High-performance spatial mapping of individual targets using releaseable handshake sequences
Functionalized molecules with handshake sequences address limitations in spatial characterization by enhancing resolution and recovery rates, enabling simultaneous mapping of multiple analytes in biological samples.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- TAKARA BIO USA INC
- Filing Date
- 2024-03-28
- Publication Date
- 2026-05-11
AI Technical Summary
Current methods for spatially characterizing analytes in samples are limited by resolution, signal-to-noise ratio, recovery rate, diffusion, and the ability to characterize different types of analytes simultaneously, particularly in biological samples like single cells and nuclei.
The use of functionalized molecules with handshake sequences, such as oligonucleotides and antibodies, to tag and localize individual nuclei and cells, enabling high-resolution spatial mapping and simultaneous characterization of multiple target types.
Enhances spatial resolution, improves target recovery rates, and allows for simultaneous mapping of multiple analytes, including proteins and nucleic acids, in biological samples, with improved signal-to-noise ratio and reduced diffusion.
Smart Images

Figure 2026514410000001_ABST
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application claims the interests of U.S. Provisional Patent Application No. 63 / 455,502, filed on 29 March 2023, and U.S. Provisional Patent Application No. 63 / 557,828, filed on 26 February 2024, both of which are incorporated herein by this reference in their entirety.
[0002] The present invention generally relates to the field of sample characterization, and more specifically to novel and useful systems, methods, and compositions for characterizing sample targets including single cells and single nuclei. [Background technology]
[0003] With growing interest in understanding the distribution of specific target analytes within biological samples, improved compositions, methods, and systems enabling analyte mapping are becoming increasingly valuable. Current techniques are limited by resolution (e.g., with respect to the location of the target analyte), the ability to characterize locations in multiple dimensions, the ability to characterize locations across different scales, the ability to characterize different types of analytes, the ability to characterize target locations in situ, and / or other limitations. Furthermore, there is a need for streamlined approaches for spatial mapping that also have the ability to process and recover sample targets related to single cells and single nuclei. Therefore, the field of sample characterization requires novel and useful systems, methods, and compositions for characterizing sample targets with spatial mapping capabilities. [Overview of the project]
[0004] Currently, methods and systems for spatially characterizing analytes in samples (e.g., in situ, in vitro, etc.) are limited with respect to resolution (e.g., with respect to the potential number of target analytes that can be characterized per unit area or volume), low signal-to-noise ratio (e.g., due to high levels of background noise), recovery rate of material from single nuclei and / or single cells of the sample being spatially characterized, diffusion of targets intended to be characterized from their origin within tissue samples, underutilization of space between interaction sites due to manufacturing or physical constraints, the ability to characterize target samples in multiple dimensions, the ability to characterize different types of analytes simultaneously (e.g., whole transcriptome characterization capability), and / or other methods.
[0005] Accordingly, this disclosure describes embodiments, modifications, and examples of systems, methods, and compositions for performing spatial biology (e.g., spatial transcriptomics, spatial proteomics, spatial multiomics, etc.) in a manner that provides broader transcriptome applications while achieving a high level of spatial resolution. This disclosure describes embodiments, modifications, and examples of methods and systems for spatially localizing individual nuclei and / or individual cells of a sample being processed. This disclosure describes embodiments, modifications, and examples of methods and systems for spatially localizing other sample targets (e.g., proteins, etc.) in space based on the reactive sequences of functionalizing molecules involved.
[0006] Embodiments of this disclosure provide embodiments, variations, and examples of systems, methods, and compositions for efficiently tagging target substances (e.g., DNA, RNA, miRNA, proteins, small molecules, single analytes, multiple analytes, etc.) to enable analysis for characterizing the localization of target substances in space. In the case of nucleic acid targets, the handshake sequences of the compositions described may include molecules complementary to the nucleic acid target (e.g., complementarity based on poly-A / poly-T interactions, complementarity based on interactions between polyadenylated mRNA and other nucleic acids incorporating U bases and / or T (e.g., sequentially, discontinuously, with patterns, without patterns), complementarity based on the sequence of the specific target being tagged, complementarity based on the sequence of a platform for the tagging molecule, etc.). In the case of protein or small molecule targets, the handshake sequences, described in more detail below, may include antibodies or aptamers conjugated with specific nucleic acid sequences for detection.
[0007] Functionalized molecules incorporating a handshake sequence may further include one or more modifications that enhance diffusion to a sample target (e.g., the nucleus). For example, functionalized molecules incorporating a handshake sequence may include one or more lipid moieties that enhance diffusion to the nucleus and / or other intracellular components.
[0008] Targets may include cytoplasmic targets, intracellular targets, or other targets on the surface or inside of cells (or cellular components). For example, targets may include cytoplasmic targets and cell targets or nucleus-related targets derived from the same tissue, thereby enabling simultaneous mapping of multiple target types in a highly parallel manner. Alternatively, the generated maps of nuclear / cellular targets can be integrated with other maps characterizing the distribution of other tissue components according to the described method. Targets may further or / or include protein targets and / or other spatially distributed targets of the sample.
[0009] In one embodiment, characterizing the nuclei of a sample involves generating a set of labeled nuclei by tagging a set of nuclei with a first set of oligonucleotides (e.g., oligonucleotides having handshake sequences that uniquely tag each nucleus in the set with one or more barcodes that can function as spatial addresses); and separating and attaching the set of labeled nuclei in the interstitial space of the distribution of functionalized particles bound to the substrate (e.g., "Systems and Methods for Characterizing Locations of Target Analytes in Multi-Dimensional" filed August 25, 2022). Embodiments, variations, or examples of the system described in U.S. Patent Application No. 17 / 895,633, titled "Space" (which is incorporated herein in its entirety by this reference), wherein each functionalized particle is separated and positioned to come into contact with at most one labeled nucleus of a set of labeled nuclei; generates a single-nucleus sequencing library from amplicons produced from a set of reactions including a set of molecules of the distribution of labeled nuclei and functionalized particles; and returns a single-nucleus analysis of the set of nuclei when processing the single-nucleus sequencing library. Illustrative outputs of the described processes may include a single-nucleus whole transcriptome library (e.g., representing gene expression information of the set of nuclei) and a spatial library including the spatial position of each nucleus in the set of nuclei. In the variations, diffusion can be reduced by covering the substrate (e.g., with a compound or another material at an optimal cutting temperature). Furthermore, in the described scenario, the nuclei are labeled with a handshake sequence that uniquely tags each nucleus in the set of nuclei with one or more barcodes that can function as spatial addresses, so it may not be necessary to decode the substrate.
[0010] In one embodiment, characterizing sample cells (e.g., single cells) involves generating a set of labeled cells by tagging the set of cells with a first set of oligonucleotides (e.g., oligonucleotides having handshake sequences that uniquely tag each cell in the set of cells with one or more barcodes that can function as spatial addresses); and separating and attaching the set of labeled cells in the interstitial space of the distribution of functionalized particles bound to a substrate (for example, "Systems and Methods for Characterizing Locations of Target Analytes in Multi-Dimensional" filed August 25, 2022). Embodiments, variations, or examples of the system described in U.S. Patent Application No. 17 / 895,633, titled "Space" (which is incorporated herein in its entirety by this reference), wherein each functionalized particle is isolated and positioned in contact with at most one labeled cell of a set of labeled cells; generates a single-cell sequencing library from an amplicon produced from a set of reactions including a set of molecules of the distribution of the labeled cells and functionalized particles; and returns a single-cell analysis of the set of cells when processing the single-cell sequencing library. Illustrative outputs of the described process may include a single-cell whole transcriptome library (e.g., representing gene expression information of the set of cells) and a spatial library including the spatial location of each cell in the set of cells. In the variations, the substrate can be coated (e.g., with a compound or another material at an optimal cutting temperature) to reduce diffusion. Furthermore, in the described scenario, the cells are labeled with handshake sequences that uniquely tag each nucleus in the set of nuclei with one or more barcodes that can function as spatial addresses, so that it may not be necessary to decode the substrate.
[0011] In one embodiment for characterizing a set of single cells or single nuclei in multidimensional space, the method is to combine a set of functionalized particles with a set of single cells and / or a set of single nuclei, where the ratio of the number of functionalized particles to the number of single cells and / or single nuclei is greater than 1 (e.g., 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, etc.) and the recess of the set of functionalized particles. The method involves: holding single cells and / or single nuclei within (e.g., gaps, pores, other surface features, etc.) (e.g., a single cell or single nucleus is associated with at most one functionalized particle of the set of functionalized particles); and stabilizing the set of functionalized particles together with the associated single cells and / or single nuclei within a matrix (e.g., a hydrogel matrix, other matrices), wherein the matrix can transition between solidified and non-solidified phases, and the matrix allows diffusion of material below a first size threshold to the functionalized particles. Stabilizing to allow diffusion to and / or between sets of functionalized particles and to prevent diffusion of material exceeding a second size threshold; lysing a set of single cells (if single cells exist) with lysis buffer, with or without raising the temperature of the lysis buffer, the lysis buffer is introduced into the set of single cells through the matrix; performing a hybridization operation between the contents of the set of single cells and / or single-nucleus sets (e.g., mRNA content, other nucleic acid content, conjugated protein content, etc.) and a set of functionalized particles, wherein the contents of the single cells or single-nucleus sets can hybridize with multiple functionalized particles from the set of functionalized particles, and the hybridization operation tags the target contents of the single cells or single-nucleus sets using one or more described handshake sequences; and, after the hybridization operation, transitioning the matrix from the solidified phase to the non-solidified phase in coordination with performing reverse transcription, second-strand synthesis, and cDNA amplification operations;The method includes: generating a sequencing library from amplicons produced from a cDNA amplification operation; and, upon processing the sequencing library, returning a single-cell and / or single-nucleus analysis of a set of cells / nuclei, wherein a subset of functionalized particles associated with the target substance from the single cell / nucleus is associated based on a barcode (e.g., spatial barcode, cellular barcode) having a nucleotide sequence (e.g., probabilistic sequence) associated with the single cell / nucleus. The described method, when combined with spatial information (e.g., using the described spatial barcode), may enable the association between genotypic and phenotypic features of a biological sample material.
[0012] Labeling the nuclei or cells of a sample includes: treating a sample containing a set of nuclei with a substrate containing a distribution of functionalized particles (e.g., by the ability to decode the location of the functionalized particles via a barcode sequence that can function as a spatial address sequence, as described below); tagging the set of nuclei or cells with a handshake sequence released (e.g., when cleaving functionalized molecules from the functionalized particles), wherein the handshake sequence contains a barcode sequence that functions as a spatial address sequence; isolating the nuclei of a set of nuclei and / or other targets of the sample; and determining the location of the nuclei of a set of nuclei when sequencing molecules generated from the distribution of functionalized particles. Optionally, in some embodiments, the method may include tagging (e.g., microfluidic tagging, tagging in microwells, tagging in partitions, tagging in droplets of emulsion) and barcoding nuclear targets (e.g., mRNA, other nuclear targets) with barcodes that can function as spatial addresses after the isolation of the nuclei. Tagging may include tagging using a membrane from which a handshake sequence can be released (e.g., a nitrocellulose membrane, or other membranes). Nuclear target identification can be further optionally performed without sequencing, using optical detection of nuclear targets tagged with a probe during nuclear tagging and barcoding.
[0013] In some embodiments, the substrate may include functionalized particles comprising a first subset of functionalized particles for tagging nuclear targets of a sample (e.g., using a described handshake sequence) and a second subset of functionalized particles for tagging cytoplasmic targets of a sample. In other embodiments, the substrate may include functionalized particles for tagging only nuclear targets of a sample (e.g., nuclear RNA) using a handshake sequence. In some embodiments, the substrate may include functionalized particles for tagging only cytoplasmic targets of a sample (e.g., cytoplasmic RNA) (e.g., using a handshake sequence or as described in the application incorporated by reference). In some embodiments, the substrate may be functionalized with functionalized particles to tag an entire single cell of a sample having a handshake sequence.
[0014] In relation to tissue processing, the Disclosure provides methods, systems, and devices for tagging targets (e.g., cytoplasmic targets) exposed during tissue processing (e.g., tissue thinning, tissue sectioning) with sequences that function as spatial addresses, and for spatially labeling individual nuclei and / or other intracellular components (e.g., using the handshake sequences described below). The described methods may include determining the cell body position of a sample (e.g., based on the nuclear position) and performing single-cell analysis techniques in coordination with spatial analysis of single cells and other targets, the analysis techniques of which may include single nuclear RNA-seq (e.g., snRNA-seq, scRNA-seq, etc.), T cell receptor (TCR) analysis, B cell receptor (BCR) analysis (e.g., including receptor-ligand characterization), ATAC-seq for assessment of chromatin accessibility, processing of nuclear and non-nuclear targets of formalin-fixed and paraffin-embedded (FFPE) samples, generation of Hi-C sequencing libraries, generation of other single-cell sequencing libraries, analysis of nuclear DNA, analysis of nuclear proteins, and / or other analyses.
[0015] Embodiments of this disclosure also provide embodiments, variations, and examples of systems, methods, and devices for precisely determining the location of nuclei in a sample (e.g., relative location, location on a substrate having functionalized particles, location relative to another reference point or reference surface). In embodiments in which nuclei are tagged using a handshake sequence of molecules of functionalized particles, nucleus tagging may include tagging nuclei with different molecules associated with different spatial locations (e.g., when photocutting handshake molecules for diffusion toward the nuclei). Thus, determining the location of nuclei may include determining the location based on a subset of locations corresponding to a subset of barcode sequences of molecules tagged to the nuclei, where the barcode sequences function as spatial addresses, and approximate spatial addresses may be determined from the barcode sequences (e.g., when determining the centroid location from the spatial addresses of each barcode sequence). In some variations, the approximate location of nuclei can be determined from the average location of a subset of probabilistic barcodes (e.g., the centroid of the locations of the subset of probabilistic barcodes). In various variations, nuclei may be tagged using a combination of cleavable and non-cleavable molecules, and as a result, the position of the nucleus can be determined from the barcode positions of the cleavable and non-cleavable molecules (e.g., as a weighted centroid of the position, where the position of the non-cleavable component is weighted more than the position of the cleavable component). Thus, the position estimated from the barcode, which acts as a spatial address, can be an estimate of the position within or on the sample, within or on a feature (e.g., functionalized particles), or a combination thereof.
[0016] The location of each cell / nucleus tagged with a handshake sequence can be determined from sequencing of the generated library. For example, the cell barcode sequence of a functionalized molecule, including the handshake sequence, may include a UMI sequence, and the location of each cell / nucleus in the processed sample is determined (e.g., by the number of sequences) based on the sequence of the UMI sequenced for each spatial location (determined from the barcode which can function as a spatial address) that has the same cell barcode / UMI sequence.
[0017] In relation to tagging and mapping nuclear targets, the Disclosure provides embodiments, variations, and examples of systems, methods, and compositions for generating spatial maps with improved nuclear target recovery rates of over 15%, over 20%, over 25%, over 30%, over 35%, over 40%, over 45%, over 50%, over 60%, over 70% or more (for example, with respect to the actual number of nuclear targets present). In some examples, the Disclosure provides embodiments, variations, and examples of systems, methods, and compositions for generating spatial maps with improved nuclear target recovery rates (for example, with respect to the actual number of nuclear targets present), where the number of nuclear targets recovered from tissue sections (e.g., embryonic tissue sections, other tissue sections) is over 50,000, over 60,000, over 70,000, over 80,000, over 90,000, over 100,000, over 110,000, over 120,000, and 13 The nuclei can be greater than 0,000, greater than 140,000, greater than 150,000, greater than 160,000, greater than 170,000, greater than 180,000, greater than 190,000, greater than 200,000, greater than 250,000, greater than 300,000, or more (for example, for tissue sections from 5 micrometers to 40 micrometers in thickness, and on surfaces greater than 3 mm × 3 mm, greater than 10 mm × 10 mm, or other suitable dimensions, where various tissue types are described). The nuclei recovery rate can be determined during sample separation and nuclei counting (e.g., via cytometry-based methods). Alternatively, the nuclei recovery rate can be determined when nuclei sequencing is performed. Alternatively, the nuclei recovery rate can be determined when nuclei are spatially positioned during mapping (e.g., after sequencing the nuclei and barcode sequences that serve as corresponding spatial addresses). In particular, nucleus retention rates are usually poor due to losses during sample processing and nucleus isolation, and this disclosure provides methods for improving nucleus recovery and retention rates. Recovery rate can be determined as the percentage of nuclei initially present in the sample.
[0018] In connection with tagging of nuclei and / or other targets of a sample with functionalized molecules of functionalized particles, the functionalized molecules can include unique molecular identifiers (UMIs). The present disclosure provides embodiments, variations, and examples of systems, methods, and compositions for recovering more than 2000 UMIs per nucleus / target, more than 2500 UMIs per nucleus / target, more than 3000 UMIs per nucleus / target, more than 3500 UMIs per nucleus / target, more than 4000 UMIs per nucleus / target, more than 4500 UMIs per nucleus / target, more than 5000 UMIs per nucleus / target, more than 5500 UMIs per nucleus / target, more than 6000 UMIs per nucleus / target, more than 6500 UMIs per nucleus / target, more than 7000 UMIs per nucleus / target, more than 7500 UMIs per nucleus / target, more than 8000 UMIs per nucleus / target, more than 8500 UMIs per nucleus / target, more than 9000 UMIs per nucleus / target, more than 9500 UMIs per nucleus / target, more than 10,000 UMIs per nucleus / target, more than 20,000 UMIs per nucleus / target, or more. Thus, the systems, methods, and devices described can achieve higher UMI capture per nucleus / target compared to existing single-cell techniques and other state-of-the-art techniques.
[0019] Aspects of the present disclosure also provide embodiments, variations, and examples of systems for generating a spatial map of a set of targets of a sample, wherein the empty / unused space between features of a substrate (e.g., beads or other particulate bodies, rods, protrusions, recesses, ridges, valleys, channels, wells, oligonucleotide spots, etc.) for generating such a spatial map is 45 micrometers, 40 micrometers, 35 micrometers, 30 micrometers, 25 micrometers, 20 micrometers, 15 micrometers, 10 micrometers, 9 micrometers, 8 micrometers, 7 micrometers, 6 micrometers, 5 micrometers, 4 micrometers, 3 micrometers, 2 micrometers, 1 micrometer, 0.5 micrometer, 0.25 micrometer, less than 0.1 micrometer, or an intermediate distance.
[0020] Aspects of the present disclosure provide embodiments, variations, and examples of systems, methods, and compositions for spatially characterizing samples in multiple dimensions (e.g., 2D, 3D, 4D including a time component) in relation to the overall structure of an organism, tissue pieces (e.g., histologically, in relation to biopsy tissue, in relation to seeded natural scaffolds, in relation to seeded synthetic scaffolds (such as cell-seeded hydrogel scaffolds, cell-seeded polaxomer scaffolds, etc.), in relation to frozen cell test pieces (such as sectioned fresh frozen tissue samples), in relation to formalin-fixed and paraffin-embedded (FFPE) test pieces, fresh frozen plasma, frozen cell suspensions, cell suspensions held in media / hydrogel media organs, whole organisms, organoids, cell suspensions, single cells, organelles, sub-organelle structures, intra-organelle components, mitochondrial targets, viruses, microorganisms, and other natural structures. The cells can include mammalian cells, bacteria, microorganisms, plant cells, fungal cells, or other cell / cell-like components.
[0021] The characterization of the location can additionally or alternatively be performed in relation to non-natural structures such as microwells, microarrays, scaffolds, gels, and other non-naturally occurring structures. For example, a handshake sequence that can interact with a target (e.g., by diffusion, etc.) can be incorporated onto the surface of the described structures.
[0022] The present invention(s) can additionally or alternatively have in situ and / or in vivo applications involving the injection of functionalized particles into a sample (e.g., into a cell, into a tissue, into an organ, etc.). Examples of injection can include one or more of injection, electroporation, the use of vectors (such as viral vectors), and other injection methods.
[0023] In relation to mapping different target types using the same unit of a system for tagging multiple target types (e.g., using handshake sequences), the present invention(s) can achieve single-cell type / subtype mapping of a sample from the same sample, using the same unit of a system (e.g., distribution of functionalized particles bound to a substrate), in addition to mapping the distribution of nuclear targets, cytoplasmic targets, and / or other targets.
[0024] Aspects of the present disclosure provide embodiments, variations, and examples of methods for generating a spatial map of the target distribution of a sample by a set of processes, the set of processes may include: receiving a sample on a substrate containing a distribution of functionalized particles, each of which the distribution of functionalized particles contains a barcode sequence (e.g., a probabilistic barcode sequence that functions as a spatial address) paired with a position on the substrate (with decoding of the position of the probabilistic barcode sequence before use for target mapping); preparing the sample for interaction between the target distribution of the sample and the distribution of functionalized particles (e.g., when transferring heat to the surface of the substrate opposite the distribution of functionalized particles in a frozen sample); applying a series of reactions to the sample on the substrate; obtaining a set of sequences of a collection of molecules produced from the set of reactions, the set of sequences relating to the target distribution labeled using the probabilistic barcode sequence of the distribution of functionalized particles; and, when processing the set of sequences, returning a set of positions of the target distribution.
[0025] Aspects of this disclosure also provide embodiments, variations, and examples of systems, methods, and compositions configured for high-level parallel sample processing, which allow a sample to be refreezed for a certain period (e.g., at 0°C, -20°C, -80°C, etc.) before performing subsequent processing steps for target mapping (e.g., after thawing) without causing significant degradation of mapping performance (e.g., in relation to the described performance and quality indicators) upon receipt of the sample on the substrate.
[0026] In relation to quality metrics, aspects of this disclosure also provide embodiments, variations, and examples of systems, methods, and compositions for achieving threshold level performance in relation to various quality metrics. For example, the invention(s) may include: the number of paired-end sequencing reads exceeding a threshold level (e.g., greater than 100,000,000, greater than 200,000,000, greater than 500,000,000); the percentage of read pairs having a suitable structure exceeding a threshold percentage (e.g., 60%, 70%, 80%, 90%, 99%, etc.), where the suitable structure is determined by comparing the read sequence with an actually synthesized sequence (e.g., barcode region, universal primer). - Percentage of read pairs (in order of region, unique molecular identifier, poly-T tail, etc.); Total number of barcode sequences read per substrate exceeding the threshold (e.g., 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000, etc.); Percentage of recovered barcode sequences exceeding the threshold (e.g., 60%, 70%, 80%, 90%, 99%, etc.); Percentage of appropriate reads matching barcode sequences exceeding the threshold (e.g., 60%) Percentages exceeding the threshold (e.g., 60%, 70%, 80%, 90%, 99%); Percentages exceeding the threshold that are suitable reads for genes (e.g., 60%, 70%, 80%, 90%, 99%); Percentages exceeding the threshold that are suitable reads matching barcode and gene sequences (e.g., 60%, 70%, 80%, 90%, 99%); Percentages exceeding the threshold that are useful raw reads (matching barcode and gene sequences) (e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%) (e.g., 5,000, 10,000, 15,000, 20,000, 25,000, 30,000, 35,000, 40,000, 50,000, etc.); (e.g., 5,000,000, 10,000,000, 15,000,000, 20,000,000, 25,000,000, etc.); (e.g., over 5,000,000, 10,000,000, 15,000,000, 20,000,000, 25,000,000, etc.)Average reads per bead exceeding the threshold (e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, etc.); Average number of UMIs per bead exceeding the threshold (e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, etc.); Average number of genes per bead exceeding the threshold (e.g., 100, 200, 300, 400, 500, 600, 700, 800, One or more of the following can be achieved: 900, 1000, etc.; the top percentage of reads, UMI, and / or genes per bead exceeding the threshold (e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, etc.); the average percentage of mitochondrial UMI per bead meeting the threshold; the average percentage of ribosomal protein UMI per bead meeting the threshold; the average percentage of ribosomal RNA UMI per bead meeting the threshold; and / or other appropriate quality indicators.
[0027] Aspects of this disclosure also provide systems, methods, and embodiments, modifications, and examples of non-natural compositions for facilitating the tagging of target biological materials from samples and for characterizing the location of target biological materials in space (e.g., two-dimensional space, three-dimensional space). Such compositions may include materials that have been modified from their natural state (e.g., in terms of providing structural differences from natural compositions). Furthermore, the invention(s) relating to combinations of materials, wherein the combinations of materials do not exist in nature (e.g., there are no naturally occurring counterparts to the compositions described and claimed).
[0028] Aspects of this disclosure also provide embodiments, variations, and examples of systems, methods, and compositions for multidimensional positional characterization, wherein functionalized molecules distributed across the sites of the described composition(s) can be implemented in a monolayer form (e.g., using a manufacturing process that applies compositional units in a monolayer or near-monolayer form, a system that forms a monolayer using magnetism or other forces, etc.), and a sample (e.g., tissue, cells) is placed adjacent to the monolayer for subsequent processing and mapping. Alternatively, functionalized molecules distributed across the sites of the described composition(s) can be injected into a sample / test specimen (e.g., by magnetic force, electroporation, using vectors, etc.). Alternatively, functionalized molecules distributed across the sites of the described composition(s) can be bonded to the surface of a sample / test specimen (e.g., by chemical bonding, magnetic bonding, other bonding) to enable surface mapping. Alternatively, functionalized molecules distributed across the site of the described composition(s) may be induced or retained within a 3D structure (e.g., in a grid, non-grid structure) such as microwells, microarrays (e.g., having nucleic acids with captured nucleic acids), scaffolds (e.g., hydrogels), or other 3D structures. In related applications, a structure (e.g., a close-packed structure) may be defined for the distribution of functionalized molecules distributed across site to interact with the sample and enable mapping, using physical or other forces. Alternatively, in relation to the characterization of location in multiple dimensions, functionalized molecules distributed across the site of the described composition(s) may be randomly distributed in space.
[0029] Aspects of this disclosure also provide embodiments, variations, and examples of systems, methods, and compositions for use in spatial transcriptomics. The compositions, methods, and systems described can be used for mapping targets in samples over time to understand the pathology and progression of disease (e.g., changes in target spread and expression over time).
[0030] Aspects of this disclosure also provide embodiments, variations, and examples of systems, methods, and compositions for mapping nuclear targets of a sample, in addition to other targets of the sample (e.g., cytoplasmic targets, protein targets, etc.) and / or cell types and / or cell subtypes, using a distribution of functionalized particles containing molecules functionalized to capture different target types. During tagging (e.g., by handshake sequences), recovery, and amplification of nuclear targets, further processing steps may be performed to generate characterizations, including, but not limited to, methylation status, epigenetic aspects (e.g., control of nuclear structure, epigenetic changes related to previous examples of sampling or sampling from relevant sources), chromatin accessibility using transposase-accessible chromatin by sequencing ATAC-Seq, cytotoxicity status, and / or other characterizations.
[0031] Aspects of the present disclosure also provide embodiments, variations, and examples of systems, methods, and compositions for mapping targets in FFPE samples by a set of processes, including deparaffinizing the sample (before application to a substrate having functionalized particles, and after application to a substrate having functionalized particles), optionally permeabilizing the FFPE sample, tagging the nuclear targets of the FFPE sample together with the cytoplasmic targets of the sample (e.g., using a handshake sequence of cleavage-type functionalized molecules, as described in more detail below), recovering the nuclear targets (e.g., by magnetic material of the implemented functionalized particles, by homogenization of the sample, by exposure of the nuclei using a surfactant, by electroporation, etc.), thereby recovering the nuclear targets with improved recovery rates of the FFPE sample, and performing downstream analysis of multiple target types from the FFPE sample for mapping. Regarding target tagging and spatial contextualization of targets, FFPE tissue samples are prepared by: dissolving paraffin in a solvent (e.g., xylene or mineral oil); dissolving the tissue at a temperature (e.g., 4°C to 90°C); rehydrating the tissue using an ethanol gradient of 100% to 0% ethanol (EtOH); transferring the rehydrated tissue to a volume of a first buffer containing a buffer, surfactant, and ionic strength of 100 mM to 200 mM (where the first buffer contains a protease inhibitor, protease, and / or BSA); using 10 mM Tris, 0.49% HAPS, 146 mM NaCl, 1 mM CaCl2, 21 mM MgCl2, and 0.01% BSA (CST), or alternatively using 10 mM Tris, 0.03% Tween-20, 146 mM NaCl, 1 mM CaCl2, 21 mM A single nucleus may be prepared and processed using a buffer containing MgCl2 and 0.01% BSA(TST). In one exemplary embodiment, the buffer is used during the extraction of the nucleus from FFPE tissue.
[0032] In one variation, a method for mapping the nuclear targets of an FFPE sample may include: receiving the FFPE sample on a substrate containing a distribution of functionalized particles for tagging the nuclear targets of the FFPE sample; drying the FFPE sample and the substrate for a certain period of time; performing a deparaffinization operation on the FFPE sample on the substrate; performing a reverse crosslinking operation on the FPPE sample on the substrate; photocutting the linkers of the functionalized molecules in the distribution of functionalized particles to release the functionalized molecules for tagging the nuclear targets of the FFPE sample; performing tissue separation and nuclear isolation operations on the FFPE sample; and generating a spatial map of the nuclear targets of the FPPE sample when sequencing the molecules of the FFPE sample after the tissue separation and nuclear isolation operations.
[0033] Variations of the process may include processing FFPE samples for target mapping (e.g., cytoplasmic targets, nuclear targets, etc.), lysing the extracellular matrix (ECM) of the FFPE sample (e.g., with collagenase); performing a reverse crosslinking operation to reverse the crosslinking of molecular components of the FFPE sample (e.g., before polyadenylation of nucleic acid targets of the FFPE sample); using a high pH buffer to facilitate polyadenylation and / or deparaffination of the FFPE sample; and performing other appropriate steps to improve the accessibility of RNA material for tagging and subsequent mapping.
[0034] In various modifications, increasing the accessibility of the nucleic acid target (e.g., RNA material in an FFPE sample) may include improving the effectiveness of nucleic acid extraction from the sample, preventing nucleic acid loss into the buffer before the hybridization step, and increasing the effectiveness of the reverse crosslinking step. In one such modification, increasing the accessibility of the nucleic acid target may include performing RNA processing in situ, followed by hybridization of the target with the molecules of the functionalized particle distribution (as described herein). In one example, the method may include increasing the accessibility of the RNA target in the sample; generating a cDNA copy of the RNA target during the reverse transcription operation; adding a reaction site to the 3' end of the cDNA copy using a template switching oligonucleotide (TSO); digesting the RNA of the sample; permeabilizing the cells of the sample and capturing the cDNA copy using the reactive site; and extending the molecules of the functionalized particle having the cDNA copy.
[0035] Aspects of this disclosure also provide embodiments, variations, and examples of systems, methods, and compositions for multi-omic characterization of a sample, using cytoplasmic targets, nuclear targets, protein / antibody targets (e.g., having oligo-bound tagging components), clustered and regularly arranged short palindromic sequence repeat (CRISPR) targets (e.g., guide RNA having A-tails or other properties that can be tagged and amplified), and mapping of other targets tagged from the same sample.
[0036] The application of the described methods can enhance the characterization of various tissue types and / or single cells and / or single nuclei. For example, in relation to nerve tissue or nerve cells, mapping of multiple target types of a sample can characterize neurons, neuronal subtypes, neuronal membrane aspects, neuronal nucleus aspects, dendritic aspects, axon aspects, oligodendrocyte aspects, puccinos aspects, myelin sheath aspects, node of Ranvier aspects, synaptic terminal globus aspects, axonal terminal aspects, and thus the neuronal processes being performed.
[0037] The application of the described methods can also be used to enhance the characterization of various tissue types of sample materials and / or single-cell and / or single-nucleus characterization, including one or more of the following: nervous system biological materials, cardiovascular system biological materials, endothelial system biological materials, skeletal system biological materials, muscular system biological materials, respiratory system biological materials, digestive system biological materials, endocrine system biological materials, urinary system biological materials, and reproductive system biological materials. Cellular material may be associated with normal and disease states, including one or more of cancer cells, circulating tumor cells, metastatic cells, benign cells, or any combination thereof. In relation to tissue or cell type, mapping of multiple target types of a sample can characterize the nucleus, cells, and tissue subcomponents, as well as the cellular functions performed. Thus, the described methods can enhance single-nucleus analysis, single-cell analysis, and / or tissue characterization analysis by providing spatial localization information of the nucleus and cells of a sample, in addition to expression data generated via tagging and sequencing or other techniques.
[0038] Aspects of the present disclosure also provide embodiments, variations, and examples of systems that can perform complex characterization without requiring conventional platforms for performing such characterization. For example, in relation to performing single-cell characterization (conventionally requiring complex platforms for single-cell division, spatial characterization platforms, and sequencing platforms), the present disclosure can streamline operations for performing such characterization. In one embodiment, a sample of cells, nuclei, or other cellular components may be barcoded (e.g., in one or more barcode sequences, where the barcode sequences may function as spatial addresses), and one or more portions of the sample may be applied to a substrate having functionalized particles for target tagging, sequencing, and mapping without requiring complex single-cell processing setups (e.g., conventionally involving microwells or other division techniques) (e.g., after forming a suspension with such components, after centrifugation, purification, concentration, freezing, cleavage, etc.).
[0039] Further aspects and advantages of the Disclosure will be readily apparent to those skilled in the art from the following detailed description, and only exemplary embodiments of the Disclosure are shown and described. Other and different embodiments of the Disclosure are possible, and some of their details can be modified in various obvious ways without departing from the Disclosure. Accordingly, the drawings and description should be considered as examples in nature and not as limitations.
[0040] Built-in by reference All publications, patents, and patent applications described herein are incorporated herein in whole for all purposes, to the same extent that each individual publication, patent, or patent application is explicitly and individually incorporated by reference. Furthermore, where a range of values is provided, it is understood that each intermediate value between the upper and lower limits of that range, as well as any other indicated values or intermediate values of that range, are included in the Invention. These upper and lower limits of smaller ranges may be independently included within the smaller range and are also included herein, according to any specific exclusion limits within the range. Where a range includes one or both limit values, ranges excluding one or both of those limit values are also included in the Invention. [Brief explanation of the drawing]
[0041] [Figure 1A] A schematic diagram of an embodiment of a system for characterizing the position of a target in space using an emissible handshake sequence is shown. [Figure 1B] A schematic diagram of an embodiment of a system for splitting single cells tagged with a handshake sequence is shown. [Figure 1C] A schematic diagram of an embodiment of a system for partitioning a single nucleus tagged with a handshake sequence is shown. [Figure 1D] We present a first variation of a structural feature for characterizing the position of a target in space using an emissible handshake sequence. [Figure 1E] We demonstrate a second variation of structural features for characterizing the position of a target in space using an emissible handshake sequence. [Figure 1F] This shows an array of substrate elements for characterizing the position of a target in space using an emissible handshake array. [Figure 1G] This document demonstrates the deformation of particle subgroups and molecules for target tagging of target analytes in space, and the deformation of an embodiment of the system for characterizing the position of target analytes in space, using a releaseable handshake sequence. [Figure 1H] This shows the deformation of functionalized molecules containing tagging elements. [Figure 1I] This shows a variation of tagging a pre-labeled sample target, with a probe having a handle corresponding to the handshake sequence. [Figure 2A] A schematic diagram shows an embodiment of a support structure for a system that characterizes the position of a target in space using an emissible handshake sequence. [Figure 2B] A schematic diagram shows the deformation of the system's support structure for characterizing the position of a target in space using an emissible handshake sequence. [Figure 3] A schematic diagram of a kit containing elements for characterizing the position of a target in space using a releaseable handshake sequence is shown. [Figure 4] This flowchart shows an exemplary workflow for a system that characterizes the position of a target in space. [Figure 5] This demonstrates a modification of the components that facilitates sample handling for characterizing the position of a target in space using a releaseable handshake sequence. [Figure 6] A schematic diagram shows another variation of the support structure and usage method of a system for characterizing the position of a target in space. [Figure 7A] A flowchart illustrating an embodiment of a method for characterizing the position of a target in space using an emissible handshake sequence is shown. [Figure 7B]A schematic diagram of an embodiment of a method for characterizing the position of a target in space using an emissible handshake sequence is shown. [Figure 7C] A schematic flowchart of a method for characterizing the position of a target in space by splitting a substrate using a releaseable handshake sequence is shown. [Figure 7D] A schematic flowchart of a method for characterizing the position of a target in space by splitting a substrate using a releaseable handshake sequence is shown. [Figure 8] Examples of processing steps related to characterizing the distribution of single cells / particles / analytes dispersed across a culture medium or scaffold are shown. [Figure 9] This shows an illustrative map of targets from the nuclei of a sample processed by this system unit. [Figure 10] A schematic flowchart of the method for processing sample elements is shown. [Figure 11A] This document illustrates an exemplary system configuration for preventing smearing artifacts and / or background artifacts. [Figure 11B] This document presents a variation of a method for preventing smearing artifacts and / or background artifacts. [Figure 12] Exemplary smearing artifacts and background artifacts are shown. [Figure 13] This document presents a variation of a method for preventing smearing artifacts and / or background artifacts. [Figure 14] This describes a computer system programmed or configured to carry out the methods provided herein. [Modes for carrying out the invention]
[0042] While various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided only as examples. Those skilled in the art will be able to make numerous modifications, alterations, and substitutions without departing from the present invention. It should be understood that various alternatives to the embodiments of the present invention described herein may be employed.
[0043] 1. Overview This disclosure relates to systems, devices, methods performed by such systems and devices, and methods for manufacturing and assembling such devices.
[0044] This disclosure provides systems and methods for labeling nuclei and / or cells of a sample, embodiments of the labeling method may include: treating a sample containing a set of nuclei or cells with a substrate containing a distribution of handshake sequences (e.g., by the ability to decode the location of functionalized molecules via barcode sequences that can function as spatial addresses of functionalized particles, as described below); tagging a set of nuclei or cells with one or more handshake sequences containing barcode sequences (e.g., when releasing the handshake sequences from the substrate); isolating nuclei / cells from a set of nuclei and / or cells of a sample; and determining the location of nuclei / cells from a set of nuclei / cells when sequencing molecules generated from the distribution of handshake sequences. Optionally, in some embodiments, the method may include tagging (e.g., microfluidic tagging, tagging in microwells, tagging in partitions, tagging in droplets of emulsion), tagging nuclear targets (e.g., mRNA, other nuclear targets) with handshake sequences, and characterization of spatial location using handshake sequences after isolation of nuclei. Tagging may include tagging using a membrane from which a handshake sequence can be released (e.g., a nitrocellulose membrane, or other membranes). Nuclear target identification can be further optionally performed without sequencing, using optical detection of nuclear targets tagged with a probe during nuclear tagging and barcoding.
[0045] In particular, the method may involve generating a spatial map of the nuclear distribution in a tissue sample when releasing a set of handshake sequences paired with a set of barcode sequences for diffusion toward the nuclear distribution. The generation of the spatial map can be performed without the use of a camera (for example, by using only a sample preparation workflow, sequencing, and bioinformatics system).
[0046] In some embodiments, the Disclosure also provides a system and method for characterizing the nuclei of a sample, which may include: generating a set of labeled nuclei by tagging a first set of oligonucleotides to a set of nuclei (e.g., upon release of a handshake sequence from a first substrate configured to interact with a sample); loading the set of labeled nuclei into the interstitial spaces of a distribution of functionalized particles bound to a second substrate, wherein each functionalized particle is in contact with at most one labeled nucleus from the set of labeled nuclei; generating a single-nucleus sequencing library from amplicons generated from a set of reactions including a set of molecules in the distribution of labeled nuclei and functionalized particles; and returning a single-nucleus analysis of the set of nuclei when processing the single-nucleus sequencing library.
[0047] In some embodiments, the Disclosure also provides systems and methods for characterizing cells of a sample (e.g., single cells), and characterizing cells of a sample may include: generating a set of labeled cells by tagging a set of oligonucleotides to a set of cells (e.g., upon release of a handshake sequence from a first substrate configured to interact with a sample); loading the set of labeled cells into the interstitial spaces of a distribution of functionalized particles bound to a second substrate, wherein each functionalized particle is in contact with at most one labeled cell of the set of labeled cells; generating a single-cell sequencing library from amplicons generated from a set of reactions including a set of molecules of the distribution of labeled cells and functionalized particles; and returning a single-cell analysis of the set of cells when processing the single-cell sequencing library.
[0048] In one embodiment for characterizing a set of single cells or single nuclei in three dimensions, the present disclosure provides a system and method, the method of combining a set of functionalized particles with a set of single cells and / or a set of single nuclei, where the ratio of the number of functionalized particles to the number of single cells and / or single nuclei is greater than 1 (e.g., 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, etc.). The method involves: holding single cells and / or single nuclei within recesses (e.g., gaps, pores, other surface features, etc.) of a set of functionalized particles (e.g., a single cell or single nucleus is associated with at most one functionalized particle of the set of functionalized particles); and stabilizing the set of functionalized particles together with the associated single cells and / or single nuclei within a matrix (e.g., a hydrogel matrix, other matrices), wherein the matrix can transition between solidified and non-solidified phases, and the matrix is less than a first size threshold. Stabilizing the diffusion of material to and / or between sets of functionalized particles, thereby preventing the diffusion of material beyond a second size threshold; lysing a set of single cells (if single cells exist) with lysis buffer, either by raising or not raising the temperature of the lysis buffer, so that the lysis buffer is introduced into the set of single cells through the matrix; performing a hybridization operation between the contents of the set of single cells and / or single nuclei (e.g., mRNA content, other nucleic acid content, conjugated protein content, etc.) and a set of functionalized particles, wherein the contents of the single cells or single nuclei can hybridize with multiple functionalized particles from the set of functionalized particles, and the hybridization operation tags the target contents of the single cells or single nuclei with one or more handshake sequences; and, after the hybridization operation, transitioning the matrix from the solidified phase to the non-solidified phase in coordination with performing reverse transcription, second strand synthesis, and cDNA amplification operations;The methods described may include: generating a sequencing library from amplicons produced from a cDNA amplification operation; and, upon processing the sequencing library, returning a single-cell and / or single-nucleus analysis of a set of cells / nuclei, wherein a subset of functionalized particles associated with the target substance from the single cells / nuclei is associated based on a barcode (e.g., a barcode that can function as a spatial address, a cell barcode) having a nucleotide sequence (e.g., a probabilistic sequence) associated with the single cell / nucleus. When combined with spatial information (e.g., using a barcode that functions as a spatial address as described), the described methods may enable association between genotypic and phenotypic features of a biological sample material.
[0049] This disclosure also provides embodiments of a substrate having functionalized particles, comprising a first subset of functionalized particles for tagging nuclear targets of a sample, and a second subset of functionalized particles for tagging cytoplasmic targets of a sample. In some embodiments, the substrate may include functionalized particles for tagging only nuclear targets of a sample (e.g., nuclear RNA). In some embodiments, the substrate may include functionalized particles for tagging only cytoplasmic targets of a sample (e.g., cytoplasmic RNA). In some embodiments, the substrate may be functionalized with functionalized particles for tagging an entire single cell of a sample. Furthermore, or alternatively, embodiments of the substrate may be configured to include multiple types of subsets of functionalized particles, each subset configured to tag different types of sample targets.
[0050] In relation to tissue processing, this disclosure provides methods, systems, and devices for spatially labeling targets (e.g., cytoplasmic targets) exposed during tissue processing (e.g., tissue thinning, tissue sectioning), and for spatially labeling individual nuclei and / or other intracellular components. The methods described may include determining the position of the cell body of a sample (e.g., based on the position of the nucleus) and performing single-cell analysis techniques in coordination with spatial analysis of single cells and other targets, the analysis techniques including single-nuclear RNA-seq (snRNA-seq), T cell receptor (TCR) analysis, B cell receptor (BCR) analysis (e.g., including receptor-ligand characterization), ATAC-seq for assessment of chromatin accessibility, processing of nuclear and non-nuclear targets of formalin-fixed and paraffin-embedded (FFPE) samples, nuclear DNA analysis, nuclear protein analysis This may include the generation and analysis of single-cell chromatin immunoprecipitation (ChIP) sequencing libraries; the generation and analysis of single-cell genome sequencing libraries; the generation and analysis of single-cell DNA methylation sequencing libraries; the generation and analysis of single-cell Hi-C sequencing libraries; the generation and analysis of single-cell enzyme tethering chromatin profiling sequencing libraries; the generation and analysis of single-cell genome and transcriptome sequencing libraries (G&T-seq); and other appropriate analyses.
[0051] The method can be carried out at 4°C or below, or at other low temperatures.
[0052] In general, embodiments of this method, system, and composition provide mechanisms for tagging and labeling target substances from single cells (e.g., DNA, RNA, miRNA, proteins, small molecules, single analytes, multiple analytes, etc.), single cells, and / or other biological materials, enabling analysis for characterization of biological materials (e.g., analysis relating to the position of target analytes of biological materials in space, single-cell analysis, single-nucleus analysis, etc.).
[0053] For nucleic acid targets, the tagging probe of the described composition may include molecules complementary to the nucleic acid target (e.g., based on poly-A / poly-T interactions, or interactions between polyadenylated mRNA and other nucleic acids incorporating U and / or T bases based on complementarity with other nucleic acid target sequences). For protein or small molecule targets, the tagging probe of the described composition may include antibodies or aptamers conjugated with specific nucleic acid sequences for detection.
[0054] Targets may include cytoplasmic targets, intracellular targets, or other targets on the surface or inside of cells (or components of cells). For example, targets may include cytoplasmic targets and cell targets or nucleus-related targets derived from the same tissue, thereby enabling simultaneous mapping of multiple target types in a highly parallel manner. In one embodiment, spatial labeling of nuclei in a sample includes treating a sample containing a set of nuclei with a substrate containing a distribution of functionalized molecules (e.g., by decoding the location of the functionalized molecules via a barcode sequence that can function as a spatial address sequence, as described below); tagging the set of nuclei with a handshake sequence containing a barcode sequence that can function as a spatial address sequence (e.g., when releasing functionalized molecules from functionalized particles); isolating the nuclei of the set of nuclei in the sample and / or other sets of targets; and determining the location of the nuclei of the set of nuclei when sequencing molecules generated from the distribution of functionalized molecules. Optionally, in some embodiments, the method may include tagging (e.g., microfluidic-based tagging, tagging in microwells, tagging in partitions, tagging in emulsion droplets) and barcoding nuclear targets (e.g., mRNA, other nuclear targets) with handshake sequences containing barcodes that can function as spatial addresses. Nuclear target identification may further optionally be performed without sequencing, using optical detection of the nuclear targets tagged with the probe during nuclear tagging.
[0055] In relation to tissue processing, this disclosure provides methods, systems, and devices for spatially labeling targets (e.g., cytoplasmic targets) exposed during tissue processing (e.g., tissue thinning, tissue sectioning), and for spatially labeling individual nuclei and / or other intracellular components. The methods described may include determining the position of the cell body of a sample (e.g., based on the position of the nucleus) and performing single-cell analysis techniques in coordination with spatial analysis of single cells and other targets, the analysis techniques including single-nuclear RNA-seq (snRNA-seq), T cell receptor (TCR) analysis, B cell receptor (BCR) analysis (e.g., including receptor-ligand characterization), ATAC-seq for assessment of chromatin accessibility, processing of nuclear and non-nuclear targets of formalin-fixed and paraffin-embedded (FFPE) samples, nuclear DNA analysis, nuclear protein analysis This may include the generation and analysis of single-cell chromatin immunoprecipitation (ChIP) sequencing libraries; the generation and analysis of single-cell genome sequencing libraries; the generation and analysis of single-cell DNA methylation sequencing libraries; the generation and analysis of single-cell Hi-C sequencing libraries; the generation and analysis of single-cell enzyme tethering chromatin profiling sequencing libraries; the generation and analysis of single-cell genome and transcriptome sequencing libraries (G&T-seq); and other appropriate analyses.
[0056] The systems, methods, and devices disclosed herein can offer several additional advantages over other systems and methods, and such systems, methods, and devices can be further implemented in many practical applications across various fields.
[0057] The systems, methods, and devices described address limitations currently hindering the performance of single-nucleus and / or single-cell analysis with respect to the isolation of nuclei and cells, rapid division of nuclei and cells (including the ability to process single-cell or nuclear material that has interacted with multiple functionalized particles), and the performance of spatial transcriptomics analysis, as well as other limitations of current state-of-the-art methods.
[0058] This system, method, and device solve the problems of cell segmentation and sensitivity related to the mapping of cell-related targets (e.g., cytoplasmic targets, nuclear-related targets, etc.). This system, method, and device solve the problems of cell segmentation and sensitivity related to the mapping of targets in human tissues.
[0059] This system, method, and device further improve the accuracy of spatial mapping of nuclear targets. In embodiments in which nuclei are tagged using releaseable molecules of functionalized particles, nuclear tagging may include tagging nuclei with different releaseable molecules associated with different spatial locations. Thus, determining the location of a nucleus may include determining the location based on a subset of locations corresponding to a subset of probabilistic barcodes of the molecules tagging the nucleus. The location of a nucleus can be determined from the average location of the subset of probabilistic barcodes (e.g., the centroid of the locations of the subset of probabilistic barcodes). In variations, nuclei may be tagged using a combination of cleavable and non-cleavable molecules, and as a result, the location of the nucleus can be determined from the probabilistic / spatial barcode locations of the cleavable and non-cleavable molecules (e.g., as a weighted centroid of the locations, where the location of the non-cleavable component is weighted more than the location of the cleavable component). Thus, the location estimated from the barcode acting as a spatial address may be an estimate of the location in or on a sample, in or on a feature (e.g., functionalized particles), or a combination thereof.
[0060] In relation to tagging nuclear targets with handshake sequences containing barcodes that can function as spatial addresses and mapping nuclear targets tagged with handshake sequences, the described systems, methods, and compositions can generate spatial maps with improved nuclear target recovery rates of over 15%, over 20%, over 25%, over 30%, over 35%, over 40%, over 45%, over 50%, over 60%, or more (for example, with respect to the actual number of nuclear targets present). In some examples, the disclosure provides embodiments, variations, and examples of systems, methods, and compositions for generating spatial maps with improved nuclear target recovery rates (for example, with respect to the actual number of nuclear targets present), where the number of nuclear targets recovered from tissue sections (e.g., embryonic tissue sections, other tissue sections) is over 50,000, over 60,000, over 70,000, over 80,000, over 90,000, over 100,000, over 110,000. The nuclei recovery rate may be greater than 00, greater than 120,000, greater than 130,000, greater than 140,000, greater than 150,000, greater than 160,000, greater than 170,000, greater than 180,000, greater than 190,000, greater than 200,000, greater than 250,000, or more (for example, for tissue sections from 5 micrometers to 40 micrometers in thickness, and on surfaces greater than 3 mm × 3 mm, greater than 10 mm × 10 mm, or other suitable dimensions). The nuclei recovery rate can be determined during sample separation and nuclei counting (e.g., via a cytometry-based method). Alternatively, the nuclei recovery rate may be determined when nuclei sequencing is performed. Alternatively, the nuclei recovery rate may be determined when nuclei are spatially positioned during mapping (e.g., after sequencing the nuclei and barcode sequences that function as corresponding spatial addresses). In particular, nucleus retention rates are usually poor due to losses during sample processing and nucleus isolation, and this disclosure provides methods for improving nucleus recovery and retention rates. Recovery rate can be determined as the percentage of nuclei initially present in the sample.
[0061] In relation to tagging of nuclei and / or other targets of a sample by functionalized molecules of functionalized particles, functionalized molecules may include unique molecular identifiers (UMIs). This disclosure includes cases where there are more than 2000 UMIs per nucleus / target, more than 2500 UMIs per nucleus / target, more than 3000 UMIs per nucleus / target, more than 3500 UMIs per nucleus / target, more than 4000 UMIs per nucleus / target, more than 4500 UMIs per nucleus / target, more than 5000 UMIs per nucleus / target, more than 5500 UMIs per nucleus / target, more than 6000 UMIs per nucleus / target, more than 6500 UMIs per nucleus / target, and one This document provides embodiments, variations, and examples of systems, methods, and compositions for recovering UMIs of more than 7,000 per nucleus / target, more than 7,500 per nucleus / target, more than 8,000 per nucleus / target, more than 8,500 per nucleus / target, more than 9,000 per nucleus / target, more than 9,500 per nucleus / target, more than 10,000 per nucleus / target, more than 20,000 per nucleus / target, or more. Thus, the systems, methods, and devices described can achieve higher UMI tags per nucleus / target compared to existing single-cell techniques and other state-of-the-art techniques.
[0062] This system, method, and device can generate a spatial map of a set of targets in a sample, and this spatial map has unprecedented resolution performance, the ability to map multiple sets of targets for different samples and tissue types, and meets the quality indicators of high-resolution mapping.
[0063] This system, method, and device are also designed to be user-friendly for end-users in relation to processing different tissue types and / or various sample types (e.g., including natural and synthetic scaffolds).
[0064] The systems, methods, and devices provide and implement non-naturally occurring compositions for facilitating the tagging of target biological materials from samples and for characterizing the position of target biological materials in space (e.g., two-dimensional space, three-dimensional space). Such compositions may include materials modified from their natural state (e.g., in terms of providing structural differences from natural compositions). Furthermore, the invention(s) relate to combinations of materials, where the combinations of materials do not exist in nature (e.g., there are no naturally occurring counterparts to the compositions described and claimed).
[0065] This system, method, and device provide an improved manufacturing method for generating a system for characterizing the position of a target analyte in space.
[0066] The system, method, and device provides multidimensional (e.g., 2D, 3D, 4D including a time element) improved target location in relation to one or more of the following: whole tissue structure, tissue piece (e.g., histologically, in relation to biopsy tissue, in relation to seeded native scaffolds, in relation to seeded synthetic scaffolds (e.g., cell-seeded hydrogel scaffolds, cell-seeded polaxomer scaffolds, etc.), in relation to frozen cell specimens, in relation to formalin-fixed and paraffin-embedded (FFPE) specimens, etc.), in relation to organs, whole organisms, cell suspensions, single cells, within organelles, suborganelles, mitochondrial targets, viruses, microorganisms, and other native structures. Cells may include mammalian cells, bacteria, microorganisms, plant cells, fungal cells, or other cell / cell-like components. Location characterization may additionally or alternatively be performed in relation to non-native structures such as microwells, microarrays, scaffolds, and other non-native structures. For example, the present invention may have in situ and / or in vivo applications involving the injection of functionalized particles into a sample (e.g., intracellularly, intratissuely, intraorganically, etc.). Examples of injection include injection, electroporation, the use of a vector (e.g., a viral vector), and one or more other injection methods.
[0067] In relation to the characterization of position in multiple dimensions, particles of the described composition(s) can be implemented in a monolayer form (e.g., using a manufacturing process that applies compositional units in a monolayer or near-monolayer form, using a system that applies magnetism or other forces to form a monolayer of particles), and the sample (e.g., tissue, cells) is placed adjacent to the monolayer for subsequent processing and mapping. Alternatively, particles of the described composition(s) can be injected into the sample / test specimen (e.g., by magnetic force, by electroporation, by using a vector). Alternatively, particles of the described composition(s) can be bonded to the surface of the sample / test specimen (e.g., by chemical bonding, by magnetic bonding, by other bonding) to enable surface mapping. Alternatively, particles of the described composition(s) can be induced or retained within a 3D structure (e.g., in a grid, in a non-grid structure) such as a microwell, a microarray (e.g., having nucleic acids with captured nucleic acids), a matrix (e.g., a hydrogel, a scaffold), or other 3D structure. In related applications, physical or other forces can be used to define the structure (e.g., a close-packed structure) for the distribution of particles interacting with the sample. Alternatively, in relation to the characterization of positions in multiple dimensions, the particles of the described composition(s) may be randomly distributed in space.
[0068] This system, method, and device offer improved applications in spatial transcriptomics. For example, the compositions, methods, and systems described can be used for mapping targets in samples over time to understand the pathology and progression of disease (e.g., changes in target spread and expression over time).
[0069] Furthermore, the described systems, devices, or methods may bring about any other suitable advantages.
[0070] 2. System As shown in Figure 1A, an embodiment of system 100 for characterizing the location of a target in a sample includes a substrate 110 and a distribution of functionalized features 120 associated with the substrate 110, wherein a representative feature 130 of the distribution of functionalized features includes one or more functionalized molecules 140 bound to the representative feature 130, and the one or more molecules 140 include a handshake sequence 141 which includes at least a reactive portion, a barcode segment 142 (the barcode segment 142 can function as a spatial address), and a cleavage linker 143 (e.g., responsive to a stimulus) configured to allow the handshake sequence 141 to be released from the representative feature 130. A variation of system 100 may optionally include a masking layer 150 (e.g., a sticker) which functions to prevent the functionalized features from being prematurely exposed to a stimulus or damaged, in a manner that prevents the handshake sequence from being controllly released from the distribution of functionalized features 120 for tagging a target in a sample.
[0071] In one variation, as shown in Figure 1B, a system for performing single-cell analysis includes a substrate 110a, a distribution of functionalized particles 120a bound to the substrate 110a (e.g., using an adhesive), and a set of cells 10 positioned in the interstitial spaces of the distribution of functionalized particles.
[0072] In one variation, as shown in Figure 1C, the system for performing single-nucleus analysis includes a substrate 110b, a distribution of functionalized particles 120b bonded to the substrate 110b (e.g., using an adhesive), and a set of nuclei 15 located in the interstitial spaces of the distribution of functionalized particles.
[0073] Embodiments, variations, and examples of System 100 function to interact with, spatially define, and label the target analyte of a sample upon release of a handshake sequence structured to interact with the target analyte of the sample, enabling the characterization of the target analyte of the sample (e.g., with respect to spatial analysis, with respect to other analyses such as single-cell or single-nucleus analysis). Embodiments, variations, and examples of System 100 can also spatially separate and isolate sample particles (e.g., single cells, nuclei, molecules, other specimens or particles, etc.) in the space between the features of the system.
[0074] In various embodiments, the target analyte may include one or more nucleic acid materials (e.g., DNA, RNA, miRNA, etc.), protein materials, amino acid materials, other small molecules, other single analytes, other multiple analytes, and / or other suitable target materials of the sample. In various embodiments, the sample may include whole tissue structures, tissue portions (e.g., histological tissue slices, formalin-fixed paraffin-embedded (FFPE) tissues, frozen tissues (e.g., fresh-frozen tissues), fixed tissues, permeabilized tissues, biopsy tissues, fresh-frozen plasma, seeded natural scaffolds, seeded synthetic scaffolds, etc.), organs, whole organisms, organoids, cell suspensions (e.g., frozen cell suspensions separated before processing in the System, cell suspensions held in culture media / hydrogel media, etc.), single cells, nuclear suspensions, organelles, suborganelle structures, intraorganelle components, mitochondrial targets, viruses, microorganisms, and other samples. In various variations, the method described herein involves tagging a target of a sample using a spatial arrangement distributed across multiple substrates, wherein the sample is not fixed or permeabilized before tagging the target of the sample. Therefore, the method described herein can omit the fixation, permeabilization, and / or decrosslinking of the sample in relation to generating a spatial analysis of the target of the sample.
[0075] In some non-limiting examples, sample materials in which the target can be tagged with a handshake sequence may include one or more of the following: nervous system biological materials, cardiovascular system biological materials, endothelial system biological materials, skeletal system biological materials, muscular system biological materials, respiratory system biological materials, digestive system biological materials, endocrine system biological materials, urinary system biological materials, and reproductive system biological materials. Cellular material may be associated with normal and diseased states, including one or more of cancer cells, circulating tumor cells, metastatic cells, benign cells, or any combination thereof. In some embodiments, the sample may include solid / continuous tissue material obtained from the subject.
[0076] System 100 and its usage details are described in more detail in the following sections.
[0077] 2.1 System - Substrate The substrate 110 functions to provide one or more surfaces on which the distribution of functionalized features 120 is patterned or deposited (as described below). Thus, the substrate 110 functions to support the reliable distribution of functionalized features 120 during sample handling and processing. The substrate 110 may further / or function to support a mechanism for controlled interaction with the distribution of functionalized particles (e.g., with respect to controllable binding and release mechanisms). The substrate 110 may further / or function to facilitate the detection of optical signals generated from the interaction between the distribution of functionalized particles 120 and the tagged target analyte of the sample by having optical properties suitable for the transmission of optical signals to an optical signal detector. The substrate 110 may further / or function to allow heat transfer to the sample interacting with the system 100 during use in order to facilitate the interaction between the target analyte and the distribution of functionalized features 120 in the substrate 110. The substrate 110 may further / or have other suitable functionalities.
[0078] In one embodiment, the substrate 110 is composed of glass / silica (e.g., borosilicate glass) which provides desirable properties for manufacturing (e.g., in relation to surface functionalization, in relation to processing, in relation to the separation of composition units, etc.), thermal properties (e.g., with respect to thermal conductivity), electrical properties (e.g., with respect to supporting charge, in relation to electrical conductivity, etc.), optical properties (e.g., providing a mechanism for optical recognition, characterized by one or more optical features encoding a set of nucleic acid bases, a set of nucleic acid bases identifiable upon detection of one or more optical features, etc.), magnetic properties (e.g., providing or supporting a magnetic field for manipulating sample components and / or in relation to the manner of distribution of functionalized features 120), biocompatibility properties, and / or other suitable properties. Alternatively, the base material 110 may include, or be composed of, one or more of the following: plastic / polymer materials (e.g., acrylic, cyclic olefin polymers, polycarbonate, poly(methyl methacrylate) (PMMA), cycloolefin polymer (COP), polystyrene, polypropylene, polyethylene terephthalate glycol modified (PEGT), etc.); ternary compositions (e.g., indium tin oxide); and / or other suitable materials.
[0079] In various deformations, the substrate 110 has a characteristic roughness of 1 micrometer or less (e.g., 0.8 micrometers), but it can instead have a different suitable roughness. For example, the deformation of the substrate 110 can have a desired roughness (e.g., greater than 1 micrometer) to provide a desired texture or to perform other suitable functions.
[0080] The base material 110 may have a thickness of 0.5 mm to 3 mm.
[0081] Furthermore, the substrate 110 may be flexible (for example, composed of a flexible material) to enable applications involving flexible application to the surface of a sample (e.g., wrapping around a tissue).
[0082] In some variations, as shown in Figure 1D, the substrate 110 (and / or the functionalized particle surface) may include a set of protrusions that establish an interface between the sample and the distribution of functionalized particles. Thus, during operation, the protrusions of the substrate 110 can be configured to extend into the sample (e.g., into the tissue) to facilitate a desired interaction between deeper parts of the sample and the distribution of functionalized particles in the substrate 110. In related variations, the protrusions may be hollow (e.g., like microneedles) to assist in the transfer of fluid material to the sample (e.g., for sample processing) and / or to facilitate the tagging of the target analyte using a handshake array.
[0083] Furthermore, or as shown in Figure 1E, the substrate 110 may include a set of recesses configured to receive or support a distribution of functionalized particles 120 in order to arrange the distribution of functionalized particles 120 in the substrate 110 in a desired configuration (e.g., in a patterned manner, at a desired density, in a monodisperse manner, in a single layer, etc.).
[0084] Furthermore, or alternatively, the substrate 110 may include or be positioned adjacent to a set of references, the set of references may provide observable marks for manufacturing (e.g., in relation to scribing / sewing the substrate into separate units). Furthermore, or alternatively, the set of references may define the addressable position / functionalized particle distribution of system 100 to characterize the position of the target analyte of a sample tagged using system 100.
[0085] Furthermore, or alternatively, the substrate 110 may be optically recognizable (for example, so that the substrate can be observed with an optical device to provide a signal). In various variations, the substrate can be characterized by one or more optical features that encode a set of nucleic acid bases, and the set of nucleic acid bases is identifiable upon detection of one or more optical features.
[0086] 2.2 System-Functionalized Features As shown in Figure 1A, the system 100 further includes a distribution of functionalized features 120 associated with the substrate 110 to enable analysis to characterize the position of a target material in space. In various variations, the distribution of functionalized features 120 may also include functionalized particles (e.g., 120a, 120b in Figures 1B and 1C) that provide void spaces for receiving sample particles (e.g., nuclei, single cells, cell clusters, sample particles, etc.) to enable tagging of such particles for further analysis. Thus, the distribution of functionalized features 120 may function to hold particles from the sample in appropriate positions and to provide functionality for decoding the aspect and / or position of the target analyte of the sample particles in space during sequencing.
[0087] A representative functionalized feature 130 comprises one or more functionalized molecules 140 bound to the representative feature 130, the one or more molecules 140 comprising a handshake sequence 141 which includes at least a reactive portion, a barcode segment 142 (the barcode segment 142 can function as a spatial address), and a cleavage linker 143 (e.g., in response to a stimulus) configured to allow the handshake sequence 141 to be released from the representative feature 130.
[0088] In various embodiments, the distribution of the functionalized feature 120 may include one or more of the following: particle distribution, well distribution, protruding feature distribution, recessed feature distribution, peg distribution, etched feature distribution, printed feature distribution, spot distribution, microsphere distribution, capillary distribution, and / or other forms of features. The feature(s) of the feature distribution may take the form of resin, metal, polymer, ceramic, or other forms or materials.
[0089] In some embodiments, the distribution of functionalized features 120 is arranged on a substrate 110 having a polygonal footprint (e.g., using a template process, using another suitable process); however, in other variations, the distribution of functionalized features 120 can be arranged in other suitable forms (e.g., circular footprint, ellipsoidal footprint, rectangular footprint, polygonal footprint, amorphous footprint, etc.). In one such example, the distribution of functionalized features 120 is arranged on a square footprint with corner notches for orientation purposes. In yet another variation, the distribution of functionalized features 120 can be patterned on the substrate 110 in an arrangement corresponding to a sample(s) processed using the system 100. For example, in some variations, the distribution of functionalized features 120 can be patterned to correspond to the shape of a characteristic sample (e.g., tissue biopsy shape), the structural features of a characteristic sample (e.g., orientation of tissue fibers), the shape of a characteristic sample container (e.g., tubular shape, well shape, etc.), and / or other suitable features.
[0090] In various variations, the characteristic dimensions (e.g., diameter, width, length, etc.) of the arrangements that make up the majority of the distribution of functionalized feature 120 may range from 1 to 10 mm (or alternatively, greater than 10 mm to allow for handling larger sample sizes). In specific examples, the characteristic dimensions of the distribution of functionalized feature 120 may range from 2 to 4 mm (e.g., width or length of the polygonal footprint).
[0091] In various variations, the distribution of the functionalized feature 120, including the distribution of functionalized particles, may be 1 millimeter in length or width, 2 millimeters in length or width, 3 millimeters in length or width, 4 millimeters in length or width, 5 millimeters in length or width, 6 millimeters in length or width, 7 millimeters in length or width, 8 millimeters in length or width, 9 millimeters in length or width, 10 millimeters in length or width, 11 millimeters in length or width, 12 millimeters in length or width, 13 millimeters in length or width, 14 millimeters in length or width, 15 millimeters in length or width, 16 millimeters in length or width, 17 millimeters in length or width, 18 millimeters in length or width, 19 millimeters in length or width, 20 millimeters in length or width, an intermediate length or width, or another suitable length or width (e.g., greater than 20 millimeters).
[0092] In one example, a distribution of functionalized features with a footprint of 3 mm x 3 mm can be used for simultaneous tagging of nuclear targets and other targets (e.g., cytoplasmic targets). In another example, a distribution of functionalized features with a footprint of 10 mm x 10 mm can be used for simultaneous tagging of nuclear targets and other targets (e.g., cytoplasmic targets).
[0093] Features can be provided on the substrate 110 as a grid of spots or patches. Features can be distributed in repeating patterns or in irregular, non-repeating patterns. Optionally, repeating patterns can include hexagonal patterns, linear patterns, grid patterns, patterns with reflective symmetry, patterns with rotational symmetry, etc. Asymmetric patterns can also be implemented. The array pitch can be the same between different pairs of nearest features, or the pitch can vary between different pairs of nearest features. The substrate 110 can have multiple distributions of functionalized features arranged as separate arrays, and these separate arrays can be manipulated, isolated, or processed independently.
[0094] In some cases, larger substrates may be used to accommodate larger tissue samples in order to generate a spatial map of the larger tissue sample. However, the distribution of functionalized features 120 may have other suitable feature dimensions.
[0095] Furthermore, the substrate 110 may have multiple distributions of functionalized features 120, as shown in Figure 1F, and different distributions (e.g., 20a-20i shown in Figure 1F) may be arranged within or within an array. In various variations, the different distributions may be arranged on the substrate 110 in a 2x2 array, a 3x3 array, or any other suitable array (aligned or disordered). Arrays of feature distributions may be used to accommodate larger tissue samples in order to generate a spatial map of larger tissue samples. Thus, a method using an arranged distribution may include applying a sample (e.g., a tissue sample) to an array of functionalized particle distributions and processing the sample according to embodiments, variations, and examples of the method steps described.
[0096] Furthermore, the distribution of one or more functionalized particles in the substrate 110 may include differences in barcode sequences (for example, each subunit of the array may have a different barcode sequence associated with a particular subunit), which can be used to selectively amplify and sequence different regions of a sample applied to the array. In one example, a region of interest associated with a first subunit of the array can be selectively amplified and sequenced using the unique barcode sequence of that unit. If the results from the region of interest are promising or if conditions requiring further investigation are met (e.g., quality conditions related to determining UMI read characteristics, quality conditions related to determining barcode read characteristics), then this method may include selectively amplifying and sequencing other regions of the sample using the unique barcode sequences of other units.
[0097] More specifically, the implementation of multiple distributions of functionalized particles (e.g., each different subarray having the same or different footprints) may enable regional subsampling (e.g., selective amplification, matching, and / or detection of targets in a particular subarray). Different subarrays can be configured to tag different target types (e.g., a first subarray can be configured to tag a first target type with a first handshake sequence, and a second subarray can be configured to tag a second target type with a second handshake sequence). Alternatively, each of the different subarrays can be configured to tag multiple target types (e.g., the first subarray can be configured to tag multiple target types with each handshake sequence).
[0098] Selective amplification can be enabled by implementing functional molecules for tagging different target types, and the molecules can have different PCR handles corresponding to the different target types intended to be tagged (as further details regarding functional molecules are described below).
[0099] The distribution of the functionalized features 120 is preferably arranged in a high-density packing manner on the substrate 110 (e.g., random close-packing, hexagonal close-packing, rectangular close-packing, near-close-packing, etc.). In certain examples, the distribution of the functionalized features 120 is characterized by a high level of packing density on the surface of the substrate 110. With respect to close-packing of particles (e.g., random close-packing), the packing density on the substrate can be 55% to 74%, resulting in interparticle space or dead space of 26% to 45%. Thus, the configuration of the distribution of the functionalized features 120 achieves the minimum dead space as permissible by physics. Furthermore, or in connection with the implementation of functionalized particles having subpopulations of different body sizes, the spaces or other gaps between first-size particles can be covered with second-size particles to further increase the packing density, and therefore to further increase the resolution of the generated map (e.g., Figure 1G, etc.), or the ability to simultaneously tag targets from different sources (e.g., cytoplasmic targets, nuclear targets, protein targets, other targets). Furthermore, the gaps or other intervening spaces between the functionalized features (e.g., particles) may be configured (e.g., sized) to accept sample components (e.g., single cells, single nuclei, clusters, etc.) for retention and processing of single components or clusters, as described herein. In embodiments in which the distribution of functionalized features 120 includes particle configurations for retaining individual cells, nuclei, clusters, or other particles, the configuration of system 100 may further include a layer 15 (described in more detail below), which can facilitate the retention of individual cells, nuclei, clusters, or other particles placed in the gaps or other intervening spaces between the functionalized particles. The layer 15 can also assist in the reliable diffusion of process reagents into the sample components of interest retained on the substrate 110 during the sample processing stage.
[0100] However, the distribution of the functionalized features 120 can be characterized by another suitable packing density percentage on the surface of the substrate. This distribution is also preferably monodisperse (e.g., uniformly dispersed, with substantially uniform particle / feature size, and critical distances between particles / features below a threshold). However, the distribution may also be non-monodisperse / random. Thus, the distribution of the functionalized features may be random or determined by the morphology of the substrate (e.g., mesh, wells, protrusions, recesses, texture, etc.).
[0101] Furthermore, the distribution of the functionalized features 120 is preferably arranged in a single layer (e.g., without stacking) on the substrate 110. However, in various variations, the distribution of the functionalized features 120 can be arranged on the substrate 110 at different degrees of density (e.g., unfilled) and / or in a non-single-layer form. In one such variation, the distribution of the functionalized features can be arranged within one or more subarrays (e.g., patterned for a specific use case). In some examples, the subarrays may include different subarrays functionalized for different target analytes, different forms of target analytes (e.g., different epitopes), control regions, or other suitable regions. Furthermore, or alternatively, multiple distributions may be arranged on a single substrate (e.g., an array or matrix of functionalized feature distributions arranged in separate zones on the substrate).
[0102] In various modifications, the distribution of functionalized features 120, including the distribution of functionalized particles, can be bound to the substrate 110 using an adhesive layer 112 to which the particles can adhere (e.g., reversibly and permanently). In various modifications, the distribution of functionalized particles can be bound to the substrate 110 by the adhesive layer 112 (shown in Figure 1A) in the binding operation mode and separated from the substrate 110 in the separation operation mode. The adhesive or detachment force for separation may be in the range of 200 to 500 nanonewtons. However, in other modifications, the adhesive or detachment force may be less than 200 nanonewtons or greater than 500 nanonewtons. Preferably, the distribution of functionalized particles 120 remains securely bound to the substrate when connected to the sample and during sample processing operations (e.g., hybridization, second chain synthesis, etc.).
[0103] In various modifications, separation can be achieved using a surfactant that directly separates the distribution of functionalized features 120 from the adhesive layer 112 and / or the substrate 110. Thus, the binding of the functionalized particle distribution can be provided by at least one of hydrophobic interactions and hydrophilic interactions, which are reversible by the addition of a surfactant. Furthermore, or alternatively, separation can be achieved using a linker (e.g., a cleavage-type linker) that binds the functionalized particles to the layer or substrate (e.g., by chemical modification in the substrate), the linker being configured to cleave in response to one or more of the following preferred cleavage / separation mechanisms: thermal cleavage, pH shift, photocleavage, chemical cleavage, enzymatic cleavage (e.g., as in molecular scissors), separation based on charge change (e.g., as in electrostatic interactions), or another preferred cleavage / separation mechanism.
[0104] The adhesive layer 112 can provide an adhesive strength having a threshold force level for the separation of functionalized particles (e.g., 100 nanonewtons, 200 nanonewtons, over 200 nanonewtons, etc.). In various modifications, the adhesive layer 112 can reliably hold the functionalized particles in place during a first set of steps in the process and reliably enable the release of all (or a desired portion) of the functionalized particles in coordination with performing a second set of steps in the process. For example, in one example, the adhesive layer 112 can reliably hold the functionalized particles in place on a substrate (e.g., a glass slide) during steps including the application of a sample (e.g., a tissue sample) placed adjacent to the functionalized particles and the release of a handshake sequence composition from the functionalized particles for tagging a sample target.
[0105] The adhesive layer 112 may further or otherwise allow for the separation of functionalized particles during sample removal (e.g., dissolution of tissue samples) and / or allow for the release and resuspension of functionalized particles for further processing of the tagged target material. Particle separation may be performed using a surfactant or other treatment to facilitate the release of particles from the adhesive layer 112. Alternatively, the adhesive layer 112 may be configured to be removed from the substrate 110 while the functionalized particles remain attached.
[0106] The adhesive layer 112 can have a surface roughness of less than 1 micrometer, less than 0.9 micrometers, less than 0.8 micrometers, less than 0.7 micrometers, less than 0.6 micrometers, less than 0.5 micrometers, less than 0.4 micrometers, less than 0.3 micrometers, less than 0.2 micrometers, less than 0.1 micrometers, less than 0.05 micrometers, less than 0.01 micrometers, or lower. A lower surface roughness value can promote uniformity of the distribution of functionalized particles in the substrate (e.g., in relation to the level of close packing achieved). A lower surface roughness value can also provide a higher level of clarity / transparency, thereby enabling optical detection of signals through the surface of the substrate 110 opposite to the surface of the substrate 110 to which the functionalized particles are bound, and / or optical detection of signals through the surface of the substrate 110 on the same side as the surface of the substrate 110 to which the functionalized particles are bound (e.g., sample analysis, optical focusing, etc.).
[0107] The adhesive layer 112 may be electrostatic (e.g., positively charged) to assist in the adhesion of the biological sample.
[0108] The adhesive layer 112 can provide a level of hydrophobicity exceeding a threshold, and under various deformations, the layer 112 can provide contact angles greater than 10 degrees, greater than 15 degrees, greater than 20 degrees, greater than 25 degrees, greater than 30 degrees, greater than 35 degrees, greater than 40 degrees, greater than 45 degrees, greater than 50 degrees, greater than 55 degrees, greater than 60 degrees, greater than 70 degrees, greater than 80 degrees, greater than 90 degrees, or greater.
[0109] The adhesive layer 112 can be made of rubber (e.g., thermoplastic rubber) and / or other suitable polymers, and specific examples include one or more of isoprene-based materials, styrene-based materials, propylene-based materials, ethylene-based materials, nylon-based materials, and other suitable rubber / polymer materials. However, in other variations, the layer 112 can be made of another suitable material.
[0110] In some examples, the adhesive layer 112 may include one or more of the following: liquid electrical tape, latex, rubber, elastomer, acrylate polymer, cyanoacrylate, gel, rubberized sealant, silicone conformal coating, other conformal coating, or other materials.
[0111] The adhesive layer 112 can support the manufacturing process (e.g., using a spray process, a vapor deposition process, a spin coating process, a printing process, etc.) and the bonding of the functionalized particle distribution to the layer. The layer 112 can further be composed of a thermoplastic material or a thermosetting material. The adhesive layer 112 can be processed in liquid form (e.g., using a suitable solvent) and applied to the substrate 110 using one or more processes (described in more detail below). However, the adhesive layer 112 can further or otherwise be applied to the substrate 110 in another suitable way (e.g., as a pre-produced film, using a printing process, using a patterning process, etc.). For example, in some examples, the adhesive layer 112 can be applied to the substrate 110 in a pattern or texture that facilitates the preferential bonding of the functionalized particle distribution 120 to the adhesive layer 112 in a desired pattern and / or density (e.g., by utilizing hydrophobic, hydrophilic, chemical bonding properties, etc.).
[0112] Furthermore, magnetic force can be used to support and / or reverse adhesion. For example, as described above, functionalized particles may have or be composed of magnetic material and may be manipulated by the application, reversal, and / or removal of magnetic force (e.g., to be held in the appropriate position or separated from the substrate).
[0113] In relation to the manufacturing process described in more detail below, multiple distributions of functionalized particles can be placed on a bulk substrate and separated from each other to create units of system 100. Further details of the manufacturing process are described in more detail below.
[0114] Furthermore, in applications involving use and spatial characterization of target analytes in 3D, stacks of substrates having a distribution of functionalized particles can be implemented (e.g., with layers of tissue samples / slices and units of system 100). Thus, system 100 may include additional substrates having a distribution of functionalized particles (e.g., a second substrate having a second distribution of functionalized particles, a third substrate having a third distribution of functionalized particles, etc.), and may include sample stacking and 3D volume reconstruction by combining data obtained from the implementation of various substrates.
[0115] Embodiments, variations, and examples of the distribution of functionalized features may further include the compositions described in U.S. Patent Application No. 17 / 376,396, filed July 15, 2021 (which is incorporated herein by reference in its entirety). Thus, such functionalized features for determining the nearest interaction may be provided together with a substrate or other natural / synthetic structure to characterize the position of a target analyte in space.
[0116] 2.2.1 Particles In embodiments in which the distribution of functionalized features 120 includes functionalized particles, a representative functionalized particle may have a body 30. To provide functionalization for tagging of sample targets (e.g., tissue-derived, cell-derived, nuclear-derived, or other biological sample component-derived) during the release of handshake sequences from the body 30, sample processing, and / or subsequent positional characterization operations, the body 30 functions to provide a surface to which one or more molecules 140 can bind.
[0117] In relation to its morphology, the body 30 can have the form of a microsphere. Alternatively, the body 30 can have a non-spherical form (e.g., ellipsoid, prism, polyhedron, amorphous, nanotube, etc.), and the cross-section taken through the body 30 is non-circular. However, the body 30 can also have another suitable form. For example, in various modifications, the body 30 may be a quantum dot that responds to excitation with different types of energy (e.g., wavelength ranges of electromagnetic energy for various applications).
[0118] Alternatively, the body 30 may include features (e.g., surface features, internal features) to support tagging or retention of sample components (e.g., single nuclei, single cells, etc.) for further processing. In various variations, such features may include recesses (e.g., depressions, gaps, holes with bottoms), pores, and gaps formed within clusters of particles used to form the body. In various variations, such features may have characteristic dimensions (e.g., width, length, depth, height, diameter, pore size, etc.) of approximately 5 micrometers, 6 micrometers, 7 micrometers, 8 micrometers, 9 micrometers, 10 micrometers, 12 micrometers, 14 micrometers, 16 micrometers, 18 micrometers, 20 micrometers, 22 micrometers, 24 micrometers, 26 micrometers, 28 micrometers, 30 micrometers, 35 micrometers, 40 micrometers, 45 micrometers, 50 micrometers, 55 micrometers, 60 micrometers, 70 micrometers, 80 micrometers, 90 micrometers, 100 micrometers, or other values based on the target particle(s) of interest. Features may include affinity molecules bound to the surface of the feature, physical properties (e.g., surface texture, extracellular matrix components), mechanical properties (e.g., stiffness, modulus of elasticity, viscoelastic properties, etc.), electrical properties (e.g., static charge), biochemical properties, and other appropriate properties to facilitate the retention of tagged particles and / or the retention of target analytes from tagged particles. Features may also include physical properties, mechanical properties, electrical properties (e.g., static charge), biochemical properties, or other appropriate properties to remove unintended sample contents from the feature in order to improve the efficiency of tagging.
[0119] Regarding dimensions, the body 30 can have a diameter (or characteristic width) ranging from nanometers to micrometers (for example, for tagging intracellular targets or other small-scale applications), and the particle size determines the resolution for characterizing the location of the target analyte. The dimensional characteristics of the body 30 correspond to a scale suitable for characterizing the location of target analytes in various structures (e.g., cells, tissues, and organs, intracellular structures, whole organisms, other components, etc.). In various variations, the body 30 can have a diameter from less than 1 micrometer to 10 micrometers. However, alternative variations of the body 30 can have other suitable dimensions (e.g., diameter less than 1 micrometer, diameter greater than 10 micrometers). In specific examples, the dimensions of the body may be 3 to 15 micrometers. In relation to body dimensions less than 6 micrometers, the tissue processing step (e.g., the permeation step) can be optimized to prevent leakage of the target to particles not adjacent to their respective locations of origin in the sample. Exemplary permeation reagents may include organic solvents (e.g., acetone, ethanol, and methanol), crosslinking agents (e.g., paraformaldehyde), surfactants (e.g., saponins, Triton X-100®, Tween-20®, or sodium dodecyl sulfate (SDS)), and enzymes (e.g., trypsin, proteases (e.g., proteinase K)).
[0120] Alternatively, the sample may not be permeabilized, and the method may include placing an impermeabilized tissue sample on a substrate, thereby avoiding the diffusion of the target from its starting position in the sample and preventing background noise (i.e., generating a high SNR value) during spatial mapping. In this way, particles with smaller dimensions may be used to achieve accurate mapping without generating background noise due to target leakage or other noise sources.
[0121] In various variations, the body 130 can have dimensions of 1 micrometer, 2 micrometers, 3 micrometers, 4 micrometers, 5 micrometers, 6 micrometers, 7 micrometers, 8 micrometers, 9 micrometers, 10 micrometers, 11 micrometers, 12 micrometers, 13 micrometers, 14 micrometers, 15 micrometers, 16 micrometers, 17 micrometers, 18 micrometers, 19 micrometers, 20 micrometers, intermediate diameters, or larger diameters. For example, larger diameters can support the above-mentioned features (e.g., recesses, gaps, holes, pores, etc.).
[0122] In various variations, the distribution of the body may include different subpopulations of the body / subpopulations of functionalized particles (e.g., as shown in Figure 1G). For example, the distribution of the body may include a first subpopulation of the body having a first diameter (e.g., a diameter less than 5 micrometers, another suitable diameter) and / or other first characteristics, and a second subpopulation of the body having a second diameter (e.g., a diameter less than 5 micrometers, another suitable diameter) and / or other second characteristics. Furthermore, the distribution of the body may include a third subpopulation of the body having a third diameter and / or other third characteristics, a fourth subpopulation of the body having a fourth diameter and / or other fourth characteristics, and / or other suitable subpopulations of the body.
[0123] In one application, the body of the first subpopulation may be functionalized for the release and tagging of a first target type (e.g., cytoplasmic targets, sample component targets, mRNA via poly-A / poly-T interactions, mRNA via interactions with polyadenylated components, protein targets, other targets that can be tagged at reactive molecular sites, etc.) (e.g., by a first handshake molecular type). The body of the first subpopulation may have a first diameter (e.g., a diameter greater than 5 micrometers, another suitable diameter). The body of the second subpopulation may be functionalized for the release and tagging of a second target type (e.g., targets containing nuclear or nuclear-related targets, e.g., random segments, segments gene-specific to nuclear targets, segments tagging extended nuclear targets, segments tagging polyadenylated nuclear targets, or other tagging segments for nuclear targets) (e.g., by a second handshake molecular type). The body of the second subpopulation may have a second diameter (e.g., a diameter less than 5 micrometers, another suitable diameter). The bodies of the second subgroup can be dispersed intermittently (e.g., in the spaces between them) on the substrate or within the first subgroup. Thus, in this application, multiple subgroups of functionalized particles can be implemented to simultaneously tag different targets with respect to characterizing the distribution of different targets using the same system.
[0124] More specifically, molecules for tagging a first target type (e.g., cytoplasmic targets, sample surface targets, mRNA via poly-A / poly-T interactions, mRNA via interactions between polyadenylated components and corresponding molecules, etc.) may include a linker sequence 21, an adapter sequence 22 (e.g., for next-generation sequencing platforms, for library preparation), a first barcode sequence 23, a UP sequence 24, a second barcode sequence 25, a UMI sequence 26, and a poly-A reactive sequence 27 for mRNA targets (e.g., dT, dTVN, dU, a combination of dT and dU, etc.). Structured molecules for mRNA tagging may further include a VN anchor 28 containing dV and dN at or near the 3' end (i.e., a V sequence containing A, C, or G nucleotides located next to an N sequence containing A, G, C, or T nucleotides). The addition of the VN anchor 28 can further facilitate mRNA tagging to the poly-A portion of mRNA molecules closer to the 5' end. The addition of VN anchor 28 can also support approaches for capturing polyadenylated (A-tail) nucleic acids (e.g., polyadenylated microRNAs, polyadenylated nuclear small RNAs, polyadenylated viral RNAs, polyadenylated microbial RNAs, polyadenylated non-host RNAs, polyadenylated coding and non-coding RNAs, etc.), and polyadenylation may involve the use of yeast poly-A polymerase or other suitable components for polyadenylation. An example of a molecule for mRNA tagging is shown in Figure 1H (below), with the sequence oriented from 5' to 3'.
[0125] More specifically, a second target type (e.g., a target containing a nuclear or nuclear-related target, e.g., a randomer segment, a segment gene-specific to a nuclear target, a segment tagging an extended nuclear target, a segment tagging a polyadenylated nuclear target, or other tagging segments for a nuclear target) may include a first linker sequence 31, a PCR handle 32 (e.g., for a next-generation sequencing platform, for library preparation), a first barcode sequence 33, a second linker sequence 34, a second barcode sequence 35, a UMI sequence 36, and a handshake sequence 37 for tagging the nuclear target / other target upon release of the molecule accompanied by cleavage of the first linker sequence 31. In one example, the handshake sequence 37 for tagging the nuclear target may include the sequence 5' GCTTTAAGGCCGGTCCTAGCAA 3'.
[0126] An example is shown in Figure 1H (top), where the sequence is oriented from 5' to 3'. Molecules for capturing a second target type can be released from each body 130 for diffusion toward the proximal sample target (e.g., the nucleus) and for tagging with the proximal sample target (e.g., the nucleus) handshake sequence 37 (e.g., via cleavage mechanisms such as photocleavage, thermalcleavage, chemicalcleavage, or enzymaticcleavage).
[0127] In further variations, one of which is shown in Figures 1B and 1C, the distribution of functionalized particles may be configured such that the spaces between functionalized particles function to hold, divide, and / or isolate sample components (e.g., cells, nuclei, cell clusters, single analytes, grouped analytes, etc.) in appropriate positions on the substrate for spatial mapping and other characterization of targets related to isolated sample components. As shown in Figures 1B and 1C, sample components can be isolated individually in the spaces between functionalized particles. Alternatively, sample components may be mounted on regions defined by the boundaries of adjacent functionalized particles. In one example, the sample component may include a single cell. In another example, the sample component may include a nucleus (e.g., a barcode-tagged and isolated nucleus as described).
[0128] In various modifications, the sample components isolated from the distribution of functionalized particles on the substrate can be covered (e.g., sealed) by a layer such as layer 15, as described below. In various modifications, layer 15 may consist of an optimal cutting temperature (OCT) compound (e.g., an OCT compound alone, or a combination of an OCT compound and other process reagents), oil, aqueous material, mesh, hydrogel, or another suitable material. Thus, covering can provide protection with respect to maintaining the viability of cells or other targets, and to general sample handling and / or sample processing functions.
[0129] With respect to the functionalized particles described, the main body 130 may have appropriate density characteristics (e.g., having a density smaller, larger, or equal to the various processing solutions associated with the processing and characterization operations), porosity (e.g., having a pore diameter of 100 to 2000 angstroms), thermal properties (e.g., with respect to melting temperature, conductivity, temperature sensitivity / responsiveness, etc.), physical properties (e.g., with respect to swelling properties, leaching properties, hydrophilicity, crosslinking, etc.), surface properties (e.g., linker molecule binding sites, functional chemical groups, charge, etc.), magnetic properties (e.g., magnetic properties, and / or, for example, paramagnetic properties due to the incorporation of magnetic nanoparticles), and / or other properties. In various modifications, when a magnetic force is applied to the functionalized particles, the functionalized particles can be delivered into a sample (e.g., into a sample of suspended cells, a sample of suspended nuclei, a hydrogel sample, a tissue sample) using the use of magnetically functionalized particles. The organism can be further or otherwise stained, or bound to stained molecules, and the stained organism or molecules may have their respective excitation and emission spectra.
[0130] With respect to the functionalized particles described, the body 130 may have suitable fluorescence properties (e.g., non-fluorescent so as not to interfere with optical detection assays, fluorescence / optical properties, e.g., fluorescent embedding labels, encoding nucleic acid bases identifiable during optical detection), buoyancy properties (e.g., for positioning particles on a surface by buoyancy and for applying a sample to a suspended distribution on a surface where suspended particles move), mechanical properties (e.g., hardness, rigidity, elastic behavior, viscoelastic behavior, fatigue resistance, fracture resistance, shear strength, compressive strength, tensile strength, rheological behavior, etc.), solubility (e.g., soluble in solvents, etc.), pH sensitivity, and / or other suitable properties, embodiments, variations, and examples of these are described in U.S. Patent Application No. 17 / 376,396, filed July 15, 2021, which is incorporated herein by reference in its entirety.
[0131] Regarding composition, the body 130 may consist of one or more of the following: polymers (e.g., polystyrene, polystyrene-divinylbenzene, polymethyl methacrylate (PMMA), etc.), hydrogels, silica, silicon, non-porous glass, porous glass, coated glass, agarose, acrylamide, polyacrylamide, iron, steel, or ceramic materials, and / or combinations of one or more suitable materials. The body composition may include peptides, nucleic acids, and, but is not limited to, those used in the synthesis of organic parts, including plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, triazoles, carbon graphite, titanium dioxide, latex, or cross-linked dextrans such as Sepharose, cellulose, nylon, cross-linked micelles, Teflon®, etc. Different regions of the body 130 may be composed of different materials (e.g., the core region may be composed of a first material and the shell region may be composed of a second material). Furthermore, or alternatively, the body may be treated or adapted with phosphoramidite chemistry for the synthesis of oligonucleotides on the body 130. In certain examples, synthesis can be performed by synthesizing a constant sequence in a single column, followed by deprotection, and then distributing the body across four columns, each configured to attach one of A, T, G, or C phosphoramidites to the body. The bodies can then be pooled, thoroughly mixed, and redistributed across the four columns to attach A, T, G, or C phosphoramidites to the bodies. Thus, the barcode sequence attached to each bead is randomized, but all oligonucleotides on each bead have the same sequence. In synthesis, the use of exonucleases may be employed to remove or avoid undesirable levels of cleaved oligonucleotides in the functionalized particles. Synthesis may include split-pool synthesis or other synthetic approaches (e.g., generating functionalized particles by attaching the 5' end of an oligonucleotide containing an adapter sequence to a particle, followed by emulsion PCR using a primer containing a unique barcode sequence).
[0132] In some embodiments, the body 130 may include multiple regions as multiple shell regions or in other configurations such as amorphous or regular spatial arrangement. In further examples, the body 130 may include or take the form of polymer bodies / molecules (e.g., DNA nanoballs, dendrimers, etc.), and in applications, the dendrimers may be reduced in size to "functional monomers" (i.e., as the smallest functional molecular assembly units).
[0133] While it has been described that the particles are arranged on a substrate (e.g., a slide), alternative embodiments may include providing a distribution of functionalized particles in a solution for interaction with a sample.
[0134] 2.2.2 Embodiments of Oligonucleotide Segments Each body has one or more molecules 140 bound thereto and structured to provide the functionality described below. The occupancy of molecules on the surface of each particle can be configured to prevent crowding, prevent self-hybridization, and / or allow access to the target analyte and / or enzyme as needed during processing. In some embodiments, a representative functionalized molecule of the functionalized molecule distribution includes a handshake sequence 141 comprising at least a reactive portion configured to tag or bind to a sample target (e.g., a nucleus derived from a tissue sample), a barcode segment 142 (the barcode segment 142 has a barcode sequence that can function as a spatial address), and a cleavage linker / release linker 143 (e.g., in response to a stimulus) configured to allow the handshake sequence 141 to be released from the representative feature 130. As described below, one or more molecules 140 may include or omit regions based on the intended use. The density of one or more molecules may be at least 10 times greater than the amount of target analyte intended for tagging from the sample(s), or may consist of other suitable densities for other uses.
[0135] For example, the number of functionalized molecules on a particle is at least 10, 100, or 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or more. It will be understood that each of the molecules on each particle or other feature may exist in multiple copies, for example, if the molecules are amplified to form clusters. Thus, the above range may explain the number of different nucleic acid clusters on the beads or other nucleic acid display substrate / feature.
[0136] 2.2.2.1 Handshake Sequence The handshake sequence 141 is released from a functionalized feature and functions to tag the target component of the sample (e.g., a tissue section) as it diffuses toward the target component of the sample (e.g., the nucleus). Therefore, the handshake sequence 141 includes a reaction site corresponding to (e.g., complementary to) the molecule of the target component of the sample. Thus, the reaction site can bind to the target component with a suitable binding during the release of the handshake sequence and the diffusion of the handshake sequence toward the target component (under passive or active control). The handshake sequence 141 is preferably located at the end of each molecule, or it may be otherwise located along the molecule. The handshake sequence may have one or more reaction sites.
[0137] The reaction site of handshake sequence 141 may correspond to a nuclear target (e.g., it may be complementary to one). The reaction site of handshake sequence 141 may correspond to a cell surface target (e.g., it may be complementary to one). The reaction site of handshake sequence 141 may correspond to an intracellular target (e.g., it may be complementary to one). The reaction site of handshake sequence 141 may correspond to a nucleic acid target (e.g., it may be complementary to one). The reaction site of handshake sequence 141 may correspond to a DNA target (e.g., genomic DNA) (e.g., it may be complementary to one). The reaction site of handshake sequence 141 may correspond to an RNA target (e.g., mRNA) (e.g., it may be complementary to one). The reaction site of handshake sequence 141 may correspond to a polyadenylated target (e.g., it may be complementary to one).
[0138] The reaction site of handshake sequence 141 may correspond to (e.g., be complementary to) a sample protein target and may contain an NHS ester (i.e., succinimidyl ester) component. The reaction site of handshake sequence 141 may correspond to (e.g., be complementary to) an extracellular matrix target. The reaction site of handshake sequence 141 may correspond to (e.g., be complementary to) another spatially distributed target in the cell.
[0139] The reaction site of handshake sequence 141 can bind to other types of molecules (e.g., antibodies, proteins, peptides, chemicals, etc.), antibodies, aptamers, and / or other suitable target-binding segments.
[0140] The reaction site of handshake sequence 141 can correspond to the target sequence without 100% complementarity.
[0141] A first variation of handshake sequence 141 may include a sequence for tagging a first target type (e.g., a target containing a nuclear or nuclear-related target, such as a random segment, a segment that is gene-specific to a nuclear target, a segment that tags an extended nuclear target, a segment that tags a polyadenylated nuclear target, or a segment that has other tagging segments for a nuclear target). An example of a first variation of handshake sequence 141 is shown above in Figure 1H. An example of handshake sequence 141 for tagging a nuclear target of a sample may include the sequence 5' GCTTTAAGGCCGGTCCTAGCAA 3'.
[0142] A second variation of the molecule having handshake sequence 141 may include a polyT sequence 27 (e.g., dT, dTVN, etc.) for tagging mRNA targets (an example is shown below Figure 1E). The molecule structured for mRNA tagging may further include a VN anchor 28 (i.e., a V sequence containing A, C, or G nucleotides located next to an N sequence containing A, G, C, or T nucleotides) containing dV and dN at or near the 3' end (shown below Figure 1H). The addition of VN anchor 28 can further facilitate mRNA tagging to the polyA portion of mRNA molecules closer to the 5' end. The addition of VN anchor 28 can also support approaches for tagging polyadenylated (A-tail) nucleic acids (e.g., polyadenylated microRNAs, polyadenylated nuclear small RNAs, polyadenylated viral RNAs, polyadenylated microbial RNAs, polyadenylated non-host RNAs, polyadenylated coding and non-coding RNAs, etc.), and polyadenylation may involve the use of yeast poly-A polymerase or other suitable components for polyadenylation.
[0143] A third variation of handshake sequence 141 may include a reactive segment configured to support target tagging in a way that does not compete with mRNA tagging (e.g., by other molecules structured for mRNA tagging, with other molecules bound to the same particle). A specific example of a third variation of handshake sequence 141 may include the sequence 5'AAGCAGTGGTATCAACGCAGAGTG 3'. In exemplary use cases, the third variation of handshake sequence 141 can support applications including CRISPR screening, antibody tagging, VDJ immunorepertory sequencing, and other applications.
[0144] A fourth variation of handshake sequence 141 may include a reactive segment configured to support 5' tagging of a single target. A specific example of a fourth variation of handshake sequence 141 may include the sequence 5'TTTCTTATATrGrGrG 3'. In an exemplary use case, a fourth variation of handshake sequence 141 may be used to tag the 5' end of a target by utilizing a non-template rC nucleotide.
[0145] However, the handshake sequence 141 can be configured for tagging other targets. For example, as shown in Figure 1I, in some variations, a target 5 (e.g., any target type of the sample that can be molecularly labeled) may be labeled (e.g., pre-labeled) with a probe 6 having a handle corresponding to the handshake sequence, and the release of the handshake sequence 141 from the features of the substrate 110 may allow the released handshake sequence to diffuse to the labeled target, and as a result the labeled target may be tagged with a barcode that serves as a spatial address. Thus, the described method may include pre-labeling a set of targets of a sample with a set of probes having handles corresponding to a set of handshake sequences, subsequently releasing the handshake sequence for diffusion to the pre-labeled target of the sample, and tagging the pre-labeled target of the sample with a barcode that serves as a spatial address.
[0146] In relation to the described deformation, the functionalized features in the substrate may include a first subset of molecules having a first type of handshake sequence and a second subset of molecules having a second type of handshake sequence. The production of particles having different subsets of molecular types may involve incorporating a mixture of recognizable elements (e.g., phosphoramidites such as dt-DMT) and protecting groups (e.g., dA-Lev). Here, the ratio of the recognizable elements to dt-DMT in the mixture can be used to control the ratio of the first subset of molecules to the second subset of molecules in a particular functionalized feature. Both the recognizable elements and protecting groups may be configured to bind to the free ends of molecules synthesized in a particular functionalized particle. The synthesis of molecules of the first subset of molecules then continues from the free ends incorporating the recognizable elements, followed by capping (e.g., after the final detritylation of the dT molecule). The synthesis of the second subset of molecules can be continued from the free end incorporating the protecting group after deprotection of the protecting group (e.g., removal of the dA-Lev group).
[0147] The ratios of the first molecular type to the second molecular type in the functionalized features were 50:50, 49:51, 48:52, 47:53, 46:54, 45:55, 44:56, 43:57, 42:58, 41:59, 40:60, 39:61, 38:62, 37:63, 36:64, 35:65, 34:66, 33:67, 32:68, 31:69, 30:70, and 29:71. It could be 28:72, 27:73, 26:74, 25:75, 24:76, 23:77, 22:78, 21:79, 20:80, 19:81, 18:82, 17:83, 16:84, 15:85, 14:86, 13:87, 12:88, 11:89, 10:90, 9:91, 8:92, 7:93, 6:94, 5:95, 4:96, 3:97, 2:98, or 1:99.
[0148] In deformations where multiple types of molecules are bound to the same functionalized feature, only a subset of the molecules may be configured to be releaseable and cleavable from the functionalized feature (e.g., depending on the intended assay).
[0149] Handshake sequences, linker sequences, and / or other adapter sequences may support downstream mononuclear RNA-seq (snRNA-seq) assays, mononuclear ATAC-seq (snATAC-seq) assays, T cell receptor (TCR) sequencing assays, and / or other assays.
[0150] Further embodiments, variations, and examples of the handshake sequence 141 may have structures that overlap with the sequence described in U.S. Patent Application No. 17 / 376,396, filed July 15, 2021, which is incorporated by reference above.
[0151] 2.2.2.2 Barcode Segments The barcode segment 142 can perform many functions. The barcode segment 142 may be continuous or may contain multiple subsegments (e.g., individual subsegments separated by one or more linkers or spacers). One or more subsegments of the barcode segment 142 can function as spatial addresses (e.g., when decoding the barcode segment and when identifying the location of the corresponding molecule in the substrate 110 before the release of the molecule from the substrate 110 for diffusion toward the target of the sample and tagging of the target of the sample). The barcode segment 142 and / or individual subsegments function to enable the identification of the functionalized feature in the substrate to which it is associated when sequencing the barcode segment 142. In some variations, the barcode segment 142 and / or other variations of the barcode segment 142 may also function to enable the identification of the substrate 110, the overall distribution of the functionalized feature 120 associated with the substrate 110, and / or other embodiments (e.g., during sequencing). Therefore, reading the barcode segment 142 can facilitate the characterization of the distribution of targets tagged using the substrate 110, and / or other aspects of the substrate 110, as well as the distribution of the functionalized features 120.
[0152] The barcode segments 142 are preferably configured to be unique to each of the functionalized features. However, several barcode segments 142 associated with different functionalized features on the substrate 110 may overlap across features, as long as the substrate can still be used to generally map spatial information of various target components. Furthermore, the barcode segments 142 associated with different functionalized features are configured to have diversity so that each functionalized feature or group of functionalized features associated with the substrate 110 can be uniquely identified. In particular, the diversity of the barcode library is at least 10 times greater than the number of functionalized particles deposited on the substrate, and as a result, almost all functionalized features have a unique barcode on the substrate. Alternatively, the barcode segments 142 can be characterized with respect to diversity in another suitable way. In some embodiments, the barcode segments 142 may have 5 to 100 bases to provide a sufficient number of unique sequences for a desired number of particles in a solution for a given process (i.e., so that each particle can be uniquely identified). However, in alternative variations, the barcode segment 142 may have a different number of bases (e.g., less than 5 bases, more than 100 bases). Furthermore, or alternatively, the barcode segment 142 may have several bases, occupying a percentage (e.g., 10%, 20%, 30%) of the length of each molecular unit of the functionalized particle. The barcode segment(s) of the functionalized feature 120 on the substrate can be decoded to identify the location of the functionalized feature, and thus any target tagged using the functionalized feature or multiple functionalized features (e.g., for the substrate 110, for a location in a tissue sample, for other appropriate data).
[0153] Furthermore, in some variations, the percentage of functionalized features may have known barcode sequences and may spike within the distribution of functionalized particles to serve a quality control function in downstream sequencing operations (e.g., in situ sequencing operations).
[0154] For example, functionalized molecules for a substrate feature may have the same barcode segment (i.e., each position has the same barcode segment) but may have different total molecular lengths. Because shorter nucleic acids diffuse further within the sample (e.g., tissue section) than longer nucleic acids, the different lengths allow for the identification of the spatial location of the tagged target in a three-dimensional handshake sequence. In exemplary embodiments, the location of tagged targets in a sample having multiple layers of targets can be determined, for example, by using a computational method to analyze the number and length of functionalized molecules tagged to each target.
[0155] When used, decoding of barcode segment 142 / associated location can be performed using an optical approach (e.g., in situ sequencing which is synthesis sequencing with or without a reversible terminator, ligation-based, hybridization-based, rolling circle amplification-based, in situ hybridization-based fluorescence, etc.), using a proximity method with next-generation sequencing reading (as described in the application incorporated by reference), using the morphology of the functionalized particles (e.g., using patterns etched onto the particles or other uniquely identifiable particle morphological features, each feature associated with one barcode), using a combination of fluorescent colors emitted from the functionalized particles (e.g., each combination of fluorescent colors corresponding to a barcode), and / or using another suitable method.
[0156] Therefore, decoding can generate sequence-validated sequences of features, and as a result, the sequence of barcodes that functions as spatial addresses at each feature position, or beyond a certain percentage of positions (e.g., 50%, 60%, 70%, 80%, 90%, 95%, 99%), is known. In exemplary embodiments, the sequence of barcodes at each position on the substrate is determined by in situ sequencing. In exemplary embodiments, features are sequence-validated by in situ sequencing before the tissue sample is placed on the substrate. In exemplary embodiments, in situ sequencing is performed by ligation sequencing or sequencing by direct synthesis on the array, and captured by a microscope. Alternatively, the sequence of the array is validated because the barcodes attached to the array at each position are specifically positioned at each position.
[0157] In some examples, decoding of barcode segment 142 / associated location may involve performing a ligation sequencing (SOLiD) operation to decode the location of nucleic acid labels (e.g., using sequencing primer sites, UP primer sites, etc.) and associated labels of functionalized particles on the substrate. Sequencing / decoding can be performed using a microfluidic device having a flow cell, by which the units of system 100 are processed for decoding before filling and delivery (e.g., sequentially, in parallel). Thus, the microfluidic device can control the flow of material for interaction with the units of the substrate in cooperation with an imaging system having a field of view encompassing the substrate(s) configured to capture an image, and from the image, the arrangement of barcode segments in relation to the substrate location can be determined.
[0158] In various examples, decoding of barcode segments can be performed using other sequencing-based approaches. For example, decoding may be performed using sequencing with error reduction by dynamic annealing and ligation (SEDAL), sequencing in the 5' to 3' direction, sequencing in the 3' to 5' direction, and / or other sequencing processes. In variations, decoding may include performing a set of iterations of SEDAL sequencing, a set of iterations of sequencing from the 5' to 3' direction, and a set of iterations of sequencing from the 3' to 5' direction. The sequencing iterations may use the same and / or different reagents (e.g., different primers). In variations, the number of iterations for each sequencing approach may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or more iterations. Here, the number of iterations for each sequencing process may be the same or different.
[0159] The decoding pass rate can be over 50%, over 60%, over 70%, over 80%, over 90%, or higher, and the decoding pass rate can be determined based on a set of criteria.
[0160] The set of criteria may include one or more of the following: particle count criteria, shape score criteria, substrate coverage criteria, criteria for the amount of empty space (e.g., patches) on the substrate, dominant barcode ratio per bead / feature criterion, base call quality criteria, image registration criteria, target area correlation criteria, target area area criteria, and overall pass / fail criteria.
[0161] Particle count criterion: This criterion is based on the number of particles counted on the substrate. For example, for a 3mm x 3mm distribution of particles that meet the particle count criterion, the particle count may be between 60,000 and 80,000 particles.
[0162] Shape Score Criteria: This criterion is related to the expected shape of the particle distribution on the substrate, based on an evaluation of a target area of the substrate that extends to a portion of the particle distribution on the substrate. For example, the shape score may indicate that the area does not have a square shape (or other undesirable shapes) in order to pass the shape score criterion.
[0163] Substrate coating criteria: This criterion relates to the coating density of the particle distribution on the substrate relative to the expected coating density (e.g., for a random close-packing distribution, for another close-packing distribution, for yet another distribution). In one example, the coating of the substrate may be 90% (or more) of the expected coating density to pass the substrate coating criteria.
[0164] Criteria for the amount of empty space: This criterion concerns the presence of observable empty space, such as empty patches on the substrate. For example, an empty patch can be defined as a continuous patch missing more than 5, 6, 7, 8, 9, 10, or more particles.
[0165] Criteria for the dominant barcode ratio per bead / feature: For example, each particle should have only one dominant barcode segment sequence across all oligonucleotides on that particle, which functions as a spatial address. The criterion is not passed if the average (e.g., mean, median, etc.) barcode segment sequence does not exceed a certain percentage of the barcode segment sequences on each particle. For example, pass rates could be more than 50% identical barcode segment sequences on a particle, more than 55% identical barcode segment sequences on a particle, more than 60% identical barcode segment sequences on a particle, more than 65% identical barcode segment sequences on a particle, more than 70% identical barcode segment sequences on a particle, more than 75% identical barcode segment sequences on a particle, etc.
[0166] Base Call Quality Criteria: This criterion captures the signal-to-noise ratio (SNR) of base call quality. In many cases, base call quality (e.g., SNR) must be greater than 2, greater than 3, greater than 4, or higher to pass the criterion.
[0167] Image Registration Criteria: This criterion concerns the registration of multiple images used to decode the position of particles on a substrate. If the images are not properly captured, the image registration criterion characterizes misalignment across the image edges. Any observable misalignment results in failure to pass the criterion.
[0168] Target Area Correlation Criteria: This criterion describes the correlation between the expected shape and the actual shape of the ROI, and the correlation must be greater than 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, or higher in order to pass the criterion.
[0169] Area of Interest Criterion: This criterion assesses the presence of missing particles at the edges of the functionalized particle distribution, or the presence of functionalized particles outside the intended distribution of functionalized particles.
[0170] Overall pass / fail criteria: This is the criterion for evaluating all the criteria mentioned. In each case, all criteria must be met to pass the overall pass / fail criteria.
[0171] The barcode segment 142 may be probabilistic or non-probabilistic. Depending on the application, the barcode segment may have a total length of 6 to 100 base pairs. Alternatively, depending on the application, the barcode segment may have a total length of less than 6 base pairs, or 100 to 200 base pairs. In a specific example, a typical barcode segment 142 has a length of 14 base pairs and includes a first barcode subsegment with 8 base pairs and a second barcode subsegment with 6 base pairs, these subsegments separated by a linker.
[0172] 2.2.2.3 Linkers for the release and diffusion of molecules to the target The cleavage linker 143 is bound to the body 130 (or to other functionalized features of the substrate 110 or the substrate itself 110, to diffuse toward and tag the target of the sample) and functions to provide a mechanism by which the molecule bound to the body 130 or substrate can be controlledly released from the body. The cleavage linker 143 can also extend units of one or more molecules 140 into space, thereby enabling interaction between one or more molecules 140 and target analytes of the sample (e.g., nuclear targets) that can benefit from tagging by the cleavage linker or are difficult to access without using the cleavage molecules.
[0173] In various embodiments, the first cleavage-type linker 143 is configured to perform selective bonding (e.g., with functional groups specific to a particular chemical action) and / or activatable cleavage to enable the controlled release of one or more molecules 140 from the body 130. In variations, activatable cleavage or separation by other means may be achieved using linker regions configured to cleave in response to one or more of the following preferred cleavage mechanisms: thermal cleavage, pH shift, photocleavage, enzymatic cleavage (e.g., as in molecular scissors), chemical cleavage, separation based on charge change, or other preferred cleavage mechanisms.
[0174] In various modifications, photocleavage can be achieved using photocleavage linkers that cleave in a controllable manner with specific optical properties (e.g., wavelength, intensity, exposure time, etc.). In such modifications, the controlled cleavage properties can prevent undesirable cleavage of molecules (e.g., in a storage environment with ambient light or other forms of light before use). For example, a photocleavage linker may be structured to cleave upon exposure to ultraviolet (UV) light (e.g., wavelength 100–400 nm) with exposure times of 1 second, 2 seconds, 3 seconds, 4 seconds, 5 seconds, 10 seconds, 30 seconds, 60 seconds, 90 seconds, 100 seconds, 200 seconds, 300 seconds, or longer. However, a photocleavage linker may also be configured to cleave in response to non-UV light.
[0175] An exemplary photoclearance linker has the following structure and can be cleaved when exposed to ultraviolet light with a wavelength of 300-350 nm.
[0176] [ka]
[0177] However, other light-section linkers or photoresponsive components can be used.
[0178] In the composition, the cleavage linker 143 may be composed of a polymer (e.g., a non-nucleic acid polymer), and in certain examples, the cleavage linker 143 may be composed of polyethylene glycol (PEG) or another suitable polymer. However, the cleavage linker 143 may be composed of another suitable material (e.g., a natural material, a synthetic material).
[0179] Structurally, the cleavage linker 143 may have a linear structure that extends units of one or more molecules 140 into space. Alternatively, the cleavage linker 143 may have a branched or nonlinear structure (e.g., dendrimer segments, double-linked segments, other branched segments). For example, in a variation where the cleavage linker 143 is configured to control the spacing / density of molecules bound to the body 130 or other features, the cleavage linker 143 may have a branched structure that reduces the density of molecules bound to the body 130 or other features and / or controls the spacing / orientation of molecules. Furthermore, or alternatively, the length and / or structure of the cleavage linker 143 may be configured to prevent steric hindrance of any enzymes or materials that may interact with oligonucleotide molecules during use. Exemplary double-linker structures may have a free OH group at the 5' end of the structure or a phosphoramidite at the 5' end of the structure to improve packing density properties. Branched structures may include protecting groups (e.g., lev protecting groups).
[0180] Regarding properties, the cleavage linker 143 can be configured with a desired charge and / or other properties (e.g., hydrophilicity level, hydrophobicity level, etc.) that prevent undesirable intermolecular interactions (e.g., entanglement, aggregation, undesirable structures). Thus, the cleavage linker 143 can be configured to extend one or more molecules 140 into space (e.g., perpendicularly from the surface of the body 130). However, the cleavage linker 143 can be configured to extend from the body 130 or other mechanisms in another suitable manner.
[0181] In various variations, one or more molecular units may omit or include additional segments as needed. For example, one or more of the one or more molecules 140 may include a segment configured for amplification reactions (e.g., a PCR handle). Furthermore or alternatively, one or more of the one or more molecules 140 may include a unique molecular identifier (UMI). Furthermore or alternatively, one or more of the one or more molecules 140 may include a fluorescent embedding label (e.g., to provide a mechanism for identifying components tagged with a handshake sequence, such as a nucleus, and separating them from untagged components, by quantifying the percentage or ratio of tagged components to untagged components, thereby providing a mechanism for determining the efficiency of components having a handshake sequence). Furthermore or alternatively, one or more of the one or more molecules may include a segment configured to simplify a library preparation step or sequencing process for a particular sequencing platform. More specifically, the molecules of one or more molecules may include an adapter segment (e.g., related to a P5 / P7 adapter for an Illumina® platform), an index sequence related to the adapter, and / or other sequences. Furthermore, additional segments may be added during sample processing (e.g., during reverse transcription). One or more units of molecule 140 may further or otherwise include other sequences (e.g., for other fragmentation, sequencing, and / or processing platforms). In various embodiments, molecules may be produced or synthesized by partitioned pool synthesis (e.g., chemically, using an oligo-synthesizer), enzymatic synthesis (e.g., using ligation and polymerase elongation), template-free synthesis by emulsion PCR (e.g., using a terminal transferase), and / or other suitable methods described in more detail below.
[0182] Functionalized molecules may further include nucleotide modifications to enhance the diffusion of the sample to a target (e.g., the nucleus). In some examples, functionalized molecules may include, or be bound to, lipophilic or amphiphilic moieties that can interact with and / or insert themselves into lipid membranes such as cell membranes and nuclear membranes. Examples of lipophilic molecules may include sterol lipids (e.g., cholesterol, tocopherol, derivatives, etc.), lignoceric acid, palmitic acid, and other moieties. Other lipophilic molecules suitable for the described applications may include amphiphilic molecules whose charge, aliphatic content, aromatic content, and / or fatty acid chain length may be altered. In some examples, the fatty acid side chain (e.g., C12, C14, C16, or C18) may be bound to glycerol or glycerol derivatives, which may also include a cationic head.
[0183] Therefore, the functionalized molecule can be bound to one or more lipophilic moieties via a linker (e.g., a tetraethylene glycol (TEG) linker, a polyethylene glycol (PEG) linker, etc.). Other exemplary linkers may include amino linkers (e.g., C6, C12), spaces (e.g., C3, C6, C12, C9, C18), or other linkers or spaces. The lipophilic moiety or linker may be bound to the functionalized molecule at its 5' end or other preferred moiety. The functionalized molecule can be structured to be releasably bound to the linker or lipophilic moiety (e.g., according to a variation of the mechanism described) so that the functionalized molecule or a portion thereof can be released from the lipophilic / amphiphilic molecule. In exemplary embodiments, the lipophilic moiety (e.g., cholesterol) is indirectly bound to an oligonucleotide (e.g., via hybridization or ligand-ligand interaction, e.g., biotin-streptavidin).
[0184] In relation to the capture of different targets (e.g., cytoplasmic targets, nuclear targets, protein targets, targets from other sample regions, etc.), functionalized particles may have molecules with different PCR handles corresponding to different target types to enable selective amplification, detection, and mapping of different target types.
[0185] Functionalized particles may have different subsets of molecules bound to them (e.g., as shown in Figure 1G), where a first subset of molecules may be cleaved by a first mechanism (e.g., to tag a first target type such as a nuclear target), and a second subset of molecules may not be cleavable (or not cleavable by a second mechanism different from the first) to tag a second target type (e.g., a cytoplasmic target). The first or second cleavage mechanism may include thermal cleavage, pH shift, photocleavage, chemical cleavage, enzymatic cleavage (e.g., as in molecular scissors), separation based on charge change (e.g., as in electrostatic interactions), or another preferred cleavage / separation mechanism. In relation to cleavage, the sample or processing reagent may contain a diffusion-limiting compound (e.g., a long-chain polymer such as in a polyethylene glycol solution) to prevent the diffusion of functionalized particles that have been cleaved beyond a threshold distance from the starting position. Thus, the diffusion-limiting compound may enable accurate target mapping even when cleavable tagging molecules are implemented to tag targets after cleavage. In use cases where nuclear targets are tagged with functionalized molecules derived from different functionalized particles (which can be determined, for example, using barcode sequences or other spatial tag sequences), bioinformatics can be used to characterize the location of such nuclear targets and the diffusion behavior of the cleaved molecules (e.g., the average distance diffused to reach the target), which can then be used to improve the signal-to-noise ratio (SNR) of the generated map.
[0186] For example, in embodiments where nuclei are tagged using cleavable molecules of functionalized particles, nucleus tagging may involve tagging nuclei with different cleavable molecules associated with different spatial locations. A bioinformatics approach may involve determining the location of nuclei based on a subset of locations corresponding to a subset of probabilistic barcodes of the molecules tagging the nuclei. The location of nuclei can be determined from the average location of the subset of probabilistic barcodes (e.g., the centroid of the locations of the subset of probabilistic barcodes). In variations, nuclei may be tagged using a combination of cleavable and non-cleavable molecules (or molecules cleaved at different stages in response to different stimuli), and consequently, the location of nuclei can be determined from the probabilistic / spatial barcode locations of the cleavable and non-cleavable molecules (e.g., as a weighted centroid of locations, where the location of the non-cleavable component is weighted more than the location of the cleavable component). Thus, locations estimated from barcodes acting as spatial addresses may be estimates of locations within or on a sample, within or on a feature (e.g., functionalized particles), or combinations thereof.
[0187] In situations where tagged nuclei, tagged cells, or other tagged sample components have multiple tags, noise can be filtered by generating location data for the tagged component using sequences associated with only one UMI or a subset of UMIs.
[0188] Different molecules configured to tag different targets can be bound to the same particle / feature / organism. Alternatively, different subpopulations of particles / feature / organisms can be paired with different molecules configured to tag different targets.
[0189] For example, in one embodiment, the distribution of functionalized features in the substrate 110 may have different subsets of molecules bound to it (e.g., as shown in Figure 1H), where different subsets of molecules include different platform-specific sequences. For example, a first subset of molecules may include sequences specific to a first platform, a second subset of molecules may include sequences specific to a second platform, a third subset of molecules may include sequences specific to a third platform, and so on. The platforms (e.g., first platform, second platform, third platform, etc.) may be different single-cell analysis platforms (e.g., including different adapter sequences, different priming sequences, etc.), different sequencing platforms (e.g., including different adapter sequences, different priming sequences, etc.), different single-nucleus analysis platforms (e.g., including different adapter sequences, different priming sequences, etc.), different splitting platforms, and / or other different types of platforms. Different platforms may be from the same manufacturer / supplier and / or different manufacturers / suppliers. In the embodiment shown in Figure 1H, a subset of molecules can tag the same type of target (e.g., nuclear target, cytoplasmic target, cell surface target, intracellular target, etc.) and be configured differently with respect to spatial and platform-specific sequences. Alternatively, a subset of molecules can tag different types of targets (e.g., nuclear target, cytoplasmic target, cell surface target, intracellular target, etc.) and be configured differently with respect to tagging sequences that bind to (e.g., hybridize with) different targets, spatial and platform-specific sequences.
[0190] With respect to individual functionalized features, different types of molecular subsets may bind to the same functionalized feature. Alternatively, individual functionalized features may have only one type of molecular subset bound to them (e.g., molecules specific to one platform). With respect to different types of molecular subsets, each subset may be configured to be cleaved from its respective functionalized feature using the same or different cleavage mechanisms (e.g., to provide different controls for cleavage of different types of molecular subsets). Cleavage mechanisms for different types of molecular subsets may include thermal cleavage, pH shift, photocleavage, chemical cleavage, enzymatic cleavage (e.g., as in molecular scissors), separation based on charge change (e.g., as in electrostatic interactions), or other preferred cleavage / separation mechanisms.
[0191] For example, with respect to a first subset and a second subset of molecules, the first subset of molecules may be configured to be cleaved in response to a first stimulus, including one of the following mechanisms: thermal cleavage, pH shift, photocleavage, chemical cleavage, enzymatic cleavage (e.g., as in molecular scissors), separation based on charge change (e.g., as in electrostatic interaction), or another preferred cleavage / separation mechanism. The second subset of molecules may be configured to be cleaved in response to a second stimulus, including one of the following mechanisms: thermal cleavage, pH shift, photocleavage, chemical cleavage, enzymatic cleavage (e.g., as in molecular scissors), separation based on charge change (e.g., as in electrostatic interaction), or another preferred cleavage / separation mechanism, different from the first cleavage / separation mechanism.
[0192] Alternatively, for example, with respect to a first subset and a second subset of molecules, the first and second subsets of molecules may be configured to be differentially cleaved in response to different parameters of the same type of stimulus or mechanism. For example, with respect to a photocleavage mechanism, the first subset of molecules may be configured to be cleaved in response to light of a first wavelength, and the second subset of molecules may be configured to be cleaved in response to light of a second wavelength different from the first wavelength. Different exposure times may also be used for different photocleavage mechanisms. In another example, with respect to a thermal cleavage mechanism, the first subset of molecules may be configured to be cleaved in response to a first thermal stimulus, and the second subset of molecules may be configured to be cleaved in response to a second thermal stimulus different from the first thermal stimulus. In another example, with respect to the chemical cleavage mechanism, a first subset of molecules may be configured to cleave in response to a first chemical stimulus (e.g., a first enzyme), and a second subset of molecules may be configured to cleave in response to a second chemical stimulus (e.g., a second enzyme) that is different from the first chemical stimulus.
[0193] Molecules can be bound to functionalized particles having an appropriate molecular density per particle. For example, a particle may have tens to hundreds of molecules to map nuclear targets and / or other target types.
[0194] Furthermore, the molecules may be bound to functionalized particles having a suitable percentage of the surface area covered by the molecules, the percentage of which may be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or another suitable coating percentage. The coating percentage, in addition to the other sample processing embodiments described, can improve the recovery rate of nuclear targets mapped to more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, or more (for example, relative to the actual number of nuclear targets present).
[0195] Several embodiments, variations, and examples of molecular segments are further described in U.S. Patent Application No. 17 / 376,396, filed July 15, 2021, which is incorporated by reference above.
[0196] 2.3 System - Support Structure and Use As shown in Figure 2A, the present invention may further include a support structure 200, which supports one or more units of the system 100 and functions to facilitate the use of the system 100 by an entity processing a sample. In various embodiments, the support structure 200 holds one or more units of the system 100 in a suitable position, facilitates contact of the units of the system 100 by a tissue sample or other sample, and allows one or more units of the system 100 to be released from the support structure 200 for further processing after interaction with the sample material.
[0197] In some embodiments, as shown in Figures 2A and 2B, the support structure 200 includes an opening 210 and a flexible film 220 bonded to the support structure around the opening 210 at a first surface of the support structure and supporting one or more units of the system 100 within the opening 210 (e.g., a substrate 110 having functional particles 120, an array of substrates having functional particles, etc.). In some variations, the support structure 200 may further include one or more of the following: a protective coating 230 facing the flexible film 220 at the opening 210, and a tag 240 encoding information associated with the system 100 / substrate 110. In some variations, the support structure 200 may be configured for use with a masking layer 150, which will be described in more detail below.
[0198] Details of embodiments, variations, and examples of the support structure 200 and related structural elements are described further below.
[0199] In various embodiments, the support structure 200 is composed of a material that provides protection from the environment associated with the transport and / or use of the system 100. Thus, the support structure 200 can function to provide one or more of the following properties: impact resistance (e.g., to protect vulnerable parts of the system 100), flame retardancy / flame retardancy, sealing (e.g., hermetically sealed, to prevent the ingress of moisture before use, to prevent the ingress of gas before use, etc.), optical properties (e.g., with respect to shielding from electromagnetic energy, with respect to enabling the transmission of light to allow optical detection or visual observation through the support structure 200, etc.), electrical properties (e.g., with respect to shielding from electric fields, etc.), and / or other suitable properties. In various examples, the support structure 200 may be composed of a polymer material, a fiber material, a foam, or another suitable material.
[0200] In one form, the support structure 200 may have a broad surface, where the broad surface is rectangular in form. However, in other variations, the support structure 200 may have another suitable defined form (e.g., a circular form, an ellipsoidal form, a polygonal form, an amorphous form, etc.). In some examples, the support structure 200 may have a characteristic length of 1 to 15 centimeters, a characteristic width of 1 to 15 centimeters, and a characteristic thickness of 0.5 to 5 millimeters. However, the support structure 200 may have other suitable dimensions.
[0201] In various modifications, the support structure 200 may include features configured to facilitate handling by an operator. For example, the support structure 200 may include surface areas with high friction (e.g., to facilitate gripping by a human or robotic operator), markings (e.g., to provide indication of orientation and to guide the proper use of the support structure 200 in relation to various operating modes), and / or other features.
[0202] The opening 210 functions to allow an operator to interact with the system 100 according to the operating modes described below when the system 100 is supported by the support structure 200. In particular, the opening 210 can allow an operator to transfer heat to the sample (e.g., through the flexible film 220, which is described in more detail below) and / or move the system 100 away from the support structure 200 (e.g., by applying mechanical force to the flexible film 220, which is described in more detail below). The opening 210 is rectangular in form. However, in other variations, the opening may have another suitable defined form (e.g., circular, ellipsoidal, polygonal, amorphous, etc.). In some examples, the opening 210 may have a characteristic length of 0.2 to 10 centimeters, a characteristic width of 0.2 to 10 centimeters, and a characteristic depth of 0.5 to 5 millimeters. However, the support structure 200 may have other suitable dimensions.
[0203] The support structure 200 may include a single opening 210. Alternatively, the support structure 200 may include a set of openings (for example, arranged as an array, or arranged in another suitable way), where each opening in the set of openings is configured to support one or more units of the system 100.
[0204] The flexible film 220 functions to support the system 100 within the opening 210 (or multiple openings) and to enable the operating modes described in more detail below. The properties of the flexible film 220 allow the operator to transfer heat to the sample (e.g., through the flexible film 220 and / or the substrate 110) and / or move the system 100 away from the support structure 200 (e.g., by applying mechanical force to the flexible film 220).
[0205] In various embodiments, the flexible film 220 is held in position around the opening 210 (e.g., bonded to a broad surface of the support structure 210, held between layers of the support structure 210, etc.). The flexible film 220 may be held without slack or under tension. Preferably, the flexible film 220 is subjected to force or heat as intended during use in the operating modes described below, but is held in such a manner that the bond of the flexible film 220 to the support structure 200 is not impaired or its function is not impaired. Alternatively, the flexible film 220 may be held in position around the opening 210 in another suitable manner.
[0206] The flexible film 220 is preferably made of a material treated with appropriate mechanical properties (e.g., with respect to tear strength, strain behavior, plastic deformation for moving the system 100 from the support structure 200, elastic deformation for moving the system 100 from the support structure 200, etc.), optical properties (e.g., transparency for observing one unit of the system 100 bonded to the flexible film 220 during use), thermal properties (e.g., conductivity for heat transfer to the sample through the flexible film 220 and the substrate 110, melting temperature, etc.), surface and bulk properties (e.g., charge, degree of hydrophobicity, porosity, etc.), electrical properties, and / or other appropriate properties. The flexible film 120 may have a thickness of 75 to 150 micrometers (or another appropriate thickness).
[0207] In various embodiments, the flexible film 120 is a flexible polymer film composed of polyvinyl chloride (PVC), polyolefin, polyethylene, polyethylene terephthalate (PET), nylon, and / or another suitable polymer material. In some variations, the flexible film 120 further includes an adhesive layer bonded to the flexible film 120 to provide a mechanism for non-permanently bonding with units of system 100. In some variations, the adhesive layer is composed of an acrylic adhesive; however, the adhesive layer may be composed of another suitable material. The adhesive layer may have a configured adhesive strength based on the size and mass characteristics of system 100 and / or in relation to a specified force required to move units of system 100 away from the flexible film 120 during use. In a particular example, the flexible film 120 is a PVC dicing tape used during the manufacture of the substrate 110 (e.g., with respect to scribing and sewing of the substrate 110). However, in variations of certain examples, the flexible film 120 may be composed and configured in other ways.
[0208] For example, as an alternative to mechanically breaking the adhesive bond, the adhesive layer can be structured so that the adhesive bond is broken upon exposure to light in a specific wavelength range (e.g., ultraviolet light), thermal stimulation (e.g., heating in a specific temperature range upon exposure), and / or another suitable mechanism.
[0209] The protective covering 230 functions to protect the units of the system 100 supported by the support structure 200 (e.g., during transport, during use, etc.). In some embodiments, the protective covering 230 is made of the same material as the bulk material used for the support structure 200. However, the protective covering may be made of another suitable material, as embodiments, modifications, and examples are described above.
[0210] The protective covering 230 may be a separate element from the bulk material of the support structure 200, and as a result, the protective covering 230 may be provided together with the support structure 200 (e.g., in relation to a kit / package, which will be described in more detail below) and may be removed from the support structure 200 during use. Alternatively, the protective covering 230 may be physically adjacent to the bulk material of the support structure 200 and / or may be transitionable between a covered mode (e.g., the units of system 100 are covered) and an uncovered mode (e.g., the units of system 100 are not covered). Here, the transition between modes may be facilitated by folding, sliding, or another mechanism, which is facilitated by the structural relationship between the protective covering 230 and the bulk material of the support structure 200. In one such variation, as shown in Figure 2B, the protective covering 230 may be folded over the opening 210 in the covered mode, but may not be folded in the uncovered mode.
[0211] However, the retention and placement of the sample for interaction with system 100 may be made possible by other suitable sample placement structures.
[0212] Furthermore, in relation to the operating modes described in more detail below, the protective covering 230 may include a sample area 231 configured to support or hold a sample, as shown in Figure 2B, where the sample may be placed in the sample area 231, and the sample can be positioned to come into contact with the system 100 for sample processing in a consistently reliable manner by transitioning the protective covering 230 into covering mode (e.g. by folding, by another mechanism).
[0213] Tag 240 functions to encode information about one or more of the following: a support structure 200, a unit of system 100 supported by the support structure 200, reagents provided with a kit containing the support structure 200, a sample(s) processed using the support structure 200, molecular barcode information (e.g., spatial location of different molecular barcodes related to the distribution of functionalized features 120). In various variations, the information encoded by tag 240 may include one or more of the following: batch number (e.g., of the support structure 200, of the system 100 unit, of the reagent), lot number (e.g., of the support structure 200, of the system 100 unit, of the reagent), sample identification information, patient or subject information related to the sample, molecular barcode information (e.g., spatial location of different molecular barcodes related to the distribution of functionalized particles 120), other spatial information (e.g., spatial location of material in system 100 unit related to the arrangement of system 100 unit in support structure), other molecular information, and / or other appropriate information.
[0214] In various embodiments, tag 240 may be a computer-readable tag. Therefore, in various embodiments, tag 240 may be in the form of a barcode, a QR code (registered trademark), a code containing characters (e.g., alphanumeric characters, other characters, etc.), or another suitable code readable at scan time (e.g., equipped with an optical detection subsystem). Furthermore, or alternatively, tag 240 may be a digitally readable tag (e.g., decoded at the time of transmission of an electrical signal).
[0215] In various embodiments, a support structure 200 having one or more units of system 100 can be provided as a kit (as shown in Figure 3), which is assembled (e.g., pre-packaged) from one or more units of system 100, including a substrate 110 having a distribution of functionalized features 120. The kit may further include a process container 250 configured to receive one or more units of system 100 (e.g., in relation to the operating modes described below, system 100 is moved from the support structure into a container 250, such as a process container or collection container).
[0216] Furthermore, or alternatively, the kit may further include one or more reagents for sample processing and / or library preparation operations. One or more of the reagents may be provided in separate containers. Furthermore, or alternatively, one or more of the reagents may be provided in container 250 (e.g., pre-packaged in container 250) for stabilizing or storing the material captured in the units of system 100 (e.g., before transport or other downstream processing operations).
[0217] In various variations, the provided reagents may be configured for the isolation of a sample target component (e.g., nuclear isolation after nuclear tagging by handshake sequences), washing of sample components (e.g., nuclear washing), sample processing (e.g., with bovine serum albumin, with an RNase inhibitor), or for one or more of the other components. Any component / reagent may include one or more of ethyl alcohol, dyecycle or AO / PI or DAPI staining agents, trypan blue, or other reagents.
[0218] Any components provided with the kit may include one or more of the following: cryostat, microscope, light source for the release of functional molecules (e.g., UV lamp), light source components (e.g., driver, power supply, lamp holder), refrigerated centrifuge, aspiration and delivery devices (e.g., pipette, pipette tip, irrigator such as Waterpik® device), miniature centrifuge, vortex, tweezers, container, razor blade, optimal cutting temperature (OCT) compound, particle filter, etc.
[0219] In other variations, the reagents provided may be designed to receive / store System 100 at a first temperature (e.g., -20°C). In some examples, the reagents may include one or more of the following: RNase inhibitors, superscript / reverse transcriptase buffer, reverse transcriptase, dNTPs, reverse transcriptase, template switching oligonucleotides, exosome isolation reagents, TC enzyme / buffer, superscript enzyme, amplification primers, PCR reagents (e.g., PCR buffer, PCR primer mix, PCR enzyme, etc.), proteinase K, exonuclease, cDNA amplification buffer, cDNA amplification primer mix(s), cDNA amplification enzyme, TE, and / or other suitable reagents.
[0220] In other variations, the reagents provided may be designed to receive / store System 100 at a second temperature (e.g., 4°C). In some examples, the reagents may include one or more of the following: functionalized particle washing buffer, TC enzyme / buffer, water (e.g., water without nuclease), hybridization buffer, tissue removal buffer, Tris buffer, sodium hydroxide, and / or other suitable reagents.
[0221] In other variations, the reagents provided may be designed to receive / store System 100 at a third temperature (e.g., room temperature). In some examples, the reagents may include one or more of the following: functionalized particle washing buffer, TC enzyme / buffer, water (e.g., nuclease-free water), hybridization buffer, and / or other suitable reagents.
[0222] Furthermore, reagents may be configured for library preparation and / or other assays. In some examples, library preparation materials may support hybridization (e.g., hybridization with whole-genome sequencing primer sites, hybridization with universal primer (UP) sites, etc.), template-switching reverse transcription (RT), sample and bead removal (e.g., in process vessel 250), exonuclease treatment or other methods for removing single-stranded oligonucleotides from functionalized particles, denaturation steps (e.g., including sodium hydroxide), second-chain synthesis, and / or other aspects of library preparation.
[0223] The reagents in the kit may be provided in a separate housing (e.g., a container, box, etc.) from the support structure 200 and / or other system elements, an example of which is shown in Figure 3. Alternatively, the reagents in the kit may be provided in the same housing (e.g., a container, box, etc.). Alternatively, the kit may include open containers (e.g., for any or custom reagents) or the provision of reagents may be omitted.
[0224] Furthermore, the kit may include a training substrate (e.g., with or without functionalized particles and / or with or without decoding of the position of functionalized particles on the substrate), which a new user can use to practice the application of a sample to the substrate and / or to practice other embodiments using the kit.
[0225] Other examples of the kit may include one or more units of a substrate having functionalized particles for tagging sample nuclei (this embodiment, variations, and examples are described above), a set of reagents for isolating sample nuclei (e.g., separation buffer, extraction buffer, washing buffer, RNase inhibitor, etc.), and / or other components.
[0226] In the first example, the kit substrate may contain a population of bodies having a first diameter (e.g., a diameter of 10 micrometers) and / or other first characteristics, and the subpopulation of bodies may be functionalized (e.g., having a first tagging molecular type including a first handshake sequence type) to tag sample targets (e.g., targets containing nuclear or nuclear-related targets, e.g., having random segments, segments that are gene-specific to nuclear targets, segments that tag extended nuclear targets, segments that tag polyadenylated nuclear targets, or other tagging segments for nuclear targets). The population of bodies may be dispersed randomly or non-randomly across the active region of the substrate. Variations of the first example may provide the population of bodies in multiple forms (e.g., as a 3 mm × 3 mm array, as a 10 mm × 10 mm array, etc.).
[0227] In the second example, the kit substrate may include a first subpopulation of bodies having a first diameter (e.g., 10 micrometers, 3 micrometers) and / or other first characteristics, and a second subpopulation of bodies having a second diameter (e.g., 10 micrometers, 3 micrometers) and / or other second characteristics. In the first example, the bodies of the first subpopulation may be functionalized for tagging of a first target type (e.g., cytoplasmic targets, sample surface targets, mRNA via poly-A / poly-T interactions, mRNA via interactions between polyadenylated components and corresponding molecules, etc.) (e.g., by the first tagging molecule type). The bodies of the second subpopulation can be functionalized for tagging of a second target type (e.g., a target containing a nuclear or nuclear-related target, e.g., a random segment, a segment that is gene-specific to a nuclear target, a segment that tags an extended nuclear target, a segment that tags a polyadenylated nuclear target, or other tagging segment for a nuclear target) (e.g., by the second tagging molecular type). The bodies of the first and second populations can be dispersed randomly or non-randomly across the active region of the substrate.
[0228] In the third example, the kit substrate may include a first subpopulation of bodies having a first diameter (e.g., 10 micrometers in diameter) and / or other first characteristics, and a second subpopulation of bodies having a second diameter (e.g., 3 micrometers in diameter) and / or other second characteristics. In the first example, bodies of the first subpopulation may be functionalized for tagging of a first target type (e.g., cytoplasmic targets, sample surface targets, mRNA via poly-A / poly-T interactions, mRNA via interactions between polyadenylated components and corresponding molecules, etc.) (e.g., by the first tagging molecule type). Bodies of the second subpopulation may be functionalized for capture of a second target type (e.g., targets including nuclear or nuclear-related targets, e.g., random segments, segments gene-specific to nuclear targets, segments tagging extended nuclear targets, segments tagging polyadenylated nuclear targets, or other tagging segments for nuclear targets) (e.g., by the second tagging molecule type). The bodies of the second subpopulation can be dispersed intermittently (e.g., in the spaces between them) or within the first population on the substrate without compromising resolution mapping for all target types. Thus, in this application, multiple subpopulations of functionalized particles can be implemented to simultaneously tag different targets with respect to characterizing the distribution of different targets using the same system.
[0229] In the fourth example, the kit substrate may include a body having a first subset of molecules functionalized to capture a first target type (e.g., cytoplasmic targets, sample surface targets, poly-A / poly-T interactions, mRNA via interactions between polyadenylated moieties and corresponding molecules, etc.) (e.g., having a first tagging molecule type) and a second subset of molecules functionalized to tag a second target type (e.g., targets including nuclear or nuclear-related targets, e.g., by randomer segments, segments gene-specific to nuclear targets, segments tagging extended nuclear targets, segments tagging polyadenylated nuclear targets, or other tagging segments for nuclear targets) (e.g., having a second tagging molecule type). An example relating to particles of the second particle type is shown in Figure 1G.
[0230] The workflows associated with the first, second, and third examples of the kit may include receiving a sample on a substrate having a distribution of functionalized particles, performing hybridization reactions between the tagging portion of the functionalized molecules of the functionalized particles and targets of a first target type (e.g., nuclear targets) and a second target type (e.g., cytoplasmic targets) in the sample (e.g., by the release of molecules in response to functionalization stimuli), performing tissue separation and nuclear processing operations, and performing sequencing operations to generate spatial maps of the first and second target types across the sample.
[0231] 2.3.1 Masking Layer As shown in Figures 1A and 2A, the system 100 or support structure 200 may include a masking layer 150 that functions to prevent the functionalized features from being prematurely exposed to stimuli or damaged, in a manner that prevents the handshake sequence from being controllly released from the distribution of functionalized features 120 for tagging the target of the sample. The masking layer 150 may be in the form of a sticker or other label that can be applied (e.g., to the support structure, a flexible film, the side of the substrate, etc.) to protect the functionalized features 120 of the substrate 110 before use.
[0232] In various modifications, the system 100 or support structure 200 may include multiple masking layers, or masking layers containing sections that can be separated from each other (e.g., having perforations). In these modifications, controlled release of the handshake sequence from different regions of the substrate 110 may include removal of individual masking layers and / or separable masking layer sections, followed by exposure to an appropriate stimulus (e.g., light wavelength) to release the handshake sequence. Thus, the methods described below may include covering the distribution of functionalized molecules in the substrate with a masking layer and removing the masking layer before applying a stimulus.
[0233] 2.3.2 Support Structures - Exemplary Operation and Deformation During use, the support structure 200 can provide a set of operating modes for sample processing (for example, with respect to protecting aspects of system 100 during transport / handling / processing, with respect to facilitating contact between units of system 100 and the sample during processing, with respect to enabling the release of units of system 100 from the support structure 200 for downstream processing, etc.).
[0234] In the various deformations, as shown in Figure 4, the set of operating modes may include a first operating mode 201 in which the protective coating 230 is removed from the support structure 200 or placed away from the substrate 110, and a second operating mode 202 in which the sample is placed in contact with the substrate 110 and the distribution of functionalized particles 120. The set of operating modes may further include a third operating mode 203 in which heat is transferred from the substrate 110 to the sample (e.g., in a deformation in which the sample is frozen, or in a deformation in which the sample is embedded in paraffin), and a fourth operating mode in which the flexible film 220 is deformed, thereby moving the substrate 110 with or without the sample from the support structure 200 into the processing container 250. Furthermore, or alternatively, additional operating modes may include facilitating the removal of functionalized particles or removed tissue from the substrate 110 within the process vessel 250 (for example, by aspirating and delivering liquid within the process vessel 250 to remove functionalized particles, nuclei, and / or tissue removed from the substrate 110 after the tissue has interacted with the sample).
[0235] As described above, the first operating mode 201 and the second operating mode 202 can be associated with the coated and uncoated modes provided by the protective cover 230, which can accept the sample and transition to the coated mode (e.g., by folding) in order to position the sample so as to come into contact with the distribution of functionalized particles 120 on the substrate 110. Operating modes 201 and 202 can also be enabled by deformation of the support structure 200 in another suitable way (an example of which will be described below in relation to the deformation of the support structure 200b).
[0236] In relation to operating mode 203, heat can be transferred from the substrate 110 to the sample through the flexible film 220. In the first example, an operator can place a warm object (e.g., a finger, a heating element, etc.) against the flexible film 220 on the opposite side of the system 100, and heat from the warm object is transferred to the sample (e.g., to melt the sample). In another example, a platform (e.g., an automated platform) can transfer heat to the sample using a heat source (e.g., a plate heater, a convection heater, etc.) that is in thermal communication with the sample (e.g., through the flexible film, or through the support structure, or through the substrate, etc.). More specifically, in relation to the operating modes described, at least one of the flexible film 220, the substrate 110, and the support structure 100 has a thermal conductivity greater than a thermal conductivity threshold (e.g., 0.05 W / mK) and provides a heat transfer path to the sample during operation.
[0237] In operation mode 204, the flexible film 220 deforms to move the substrate 110 from the support structure 200 into the process container 250 for transport, storage, and / or further processing (e.g., sequencing). In one deformation, an operator can apply force to the flexible film 220 (e.g., the back side of the flexible film 200) to move the substrate 110 away from the adhesive layer bonded to the flexible film 220. In another deformation, a robotic device can apply force (e.g., using the tip or other end) to the flexible film 220 (e.g., the back side of the flexible film 200) to move the substrate 110 away from the adhesive layer bonded to the flexible film 220. In an alternative deformation, operation mode 204 can omit the application of mechanical force and instead facilitate the separation of the substrate 110 from the film 220 by applying light (e.g., UV light) within a specified wavelength range and / or heat (e.g., within a specified temperature range).
[0238] Furthermore, or in connection with operating mode 204, the system may include a magnetic component 24 (e.g.,) to which the substrate 110 is bound or to which the substrate 110 having a distribution of functionalized particles is transferred, before the substrate 110 is transferred to the process vessel, as shown in Figure 5 (above). In addition, the system 100 or any other entity performing the sampling may apply a magnetic force to the substrate 110 (e.g., by activating a magnetic rod / stylus 25) to control the movement of the substrate 110 into, from, or within the process vessel 250 during the sampling step.
[0239] Furthermore, or in connection with operating mode 204, the system may include a cage / cassette 26 into which a substrate 110 having a distribution of functionalized particles is transported in coordination with the interaction of the functionalized particle distribution with the sample. As shown in Figure 5 (below), the cage / cassette can be manipulated more easily than the substrate to control the movement of the substrate 110 into, from, or within the process vessel 250 during the sample processing step.
[0240] Under various deformations, the film may not be flexible, but instead may be rigid.
[0241] The described inventions(s) may include and / or support further modes of operation. For example, the invention(s) may include a flow cell configured to accept one or more units of system 100 (e.g., after interaction with a sample and after movement from a support structure), the flow cell enabling sequencing of a target analyte, a tagged and processed target analyte, and / or material derived from other sample processing steps. Thus, such a flow cell may include fluid channels communicating with the distribution of functionalized particles in the substrate of the system's units, enabling optical detection of signals generated from the tagged and / or processed target analytes of the sample. Furthermore, the flow cell may contain one or more units of the system for higher throughput and / or multiplexed operations.
[0242] Alternative Modifications: In alternative modifications, as shown in Figure 6, the support structure 200b may include a tip 210b that supports one or more units of the system 100, and during use, the tip 210b may be positioned to contact the sample, and the unit(s) of the system 100 may be moved away from the tip 210b to contact a specific portion of the sample. In some examples, the unit(s) of the system 100 may be bonded to the tip 210b using a layer (e.g., an adhesive layer), and contact with the sample provides a force that separates the system 100 from the layer and interacts with the sample. Furthermore, or otherwise, the tip 210b and / or other parts of the support structure 200b may provide a controlled release mechanism, for example, using a plunger (e.g., a mechanical plunger that moves the system 100 away from the tip 210b). The system 100 is separated from the tip 210b by magnetic force (for example, by reversible polarity or removal of magnetism, causing the system 100 to move away from the tip 210b) or by other forces.
[0243] Furthermore, the deformation of the described support structure 200b may include a plurality of tips that individually support units of system 100, and the plurality of tips can be controlled simultaneously and / or individually to move each unit of system 100, thereby facilitating sample interaction, target tagging, characterization of target positions, and / or other aspects of sample processing.
[0244] In certain use cases, the sample / tissue may still be integrated with the patient or other subject (e.g., not removed from the patient / subject), and in certain examples, the sample / tissue may include a skin sample (e.g., a lesion) or other accessible tissue (e.g., during a biopsy procedure, orthoscopy, or endoscopy), allowing for tissue sampling without removal from the patient. For example, in one specific use case, during the removal of cancerous tissue, the support structure 200b may be applied to adjacent tissue with one or more system units to help confirm whether the cancerous tissue has been completely removed. Alternatively, the support structure 200b may be applied to tissue with units of the system, followed by cutting and tagging of the tissue target, and then biopsy of the tagged tissue. However, the support structure 200b may be applied in other appropriate ways.
[0245] Further variations of the support structure may be configured to facilitate interaction with the sample for target tagging, characterization of the target sample location, and / or other aspects of sample handling. For example, the system may include a sample placement structure configured to hold the sample in a suitable position relative to the substrate.
[0246] 3. Method of Use and Examples of Uses As shown in Figures 7A and 7B, embodiments of method 400 for generating spatial analysis of a sample may include: S410 treating a sample containing a set of targets (e.g., nuclei, cells) with a substrate containing a distribution of tagging molecules containing barcode sequences that function as spatial addresses; S420 tagging the set of targets with a handshake sequence of the distribution of tagging molecules (e.g., when the distribution of tagging molecules is cleaved (e.g., by application of a stimulus) and they become able to diffuse toward the set of targets); S430 isolating the targets (e.g., nuclei, cells) of the set of targets in the sample; and S440 determining the target locations of the set of targets when sequencing the molecules generated from the distribution of tagging molecules (e.g., determining the set of sequences of resulting molecules generated from the set of nuclei and the distribution of functionalized molecules, thereby determining the set of spatial locations of the set of nuclei based on the barcode sequences associated with each of the set of nuclei). Optionally, in some embodiments, the method may include, after the isolation of the target in step S430, tagging (e.g., microfluidic tagging, tagging in microwells, tagging in partitions, tagging in emulsion droplets) and barcoding the target (e.g., mRNA, other nuclear and / or cellular targets).
[0247] As shown in Figure 7C, an embodiment of method 500 for generating a single-cell analysis of a sample may include generating a set of labeled cells by tagging a set of cells with a first set of oligonucleotides (S510), loading the set of labeled cells into the interstitial spaces of a distribution of functionalized particles bound to a substrate (each functionalized particle is in contact with at most one labeled cell of the set of labeled cells) (S520), generating a single-cell sequencing library from an amplicon generated from a set of reactions including a set of molecules of the distribution of labeled cells and functionalized particles (S530), and returning a single-cell analysis of the set of cells when processing the single-cell sequencing library (S540).
[0248] As shown in Figure 7D, embodiments of method 600 for generating a single-nucleus analysis of a sample may include generating a set of labeled nuclei by tagging a first set of oligonucleotides to a set of nuclei (S610), loading the set of labeled nuclei into the interstitial spaces of a distribution of functionalized particles bound to a substrate (each functionalized particle is in contact with at most one labeled nucleus from the set of labeled nuclei) (S620), generating a single-nucleus sequencing library from amplicons generated from a set of reactions including a set of molecules in the distribution of labeled nuclei and functionalized particles (S630), and returning a single-nucleus analysis of the set of nuclei when processing the single-nucleus sequencing library (S640).
[0249] Embodiments, variations, and examples of Methods 400, 500, and 600 function to provide an efficient and high-performance method for tagging dispersed targets in a sample with oligonucleotide tags that encode spatial locations (e.g., spatial locations corresponding to the generation locations of oligonucleotide tags on a substrate, spatial locations corresponding to the coordinates of targets dispersed across the sample, etc.). Thus, Methods 400, 500, and 600 generate spatially tagged and isolated single nuclei from a sample (e.g., tissue samples, other sample types) as described.
[0250] Furthermore, Methods 400, 500, and 600 can provide significant improvements to single-nucleus and single-cell analysis by pre-treating single-nucleus and single-cell targets with spatial tags before processing them in single-nucleus and single-cell sample processing workflows for characterizing genomics, transcriptomics, proteomics, metabolomics, and / or other features of single-nucleus / cells. Methods 400, 500, and 600 also provide significant improvements in performance regarding single-nucleus / cell recovery and isolation after spatial tagging.
[0251] Embodiments, variations, and examples of Methods 400, 500, and 600 also serve to improve workflows for performing single-cell, single-nucleus, or other single-particle analysis by providing novel mechanisms for tagging and spatially isolating individual cells, nuclei, and / or other particles, while reducing the need for control and complex setups to unify biological content under analysis, and by combining them with reagents (e.g., reagent particles) to analyze the unified biological content. Embodiments, variations, and examples of Methods 400, 500, and 600 also serve to enhance single-cell, single-nucleus, and / or other single-particle analysis by adding spatial localization information (e.g., including in situ and in vitro spatial characterization, including tissue information of cell buildup).
[0252] In particular, the described methods can provide single-cell and single-nucleus spatial analysis results without reinventing existing molecular assays in a spatial context, and without reinventing solutions to address the problem of cell mixing. Furthermore, the described method(s) can consistently achieve efficient tagging of cell and nuclear profiles from tissue sections (e.g., on a commercial scale) at high resolution, while preserving spatial localization information, and are applicable to any single-cell or single-nucleus methodology. The resolution of single-cell and single-nucleus mapping can be achieved according to the performance specifications described above.
[0253] Therefore, the method may involve generating a spatial map of the distribution of nuclei isolated from a tissue sample when tagging the distribution of nuclei with a set of handshake sequences paired with a set of barcode sequences that serve as spatial addresses. Generating this spatial map involves recovering and mapping the locations of nuclei that are present in the tissue sample above a certain percentage (e.g., 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%).
[0254] The method can generate high-resolution spatial sequencing maps of single cells, single nuclei, or other targets of a sample (multiple targets are possible). In some cases, the method is 500 μm.2 More than one target mapped per hit, 400um 2 More than one target mapped per hit, 300um 2 More than one target mapped per hit, 200um 2 More than one target mapped per hit, 150um 2 More than one target mapped per hit, 100um 2 More than one target mapped per hit, 50um 2 More than one target mapped per hit, 40um 2 More than one target mapped per hit, 30um 2 More than one target mapped per hit, 20um 2 More than one target mapped per hit, 10um 2 The resolution of more than one target mapped per hit, or any intermediate number of targets mapped per unit area can be achieved.
[0255] The method can generate a high-resolution spatial map of the target(s) of the sample(s). In some examples, method 400 is 500um 2 More than one target mapped per hit, 400um 2 More than one target mapped per hit, 300um 2 More than one target mapped per hit, 200um 2 More than one target mapped per hit, 150um 2 More than one target mapped per hit, 100um 2 More than one target mapped per hit, 50um 2 More than one target mapped per hit, 40um 2 More than one target mapped per hit, 30um 2 More than one target mapped per hit, 20um 2 More than one target mapped per hit, 10um 2 The resolution of more than one target mapped per hit, or any intermediate number of targets mapped per unit area can be achieved.
[0256] The method can provide a rapid and high-performance workflow for spatial mapping of nuclei, cells, and / or other sample components, and the entire workflow, from sample handling (and application to a substrate with functionalized features) to sequencing (e.g., snRNA-seq, scRNA-seq, RNA-seq, TCR, etc.) and mapping, can be achieved within a short duration. Thus, the method involves generating a spatial map of the distribution of nuclei isolated from a tissue sample by tagging the distribution of nuclei with a set of handshake sequences paired with a set of barcode sequences that function as spatial addresses, and the generation of the spatial map is performed within a period of less than 10 hours, less than 9 hours, less than 8 hours, less than 7 hours, less than 6 hours, less than 5 hours, less than 4 hours, less than 3 hours, less than 2 hours, or less than 1 hour.
[0257] In particular, with respect to nuclear mapping, the separation of nuclei from the substrate may have durations of less than 1 hour, less than 45 minutes, less than 30 minutes, less than 20 minutes, less than 10 minutes, less than 5 minutes, or shorter.
[0258] With regard to nuclear tagging, nuclear tagging workflows may have durations of less than 3 hours, less than 2 hours, less than 1 hour, less than 45 minutes, less than 30 minutes, less than 20 minutes, less than 10 minutes, less than 5 minutes, or shorter.
[0259] At the resolutions described, it is possible to simultaneously perform mapping on each set of targets, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 100, 1000, or any intermediate number of targets.
[0260] The method can further achieve the generation of spatial maps having a resolution of less than a threshold distance between substrate features (e.g., beads or other particles, rods, protrusions, recesses, ridges, valleys, channels, wells, oligonucleotide spots, etc.) for target tagging interactions. Embodiments, variations, and examples of the generated spatial maps have a resolution of less than 50 picometers between features, less than 40 picometers between features, less than 30 picometers between features, less than 20 picometers between features, less than 10 picometers between features, less than 5 picometers between features, or less than 1 picometer between features.
[0261] In various embodiments, targets spatially characterized according to the method may include one or more of the following: nucleic acid materials (e.g., DNA, RNA, miRNA, etc.), protein materials, amino acid materials, other small molecules, other single analytes, other multiple analytes, and / or other suitable target materials of the sample. In various embodiments, the sample may include whole tissue structures, tissue portions (e.g., histological tissue slices, formalin-fixed paraffin-embedded (FFPE) tissues, frozen tissues, biopsy tissues, fresh frozen plasma, seeded natural scaffolds, seeded synthetic scaffolds, etc.), organs, whole organisms, organoids, cell suspensions (e.g., frozen cell suspensions separated before processing in the system, cell suspensions held in culture media / hydrogel media, etc.), nuclear suspensions, single cells, organelles, suborganelle structures, intraorganelle components, mitochondrial targets, viruses, microorganisms, and other samples.
[0262] Sections of tissues, cells, or suspensions (e.g., cell suspensions, nuclear suspensions, etc.) can be 0.1 micrometers thick, 0.25 micrometers thick, 0.5 micrometers thick, 0.75 micrometers thick, 1 micrometer thick, 2 micrometers thick, 3 micrometers thick, 4 micrometers thick, 5 micrometers thick, 6 micrometers thick, 7 micrometers thick, 8 micrometers thick, 9 micrometers thick, 10 micrometers thick, 11 micrometers thick, 12 micrometers thick, 13 micrometers thick, 14 micrometers thick, 15 micrometers thick, 16 micrometers thick, 17 micrometers thick, 18 micrometers thick, 19 micrometers thick, 20 micrometers thick, 25 micrometers thick, 30 micrometers thick, or other suitable thicknesses.
[0263] The sections can be generated using a microtome system, freehand sectioning, a tissue slicer for immersion samples, a tissue dissociation system, and / or other techniques.
[0264] In the case of cell or nuclear suspensions, the selected sample thickness can improve the recovery rate of tagged nuclear targets (e.g., the percentage of mapped nuclear targets compared to the actual number of nuclear targets) based on factors such as the amount of nuclear exposure, the ability of the substrate to separate the sample from the functionalized particles, or other factors. Furthermore, to improve the recovery rate of tagged nuclear targets using the distribution of functionalized particles, the sample can be sandwiched between different substrates having functionalized particles. The recovery rate of nuclear targets can further be improved by the implementation of magnetically functionalized particles (e.g., by applying them to the sample by force, injecting them into the sample, or using them in other ways), and the recovery rate can be improved by magnetic recovery after target tagging. Functionalized particles (e.g., magnetically functionalized particles) can be equipped with antibodies configured against nuclear membrane components to further enhance interaction with nuclear targets and improve recovery. Sample processing may further include the use of electroporation (e.g., application of an electric field) or membrane permeation techniques when the sample comes into contact with the functionalized particles to increase access to the nuclei for tagging nuclear targets for mapping (in addition to cytoplasmic targets). Viral vectors can also be used to deliver tagging probes for nuclear targets. Furthermore, the handshake sequence may contain single-stranded oligonucleotides, which can diffuse more efficiently into or toward the nucleus than double-stranded oligonucleotides. Furthermore, the functionalized molecule may contain, or be bound to, lipophilic or amphiphilic moieties that enhance passage through membranes (e.g., cell membrane, nuclear membrane) for interaction with such targets.
[0265] In embodiments involving sandwiching a sample between two substrates, one or both substrates can include features that allow reagents to access the internal sample portion during sample processing in order to tag the target on both sides of the sample. In various variations, one or both substrates can be composed of a porous material (e.g., porous glass) that allows reagents to cross the substrate to the internal sample portion. Further or alternatively, in various variations, the reagents can be stored within the body of functionalized particles (e.g., as vesicles), and such reagents can be controllably released in response to a trigger (e.g., chemical stimulus, mechanical stimulus, light stimulus, pH stimulus, temperature stimulus, etc.) to allow the reagents to access the internal sample portion. Further or alternatively, the body of the particles (e.g., functionalized particles, particles disposed between functionalized particles and configured to be sacrificial) can be controllably decomposed in response to a trigger (e.g., chemical stimulus, mechanical stimulus, light stimulus, pH stimulus, temperature stimulus, etc.) to allow the penetration of the reagents to the internal sample portion through the space created upon decomposition.
[0266] The sample can be further processed (before and / or after spatial tagging of the nuclei) to efficiently isolate the nuclei of the sample. In certain examples, an improved buffer composition can be used, mechanical shearing of the tissue to expose the nuclei can be used, and photocleavage parameters can be used to improve the tagging efficiency of the nuclei and / or other nuclear isolation mechanisms to achieve nuclear isolation efficiency. For example, the nuclei can be bound to floating particles (e.g., microbubbles) functionalized to bind to / tag the nuclei, which can be recovered by buoyancy-based separation (e.g., nuclei bound to such floating particles float and are thus isolated from other sample components). Further or alternatively, the nuclei can bind to magnetic particles (e.g., magnetic microparticles, magnetic nanoparticles, etc.) functionalized to bind to / tag the nuclei, which can be recovered by magnetic-based separation (e.g., nuclei bound to such magnetic particles are separable from other sample components upon application of a magnetic field).
[0267] Prior to interaction with the system, the sample may be further processed by other suitable methods. For example, sample preparation may include one or more of the following: preservation of the sample material (e.g., by freezing, by immobilization, by embedding, etc.), dissolution of the sample material, washing of the sample material, induction of swelling / expansion or contraction of cells / tissues (e.g., via hypertonic / hypotonic solutions), induction of gelation of cells / tissues, clarification of cells / tissues (e.g., using lipid clarification), and / or other suitable processing steps. In relation to nuclear mapping, sample preparation may include freezing of nuclei (e.g., in suspension, in layers), followed by application onto a substrate having functionalized particles, and optionally sealing of the nuclear sample on the substrate with a membrane or material (e.g., gel material).
[0268] To facilitate the isolation and recovery of nuclei after tagging using a handshake sequence, a layer (e.g., a layer of OCT compound) can be applied to the tissue to aid hydration, thereby facilitating subsequent steps of tissue clarification, grinding, homogenization, and / or irrigation. Thus, the method may involve covering a tissue sample with a layer of optimal cutting temperature (OCT) compound between a) tagging a set of nuclei with a handshake sequence of functionalized molecule distributions and b) isolating the set of nuclei from the tissue sample.
[0269] Alternatively, a layer (e.g., a layer of OCT compounds) may be placed between a set of features (e.g., functionalized particles) and a sample (e.g., a tissue sample) to facilitate the separation of the sample (e.g., having various sample thicknesses such as 5 micrometers, 10 micrometers, 20 micrometers, etc.).
[0270] Polyacrylamide can be used as a coating (for example, on a feature surface or on a sample surface) to improve the robustness of nucleus separation.
[0271] To improve target recovery and / or loss, the sample can be gently fixed, reducing tackiness and facilitating the removal of the sample from the substrate with functionalized particles for further processing. Further processing may include using a device to further expose the nuclei to improve the recovery rate of the nuclear target, such a device can homogenize the sample in a manner that preserves the separation of the nuclei for further characterization and mapping (e.g., using a nuclear target tagged with functionalized particles as described below).
[0272] In relation to frozen sample materials, the method may include freezing the sample material in a manner that dissolves cell membranes and / or other sample structures. Alternatively, the method may include freezing the sample material in a manner that preserves cell membranes and / or other sample structures. For example, freezing in a preservation method may involve one or more of the following: rapid freezing (e.g., in liquid nitrogen, in another freezing medium, at a different freezing temperature); drawing water from nucleating proteins, low molecular weight solutes, sugars (e.g., glucose), or other compounds (thereby reducing the amount of water that turns into ice and reducing volume expansion during freezing); or other nonfreezing compounds to implement the method without dissolving or damaging the structure (e.g., with respect to revealing the characterization of the target analyte on the surface without destroying the original structure). Any effect on the nature of sample freezing may further affect the amount of water and / or analyte concentration during sample processing.
[0273] In various modifications, tagged targets may be processed and observed when such target analytes and / or derivatives thereof are collected after they have interacted with the embodiments, modifications, and examples of the systems and supporting structures described above. Furthermore, the method may perform steps to observe and map the location of target analytes in space without collecting target analytes or derivatives from host tissue, cells, or other host material.
[0274] In some non-limiting examples, sample material that can be tagged and processed according to embodiments of the method may include natural tissues containing one or more of the following: nervous system biological material (e.g., brain tissue, spinal cord tissue, nerve tissue, etc.) relating to a single or multiple layer of tissue (e.g., cortical layer) and / or different types of neurons (e.g., excitatory neurons, inhibitory neurons); lymphatic system biological material (e.g., spleen tissue, lymph, tonsil tissue, etc.) spanning zone 1, zone 2 and / or zone 3 tissues; cardiovascular system biological material; endothelial system biological material; skeletal system biological material; muscular system biological material; respiratory system biological material; digestive system biological material; endocrine system biological material; urinary system biological material; and reproductive system biological material. Furthermore or alternatively, sample material may include plant tissue material, fungal tissue material, or other material. Cellular material may be associated with normal and diseased states, including one or more of cancer cells, circulating tumor cells, metastatic cells, benign cells, or any combination thereof. In some embodiments, the sample may include solid / continuous tissue material obtained from the subject.
[0275] The sample material may include material derived from almost any eukaryote. For example, the sample material may include mouse tissue (e.g., brain tissue, spleen tissue, liver tissue, embryonic tissue, kidney tissue, etc.). In some cases, the sample material may include human tissue (e.g., melanoma tissue, breast cancer tissue, brain tissue, etc.). The tissue may be derived from other multicellular organisms. Exemplary multicellular organisms include, but are not limited to, mammals, plants, algae, nematodes, insects, fish, reptiles, amphibians, fungi, or Plasmodium falciparum. The tissue may be freshly excised from an organism, or it may have been previously preserved by, for example, freezing, embedding in a material such as paraffin (e.g., formalin-fixed paraffin-embedded specimens (FFPE)), formalin fixation, infiltration, dehydration, etc. Optionally, tissue sections can be frozen. As a further option, the tissue can be permeabilized to allow spatially barcoded nucleic acids to access the nucleus. As used herein, the term “tissue” is intended to mean aggregates of cells and, optionally, intracellular material. Exemplary tissue types include muscle, nerve, epidermis, and connective tissue. Tissue may also be derived from a patient, but is not limited to, autoimmune diseases or cancer (e.g., tissue from irritable bowel disease (IBD) or MS, or tumor tissue).
[0276] In some non-limiting examples, sample materials that can be tagged and processed to a target according to the described method may include synthetic tissues or other composite materials containing cell seeding scaffolds.
[0277] Accepting a sample on a substrate may further or or may involve implementing one or more structures for holding the sample in place relative to functionalized particles, in various examples the structures may include a substrate (e.g., a substrate patterned with a distribution of functionalized particles), microwells, microarrays (e.g., with particles that capture nucleic acids), scaffolds, or other 2D / 3D structures. Furthermore or or one or more of the sample and functionalized particles may be held in place using forces (e.g., magnetic forces, electric forces / charged surfaces, gravity, forces applied using acoustic or other vibrations, centrifugal forces, buoyancy, chemical bonds, etc.). In such modifications, the holding may be reversed by releasing the held functionalized particles from the support structure or substrate by one or more of the following mechanisms: application of a magnetic force of opposite polarity or removal of a magnetic field (e.g., in the case of functionalized magnetic particles), removal of polar charges or other electrical forces, removal of gravity, removal of forces applied using acoustic or other vibrations, application of a surfactant to break chemical bonds, and / or other suitable mechanisms. Therefore, the retention and release of the sample from the substrate can be carried out in a reversible or irreversible manner (for example, after transferring the substrate to a process vessel, the enzymatic reaction in and / or within the substrate is facilitated).
[0278] As shown in Figure 8, variations of accepting a sample on a substrate may include accepting a composite sample on a substrate that includes the distribution of single cells (or / or single particles, single analytes, etc.) distributed within or across a medium (e.g., hydrogel medium, poloxamer medium), and performing embodiments, variations, and examples of the method(s) described accordingly. Thus, such variations may enable spatial multi-omics of single cells or single particles without droplet-based or microwell-based systems, thereby producing single-particle processing devices with less manual time and / or less complexity. Furthermore, such variations can implement various substrate sizes to overcome double-let, triple-let, quadruple-let rates, etc., and increase throughput.
[0279] Furthermore, or otherwise, facilitating the interaction between the functionalized particles of the system and the sample may include injecting the functionalized particles and / or system units into or onto the sample (e.g., into tissue, organ, etc.). Examples of injection include injection, electroporation, the use of vectors (e.g., viral vectors), and one or more other injection methods. Furthermore, or otherwise, facilitating the interaction between the functionalized particles of the system and the sample may include binding the functionalized particles to the surface of the sample / test specimen (e.g., by chemical bonding, magnetic bonding, or other bonding).
[0280] Furthermore, or in applications involving spatial characterization of the target analyte in 3D, a stack of substrates having a functionalized particle distribution can be implemented (e.g., with layers of tissue samples / slices and units of system 100, involving decomposing the sample into subregions and having those subregions interact with various substrates). Thus, system 100 may include additional substrates having a functionalized particle distribution (e.g., a second substrate with a second functionalized particle distribution, a third substrate with a third functionalized particle distribution, etc.), and may involve stacking or reassembling the sample piece and reconstructing the 3D volume by combining data obtained from the implementation of various substrates.
[0281] Furthermore, or in applications involving the spatial characterization of a target analyte in use and in 3D, the described method may include applying units of system 100 to a set of sides of a sample (e.g., a block of tissue), and subsequently facilitating the interaction between the sample and the functionalized particles of each unit of system 100, and reconstructing the 2D surface and / or 3D volume by combining data obtained from embodiments of the substrate of the units of system 100. In some variations, applying units of system 100 to a set of sides of a sample may include providing a support structure 200 configured to fold around the set of sides of the sample (e.g., by an origami structure, for example, by folding to apply units of substrate 110 to a set of sides of the sample and unfolding to release the sample). Furthermore, the support structure 200 can be constructed of a shape memory material that, in response to environmental conditions (e.g., temperature, electric field, pH, etc.), modulates its shape to contact a set of sides of the sample, and / or in response to environmental conditions (e.g., temperature, electric field, pH, etc.), modulates its shape to move a unit of system 100 away from the set of sides of the sample (e.g., to release the sample for further processing). Thus, for samples with low levels of rigidity, such elements and configurations can be used to generate a spatial distribution of the sample target. In some examples, such structures may have a Young's modulus of less than 50 kPa, less than 40 kPa, less than 30 kPa, less than 20 kPa, less than 15 kPa, less than 10 kPa, less than 9 kPa, less than 8 kPa, less than 7 kPa, less than 6 kPa, less than 5 kPa, less than 4 kPa, less than 3 kPa, less than 2 kPa, less than 1 kPa, or other suitable values. Furthermore, such elements and configurations can be used for samples with high levels of rigidity to generate a spatial distribution of the sample target. In various examples, such structures may have a Young's modulus greater than 50 kPa, greater than 100 kPa, greater than 1 MPa, greater than 50 MPa, greater than 1 GPa, greater than 10 GPa, greater than 20 GPa, greater than 30 GPa, greater than 40 GPa, greater than 50 GPa, greater than 60 GPa, greater than 70 GPa, greater than 80 GPa, greater than 90 GPa, greater than 100 GPa, or other appropriate values.
[0282] Furthermore, the method can implement mapping molecules that interact with the corresponding sample target of the sample (e.g., through interaction with the exposed target projection region of the sample) (e.g., delivered using a viral library encoding a diverse collection of RNA sequences), and tracking the mapped molecules in facilitating the interaction between the sample and the units of the system described above (e.g., via a downstream sequencing process).
[0283] Furthermore, the method may implement a structure placed near the sample (e.g., a mesh structure with affinity molecules, a mesh structure with primer-like sequences, etc.), the target analyte moves to the structure during sample processing, and is then processed using units of the system described above (e.g., by facilitating interactions between the mesh structure and the units of the system).
[0284] In various variations, the described method can include returning an output. In exemplary applications, returning an output can include returning an output that characterizes the stage of cancer (e.g., when identifying a set of cancer genes and / or their spatial distribution), returning an output that characterizes somatic mutations associated with a sample, returning an output that characterizes an immune response associated with a sample, returning an output that characterizes the stage of biological development associated with a sample (e.g., a developmental stage associated with mRNA clustering, etc.), returning an output that characterizes a pathological state associated with a sample (e.g., associated with liver disease, associated with kidney disease, associated with neurological disease, associated with another disease state, performing a diagnosis without whole transcriptome evaluation, etc.), returning an output that characterizes the spatial characteristics of the whole transcriptome associated with a sample, returning an output that characterizes the gene expression of a target set of genes, returning an output that characterizes protein expression (e.g., via an oligonucleotide-conjugated antibody), returning an output that characterizes the nucleosome arrangement (e.g., using ATAC-seq), returning an output that characterizes methylated sequences, returning an output that characterizes chromatin structure (e.g., using open chromatin characterization, chromatin accessibility characterization, etc.), returning an output that characterizes transcription factor binding, returning an output that characterizes genomic characteristics (e.g., mutations, copy number variations, etc.), and / or returning one or more other appropriate outputs.
[0285] As described, spatial characterization can be performed in 2D and / or 3D (e.g., using 3D structures and / or layering of system units with sample pieces). Further, a set of samples can be processed in parallel for a set of subjects / patients using barcodes (e.g., molecular barcodes) for different subjects / patients in a way that enables decoding of the corresponding characterization for each subject / patient in an efficient manner.
[0286] Additional method aspects are described below.
[0287] 3.1 Methods - Target Tagging (e.g., nuclear / cell tagging) As shown in Figure 7C, step S510 is to generate a set of labeled cells by labeling a set of cells with a first set of oligonucleotides. Relatedly, as shown in Figure 7D, step S610 is to generate a set of labeled nuclei by tagging a set of nuclei with a first set of oligonucleotides. Generating a set of labeled cells and / or labeled nuclei functions to tag them in a manner that associates (e.g., hybridizes or associates) the nucleic acids of nearby cells / nuclei, thereby enabling the spatial identification of the cell / nucleus location by performing further processing and sequencing operations, which are described in more detail below.
[0288] In one embodiment, as shown in Figure 7A, labeling may include treating a sample containing a set of targets (e.g., nuclei, cells) with a substrate containing a distribution of tagging molecules containing a spatial sequence (S410), tagging the set of targets with the distribution of tagging molecules (e.g., when cleaving functional molecules of the spatial sequence distribution to diffuse toward the set of targets) (S420), isolating the targets (e.g., nuclei, cells) of the set of targets in the sample (S430), and determining the location of the targets of the set of targets when sequencing the molecules generated from the distribution of tagging molecules (thereby mapping the locations to spatially characterize the locations of all isolated and treated nuclei).
[0289] In relation to step S410, embodiments, variations, and examples of substrates including the distribution of tagging molecules with spatial arrangements are described above in Section 2. One such embodiment of a substrate includes a distribution of functionalized particles to which tagging oligonucleotides are bound by cleavage linkers. Each functionalized particle includes a tagging oligonucleotide with a spatial arrangement corresponding to the position of the respective functionalized particle, and a tagging / handshake sequence that interacts with the sample target (e.g., nucleus, cell) upon delivery to a proximal sample target. Variations of the substrate may include tagging oligonucleotides that are spatially distributed but not bound to functionalized particles. For example, tagging oligonucleotides can be distributed across the shape of the substrate (e.g., slide), and its features may include spots, pits, wells, pillars, or other shapes to which the tagging oligonucleotides are bound by cleavage linkers.
[0290] Step S410 may include bringing a biological sample (i.e., a frozen sectioned tissue sample) into contact with units of the described systems 100, 200, where the identification and location of each barcode corresponding to a feature on the substrate can be decoded before bringing the biological sample into contact with the system. In variations, the spatial sequence includes a stochastic barcode sequence, and the locations of the stochastic barcode sequences are decoded to generate the coordinate locations of each stochastic barcode sequence before bringing the sample into contact with the distribution of functionalized particles. In variations, the tagging sequence may include tagging sequences (e.g., ligation sequences, hybridization sequences, etc.) that have nuclear targets and / or cellular targets (e.g., cytoplasmic targets, intracellular targets, other cellular targets, etc.).
[0291] In various embodiments of step S410, the sample may include whole tissue structures, tissue portions (e.g., histological tissue slices, formalin-fixed paraffin-embedded (FFPE) tissues, frozen tissues (e.g., fresh frozen tissues), fixed tissues, permeabilized tissues, biopsy tissues, fresh frozen plasma, seeded natural scaffolds, seeded synthetic scaffolds, etc.), organs, whole organisms, organoids, cell suspensions (e.g., frozen cell suspensions separated before processing in this system, cell suspensions held in culture media / hydrogel media, etc.), single cells, nuclear suspensions, organelles, suborganelle structures, intraorganelle components, mitochondrial targets, viruses, microorganisms, and other samples.
[0292] In relation to steps S410 and S420, tagging a set of nuclei or cells with tagging oligonucleotides may involve cleaving functionalized molecules from functionalized particles or the substrate surface, where the cleaved molecules diffuse toward nucleic acids near the target of the sample (e.g., nuclear target, cellular target) and interact with them. Such embodiments enable precise cell / nucleus positioning in downstream steps by using tagging oligonucleotides that are initially immobilized in appropriate positions on the substrate and have a spatial sequence (e.g., a stochastic barcode sequence, an address sequence). In embodiments of tagging oligonucleotides whose spatial sequence includes a stochastic barcode, the sequence of the stochastic barcode and the position of the barcode portion may be predetermined according to the embodiments, variations, and examples of the sequencing techniques described above.
[0293] Tagging of the nuclei or cells of the sample in step S420 may include cleaving the tagging oligonucleotides by a photocleavage mechanism, an enzymatic cleavage mechanism, a pH shift, mechanical separation, a thermal mechanism, or another suitable cleavage mechanism. Tagging of the nuclei or cells may also include delivering functionalized particles containing a spatial arrangement to the sample containing the nuclei or cells using a magnetic field (e.g., magnetic or paramagnetic particles), where the tagging oligonucleotides and / or functionalized particles may be retained and / or released in place with the application and / or removal of the magnetic field.
[0294] Tagging of the sample nucleus or cells in step S420 may further include facilitating cytosolic entry or other transmembrane transfer of the tagging oligonucleotide with respect to the sample cell membrane. Therefore, step S420 may include facilitating transmembrane transport of the tagging oligonucleotide toward the nucleus of the sample cells upon stimulation. Step S420 may also include the application of a second stimulation to remove the stimulus or reduce accessibility across the cell membrane.
[0295] Transmembrane transport may include one or more of the following: passive diffusion, active transport, the use of vectors (e.g., viral vectors) for the delivery of tagging oligonucleotides, the use of cell-permeable peptides for the delivery of tagging oligonucleotides, the use of prototoxins for entry across membrane channels by tagging oligonucleotide transporters, and / or other suitable mechanisms. In variations, stimuli applied to improve the delivery of tagging oligonucleotides toward the nucleus or cell may include one or more of the following: electric fields (e.g., in electroporation), temperature decreases (e.g., in cryoporation), temperature increases, forces that physically disrupt the membrane, membrane-disrupting enzymes, chemical gradients, electromagnetic energy, or other stimuli that increase membrane permeability.
[0296] The cutting parameters are as described above.
[0297] Isolating the target (e.g., nucleus, cell) of the sample target set in step S430 may include performing homogenization and / or grinding with a suitable buffer (e.g., isolation buffer), examples of which are described. Grinding may be performed using aspiration and delivery devices (e.g., pipette, irrigator) or other suitable devices.
[0298] When sequencing molecules generated from a distribution of tagging molecules, determining the target locations of a set of targets may involve processing the targets using a particle (e.g., cell / nucleus) processing platform that assists in sequencing the tagged targets using the described handshake sequences. For example, in embodiments where nuclei are tagged with handshake molecules of functionalized particles after cleavage, the tagging of nuclei may involve tagging the nuclei with different cleavage-type molecules associated with different spatial locations on the substrate.
[0299] In exemplary embodiments, nucleic acid sequences generated using a single-cell / single-nucleus processing platform may include CBCs and UMIs, and if a single target is adjacent to or overlaps with multiple locations on the substrate, multiple spatial barcodes may be captured, and therefore multiple handshake sequences may be captured. Thus, considering that multiple handshake sequences associated with different substrate locations can tag a single target, a bioinformatics method may include determining the nuclear location based on a subset of different locations corresponding to a subset of barcodes of handshake molecules tagged to the nucleus. The nuclear location can be determined from the average location of a subset of probabilistic barcodes (e.g., the centroid of the locations of the subset of probabilistic barcodes). In variations, the nucleus may be tagged using a combination of cleavable and non-cleavable molecules (or molecules cleaved at different stages in response to different stimuli), and as a result, the nuclear location can be determined from the probabilistic / spatial barcode locations of the cleavable and non-cleavable molecules (e.g., as a weighted centroid of the locations, where the locations of the non-cleavable components are weighted more than the locations of the cleavable components). Therefore, the location estimated from a barcode acting as a spatial address may be an estimate of the location within or on a sample, within or on a feature (e.g., functionalized particles), or a combination of these.
[0300] For example, DBSCAN may be applied to distinguish "signal" barcodes (e.g., sequenced barcodes that may provide values for nuclear alignment) from background "noise" barcodes (e.g., sequenced barcodes that are likely to be confusing nuclear alignment). The application of DBSCAN can output cluster assignments for each sequenced barcode acting as a spatial address, where cluster=0 represents a noise barcode and cluster>0 indicates a signal barcode grouped with other signal barcodes clustered in space. Spatial locations with all spatial barcodes indicating noise are not assigned to a target (e.g., nucleus, cell) or to a target (e.g., nucleus, cell) with multiple signal clusters. From the remaining targets with one distinct spatial barcode signal cluster, the weighted centroid of the spatial barcode coordinates in the signal cluster is obtained, where the weight is the number of unique molecular identifiers (UMIs) of the sequenced barcode. Importantly, DBSCAN requires two parameters: minPts and eps (essentially the radius). To determine the optimal parameter set for each run, 15 different minPts parameters are iterated through, and the parameter set with the highest proportion of targets to which spatial locations are assigned (i.e., one DBSCAN signal cluster) is selected. While DBSCAN can position targets with relatively high sensitivity and specificity, alternative approaches for positioning may include assigning the location of its best UMI spatial barcode to a target (e.g., nucleus, cell), taking the weighted 2D median of spatial barcode coordinates, K-means clustering, affinity propagation, mean shift, spectral clustering, agglomerative clustering, DBSCAN extensions such as HDBSCAN and OPTICS, and / or other methods.
[0301] Counting UMI can also assist in determining the location of the nucleus / cell. The calculation method can use the distance on the substrate of different handshake sequence barcodes associated with the target during sequencing. If different handshake sequence barcodes are close together on the substrate, the target's location is most likely somewhere between or overlapping those locations. If different handshake sequence barcodes are far apart, the spatial barcode nucleic acids may have diffused away from their locations, and that location is the spatial barcode with the highest UMI. This is because the spatial barcode with the higher UMI was the primary spatial barcode that nucleic acidized within that single cell.
[0302] Next, using the determined positions, a spatial map of the nucleus distribution can be generated from the set of spatial locations.
[0303] 3.1.1 First Example of Target Tagging and Isolation - Nucleus / Cell In a specific example of step S420, tagging a set of nuclei or cells using tagging oligonucleotides may include:
[0304] 0. Preparing the material, which may include equilibrating fresh frozen tissue samples and optimal cutting temperature (OCT) compounds to -18°C in a cryostat for at least 20 minutes prior to sectioning. The optimal temperature for sectioning may vary depending on the type of tissue. Preparing the material may also include lowering the temperature of the centrifuge included in the procedure (e.g., to 4°C) and inserting appropriate swing bucket attachments into the containers used in the procedure (e.g., 1.5 mL tubes). Preparing the material may also include providing ice and cooling the multiwell containers (e.g., 12-well plates on ice) to lower the temperature of the multiwell containers. Preparing the material may also include lowering the temperature of the filtration device (e.g., cell strainer) to a low temperature (e.g., -20°C, 0°C, below 0°C). Preparation of materials may also include, if used for tissue staining, preparing Crystal Violet and dissolving it in a certain volume (e.g., 4 mL) of nuclease-free water to create a solution (e.g., a 25% solution). Preparation of materials may also include preparing a cleavage buffer and storing the cleavage buffer on ice. In one example, the cleavage buffer may be configured for cleavage using a photocleavage mechanism (as described below). The cleavage buffer may include a wash buffer containing a dye (e.g., 4% Trypan Blue, 0.01% Trypan Blue, etc.). Preparation of materials may also include preparing an isolation buffer for isolating the nuclei of the sample after tagging the nuclei of the sample and storing the isolation buffer on ice. In variations, the isolation buffer may include a combination of a nuclear isolation reagent and an RNAse inhibitor. Preparation of materials may also include preparing a wash buffer and storing the wash buffer on ice, which may include a combination of storage buffer, bovine serum albumin (BSA), and an RNAse inhibitor.
[0305] 1. Preparation of tissue sections (e.g., fresh frozen tissue sections frozen to 20 μm at -18°C), where variations in section thickness and preparation method are described. When working with tissue blocks larger than the area of functionalized particle / feature distribution of the substrate, preparation of a second tissue sample may include defining the desired capture area using a square tissue punch and optionally further cutting the tissue (e.g., scoring the boundaries using a razor blade). If the tissue block has been previously stored in a freezer or cryostat for an extended period, it is recommended to section the block to 50-100 μm before taking 20 μm sections. Furthermore, it is recommended to cover the sectioning / exposed surface of the tissue block with an OCT compound to protect the sectioning / exposed surface of the tissue block between instances of cutting sections from the tissue block. The quality of a tissue sample can be assessed in terms of RNA quality by collecting one or more sections (e.g., 10 μm sections) of the tissue sample, isolating the RNA using an RNA extraction kit, and subsequently analyzing the RNA to derive the RNA integrity number (RIN). The RIN must be greater than a threshold value (e.g., at least 7 RIN values, at least 8 RIN values, etc.). Furthermore, the quality assessment of a tissue sample may include performing staining (e.g., H&E staining) on adjacent sections of the tissue sample to provide information about the structural context of the tissue and the quality of sectioning.
[0306] 2. The tissue section is brought into contact with the distribution of functionalized particles / features on the substrate.
[0307] A first option for precise placement of the desired region includes placing a substrate with a distribution of functionalized particles in a cryostat to lower its temperature (e.g., for 1 minute), and then placing the cooled substrate with the distribution of functionalized particles on a cutting stage. Bringing a tissue section into contact with the distribution of functionalized particles may then include using a brush to position the tissue section on the substrate and ensuring that the desired region is positioned directly above the distribution of functionalized particles. Next, with the substrate and tissue section facing upward, the substrate is moved from the cryostat stage and the tissue section is melted on the substrate by gently placing a finger on the bottom of the substrate. To avoid curling of the tissue section, heating the tissue section may be done from one edge of the section toward the other (e.g., rather than heating the section from the center). A small brush can be used to keep the other edge of the tissue flat during the initial melting from one end. Do not lift the edges of the substrate from the flexible film supporting the substrate while melting the tissue.
[0308] A second option for rapidly positioning the target region involves holding a room-temperature substrate having functionalized particles within a support structure having a flexible film, such that the distribution of functionalized particles is oriented downwards. Contacting the tissue section may then involve hovering the substrate over the target region and slowly lowering the substrate to bring it into contact with the tissue section. In the second option, the substrate with the tissue section can then be returned to the cryostat.
[0309] If tissue application is difficult due to static charge, one or more of the following can be done: grounding the tissue itself before sectioning, replacing with a new pair of gloves, wiping the back of the flexible film with 100% ethanol followed by drying, cleaning the entire cryostat chamber with 100% ethanol to reduce the charge, placing a portion of the drying sheet in the corner of the cryostat, and taking other appropriate actions to reduce or remove static charge that may be interfering with tissue application.
[0310] 3. Prepare tissue sections for storage of functionalized particles and / or cleavage by stimulation. If a masking element (e.g., the sticker described above) was used according to step 2 above (e.g., on the back of the substrate), the masking element can be removed before removing the substrate from the flexible film. Using tweezers or other tools, the substrate can be removed from the flexible film and then prepared on ice and placed in the wells of the multiwell plate described in step 0. Preparing tissue sections then may include distributing the cleavage buffer prepared in step 0 (e.g., 30 μL of cleavage buffer) onto the tissue section (immediately injecting with a pipette) and ensuring that the entire tissue section is covered with the buffer. The multiwell plate and / or substrate can then be tilted to spread the buffer over the entire tissue section.
[0311] 4. Cut the functionalized molecules from the particles / characteristics of the substrate and release them toward the target of the sample (e.g., nucleus, cell). Cutting may include placing ultraviolet (UV) light over the multiwell plate prepared in step 3 (e.g., 1-2 cm) and ensuring that the UV meter of the UV light is set to the desired current limit (1.2 A) and the desired power setting. Next, cutting may include turning on the UV light and exposing the substrate with the tissue section to the UV light for a certain period of time (e.g., 30 seconds, 60 seconds) while keeping the multiwell plate on ice. However, other power settings, wavelengths of light, and exposure times may be used depending on the structure(s) of the functionalized molecules of the substrate. Next, step 4 may include incubating the substrate at a low temperature (e.g., on ice) for a certain period of time (e.g., 7.5 minutes, 5 minutes, 2.5 minutes, another appropriate or intermediate duration) in conjunction with cutting, before tissue removal and separation in workflow operations 5 and 6 described below. By adjusting the incubation time, the accuracy of the spatial arrangement of nuclei in subsequent workflow operation steps can be improved. Thus, cleavage releases a handshake sequence of functionalized particles for interaction with nuclei / cells / other targets in the tissue sample.
[0312] 5. Remove the tissue section from the substrate. After incubation in step 4, removing the tissue section may involve distributing a fixed volume (e.g., 200 μL) of lysis buffer containing the RNase inhibitor onto the distribution of functionalized particles on the substrate, targeting the tissue sample. Distributing the volume of lysis buffer containing the RNase inhibitor may be repeated several times (e.g., four distributions of a total of 1 mL). Distributing may involve targeting different areas of the distribution of functionalized particles in order to separate the entire tissue section from the substrate. Removing the tissue section may further involve continuing to separate the tissue from the substrate by aspirating any dispensing buffer still contained in the wells, distributing it onto the area of functionalized particle distribution covered by the tissue, and keeping the multiwell plate on ice as far as possible. Visual inspection (e.g., using a microscope) may be performed to determine whether any tissue remains covering the substrate / distribution of functionalized particles, and further aspiration and buffer distribution may be performed to further remove tissue from the substrate. Removing the tissue in step 5 may then involve transferring the substrate to an empty container (e.g., an empty well in a multiwell plate) and carefully removing the functionalized particles along with the removed tissue into the solution, taking care not to damage the substrate. In particular, contamination of the functionalized particles can cause problems in the downstream single-nucleus tagging step.
[0313] 6. Separation of nuclei. Separation of nuclei may include mechanically separating the nuclei by grinding (e.g., repeatedly aspirating and delivering the nuclear suspension obtained from the removed tissue). Multiple grinding steps may be performed with resting periods between instances of grinding. Separation of nuclei may include observing (e.g., under a microscope) that the nuclear suspension mainly contains single nuclei. If tissue clumps remain, additional grinding steps may be performed. Separation of nuclei may then include dispensing a certain amount (e.g., 1 mL) of washing buffer containing an RNase inhibitor into the nuclear suspension, followed by pipetting the nuclear suspension with the washing buffer and RNase inhibitor and transferring the contents of the wells to one or more centrifuge vessels. Separation of nuclei may then include rotating one or more centrifuge vessels in a pre-cooled centrifuge equipped with a spin bucket set to 4°C (e.g., 500xg for 5 minutes). Following centrifugation, separation of nuclei may then include carefully removing the centrifuge vessels from the centrifuge and immediately placing them on ice. Separating the nuclei may involve removing the supernatant, taking care not to disturb the pellet. The nuclear pellet can then be resuspended in a volume (e.g., 1 mL) of storage buffer containing an RNase inhibitor. The resuspension can then be mixed, and the nuclear suspension can be filtered into a new centrifuge vessel by passing it through a pre-cooled strainer (e.g., pluriStrainer Mini® 20 μm cell strainer). The filtered sample can then be centrifuged (e.g., at 500 x g for 5 minutes, set to 4°C), followed by removing the centrifuge vessel from the centrifuge and placing it on ice. The nuclear suspension can then be processed for nuclear counting (e.g., by setting aside a portion of the buffer, such as 50 μL of buffer).
[0314] 7. Nucleus counting. When performing snRNA-seq with a single-cell scanner-free workflow, nuclei can be counted with AOPI or ethidium homodimer-1 and diluted to the desired concentration according to the manufacturer's guidelines. When performing snRNA-seq using a scanner workflow, nuclei can be counted with DyeCycle Green. Counting with an automated fluorescence counter or microscope is strongly recommended, as the use of Trypan Blue may overestimate the number of nuclei. To ensure accuracy, count nuclei multiple times (2-3 reproducible counts).
[0315] 7B. (Optional) Assessment of tissue separation integrity. The assessment may include staining the substrate that initially had a distribution of functionalized particles after nuclear isolation to assess the integrity of tissue dissociation. The assessment may lead to a decision on whether to proceed to scRNA-seq according to step 8. In one example, the assessment of tissue separation may include placing the substrate from step 5 on a wipe (e.g., an absorbent wipe) so that the side with functionalized particles faces upward. The assessment may then include exposing the substrate to a certain amount (e.g., 75 ul) of dye (e.g., Trypan Blue) and incubating the substrate at room temperature for a certain time (e.g., 5 minutes, more than 5 minutes, less than 5 minutes). The assessment then includes washing the substrate (e.g., with 1x PBS washing solution) to remove excess liquid from the substrate, taking care not to come into contact with the distribution of functionalized particles. The remaining tissue on the substrate is stained (e.g., an assessment with Trypan Blue base is dark blue). The remaining functionalized particles are also stained (for example, a lighter blue tint in the case of Trypan blue-based evaluation).
[0316] 8. Proceed to the capture and processing of a single nucleus using a single-particle (e.g., single cell, single nucleus) capture and processing platform. Single-nucleus capture and processing may include performing single-nucleus RNA sequencing using an appropriate library preparation step (e.g., for whole transcriptome analysis, for AbSeq, etc.) and amplification by an appropriate number of amplification cycles (or isothermal amplification process).
[0317] In relation to the specific examples described above in Section 4.1.1, the steps of the procedure can be performed at low temperatures (e.g., 0°C, 4°C, etc.). For example, the entire procedure may involve manipulating and handling materials using ice whenever possible, in which case the buffer, tissue, and nuclear suspension are kept on ice as much as possible. Furthermore, in the case of specific examples, in order to maintain nuclear quality, single nuclear isolation for single nuclear RNA sequences (snRNA sequences) can be performed immediately after rapidly executing this procedure.
[0318] Modifications of the above method can be adapted to single-cell tagging using handshake sequences, and then processed (for example, using a single-cell processing protocol).
[0319] 9. Sequencing. Sequencing of the resulting snRNA-seq library can be performed according to the manufacturer's instructions for the selected single-cell RNA-seq platform. Sequencing of the resulting snRNA-seq library can generate a number of reads per captured nucleus (e.g., at least 5,000 read pairs, at least 10,000 read pairs, at least 20,000 read pairs, etc.). Exemplary read lengths may range from 12 to 50 or more.
[0320] 10. Bioinformatics. Based on the sequencing performed in the above steps, bioinformatics pipeline analysis may be performed to spatially map the nuclear locations. The location of a tagged single nucleus can be determined and then mapped using the centroid approach or other approaches as described above, in which case the centroid of the barcode, which acts as a spatial address, is used to approach the location of each isolated nucleus, and then the location of the corresponding nucleus is mapped. Variations of the location determination have been described above (for example, with respect to DBSCAN).
[0321] The variations of the examples provided in Section 3.1.1 above may include modifications individually or in combination. For example,
[0322] In relation to workflow operation 1, the tissue sections to be processed may have different thicknesses (e.g., the stated thickness, 25-30 micrometers) to facilitate separation in workflow operations 5 and 6 and to increase the nuclear yield determined in workflow item 7, etc.
[0323] In workflow operation 2, a layer with an appropriate thickness (e.g., 5 micrometers, 10 micrometers, 15 micrometers, 20 micrometers, etc.) is added between the tissue section and functionalized particles / features on the substrate (e.g., an optimal cutting temperature (OCT) compound, a hydrogel, another hydration material) to facilitate separation in workflow operations 5 and 6 and increase the nucleus yield determined in workflow item 7, etc. During the operation, the layer can be kept at a low temperature (e.g., by placing the substrate on ice, by using a coolant, etc.).
[0324] To limit the diffusion of the single-nucleus / single-cell library generated in connection with workflow operation 9 and to improve the signal-to-noise ratio, a layer with an appropriate thickness (e.g., 5 micrometers, 10 micrometers, 15 micrometers, 20 micrometers, 35 micrometers, 30 micrometers, 35 micrometers, etc.) (e.g., an optimal cutting temperature (OCT) compound, a hydrogel, or another hydrating material) is added on top of the tissue section in connection with workflow operation 3. Adding a layer makes it easier to freeze, store, and thaw the tissue sample on the substrate at this stage (e.g., to facilitate batch processing of multiple substrates) to provide a more flexible workflow (e.g., when the operator is not near the cryostat).
[0325] To reduce noise associated with workflow operations 9 and 10 and improve the percentage of useful reads, a washing step is added to workflow operation 4 after UV exposure (e.g., immediately after UV exposure) to remove functionalized molecules released that were not absorbed by the tissue section. The washing step may include a suitable washing buffer, and embodiments, variations, and examples thereof are described.
[0326] 3.1.2 Second example of target tagging and isolation - nucleus / cell 1. Prepare sections of the tissue sample (for example, a fresh frozen tissue sample frozen into 20 μm sections at -16°C). Here, variations in section thickness and preparation method will be explained.
[0327] 2. Facilitate interaction between functionalized particles on the substrate and the target of the sample (e.g., single-cell target, nuclear target) (e.g., apply sections to the substrate to which the functionalized particles will bind to ensure there are no folds, flatten the sections of the substrate using a brush).
[0328] 3. Heat is transferred to the section through the substrate, thereby melting the section of the substrate.
[0329] 4. Use the section to transfer heat from the substrate and cover the substrate with the separation buffer using the section. In one example, the substrate containing the section is placed on ice, and 6-10 μL of separation buffer is placed on top of the substrate containing the section. In one example, the separation buffer contains Na2SO4, K2SO4, glucose, HEPES, and MgCl2. In various variations, the separation buffer can be used in conjunction with nuclear separation, following the first example of target tagging and isolation described above.
[0330] 5. The substrate containing the sections is exposed to UV light (e.g., 365 nm emission) for a set period of time (e.g., 30 seconds) to cleave the spatial barcode oligonucleotides of the functionalized particles, and then the substrate containing the sections is incubated at a low temperature (e.g., on ice) for a set period of time (e.g., 7.5 minutes).
[0331] 6. Place the substrate containing the section in a sample processing container (e.g., a 12-well plate, other well plates, tubes, channels, flow cells, containers, etc.), and distribute the extraction buffer onto the substrate to release the section from the substrate (for example, using a 200 μL pipette, dispense 10 × 200 μL aliquots of the extraction buffer onto the substrate to a total volume of 2 mL. Disperse the section 10 to 15 times using the pipette). In one example, the extraction buffer may include the exemplary separation buffer described in step 4 above, Kollidon®, Triton X-100, bovine serum albumin, and an RNase inhibitor.
[0332] 7. After each grinding, the substrate is examined (for example, under a microscope) to confirm that the sections have been completely removed from the substrate. This step is repeated until the sections have been completely removed from the substrate.
[0333] 8. Once the sections are removed from the substrate, remove the functionalized particles (for example, by mechanical separation, which involves grinding 20-25 times using a 1 mL pipette).
[0334] 9. Remove the separated nuclei from the processing vessel, rinse the processing vessel twice with 1 mL of washing buffer, and add this to the nucleus suspension. In one example, the washing buffer may contain a portion of the separation buffer described above, bovine serum albumin, and an RNase inhibitor.
[0335] 10. Rotate the nucleus suspension (for example, centrifuge 600g in a pre-cooled swing bucket at 4°C for 10 minutes).
[0336] 11. Remove the supernatant and, optionally, pool the nucleus pellets from multiple centrifuges.
[0337] 12. Filter the nuclear suspension (for example, using a pre-cooled 40-micrometer filter moistened with separation buffer).
[0338] 13. Add DAPI (e.g., 1:1000DAPI) to the filtered solution and incubate it (e.g., on ice for 8-10 minutes).
[0339] 14. After incubation, centrifuge the DAPI / nucleus solution (e.g., 200g for 10 minutes at 4°C).
[0340] 15. Remove the supernatant.
[0341] 16. Nucleus counting using a cell counter
[0342] a. Compare the number of counted nuclei to a passing criterion (e.g., more than 10,000 nuclei).
[0343] In various variations, the isolation of labeled nuclei may involve implementing an automated sample homogenizer for tissue separation and nuclear isolation. Nuclear isolation may further or or otherwise involve the use of affinity tagging, which involves binding nuclei or cells to particles that can be separated from other sample components (e.g., magnetic attraction, buoyancy, density-based separation methods, and filtration).
[0344] Figure 9 shows exemplary data illustrating the analysis of over 52,000 nuclei from a human cortical tissue sample using a 10 mm × 10 mm distribution of functionalized particles for spatial tagging of nuclei in the sample. In the example shown in Figure 9, a human cortical tissue sample was treated with nuclear tagging using handshake sequences, and subsequent analysis by the described method revealed the spatial distribution of nuclei corresponding to cell types: astrocytes, endothelial cells, excitatory neurons, inhibitory neurons, microglia, oligodendrocytes, and oligodendrocyte precursor cells, along with an indication of gray matter and white matter distribution. In the exemplary sample, astrocytes accounted for 8.06% of the tagged and mapped nuclei, endothelial cells for 5.15%, excitatory neurons for 15.54%, inhibitory neurons for 5.89%, microglia for 3.92%, oligodendrocytes for 35.29%, and oligodendrocyte progenitor cells for 2.65%. The logarithm of the UMI number was greater than 3 for all cell types.
[0345] 3.2 Methods - Spatial separation and further processing of cells / nuclei Step S520 involves attaching a set of labeled cells in the interstitial space of the distribution of functionalized particles bound to the substrate (where each functionalized particle is in contact with only one labeled cell in the set of labeled cells). Step S620 involves attaching a set of labeled nuclei in the interstitial space of the distribution of functionalized particles bound to the substrate.
[0346] Steps S520 and S620 function to ensure that the target sample components (e.g., cells, nuclei) on the substrate are captured and positioned, and the features of the substrate function simultaneously to spatially separate / isolate the individual components and further tag the components with functionalized oligonucleotides in order to further barcode the target components for processing (e.g., according to the library preparation procedure described further below).
[0347] In various modifications, the labeled cells / nuclei generated in steps S510 and S610 can be transferred to a second substrate having a distribution of functionalized particles, where the spaces between the functionalized particles (e.g., interstitial spaces) arrange them so that they can receive the cells / nuclei and be labeled by functional molecules bound to the functionalized particles. In various embodiments, modifications, and examples, the second substrate may include the substrate described in U.S. Patent Application No. 17 / 895,633, filed on August 25, 2022, entitled “Systems and Methods for Characterizing Locations of Target Analytes in Multi-Dimensional Space” (which is incorporated herein in its entirety by this reference).
[0348] Functionalized particles of the second substrate can be bound to the second substrate by close packing (e.g., random close packing, rectangular close packing, hexagonal close packing, etc.) or without close packing. The spaces defined between the functionalized particles may be configured to accommodate cells / nuclei, approximately 5 micrometers, 6 micrometers, 7 micrometers, 8 micrometers, 9 micrometers, 10 micrometers, 11 micrometers, 12 micrometers, 13 micrometers, 14 micrometers, 15 micrometers, 16 micrometers, 17 micrometers, 18 micrometers, 19 micrometers, 20 micrometers, 21 micrometers, 22 micrometers, 23 micrometers, 24 micrometers, 25 micrometers, 26 micrometers, 27 micrometers, 28 micrometers, 29 micrometers, 30 micrometers, 31 micrometers It may have characteristic dimensions (e.g., width, length, depth, effective diameter, etc.) of chromates, approximately 32 micrometers, approximately 33 micrometers, approximately 34 micrometers, approximately 35 micrometers, approximately 36 micrometers, approximately 37 micrometers, approximately 38 micrometers, approximately 39 micrometers, approximately 40 micrometers, approximately 41 micrometers, approximately 42 micrometers, approximately 43 micrometers, approximately 44 micrometers, approximately 45 micrometers, approximately 46 micrometers, approximately 47 micrometers, approximately 48 micrometers, approximately 49 micrometers, approximately 50 micrometers, or other dimensions suitable for reliably receiving and holding the desired component in single-component form while still allowing interaction with the molecules of functionalized particles defining each interstitial space.
[0349] Preferably, in connection with steps S520 and S620, each functionalized particle comes into contact with at most one labeled nucleus from a set of labeled nuclei, or with at most one labeled cell from a set of labeled cells. To provide such a configuration for cell / nucleus capture and tagging on the second substrate, the cell / nucleus suspension may be produced with an appropriate number or density of components so that delivery to the second substrate does not provide an overload configuration, and the functionalized particles come into contact with multiple nuclei or cells. In various variations, steps S520 and S620 each include counting cells or nuclei (e.g., using a hemocytometer) and producing a suspension containing cells or nuclei in an appropriate buffer (e.g., nuclear lysis buffer, cell lysis buffer, other buffer). In some examples, the lysis buffer may contain proteinase K and DTT.
[0350] The resulting suspensions are then divided into 1 component / microliter, 2 components / microliter, 3 components / microliter, 4 components / microliter, 5 components / microliter, 6 components / microliter, 7 components / microliter, 8 components / microliter, 9 components / microliter, 10 components / microliter, 11 components / microliter, 12 components / microliter, 13 components / microliter, 14 components / microliter, 15 components / microliter, and 16 components / microliter, depending on the number of functionalized particles provided by the second substrate. Tol, 17 components / microliter, 18 components / microliter, 19 components / microliter, 20 components / microliter, 21 components / microliter, 22 components / microliter, 23 components / microliter, 24 components / microliter, 25 components / microliter, 26 components / microliter, 27 components / microliter, 28 components / microliter, 29 components / microliter, 30 components / microliter, 31 components / microliter, 32 components / microliter, 33 components / microliter, 34 components / micro Liter, 35 components / microliter, 36 components / microliter, 37 components / microliter, 38 components / microliter, 39 components / microliter, 40 components / microliter, 41 components / microliter, 42 components / microliter, 43 components / microliter, 44 components / microliter, 45 components / microliter, 46 components / microliter, 47 components / microliter, 48 components / microliter, 49 components / microliter, 50 components / microliter, 100 components / microliter, 150 components / microliter, 200 ingredients / microliter, 250 ingredients / microliter, 300 ingredients / microliter, 350 ingredients / microliter, 400 ingredients / microliter, 450 ingredients / microliter, 500 ingredients / microliter, 550 ingredients / microliter, 600 ingredients / microliter, 650 ingredients / microliter, 700 ingredients / microliter, 750 ingredients / microliter, 800 ingredients / microliter, 850 ingredients / microliter, 900 ingredients / microliter, 950 ingredients / microliter,The concentration of cells or nuclei (i.e., components) may be 1000 components / microliter, 1050 components / microliter, 1100 components / microliter, 1150 components / microliter, 1200 components / microliter, 1250 components / microliter, 1300 components / microliter, 1350 components / microliter, 1400 components / microliter, 1450 components / microliter, 1500 components / microliter, 1550 components / microliter, 1600 components / microliter, 1650 components / microliter, 1700 components / microliter, 1750 components / microliter, 1800 components / microliter, 1850 components / microliter, 1900 components / microliter, 1950 components / microliter, 2000 components / microliter, greater than 2000 components / microliter, or another appropriate number of components / microliter.
[0351] In deformations that attach each component(s) in the interstitial space, the volume of the cell / nucleus set can be delivered to the second substrate, and that volume is 0.5 microliters, 1 microliter, 2 microliters, 3 microliters, 4 microliters, 5 microliters, 6 microliters, 7 microliters, 8 microliters, 9 microliters, 10 microliters, 11 microliters, 12 microliters, 13 microliters, 14 microliters, 15 microliters, 16 microliters, 17 microliters, 18 microliters, 19 microliters, 20 microliters, 21 microliters, 22 microliters, 23 microliters, 24 microliters, 25 microliters, 26 microliters, 27 microliters, 28 microliters, 29 microliters, 30 microliters, 31 microliters, 32 microliters, 33 microliters, 34 microliters, 35 microliters, 36 microliters, 37 microliters, 38 microliters, 39 microliters, 40 microliters, 41 microliters, 42 microliters, 43 microliters, 44 microliters, 45 microliters, 46 microliters, 47 microliters, 48 microliters, 49 microliters, 50 microliters, an intermediate formulation, or another suitable formulation.
[0352] Attaching each component to the interstitial space of the functionalized particles on the second substrate may include one or more of the following: precipitating the component from the suspension toward the functionalized particles under gravity; binding the component to magnetic particles to provide a biasing force for driving the component toward the functionalized particles when a magnetic field is applied; binding the component to charged particles that promote the movement of the component toward the functionalized particles; binding the component to buoyant particles that promote the movement of the component toward the functionalized particles; binding the component to particles having a density that promotes the movement of the component toward the functionalized particles; or attaching the component by another suitable method.
[0353] In various variations, the cells / nuclei transferred to the second substrate do not need to be pre-labeled according to steps S510 and S520 and S610 and S620, thereby allowing unlabeled cells, nuclei, or other components of the sample to be transferred to the substrate having functionalized particles and unlabeled cells, unlabeled nuclei, or other components to be tagged simultaneously using a spatially stochastic sequence and barcoded for single-component (e.g., single cell, single nucleus) analysis.
[0354] In various modifications, the components mounted in steps S520 and S620 can be covered (e.g., sealed) with a layer. In various modifications, layer 15 may consist of an optimal cutting temperature (OCT) compound (e.g., the OCT compound alone, or a combination of the OCT compound with other process reagents), oil, aqueous material, mesh, hydrogel, or another suitable material. Thus, covering can serve a protective function with respect to maintaining the viability of cells or other targets, and general sample handling, and / or sample processing function. The layers (for example, of OCT) may have thicknesses of 2 micrometers, 3 micrometers, 4 micrometers, 5 micrometers, 6 micrometers, 7 micrometers, 8 micrometers, 9 micrometers, 10 micrometers, 11 micrometers, 12 micrometers, 13 micrometers, 14 micrometers, 15 micrometers, 16 micrometers, 17 micrometers, 18 micrometers, 19 micrometers, 20 micrometers, 21 micrometers, 22 micrometers, 23 micrometers, 24 micrometers, 25 micrometers, 26 micrometers, 27 micrometers, 28 micrometers, 29 micrometers, 30 micrometers, 35 micrometers, 40 micrometers, 50 micrometers, 60 micrometers, an intermediate thickness between the listed thickness values, or a thickness greater than 60 micrometers.
[0355] In one example, steps S520 and S620 include placing a 30-micrometer OCT section on a second substrate to seal components (e.g., cells, nuclei). Next, the second substrate is transferred to a container (e.g., a well plate, another container), a certain volume (e.g., 1 ml) of lysis buffer is supplied to the container, followed by incubation (e.g., incubation on ice for 5 minutes). Then, the second substrate is washed (e.g., in 400 uL of RT wash buffer for 10-15 seconds).
[0356] Optionally, in some embodiments, steps S520 and S620 may include, after cell / nucleus isolation, component capture (e.g., microfluidic capture, capture in microwells, capture in distribution, capture in emulsion droplets) and further barcoding using distribution-based single-nucleus or single-cell sequencing techniques for further processing. Nuclear target identification may be further optionally performed without sequencing, using optical detection of nuclear targets tagged with probes during nuclear tagging and barcoding.
[0357] 3.3 Library Preparation Step S530 involves generating a single-cell sequencing library from amplicons produced from a set of reactions involving labeled cells and a set of particles with a distribution of functionalized particles. Step S630 involves generating a single-nucleus sequencing library from amplicons produced from a set of reactions involving labeled nuclei and a set of particles with a distribution of functionalized particles.
[0358] Library preparation can be carried out according to embodiments, variations, and examples of the library preparation steps described in U.S. Patent Application No. 17 / 895,633, “Systems and Methods for Characterizing Locations of Target Analytes in Multi-Dimensional Space,” filed on 25 August 2022.
[0359] 3.4 Single-component analysis Step S540 is to return a single-cell analysis for a set of cells obtained by sequencing a single-cell sequencing library. Step S640 is to return a single-nucleus analysis for a set of nuclei obtained by sequencing a single-nucleus sequencing library. Returning single-cell and / or single-nucleus analyses may include sequencing nucleic acid material generated from tagged cells and / or nuclei (e.g., from libraries generated from S530 and S640, respectively). Analytical techniques include mononuclear RNA-seq (e.g., snRNA-seq, scRNA-seq), T cell receptor (TCR) analysis, B cell receptor (BCR) analysis (e.g., by receptor-ligand characterization), ATAC-seq for evaluating chromatin accessibility (described handshake sequences / functionalization molecules may include the same adapter sequences as the adapters inserted into active chromatin by Tn5 transposases), Hi-C sequencing library generation, spatially degraded methylation sequencing library generation, and single-cell / mononuclear chromatin immunoprecipitation. Potential applications include the generation of regression sequencing libraries, spatially degraded single-cell / single-nucleus enzyme-tethered chromatin profiling libraries, single-cell / single-nucleus spatially degraded proteomic libraries, other multi-omics spatially degraded libraries (e.g., barcodes acting as spatial addresses need to be tagged with cell barcodes for only one of the omics parts of a multi-omics assay), processing of nuclear and non-nuclear targets in formalin-fixed and paraffin-embedded (FFPE) specimens, nuclear DNA analysis, nuclear protein analysis, and / or other analyses.
[0360] The locations of tagged single nuclei and / or single cells can also be determined and then mapped using the centroid approach or other approaches as described above, in which case the centroid of the barcode, which acts as a spatial address, is used to approach the location of each isolated nucleus, and then the location of the corresponding nucleus is mapped.
[0361] 3.5 Methods - Alternative single-cell analysis As shown in Figure 10, one embodiment of Method 700 for characterizing a set of single cells or single nuclei in a multidimensional manner is to combine a set of functionalized particles with a set of single cells and / or a set of single nuclei, where the ratio of the number of functionalized particles to the number of single cells and / or single nuclei is greater than 1 (e.g., 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, etc.), and S710; S720; holding single cells and / or single nuclei within recesses (e.g., gaps, pores, other surface features, etc.) of a set of functionalized particles (e.g., a single cell or single nucleus is associated with at most one functionalized particle of the set of functionalized particles); and stabilizing the set of functionalized particles together with the associated single cells and / or single nuclei within a matrix (e.g., a hydrogel matrix, other matrices), wherein the matrix can transition between solidified and non-solidified phases, and the matrix is less than a first size threshold. S730 Stabilizing the material to allow diffusion to and / or between sets of functionalized particles and to prevent diffusion of material exceeding a second size threshold; S740 Dissolving a set of single cells (if single cells are present) with lysis buffer, with or without raising the temperature of the lysis buffer, the lysis buffer is introduced into the set of single cells through the matrix; Performing a hybridization operation between the contents of the set of single cells and / or single nuclei (e.g., mRNA content, other nucleic acid content, conjugated protein content, etc.) and a set of functionalized particles, wherein the contents of the single cells or single nuclei can hybridize with multiple functionalized particles from the set of functionalized particles, the hybridization operation tags the target contents of the single cells or single nuclei; S750 Performing a hybridization operation to transition the matrix from the solidified phase to the non-solidified phase in coordination with performing reverse transcription, second strand synthesis, and cDNA amplification operations after the hybridization operation;S770: To generate a sequencing library from amplicons produced from a cDNA amplification operation; S780: To return a single-cell and / or single-nucleus analysis of a set of cells / nuclei when processing the sequencing library, wherein a subset of functionalized particles associated with a target substance from a single cell / nucleus is associated based on a barcode (e.g., spatial barcode, cell barcode) having a nucleotide sequence (e.g., probabilistic sequence) associated with the single cell / nucleus. When the described methods are combined with spatial information (e.g., using the described spatial barcode), they can generate and return associations between genotypic and phenotypic features of a biological sample material.
[0362] 3.6 Methods - Mitigating Smearing Artifacts Modifications of the described method may include steps to mitigate problems associated with undesirable diffusion of handshake molecules and / or targets from each other, thus resulting in inaccurate determined target locations. Target migration may be due to one or more of the following: the presence of a highly expressed target (e.g., a target gene); diffusion or directional flow of a target or functionalized molecule away from its origin by a sample processing step and / or apparatus that allows for the flow of a target away from its origin in the sample; or the provision of a distribution of functionalized particles having a substantially larger footprint than the footprint occupied by the sample (e.g., area to which they belong, number of functionalized particles, etc.).
[0363] Reducing smearing involves: increasing the density or number of available tagging sites on the functionalized molecules used to spatially tag the target of the sample; increasing the volume of the chamber used in the hybridization and washing steps to reduce undesirable hybridization of target molecules (e.g., of highly expressed genes) to non-neighboring functionalized particles; matching (or attempting to match) the area of the functionalized particle distribution footprint with the sample footprint; and blocking the exposed functionalized particle tagging molecules of the functionalized particle distribution after the sample has been applied to the functionalized particle distribution. Therefore, exposed functionalized particles include particles not covered by the sample, and blocking tagging molecules may be made by one or more of the following: adding an adenosine (dA) blocker (or other blocker) to the hybridization buffer used in the assay workflow; stirring the hybridization solution during the hybridization step of the assay workflow; applying a less efficient hybridization buffer and / or a longer incubation time to prevent leakage; or performing other appropriate operations.
[0364] In some cases, the direction of flow of target and / or handshake sequences, which can cause a smearing effect in the generated map, can correlate with the orientation of the substrate in the chamber containing the hybridization buffer for the hybridization step, and the primary direction of movement of system units into the chamber of hybridization buffer and / or the primary direction of removal of system units from the chamber of hybridization buffer correlate with the direction of smearing (e.g., loose / unbound targets move and are tagged during the movement or removal of hybridization buffer).
[0365] In one variation, a method involving hybridization to functionalized particles of a target may include applying a layer 15 (e.g., a smear-preventing layer) on top of the sample, so that the sample is sandwiched between layer 15 and the distribution of functionalized particles (e.g., during the hybridization step), preventing target drift and / or preventing smearing of the map generated from the process and reaction involving the distribution(s) of functionalized particles (see Figure 11A).
[0366] In one variation, layer 15 may include a layer of optimal cutting temperature (OCT) compound, and method 800 for applying layer 15 (e.g., OCT compound) may include, as shown in Figure 11B, placing a sample (e.g., frozen tissue section, other sample) on a substrate on at least a portion of the distribution of functionalized particles S810; placing a layer (e.g., a layer of OCT compound) on the sample S820; optionally transferring heat to the sample and layer S830; and performing a subsequent sample processing step (e.g., a hybridization step) S840; in various variations, the method for applying the layer may include refrozing the sample and layer (e.g., OCT compound) before subsequent processing.
[0367] In various modifications, the layer (e.g., of the OCT compound) may be generated from a solidified (e.g., frozen) body of the material, and the layer may be sectioned from the solidified body. In various modifications, sectioning may be performed using cutting, laser cutting, machining, or one or more of the other suitable methods. In various modifications, the layer 15 does not have to be sectioned, or it may be applied by suction and delivery, spraying, coating, rotation, or other methods that apply the liquid volume of the material of the layer.
[0368] In various variations, the layer thickness may be 2 micrometers, 3 micrometers, 4 micrometers, 5 micrometers, 6 micrometers, 7 micrometers, 8 micrometers, 9 micrometers, 10 micrometers, 11 micrometers, 12 micrometers, 13 micrometers, 14 micrometers, 15 micrometers, 16 micrometers, 17 micrometers, 18 micrometers, 19 micrometers, 20 micrometers, 21 micrometers, 22 micrometers, 23 micrometers, 24 micrometers, 25 micrometers, 26 micrometers, 27 micrometers, 28 micrometers, 29 micrometers, 30 micrometers, 35 micrometers, 40 micrometers, 50 micrometers, 60 micrometers, an intermediate thickness between the listed thickness values, or greater than 60 micrometers.
[0369] In various modifications, the layer material (e.g., OCT compound) can be diluted, thereby improving the diffusion of the treatment reagent across the layer during sample processing while preventing target drift and tagging problems. Therefore, the layer thickness can be adjusted, and / or the layer material can be diluted to provide suitable conditions for simultaneously achieving reagent permeability and prevention of target drift. Layer dilution can be carried out in a manner that does not significantly affect temperature-related performance aspects (e.g., freezing behavior, melting behavior, etc.) with respect to the described sample processing steps.
[0370] In deformations where applying a layer reduces sensitivity with respect to the number of tagged targets derived from the tissue sample (e.g., targets tagged in the "correct position" without smearing), the layer material can be combined with sample preparation reagents associated with various tagging steps and / or steps that facilitate interactions between targets and functionalized particles.
[0371] For example, the layer material may include a combination of the OCT compound and a hybridization buffer, a sample lysis buffer, a crosslinking reagent, a cleavage reagent (for molecules with cleavage sites, e.g.), and / or other suitable materials. Thus, the combination of the layer material(s) and process reagents can facilitate the efficiency of the sample processing step, improve the sensitivity of tagging, and / or provide other suitable advantages.
[0372] The application of layers (e.g., layers of OCT compounds) may result in a reduction in the proportion of smearing and background artifacts in the generated maps. In some cases, the reduction in smearing was over 60%, over 61%, over 62%, over 63%, over 64%, over 65%, over 66%, over 67%, over 68%, over 69%, over 70%, over 71%, over 72%, over 73%, over 74%, over 75%, over 76%, over 77%, over 78%, over 79%, over 80%, over 81%, over 82%, over 83%, over 84%, over 85%, over 86%, over 87%, over 88%, over 89%, over 90%, or higher. In some cases, the smearing reduction rate is determined by comparing the values (e.g., percentage values, numerical values) of functionalized particles causing noise (e.g., noise related to target migration and re-tagging) between a first section and a second section of the tissue sample, and the smear prevention layer is added to the first section but not to the second section. In some cases, the smearing reduction rate is determined by comparing the values (e.g., percentage values, numerical values) of UMI / beads detected during sequencing causing noise (e.g., noise related to target migration and re-tagging) between a first section and a second section of the tissue sample, and the smear prevention layer is added to the first section but not to the second section.
[0373] Smearing mitigation can be further enabled by using a bioinformatics-based approach to processing data generated using the units of the described system, and the data processing architecture can be structured to remove background signal artifacts and directional signal artifacts (observed as “smearing” in the generated spatial map). Background artifacts and / or directional signal artifacts may be due to target leakage away from the point of origin and subsequent re-tagging by tagging molecules in the distribution of functionalized particles, as described above. Examples of each type of artifact are shown in Figure 12.
[0374] Method 900 for removing signal artifacts may include, as shown in Figure 13, omitting the mapping of data from a first category of particles in the functionalized particle distribution, wherein each sequence obtained from the first category of particles has a UMI count greater than a first threshold (S910); omitting the mapping of data from a second category of particles in the functionalized particle distribution, wherein each particle in the second category has an association density greater than a second threshold (S920); and omitting the mapping of data from a third category of particles in the functionalized particle distribution, wherein each particle in the third category has an association density greater than a third threshold (S930).
[0375] In various variations, the first threshold could be a threshold for over 70 UMI counts, a threshold for over 75 UMI counts, a threshold for over 80 UMI counts, a threshold for over 85 UMI counts, a threshold for over 90 UMI counts, a threshold for over 95 UMI counts, a threshold for over 100 UMI counts, a threshold for over 105 UMI counts, a threshold for over 110 UMI counts, a threshold for over 120 UMI counts, a threshold for over 130 UMI counts, a threshold for over 140 UMI counts, a threshold for over 150 UMI counts, or another UMI count threshold.
[0376] In various variations, the second threshold may be greater than the first number of particles in the first region, where the first number of particles is 1, 2, 3, 4, 5, 6, 7, or more. The first region may be 15 micrometers × 15 micrometers, 20 micrometers × 20 micrometers, 25 micrometers × 25 micrometers, 30 micrometers × 30 micrometers, 35 micrometers × 35 micrometers, 40 micrometers × 40 micrometers, 45 micrometers × 45 micrometers, 50 micrometers × 50 micrometers, 60 micrometers × 60 micrometers, 70 micrometers × 70 micrometers, or another suitable region. The second density threshold may be a finer density threshold compared to the third threshold.
[0377] In various variations, the third threshold may be greater than the second number of particles in the second region, where the second number of particles is 7, 8, 9, 10, 11, 12, 13, 14, 15, or more. The second region may be 70 micrometers × 70 micrometers, 75 micrometers × 75 micrometers, 80 micrometers × 80 micrometers, 85 micrometers × 85 micrometers, 90 micrometers × 90 micrometers, 95 micrometers × 95 micrometers, 100 micrometers × 100 micrometers, 110 micrometers × 110 micrometers, 120 micrometers × 120 micrometers, 130 micrometers × 130 micrometers, 150 micrometers × 150 micrometers, 200 micrometers × 200 micrometers, or another suitable region. The second density threshold may be a coarser density threshold compared to the second threshold.
[0378] In a specific example, the first threshold is the threshold of 100 UMI or more, the second threshold is the threshold of more than 5 particles in a 40 micrometer x 40 micrometer area, and the third threshold is the threshold of more than 10 particles in a 100 micrometer x 100 micrometer area.
[0379] Variations of Method 900 may include variations in sample type (e.g., tissue type), presence or absence of highly expressed genes, characteristics of the substrate and functionalized particles (e.g., size of the distribution of functionalized particles, footprint occupied by functionalized particles, sample size, size of the substrate relative to particle size(s), etc.), processing method (e.g., amount and type of solution used for hybridization, involvement of stirring during the hybridization step, sequencing depth, and / or adjustment of thresholds based on factors).
[0380] Variations of Method 900 may include the omission of data used for mapping based on other appropriate thresholds, which may be based on other parameters that distinguish the desired signal for mapping from background and directional signals. Furthermore, artifact removal may be performed by manual removal (e.g., by manually selecting the data to remove via a user interface for converting the data to a target map) and / or by a clustering algorithm.
[0381] Variations of method 900 may include removing intra-tissue smears by omitting / subtracting data from functionalized particles associated with the smear (for mapping purposes) and / or removing characteristic transcriptome patterns in the smear from the tissue.
[0382] The described bioinformatics methods may result in a reduction in the proportion of smearing and background artifacts in the generated maps. In some cases, the reduction in smearing was over 60%, over 61%, over 62%, over 63%, over 64%, over 65%, over 66%, over 67%, over 68%, over 69%, over 70%, over 71%, over 72%, over 73%, over 74%, over 75%, over 76%, over 77%, over 78%, over 79%, over 80%, over 81%, over 82%, over 83%, over 84%, over 85%, over 86%, over 87%, over 88%, over 89%, over 90%, over 95%, or 100%. In some cases, the percentage reduction in smearing was determined by comparing the values (e.g., percentage values, numerical values) of functionalized particles causing noise (e.g., noise related to target movement and retagging) between a first spatial map of the target generated without applying the described bioinformatics process and a second spatial map of the target generated with the described bioinformatics process. In some cases, the percentage reduction in smearing was determined by comparing the values (e.g., percentage values, numerical values) of UMI / beads detected during sequencing causing noise (e.g., noise related to target movement and retagging) between a first spatial map of the target generated without applying the described bioinformatics process and a second spatial map of the target generated with the described bioinformatics process.
[0383] Method 400 may include other appropriate steps and / or enable other downstream applications.
[0384] For example, images can be acquired in coordination with targeting of sample tagging and spatial contextualization. Images can be acquired using microscopes configured for light, brightfield, darkfield, phase-contrast, fluorescence, reflection, interference, or confocal imaging. Biological samples can be stained before imaging to provide contrast between different regions or cells. In some embodiments, multiple dyes can be used to image different aspects of a sample (e.g., different regions of tissue, different cells, specific intracellular components). In other embodiments, biological samples may be imaged without staining. Images of biological samples can be acquired at a desired resolution to distinguish, for example, tissue, cells, or intracellular components. Thus, the resolution may be sufficient to distinguish components of a biological sample separated at least 0.5 μm, 1 μm, 5 μm, 10 μm, 50 μm, 100 μm, 500 μm, 1 mm or more. Alternatively, the resolution may be set to distinguish components of a biological sample separated at a minimum of 1 mm, 500 μm, 100 μm, 50 μm, 10 μm, 5 μm, 1 μm, 0.5 μm, or less.
[0385] The methods described herein may include the step of correlating the position of a biological sample in an image with the handshake sequence of functionalized molecules attached to individual beads that the biological sample is in contact with, has been in contact with, or will come into contact with. Thus, features of the biological sample identifiable in the image may correlate with nucleic acids found to be present in their vicinity. Any of the various morphological features, including, for example, cell shape, cell size, tissue shape, staining pattern, presence of specific proteins (e.g., detected by immunohistochemical staining), or other features routinely used and evaluated for pathological or research purposes, can be used in such correlations. Thus, the biological state of a tissue or its components determined by visual observation may correlate with molecular biological properties determined by spatially degraded nucleic acid analysis.
[0386] 4. Computer System This disclosure provides a computer system programmed to implement the method of this disclosure. Figure 14 shows a computer system 1001 programmed or configured to perform steps of a method for generating a spatial map of the target distribution of a sample by, for example, one or more processes described.
[0387] The computer system 1001 can adjust various aspects of the analysis, calculation, and generation of this disclosure, for example, by generating a spatial map of the target distribution of a sample through the set of processes described above. The computer system 1001 may be a computer system located remotely from the user's electronic device or from the electronic device. The electronic device may be a mobile electronic device.
[0388] Computer system 1001 includes a central processing unit (CPU, also referred to herein as “processor” and “computer processor”) 1005, which may be a single-core or multi-core processor, or multiple processors for parallel processing. Computer system 1001 also includes memory or memory locations 1010 (e.g., random-access memory, read-only memory, flash memory), electronic storage devices 1015 (e.g., hard disks), a communication interface 1020 for communicating with one or more other systems (e.g., a network adapter), and peripheral devices 1025 such as a cache, other memory, data storage, and / or an electronic display adapter. Memory 1010, storage devices 1015, interface 1020, and peripheral devices 1025 communicate with the CPU 1005 via a communication bus (solid line), such as a motherboard. Storage devices 1015 may be a data storage device (or data repository) for storing data. Computer system 1001 can be operably coupled to a computer network (“network”) 1030 with the assistance of the communication interface 1020. Network 1030 may be the Internet, the Inter...
Claims
1. It is a method, The method involves tagging the distribution of nuclei with a set of handshake sequences paired with a set of barcode sequences that function as spatial addresses, generating a spatial map of the distribution of nuclei isolated from a tissue sample, wherein generating the spatial map includes recovering and mapping the locations of more than 30% of the nuclei initially present in the tissue sample.
2. It is a method, The method includes generating a spatial map of the distribution of nuclei isolated from a tissue sample, where the tagging of the distribution of nuclei is performed with a set of handshake sequences paired with a set of barcode sequences that function as spatial addresses, wherein the generation of the spatial map is performed within two hours.
3. The method according to claim 2, further comprising decoding the set of barcode sequences bonded to a substrate by performing a set of sequencing iterations with error reduction by dynamic annealing and ligation (SEDAL), wherein the decoding of the set of barcode sequences has a pass rate of more than 90% as determined by a set of criteria, the set of criteria including a substrate coating criterion and a criterion relating to the amount of empty space on the substrate.
4. It is a method, The method comprising generating a spatial map of the distribution of nuclei in a tissue sample, upon releasing a set of handshake sequences paired with a set of barcode sequences for diffusion toward the distribution of nuclei.
5. It is a method, The method involves generating a spatial map of the distribution of nuclei in a tissue sample by processing the tissue sample containing the distribution of nuclei with a substrate containing the distribution of functionalized molecules, wherein a representative functionalized molecule is: A handshake sequence configured to bind to one of the nuclei in the set of nuclei, A barcode sequence that functions as a spatial address, and The generation of the aforementioned, which includes a releaseable linker, When stimulating the releaseable linker of the distribution of the functionalized molecules, the set of nuclei is tagged with the handshake sequence of the distribution of the functionalized molecules, thereby tagging the nuclei of the set of nuclei with the barcode sequence of the distribution of the functionalized molecules, To isolate the set of nuclei from the tissue sample, Determine the set of molecular sequences resulting from the set of nuclei and the distribution of the functionalized molecules, thereby determining the set of spatial positions of the set of nuclei based on the barcode sequence associated with each of the set of nuclei. The method comprising generating the spatial map of the distribution of the nuclei from the set of spatial locations.
6. The method according to claim 5, wherein the generation of the spatial map is performed within two hours.
7. The method according to claim 5, wherein isolating the set of nuclei comprises recovering more than 30% of the nuclei initially present in the tissue sample.
8. The method according to claim 7, wherein isolating the set of nuclei comprises grinding the tissue sample with an isolation buffer.
9. The method according to claim 7, wherein isolating the set of nuclei includes isolating the set of nuclei with an injector.
10. The method according to claim 5, wherein the ejectable linker responds to a light-cutting mechanism.
11. The method according to claim 5, wherein the distribution of the functionalized molecule includes a first subset of linkers configured to cleave in response to a first stimulus, and a second subset of linkers configured to cleave in response to a second stimulus.
12. The method according to claim 11, wherein the first stimulus is a first wavelength of light, and the second stimulus is a second wavelength of light.
13. The method according to claim 5, wherein determining the set of spatial positions includes determining the position of the nucleus from the centroid of a subset of spatial positions of a subset of barcode sequences of a subset of functionalized molecules tagged to the nucleus.
14. The method according to claim 5, wherein the method is carried out at 4°C or below.
15. The method according to claim 5, wherein the distribution of the functionalized molecules is distributed over the distribution of particles bonded to the substrate by the adhesive.
16. The method of claim 5, further comprising covering the tissue sample with a layer of optimal cleavage temperature (OCT) compounds between a) tagging the set of nuclei in a handshake sequence of the distribution of the functionalized molecules and b) isolating the set of nuclei from the tissue sample.
17. The method according to claim 5, further comprising covering the distribution of the functionalized molecules on the substrate with a masking layer, and removing the masking layer before applying the stimulus.
18. It is a method, When tagging a set of nuclei with a first set of oligonucleotides, the goal is to generate a labeled set of nuclei, The process involves attaching the labeled nuclei set in the interstitial space of the distribution of functionalized particles bound to the substrate, To generate a single-nucleus sequencing library from an amplicon generated from a set of reactions involving the labeled nucleus and the set of molecules of the functionalized particle distribution, The method comprising: returning a single-nucleus analysis for a set of nuclei when sequencing the single-nucleus sequencing library.
19. The method according to claim 18, wherein each functionalized particle comes into contact with at most one labeled nucleus from the set of labeled nuclei.
20. It is a system, Substrate and The distribution of functionalized features associated with the said substrate, A representative feature of the distribution of the functionalized features is: The system comprises one or more functionalized molecules bound to the representative feature, the one or more molecules comprising at least a reactive portion, a barcode segment functioning as a spatial address, and a cleavage linker configured to allow the handshake sequence to be released from the representative feature in response to a stimulus, the handshake sequence.
21. A system for single-cell analysis, wherein the system is Distribution of functionalized particles bound to the substrate, and The system includes a set of labeled cells arranged in the interstitial spaces of the distribution of the functionalized particles.
22. The system according to claim 21, wherein the labeled cells in the set of labeled cells are tagged with a handshake sequence released from the substrate.