Method for determining the sex of chicken embryos

Transgenic chickens with a recombinant Z sex chromosome expressing RFP enable accurate sex determination of embryos in unhatched eggs, addressing the limitations of existing methods with a universal and cost-effective solution.

JP2026513245APending Publication Date: 2026-04-23EGGXYT LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
EGGXYT LTD
Filing Date
2024-03-27
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Current methods for determining the sex of chicken embryos in unhatched eggs are not robust, cost-effective, and accurate, especially at early stages of embryonic development, and do not apply universally across all chicken strains.

Method used

Development of transgenic female chickens with a recombinant Z sex chromosome containing a nucleic acid sequence of an exogenous reporter gene encoding red fluorescent protein (RFP), allowing for the detection of RFP expression in embryos to determine sex through fluorescent signal detection.

Benefits of technology

Provides a reliable and cost-effective method for sexing chicken embryos in unhatched eggs, applicable across various chicken strains, with high accuracy and minimal impact on embryo development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026513245000001_ABST
    Figure 2026513245000001_ABST
Patent Text Reader

Abstract

The present invention provides a transgenic female chicken having a recombinant Z sex chromosome, wherein at least one position on the Z sex chromosome contains a nucleic acid sequence of an exogenous reporter gene encoding red fluorescent protein (RFP). A method for determining the sex of a chicken embryo in an unhatched egg is further provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Reference to Electronic Array List The content of the electronic array list (EGG-P-010-PCT.xml; size: 59,207 bytes; creation date: March 21, 2024) is incorporated herein by reference in its entirety.

[0002] Cross-Reference to Related Applications This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 454,804, filed on March 27, 2023, entitled "METHOD FOR GENDER DETERMINATION OF CHICKEN EMBRYOS", the content of which is incorporated herein by reference in its entirety.

[0003] Field of the Invention The present invention relates to transgenic chickens and methods of using them for, among other things, gender determination of chicken embryos in unhatched eggs.

Background Art

[0004] The food industry uses "broiler" chickens for chicken meat production. These chickens are known to reach slaughter weight between 4 and 6 weeks of age. On the other hand, laying hens are mainly bred to put all their energy into egg production and thus rarely reach a weight sufficient for meat production. Male birds of leaner breeds used for egg production are economically disadvantageous for the industry because they are more expensive to feed and raise than to sell as meat. As a result, billions of male chickens are culled daily by suffocation or grinding, posing global economic and ethical problems.

[0005] Chick sexing is a method of determining the sex of chickens and other newly hatched young birds, and is usually performed by trained individuals called chick sexers or chicken sexers. Several methods are used to determine the sex of chicks at least one day old, including vent sexing, which is universal to all breeds but requires expert work, as well as feather sexing, which depends on the sex-linked feathering gene and the sex-linked feathering gene, respectively, and color sexing. However, the need for in-egg sexing of unhatched eggs remains significant.

[0006] An automated system for determining the sex of chicks during 14 days of in-oven development has been previously described. This system is based in particular on the significant difference in feather color between males and females, which can be observed by examining eggs at 14 days of age. In this system, eggs are examined with a halogen lamp. Although no adverse effects have been observed on developing chicks, halogen lamps are known to generate a large amount of heat that could adversely affect embryos if the examination time is too long.

[0007] There is still a great need for a new, robust, cost-effective, and accurate method for sexing embryos in unhatched eggs, specifically one that can be generally applied to all chicken strains and is applicable at very early stages of embryonic development. [Overview of the project]

[0008] According to one embodiment, a transgenic female chicken is provided, which has a recombinant Z sex chromosome containing a nucleic acid sequence of an exogenous reporter gene encoding red fluorescent protein (RFP) at at least one position on the Z sex chromosome of the female chicken, wherein this at least one position is listed in Table 1.

[0009] In some embodiments, at least one location of the Z sex chromosome disclosed throughout this application, including in Table 1, conforms to or is based on UCSC genome browser assembly ID:galGal6.

[0010] In another embodiment, cells obtained from or derived from transgenic female chickens disclosed herein are provided.

[0011] In another embodiment, a method for determining the sex of a chicken embryo in an unhatched egg containing an embryo within a structurally unified shell is provided, comprising the steps of (a) obtaining at least one unhatched egg containing an embryo within a structurally unified shell from a transgenic female chicken disclosed herein, and (b) determining whether a red fluorescent signal is detected in the embryo present in the unhatched egg, wherein the detection of the red fluorescent signal indicates the expression of RFP in the embryo within the structurally unified shell of the unhatched egg, and therefore indicates the presence of a recombinant Z chromosome in the embryo, thereby determining that the chicken embryo in the unhatched egg is a male embryo.

[0012] In another embodiment, a method for producing chickens containing a recombinant Z sex chromosome is provided, comprising the steps of (a) obtaining at least one transgenic PGC containing a recombinant Z chromosome having a nucleic acid sequence of an exogenous reporter gene encoding RFP at at least one position on the chicken's Z sex chromosome as described in Table 1, and (b) transplanting the transgenic PGC into a receptive chicken embryo, thereby providing a method for producing chickens containing the recombinant Z sex chromosome.

[0013] In another embodiment, a kit is provided comprising at least one first nucleic acid molecule encoding a guide RNA (gRNA) having a nucleotide sequence described in any one of SEQ ID NOs: 1-3 and 18-20.

[0014] In some embodiments, at least one location is selected from the group consisting of part 3, part 4, part 5, part 7, part 8, part 13, part 14, part 15, and any combination thereof.

[0015] In some embodiments, at least one location is described in Table 3.

[0016] In some embodiments, at least one location is selected from the group consisting of part 4a, part 5a, part 7b, part 14a, and any combination thereof.

[0017] In some embodiments, at least one location is selected from the group consisting of site 4a, site 13a, site 14a, and any combination thereof.

[0018] In some embodiments, the RFP is characterized by an excitation wavelength of 500–650 nm and an emission wavelength of 550–650 nm.

[0019] In some embodiments, the recombinant Z sex chromosome contains the nucleotide sequence described in any one of SEQ ID NOs: 4-6.

[0020] In some embodiments, the cells are primordial germ cells (PGCs).

[0021] In some embodiments, the absence of a red fluorescent signal in embryos present in unhatched eggs indicates that RFP is not expressed in the embryo, and therefore, that a recombinant Z chromosome is not present in the embryo, thus allowing the chicken embryo in the unhatched egg to be determined to be a female embryo.

[0022] In some embodiments, the method further includes a step of exposing an unhatched egg containing an embryo within a structurally integrated shell to a light source.

[0023] In some embodiments, the method further includes a process preceding step (b), which involves isolating at least one female embryo of a transgenic female chicken.

[0024] In some embodiments, the kit further comprises at least one second nucleic acid molecule encoding either clustered, regularly spaced short palindromic sequence repeats (CRISPR)-associated protein 9 (Cas9), RFP, or both.

[0025] In some embodiments, the kit further includes instructions for integrating at least a second nucleic acid molecule encoding RFP into at least one position on at least one of the Z chromosomes of female chickens, and the at least one position is described in Table 1.

[0026] In some embodiments, the method includes a step preceding step (a), which is to integrate the nucleic acid sequence of an exogenous reporter gene encoding RFP into at least one position described in Table 1 of the Z chromosome of PGCs, thereby obtaining the transgenic PGCs.

[0027] In some embodiments, the nucleic acid sequence of the exogenous reporter gene encoding RFP is integrated into the Z chromosome position using a CRISPR type II system comprising a Cas9 protein and a gRNA.

[0028] In some embodiments, the gRNA comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 1-3 and 18-20.

[0029] In some embodiments, the nucleic acid sequence of the exogenous reporter gene is integrated into Site 4a, Site 5a or Site 14a using a Cas9 protein and a gRNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 20 or SEQ ID NO: 3, respectively.

[0030] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. Further, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0031] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description below. However, it should be understood that the detailed description and specific examples, while illustrating preferred embodiments of the present invention, are provided for illustrative purposes only, as various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

[0032] In addition to the exemplary embodiments and models described above, further embodiments and models will become apparent by referring to the study of the detailed description below. [Brief explanation of the drawing]

[0033] [Figure 1] This figure shows gel electrophoresis images demonstrating the cleavage products of double-stranded DNA (dsDNA) molecules derived from DF1 cells by T7EI nuclease. Genomic DNA was edited with CRISPR-related protein 9 (Cas9) and guide RNA molecules (gRNAs) selected from gRNA6.1, gRNA7.2, and gRNA9.1, and amplified by PCR before cleavage by T7EI nuclease. + indicates gRNA molecule present; - indicates gRNA molecule absent; m indicates marker. [Figure 2] This figure shows a bar graph of indel tracking by degradation (TIDE) analysis demonstrating the frequency of DNA insertions and deletions (indels) in DF1 genomic DNA treated with the Cas9 / gRNA ribonucleoprotein (RNP) complex. Indels were observed at a higher frequency in genomic DNA targeted by gRNA6.1, gRNA7.2, or gRNA9.1 compared to other gRNA molecules. [Figure 3]This figure shows agarose gel electrophoresis images of the T7 assay to evaluate the efficiency of the designed guide RNA (gRNA). For sites 4a and 14a, the inventors utilized previously validated gRNAs (gRNA 6.1 and 9.1, respectively) known to be effective in inducing double-strand breaks (DSBs) at target genomic loci. For safe harbor loci (SHLs) 7b, 8a, and 13a, the inventors designed and tested 2, 4, and 4 gRNAs, respectively. The symbols "-" and "+" indicate samples before and after treatment with T7 endonuclease, respectively. The untransfected control shows PCR products obtained using equivalent T7 primers without RNP electroporation. In this assay, gRNA 6.1, 6.1#2, and 7.2 were used as positive controls representing RNP complexes with confirmed cleavage ability to ensure the fidelity of the T7 assay. Furthermore, the "NTC" represents a control without a template, demonstrating the absence of contaminants in the PCR assay. [Figures 4A-4F] This figure shows fluorescence micrographs illustrating the genomic integration of transgenes in two SHLs. DsRed (4A and 4D) and EGFP (4B and 4E) fluorescence observed 2–3 days after transfection of Lohmann-LSL PGCs targeting two different genomic SHLs, representing expression from DsRed HDR and CRISPR / Cas9 plasmids, respectively. Merge fields (4C and 4F) demonstrate co-localization of red and green fluorescence in some cells. [Figure 5A] This figure shows a fluorescence micrograph of a stable primordial germ cell (PGC) culture expressing DsRed, which targets SHL:4a. [Figure 5B] This figure shows a fluorescence micrograph of a stable primordial germ cell (PGC) culture expressing DsRed, which targets SHL:13a. [Figure 6A] This figure shows an agarose gel electrophoresis image of a PCR assay confirming the precise integration of the DsRed coding gene in SHL 4a, along with the expected product size. [Figure 6B] This figure shows an agarose gel electrophoresis image of a PCR assay confirming the accurate integration of the DsRed coding gene in SHL 13a, along with the expected product size. In SHL 13a, two sets of primers (#1 and #2) were used for each homologous arm. [Figure 7A-7C] This figure shows fluorescence micrographs illustrating the intraocular expression of DsRed in PGCs containing the DsRed coding gene integrated into the SHL in the genome. Unfertilized eggs were injected with either unedited control PGCs (7B) or edited PGCs containing the DsRed coding gene in the SHL of the genome at a volume equal to the cell number at embryonic day 3 (7C), and then scanned using an electro-optic scanner. As indicated by the arrows, a distinct fluorescence focus was detected only in eggs injected with DsRed+ cells (7C). (7A) Control untreated egg. [Modes for carrying out the invention]

[0034] In some embodiments, the present invention provides transgenic female chickens containing a recombinant Z sex chromosome comprising a nucleic acid sequence of an exogenous reporter gene encoding red fluorescent protein (RFP). The present invention further relates to a method for sexing chicken embryos of unhatched eggs containing the embryo within a structurally homogeneous shell. Also provided herein are a kit comprising at least one nucleic acid molecule encoding a guide RNA (gRNA) comprising the nucleotide sequences shown in SEQ ID NOs. 1-3 and 18-20, and a method for producing chickens containing a recombinant Z sex chromosome.

[0035] Transgenic chicken, its cells, and method for producing the same. In another embodiment, a transgenic female chicken is provided having a recombinant Z sex chromosome containing a nucleic acid sequence of an exogenous reporter gene encoding red fluorescent protein (RFP) at at least one position on the Z sex chromosome, the at least one position of which is described in Table 1.

[0036] In another embodiment, a transgenic chicken cell is provided which has a recombinant Z sex chromosome containing a nucleic acid sequence of an exogenous reporter gene encoding red fluorescent protein (RFP) at at least one position on the Z sex chromosome, the at least one position of which is shown in Table 1.

[0037] In some embodiments, transgenic chicken cells are stable cells. In some embodiments, transgenic chicken cells are genomically stable.

[0038] In some embodiments, the stability, genomic stability, compatibility, viability, survival capacity, or any combination thereof of the transgenic cells of the present invention are essentially similar to those of the control. In some embodiments, the control is or includes control chicken cells.

[0039] In some embodiments, the control chicken cells include wild-type chicken cells, cells derived from the genetic background or reference of transgenic chicken cells, or both.

[0040] In some embodiments, “essentially similar” means at least 80%, 90%, 95%, 97%, or 99% similarity to the control cells described herein, or any value and range between them. In some embodiments, “essentially similar” means 80–100%, 85–100%, 90–100%, 95–100%, or 97–100% similarity to the control cells described herein. Each possibility represents a distinct embodiment of the invention.

[0041] In some embodiments, transgenic chicken cells are characterized by RFP expression equivalent to that of the control, a growth rate equivalent to that of the control, or both.

[0042] In some embodiments, transgenic chicken cells are characterized by stable RFP expression, a stable growth rate, or both. In some embodiments, "stable" means equivalent to the control.

[0043] In some embodiments, stability means stability over time or beyond time. In some embodiments, stability is for a certain period of time. In some embodiments, stability means at least one passage, two passages, four passages, five passages, or any value and range in between. Each possibility represents a distinct embodiment of the invention.

[0044] In some embodiments, stability is defined as at least one week, two weeks, three weeks, four weeks, two months, four months, six months, or any value and range in between. In some embodiments, stability is defined as one to three weeks, two to six weeks, three to seven weeks, one to three months, two to six months, or four to six months. Each possibility represents a distinct embodiment of the present invention.

[0045] The terms “equivalent” and “essentially similar” are used interchangeably in this specification.

[0046] In some embodiments, being essentially similar includes, for example, being "identical" or being 100% similar.

[0047] As used herein, the terms “stable” or “genomically stable” mean a cell that has not lost fitness, survival, viability, activity, etc., due to the presence of a nucleic acid sequence of an exogenous reporter gene encoding red fluorescent protein (RFP) at at least one location on the cell’s Z sex chromosome, the at least one location being listed in Table 1.

[0048] In some embodiments, the transgenic chicken cells of the present invention are characterized by consistently stable RFP expression. In some embodiments, the transgenic chicken cells of the present invention are characterized by sustained proliferation. In some embodiments, the transgenic chicken cells of the present invention are characterized by consistently stable RFP expression and sustained proliferation.

[0049] Methods for determining RFP expression over time (e.g., consistently stable RFP expression) and cell proliferation over time (e.g., sustained proliferation) are common and will be apparent to those skilled in the art, as illustrated herein.

[0050] As used herein, the term “transgenic chicken” refers to a chicken (Gallus gallus) whose genome has been genetically modified to include an exogenous DNA sequence into which it is incorporated. In some embodiments, the exogenous DNA sequence is incorporated into the sex chromosomes of the germ cells of the transgenic chicken. As a result of such incorporation, the exogenous sequence can be transmitted to the offspring of the transgenic chicken via germ cells. The transgenic chicken, including its progeny, has an exogenous reporter gene incorporated into the sex chromosomes of somatic cells. As used herein, the terms “location,” “locus,” and “genomic site” are interchangeable and refer to a site within a chromosome into which an exogenous reporter gene can be incorporated. A genomic site may refer to a location between two consecutive nucleotides in genomic DNA, or it may refer to a range of consecutive nucleotides containing up to 6,000,000 nucleotides. As used herein, the term “Z sex chromosome” refers to the “male” sex chromosome in chickens. As used herein, the term “recombinant Z sex chromosome” refers to a chicken Z sex chromosome that has been genetically modified to contain the nucleic acid of an exogenous reporter gene encoding the RFP. In some embodiments, the genetic modification is carried out by a gene editing tool or system.

[0051] In some embodiments, at least one position is selected from: site 1 containing nucleotide numbers 1,550,000 to 1,730,000 of the chicken Z sex chromosome; site 2 containing nucleotide numbers 4,075,000 to 6,150,000 of the chicken Z sex chromosome; site 3 containing nucleotide numbers 17,100,000 to 17,450,000; and site 17,550,000 to 18,050. Site 4 containing 000, Site 5 containing nucleotide numbers 19,500,000 to 20,000,000, Site 6 containing nucleotide numbers 26,000,000 to 26,400,000, Site 7 containing nucleotide numbers 30,000,000 to 30,800,000, Site 8 containing nucleotide numbers 36,000,000 to 36,600,000, Site 38,500,000 to 39,2 Site 9 containing 00,000, Site 10 containing nucleotide numbers 48,300,000 to 50,000,000, Site 11 containing nucleotide numbers 51,400,000, Site 12 containing nucleotide numbers 58,500,000 to 59,700,000, Site 13 containing nucleotide numbers 61,400,000 to nucleotide numbers Site 14 containing nucleotide number 62,400,000, Site 15 containing nucleotide numbers 63,150,000 to 63,550,000, Site 16 containing nucleotide numbers 64,350,000 to 65,250,000, Site 17 containing nucleotide numbers 69,700,000 to 70,400,000, Site 18 containing nucleotide numbers 73,500,000 to 78,800,000, or any combination thereof.

[0052] In some embodiments, at least one location is one of the locations 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 selected from part numbers 1 to 18 as disclosed herein, or any combination thereof. Each possibility represents a distinct embodiment of the present invention. In some embodiments, at least one location is one of the locations selected from part numbers 1 to 18 as disclosed herein.

[0053] In some embodiments, at least one location is selected from part 3, part 4, part 5, part 7, part 8, part 13, part 14, part 15, or any combination thereof. In some embodiments, at least one location includes locations 1, 2, 3, 4, 5, 6, 7, or 8, selected from part numbers 3, 4, 5, 7, 8, 13, 14, and 15, or any combination thereof, as disclosed herein. Each possibility represents a distinct embodiment of the present invention. In some embodiments, at least one location is one location selected from part numbers 3, 4, 5, 7, 8, 13, 14, and 15, as disclosed herein.

[0054] In some embodiments, at least one location is listed in Table 3. In some embodiments, site 3 includes nucleotide numbers 17,141,000 to 17,406,000 (site 3a) of the chicken Z sex chromosome, site 4 includes nucleotide numbers 17,735,000 to 18,020,000 (site 4a), site 5 includes nucleotide numbers 19,560,000 to 19,995,000 (site 5a), site 7 includes nucleotide numbers 30,060,000 to 30,270,000 (site 7a), or nucleotide numbers 30,465,000 to 30,750,000 (site 7a). Site 8 includes nucleotide numbers 36,215,000 to 36,545,000 (site 8a), site 13 includes nucleotide numbers 59,100,000 to 59,430,000 (site 13a), site 14 includes nucleotide numbers 61,530,000 to 61,865,000 (site 14a) or nucleotide numbers 61,875,000 to 62,315,000 (site 14b), and site 15 includes nucleotide numbers 63,210,000 to 63,440,000 (site 15a).

[0055] In some embodiments, at least one location is one of the locations 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 selected from part numbers 3a, 4a, 5a, 7a, 7b, 8a, 13a, 14a, 14b, and 15a, as disclosed herein, or any combination thereof. Each possibility represents a distinct embodiment of the present invention. In some embodiments, at least one location is one of the locations selected from part numbers 3a, 4a, 5a, 7a, 7b, 8a, 13a, 14a, 14b, and 15a, as disclosed herein.

[0056] In some embodiments, at least one location is selected from part 4a, part 5a, part 7b, part 13a, part 14a, or any combination thereof. In some embodiments, at least one location includes one, two, three, or four locations selected from part numbers 4a, 5a, 7b, 13a, and 14a, or any combination thereof, as disclosed herein. Each possibility represents a distinct embodiment of the present invention. In some embodiments, at least one location is one location selected from part numbers 4a, 5a, 7b, 13a, and 14a, as disclosed herein.

[0057] In some embodiments, at least one location is selected from part 4a, part 5a, part 13a, part 14a, or any combination thereof. In some embodiments, at least one location includes one, two, or three locations selected from part numbers 4a, 5a, 13a, and 14a, or any combination thereof, as disclosed herein. Each possibility represents a distinct embodiment of the present invention. In some embodiments, at least one location is one location selected from part numbers 4a, 5a, 13a, and 14a, as disclosed herein.

[0058] As used herein, the term “reporter gene” encompasses a gene encoding a polypeptide whose expression can be detected in various known assays, and the detected signal level indicates the presence of the reporter.

[0059] As used herein, the term “red fluorescent protein” or “RFP” refers to an orange, red, and far-red fluorescent fluorophore isolated from an antzoan or anemone, or any variant thereof. In some embodiments, RFP comprises the DsRed protein. In some embodiments, the DsRed protein is isolated from Discosoma striata. In some embodiments, RFP comprises the Kaede protein isolated from Trachyphyllia geoffroyi. In some embodiments, RFP comprises RFP variants. In some embodiments, the RFP variants disclosed herein emit orange, red, far-red, or any combination thereof. In some embodiments, RFP variants comprise monomeric variants. In some embodiments, RFP variants exhibit a shortened time between protein synthesis and fluorescence expression (e.g., maturation time) compared to DsRed. Variants of RFP are known in the art. Non-exclusive examples include mFruits (mCherry, mOrange, mRaspberry), mKO, TagRFP, mKate, mRuby, FusionRed, mScarlet, and DsRed-Express.

[0060] In some embodiments, the RFP includes or is DsRed-Express.

[0061] In some embodiments, the RFP or its analogues are characterized by or have excitation at wavelengths of 500-650 nm. In some embodiments, the RFP or its analogues are characterized by excitation at wavelengths of 510-650, 520-650, 530-650, 540-650, 550-650, 500-600, 510-600, 520-600, 530-600, 540-600, 550-600, 500-590, 510-590, 520-590, 530-590, 540-590, 550-590, Characterized by or having excitation at wavelengths of 500-580, 510-580, 520-580, 530-580, 550-580, 500-570, 510-570, 520-570, 530-570, 540-570, 550-570, 500-560, 510-560, 520-560, 530-560, 540-560, or 550-560 nm. Each possibility represents a distinct embodiment of the present invention.

[0062] In some embodiments, the RFP or its analogues are characterized by or have emission at wavelengths of 550-650 nm. In some embodiments, the RFP or its analogues are characterized by emission at wavelengths of 500-650, 510-650, 520-650, 530-650, 540-650, 550-650, 570-650, 580-650, 500-640, 510-640, 520-640, 530-640, 540-640, 550-640, 550-6 40, 550~640, 540~640, 500~640, 500~630, 510~630, 520~630, 530~630, 550~630, 550~630, 530~630, 550~630, 370~630, 530~630, 550~630, 500~620, 510~620, 520~620, 530~620, 540 ~620, 550~620, 530~620, 530~620, 520~620, 520~620, 380~620, 500~610, 500~610, 510~610, 520~610, 530~610, 540~610, 550~610, 560~610, 570~610, 580~610, 500~600, 510~600, 5 Characterized by or having excitation at wavelengths of 20-600, 530-600, 540-600, 550-600, 560-600, 570-600, 580-600, 500-590, 510-590, 520-590, 530-590, 540-590, 550-590, 560-590, 570-590, or 580-590 nm. Each possibility represents a separate embodiment of the present invention.

[0063] Further examples of RFP analogues are disclosed in International Publication No. 2017094015, which is incorporated in its entirety herein by reference.

[0064] In one embodiment, the maximum excitation of the RFP is approximately 554 nm. In some embodiments, the maximum emission of the RFP is approximately 586 nm.

[0065] As used herein, the term “approximately” indicates a value that may deviate by up to 1%, 5%, 10%, 15%, or 20% above or below the value mentioned, and the deviation range includes integer values ​​and, where applicable, non-integer values, and constitutes a continuous range. As used herein, the term “approximately” refers to ±10%.

[0066] In some embodiments, the RFP disclosed herein has the amino acid sequence: MASSEDVIKEFMRFKVRMEGSVNGHEFEIEGEGEGRPYEGTQTAKLKVTKGGPLPFAWDILSPQFQYGSKVYVKHPADIPDYKKLSFPEGFKWERVMNFEDGGVVTVTQDSSLQDGSFIYKVKFIGVNFPSDGPVMQKKTMGWEASTERLYPRDGVLKGEIHKALKLKDGGHYLVEFKSIYMAKKPVQLPGYYYVDSKLDITSHNEDYTIVEQYERAEGRHHLFL (Sequence ID 7), or its analogues or variants.

[0067] The terms “mutant” and “analog” are used interchangeably herein. An analog of the RFP polypeptide includes any polypeptide that is similar to, but not identical to, the polypeptide comprising the amino acid sequence shown in SEQ ID NO: 7, insofar as it has or maintains at least 70%, 80%, 90%, or 95%, 99%, or any value and range between them, of the maximum excitation and / or maximum emission of the RFP disclosed herein. Each possibility represents a distinct embodiment of the invention. In some embodiments, an analog of the RFP polypeptide maintains 70%–100%, 80%–100%, 90%–100%, 95%–100%, or 99%–100% of the maximum excitation and / or maximum emission of the RFP disclosed herein. Each possibility represents a distinct embodiment of the invention. It should be understood that an analog of RFP refers to any fluorescent protein characterized by being excitable at wavelengths of 500–650 nm and emitting at wavelengths of 550–650 nm.

[0068] In some embodiments, the reporter gene encoding the RFP includes a codon sequence optimized for expression in chicken cells. As used herein, the term “optimized codon sequence” refers to a sequence that encodes the same amino acid as the amino acid encoded by an unoptimized codon sequence (synonymous codon), but which increases the translation rate, the amount of protein product, the duration of protein structural stability, or any combination thereof, of the optimized codon sequence compared to the unoptimized codon sequence. Those skilled in the art will know how to optimize a codon sequence for its expression in a desired cell using codon optimization genetic engineering tools, which include, but are not limited to, algorithms that analyze codon optimization based on codon frequencies in a desired cell / species. In some embodiments, the increase in one of the translation rate, the amount of protein product, and the duration of structural stability is an increase of at least 30%.

[0069] In some embodiments, the reporter gene encoding RFP includes the nucleic acid sequence: (SEQ ID NO: 8).

[0070] In some embodiments, the reporter gene encoding RFP includes the nucleic acid sequence described in Sequence ID No. 8, or an analogue thereof having at least 50%, 60%, 70%, 80%, 90%, 95%, 99%, or any value and range between them. Each possibility represents a distinct embodiment of the present invention. In some embodiments, an analogue of RFP having 50-100%, 60-100%, 70-100%, 80-100%, 90-100%, 95-100%, or 99-100% identity or homology to the nucleic acid sequence described in Sequence ID No. 8. Each possibility represents a distinct embodiment of the present invention.

[0071] In some embodiments, the RFP analogues include proteins translated by nucleic acid molecules containing nucleotide sequences having at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity or homology, or any value and range between them, to the nucleotide sequence described in Sequence ID No. 8. Each possibility represents a distinct embodiment of the present invention. In some embodiments, the RFP analogues include proteins translated by nucleic acid molecules containing nucleotide sequences having 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, or 99% to 100% identity or homology, to the nucleotide sequence described in Sequence ID No. 8. Each possibility represents a distinct embodiment of the present invention.

[0072] In some embodiments, the reporter gene encoding the RFP is integrated into a genomic site on the Z chromosome using a programmable engineered nuclease (PEN).

[0073] As used herein, the term “programmable engineered nuclease (PEN)” refers to synthetic enzymes derived from naturally occurring nucleases involved in DNA repair of double-stranded DNA damage, which cleave specific DNA sequences and enable direct genome editing.

[0074] In some embodiments, the PEN used in the method of the present invention may be either a clustered, regularly spaced short palindromic repeat (CRISPR) class I or class II system.

[0075] As used herein, “CRISPR” or “CRISP array,” also known as SPIDR (Spacer Interspersed Direct Repeat), constitutes a family of recently described DNA loci, typically specific to particular bacterial species. CRISPR arrays are a unique class of scattered short sequence repeats (SSRs) first recognized in Escherichia coli. Subsequently, similar CRISPR arrays have been found in Mycobacterium tuberculosis, Haloferax mediterranei, Methanocaldococcus jannaschii, Thermotoga maritima, and other bacteria and archaea. It should be understood that this invention assumes the use of any known CRISPR system, in particular the CRISPR system described herein. The CRISPR-Cas system targets DNA molecules based on short homologous DNA sequences called spacers present between repeats. These spacers guide CRISPR-associated (Cas) proteins to matching (and / or complementary) sequences in foreign DNA, called protospacers, which are then cleaved. Spacers can be reasonably designed to target any DNA sequence. Furthermore, this recognition element may be separately designed to recognize and target any desired target. As is recognized by those skilled in the art with respect to the CRISPR system, the structure of naturally occurring CRISPR loci generally contains several short repeat sequences called “repeats.” Repeats occur within clusters and are usually regularly spaced by unique intervening sequences called “spacers.” Typically, CRISPR repeats vary in length from about 24 to 47 base pairs (bp) and are partially palindromic in structure. Spacers are located between two repeats, and typically, each spacer has a unique sequence ranging in length from about 20 bp or less to 72 bp or more. In some embodiments, the CRISPR spacers used in sequences encoding at least one gRNA of the methods and kits of the present invention each contain 10 nucleotides (nt) to 75 nucleotides (nt).In some embodiments, the gRNA includes at least: 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or any values ​​and ranges in between. Each possibility represents a distinct embodiment of the invention. In some embodiments, the gRNA includes 70 to 150 nt. In some embodiments, the spacer contains 20 to 35 nucleotides. In addition to at least one repeat and at least one spacer, the CRISPR locus also contains a leader sequence and, optionally, a sequence encoding at least one tracrRNA. The leader sequence is typically an AT-rich sequence of up to 550 bp directly adjacent to the 5' end of the first repeat.

[0076] In some embodiments, the PEN used in the method of the present invention may be a CRISPR Class 2 system. In some specific embodiments, such a Class 2 system may be a CRISPR Type II system. In some embodiments, the PEN includes a CRISPR Type II system.

[0077] The term "CRISPR-Type II" system refers to a bacterial immune system modified for genome engineering. However, it should be noted that other genome engineering techniques, such as those relying on customizable DNA-binding protein nucleases (e.g., zinc finger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs)) and requiring the design and generation of specific nuclease pairs for each genomic target, are also applicable to this technology. CRISPR-Cas systems are classified into two classes. Class 1 systems use a complex of multiple Cas proteins to degrade foreign nucleic acids. Class 2 systems use a single large Cas protein for the same purpose. More specifically, Class 1 can be further classified into types I, III, and IV, and Class 2 can be further classified into types II, V, and VI.

[0078] The type II CRISPR-Cas system includes the "HNH" system (Streptococcus-like; also known as meningococcal serotype A str.Z2491, or the Nmeni subtype of CASS4), in which Cas9 is sufficient for crRNA generation and target DNA cleavage, in addition to the ubiquitous Cas1 and Cas2. Cas9 contains at least two nuclease domains, namely a RuvC-like nuclease domain near the amino terminus and an HNH (or McrA-like) nuclease domain in the middle of the protein, but the functions of these domains are not elucidated. However, the HNH nuclease domain is abundant in restriction enzymes and possesses endonuclease activity responsible for target cleavage.

[0079] The Type II system cleaves pre-crRNA via a specialized mechanism involving double-strand formation between tracrRNA and a portion of the repeats in pre-crRNA. Subsequently, the first cleavage in the pre-crRNA processing pathway occurs at this repeat region. Furthermore, it should be noted that the Type II system includes at least one of the Cas9, Cas1, Cas2 csn2, and Cas4 genes. It should be understood that any Type II CRISPR-Cas system, specifically either Type II-A or Type II-B, may be applicable in this invention.

[0080] In some embodiments, the at least one Cas gene used in the methods and kits of the present invention may be at least one Cas gene of a type II CRISPR system (either type II-A or type II-B). In some embodiments, the at least one Cas gene of the type II CRISPR system used in the methods and kits of the present invention is the Cas9 gene. It should be noted that such a system may further include at least one of the Cas1, Cas2, csn2, and Cas4 genes.

[0081] In some embodiments, the Cas protein consists of or contains the Cas9 protein. Cas9-mediated double-strand DNA (dsDNA) breaks are a feature of the “Type II CRISPR-Cas” immune system. The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA:DNA complementarity to identify target sites for sequence-specific double-strand DNA (dsDNA) breaks and generate the double-strand breaks (DSBs) necessary for HDRs, which result in the integration of a reporter gene into a specific target sequence, e.g., within the Z sex chromosome of birds. The target DNA sequence is identified by a CRISPR array, which is a sequence of spacers approximately 30-40 bp long, separated by short palindromic sequence repeats. The array is transcribed as pre-crRNA and processed into shorter crRNAs that target complementary DNA sequences known as protospacers, which associate with the Cas protein complex. These protospacer targets must also have additional flanking sequences known as protospacer flanking motifs (PAMs), which are necessary for target recognition. After binding, the Cas protein complex acts as a DNA endonuclease, cleaving both strands of the target, and subsequent DNA degradation occurs via exonuclease activity.

[0082] The CRISPR Type II system used herein requires the inclusion of two essential components: a “guide” RNA (gRNA) and a nonspecific CRISPR-associated endonuclease (Cas9). gRNA is a short synthetic RNA composed of a “scaffold” sequence necessary for Cas9 binding and a “spacer” or “target” sequence approximately 20 nucleotides long that defines the genomic target to be modified. Therefore, the genomic target of Cas9 can be altered simply by changing the target sequence present in the gRNA. When used herein, guide RNA (gRNA) refers to a synthetic fusion of endogenous bacterial crRNA and tracrRNA that provides both the targeting specificity and scaffold / binding ability of the Cas9 nuclease. It is also called “single guide RNA” or “sgRNA.” While CRISPR was originally used to “knock out” target genes in various cell types and organisms, modifications to the Cas9 enzyme have expanded the scope of CRISPR applications to include “knock-in” target genes, selective activation or repression of target genes, purification of specific regions of DNA, and even imaging of DNA in living cells using fluorescence microscopy. Furthermore, the ease of gRNA generation has made CRISPR one of the most scalable genome editing technologies, and it is now being used for genome-wide screening.

[0083] In some embodiments, the CRISPR type II system used in the methods described herein comprises CRISPR-associated endonuclease 9 (Cas9) and gRNA. In some embodiments, the gRNA described herein comprises a nucleotide sequence selected from ACATGCAATACACTGAACTG (SEQ ID NO: 1), ACTGTTAACAAGGTTGGTTG (SEQ ID NO: 2), CTTGTAGGGCTTGATTACTG (SEQ ID NO: 3), TCTTGCTTTCCACTTTCCAT (SEQ ID NO: 18), AAGTGTGGAACAAACTGCTG (SEQ ID NO: 19), GATGGGCTCCACAAGGAACT (SEQ ID NO: 20), or any combination thereof. In some embodiments, the gRNA described herein comprises the nucleotide sequence described in SEQ ID NO: 1. In some embodiments, the gRNA comprises the nucleotide sequence described in SEQ ID NO: 2. In some embodiments, the gRNA comprises the nucleotide sequence described in SEQ ID NO: 3. In some embodiments, the gRNA comprises the nucleotide sequence described in SEQ ID NO: 18. In some embodiments, the gRNA comprises the nucleotide sequence described in SEQ ID NO: 19. In some embodiments, the gRNA comprises the nucleotide sequence described in SEQ ID NO: 20.

[0084] In some embodiments, a gRNA containing the nucleotide sequence described in SEQ ID NO: 1 is used for integration into site 4a of the exogenous reporter gene. In some embodiments, a gRNA containing the nucleotide sequence described in SEQ ID NO: 20 is used for integration into site 13a of the exogenous reporter gene. In some embodiments, a gRNA containing the nucleotide sequence described in SEQ ID NO: 3 is used for integration into site 14a of the exogenous reporter gene.

[0085] In some embodiments, the recombinant Z sex chromosome has the following nucleotide sequence:

[0086] In some embodiments, a recombinant Z sex chromosome containing an exogenous reporter gene at site 4a contains the nucleotide sequence described in SEQ ID NO: 4.

[0087] In some embodiments, the recombinant Z sex chromosome includes the nucleotide sequence or analogues described in SEQ ID NO: 4 having at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity or homology, or any value and range between them. Each possibility represents a separate embodiment of the present invention. In some embodiments, the nucleotide sequence analogues described in SEQ ID NO: 4 include 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, or 99% to 100% identity or homology with the nucleic acid sequence described in SEQ ID NO: 4. Each possibility represents a separate embodiment of the present invention.

[0088] In some embodiments, the recombinant Z sex chromosome has the following nucleotide sequence:

[0089] In some embodiments, a recombinant Z sex chromosome containing an exogenous reporter gene at site 5a contains the nucleotide sequence described in SEQ ID NO: 5.

[0090] In some embodiments, the recombinant Z sex chromosome includes the nucleotide sequence or analogues described in SEQ ID NO: 5 having at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity or homology, or any value and range between them. Each possibility represents a separate embodiment of the present invention. In some embodiments, the nucleotide sequence analogues described in SEQ ID NO: 5 include 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, or 99% to 100% identity or homology with the nucleic acid sequence described in SEQ ID NO: 5. Each possibility represents a separate embodiment of the present invention.

[0091] In some embodiments, the recombinant Z sex chromosome has the following nucleotide sequence:

[0092] In some embodiments, a recombinant Z sex chromosome containing an exogenous reporter gene at site 14a contains the nucleotide sequence described in SEQ ID NO: 6.

[0093] In some embodiments, the recombinant Z sex chromosome includes the nucleotide sequence or analogues described in SEQ ID NO: 6 having at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity or homology, or any value and range between them. Each possibility represents a separate embodiment of the present invention. In some embodiments, the nucleotide sequence analogues described in SEQ ID NO: 6 include 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, or 99% to 100% identity or homology with the nucleic acid sequence described in SEQ ID NO: 6. Each possibility represents a separate embodiment of the present invention.

[0094]

[0095] In some embodiments, a recombinant Z sex chromosome containing an exogenous reporter gene at site 7b contains the nucleotide sequence described in SEQ ID NO: 39.

[0096] In some embodiments, the recombinant Z sex chromosome includes the nucleotide sequence or analogue described in SEQ ID NO: 39 having at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity or homology, or any value and range between them. Each possibility represents a separate embodiment of the present invention. In some embodiments, the nucleotide sequence analogue described in SEQ ID NO: 39 includes 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, or 99% to 100% identity or homology with the nucleic acid sequence described in SEQ ID NO: 39. Each possibility represents a separate embodiment of the present invention.

[0097]

[0098] In some embodiments, a recombinant Z sex chromosome containing an exogenous reporter gene at site 8a contains the nucleotide sequence described in SEQ ID NO: 40.

[0099] In some embodiments, the recombinant Z sex chromosome includes the nucleotide sequence or analogue of SEQ ID NO: 40 having at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity or homology, or any value and range between them. Each possibility represents a separate embodiment of the present invention. In some embodiments, the nucleotide sequence analogue of SEQ ID NO: 40 includes 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, or 99% to 100% identity or homology with the nucleic acid sequence of SEQ ID NO: 40. Each possibility represents a separate embodiment of the present invention.

[0100]

[0101] In some embodiments, a recombinant Z sex chromosome containing an exogenous reporter gene at site 13a contains the nucleotide sequence described in SEQ ID NO: 41.

[0102] In some embodiments, the recombinant Z sex chromosome includes the nucleotide sequence or analogue described in SEQ ID NO: 41 having at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity or homology, or any value and range between them. Each possibility represents a separate embodiment of the present invention. In some embodiments, the nucleotide sequence analogue described in SEQ ID NO: 41 includes 50% to 100%, 60% to 100%, 70% to 100%, 80% to 100%, 90% to 100%, 95% to 100%, or 99% to 100% identity or homology with the nucleic acid sequence described in SEQ ID NO: 41. Each possibility represents a separate embodiment of the present invention.

[0103] In another embodiment, cells obtained from or derived from transgenic female chickens disclosed herein are provided. In some embodiments, the cells include a recombinant Z chromosome as described herein. In some embodiments, an exogenous reporter gene encoding RFP is incorporated into the Z chromosome of the cell. In some embodiments, the cells include primordial germ cells (PGCs). In some embodiments, the cells are PGCs. In some embodiments, PGCs are provided that include a nucleic acid sequence of an exogenous reporter gene encoding RFP, incorporated into their Z sex chromosome.

[0104] The term "germ cell" refers to an embryonic cell that has the potential to develop into a gamete. As used herein, the term "primordial germ cell (PGC)" refers to a germline stem cell that functions as a precursor to gametes and gives rise to pluripotent embryonic stem cells.

[0105] The use of PGCs for creating transgenic chickens is well known in the art. Early-stage PGCs are readily available and can be manipulated in vitro for practical applications including genetic material repair and genome editing. Due to the ability of chicken PGCs to maintain an undifferentiated state in vitro without losing their properties, as well as their high mobility through the bloodstream of chicken embryos, PGCs have attracted attention as a primary source of genetic modification. In some embodiments, PGCs are used to create chimeric and / or transgenic chickens by injecting genetically modified PGCs into the blood vessels of recipient eggs. However, it should be noted that other cells for creating transgenic chickens are also known in the art. Non-limiting examples of such cells include embryonic stem cells (ESCs) and spermatogonial stem cells (SSCs).

[0106] In another embodiment, a method for producing chickens containing a recombinant Z sex chromosome is provided, comprising the steps of (a) obtaining at least one transgenic PGC containing a recombinant Z chromosome having a nucleic acid sequence of an exogenous reporter gene encoding RFP at at least one position on the chicken's Z sex chromosome as described in Table 1, and (b) transplanting the transgenic PGC into a receptive chicken embryo, thereby providing a method for producing chickens containing the recombinant Z sex chromosome.

[0107] In some embodiments, the transplantation involves injecting a transgenic PGC into at least one blood vessel of the recipient egg.

[0108] In some embodiments, the recombinant Z chromosome contains the nucleic acid sequence of the exogenous reporter gene encoding the RFP at at least one of the locations listed in Table 3. In some embodiments, the at least one location is selected from site 4a, site 5a, site 13a, site 14a, or any combination thereof.

[0109] In some embodiments, the methods described herein are for producing chimeric chickens or transgenic chickens. It should be noted that steps (a) and (b) described herein refer only to the steps necessary to obtain chickens containing a recombinant Z sex chromosome, for example, a chimeric chicken, but not limited to these. Other steps and protocols applicable to the production of transgenic chickens (e.g., protocols for germline chimera production and techniques for screening for the presence of recombinant Z chromosomes) are well known in the art. Some of these protocols are disclosed in International Publication No. 2017094015, which is incorporated in whole herein by reference.

[0110] In some embodiments, the method further includes a step preceding step (a) comprising isolating at least one PGC from the blood of a chicken embryo. In one embodiment, the chicken embryo is a 2-day-old embryo. In some embodiments, the chicken embryo is a naive chicken embryo. In some embodiments, the chicken embryo is a naive 2-day-old chicken embryo.

[0111] As used herein, the term “naive” refers to an embryo having a genome lacking the recombinant Z sex chromosome described herein. In some embodiments, “naive” refers to an embryo having a genome lacking the nucleic acid sequence of an exogenous reporter gene encoding an RFP, such as described herein.

[0112] In some embodiments, the method further includes a step preceding step (a) of incorporating the nucleic acid sequence of an exogenous reporter gene encoding RFP at at least one of the positions listed in Table 1 on the Z sex chromosome of the PGC, thereby obtaining a transgenic PGC. In some embodiments, the incorporation of the nucleic acid sequence of the exogenous reporter gene encoding RFP as described herein is carried out by using a CRISPR / Cas9 system. In some embodiments, the incorporation of the nucleic acid sequence of the exogenous reporter gene encoding RFP is carried out by using a CRISPR / Cas9 system comprising a gRNA containing the nucleic acid sequence described in any one of SEQ ID NOs: 1-3 and 18-20.

[0113] In some embodiments, the transfer of transgenic PGCs to the receptive chicken embryo in step (b) includes injecting the PGCs into the circulatory system of the receptive chicken embryo.

[0114] In some embodiments, a method for producing chickens containing a recombinant Z sex chromosome further comprises one or more steps selected from: (c) incubating embryos with a PGC implanted at 36-38°C until hatching; (d) raising chicks developed from the implanted embryos in step (c) until sexual maturity; (e) mating sexually mature chickens developed from the chicks in step (d) with a corresponding chicken; and (f) isolating at least one offspring from the progeny obtained by the mating in step (e) that contains a recombinant Z sex chromosome or any combination thereof. In some embodiments, the mating comprises at least one mating. In some embodiments, the mating comprises multiple mating steps for producing the transgenic chickens described herein.

[0115] In some embodiments, the transgenic PGC containing the recombinant Z chromosome is, for example, a female PGC obtained from a female chicken embryo. In some embodiments, the transgenic female PGC is transplanted into a receptive female chicken embryo to produce a female chicken containing the recombinant Z sex chromosome. In some embodiments, the chick that develops from the transplanted embryo is a chimeric female chick containing the recombinant Z sex chromosome. In some embodiments, the chimeric female chicken is further crossbred with a corresponding male chicken. In some embodiments, the corresponding male chicken is a wild-type male.

[0116] In some embodiments, the transgenic PGC containing the recombinant Z chromosome is, for example, a male PGC obtained from a male chicken embryo. In some embodiments, the transgenic male PGC is transplanted into a receptive male chicken embryo to produce a male chicken containing the recombinant Z sex chromosome. In some embodiments, the chick that develops from the transplanted embryo is a chimeric male chick containing the recombinant Z sex chromosome. In some embodiments, the chimeric male chicken is further crossbred with a corresponding female chicken. In some embodiments, the corresponding female chicken is a wild-type female.

[0117] In some embodiments, a method is provided for producing a male chicken containing at least one recombinant Z sex chromosome as described herein, the method comprising obtaining at least one male offspring from a chimeric male or female chicken as described herein. In some embodiments, the male chick contains two recombinant Z sex chromosomes. In some embodiments, the method further comprises the step of isolating or selecting male chicks containing two recombinant Z sex chromosomes as described herein. In some embodiments, the method further comprises obtaining a transgenic female chicken containing recombinant Z sex chromosomes as described herein by obtaining at least one female offspring from a male chicken containing two recombinant Z sex chromosomes as described herein.

[0118] Gender determination method In another embodiment, a method is provided for determining the sex of a chicken embryo in an unhatched egg containing an embryo within a structurally homogeneous shell, the method comprising (a) obtaining at least one unhatched egg containing an embryo within a structurally homogeneous shell from a transgenic female chicken as described herein, and (b) determining whether a red fluorescent signal is detected in the embryo present in the unhatched egg.

[0119] In some embodiments, the detection of a red fluorescence signal indicates the expression of RFP in the embryo within the structurally unhatched egg shell, and therefore indicates the presence of a recombinant Z chromosome in the embryo, thereby determining that the chicken embryo in the unhatched egg is a male embryo.

[0120] In some embodiments, the absence of a red fluorescent signal in embryos present in unhatched eggs indicates that RFP is not expressed in the embryo, and therefore, that recombinant Z chromosomes are not present in the embryo, thus determining that the chicken embryos in unhatched eggs are female embryos.

[0121] In some embodiments, the transgenic female chicken comprises a recombinant Z sex chromosome containing a nucleotide sequence or analogue described in any one of SEQ ID NOs. 4-6 and 39-41 disclosed herein.

[0122] In some embodiments, the method further includes a processing step prior to step (b), which involves isolating at least one unhatched egg that is determined to contain a female embryo, for example, one in which no red fluorescence signal is detected, and thus isolating at least one female embryo.

[0123] As used herein, the term “structurally intact shell” means an eggshell that is not structurally damaged, cracked, broken, unhatched, perforated, punctured, thinned, or any combination thereof. It should be understood that the sex determination methods disclosed herein may be applicable to unhatched eggs at any stage of embryonic development of chicken embryos.

[0124] In this specification, “embryonic stages of a chicken embryo” refers to: Day 1, when the blastodisc is in the blastodisc stage and the cleavage cavity takes the shape of a dark ring; Day 2, when the first groove appears in the center of the blastodisc and the vitelline membrane emerges; Day 3, when blood circulation begins, the head and trunk become distinguishable, and the brain and heart structure that begins to beat can be identified; Day 4, when the amniotic cavity develops to surround the embryo and the urinary sac emerges; Day 5, when the embryo becomes C-shaped and the limbs extend; Day 6, when the fingers of the upper and lower limbs become clear; Day 7, when the neck clearly separates the head and body, the beak is formed, and the brain gradually enters the head region; Day 8, when eye pigmentation is easily visible, the wings and legs differentiate, and the external auditory canal is opening; Day 9, when claws appear and the first feather follicles begin to sprout; Day 10, when nostrils are present, the eyelids develop, and the egg teeth emerge; and the eyelid opening. On day 11, the embryo becomes oval-shaped and takes on the appearance of a chick; on day 12, the feather follicles surround the external auditory canal and cover the upper eyelid, while the lower eyelid covers most of the cornea; on day 13, the allantoate becomes chorioalulia, and the scales on the claws and legs become apparent; from day 14 to 16, the whole body grows rapidly, the yolk contraction accelerates, and the egg white gradually disappears; the renal system produces uric acid, the beak points to the air sac, and the egg white is completely absorbed. This refers to the stage on day 17 when the egg is released; the stage on day 18 when the yolk is absorbed into the egg and the amount of amniotic fluid decreases; the stage on day 19 when the yolk absorption accelerates and the beak is ready to break through the inner membrane; the stage on day 20 when the yolk is completely absorbed, the umbilicus closes, the chick breaks through the inner membrane, breathes in the air sac, and is ready to hatch; and the stage on day 21 when the chick uses its egg teeth to pierce the shell in a circular motion, emerges from the shell over 12-18 hours, and dries its feathers.

[0125] In some embodiments, the method includes determining the sex of a chicken embryo in an intact egg at any stage of embryonic development, while it is present in an egg with a complete or intact shell, or any combination thereof. In some embodiments, the method includes determining the sex of chicken embryos from day 1 to 21, day 1 to 20, day 1 to 19, day 1 to 18, day 1 to 17, day 1 to 16, day 1 to 15, day 1 to 14, day 1 to 13, day 1 to 12, day 1 to 10, day 1 to 9, day 1 to 8, day 1 to 7, day 1 to 6, and day 1 to 5. Each possibility represents a separate embodiment of the present invention.

[0126] In some embodiments, the method further includes a step of exposing an unhatched egg containing an embryo within a structurally integrated shell to a light source.

[0127] In some embodiments, the light source is applicable or configured to detect the RFP. In some embodiments, the light source includes wavelengths from about 400 to about 650 nm. In some embodiments, the light source includes wavelengths from 500 nm to about 650 nm. In some embodiments, the light source includes wavelengths in the range of about 515 to about 555 nm. In some embodiments, the light source includes wavelengths in the range of 500-600, 510-600, 520-600, 520-600, 530-600, 500-590, 510-590, 520-590, 530-590, 500-580, 510-580, 520-580, 530-580, 500-570, 510-57 The wavelength range includes 0, 520-570, 530-570, 500-560, 510-560, 520-560, 530-560, 500-550, 510-550, 520-550, 530-550, 500-540, 510-540, 510-540, 520-540, or 530-540 nm. Each possibility represents a separate embodiment of the present invention. In some further embodiments, the wavelength may be approximately 532 nm.

[0128] In some specific, non-limiting embodiments, the light source may be provided by a laser.

[0129] As used herein, the term “laser” refers to electromagnetic radiation of any frequency that is amplified by stimulated emission of radiation. A laser also refers to a device that stimulates atoms or molecules to emit light at a specific wavelength and amplifies that light to produce a typically very narrow beam of radiation. In some embodiments, the light source is a green laser.

[0130] In some embodiments, an unhatched egg is exposed to a light source. In some embodiments, the egg is positioned to allow exposure to the light source at any stage of embryonic development. In some embodiments, a region of the egg including the upper surface of the yolk at stage X is excited by the light source.

[0131] In some further embodiments, the step of exposing unhatched eggs to a light source is provided by a system, apparatus, or device which may include a laser light source, an egg stand, lenses, filters, a detector stand, and a detector.

[0132] As used herein, the term “detector” refers to any device of any kind that detects and / or measures light. It should be noted that in some embodiments, a detectable signal, specifically a fluorescent signal, may be detected using appropriate fluorescent means. In some embodiments, a detectable signal formed by an exogenous RFP reporter gene may be detected by a photosensitive device such as a modified optical microscope or a charge-coupled device (CCD), which is a highly sensitive photon detector.

[0133] It should be noted that in some embodiments, the method further includes steps necessary for detecting RFP in the unhatched eggs examined, a system or apparatus for doing so. Examples of such steps, systems, and / or apparatus are further described in International Publication No. 2017094015, which is incorporated herein by reference in its entirety.

[0134] kit In another embodiment, a kit is provided comprising at least one first nucleic acid molecule encoding a guide RNA (gRNA) having a nucleotide sequence described in any one of SEQ ID NOs: 1-3 and 18-20.

[0135] In some embodiments, the kit further comprises at least one second nucleic acid molecule encoding the Cas9 protein, RFP, or both.

[0136] In some embodiments, the kit includes a first nucleic acid molecule encoding the gRNA disclosed herein, a second nucleic acid molecule encoding the Cas9 protein, and a third nucleic acid molecule encoding the RFP.

[0137] In some embodiments, the nucleic acid molecules disclosed herein are incorporated into or present within at least one expression vector or plasmid.

[0138] In some embodiments, the first nucleic acid molecule and the second nucleic acid molecule are incorporated into or present in the same expression vector or plasmid. In some embodiments, the first nucleic acid molecule and the second nucleic acid molecule are incorporated into or present in the first expression vector or plasmid, and the third nucleic acid molecule is incorporated into or present in the second expression vector or plasmid.

[0139] Some kits include (i) at least one first nucleic acid molecule encoding a gRNA, comprising a nucleotide sequence shown in any one of SEQ ID NOs: 1-3 and 18-20; (ii) a second nucleic acid molecule comprising a sequence encoding a Cas9 protein; and (iii) a third nucleic acid molecule comprising a sequence encoding the RFP disclosed herein.

[0140]

[0141] In some embodiments, the third nucleic acid molecule encoding the RFP includes the nucleic acid sequence described in Sequence ID No. 8, or an analogue thereof described herein.

[0142] In some embodiments, the third nucleic acid molecule includes a promoter. In some embodiments, the promoter includes a chicken β-actin (CBA) promoter. In some embodiments, the promoter includes a CBh promoter. In some embodiments, the promoter includes the nucleotide sequence: (SEQ ID NO: 10).

[0143] In some embodiments, the third nucleic acid molecule includes a nucleotide sequence encoding a polyadenylation (poly-A) signal. In some embodiments, the nucleotide sequence encoding the poly-A signal includes the nucleotide sequence:CGGCCGCGACTCTAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAAGGCGTGGATCC (SEQ ID NO: 11).

[0144] In some embodiments, the third nucleic acid molecule comprises a nucleotide sequence that enables the integration of an exogenous reporter gene into at least one location on the Z sex chromosome. In some embodiments, Sequence ID No. 8 or an analogue is flanked by homologous arms at its 5', its 3', and both. In some embodiments, the integration of the exogenous reporter gene into at least one location on the Z sex chromosome is achieved by homologous recombination repair (HDR) of the homologous arms to the sequence within the genomic site disclosed herein.

[0145] As used herein, the term “Homologous Recombination Repair (HDR)” encompasses the process by which DNA double-strand breaks (DSBs) are repaired by homologous recombination using a DNA template. As used herein, the term “Homologous Arm” refers to an HDR template introduced into a specific vector or plasmid, designed to align a functional gene to a specific location within the genome. In some embodiments, when CRISPR is used as the PEN, the arm sequences (e.g., 5' homologous arm; left, upstream, and 3' homologous arm; right, downstream) contain approximately 10–5,000 bp, approximately 50–1,000 bp, or approximately 100–500 bp.

[0146] In some embodiments, the third nucleic acid molecule includes a 5' homologous arm. In some embodiments, the 5' homologous arm includes the nucleotide sequence:GGCCTATACAGACAAATCTTTACTAAATGGAGAATCCTGACATTTTGTCCATTTCTCTCTATACCACCAACTCTCATCTTGGTTACATTGCCTGTCAGTTGAACAGGCAAGATCTCCATTCCCAAAACACCACACTTATCTTGAATTGAGCCATCAAGAGGTATTTCTCTGATACACCATTATCTAAAACCCAGTGTTATTTTTCAGTGAGGGTAGATTCCCTTTACTGCTTTTTCTCCTCATTTCCA (SEQ ID NO: 12).

[0147] In some embodiments, the third nucleic acid molecule includes a 3' homologous arm. In some embodiments, the 3' homologous arm includes the nucleotide sequence:ATAACGGCATTCAGTACTTGTCATCACTAATTAGTGTATTCAATCTACCCTCTATTTCTAGGACAACATGTTTTAATAATTCACCATAAATTAGTTCTATGAGCATTTTGATCTAGTGGTTGTTGTAGATCACAGGATATGAATAGATTGTGTGTATGTGTAAACCAGGAGTGTCTTGACAAAAGGACACAGTGCTGGTAAGACCAGCAGAAGAGGGTCCCCTGTGGCAAAAATGTTTTACTGACCTTTG (SEQ ID NO: 13).

[0148] In some embodiments, a third nucleic acid molecule containing the nucleotide sequences shown in SEQ ID NO: 12, SEQ ID NO: 13, and both is used to incorporate an exogenous reporter gene into site 4a.

[0149] In some embodiments, the 5' homologous arm contains the nucleotide sequence: AATACACGCACTGTATCTTTTATGGCAATCTATTTTCGATTGTCTCATGTGCAGAACAGTTACCAGGATTGCAACAACGGATTGAATTTATCCGAAAAGAAGTTTTGTGTCCTGCTTTGTGATAGCTGAGAAAGAAAGGCAGTGATGCTTAAAAAGCAGTCAGTGACCTAATCACCTACTGTCAGGTGTACTATGAATACATACAGTAGAGCCAGTAACACAGTTTGACAGCATTTTCATTAGATGTTT (SEQ ID NO: 14).

[0150] In some embodiments, the 3' homologous arm contains the nucleotide sequence: CAGAACAAAATAGTATTTTTGTTCACAACTGGGAGTGAAATCTGATTTCAAACCACTAAAAAGAATAGTGGAGACATGAAGAAAAAACGTTTTGTCTGAATGCTTTCTTGGGTAGTCAGAAATAAAAGCTGTTGTACGGAAGATCATATGAGGCTGCTATGGGTAGCAGCATCAAGTGTGGCAGTGGAGCAGAGAGAGATTGCATGCCACGGGGAGAGGAAATGTGGAAAATTACACATATCACCGTGAG (SEQ ID NO: 15).

[0151] In some embodiments, a third nucleic acid molecule containing the nucleotide sequence shown in SEQ ID NO: 14, SEQ ID NO: 15, or both is used to incorporate the exogenous reporter gene into site 5a.

[0152] In some embodiments, the 5' homologous arm comprises the nucleotide sequence: GGTCTGTGCAAACAGTGTTTCTCATGCAACTTGGCTGCCTTTAAATGGCTTACCAACTCTTTTCTGAAAAACCTAAAAAATGTCTGTGTGCCAAGTAAGATACTTCAATTCAAAAGGAGGTTTTTCAATTTTTTCTCTCAGTTTATCATTTCTTCTACTTGAAAAATATATTTTAATTTTAATGTTTTTTGTTTTATACAAAAATATATGAACTATGTATTACTATTGTCACCTGTCATTACCAAGAAGT (SEQ ID NO: 16).

[0153] In some embodiments, the 3' homologous arm contains the nucleotide sequence: ACATCACCAGGGCTGGAGGTTACATCCTGCTGGCCAAAACTACATTATGGTGGGTTAGCTAATTTTACAGGAGGGATAAATTGTGAGAATCTGGAAACCATAATCTTGACAAGAAAAAATTAACACCCAATTCCTTGGTGAGACTGGGCATTATATGGACATGGGAAATCTCACAGTCATGATATATGTTAGGAAGGAACTCTCCTTCAAGGGTCCAGGACTGTAAGTATTGGCCTGCCCCAACACTTGG (SEQ ID NO: 17).

[0154] In some embodiments, a third nucleic acid molecule containing the nucleotide sequences shown in SEQ ID NO: 16, SEQ ID NO: 17, and both is used to incorporate an exogenous reporter gene into site 14a.

[0155] In some embodiments, the 5' homologous arm contains the nucleotide sequence:TGAATGTGGAAAGTGAAGATAACTACTAGTGCAGCAAGCAGACATAGAGATTTTATAAAAGTGGATGGTGAGCATTGTTTGTTAGATACAAACCATTAAGCAGAGATGCCTAGTGACTCAGAGTACAGAGCTTCCTGACTGTCAACACTGACCATGACACTGACCACGTTATGATCCAGGAATAATAGAACCTGTATTTACTCTTAGATATTCTTAAATTGTAATCACAGAAGAGGACAAACAGTGATAG (SEQ ID NO: 21).

[0156] In some embodiments, the 3' homologous arm contains the nucleotide sequence:TCTATTGTCTCATAAGTCCTACCACTCAGGAATAAGGCTTATAAGAAACATGAGAAATGTGTAACTGTAGAGTGAGTTAGACATAGCCAGCAGCTATATACGTACCCATATGCTCACAGTCTCTCTCCTTCGCAGGATTAGGAAATAAAATTGGGTGAAAAAGGTTATAGATAAGACAGAGATAGAAAGATTGCTAATCATTTAACATATTTGATTTGGGCAAAGTAATTGAATACACTGTCAAGTAAAG (SEQ ID NO: 22).

[0157] In some embodiments, a third nucleic acid molecule containing the nucleotide sequences shown in SEQ ID NO: 21, SEQ ID NO: 22, and both is used to incorporate an exogenous reporter gene at site 7b.

[0158] In some embodiments, the 5' homologous arm contains the nucleotide sequence:CAAGAACATTAAAAAGAAACAGGATCTCTCTTGCTTTTGTTAAGAAAAAAAAACAGCAGCAGTACACCAAGAGCAGTTAAATTACTCTATTTAGAGATGTCTGAAACACTTCTAAAGCAAAGCAGGTAATACTTCAGGGACCATCTACAAGCTTGCAGTTTTAGCTCCCTTCTATAACTTTTCCAATTTGATCTTTCTGTGGAAAAATACAAAATTGTGTCTGTTTCTTGAAGACCGGTAACCAGAAAGT (SEQ ID NO: 23).

[0159] In some embodiments, the 3' homologous arm contains the nucleotide sequence:TATTTGTCAGAAAAATCTATCTGCATACTCATTTCTTTGAATGAGATTACAATCATGAGATGTCCACTATCTGCATTTTTGATCACTAGTGAAAACTCCTTCTTTCCAAAGCCACTGGTGATTATTGTTTATTTAGGAGAGCAGGCCTTTAAAAGAAATACTGTGGTCACCTGTGTGACTGAAAAAAGCACATATTCAATTCATGTGAATAACATTAGAAAGTTTCCAGGAACTGCTGATGATTCAAGCA (SEQ ID NO: 24).

[0160] In some embodiments, a third nucleic acid molecule containing the nucleotide sequences shown in SEQ ID NO: 23, SEQ ID NO: 24, and both is used to incorporate an exogenous reporter gene at site 8a.

[0161] In some embodiments, the 5' homologous arm comprises the nucleotide sequence: GAAACATCATTTATAGACTAAGTGTGTATATTATAAATCTGCTGATTGCATAGGTAAATTTTTTTCAGTATCATCTGCTGTCAAAATTTTGGCTGTGATGAAATCAACTTTCTTCATAGAAACTCATATAATGCTGTGCTTCGGATTTTTGATGAAAATAGTGATGATAATACACCAGTGTTCCAGTTGTGACAGAGCAGTGCTTACAGAGTCAAAAACTTTTTATTTTATTGTGCTATCCTGCCAATGA (SEQ ID NO: 25).

[0162] In some embodiments, the 3' homologous arm contains the nucleotide sequence:TGCTTTGCTTGCACATGCAGTAAACTTTTTTAATCTTAATTCATAAACTCTCACACTTTTACATTTCCAATTTTCACATCTTTAATCATCTGGGAGATGATTTCACATCCTCATCAAGTTTGTGGATGACCCAGAACTGAGGGCAGTGGCTAACTCACCAGAGTGCTGTGCTGCCATCTGGAGGAACTTGCACAGTTGGAGAAGGGCTGACAGGAACTTGATGGAGTTCTACATGGAGAAGGGAAAGTTC (SEQ ID NO: 26).

[0163] In some embodiments, a third nucleic acid molecule containing the nucleotide sequences shown in SEQ ID NO: 25, SEQ ID NO: 26, and both is used to incorporate an exogenous reporter gene into site 13a.

[0164] In some embodiments, at least one first nucleic acid molecule and one of the second and third nucleic acid molecules are operably linked. In some embodiments, at least one first nucleic acid molecule, a second nucleic acid molecule, and a third nucleic acid molecule disclosed herein are operably linked. In some embodiments, at least one first nucleic acid molecule and a second nucleic acid molecule are operably linked.

[0165] The term "operably ligated" is intended to mean that the nucleotide sequence of interest is ligated to one or more regulatory elements in a manner that enables the expression of the nucleotide sequence (for example, within an in vitro transcription / translation system, or within a host cell if the vector is introduced into a host cell).

[0166] In some embodiments, the kit further includes instructions for incorporating at least a second nucleic acid molecule encoding the RFP at at least one location on the Z sex chromosome of a female chicken, the at least one location being listed in Table 1. In some embodiments, the at least one location being listed in Table 3. In some embodiments, the at least one location is selected from site 4a, site 5a, site 13a, site 14a, or any combination thereof.

[0167] The term “encodes” is intended to mean, for example, that when the target nucleic acid is ligated to suitable regulatory sequences such as promoter and enhancer elements in a suitable vector (e.g., an expression vector), and when the vector is introduced into a suitable system or cell, the target nucleic acid can be transcribed and translated into either the desired polypeptide or the target protein in a suitable expression system. The term “nucleic acid” is intended to mean natural and / or synthetic linear, cyclic and continuous arrays of nucleotides and nucleosides, such as cDNA, genomic DNA (gDNA), mRNA and RNA, oligonucleotides, oligonucleosides, and their derivatives.

[0168] It should be understood that in some embodiments, at least one first and second nucleic acid sequence provided and used by the methods and kits of the present invention may be constructed and contained within a vector. As used herein, “vector” encompasses vectors such as plasmids, phagemids, viruses, embeddable DNA fragments, and other media that enable the incorporation of a DNA fragment into the host genome or enable the expression of an unincorporated genetic element. A vector is typically a self-replicating DNA or RNA construct containing a desired nucleic acid sequence and an operablely linked gene regulatory element that is recognized in a suitable host cell and results in translation of the desired spacer. Generally, gene regulatory elements may include prokaryotic promoter systems or eukaryotic promoter expression regulatory systems. Such systems typically include a transcription promoter and a transcription enhancer to increase the level of RNA expression. A vector typically includes an origin of replication that enables the vector to replicate independently of the host cell. In some further alternative embodiments, the expression vector used in the present invention may contain elements necessary to incorporate a desired exogenous reporter gene into chicken sex-specific chromosome Z.

[0169] Therefore, the term “regulatory and regulatory elements” includes promoters, terminators, and other expression regulatory elements. Such regulatory elements are described by Goddel [Goeddel et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)]. For example, any of the broad range of expression regulatory elements that control the expression of a DNA sequence when functionally ligated to a DNA sequence can be used in these vectors to express a DNA sequence encoding a desired protein using the method of the present invention.

[0170] As used herein, the term “promoter” refers to a group of transcriptional regulatory modules concentrated around the start site of RNA polymerase, i.e., RNA polymerase II. Each promoter consists of a separate functional module, each approximately 7–20 bp in length of DNA, containing one or more recognition sites for transcription activators or repressor proteins. Promoters may extend upstream or downstream of the transcription start site and may be of any size, ranging from a few base pairs to a few kilobases. In some embodiments, the promoter is a chicken cell promoter. In some embodiments, the promoter is located on the Z chromosome of a chicken cell. In some embodiments, the promoter is located within an inducible promoter.

[0171] As used herein, the term “inducible promoter” encompasses promoters that are activated only in response to specific stimuli. When activated, inducible promoters bind to RNA polymerase and transcription factors, enabling the transcription process.

[0172] Vectors may further include appropriate restriction sites for selecting vector-containing cells, antibiotic resistance, or other markers. Plasmids are the most commonly used form of vectors, but other forms of vectors that perform equivalent functions and are known or will be known in the art are also suitable for use herein. See, for example, Pouwels et al., Cloning Vectors: a Laboratory Manual (1985 and supplements), Elsevier, NY; and Rodriquez et al. (eds.), Vectors: a Survey of Molecular Cloning Vectors and their Uses, Buttersworth, Boston, Mass (1988), which are incorporated herein by reference.

[0173] In some embodiments, the vector is introduced into cells by standard methods including electroporation (e.g., From et al., Proc. Natl. Acad. Sci. USA 82, 5824 (1985)), heat shock, infection with a viral vector, high-speed ballistic penetration by small particles having nucleic acids either within or on the surface of a matrix of small beads or particles (Klein et al., Nature, 327, 70-73 (1987)), bioristic use of coated particles and needle-shaped particles, and Agrobacterium Ti plasmids.

[0174] In some embodiments, nucleic acid molecules are transcribed by RNA polymerase II (RNAP II and Pol II). RNAP II is an enzyme found in eukaryotic cells and is known to catalyze DNA transcription to synthesize mRNA and precursors of most snRNAs and microRNAs.

[0175] Beyond containing elements necessary for the transcription and translation of the inserted coding sequence (encoding the polypeptide disclosed herein), it will be understood that the expression constructs of the present invention may also include sequences designed to optimize the stability, production, purification, yield, or activity of the expressed polypeptide.

[0176] Unless otherwise specified, the concentration ranges, percentage ranges, or ratio ranges described herein are understood to include any integers and fractions of those ranges, such as 1 / 10 and 1 / 100 of an integer, as well as concentrations, percentages, or ratios.

[0177] Numerical ranges relating to the physical characteristics, size, weight, or length of polynucleotides, polypeptides, etc., described herein are understood to include any integer within the specified range unless otherwise specified.

[0178] In the description, unless otherwise specified, adjectives such as “substantially” and “about” modifying a condition or relational feature of one or more features of one embodiment of an embodiment of the present invention are understood to mean that the condition or feature is defined within the limits of the tolerances permitted for the operation of the embodiment for its intended use. Unless otherwise specified, the word “or” in this specification and the claims is considered to be an inclusive “or” rather than an exclusive “or” indicating at least one or any combination of the items to which it relates.

[0179] It should be understood that the terms “a” and “an” as used above and elsewhere in this specification refer to “one or more” of the enumerated components. Unless otherwise specified, it will be obvious to those skilled in the art that the use of the singular includes the plural. Thus, the terms “a,” “an,” and “at least one” are used interchangeably in this application.

[0180] The descriptions of various embodiments of the present invention are presented for illustrative purposes only and are not intended to be exhaustive or limitful to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the embodiments described. The terms used herein have been selected to best describe the principles of the embodiments, their practical applications to the art found in the market or technical improvements, or to enable those skilled in the art to understand the embodiments disclosed herein.

[0181] For a better understanding of these instructions, and without limiting their scope, all numbers representing quantities, percentages, or proportions, as well as other numerical values ​​used in the specification and claims, should be understood in all cases to be modified by the term "approximately," unless otherwise specified. Therefore, unless otherwise indicated, the numerical parameters described in the following specification and appended claims are approximations that may vary depending on the desired properties to be obtained. At a minimum, each numerical parameter should be interpreted by applying common rounding techniques in light of the reported number of significant figures.

[0182] In the description and claims of this application, the verbs “comprise,” “include,” and “have,” and each of their conjugations, are used to indicate that one or more objects of the verb are not necessarily a complete list of components, elements, or parts of one or more subjects of the verb. Other terms used herein shall be defined by their meanings well known in the art.

[0183] For clarity, it is understood that certain features of the Invention described in the context of separate embodiments may be provided in combination in a single embodiment. Conversely, for brevity, various features of the Invention described in the context of a single embodiment may be provided separately, in any suitable partial combination, or as appropriate in any other described embodiment of the Invention. Certain features described in the context of different embodiments are not considered essential features of those embodiments unless the embodiments would not function without those elements.

[0184] All publications, patents, and patent applications referenced herein are incorporated herein by reference in the same manner as each individual publication, patent, or patent application is specifically and individually indicated as being incorporated herein by reference. Furthermore, no citation or specification of any reference in this application should be construed as an endorsement that such reference is available as prior art of the present invention. Section headings should not necessarily be construed as restrictive to the extent in which they are used. [Examples]

[0185] In general, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, biotechnological, bioprocess, microbiological, and recombinant DNA technologies. Such technologies are well described in the literature. For example, "Molecular Cloning: A Laboratory Manual," Sambrook et al., (1989); "Current Protocols in Molecular Biology," Volumes I-III, edited by Ausubel, RM (1994); Ausubel et al., "Current Protocols in Molecular Biology," John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning," John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA," Scientific American Books, New York; Birren et al. (eds.), "Genome Analysis: A Laboratory Manual Series," Volumes 1-4, Cold Spring Harbor Laboratory Press, New York York (1998); Methods described in U.S. Patent Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook," Vols. I-III, Cellis, JE (eds.) (1994); "Culture of Animal Cells - A Manual of Basic Technique," Freshney, Wiley-Liss, NY (1994), 3rd edition; "Current Protocols in Immunology," Vols. I-III, Coligan, JEEdited by (1994); Stites et al. (eds.), "Basic and Clinical Immunology" (8th edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds.), "Selected Methods in Cellular Immunology", WH Freeman and Co., New York (1980); Molecular Cell Biology, Berk A. et al., 8th edition; Molecular Biotechnology: Principles and Applications of Recombinant DN, Glick BR., 5th edition; Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, Freshney IR, 7th edition; "Oligonucleotide Synthesis", Gait, MJ (eds.) (1984); "Nucleic Acid Hybridization", Hames, BD, and Higgins S J. (eds.) (1985); "Transcription and Translation", Hames, BD, and Higgins SJ (eds.) (1984); "Animal Cell Culture'', edited by Freshney, RI (1986); ``Immobilized Cells and Enzymes'', IRL Press, (1986); ``A Practical Guide to Molecular Cloning'', Perbal, B.See also (1984) and "Methods in Enzymology," Vols. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications," Academic Press, San Diego, CA (1990); and Marshak et al., "Strategies for Protein Purification and Characterization—A Laboratory Course Manual," CSHL Press (1996); all of these are incorporated by reference. Other general references are provided throughout this document. [Examples]

[0186] Bioinformatics to identify novel genome-safe harbor sites To identify genomic locations on the chicken Z chromosome that can be targeted by bioreporter expression cassettes, such as genes encoding red fluorescent proteins, we performed comprehensive bioinformatics analysis by applying robust criteria for assigning novel potential genome-safe harbor sites.

[0187] The inventors performed bioinformatics analysis based on criteria used in previously published studies aimed at identifying genome-safe harbor regions on other genomes. Differences in genome size and chromosome number were considered during the analysis (for example, the chicken genome contains approximately 1.2 Gb with 39 chromosomes, while the mouse genome and human genome contain approximately 2.5 Gb with 20 chromosomes and approximately 3 Gb with 23 chromosomes, respectively). The following criteria were established to identify safe harbor genome regions: Criterion 1: The distance from the genome region to the end of the gene must be 20kb or more. Criterion 2 - The distance from the genomic region to the cancer-related gene must be 120kb or greater. Criterion 3 - The distance from the genomic site to the microRNA (miRNA) must be 120kb or more. Criterion 4 - The genomic region must be located outside a CpG island. A CpG island generally represents one or more topological domains (TADs), enhancers, or promoters, which are transcription units. Criterion 5 - The genomic region must be located outside the superconserved genomic region. Criterion 6 - Genomic regions should exclude repeating elements.

[0188] The inventors performed bioinformatics analysis using a platform provided by the University of California, Santa Cruz (UCSC) genome browser.

[0189] Genome data, assembly, mapping, and sequencing: • UCSC Genome Browser Assembly ID: galGal6 • Sequence determination / assembly provider ID: Genome Reference Consortium GRCg6a • Assembly date: March 2018 Accession ID: GCF_2315.5 NCBI Genome ID: 111 (Gallus gallus) • NCBI Assembly ID: 1668981 • NCBI BioProject ID: 13342 ·NCBI BioSample ID:SAMN02981218

[0190] Genes and gene prediction: • TransMap alignment version 5 track (Last data update at UCSC: 2019-06-10) • TransMap Ensembl and GENCODE mapping version 5 • Ensembl gene prediction, source data version: 104 (Last data update at UCSC: 2021-05-25) • RefSeq gene prediction - annotation release from NCBI: NCBI Gallus gallus annotation release 104 (Last data update at UCSC: 2020-03-29) Non-chicken RefSeq genes • Chicken mRNA derived from GenBank • Non-chicken mRNA from GenBank • UniProt SwissProt / TrEMBL protein annotation (Source data version at UCSC: UniProt Knowledgebase Release2020_05)

[0191] miRNA prediction: miRBase • MiRscan

[0192] Expression and regulation: • CpG Island Track (Island < 300bp)

[0193] Comparative genomics: • Multiz alignment and preservation of vertebrates (multi-alignment of all 77 vertebrate species) ·Birds Chain and Net Alignments

[0194] Variation and repetition: Repeat elements identified by RepeatMasker (short scattered repeat sequences containing ALUs, long scattered repeat sequences, long terminal repeat sequences containing retroposons, satellites, microsatellites, low-complexity repeats, RNA repeats).

[0195] The inventors successfully identified 18 potential genomic locations on the Z sex chromosome through unbiased bioinformatics screening that met the applied stringent criteria. [Table 1] [Table 2] JPEG2026513245000004.jpg65162

[0196] Next, the inventors excluded genomic locations that did not meet the following cytogenetic criteria from genomic site numbers 1-18: Criterion 7 - The site should be located outside the centromere of the Z sex chromosome (approximately chrZ:42, 150,000-42, 260,000).

[0197] Criterion 8 - The site should be located outside of "ZW unpairing," which is a site with a potential risk of recombination between the Z and W sex chromosomes.

[0198] After applying genomic site numbers 1–18 to reference sites 7 and 8, the inventors narrowed their list to 10 locations on the Z sex chromosome, as shown in Table 3. Initially, of the 18 possible origin sites, only genomic locations within site numbers 3, 4, 5, 7, 8, 13, 14, and 15 were found to satisfy the cytogenetic criteria. Furthermore, by applying these cytogenetic criteria, the size of each genomic site that met these criteria was narrowed down. The newly narrowed safe harbor loci found to satisfy reference sites 1–8 were named by adding a lowercase letter to the origin site number (e.g., site 3a is the narrowed genomic location of site 3). As shown in Table 3, for site numbers 7 and 14, two potential distinct safe harbor loci were found for each site, designated site numbers 7a, 7b, 14a, and 14b, respectively. [Table 3]

[0199] Next, the inventors ranked the 10 sites listed in Table 3 according to an internal scoring system based on all the findings. As shown in Table 4, the top four sites were found to be sites 4a, 5a, 7b, and 14a. [Table 4]

[0200] Next, the inventors designed several gRNAs corresponding to site numbers 4a, 5a, 7b, and 14a, and evaluated their accessibility to Cas9 at these sites as well as their potential for gene editing and knock-in (KI). The gRNAs were designed using the CCTop-CRISPR / Cas9 targeting online prediction tool.

[0201] The gRNA was designed according to the following parameters: • Cas9: Streptococcus pyogenes Cas9 (one gRNA per site) • Protospacer adjacent motif (PAM) location: NGG • Genome targets: Gallus gallus, Ensemble V103 • Core length = 12bp • Protospacer length = 20 bp • Off-target score: CRISPRater score > 0.74. • Off-target maximum core mismatch = 2 • Off-target search methods: Comprehensive and exhaustive methods that cover the entire genome.

[0202] Of all the gRNAs tested, three gRNA molecules, designated gRNA6.1 (SEQ ID NO: 1), gRNA7.2 (SEQ ID NO: 2), and gRNA9.1 (SEQ ID NO: 3), were found to be the most suitable for DNA cleavage within site numbers 4a, 5a, and 14a, respectively. The sequences of these gRNAs are listed in Table 5 below. Therefore, of the original 18 potential sites, three genomic sites within the Z sex chromosome were ultimately selected, and three corresponding gRNA molecules were chosen for further evaluation. [Table 5]

[0203] The next objective was to evaluate the potential efficiency of gene editing at the top three sites mentioned above using the corresponding gRNA molecules (Table 5). Cas9 / guide RNA (gRNA) ribonucleoprotein (RNP) complexes were separately electroporated into DF1 cells, a chicken embryo fibroblast cell line, and the DNA cleavage efficiency at the top sites, sites 4a, 5a, and 14a, was tested using the corresponding gRNA molecules. DNA samples were tested using the T7 endonuclease I (T7EI) mismatch cleavage assay, which determines on-target genome editing and provides an estimate of genome editing efficiency in CRISPR-treated cells.

[0204] As shown in Figure 1, the T7E1 assay revealed that 85.1%, 41.1%, and 45.8% of the dsDNA molecules were cleaved by Cas9 / gRNA RNP complexes containing gRNA6.1, gRNA7.2, and gRNA9.1, respectively. Therefore, these loci are relatively likely to be suitable for insertion of exogenous RFP reporter genes.

[0205] Next, the DNA samples were subjected to Sanger sequencing, followed by TIDE analysis to track DNA insertions and deletions (indels). As shown in Figure 2, the highest percentage of indels was observed in the tested gRNA molecules: gRNA6.1 (SEQ ID NO: 1), gRNA7.2 (SEQ ID NO: 2), and gRNA9.1 (SEQ ID NO: 3), compared to other candidate gRNA molecules.

[0206] Accordingly, the inventors conclude that a specific, improved, non-obvious safe harbor site has been devised for the proper incorporation of the nucleic acid sequence of the exogenous reporter gene encoding RFP into the chicken Z sex chromosome, following the narrowing process disclosed herein. [Examples]

[0207] Molecular and functional characterization of genome-edited chicken PGCs. To ensure the successful generation of at least three DsRed-positive PGCs, which are essential for subsequently creating chimeric male chickens and sex-detectable flocks, the inventors focused on five SHL sites. Selection criteria included culture viability, growth rate, and fluorescence stability. After careful evaluation, the inventors preferred the three SHL sites that showed the most promising results.

[0208] The five SHLs initially targeted are shown in Table 6. [Table 6]

[0209] Generally, the workflow for each site encompassed five steps: (1) evaluation of various guide RNAs (gRNAs) targeting genomic sites to facilitate DNA cleavage by Cas9; (2) construction of two plasmids per site: (i) a CRISPR / Cas9 plasmid containing spCas9 and selected site-specific gRNA, and (ii) a DsRed HDR cassette adjacent to the site-specific homologous arm; (3) introduction of the plasmid into PGCs derived from male Lohmann-LSL chicken embryos; (4) execution of a sorting procedure to enrich DsRed-positive cells; and (5) molecular validation to confirm the accurate integration of DsRed into each of the desired SHLs.

[0210] result Discovery of gRNAs suitable for each target genomic site. The inventors designed gRNAs with the following specifications for each of the five genomic SHLs using the CCTop online tool: Cas9: Streptococcus pyogenes Cas9 (one gRNA per site) Protospacer adjacent motif (PAM) location: NGG Genome targets: Gallus Gallus, Ensemble V103 Core length = 12bp Protospacer length = 20 bp Off-target score: CRISPRater score > 0.74. Off-target maximum core mismatch = 2 Off-target search methods: Comprehensive and exhaustive methods that cover the entire genome.

[0211] The inventors designed 2 to 4 gRNAs for each SHL, excluding sites 4a and 14a, where they had previously designed high-quality gRNAs.

[0212] Each gRNA was tested as a ribonucleoprotein (RNP) complex with Cas9 in the chicken DF1 cell line using electroporation.

[0213] DF1 cells were collected 2-3 days after electroporation, and DNA was extracted and evaluated for DNA cleavage using the T7 assay.

[0214] T7 products were analyzed on agarose gels and compared with untransfected and uncleaved control groups (Figure 3), and then subjected to sequencing for cleavage quantification via an online TIDE analysis tool.

[0215] gRNAs that showed efficient cleavage rates in both gel electrophoresis and TIDE analysis were selected for further steps (Tables 7-8). [Table 7] [Table 8]

[0216] Plasmid cloning Based on the selected gRNA sequences, two plasmids were designed for each genomic region.

[0217] (1) CRISPR / Cas9 plasmid This plasmid contains spCas9 along with site-specific gRNA under the human U6 promoter. Furthermore, EGFP acts as a reporter gene for evaluating the effectiveness of transfection.

[0218] Plasmids were sequenced to verify the accurate sequences of key segments, including the Cas9 promoter and ORF, as well as the U6 promoter and gRNA sequence. Sequencing revealed mutations in sites 4a and 14a. As a result, the inventors used plasmids from other sites exhibiting the correct sequences to clone gRNAs targeting sites 4a and 14a. In these examples, the gRNA promoter was obtained from chicken U6. The resulting cloned products were validated by Sanger sequencing.

[0219] (2) DsRed HDR plasmid This plasmid contains a DsRed cassette containing the CBh promoter, ORF, and SV40 PolyA signal. The cassette is adjacent to a 250 bp site-specific homologous arm, which facilitates integration into the Z chromosome break region (Table 9). All cloned plasmids were validated by Sanger sequencing. [Table 9] JPEG2026513245000012.jpg78162

[0220] Plasmid insertion into male-derived Lohmann-LSL PGC To promote the integration of the DsRed gene into the desired SHL on the Z chromosome, PGCs were co-transfected with CRISPR / Cas9 and the DsRed HDR plasmid.

[0221] CRISPR / Cas9 plasmids induce double-strand breaks at target genomic loci, while DsRed plasmids promote repair by incorporating DsRed cassettes into the break sites.

[0222] Two to three days after transfection, GFP and DsRed fluorescence signals were observed in PGCs (Figure 4). These signals exhibited distinct green and red fluorescence, and a large number of cells were positive for both signals.

[0223] Selection procedure for enriching DsRed-positive cells To isolate cells exhibiting stable expression of the DsRed fluorescent protein, the red cell population was subjected to multiple sorting procedures. For each specific genomic region of the target, cells were sorted approximately four times at intervals of 1-2 weeks until consistently stable red PGC culture was achieved (Figure 5).

[0224] Of the five target SHLs, three—4a, 14a, and 13a—showed robust and consistent fluorescence in their cultures, along with sustained growth. Subsequently, these three stable DsRed + PGC cultures were grown.

[0225] Molecular verification of the correct integration of DsRed into the desired SHL To verify the precise integration of the DsRed cassette within the SHL on the Z chromosome of three stable PGC cultures, two PCR assays were performed using primers adjacent to either the 5' or 3' homologous arm of the cassette (Table 10). [Table 10]

[0226] PCR analysis yielded the expected product size (Figure 6), confirming successful amplification of the target sequence. Sanger sequencing further verified the expected sequence integration within the SHL.

[0227] Example 3 Intraooocyte injection of PGC to verify fluorescence properties To demonstrate that the genome-integrated DsRed cells disclosed herein (e.g., DsRed-positive PGCs) are detectable through the eggshell, either a control (e.g., unedited PGCs) or gene-edited PGCs containing the DsRed gene were injected into fertilized eggs. The number of injected cells was equivalent to the number of cells in the embryo of the oocyte on day 3 of embryonic development.

[0228] The results show that no fluorescence signal was detected when unedited parental PGCs were injected (Figure 7B). In contrast, a clear fluorescence focus was observed when DsRed-positive chicken PGCs were injected.

[0229] Therefore, it can be concluded that chicken PGCs containing a DsRed coding sequence integrated into a safe harbor region within the PGC genome were successfully produced. Those skilled in the art will recognize that fully grown chickens can be obtained from the disclosed PGCs according to methods known in the art.

[0230] Although the present invention has been described in detail, those skilled in the art will understand that many modifications and changes can be made. Therefore, the present invention should not be construed as being limited to the embodiments specifically described, and the scope and concepts of the present invention will be more readily understood by referring to the following claims.

Claims

1. A transgenic female chicken having a recombinant Z sex chromosome containing a nucleic acid sequence of an exogenous reporter gene encoding red fluorescent protein (RFP) at at least one position on the Z sex chromosome of a female chicken, wherein the at least one position is listed in Table 1.

2. The transgenic female chicken according to claim 1, wherein the at least one location is selected from the group consisting of part 3, part 4, part 5, part 7, part 8, part 13, part 14, part 15, and any combination thereof.

3. The transgenic female chicken according to claim 1 or 2, wherein the at least one of the positions is listed in Table 3.

4. The transgenic female chicken according to claim 3, wherein the at least one location is selected from the group consisting of part 4a, part 5a, part 7b, part 13a, part 14a, and any combination thereof.

5. The transgenic female chicken according to claim 4, wherein the at least one position is selected from the group consisting of part 4a, part 13a, part 14a, and any combination thereof.

6. The transgenic female chicken according to any one of claims 1 to 5, wherein the RFP is characterized by an excitation wavelength of 500 to 650 nm and an emission wavelength of 550 to 650 nm.

7. Cells obtained from or induced from a transgenic female chicken according to any one of claims 1 to 6.

8. The cell according to claim 7, which is a primordial germ cell (PGC).

9. A method for determining the sex of a chicken embryo in an unhatched egg, which contains the embryo within a structurally unified shell, (a) A step of obtaining at least one unhatched egg containing an embryo within a structurally integrated shell from a transgenic female chicken according to any one of claims 1 to 6, (b) A step of determining whether a red fluorescent signal is detected in the embryo present in the unhatched egg, wherein the detection of the red fluorescent signal indicates the expression of the RFP in the embryo within the structurally integrated shell of the unhatched egg, and therefore indicates the presence of the recombinant Z chromosome in the embryo. This involves a step of determining that the chicken embryo in the unhatched egg is a male embryo. A method that includes this.

10. The absence of a red fluorescent signal in the embryo present in the unhatched egg indicates that RFP is not expressed in the embryo, and therefore, that the recombinant Z chromosome is not present in the embryo. The method according to claim 9, wherein the chicken embryo of the unhatched egg is determined to be a female embryo.

11. The method according to claim 9 or 10, further comprising the step of exposing the unhatched egg containing the embryo within a structurally integrated shell to a light source.

12. The method according to any one of claims 9 to 11, further comprising a proceeding step preceding step (b), which includes isolating at least one female embryo of the transgenic female chicken.

13. A kit comprising at least one first nucleic acid molecule encoding a guide RNA (gRNA) containing the nucleotide sequence described in any one of SEQ ID NOs: 1-3 and 18-20.

14. The kit according to claim 13, further comprising at least one second nucleic acid molecule encoding either clustered, regularly spaced short palindromic sequence repeat (CRISPR)-associated protein 9 (Cas9), RFP, or both.

15. The kit according to claim 14, further comprising instructions for incorporating the at least second nucleic acid molecule encoding the RFP into at least one position on the Z sex chromosome of a female chicken, wherein the at least one position is listed in Table 1.

16. A method for producing chickens containing a recombinant Z sex chromosome, (a) A step of obtaining at least one transgenic PGC, which includes a recombinant Z chromosome containing the nucleic acid sequence of an exogenous reporter gene encoding RFP at at least one position on the chicken Z sex chromosome as described in Table 1, (b) The step of implanting the transgenic PGC into a receptive chicken embryo, This produces chickens containing the recombinant Z sex chromosome. method.

17. The method according to claim 16, comprising a step preceding step (a) of incorporating the nucleic acid sequence of an exogenous reporter gene encoding an RFP into at least one position on the Z sex chromosome of the PGC as listed in Table 1, thereby obtaining the transgenic PGC.

18. The method according to claim 16 or 17, wherein the at least one of the positions is listed in Table 3.

19. The method according to any one of claims 16 to 18, wherein the at least one location is selected from the group consisting of part 4a, part 13a, part 14a, and any combination thereof.

20. The method according to any one of claims 16 to 19, wherein the nucleic acid sequence of an exogenous reporter gene encoding an RFP is incorporated into the position on the Z sex chromosome using a CRISPR type II system comprising a Cas9 protein and gRNA.

21. The method according to claim 20, wherein the gRNA comprises the nucleotide sequence described in any one of SEQ ID NOs: 1, 3, and 20.

22. The method according to claim 21, wherein the nucleic acid sequence of the exogenous reporter gene is incorporated into site 4a, site 13a, or site 14a using the Cas9 protein and a gRNA containing the nucleotide sequence described in SEQ ID NO: 1, SEQ ID NO: 20, or SEQ ID NO: 3, respectively.