[0082] In some aspects, a non-naturally occurring variant of OMNI-50 nuclease comprises an amino acid substitution at position S779 of the sequence set forth in SEQ ID NO: 1. In some aspects, such variants have improved stability compared to an equivalent / identical sequence without said substitution and / or the sequence of wild-type OMNI-50 (SEQ ID NO: 1). In some aspects, a non-naturally occurring variant of OMNI-50 nuclease comprises an amino acid substitution at position S779 of the sequence set forth in SEQ ID NO: 1 and further comprises one, two, three, four, five, six, or seven amino acid substitutions at positions N300, G614, N698, E836, T939, L1100, and S1339.

[0083] In some aspects, a non-naturally occurring variant of an OMNI-50 nuclease comprises an amino acid substitution at position S1339 of the sequence set forth in SEQ ID NO: 1. In some aspects, such a variant has improved specificity and / or activity compared to an equivalent / identical sequence without said substitution.

[0084] In some aspects, non-naturally occurring variants of OMNI-50 nuclease comprise amino acid substitutions at positions S779 and S1339 of the sequence set forth in SEQ ID NO: 1, and optionally 1, 2, 3, 4, 5, or 6 amino acid substitutions at positions N300, G614, N698, E836, T939, and L1100. In some aspects, such variants have improved stability, specificity, and / or activity compared to the equivalent / identical sequence without said substitutions.

[0085] In some aspects, the non-naturally occurring variant of OMNI-50 nuclease comprises amino acid substitutions at positions S779, L1100, and S1339 of the sequence set forth in SEQ ID NO:1, and optionally one, two, three, four, or five amino acid substitutions at positions N300, G614, N698, E836, and T939.

[0086] In some embodiments, the amino acid substitution at position S779 is any one of S779D, S779E, S779R, S779T, S779N, S779Q, S779G, S779P, S779C, S779A, S779V, S779I, S779L, S779M, S779F, S779Y, or S779W. Each possibility represents a separate aspect of this disclosure. In some embodiments, the amino acid substitution at position S779 is any one of the following groups: non-polar aliphatic (G, A, V, L, M, I); aromatic (F, Y, W); positively charged (K, R, H); polar and uncharged (S, T, C, P, N, Q), and negatively charged (D, E). In some aspects, the amino acid at position S779 is substituted with any one of alanine (A), aspartic acid (D), asparagine (N), histidine (H), or phenylalanine (F).

[0087] In some aspects, the amino acid substitution at position S1339 is any one of S1339D, S1339E, S1339R, S1339T, S1339N, S1339Q, S1339G, S1339P, S1339C, S1339A, S1339V, S1339I, S1339L, S1339M, S1339F, S1339Y, or S1339W, each possibility representing a separate aspect of this disclosure.

[0088] Some embodiments of the invention provide non-naturally occurring variants of OMNI-50 nuclease that have at least 80%, 85%, 90%, 95%, or 97% identity to the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1) and include at least one of the following amino acid substitutions relative to the sequence set forth in SEQ ID NO: 1: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R. In some embodiments, the non-naturally occurring variant of OMNI-50 nuclease includes at least one, two, three, four, five, six, seven, or eight of the following substitutions relative to the sequence set forth in SEQ ID NO: 1: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R. Each possibility represents a separate aspect of the invention and can be freely combined.

[0089] In some embodiments, the variant of OMNI-50 nuclease comprises any one of the amino acid sequences set forth in SEQ ID NOs: 2-30.

[0090] In some embodiments, polynucleotides are provided that encode non-naturally occurring variants of OMNI-50 nuclease having the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1) containing an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779. In some embodiments, the polynucleotide sequence comprises a nucleotide sequence selected from the sequences set forth in SEQ ID NOs: 32-60. In some embodiments, the polynucleotide is a DNA expression vector. In some embodiments, the polynucleotide is an RNA molecule, preferably an mRNA molecule.

[0091] Some aspects of the present invention provide a CRISPR system comprising any one of the OMNI-50 nuclease variants disclosed herein complexed with a guide RNA molecule that targets a DNA target site, wherein the CRISPR system exhibits reduced off-target editing activity compared to a wild-type CRISPR system comprising a wild-type OMNI-50 nuclease protein and the guide RNA molecule. In some aspects, the guide RNA molecule is a single guide RNA (sgRNA). In some aspects, the guide RNA molecule is part of a crRNA:tracrRNA complex.

[0092] In some aspects, the OMNI-50 nuclease variant has increased specificity and / or activity for a target site compared to wild-type OMNI-50 nuclease (SEQ ID NO: 1) when complexed with a guide RNA that targets the target site.

[0093] In some embodiments, the variant of OMNI-50 nuclease is a nickase having an inactive RuvC domain created by amino acid substitutions in a CRISPR nuclease at the positions shown in column 1 of the table below: In some embodiments, the nickase further comprises an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779.

[0094] In some embodiments, the variant of an OMNI-50 nuclease is a nickase having an inactive HNH domain created by amino acid substitutions in a CRISPR nuclease at the positions shown in column 2 of Table 1 below. In some embodiments, the nickase further comprises an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779.

[0095] In some embodiments, the variant of OMNI-50 nuclease is a dead nuclease having an inactivated RuvC domain and an inactivated HNH domain created by substitution of a CRISPR nuclease at the positions shown in column 3 of the table below. In some embodiments, the dead nuclease comprises an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779.

[0096] [Table 1]

[0097] This table shows the positions to be substituted to create a nickase with an inactivated RuvC domain, the positions to be substituted to create a nickase with an inactivated HNH domain, and the positions to be substituted to create an inactivated nuclease with inactivated RuvC and HNH domains. At each amino acid position shown in columns 1-3, if an asterisk is marked, any other amino acid substitution is allowed, except that substitutions other than aspartic acid (D) to glutamic acid (E) or glutamic acid (E) to aspartic acid (D) are inactivating.

[0098] Although the specification refers to variants of OMNI-50 nuclease, these variants may be modified to have nickase activity (i.e., a nuclease that cleaves single-stranded DNA rather than double-stranded DNA) or to have no nuclease activity (i.e., an inactivated nuclease).

[0099] Thus, point mutations can be introduced into any one of the variants described herein to modify or eliminate nuclease activity while maintaining the ability to specifically bind to DNA programmed by the guide RNA. Any one of these variants can utilize a guide RNA molecule (e.g., a single guide RNA (sgRNA) or a crRNA:tracrRNA complex) to specifically target a desired DNA target sequence. The variant-guide complex delivers any molecule associated with the complex to the target site. Thus, this disclosure also contemplates fusion proteins comprising any one of the variants described herein and a DNA-modifying domain (e.g., a deaminase, nuclease, nickase, recombinase, methyltransferase, methylase, acetylase, acetyltransferase, transcriptional activator, or transcriptional repressor domain), and the use of such fusion proteins to modify disease-associated mutations in a genome (e.g., the genome of a human subject) or to generate mutations in a genome (e.g., the human genome) to reduce or prevent gene expression.

[0100] In some embodiments, the variants of the present invention may be fused to a protein having enzymatic activity. In some embodiments, the enzymatic activity modifies target DNA. In some embodiments, the enzymatic activity is nuclease activity, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, or glycosylase activity. In some cases, the enzymatic activity is nuclease activity. In some cases, the nuclease activity induces double-strand breaks in the target DNA. In some cases, the enzymatic activity modifies a target polypeptide associated with the target DNA. In some cases, the enzymatic activity is a methyltransferase activity, a demethylase activity, an acetyltransferase activity, a deacetylase activity, a kinase activity, a phosphatase activity, a ubiquitin ligase activity, a deubiquitinating activity, an adenylating activity, a deadenylating activity, a sumoylating activity, a desumoylating activity, a ribosylation activity, a deribosylation activity, a myristoylating activity, or a demyristoylating activity. In some cases, the target polypeptide is a histone and the enzymatic activity is a methyltransferase activity, a demethylase activity, an acetyltransferase activity, a deacetylase activity, a kinase activity, a phosphatase activity, a ubiquitin ligase activity, or a deubiquitinating activity.

[0101] Thus, any one of the OMNI-50 nucleases, nickases, or dead nuclease variants may be fused (e.g., directly or via a linker) to another DNA-modifying or DNA-modifying enzyme, including, but not limited to, a deaminase, a reverse transcriptase (e.g., for use in prime editing, see Anzalone et al. (2019)), an enzyme that alters the methylation state of DNA (e.g., a methyltransferase), or a modifier of histones (e.g., a histone acetyltransferase). Indeed, the OMNI-50 nucleases, nickases, and dead variants described herein may be fused to a DNA-modifying enzyme or its effector domain. Examples of DNA-modifying enzymes include, but are not limited to, deaminases, nucleases, nickases, recombinases, methyltransferases, methylases, acetylases, acetyltransferases, reverse transcriptases, helicases, integrases, ligases, transposases, demethylases, phosphatases, transcriptional activators, or transcriptional repressors. In some embodiments, the OMNI-50 variants of the present invention are fused to a protein having enzymatic activity. In some embodiments, the enzymatic activity modifies a target DNA molecule. The OMNI-50 variants described herein, or fusion proteins thereof, may be used to correct or create one or more mutations in a gene associated with a disease, or to increase, correct, reduce, or prevent gene expression.

[0102] Some embodiments of the invention provide methods for gene editing with increased editing activity and / or increased specificity, comprising contacting a DNA target site with an active CRISPR system comprising any one of the OMNI-50 nuclease variant proteins described herein.

[0103] Some embodiments provide gene editing methods with increased on-target editing activity, increased fidelity (reduced off-target activity), and / or increased discrimination (increased allele-specific editing), comprising contacting a target site locus with an active CRISPR system comprising a variant of an OMNI-50 nuclease protein, such as any one of the variants described herein, wherein the active CRISPR system has reduced off-target editing activity and maintained on-target editing activity compared to a wild-type CRISPR system having a wild-type OMNI-50 nuclease protein.

[0104] This disclosure provides modified OMNI-50 nucleases that have increased target site specificity compared to wild-type OMNI-50 nuclease (SEQ ID NO: 1). Wild-type OMNI-50 nuclease is disclosed in WO 2020 / 030782, which is incorporated herein by reference. When the modified OMNI-50 nuclease variants are active in a CRISPR endonuclease system, the CRISPR endonuclease system exhibits reduced off-target editing activity, increased editing activity, and / or increased discrimination while maintaining on-target editing activity compared to a CRISPR endonuclease system comprising wild-type OMNI-50 nuclease. In some embodiments, the modified OMNI-50 nuclease is a variant of OMNI-50 nuclease that includes at least one amino acid substitution relative to wild-type OMNI-50 nuclease. In some embodiments, the modified OMNI-50 nuclease comprises multiple amino acid substitutions relative to wild-type OMNI-50 nuclease.

[0105] In some embodiments, a variant of an OMNI-50 nuclease is at least 80%, e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence of SEQ ID NO: 1. By way of non-limiting example, a variant of an OMNI-50 nuclease may differ in the amino acid sequence of up to 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, or 20% of the residues compared to the sequence set forth in SEQ ID NO: 1. Such sequence differences can be revealed by sequence alignment. Variants of OMNI-50 nuclease may be generated by substituting at least one amino acid residue of a wild-type OMNI-50 nuclease with another amino acid residue (e.g., a conservative or non-conservative amino acid) and / or by inserting or deleting an amino acid residue from a wild-type OMNI-50 nuclease. Any mutation, including but not limited to substitutions, insertions, or deletions, may be used to generate a variant of an OMNI-50 nuclease from a wild-type OMNI-50 nuclease, in addition to or in addition to the other mutations described herein. In some embodiments, variants of OMNI-50 nuclease retain a desired activity of the parent wild-type OMNI-50 nuclease, e.g., the ability to interact with guide RNA and target DNA and / or nuclease activity (e.g., the ability to cause double-stranded DNA breaks, single-stranded DNA breaks, or the lack of nuclease activity or nickase activity). In some aspects, the variants have increased, e.g., nuclease activity, above the level of activity of the parent. In some aspects, the variants retain the desired activity, e.g., nuclease activity, of the parent at a level equal to or greater than the level of activity of the parent. In some aspects, the variants retain the desired activity, e.g., nuclease activity, of the parent at a level that is at least 100%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, or 30% of the level of activity of the parent. In some aspects, variants of OMNI-50 nuclease have reduced off-target effects compared to wild-type OMNI-50 nuclease.

[0106] In some aspects, variants of OMNI-50 nuclease proteins are provided that comprise a sequence at least 80% identical to the amino acid sequence of wild-type OMNI-50 (SEQ ID NO: 1) and have at least one amino acid substitution. In some aspects, the amino acid substitution comprises a substitution of an amino acid residue with a positively charged, negatively charged, uncharged, hydrophilic, hydrophobic, polar, or nonpolar amino acid. In some aspects, the amino acid substitution is selected from the substitution of an amino acid with any one of the amino acids selected from the group consisting of R, K, H, D, E, S, T, N, Q, C, U, G, P, A, I, L, M, F, W, Y, and V.

[0107] Positively charged amino acids include amino acids with a positively charged R group (e.g., lysine (K), arginine (R), or histidine (H)). Negatively charged amino acids include amino acids with a negatively charged R group (e.g., aspartic acid (D) or glutamic acid (E)).

[0108] Uncharged or neutral amino acids include amino acids in which the R group is normally uncharged. Polar amino acids include amino acids with a polar R group (e.g., serine (S), threonine (T), tyrosine (Y), asparagine (N), or glutamine (Q)). Nonpolar amino acids include amino acids with a nonpolar R group (e.g., glycine (G), alanine (A), valine (V), cysteine ​​(C), proline (P), leucine (L), isoleucine (I), methionine (M), tryptophan (W), or phenylalanine (F)).

[0109] The most hydrophobic amino acids include leucine, methionine, proline, and valine. The aromatic amino acids include histidine, phenylalanine, tryptophan, and tyrosine. The polar, uncharged amino acids include serine, cysteine, threonine, asparagine, and glutamine.

[0110] The properties of a protein variant with an original amino acid substitution at a given position can be extended to other variants with a different amino acid substitution at the same position if the R group of the other amino acid substitution has similar properties to the original amino acid substitution. For example, if a protein variant in which a lysine (K) residue is replaced with a glutamic acid (E) residue is shown to have high specificity compared to the wild-type protein, it is reasonable to assume that a similar variant in which an arginine (R) residue is replaced with a glutamic acid (E) residue will also exhibit high specificity, since lysine (K) and arginine (R) have similar properties (e.g., both contain positively charged R groups). Conversely, a variant in which a glutamic acid (E) residue is replaced with an aspartic acid (D) residue is unlikely to exhibit high specificity because glutamic acid (E) and aspartic acid (D) have similar properties, including negatively charged R groups.

[0111] In some aspects, variants of OMNI-50 nuclease proteins are provided that comprise a sequence that is at least 80% identical to the amino acid sequence of wild-type OMNI-50 nuclease (SEQ ID NO: 1), and that has at least one amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779 of the sequence of the wild-type OMNI-50 protein. In some aspects, the variants of OMNI-50 nuclease proteins comprise an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339, and S779 of the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1). Each possibility is a separate aspect of this disclosure.

[0112] In some aspects, variants of OMNI-50 nuclease proteins contain at least one amino acid substitution at the following positions in the double-stranded DNA nuclease catalytically active form, nickase or inactivated form of the sequence of the OMNI-50 protein: N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339 and S779. In some aspects, the variant of the OMNI-50 nuclease protein comprises at least one of the following amino acid substitutions at the following positions in the fully active, nickase, or inactivated form of the sequence of the wild-type OMNI-50 protein: N300A, G614R, N698L, E836F, T939L, L1100F, D252Y, D281V, L302N, N368S, S1339R, and S779P.

[0113] In some aspects, the variants of the OMNI-50 nuclease protein comprise at least one amino acid substitution at the following positions in the double-stranded DNA nuclease catalytically active, nickase, or inactivated form of the OMNI-50 protein sequence: N300, G614, N698, S779, E836, T939, L1100, and S1339. In some aspects, the variants of the OMNI-50 nuclease protein comprise at least one of the following amino acid substitutions at the following positions in the fully active, nickase, or inactivated form of the wild-type OMNI-50 protein sequence: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R.

[0114] In some embodiments, the OMNI-50 nuclease variant further comprises one or more of a nuclear localization sequence (NLS), a cell-penetrating peptide sequence, and / or an affinity tag (e.g., a HIS tag, an HA tag). In certain embodiments, the OMNI-50 nuclease variant comprises one or more nuclear localization sequences of sufficient strength to promote the accumulation of a CRISPR complex containing a detectable amount of CRISPR nuclease in the nucleus of a eukaryotic cell. Exemplary sequences of OMNI-50 nuclease variants modified to include additional peptides are set forth in SEQ ID NOS: 61-89. Specifically, these examples provide variants modified to the format NLS-variant-HA-NLS-8xHis. Polynucleotides encoding the amino acids set forth in SEQ ID NOS: 61-89 are set forth in SEQ ID NOS: 90-118, respectively.

[0115] Some embodiments provide isolated variants of OMNI-50 nuclease proteins that include one or more substitutions or mutations relative to the sequence of a wild-type OMNI-50 nuclease, wherein the isolated variants are active in a CRISPR system, wherein the CRISPR system exhibits reduced off-target editing activity and maintains on-target editing activity compared to a wild-type CRISPR system.

[0116] In some embodiments, the OMNI-50 nuclease variants described herein may further be mutated. Examples of mutations include, but are not limited to, altering the PAM recognition sequence, altering the nuclease activity of the enzyme, and truncating or removing portions of the nuclease. In some embodiments, the OMNI-50 nuclease variants may be encoded by a nucleic acid sequence that produces the desired amino acid sequence of the variant. For example, the nucleic acid sequence may be codon-optimized for a cell, such as a bacterial cell, a plant cell, or a mammalian cell.

[0117] In some embodiments of the present invention, a CRISPR nuclease and a target molecule form a CRISPR complex that binds to and cleaves a target DNA sequence. The CRISPR nuclease may form a CRISPR complex comprising the CRISPR nuclease and a single guide RNA (sgRNA) molecule. Alternatively, the CRISPR nuclease may form a CRISPR complex comprising the CRISPR nuclease, a crRNA molecule, and a tracrRNA molecule. In some embodiments, the single guide RNA (sgRNA) molecule comprises an RNA sequence having at least 80%, 85%, 90%, or 95% identity to the sequence set forth in SEQ ID NO: 140 or SEQ ID NO: 141.

[0118] Some aspects of the invention provide gene editing methods with reduced off-target editing activity and / or increased on-target editing activity, comprising contacting a target site locus with an active CRISPR endonuclease system having a variant of the OMNI-50 protein complexed with a suitable guide RNA or guide RNA complex, wherein the active CRISPR endonuclease system has increased editing activity, reduced off-target editing activity, and / or increased allele-specific editing compared to a wild-type OMNI-50 CRISPR system.

[0119] Some embodiments of the present invention provide gene editing methods with reduced off-target editing activity, comprising contacting a DNA target site with an active CRISPR system comprising any one of the OMNI-50 nuclease variant proteins described herein. Some embodiments of the present invention provide gene editing methods with increased editing activity, comprising contacting a DNA target site with an active CRISPR system comprising any one of the OMNI-50 nuclease variant proteins described herein. Some embodiments of the present invention provide gene editing methods with increased allele-specific editing, comprising contacting a DNA target site with an active CRISPR system comprising any one of the OMNI-50 nuclease variant proteins described herein.

[0120] In some embodiments, gene editing occurs within a eukaryotic cell or a prokaryotic cell. In some embodiments, the eukaryotic cell is a plant cell or a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the DNA target site is located within or near a pathogenic allele of a gene.

[0121] In some aspects, the DNA target site is located in a gene selected from the group consisting of ELANE, CXCR4, EMX, RyR2, KNCQ1, KCNH2, SCN5a, GBA1, GBA2, rhodopsin, GUCY2D, IMPDH1, FGA, BEST1, PRPH2, KRT5, KRT14, ApoA1, STAT3, STAT1, ADA2, RPS19, SBDS, GATA2, RPE65, LDLR, ANGPTL3, B2M, TRAC, TCF4, TGFBi, PAX6, C3, LRRK2, SARM1, SAMD9, SAMD9L, HAVCR2, CD3E, APLP2, CISH, TIGIT, TNNT2, TNN, MYH7, and HLA-E.

[0122] Non-limiting examples of sgRNA sequences that can be used to target TRAC include: UUAGAGUCUCUCAGCUGGUACAGUUUGAGAGUUAUGAAAAUGACGAGUUCAAAUAAAAAUUUAUUCAAACCGCCUAUUUAUAGGCCGCAGAUGUUCUGCUUU (SEQ ID NO: 142) Includes:

[0123] In some embodiments, the DNA target is repaired with an exogenous donor molecule.

[0124] In some embodiments, the DNA target site is selected from the group consisting of AAVS1, ABCD1, APOLD1, AQP4, ATP7B, B2M, BCL11A, CCL4, CCR5, CD34, CD52, CD5, CD7, CIITA, CLK3, CLYBL, CTNS, CUL3, DYRK1A, EGFR, EMX1, F8, FANCF, FKTN, GALNS, GRN2B, HAS3, HBB, HPRT1, KRAS, MECP2, MIP, NRL, OMP, OTC, PAH, PDCD1, PDGFRA, PLP1 , PPP2R5D, PTEN, RELN, RUNX1, RYR2, SHANK3, SNCA, TMEM175, TRAC, TRBC1, UBE3A, VEGFA, ZSCAN, FBL, FUS, G3BP1, HIST1H2BJ, LAMP1, MAP1LC3B, NPM1, Rab11A, RAD21, Roji1, Roji2, SEC61B, SMC1A, Sqstm1, TOMM20, TOP2a, TUBa1B.

[0125] In some embodiments, the allele-specific editing activity of the variant is at least 1.25-fold, 1.5-fold, 2-fold, 10 ... 2 double, 10 3 double, 10 4 double, 10 5 double or 10 6 In some embodiments, the off-target editing activity is increased by at least 2-fold, 10-fold, 10-fold, or 2 double, 10 3 double, 10 4 double, 10 5 double or 10 6 In some embodiments, the on-target editing activity is reduced by at least 1.25-fold, 1.5-fold, 2-fold, 10-fold, 10-fold, or 2 double, 10 3 double, 10 4 double, 10 5 double or 10 6 double increase.

[0126] Some aspects of the invention provide polynucleotide molecules encoding any one of the OMNI-50 variant proteins described herein.

[0127] Additional description of OMNI-50 nuclease (SEQ ID NO: 1) is provided in WO 2020 / 223514, WO 2022 / 098693 and WO 2023 / 019263, the contents of which are incorporated herein by reference.

[0128] delivery The OMNI-50 variant compositions described herein may be delivered as proteins, DNA molecules, RNA molecules, ribonucleoproteins (RNPs), nucleic acid vectors, or combinations thereof. In some embodiments, the RNA molecules comprise chemical modifications. Non-limiting examples of suitable chemical modifications include 2'-O-methyl (M), 2'-O-methyl-3'-phosphorothioate (MS) or 2'-O-methyl-3'-thioPACE (MSP), pseudouridine, and 1-methylpseudouridine. Each possibility represents a separate embodiment of this invention.

[0129] The OMNI-50 variants described herein and / or polynucleotides encoding them, and / or other molecules, such as single guide RNA molecules, crRNA molecules, tracrRNA molecules, or nucleotide molecules encoding any one of these, may be delivered to a target cell by any suitable means. The target cell may be any cell (e.g., eukaryotic or prokaryotic) in any environment (e.g., isolated, in culture, in vitro, ex vivo, in vivo, in planta). The target site in the target cell may be within the nucleus of the cell.

[0130] The compositions described herein may be introduced into cells as part of a vector molecule containing additional sequences, such as an origin of replication, a promoter, and a gene encoding antibiotic resistance. Furthermore, the compositions may be introduced into cells as naked nucleic acid or protein, or as nucleic acid or protein complexed with or packaged within an agent, such as a liposome, exosome, or poloxamer, or delivered by a recombinant virus (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)) or virus-like particle. By way of non-limiting example, the compositions may be packaged into an adeno-associated virus (AAV) or a lentivirus, such as a non-integrating lentivirus or a lentivirus lacking reverse transcription. Another non-limiting example includes packaging the compositions into liposomes, extracellular vesicles, or exosomes, which may be pseudotyped with vesicular stomatitis protein (VSVG) or complexed with a cell-penetrating peptide, an antibody, a targeting moiety, or a combination thereof.

[0131] In some aspects, the composition to be delivered comprises a nuclease mRNA and a guide RNA. In some aspects, the composition to be delivered comprises a nuclease mRNA, a guide RNA, and a donor template. In some aspects, the composition to be delivered comprises a CRISPR nuclease and a guide RNA. In some aspects, the composition to be delivered comprises a CRISPR nuclease, a guide RNA, and a donor template for gene editing, e.g., by homology-directed repair. Optionally, the lentivirus comprises the nuclease mRNA and a guide RNA molecule (e.g., a single guide RNA molecule or a crRNA molecule) used to target the nuclease to a target site. In some aspects, the composition to be delivered to a cell comprises a nuclease mRNA, a guide RNA molecule, and a donor template molecule. Optionally, the lentivirus comprises a nuclease protein variant and a guide RNA molecule. Optionally, the composition to be delivered to a cell comprises a nuclease protein variant, a guide RNA molecule, and / or a donor template for homology-directed repair. Optionally, the composition delivered to a cell comprises an mRNA of a nuclease variant, a DNA-targeting crRNA molecule, and a tracrRNA molecule. Optionally, the composition delivered to a cell comprises an mRNA of a nuclease variant, a DNA-targeting crRNA molecule, a tracrRNA molecule, and a donor template molecule. Optionally, the composition delivered to a cell comprises a variant of a nuclease protein, a DNA-targeting crRNA molecule, and a tracrRNA molecule. Optionally, the composition delivered to a cell comprises a variant of a nuclease protein, a DNA-targeting crRNA molecule, a tracrRNA molecule, and a DNA donor template molecule for homologous recombination repair.

[0132] Such compositions can be delivered using an appropriate viral vector system. Conventional viral and non-viral gene transfer methods can be used to introduce the nucleic acid and / or OMNI-50 variant protein into cells (e.g., mammalian cells, plant cells, etc.) and target tissues. Such methods can also be used to provide the encoded nucleic acid and / or OMNI-50 variant protein to cells in vitro. In some embodiments, the nucleic acid and / or OMNI-50 variant protein is administered for in vivo or ex vivo gene therapy. Non-viral vector delivery systems include naked nucleic acid and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. For reviews of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and See Bohm (eds.) (1995) and Yu et al., Gene Therapy 1:13-26 (1994).

[0133] Non-viral methods for delivery of nucleic acids and / or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, virus-like particles, exosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, artificial virions, and drug-enhanced nucleic acid uptake, or delivery to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, Tobacco mosaic virus, Potato virus X, Cauliflower mosaic virus, Cassava vein mosaic virus). See, e.g., Chung et al. Trends Plant Sci. (2006). Sonoporation, for example using the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acids. Cationic lipid-mediated delivery of proteins and / or nucleic acids is also contemplated as an in vivo or in vitro delivery method. See Zuris et al., Nat. Biotechnol. (2015); Coelho et al., N. Engl. J. Med. (2013); Judge et al., Mol. Ther. (2006); and Basha et al., Mol. Ther. (2011).

[0134] Non-viral vectors, such as transposon-based systems (e.g., recombinant Sleeping Beauty transposon systems or recombinant PiggyBac transposon systems), may also be used to deliver and transpose the polynucleotide sequences of or encoding the molecules of the composition into target cells.

[0135] Other representative nucleic acid delivery systems include those offered by Amaxa® Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.), and Copernicus Therapeutics Inc. (see, e.g., U.S. Pat. No. 6,008,336). Lipofectin is described, for example, in U.S. Pat. Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam®, Lipofectin®, and Lipofectamine® RNAiMAX). Cationic and neutral lipids suitable for efficient receptor-recognition lipofection of polynucleotides include those disclosed in WO 91 / 17424 and WO 91 / 16024. Delivery to cells (ex vivo) or target tissues (in vivo) is possible.

[0136] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is widely known to those of skill in the art (e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820). (1992); see U.S. Patent Nos. 4,186,183; 4,217,344; 4,235,871; 4,261,975; 4,485,054; 4,501,728; 4,774,085; 4,837,028; and 4,946,787).

[0137] Another delivery method involves packaging the nucleic acid to be delivered in an EnGeneIC delivery vehicle (EDV). EDVs are specifically delivered to target tissues using bispecific antibodies, where one arm of the antibody has specificity for the target tissue and the other arm has specificity for the EDV. The antibody carries the EDV to the surface of the target cell, where it is then transported into the cell by endocytosis. Once inside the cell, its contents are released (see MacDiamid et al. (2009) Nature Biotechnology 27(7) p. 643).

[0138] The use of RNA or DNA virus-based systems for nucleic acid delivery utilizes highly evolved methods to target viruses to specific cells in the body and transport the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or used to engineer cells in vitro, and the engineered cells are then administered to patients (ex vivo). Traditional viral systems for nucleic acid delivery include, but are not limited to, retroviral, lentiviral, adenoviral, adeno-associated viral, vaccinia virus, and herpes simplex viral vectors for gene transfer. Integration into the host genome is possible using retroviral, lentiviral, and adeno-associated viral gene transfer methods, often leading to long-term expression of the inserted transgene. High transduction efficiencies have also been observed in a variety of cells and target tissues. OMNI-50 variants or nucleic acids expressing variants and related nucleic acids can also be delivered using non-integrating lentiviruses. Where necessary, lentiviral RNA delivery can be utilized. Optionally, the lentivirus comprises a nuclease mRNA and a guide RNA molecule (e.g., a single guide RNA molecule or a crRNA molecule) used to target the nuclease to a target site. Optionally, the lentivirus comprises a nuclease mRNA, a guide RNA molecule, and a donor template molecule. Optionally, the lentivirus comprises a nuclease protein variant and a guide RNA molecule. Optionally, the lentivirus comprises a nuclease protein variant, a guide RNA molecule, and / or a donor template molecule for homologous recombination repair. Optionally, the lentivirus comprises a nuclease variant mRNA, a DNA-targeting crRNA molecule, and a tracrRNA molecule. Optionally, the lentivirus comprises a nuclease variant mRNA, a DNA-targeting crRNA molecule, a tracrRNA molecule, and a donor template molecule. Optionally, the lentivirus comprises a nuclease protein variant, a DNA-targeting crRNA molecule, a tracrRNA molecule, and a donor template molecule. Optionally, the lentivirus comprises a nuclease protein variant, a DNA-targeting crRNA molecule, and a tracrRNA molecule.Optionally, the lentivirus comprises a variant of a nuclease protein, a DNA-targeting crRNA molecule, a tracrRNA molecule, and a DNA donor template molecule for homologous recombination repair.

[0139] As previously described, the compositions described herein can be delivered to target cells using non-integrating lentiviral particle methods (e.g., the LentiFlash® system). Such methods may also be used to deliver mRNA or other RNA to target cells, such that delivery of the RNA to the target cell results in assembly of the compositions described herein inside the target cell. See also WO 2013 / 014537, WO 2014 / 016690, WO 2016 / 185125, WO 2017 / 194902, and WO 2017 / 194903.

[0140] Retroviral tropism can be altered by incorporating foreign envelope proteins, expanding the potential target cell range. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and typically produce high viral titers. The choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats that can package foreign sequences up to 6-10 kb. A minimal set of cis-acting LTRs is sufficient for vector replication and packaging, which is then used to integrate therapeutic genes into target cells and provide permanent transgene expression. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher Panganiban, J. Virol. (1992); Johann et al., J. Virol. (1992); Sommerfelt et al., Virol. (1990); Wilson et al., J. Virol. (1989); Miller et al., J. Virol. (1991); WO 94 / 26877).

[0141] At least six viral vector approaches are currently available for gene transfer in clinical trials, using methods involving complementation of defective vectors by genes inserted into helper cell lines to generate transducing agents.

[0142] pLASN and MFG-S are examples of retroviral vectors used in clinical trials (Dunbar et al., Blood (1995); Kohn et al., Nat. Med. (1995); Malech et al., PNAS (1997)). PA317 / pLASN was the first therapeutic vector used in gene therapy (Blaese et al., Science (1995)). Transduction efficiencies of over 50% have been observed with MFG-S-packaged vectors (Ellem et al., Immunol Immunother. (1997); Dranoff et al., Hum. Gene Ther. (1997)).

[0143] Packaging cells are used to form viral particles capable of infecting host cells. Such cells include 293 cells, which package adenovirus (AAV), and psi.2 or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are typically generated by producer cell lines that package nucleic acid vectors into viral particles. The vector typically contains minimal viral sequences necessary for packaging and subsequent integration into the host (if applicable), with other viral sequences replaced by expression cassettes encoding the proteins to be expressed. Missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically contain only the inverted terminal repeat (ITR) sequences of the AAV genome, which are necessary for packaging and integration into the host genome. The viral DNA is packaged into cell lines containing helper plasmids encoding other AAV genes, namely rep and cap, but lacking the ITR sequences. The cell lines are also infected with adenovirus as a helper. The helper virus facilitates AAV vector replication and expression of AAV genes from the helper plasmid. The helper plasmid lacks ITR sequences and is therefore not packaged in large quantities. Contamination with adenovirus can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV. Furthermore, AAV can be produced on a clinical scale using the baculovirus system (see U.S. Patent No. 7,479,554).

[0144] In many gene therapies, highly specific delivery of gene therapy vectors to specific tissues is desirable. Therefore, viral vectors can be engineered to have specificity for target cells by expressing a ligand as a fusion protein with the viral coat protein on the outer surface of the virus. The ligand is selected to have affinity for a receptor known to be present on the target cells. For example, Han et al., Proc. Natl. Acad. Sci. USA 92:9747-9751 (1995) reported that Moloney murine leukemia virus can be engineered to express human heregulin fused to gp70 and that the recombinant virus infects specific human breast cancer cells expressing the human epidermal growth factor receptor. This principle can be extended to other virus-target cell combinations, where the target cells express a receptor and the virus expresses a fusion protein containing a ligand for the cell surface receptor. For example, filamentous phage can be engineered to display antibody fragments (e.g., Fab, Fv) that have substantial specific binding affinity for a selected cellular receptor. Although this description applies primarily to viral vectors, the same principles can be applied to non-viral vectors. Such vectors can be modified to contain uptake sequences that facilitate uptake by specific target cells.

[0145] Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial injection) or local application, as described below. Alternatively, vectors can be delivered ex vivo to cells, such as transplanted cells from an individual patient (e.g., lymphocytes, bone marrow aspirate, biopsy tissue) or hematopoietic stem cells from a universal donor, which are then re-implanted into the patient, typically after selection of cells that have incorporated the vector.

[0146] Ex vivo cell transfection for diagnostics, research, or gene therapy (eg, by re-infusion of the transfected cells into the host organism) is well known to those of skill in the art.

[0147] In a preferred embodiment, cells are isolated from the subject organism, transfected with an RNA composition, and re-infused into the subject organism (e.g., a patient). Various cells suitable for ex vivo transfection are well known to those of skill in the art (e.g., Freshney et al., Culture of Animal Cells, A Manual of Basic Technique (3 rd ed. 1994) and the references cited therein for a discussion of methods for isolating and culturing cells from patients.

[0148] Suitable cells include, but are not limited to, eukaryotic and prokaryotic cells and / or cell lines. Non-limiting examples of such cells or cell lines generated from such cells include COS, CHO (e.g., CHO-S, CHO-K1, CHO-DG44, CHO-DUXB11, CHO-DUKX, CHOK1SV), VERO, MDCK, WI38, V79, B14AF28-G3, BHK, HaK, NSO, SP2 / 0-Ag14, HeLa, HEK293 (e.g., HEK293-F, HEK293-H, HEK293-T) and perC6 cells, plant cells (differentiated or undifferentiated), and insect cells such as Spodoptera fugitive flora (Sf), or fungal cells such as Saccharomyces, Pichia, and chizosaccharomyces. In one embodiment, the cell line is a CHO-K1, MDCK, or HEK293 cell line. Additionally, primary cells may be isolated, treated with a nuclease system (e.g., CRISPR / Cas), and then used ex vivo for reintroduction into the subject. Suitable primary cells include peripheral blood mononuclear cells (PBMCs) and blood cell subsets, such as, but not limited to, CD4+ T cells or CD8+ T cells. Suitable cells also include stem cells, such as, for example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells (CD34+), neural stem cells, and mesenchymal stem cells.

[0149] In one embodiment, stem cells are used in ex vivo procedures for cell transfection and gene therapy. The advantage of using stem cells is that they can be differentiated into other cells in vitro or introduced into a mammal (such as a cell donor) where they engraft in the bone marrow. Methods are known for differentiating CD34+ cells into clinically important immune cells in vitro using cytokines such as GM-CSF, IFNγ, and TNFα (see, for non-limiting examples, Inaba et al., J. Exp. Med. 176:1693-1702 (1992)).

[0150] Stem cells are isolated for transduction and differentiation using known methods. For example, stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies that bind to unwanted cells such as CD4+ and CD8+ (T cells), CD45+ (pan-B cells), GR-1 (granulocytes), and Iad (differentiated antigen-presenting cells) (see, for a non-limiting example, Inaba et al., J. Exp. Med. 176:1693-1702 (1992)). In some embodiments, modified stem cells can also be used.

[0151] In particular, any one of the OMNI-50 variants described herein may be suitable for genome editing of post-mitotic cells or cells that are not actively dividing (e.g., arrested cells). Examples of post-mitotic cells that may be edited with the OMNI-50 variants of the invention include, but are not limited to, myocytes, cardiomyocytes, hepatocytes, bone cells, and neurons.

[0152] Vectors (e.g., retroviruses, liposomes, etc.) containing therapeutic RNA compositions can also be administered directly to an organism for transduction of cells in vivo. Alternatively, naked RNA or mRNA can be administered. Administration can be by routes commonly used to introduce molecules with ultimate contact with blood or tissue cells, including, but not limited to, injection, infusion, topical application, and electroporation. Suitable methods for administering such nucleic acids are available and known to those of skill in the art, and while multiple routes of administration for a particular composition can be used, certain routes often result in more rapid and effective responses than others.

[0153] Suitable vectors for introducing transgenes into immune cells (e.g., T cells) include non-integrating lentiviral vectors, see, e.g., U.S. Patent Application Publication No. 2009 / 0117617.

[0154] Pharmaceutically acceptable carriers are determined in part by the composition being administered, as well as by the method used to administer the composition. Thus, there is a wide variety of suitable formulations of pharmaceutical compositions available, for example, as described in Remington's Pharmaceutical Sciences, 17th ed., 1989.

[0155] DNA repair by homologous recombination In some embodiments of the invention, OMNI-50 nuclease variants are used to cleave DNA at target sites to trigger cellular repair mechanisms, including, but not limited to, non-homologous end joining (NHEJ) or homology-directed repair (HDR).

[0156] The term "homologous recombination repair" or "HDR" refers to a mechanism that repairs DNA damage in cells, e.g., during repair of double- and single-strand breaks in DNA. HDR requires nucleotide sequence homology and uses a "nucleic acid template" (the terms nucleic acid template and donor template are used interchangeably herein) to repair the sequence (e.g., DNA target sequence) where the double- or single-strand break occurred. This results in, for example, the transfer of genetic information from the nucleic acid template to the DNA target sequence. If the nucleic acid template sequence differs from the DNA target sequence and some or all of the nucleic acid template polynucleotide or oligonucleotide is incorporated into the DNA target sequence, HDR can result in an alteration (e.g., addition, deletion, mutation) of the DNA target sequence. In some embodiments, all or part of the nucleic acid template polynucleotide, or a copy of the nucleic acid template, is incorporated at the site of the DNA target sequence.

[0157] The terms "nucleic acid template" and "donor" refer to a nucleotide sequence to be inserted or copied into a genome. A nucleic acid template comprises, e.g., one or more nucleotide sequences that may be added to a target nucleic acid, template a change in the target nucleic acid, or be used to modify the target sequence. The nucleic acid template sequence may be any length, e.g., 2 to 10,000 nucleotides (or any integer therebetween), preferably about 100 to 1,000 nucleotides (or any integer therebetween), and more preferably about 200 to 500 nucleotides. A nucleic acid template may be a single-stranded nucleic acid or a double-stranded nucleic acid. In some embodiments, a nucleic acid template comprises, e.g., one or more nucleotide sequences corresponding to the wild-type sequence of a target nucleic acid, e.g., at a target location. In some embodiments, a nucleic acid template comprises, e.g., one or more ribonucleotide sequences corresponding to the wild-type sequence of a target nucleic acid, e.g., at a target location. In some embodiments, a nucleic acid template comprises modified ribonucleotides.

[0158] Insertion of an exogenous sequence (also referred to as a "donor sequence," "donor template," or "donor") can also be performed, for example, to correct a mutant gene or increase expression of a wild-type gene. It is readily apparent that the donor sequence is usually not identical to the genomic sequence into which it is placed. The donor sequence can comprise a non-homologous sequence flanked by two homologous regions to enable efficient HDR at the target location. Furthermore, the donor sequence can comprise a vector molecule comprising a sequence that is not homologous to the target region in cellular chromatin. The donor molecule can comprise discontinuous regions homologous to cellular chromatin. For example, to target insertion of a sequence not normally present in the target region, the sequence can be present in the donor nucleic acid molecule and can be flanked by regions homologous to the sequence of the target region.

[0159] The donor polynucleotide may be single-stranded and / or double-stranded DNA or RNA and may be introduced into cells in a linear or circular form. See, for example, U.S. Patent Application Publication Nos. 2010 / 0047805; 2011 / 0281361; 2011 / 0207221; and 2019 / 0330620. When introduced in a linear form, the ends of the donor sequence can be protected (e.g., from exonuclease degradation) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues can be added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides can be ligated to one or both ends. See, for example, Chang and Wilson, Proc. Natl. Acad. Sci. USA (1987); Nehls et al., Science (1996). Other methods of protecting exogenous polynucleotides from degradation include, but are not limited to, the addition of terminal amino groups and the use of modified internucleotide linkages (e.g., phosphorothioates, phosphoramidates, and O-methylribose or deoxyribose residues).

[0160] Thus, embodiments of the invention that use a donor template for repair may use single-stranded and / or double-stranded donor templates, such as DNA or RNA, that can be introduced into cells in linear or circular form. In some embodiments of the invention, the gene-editing composition contains (1) an RNA molecule comprising a guide sequence that makes a double-stranded break in the gene prior to repair, and (2) a donor RNA template for repair, where the RNA molecule comprising the guide sequence is a first RNA molecule and the donor RNA template is a second RNA molecule. In some embodiments, the guide RNA molecule and the template RNA molecule are linked as part of a single molecule.

[0161] The donor sequence may be an oligonucleotide and may be used for gene correction or targeted modification of an endogenous sequence. The oligonucleotide may be introduced into a cell via a vector, electroporated into a cell, or by other methods known in the art. The oligonucleotide may be used to "correct" a mutant sequence in an endogenous gene (e.g., the sickle mutation of beta-globin) or may be used to insert a sequence for a desired purpose into an endogenous gene locus.

[0162] Polynucleotides can be introduced into cells as part of vector molecules that contain additional sequences, such as an origin of replication, a promoter, and genes encoding antibiotic resistance. Furthermore, donor polynucleotides can be introduced as naked nucleic acid, or as nucleic acid complexed with or packaged within agents such as liposomes, exosomes, or poloxamers, or delivered by recombinant viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus, and integrase-deficient lentivirus (IDLV)) or virus-like particles. Non-viral vectors, such as transposon-based systems (e.g., recombinant Sleeping Beauty transposon system, recombinant PiggyBac transposon system), can also be used to transpose polynucleotide sequences in target cells.

[0163] The donor is generally inserted such that its expression is driven by the endogenous promoter of the integration site, i.e., the promoter that drives expression of the endogenous gene into which the donor is inserted. However, it will be apparent that the donor may also comprise a promoter and / or enhancer, e.g., a constitutive promoter or an inducible or tissue-specific promoter.

[0164] The donor molecule may be inserted into an endogenous gene such that all, a portion, or none of the endogenous gene is expressed. For example, a transgene described herein may be inserted into an endogenous locus such that a portion of the endogenous sequence (e.g., the N-terminus and / or C-terminus of the transgene) is expressed, e.g., as a fusion with the transgene, or none of the endogenous sequence is expressed. In other embodiments, a transgene (e.g., with or without additional coding sequence, e.g., an endogenous gene) is integrated into an endogenous locus, such as a safe harbor locus (e.g., the CCR5 gene, the CXCR4 gene, the PPP1R12c (also known as AAVS1) gene, the albumin gene, or the Rosa gene). See, e.g., U.S. Patent Nos. 7,951,925 and 8,110,379; U.S. Patent Application Publication Nos. 2008 / 0159996; 20100 / 0218264; 2010 / 0291048; 2012 / 0017290; 2011 / 0265198; 2013 / 0137104; 2013 / 0122591; 2013 / 0177983 and 2013 / 0177960, and U.S. Provisional Application No. 61 / 823,689).

[0165] When an endogenous sequence (endogenous or a portion of a transgene) is expressed in conjunction with a transgene, the endogenous sequence can be a full-length sequence (wild-type or variant) or a partial sequence. Preferably, the endogenous sequence is functional. Non-limiting examples of functions of these full-length or partial sequences include increasing the half-life of a polypeptide expressed by the transgene (e.g., a therapeutic gene) and / or acting as a carrier.

[0166] Additionally, although not essential for expression, the exogenous sequence may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides, and / or polyadenylation signals.

[0167] In some embodiments, the donor molecule comprises a sequence selected from the group consisting of a gene encoding a protein (e.g., a coding sequence encoding a protein that is missing in the cell or individual, or an alternative version of a gene encoding a protein), a regulatory sequence, and / or a sequence encoding a structural nucleic acid such as a microRNA or siRNA.

[0168] DNA-targeting RNA molecules In some embodiments of the present invention, the DNA-targeting RNA sequence includes a guide sequence portion. The "guide sequence portion" of an RNA molecule refers to a nucleotide sequence capable of hybridizing to a specific target DNA sequence. For example, the guide sequence portion has a nucleotide sequence that is partially or completely complementary to the targeted DNA sequence along the guide sequence portion. In some embodiments, the length of the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, or approximately 17-30, 17-29, 17-28, 17-27, 17-26, 27-25, 17-24, 18-22, 19-22, 18-20, 17-20, or 21-22 nucleotides. The entire length of the guide sequence portion is completely complementary to the targeted DNA sequence. Guide sequence portion can be a part of the RNA molecule that can form a complex with CRISPR nuclease, and guide sequence portion serves as the DNA targeting portion of CRISPR complex.When the RNA molecule with guide sequence portion exists together with CRISPR molecule, the RNA molecule can direct CRISPR nuclease to specific target DNA sequence.Each possibility is a separate embodiment.RNA molecule can be specifically designed to target desired sequence.

[0169] According to some aspects of the invention, the disclosed methods include methods for modifying the nucleotide sequence of a target site in the genome of a cell-free system or a cell, comprising introducing into the cell a composition of the embodiments described herein.

[0170] In some aspects, the cell is a eukaryotic cell, preferably a mammalian cell or a plant cell. In some aspects, the modification of the genome occurs within the nucleus of the cell.

[0171] According to some aspects of the invention, the disclosed methods also provide for the use of the compositions described herein in treating a subject suffering from a disease associated with a genomic mutation, comprising modifying a nucleotide sequence at a target site in the subject's genome.

[0172] According to some aspects of the invention, the disclosed methods include methods of treating a subject having a mutational disorder, comprising targeting a composition described herein to an allele associated with the mutational disorder.

[0173] In some aspects, the mutational disorder is associated with a disease or disorder selected from neoplasia, age-related macular degeneration, schizophrenia, neurological disorders, neurodegenerative diseases, movement disorders, fragile X syndrome, secretase-related disorders, prion-related disorders, ALS, addiction, autism, Alzheimer's disease, neutropenia, inflammation-related disorders, Parkinson's disease, blood and coagulation diseases and disorders, beta thalassemia, sickle cell anemia, cellular dysregulation, tumor-related diseases and disorders, inflammation and immune-related diseases and disorders, metabolic, liver, hypercholesterolemia, kidney and protein diseases and disorders, muscular and skeletal diseases and disorders, skin diseases and disorders, neurological diseases and disorders, pulmonary diseases and disorders, corneal diseases and disorders, retinal diseases and disorders, and ophthalmic diseases and disorders.

[0174] Diseases and Treatments Certain embodiments of the invention target nucleases to specific genetic loci associated with a disease or disorder as a form of gene editing, treatment, or therapy. For example, the novel nucleases disclosed herein may be specifically targeted to pathogenic mutant alleles of a gene using specially designed guide RNA molecules to induce gene editing or knockout. Preferably, guide RNA molecules are designed by first considering the PAM requirements of the nuclease, which will depend on the system in which gene editing will be performed, as described herein. For example, guide RNA molecules designed to target an OMNI-50 nuclease to a target site are designed to include a spacer sequence complementary to the DNA strand of the DNA double-stranded region adjacent to the OMNI-50 PAM sequence (e.g., "NGG"). The guide RNA molecule is preferably further designed to include a spacer region (i.e., the region of the guide RNA molecule complementary to the target allele) of sufficient, and preferably optimal, length to increase the specific activity of the nuclease and reduce off-target effects.

[0175] As a non-limiting example, a guide RNA molecule may be designed to target a nuclease to a specific region of a mutant allele, such as near the start codon, such that upon DNA damage by the nuclease, the non-homologous end joining (NHEJ) pathway is induced, resulting in the silencing of the mutant allele by introducing a frameshift mutation. This approach to designing a guide RNA molecule is particularly useful for altering the effect of a dominant-negative mutation, thereby treating a subject. As another non-limiting example, a guide RNA molecule may be designed to target a specific pathogenic mutation of a mutated allele, such that upon DNA damage by the nuclease, the homology-directed repair (HDR) pathway is induced, resulting in template-mediated correction of the mutant allele. This approach to designing a guide RNA molecule is particularly useful for altering the haploinsufficient effect of a mutant allele, thereby treating a subject.

[0176] Non-limiting examples of genes that may be targeted for modification to treat a disease or disorder are provided below. Disease-related genes and mutations that cause mutational disorders have been described in the literature. Such mutations allow for the design of DNA-targeting RNA molecules that direct CRISPR compositions to alleles of disease-related genes, where the CRISPR compositions cause DNA damage and induce DNA repair pathways to modify the alleles, thereby treating the mutational disorder.

[0177] Mutations in ELANE gene are associated with neutropenia.Therefore, without being limited thereto, the embodiments of the invention that target ELANE can be used in the method for treating subjects suffering from neutropenia.Guide RNA molecules that target ELANE gene and are useful for treating neutropenia are disclosed in PCT International Patent Application PCT / US2020 / 059186, which is incorporated herein by reference.

[0178] CXCR4 is a co-receptor in human immunodeficiency virus type 1 (HIV-1) infection. Accordingly, without limitation, embodiments of the invention that target CXCR4 may be used in methods of treating a subject with HIV-1 or conferring resistance to HIV-1 infection in a subject.

[0179] Disruption of programmed cell death protein 1 (PD-1) promotes CAR-T cell killing of tumor cells, making PD-1 a potential target for cancer therapy. Accordingly, without limitation, embodiments of the invention that target PD-1 may be used in methods of treating subjects with cancer. In one embodiment, the treatment is CAR-T cell therapy with T cells engineered according to the invention to be PD-1 deficient.

[0180] Furthermore, BCL11A is a gene involved in the suppression of hemoglobin production. Inhibiting BCL11A increases globin production and may treat diseases such as thalassemia and sickle cell anemia. See, for example, International Publication No. 2017 / 077394, U.S. Patent Application Publication No. 2011 / 0182867; Humbert et al. Sci. Transl. Med. (2019), and Canver et al. Nature (2015). Thus, without limitation, embodiments of the invention targeting the BCL11A enhancer may be used in methods for treating subjects with β-thalassemia or sickle cell anemia.

[0181] Aspects of this invention that target disease-associated genes may be used to study, modify, or treat the diseases or disorders listed below in Table A or Table B. Indeed, any disease associated with a genetic locus may be studied, modified, or treated using the nucleases disclosed herein to target the appropriate disease-associated gene (e.g., those listed in U.S. Patent Application Publication No. 2018 / 0282762 and EP 3079726 B1).

[0182] [Table A]

[0183] [Table B-1]

[0184] [Table B-2]

[0185] [Table B-3]

[0186] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described in the specification can be used in the practice or testing of embodiments of the invention, representative methods and / or materials are described below. In case of conflict, the specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0187] Unless otherwise stated in the discussion section, adjectives such as "substantially" and "about" modifying a state or characteristic of a feature of an embodiment of the invention are understood to mean that the state or characteristic is defined within a range acceptable for operation of the embodiment in its intended use. Unless otherwise indicated, the term "or" in the specification and claims is considered an inclusive "or" rather than an exclusive "or," indicating at least one or any combination of the associated items.

[0188] The term "a" or "an" in the specification should be understood to refer to "one or more" of the listed components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless otherwise specified. Thus, the terms "a" and "at least one" have the same meaning in this application.

[0189] To better understand the present teachings and in no way limit the scope of the teachings, unless otherwise specified, all numbers indicating quantities, percentages, or ratios, and other numerical values ​​used in the specification and claims should be understood to be modified in all instances by the term "about." Thus, unless indicated to the contrary, the numerical values ​​set forth in the specification and claims are approximations that may vary depending on the desired properties sought to be obtained. At the very least, each numerical value should be construed in light of the number of significant digits and by applying ordinary rounding techniques.

[0190] In this specification and claims, the verbs "contain," "include," and "have," and each of their conjugations, are used to indicate that the object of the verb is not necessarily an exhaustive list of components, elements, or parts of the subject of the verb. Other terms used in this specification have meanings commonly known in the art.

[0191] As used herein, the term "targeting sequence" or "targeting molecule" refers to a nucleotide sequence capable of hybridizing with a specific target sequence or a molecule comprising such a nucleotide sequence; for example, a targeting sequence has a nucleotide sequence that is at least partially complementary to the targeted sequence. The targeting sequence or targeting molecule may be a portion of an RNA molecule capable of forming a complex with a CRISPR nuclease, where the targeting sequence serves as the targeting portion of the CRISPR complex. When a molecule having a targeting sequence is present simultaneously with a CRISPR molecule, the RNA molecule can direct the CRISPR nuclease to a specific target sequence. Each possibility is a separate embodiment. The RNA molecule can be specifically designed to target a desired sequence.

[0192] In this specification, the term "targeting" or "directing to the target" refers to the preferential hybridization of a targeting molecule or targeting sequence to a nucleic acid having a target nucleotide sequence. The term "targeting" or "directing to the target" encompasses variable hybridization efficiency, and thus, although the nucleic acid having the target nucleotide sequence is preferentially targeted, it is understood that in addition to on-target hybridization, unintended off-target hybridization may also occur. When an RNA molecule targets a sequence, it is understood that the complex of the RNA molecule and the CRISPR nuclease molecule targets that sequence for nuclease activity.

[0193] As used herein, the term "wild-type" is a term of art understood by those skilled in the art and refers to the typical form of a naturally occurring organism, strain, gene, or trait, as distinguished from a variant or mutant. Thus, as used herein, when an amino acid sequence or nucleotide sequence refers to a wild-type sequence, a variant refers to a variant of that sequence, including, for example, a substitution, deletion, or addition. In embodiments of the invention, the modified CRISPR nuclease is a variant of a CRISPR nuclease that includes at least one amino acid modification (e.g., a substitution, deletion, and / or addition) (also referred to as a "mutation") relative to the wild-type OMNI-50 nuclease set forth in SEQ ID NO:1.

[0194] The terms "non-natural," "non-naturally occurring," or "modified" are used interchangeably and refer to human modification. When used with reference to a nucleic acid molecule or polypeptide, the term may mean that the nucleic acid molecule or polypeptide is at least substantially free from at least one component with which it is naturally associated and found in nature.

[0195] The terms "mutant" or "variant" have the same meaning and refer to a non-naturally occurring or altered molecule.

[0196] As used herein, the term "amino acid" includes natural and / or unnatural or synthetic amino acids, including glycine, their D or L, optical isomers, and amino acid analogs and peptidomimetics.

[0197] As used herein, "genomic DNA" refers to linear and / or chromosomal DNA and / or plasmid or other extrachromosomal DNA sequences present in a cell or cells of interest. In some embodiments, the cells of interest are eukaryotic cells. In some embodiments, the cells of interest are prokaryotic cells. In some embodiments, the method generates a double-strand break (DSB) at a predetermined target site in the genomic DNA sequence, resulting in a mutation, addition, and / or deletion of the DNA sequence at the target site in the genome.

[0198] "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells.

[0199] As used herein, the term "modified cell" refers to a cell in which a double-stranded break has been created by a complex of an RNA molecule and a CRISPR nuclease variant as a result of hybridization with a target sequence, i.e., on-target hybridization. The term "modified cell" may also include cells in which a mutation has been repaired or corrected following a variant-induced double-stranded break. Modified cells may be any cell (e.g., eukaryotic, prokaryotic) in any environment (e.g., after isolation, in culture, in vitro, ex vivo, in vivo, in planta).

[0200] The present invention provides modified cells or cells obtained using the variants or methods described herein. In certain embodiments, these modified cells or cells are capable of giving rise to progeny cells. In certain embodiments, these modified cells are capable of giving rise to progeny cells after transplantation. By way of non-limiting example, the modified cells may be hematopoietic stem cells (HSCs) or cells suitable for allogeneic or autologous cell transplantation. The variants and methods described herein may also be used to generate chimeric antigen receptor T (CAR-T) cells.

[0201] The invention also provides compositions containing these modified cells and a pharmaceutically acceptable carrier, as well as in vitro or ex vivo methods for preparing the same, which involve combining the cells with a pharmaceutically acceptable carrier.

[0202] As used herein, the term "nuclease" refers to an enzyme capable of cleaving phosphodiester bonds between nucleotide subunits of nucleic acids. Nucleases may be isolated or derived from natural sources. The natural source may be any organism. Alternatively, nucleases may be modified or synthetic proteins with phosphodiester bond cleavage activity.

[0203] As used herein, the term "protospacer adjacent motif" or "PAM" refers to a nucleotide sequence in a target DNA that is located adjacent to the target DNA sequence and recognized by a CRISPR nuclease. The PAM sequence may vary depending on the nuclease. For example, wild-type Streptococcus pyogenes Cas9 recognizes the "NGG" PAM sequence. Those skilled in the art will appreciate that a single guide RNA molecule or crRNA:tracrRNA complex can be complexed with a CRISPR nuclease to bind to a target genomic DNA sequence of interest adjacent to the protospacer adjacent motif (PAM). The nuclease then cleaves the target DNA, creating a double-stranded break within the protospacer.

[0204] As used herein, the "sequence identity" of a sequence or molecule is X% with respect to a second sequence or molecule if X% of the bases or amino acids between the sequences of the molecules are the same and in the same relative positions. For example, a first nucleotide sequence that has at least 95% sequence identity with a second nucleotide sequence has at least 95% base identity with the other sequence in the same relative positions.

[0205] The terms "nuclear localization sequence" and "NLS" are used interchangeably to refer to an amino acid sequence / peptide that directs the transport of a bound protein from the cytoplasm across the nuclear membrane barrier. The term "NLS" is intended to encompass not only specific peptides that can direct the translocation of cytoplasmic polypeptides across the nuclear membrane barrier, but also their derivative nuclear localization sequences. An NLS can direct the nuclear translocation of a polypeptide by attaching it to the N-terminus, C-terminus, or both of the polypeptide. Furthermore, polypeptides with NLSs linked to the N- or C-terminus of an amino acid side chain randomly positioned in the amino acid sequence translocate. NLSs typically consist of one or more short sequences of positively charged lysines or arginines exposed on the protein surface, although other types of NLSs are known. Non-limiting examples of NLSs include NLS sequences derived from SV40 virus large T antigen, nucleoplasmin, c-myc, hRNPA1 M9 NLS, the IBB domain from importin alpha, fibroid T protein, human p53, mouse c-abl IV, influenza virus NS1, hepatitis virus delta antigen, mouse Mx1 protein, human poly(ADP-ribose) polymerase, and steroid hormone receptor (human) glucocorticoid.

[0206] The term "CRISPR system" refers to a CRISPR endonuclease system that includes a CRISPR nuclease protein, such as a mutant or variant described herein, and an appropriate guide RNA molecule or guide RNA complex (e.g., a single guide RNA, a crRNA:tracrRNA complex) to target the CRISPR nuclease protein to a desired target DNA sequence based on complementarity between the guide RNA molecule or a portion of the guide RNA complex and the target DNA sequence. The term "wild-type CRISPR endonuclease system" refers to a CRISPR endonuclease system that includes a wild-type CRISPR protein and an appropriate guide RNA molecule or guide RNA complex (e.g., a single guide RNA, a crRNA:tracrRNA complex) to target the wild-type CRISPR nuclease protein to a desired target DNA sequence based on complementarity between the guide RNA molecule or a portion of the guide RNA complex and the target DNA sequence.

[0207] In this invention, "maintained on-target editing activity" refers to the ability of an OMNI-50 variant to target a DNA target site targeted by a guide RNA molecule bound to the OMNI-50 variant, thereby programming the OMNI-50 variant. In some embodiments, the OMNI-50 variant maintains on-target editing activity on the DNA target at or above the editing rate of wild-type OMNI-50 nuclease on the DNA target. In some embodiments, the OMNI-50 variant maintains on-target editing activity on the DNA target at at least 100%, 95%, 90%, 80%, 70%, 60%, 50%, 40%, or 30% of the editing rate of wild-type OMNI-50 nuclease on the DNA target.

[0208] It is intended that the embodiments described above are applicable to one another, for example, it is understood that an RNA molecule or composition of the invention may be utilized in a method of the invention.

[0209] All headings in this specification are for organizational purposes only and are not intended to limit the disclosure in any way. The content of each section is equally applicable to all sections.

[0210] Additional objects, advantages, and novel features of the present invention will become apparent to those skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the invention as described hereinabove and as claimed below finds experimental support in the following examples.

[0211] It will be understood that features of the invention that are, for clarity, described in separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention that are, for brevity, described in a single embodiment, may also be provided separately, in any suitable subcombination, or in other embodiments of the invention, as appropriate. Certain features described in various embodiments should not be considered essential features of those embodiments, unless the embodiment cannot function without those elements.

[0212] Generally, the nomenclature used herein and the laboratory procedures utilized in this invention include molecular, biochemical, microbiological, and recombinant DNA techniques. Such techniques are fully described in the literature. See, e.g., Sambrook et al., "Molecular Cloning: A Laboratory Manual" (1989); Ausubel, R.M. (Ed.), "Current Protocols in Molecular Biology" Volumes I-III (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley & Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (Eds.), "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York. (1998); methods disclosed in U.S. Patent Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cellis, JE (Ed.), "Cell Biology: A Laboratory Handbook", Volumes I-III (1994); Freshney, "Culture of Animal Cells - A Manual of Basic Technique" Third Edition, Wiley-Liss, NY (1994); Coligan JE (Ed.), "Current Protocols in Immunology" Volumes I-III (1994); Stites et al. (Eds.), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (Eds.), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); Clokie and Kropinski (Eds.), "Bacteriophage Methods and Protocols", Volume 1: Isolation, Characterization, and Interactions (2009), all of which are incorporated by reference. Other general references are provided throughout this specification.

[0213] In order to facilitate a more complete understanding of the present invention, the following examples are provided. The following examples illustrate representative modes of making and practicing the invention. However, the scope of this invention is not limited to the specific embodiments disclosed in these examples, which are for illustrative purposes only. [Example]

[0214] Example 1 General Method To select for variants of OMNI-50 nuclease with improved functions such as activity, fidelity, and discrimination, amino acid substitutions are introduced into the open reading frame of the wild-type OMNI-50 sequence (SEQ ID NO: 1).

[0215] To assess the functionality of OMNI-50 variants, we will compare the activity of OMNI-50 nuclease variants with that of wild-type OMNI-50 nuclease. Furthermore, we will use guides designed to identify SNP locations to test the activity and allele-specific editing of OMNI-50 nuclease variants.

[0216] Example 2 Variants of OMNI-50 CRISPR Nuclease OMNI-50 CRISPR nuclease variant library The wild-type OMNI-50 CRIPSR nuclease open reading frame was codon-optimized for expression in human cell lines and cloned into a dual expression plasmid (pShuttle) that allows bacterial and mammalian expression using the T7 or CMV promoters, respectively. Using oligos incorporating NNK degenerate codons at each position in the OMNI-50 sequence, a complete gene library containing combinatorial random mutations along the entire length of the OMNI-50 open reading frame (ORF) was constructed.

[0217] Bacteria-based positive selection systems To isolate OMNI-50 variants with enhanced activity, we designed a positive selection bacterial system. In this system, a positive selection plasmid was electroporated into E. coli strain BW25141 (lDE3) to create a positive selection bacterial strain. The positive selection plasmid contains a T7-expressed single guide RNA (sgRNA) and an embedded on-target site. The sequence of the target site upstream of the human ELANE gene and the spacer and scaffold sequences of the guide RNA molecule are shown in Table 5.

[0218] The positive selection plasmid also contains a chloramphenicol resistance cassette and expresses the E. coli toxin gene CcdB under the control of the araBAD promoter. Thus, when the OMNI-50 library pool containing OMNI-50 variants is electroporated into a positive selection bacterial strain, only bacterial colonies expressing active OMNI-50 variants that cleave the positive selection plasmid and neutralize the toxin can survive on selective plates containing arabinose.

[0219] After a 10-minute recovery period in TB medium following electroporation, the transformed bacteria were plated onto selective TB plates containing carbenicillin and 15 mM arabinose and incubated overnight at 37°C. The following morning, the surviving pool was harvested, the plasmids isolated, and retransformed into the positively selected bacterial strain for the next round of selection. The first generation of mutagenesis involved three rounds of positive selection, and the second generation involved six more rounds of positive selection. After the final round of selection, single bacterial colonies were randomly picked and fully sequenced. Unique variants were cloned into the pET9 vector for production of proteins for RNPs.

[0220] High-grade protein expression and purification Wild-type OMNI-50 and its variants were grown in autoinduction TB medium at 37°C and 250 rpm until an OD600 of 1 was reached, then cultured at 20°C for 17–20 h. Cells were harvested by centrifugation at 6000 × g for 20 min and stored at -80°C. Cells were lysed by chemical lysis followed by centrifugation. The cleared lysate was purified with Ni-NTA resin. The Ni-NTA elution fraction was purified with CEX resin (SO3 Fractogel) and then SEC-purified on an AKTA Pure® (GE Healthcare Life Sciences) with a Superdex® 200 Increase 10 / 300 GL column. Fractions containing OMNI-50 variants were pooled, concentrated to 20 mg / ml, 0.22 μm filtered, flash-frozen in liquid nitrogen, and stored at -80°C.

[0221] Expression and purification of HTP proteins Wild-type OMNI-50 and its variants were cultured in autoinduction TB medium at 37°C and 350 rpm for 3.5 hours, then cultured at 18°C ​​for 17–20 hours. Cells were harvested by centrifugation at 4000 × g and stored at -80°C. OMNI-50 variant and wild-type cell pellets were thawed and incubated in lysis buffer for 30 minutes. Crude lysates were clarified by centrifugation at 4000 × g for 1 hour at 4°C. The clarified protein lysates were incubated with Sepharose 6 Ni-NTA resin (Cytiva). The bound Ni-NTA resin was placed in a 96-well filter plate and washed with buffer (20 mM HEPES, 0.6 M NaCl, 60 mM imidazole) to remove contaminants. The protein was eluted from the resin with a high-imidazole buffer (HEPES 20 mM, NaCl 0.6 M, imidazole 0.4 M). The eluted protein was desalted using a 96-well filter plate containing 1800 μL of G-25 Sephadex resin equilibrated with storage buffer. The desalted protein was then concentrated (Amicon-ultra 0.5 ml 50 kDa, Millipore) and sterile filtered (Ultrafree-MC 0.22 μm PVDF filters). The purified variants were stored at -80°C and analyzed for concentration, purity, and in vitro activity before transfection into cells.

[0222] Screening and cleavage analysis in mammalian cells The RNP mixture was prepared by mixing 105 pmol of nuclease with 124 pmol of the sgRNA listed in Table 5 for 10 minutes at room temperature. HSCs homozygous or heterozygous for the ELANE_g58 target site or SH-SY5Y cells homozygous for hSARM1_g92 were centrifuged at 300 g for 5 minutes at room temperature and washed with PBS. The pellet was resuspended in an appropriate volume of Lonza Nucleofection electroporation solution and transferred to the RNP mixture. Electroporation was performed using a 4D-Nucleofector device (Lonza Bioscience) (triplicates or duplicates). Immediately after electroporation, prewarmed medium was added to the cuvette. The cells were incubated for 3 days (37°C, 5% CO2). After 72 hours, the cells were harvested, and their genomic DNA content was used as a template in PCR reactions to amplify the cleavage target and off-targets (if known). Next-generation sequencing (NGS) of the amplicons was performed, and the resulting sequences were used to calculate the editing rate at each target site. Short insertions or deletions (indels) around the cut site are a typical outcome of DNA repair after nuclease-induced DNA breaks, so the editing rate was calculated by estimating the proportion of sequences containing indels within each amplicon.

[0223] Determination of protein residual activity To determine thermal stability, the protein was diluted to 100 nM and incubated at 25°C and 44°C for 10 minutes. After incubation, 150 nM of gRNA was added and incubated at 25°C for 10 minutes. Next, 100 nM of DNA was added to the RNP, and cleavage activity was measured. The residual activity was calculated by dividing the activity at 44°C by the activity at 25°C.

[0224] result Increased activity and fidelity of two OMNI-50 variants at selected test target sites The two major variants isolated from the bacterial selection, OMNI-50 V6552 and V6172 (Table 2), had significantly increased activity compared to wild-type OMNI-50 nuclease.

[0225] In ELANE_g58Ref homozygous HSCs, both variants showed significantly increased activity against the human target site used in the selection system compared to wild-type RNPs (Figures 1A and 1B). In addition to high activity, these variants also showed increased fidelity, as evidenced by reduced off-target editing of the g58Ref target (Figures 1C and 1D).

[0226] OMNI-50 variants show broadly increased activity at various sites The two major variants also showed significantly increased activity compared to wild-type RNP at other sites in mammalian cell assays (Figures 2A-2C, Table 5). In assays with Jurkat cells, V6552 showed higher activity than wild-type OMNI-50 against the SARM_g13, SARM_g68, and RPE_g13 target sites. V6552 also showed higher activity against ELANE_g38Ref than wild-type OMNI-50 in assays with HSC lines (Figure 2B). Furthermore, V6172 showed increased activity against ELANE_g38Ref in assays with Jurkat cells (Figure 2C).

[0227] OMNI-50 variants show increased specificity Because the undesired and targeted DNA sites may differ by as little as a single nucleotide, discrimination between two heterozygous alleles requires high nuclease specificity rather than fidelity. When tested on HSCs heterozygous for the selected ELANE SNP g58Ref, the discrimination profiles of both variants increased relative to wild-type OMNI-50, as indicated by a higher proportion of unedited Alt alleles compared to the targeted Ref allele (Figures 3A and 3C). However, when treated with Alt guide RNA, only V6172 showed complete discrimination, indicating the higher specificity of the two variants. Nevertheless, the fidelity of both variants remained higher than wild-type, as indicated by fewer off-target edits (Figures 3B and 3E).

[0228] We further tested the ability of the V6172 and V6552 variants to discriminate between alleles on another ELANE SNP (target 62, Table 5). As shown in Figures 4A-4D, when cells were treated with g62Ref, wild-type OMNI-50 protein primarily cleaved the Ref allele, with only 10% nonspecific editing of the Alt allele. However, V6552 specifically edited the Ref target allele without nonspecific editing of the Alt allele (Figure 4A). V6172 also demonstrated a highly discriminatory profile, almost completely cleaving the targeted Ref allele without contacting the Alt allele (Figure 4C). This specificity is also evident by the reduced off-target activity of this variant for g62Ref, but not for V6552. In this case, this indicates that specificity may be sequence-dependent (Figure 4D). V6172 also exhibited activity at g35, with reduced off-target activity compared to wild-type OMNI-50 (0.03% and 0.49%, respectively—Figures 5A-5B).

[0229] [Table 2]

[0230] [Table 3]

[0231] [Table 4]

[0232] Contribution of each mutation to the nuclease activity and specificity of variant 6552 V6552 of OMNI-50 contains six mutations: D252Y, D281V, L302N, N686S, L1100F, and S1339R (Table 2). To gain a deeper understanding of the impact and contribution of each mutation to OMNI-50 V6552 activity, we expressed and purified all single V6552 variants (i.e., each variant contained one of the six mutations) in HTP and tested their activity and fidelity as RNPs against the ELANE_g58Ref target site and off-target sites of this guide sequence in homozygous HSCs (Table 3, Figures 6A-6B). The L1100F and S1339R mutations are the mutations that contribute most to increased activity, as shown by the variants with these single mutations (V7101 for the S1339R mutation and V7896 for the L1100F mutation). The combination of these two mutations (V7492) further increases activity compared to either mutation alone. L1100F also increases off-target activity (V7896, Figure 6B), while S1339R reduces the level of editing of the g58Ref off-target compared to wild-type (V7101, Figure 6B), indicating that this mutation may contribute to the increased specificity of V6552.

[0233] Four other single mutations reduced activity compared to the wild type (V7274, V7275, V7276, and V7277—Figure 6A ), but did not affect the activity of the full variant V6552, suggesting a possible contribution to specificity.

[0234] We also tested the effect of reverting each single mutation to a wild-type substitution relative to V6552 on activity and fidelity. All variants were expressed and purified in HTPs and tested for activity and fidelity as RNPs against the ELANE_g58Ref target site and off-target sites of this guide sequence in homozygous HSCs (Table 3, Figures 7A-7B). Removal of L1100F (V7257) or S1339R (V7256) reduced activity compared to V6552, further highlighting the importance of these mutations for variant activity. Removal of mutations D252Y (V7253) and L302N (V7255) increased editing at off-target sites compared to V6552, demonstrating the contribution of these mutations to V6552 specificity.

[0235] Contribution of each mutation to the nuclease activity and specificity of variant 6172 V6172 of OMNI-50 contains six mutations: N300A, G614R, N698L, E836F, T939L, and L1100F (Table 2). To gain a deeper understanding of the impact and contribution of each mutation to the activity of OMNI-50 V6172, we expressed and purified all single V6172 variants (i.e., each variant had any one of the six mutations) in HTP and tested their activity and fidelity as RNPs against the ELANE_g58Ref target site and off-target sites of this guide sequence in homozygous HSCs (Figure 8A-8B). Here, L1100 (V7896) is the mutation that contributes most to activity compared to the wild type (Figure 8A). However, since V6172 alone is more active than L1100F, mutations other than V6172 may contribute to further increased activity. The single mutations N300A (V7239), N698L (V7241), and T939L (V7243) showed reduced off-target levels, indicating that they affect the level of fidelity (Figure 8B).

[0236] We also tested the effect of reverting each single mutation to a wild-type substitution relative to V6712 on activity and fidelity. All variants were expressed and purified in HTPs and tested for activity and fidelity as RNPs against the ELANE_g58Ref target site and off-target sites of this guide sequence in homozygous HSCs (Table 4, Figures 9A-9B). In g58Ref, removal of L1100F (V7143) reduced activity compared to V6172 (Figure 9A). However, this did not reduce activity to wild-type levels, indicating that other mutations contribute to activity. Removal of one of the mutations N300A (V7138), T939L (V7142), or N698L (V7140) notably increased off-target activity compared to V6172, indicating a contribution to specificity (Figure 9B).

[0237] Because V6172 is highly specific, as evidenced by its ability to discriminate between SNPs, we further tested the contribution of removing single mutations from V6172 using the more challenging Alt guide in g58 heterozygous HSCs (Figure 10). For g58Alt, a similar trend in discrimination was observed as observed for fidelity, with removal of N300A (V7138), N698L (V7140), and T939L (V7142) decreasing discrimination.

[0238] Design of variants based on variant 6172 with improved activity and fidelity Variant V7765 (containing the following substitutions relative to wild-type OMNI-50: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R) is a rationally designed variant based on variant V6172, with increased activity and specificity. Two mutations, S779P and S1339R, identified during screening and shown to increase activity in V6552 were introduced (Table 2).

[0239] The S779P substitution increases the thermal stability of OMNI-50 We screened wild-type OMNI-50 variants and confirmed that a single substitution of S779 of wild-type OMNI-50 with a proline residue (i.e., S779P, forming variant V7261) significantly increased the protein's thermal stability, as measured by increased residual activity at 44 °C (Figure 11). A similar effect was observed when S779P was introduced into variant V6552 (i.e., variant V7281, see Table 2). These results indicate that, among various mutations, S779P is an overall stabilizing mutation that increases the protein's thermal stability.

[0240] Increased activity of OMNI-50 variants V6552, V6172, and V7765, and increased fidelity of V7765 against various targets OMNI-50 variants V6552, V6172, and V7765 were designed to be more active than wild-type OMNI-50. To characterize their activity, they were expressed in HG and purified, and their activity as RNPs in HSCs homozygous for the target sites RPE65 and VEGFA3 was tested using the corresponding guide sequences (Table 3, Figures 12A-12B). Indeed, V6552, V6172, and V7765 showed high activity at these targets, with V7765 being the most active.

[0241] These variants were then tested against targets with known off-target sites to characterize their activity and specificity. For the target ELANE_g62Ref, all variants exhibited high activity, but V6172 and V7765 showed high fidelity at two off-target sites (Figures 13A-13C). For ELANE_g58Ref, variant V7765 exhibited the highest activity and fidelity (Figures 13D-13E). When tested against the target hSARM1_g92 in SH-SY5Y cells, V7765 exhibited the highest activity and fidelity (Figures 13F-13G). For FANCF, V7765 exhibited higher activity than wild-type OMNI-50 and similar activity at off-target sites (Figures 13H-13I).

[0242] Table 5-1

[0243] Table 5-2

Claims

1. A composition comprising a non-naturally occurring nuclease variant having at least 90% identity to the sequence set forth in SEQ ID NO:1 and including an amino acid substitution at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339 and S779 of the sequence set forth in SEQ ID NO:

1.

2. The composition of claim 1, wherein the nuclease variant comprises an amino acid substitution at at least one of positions L1100, S1339 and / or S779.

3. The composition of claim 1 or 2, wherein the nuclease variant comprises an amino acid substitution at position L1100.

4. The composition of any one of claims 1 to 3, wherein the nuclease variant comprises an amino acid substitution at position S1339.

5. The composition of any one of claims 1 to 4, wherein the nuclease variant comprises amino acid substitutions at positions L1100 and S1339.

6. The composition of any one of claims 1 to 5, wherein the nuclease variant comprises an amino acid substitution at position S779.

7. The composition of any one of claims 1 to 6, wherein the nuclease variant comprises amino acid substitutions at positions L1100, S1339 and S779.

8. 8. The composition of any one of claims 1 to 7, wherein the nuclease variant comprises an amino acid substitution at position L1100, wherein the amino acid substituting for leucine is histidine (L1100H), phenylalanine (L1100F), tryptophan (L1100W) or tyrosine (L1100Y).

9. 9. The composition of any one of claims 1 to 8, wherein the variant of the nuclease comprises an amino acid substitution at position L1100, wherein the amino acid substituting for leucine is phenylalanine (L1100F).

10. 10. The composition of any one of claims 1 to 9, wherein the nuclease variant comprises an amino acid substitution at position S1339, wherein the amino acid substituting the serine is arginine (S1339R), lysine (S1339K) or histidine (S1339H).

11. The composition of any one of claims 1 to 10, wherein the nuclease variant comprises an amino acid substitution at position S1339, wherein the amino acid substituting the serine is arginine (S1339R).

12. 12. The composition of any one of claims 1 to 11, wherein the nuclease variant comprises an amino acid substitution at position S779, wherein the amino acid substituting the serine is glycine (S779G), alanine (S779A), valine (S779V), cysteine ​​(S779C), proline (S779P), leucine (S779L), isoleucine (S779I), methionine (S779M), tryptophan (S779W), phenylalanine (S779F), aspartic acid (S779D), asparagine (S779N), or histidine (S779H).

13. The composition of any one of claims 1 to 12, wherein the variant of the nuclease comprises an amino acid substitution at position S779, wherein the amino acid substituting the serine is proline (S779P).

14. The composition of any one of claims 1 to 13, wherein the nuclease variant comprises an amino acid substitution at at least one of positions N300, G614, N698, E836, T939 and L1100.

15. The composition of any one of claims 1 to 14, wherein the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, E836F, T939L, and L1100F.

16. The composition of any one of claims 1 to 15, wherein the nuclease variant comprises an amino acid substitution at at least one of positions D252, D281, L302, N368, L1100, and S1339.

17. The composition of any one of claims 1 to 16, wherein the nuclease variant comprises at least one of the following amino acid substitutions: D252Y, D281V, L302N, N368S, L1100F, and S1339R.

18. The composition of any one of claims 1 to 17, wherein the nuclease variant comprises an amino acid substitution at at least one of positions N300, G614, N698, S779, E836, T939, L1100, and S1339.

19. 19. The composition of any one of claims 1 to 18, wherein the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, S779P, E836F, T939L, L1100F, and S1339R.

20. 20. The composition of any one of claims 1 to 19, wherein the nuclease variant has at least 97% identity with the sequence of the wild-type OMNI-50 protein (SEQ ID NO: 1) and comprises amino acid substitutions at at least one of positions N300, G614, N698, E836, T939, L1100, D252, D281, L302, N368, S1339 and S779.

21. 21. The composition of any one of claims 1 to 20, wherein the nuclease variant comprises at least one of the following amino acid substitutions: N300A, G614R, N698L, E836F, T939L, L1100F, D252Y, D281V, L302N, N368S, S1339R, and S779P.

22. The composition according to any one of claims 1 to 21, wherein the nuclease variant comprises any one of the amino acid sequences shown in SEQ ID NOs: 2 to 30.

23. The composition of any one of claims 1 to 22, wherein the nuclease variant further comprises at least one nuclear localization sequence (NLS).

24. The composition of any one of claims 1 to 23, wherein the nuclease variant further comprises at least one affinity tag.

25. The composition of any one of claims 1 to 24, wherein the nuclease variant is conjugated to another protein to form a fusion protein.

26. The composition of any one of claims 1 to 25, wherein the nuclease variant is a nickase or has no catalytic activity.

27. A composition comprising a polynucleotide encoding a variant of a nuclease according to any one of claims 1 to 26, wherein preferably said polynucleotide is a DNA or RNA molecule, preferably an mRNA molecule.

28. 28. The composition of any one of claims 1 to 27, further comprising a single guide RNA (sgRNA) molecule, a crRNA molecule and / or a tracrRNA molecule, or a DNA molecule encoding a single guide RNA (sgRNA) molecule, a crRNA molecule and / or a tracrRNA molecule.

29. 29. A method of binding to and / or modifying a DNA target site in a cell or cell-free system, the method comprising delivering to the cell or cell-free system a composition according to any one of claims 1 to 28.

30. 30. The method of claim 29, wherein the binding and / or modification occurs inside a eukaryotic or prokaryotic cell.

31. 31. The method of claim 30, wherein the eukaryotic cell is a plant cell or a mammalian cell.

32. 32. The method of claim 31 , wherein the mammalian cell is a human cell.

33. 33. The method of claim 32, wherein the DNA target site is located within or near a pathogenic allele of a gene.

34. The DNA target sites include ELANE, CXCR4, EMX, RyR2, KNCQ1, KCNH2, SCN5a, GBA1, GBA2, rhodopsin, GUCY2D, IMPDH1, FGA, BEST1, PRPH2, KRT5, KRT14, ApoA1, STAT3, STAT1, ADA2, RPS19, SBDS, GATA2, RPE65, LDL 34. The method of any one of claims 29 to 33, wherein the gene is located in a gene selected from the group consisting of R, ANGPTL3, B2M, TRAC, TCF4, TGFBi, PAX6, C3, LRRK2, SARM1, SAMD9, SAMD9L, HAVCR2, CD3E, APLP2, CISH, TIGIT, TNNT2, TNN, MYH7 and HLA-E.

35. 35. The method of any one of claims 29 to 34, wherein the DNA target is repaired with an exogenous donor molecule.

36. 36. The method of claim 35, wherein the exogenous donor molecule is an RNA or DNA molecule.

37. The off-target editing activity is at least 2-fold, 10 ... 2 double, 10 3 double, 10 4 double, 10 5 Double or 10 6 The method according to any one of claims 29 to 36, wherein the amount of the hydroxyl group is reduced by a factor of 1.

38. A modified cell obtained by the method of any one of claims 29 to 37.

39. 39. The modified cell of claim 38, wherein the cell is transplantable.

40. 40. The modified cell of claim 38 or 39, wherein the cell is capable of giving rise to progeny cells after transplantation.

41. 41. The modified cell of any one of claims 38 to 40, wherein the cell is capable of giving rise to progeny cells after autologous transplantation.

42. 42. The modified cell of any one of claims 38 to 41, wherein the cell is capable of giving rise to progeny cells for at least 12 months or at least 24 months after transplantation.

43. 43. The modified cell of any one of claims 38 to 42, wherein the cell is selected from the group consisting of hematopoietic stem cells, progenitor cells, CD34+ hematopoietic stem cells, bone marrow cells, and peripheral mononuclear cells.

44. A composition comprising the modified cells of any one of claims 38 to 43 and a pharmaceutically acceptable carrier.

45. 45. A method for producing the composition of claim 44 in vitro or ex vivo, comprising mixing said cells with said pharmaceutically acceptable carrier.

46. A composition, method, process, kit or use characterized by one or more elements disclosed herein.